WO2023224388A1 - 금속 나노 입자-핵산 결합체를 기반으로 하는 유전자 운반체 - Google Patents

금속 나노 입자-핵산 결합체를 기반으로 하는 유전자 운반체 Download PDF

Info

Publication number
WO2023224388A1
WO2023224388A1 PCT/KR2023/006697 KR2023006697W WO2023224388A1 WO 2023224388 A1 WO2023224388 A1 WO 2023224388A1 KR 2023006697 W KR2023006697 W KR 2023006697W WO 2023224388 A1 WO2023224388 A1 WO 2023224388A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
gene
acid molecule
interest
gene carrier
Prior art date
Application number
PCT/KR2023/006697
Other languages
English (en)
French (fr)
Inventor
이강석
배지현
염지현
심세훈
김홍만
송우석
유민경
주민주
이상문
Original Assignee
주식회사 엔이에스바이오테크놀러지
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020230063360A external-priority patent/KR20230161366A/ko
Application filed by 주식회사 엔이에스바이오테크놀러지 filed Critical 주식회사 엔이에스바이오테크놀러지
Publication of WO2023224388A1 publication Critical patent/WO2023224388A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation

Definitions

  • the present invention relates to a gene carrier comprising a metal nanoparticle and a double helix-shaped nucleic acid molecule bound to the surface of the nanoparticle, a gene expression method using the same, and a method for producing the same.
  • Nanoparticles are particles with a nanoscale size and have various physical and chemical properties due to their small size and high surface area.
  • Gold nanoparticles the most widely used nanoparticles, generate surface electromagnetic resonance (SPR) by absorption and scattering in the visible light region depending on their size and shape, so they are used for detection and imaging based on fluorescent labels, and the introduction of surface functional groups is necessary. It is easy to use and has high biological affinity and stability, so it can be used to deliver biomaterials such as DNA, RNA, proteins, and antibodies, as well as various drugs.
  • SPR surface electromagnetic resonance
  • DNA is the simplest genetic material and can be easily genetically modified, shortening the development period for use as a treatment such as a vaccine. In addition, it is very economical in terms of production facility construction and production costs compared to other vaccine candidates such as viruses, proteins, and RNA, and has excellent stability, making it easy to store and distribute.
  • DNA vaccines require a process to be delivered to the nucleus of a cell and produce mRNA directly within the nucleus. DNA injected into the nucleus can continuously produce mRNA and antigen proteins, but since other genes are injected into the cell nucleus in our body, there is a risk of side effects such as innate immune response. Additionally, when delivered through a plasmid, DNA may deliver bacterial-derived genes in addition to antigens, causing side effects such as mutations in the body. Therefore, research on carriers and delivery technologies to safely deliver DNA is necessary.
  • nucleic acid delivery technology to efficiently deliver nucleic acid molecules, especially double stranded DNA (dsDNA), that can be delivered into cells and expressed independently, into the nucleus of cells.
  • dsDNA double stranded DNA
  • metal The present invention has been completed regarding a delivery system that can directly attach a nucleic acid molecule containing a gene of interest to the surface of a nanoparticle and deliver it into a cell by covalent bonding, a method of expressing a gene through the same, and a method of manufacturing the delivery system.
  • the object of the present invention is metal nanoparticles; and a nucleic acid molecule containing one or more genes of interest that bind to the metal nanoparticle and are delivered and expressed into cells.
  • Another object of the present invention is to provide a pharmaceutical composition containing the gene carrier.
  • Another object of the present invention is to provide a composition for detecting a target substance containing the gene carrier.
  • Another object of the present invention is to provide a composition for intracellular delivery of a gene of interest, including the gene carrier.
  • Another object of the present invention is to modify the surface of the metal nanoparticles by treating the metal nanoparticles with an acidic solution; and binding a nucleic acid molecule containing one or more genes of interest to be expressed by being delivered into cells to the surface of the metal nanoparticle.
  • Another object of the present invention is to provide a method for expressing a gene of interest through a nucleic acid molecule that is bound to the surface of a metal nanoparticle and expressed alone within a cell.
  • the present invention provides metal nanoparticles; And it provides a gene carrier comprising a nucleic acid molecule containing one or more genes of interest that binds to the metal nanoparticle and is delivered and expressed into cells.
  • the present invention provides a pharmaceutical composition containing the gene carrier.
  • the present invention provides a composition for detecting a target substance containing the gene carrier.
  • the present invention provides a composition for intracellular delivery of a gene of interest, including the gene carrier.
  • the present invention includes the steps of modifying the surface of the metal nanoparticles by treating the metal nanoparticles with an acidic solution; and binding a nucleic acid molecule containing one or more genes of interest to be expressed by being delivered into cells to the surface of the metal nanoparticle.
  • the present invention provides a method of expressing a gene of interest through a nucleic acid molecule that is bound to the surface of a metal nanoparticle and expressed alone in a cell.
  • the present invention provides metal nanoparticles; and a gene carrier comprising a nucleic acid molecule containing one or more genes of interest that binds to the metal nanoparticle and is delivered and expressed into cells.
  • the gene carrier of the present invention includes metal nanoparticles.
  • the metal nanoparticles have a diameter in nanoscale and are not limited in size, but preferably have a diameter of 5 to 500 nm, more preferably 10 to 200 nm, and nanoparticles of this size have a stable particle size. It is easy to manufacture in this shape, and the size can be easily adjusted during the manufacturing process.
  • the metal nanoparticles for use as gene carriers as in the present invention when the diameter increases beyond 500 nm, not only the characteristics as nanoparticles disappear, but the bond between the metal surface and the functional group becomes weak. It has the disadvantage of being difficult to manufacture a delivery vehicle using nanoparticles.
  • the metal nanoparticles may preferably be gold nanoparticles, and the gold nanoparticles are harmless to the human body and have high biocompatibility, unlike heavy metals such as manganese, aluminum, cadmium, lead, mercury, cobalt, nickel, and beryllium. has
  • gold nanoparticles used in the present invention can be prepared as follows, for example: gold nanoparticles were prepared by reducing HAuCl 4 using HAuCl 4 as a gold source and sodium citrate as a reducing agent. .
  • the size of the gold nanoparticles can be adjusted by varying the added citrate. In other words, as the amount of citrate added increases, nucleation increases and the size of gold nanoparticles decreases.
  • the metal nanoparticle of the present invention has a nucleic acid molecule containing a gene of interest bound to its surface.
  • the nucleic acid molecule is incorporated into the cell and bound to the surface of the metal nanoparticle for the purpose of delivering the gene of interest for independent expression.
  • nucleic acid molecule is not limited to its type.
  • a nucleic acid molecule refers to a compound with a structure in which a base, sugar, and phosphoric acid are linked by a phosphodiester bond, which is 2'-deoxyribonucleic acid (natural occurring oligonucleotides such as 2'-deoxyribonucleic acid (hereinafter "DNA”) and ribonucleic acid (hereinafter "RNA”), and modified sugar residues, modified phosphate residues, or modified nuclei.
  • DNA 2'-deoxyribonucleic acid
  • RNA ribonucleic acid
  • nucleic acids containing a base nodeoxyribonucleic acid
  • Modifications to sugar moieties include replacement of the ribose ring with a hexose, cyclopentyl, or cyclohexyl ring.
  • the D-ribose ring of naturally occurring nucleic acids can be replaced by an L-ribose ring, or the ⁇ -anomer ( ⁇ ) of naturally occurring nucleic acids.
  • -anomer can be replaced with a-anomer ( ⁇ -anomer).
  • Nucleic acid molecules may also contain one or more abasic moieties.
  • Modified phosphate moieties may also include phosphorothioates, phosphorodithioates, methylphosphonates, and methyl phosphate.
  • nucleic acid molecules comprising a mixture of two or more of the above mixtures may be prepared, for example, from mixtures of deoxyribonucleosides, especially 2'-O-methyl ribonucleosides (2'-O-methyl ribonucleoside) or a mixture of deoxyribonucleosides such as 2'-O-methoxyethyl ribonucleoside and 2'-O-substituted ribonucleosides.
  • the nucleic acid molecule may be selected from DNA, RNA, or DNA/RNA molecules, and more specifically, may be double-stranded DNA.
  • the double-stranded DNA may include cDNA, gDNA, plasmid DNA, and PCR DNA that can be expressed alone.
  • the double-stranded DNA is bound to a gold nanoparticle in a double-helix state, and is used to transport the double-stranded DNA into a cell. This means that after the single-stranded DNA is bound to the gold nanoparticle, it is transferred into the cell. This is different from being imported and hybridized with a complementary strand.
  • the nucleic acid molecule may contain one or more genes of interest and be expressed alone after being introduced into the cell.
  • the term "gene of interest” refers to any nucleic acid or functional peptide or polypeptide (protein) of interest that has a therapeutic, diagnostic, and/or prophylactic effect and/or induces a desired biological and/or pharmacological effect. nucleic acids encoding native or modified peptides/proteins).
  • 'solely expressed means that the gene of interest contained in the nucleic acid molecule undergoes a process of transcription and/or translation independently without being integrated into the genome of the injected cell.
  • the nucleic acid molecule may include one or more promoters, open reading frames, or terminators, and more preferably, may be operably linked to the gene of interest. It may include one or more promoters linked.
  • Promoter sequences are often virally derived or truncated eukaryotic promoters, such that promoters include the proopiomelanocortin promoter (POMC), adenovirus promoter, baculovirus promoter, CMV promoter, parvovirus promoter, herpesvirus promoter, It may be a poxvirus promoter, adeno-associated virus promoter, Semliki Forest virus promoter, SV40 promoter, vaccinia virus promoter, or retrovirus promoter.
  • POMC proopiomelanocortin promoter
  • adenovirus promoter baculovirus promoter
  • CMV promoter CMV promoter
  • parvovirus promoter parvovirus promoter
  • herpesvirus promoter It may be a poxvirus promoter, adeno-associated virus promoter, Semliki Forest virus promoter, SV40 promoter, vaccinia virus promoter, or retrovirus promoter.
  • promoters examples include the human simplex virus thymidine kinase (HSV TK or miniTK) promoter, cauliflower mosaic virus (CaMV) 35S promoter, human cytomegalovirus CMV promoter (miniCMV), CMV53 (minCMV with an upstream GC box added) ), simian virus 40 promoter (minSV40), MLP (-38 to +6 region of adenovirus major late promoter), minP (synthetic promoter consisting of TATA box and transcription start site - Promega product), pJB42CAT5 (derived from human junB gene) promoter), YB_TATA, and super core promoter 1 (SCP1) promoters.
  • HSV TK or miniTK cauliflower mosaic virus
  • miniCMV human cytomegalovirus CMV promoter
  • CMV53 minCMV with an upstream GC box added
  • simian virus 40 promoter minSV40
  • MLP -38 to +6 region of adenovirus major late promote
  • operably arranged refers to the precise functional location of a promoter (and/or enhancer) on a nucleic acid sequence to control transcription initiation and expression of that nucleic acid. and orientation.
  • An enhancer is “operably linked” to a promoter when it is in the correct functional position and orientation to increase transcriptional activity of the promoter.
  • the nucleic acid molecule further comprises a polyadenylation (poly(A)) sequence.
  • the poly(A) sequence causes appropriate polyadenylation of the nucleic acid (transcript) of interest.
  • Representative examples of poly(A) sequences include SV40 poly(A) and/or bovine growth hormone poly(A), which are known to be convenient and/or function well in a variety of target cells.
  • the nucleic acid molecule further comprises a transcription termination sequence.
  • a “termination signal” or “termination factor” consists of a DNA sequence that is involved in the specific termination of RNA transcripts by RNA polymerase.
  • the nucleic acid molecule may produce a transcription and/or translation product through an expression process in which transcription and/or translation are performed.
  • the transcription and/or translation products are not limited thereto, but may include, for example, mRNA, non-coding RNA, protein, antigen, or antibody.
  • the gene delivery vehicle of the present invention is one in which nucleic acid molecules are bound to the surface of gold nanoparticles.
  • the nucleic acid molecule contains one or more functionalities for binding to the gold nanoparticle surface.
  • the functional group is not limited to its type, and may be a thiol group or an amine group, and may be included in one or more residues of the nucleic acid molecule to be delivered.
  • the nucleic acid molecule contains one or more thiolated residues, through which it binds directly to the surface of the gold nanoparticle.
  • the linkage does not involve a separate spacer or linker.
  • the thiolated residue may be the 3' end, the 5' end, or one or more bases included in the base sequence of the nucleic acid molecule.
  • nucleic acid molecules are bound to the surface of the gold nanoparticle, but are not limited thereto, and for expression, 1 to 20 nucleic acid molecules may be bound to the surface of the gold nanoparticle.
  • the length of the linked nucleic acid molecule is at least 100 bp, 200 bp, or 300 bp, but is not limited to that length. Additionally, in some cases, the nucleic acid molecule is greater than 30 nucleotides. In another embodiment, the nucleic acid molecule is greater than 35 nucleotides. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides.
  • the length is at least 50 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides.
  • the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides.
  • the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides. In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides. In another embodiment, the length is at least 4000 nucleotides. In another embodiment, the length is at least 5000 nucleotides, or greater than 5000 nucleotides.
  • the present invention relates to a pharmaceutical composition containing the above-described gold nanoparticles and a gene carrier containing double-stranded DNA.
  • the pharmaceutical composition is intended for the prevention, improvement or treatment of diseases, is not limited to its type, and may have different uses depending on the type and expression product of the double-stranded DNA bound to the gold nanoparticle.
  • the pharmaceutical composition may be a cell gene therapy product including cell therapy, genetically modified cell therapy, gene therapy, and RNA therapy, and the cell gene therapy may include vaccines, antibiotics, and anticancer agents.
  • the cell therapy product involves proliferating and selecting live autologous, allogenic, or xenogeneic cells in vitro or changing the biological characteristics of the cells by other methods in order to restore the tissue and function of the cells. It refers to medicines used for the purpose of treatment, diagnosis, and prevention through a series of actions. When genes in cells are modified, they are also classified as genetically modified cell therapy.
  • the gene therapy is a medicine manufactured for the purpose of treating or preventing genetic defects by correcting defective genes or adding new functions to cells by transferring normal genes and therapeutic genes into the patient's cells using genetic manipulation such as genetic recombination. am.
  • RNA therapeutic agent exhibits drug efficacy while suppressing the protein production process that induces disease from the target gene, and may include mRNA, RNAi, ASO (antisense oligonucleotide), RNA aptamer, etc.
  • the pharmaceutical composition according to the present invention may further include appropriate carriers, excipients, and diluents commonly used in the preparation of pharmaceutical compositions.
  • the excipient may be, for example, one or more selected from the group consisting of diluents, binders, disintegrants, lubricants, adsorbents, humectants, film-coating materials, and controlled-release additives.
  • the pharmaceutical composition according to the present invention can be prepared as powder, granules, sustained-release granules, enteric-coated granules, solutions, eye drops, ellipsis, emulsions, suspensions, spirits, troches, perfumes, and limonadese according to conventional methods.
  • Carriers, excipients, and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, and calcium. These include phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • the pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat the disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, drug activity, and It can be determined based on factors including sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, drugs used simultaneously, and other factors well known in the medical field.
  • the pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Considering all of the above factors, it is important to administer an amount that can achieve the maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art to which the present invention pertains.
  • the pharmaceutical composition of the present invention can be administered to an individual through various routes. All modes of administration are contemplated, including oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, intrarectal injection, vaginal injection. It can be administered by internal insertion, ocular administration, ear administration, nasal administration, inhalation, spraying through the mouth or nose, dermal administration, transdermal administration, etc.
  • the pharmaceutical composition of the present invention is determined depending on the type of drug that is the active ingredient along with various related factors such as the disease to be treated, the route of administration, the patient's age, gender, weight, and severity of the disease.
  • “individual” refers to a subject in need of treatment for a disease, and more specifically, human or non-human primates, mice, rats, dogs, cats, horses, cows, etc. refers to mammals of
  • “administration” means providing a given composition of the present invention to an individual by any appropriate method.
  • prevention refers to any action that suppresses or delays the onset of the desired disease
  • treatment refers to the improvement or improvement of the desired disease and its associated metabolic abnormalities by administration of the pharmaceutical composition according to the present invention. It refers to all actions that are beneficially changed, and “improvement” refers to all actions that reduce parameters related to the target disease, such as the degree of symptoms, by administering the composition according to the present invention.
  • the present invention provides a vaccine composition
  • a vaccine composition comprising a gene carrier containing the metal nanoparticle of the present invention and a nucleic acid molecule containing a gene of interest.
  • 'vaccine' refers to a biological agent containing an antigen that provides immunity to an individual, and refers to an immunogenic or antigenic substance that generates immunity by administering it to humans or animals, for example, by injection or oral administration, to prevent disease.
  • the vaccine may be a DNA vaccine.
  • the term 'DNA vaccine' refers to a vaccine that induces an immune response by artificially replicating some of the genes of pathogens, viruses, etc. and then administering them.
  • the vaccine composition may form immunity against various infectious diseases, genetic diseases, other diseases, or cancer.
  • the vaccine composition can be injected into an individual in various forms.
  • the 'injection' may be performed by any one method selected from the group consisting of subcutaneous injection, intramuscular injection, subcutaneous injection, intraperitoneal injection, intranasal administration, oral administration, transdermal administration, and oral administration, and more preferably
  • the DNA vaccine can be administered by any suitable route, for example, subcutaneously, intramuscularly, intraperitoneally, or intravenously.
  • the vaccine composition may include one or more adjuvants to improve or strengthen the immune response.
  • Suitable adjuvants may include peptides, aluminum hydroxides, aluminum phosphates, aluminum oxides and compositions consisting of mineral or vegetable oils such as Marcol 52 and one or more emulsifiers, or surface active substances such as lysolcecithin, polyvalent cations, polyanions, etc. there is.
  • the present invention relates to a composition for diagnostic or target substance detection comprising the above metal nanoparticles and a gene carrier containing a nucleic acid molecule containing a gene of interest.
  • the present invention relates to a composition for intracellular delivery of a gene of interest, comprising the above metal nanoparticle and a nucleic acid molecule containing the gene of interest.
  • the present invention includes the steps of modifying the surface of the metal nanoparticles by treating the metal nanoparticles with an acidic solution;
  • the present invention relates to a method for producing a gene carrier comprising the step of binding a nucleic acid molecule containing one or more genes of interest to be expressed by being delivered into cells to the surface of the metal nanoparticle.
  • the present invention relates to a method of expressing a gene of interest through a nucleic acid molecule that is bound to the surface of a metal nanoparticle and expressed alone within a cell.
  • the present invention relates to a metal nanoparticle and a gene carrier comprising a nucleic acid molecule containing a gene of interest bound to the surface of the metal nanoparticle, a method for producing the same, and a use thereof, wherein the nucleic acid molecule containing one or more genes, particularly a double helix, Nucleic acid molecules in the form of DNA are directly bound to the surface of gold nanoparticles through covalent bonds and are delivered and expressed into cells. This enables stable delivery and expression, and can be used as a gene therapy, vaccine, and composition for disease diagnosis. has
  • Figure 1 is a schematic diagram showing the structure of a nucleic acid molecule containing a gene of interest bound to a gold nanoparticle in an embodiment of the present invention.
  • Figure 2 shows the results of confirming the binding efficiency of nucleic acid molecules bound to the gold nanoparticles of the present invention through thiolated residues.
  • Figure 3 shows the results of confirming intracellular delivery of genes according to the thiolated strand ((+), (-)) of the double-stranded DNA that binds to the gold nanoparticle of the present invention.
  • Figure 4 is a production example of AuNP-dsDNA, which enables intracellular delivery and expression by binding thiolated double-stranded DNA of various lengths to gold nanoparticles.
  • Figure 5 confirms the results of functionalizing and binding thiolated double-stranded DNA to the surface of gold nanoparticles.
  • Figure 6 shows the results of confirming gene transfer and expression in a small animal model of a gold nanocarrier loaded with double-stranded DNA having various lengths of SEQ ID NOs: 1 to 4.
  • Figure 7 shows the results of functionalizing the luciferase (SEQ ID NO: 5) gene on the surface of gold nanoparticles.
  • Figure 8 shows the results of confirming whether the luciferase gene is delivered and expressed intracellularly through a gold nanocarrier.
  • AuNP-dsDNA capable of intracellular delivery and expression was prepared by binding thiolated double-stranded DNA for intracellular expression to gold nanoparticles in the following steps, a schematic diagram of which is shown in Figure 1.
  • the target gene for transfer was cloned between the CMV promoter and bGH terminator of the plasmid.
  • the thiolated residues of the genes were synthesized through PCR using thiolated primers to synthesize double-stranded DNA in which the 5' end, 3' end, or internal residues were thiolated, respectively.
  • the eGFP gene of SEQ ID NO: 1 was cloned through the above method, and the 5' end thiolation primer sequence in Table 1 below was used to thiolate the 5' end, 3' end, or internal residues, Thiolated double-stranded DNA of eGFP was synthesized.
  • the thiolated double-stranded DNA and gold mixture was collected by centrifugation at ⁇ 10,000 x g for 20 minutes, and unreacted double-stranded DNA in the supernatant was removed, and this process was repeated three times.
  • the final AuNP-thiolated double-stranded DNA conjugate (AuNP-thiolated dsDNA) was dispersed in 10mM sodium phosphate buffer (pH 7.4) containing 0.1 M NaCl.
  • the prepared AuNP-thiolated double-stranded DNA conjugate was analyzed by electrophoresis on a 10% acrylamide 8M urea gel, and it was confirmed that 1.98 to 9.27 thiolated double-stranded DNA was bound per one gold nanoparticle ( Figure 2).
  • a xenograft tumor model was used. HeLa cells were injected into 6-week-old immunodeficient BALB/c-nu/nu mice (Central Lab Animal Inc, Korea) to develop cervical cancer, and AuNP-thiolated dsDNA was injected into the xenograft tumor. 36 hours later, the xenograft tumor were extracted and the expression of the injected GFP was observed using FOBI (Fluorescence In Vivo Imaging System).
  • FOBI Fluorescence In Vivo Imaging System
  • AuNP-dsDNA capable of intracellular delivery and expression was prepared by binding thiolated double-stranded DNA of various lengths to gold nanoparticles, and a schematic diagram thereof is shown in Figure 4.
  • eGFP SEQ ID NO: 1, SEQ ID NO: 2
  • A3APO-FLAG SEQ ID NO: 3
  • pFOX-FLAG SEQ ID NO: 4
  • the synthesized thiolated double-stranded DNA was pretreated in the same manner as in Experimental Example 1-2, and the thiolated double-stranded DNA was precipitated using the ethanol precipitation method (EtOH precipitating method).
  • the thiolated double-stranded DNA synthesized, pretreated, and precipitated through the process 3-1 was functionalized on the surface of the gold nanoparticles through the same process as 1-3.
  • the prepared AuNP-thiolated dsDNA complex was analyzed by electrophoresis on a 10% acrylamide 8M Urea gel, and it was confirmed that 2.38 to 5.67 thiolated double-stranded DNAs were bound to one gold nanoparticle ( Figure 5).
  • a xenograft tumor model was used. Tumors were generated by subcutaneously injecting HeLa cells into 6-week-old immunodeficient BALB/c-nu/nu mice (Central Lab Animal Inc, Korea), and the cells of SEQ ID NOs: 1 to 4 (6 kbp, 1.7 kbp, or 0.5 kbp) were generated. AuNP-thiolated dsDNA bound to double-stranded DNA was injected around the tumor. 36 hours after injection, the xenograft tumor or gastrocnemius muscle was removed, sections were created using frozen sectioning, and protein expression by the injected dsDNA was observed through immunofluorescence staining. As a result, protein expression by 6 kbp, 1.7 kbp, or 0.5 kbp dsDNA of SEQ ID NOs: 1 to 4 was confirmed in the mouse tumor or gastrocnemius muscle, respectively. ( Figure 6)
  • the Luciferase (SEQ ID NO: 5) gene contained between the CMV promoter and bGH terminator of the plasmid was cloned.
  • the thiolated residues of the genes are synthesized through PCR using 5'-thiolated primers to synthesize double-stranded DNA in which one of the 5'-end, 3'-end, or internal residues is thiolated. did.
  • the synthesized thiolated double-stranded DNA was pretreated in the same manner as in Experimental Example 1-2, and the thiolated double-stranded DNA was precipitated using the ethanol precipitation method (EtOH precipitating method).
  • the thiolated double-stranded DNA synthesized, pretreated, and precipitated through the process 5-1 above was functionalized on the surface of the gold nanoparticles through the same process as 1-3 above.
  • the prepared AuNP-thiolated dsDNA conjugate was analyzed by electrophoresis on a 10% acrylamide 8M Urea gel, and it was confirmed that 2.4 thiolated double-stranded DNAs were bound to each gold nanoparticle (Figure 7).
  • Physiological saline or AuNP-thiolated dsDNA was injected into both gastrocnemius muscles of 7-week-old Balb/c mice, and corresponding amounts of AuNP or luciferase dsDNA were injected as a comparison group, respectively.
  • the subjects were anesthetized with isoflurane every 12 or 24 hours, and D-Luciferin was injected intraperitoneally to measure luciferase activity.
  • LUCI Luciferase was confirmed in the gastrocnemius muscle injected with luciferase dsDNA bound to AuNP ( Figure 8).
  • the present invention provides metal nanoparticles; and a gene carrier comprising a nucleic acid molecule containing one or more genes of interest that binds to the metal nanoparticle and is delivered and expressed into cells.
  • the nucleic acid molecule includes a promoter operably linked to the gene of interest.
  • the gene of interest is one that is not replicated within the cell.
  • the gene of interest is one that is not integrated into the genome of the injected cells.
  • the gene of interest produces a product through transcription and/or translation within the cell.
  • the product produced through the transcription and/or translation may be selected from the group including mRNA, non-coding RNA, protein, antigen, or antibody.
  • the nucleic acid molecules are expressed singly or independently within the cell.
  • the nucleic acid molecule binds to the surface of the metal nanoparticle through one or more thiolated residues.
  • the thiolated residue may be included at least one at the 3' end, 5' end of the nucleic acid molecule, or within the base sequence of the nucleic acid molecule.
  • the metal nanoparticles have a size of 5 to 500 nm.
  • the metal nanoparticles may be gold nanoparticles.
  • the nucleic acid molecule may be selected from DNA, RNA or DNA/RNA molecules.
  • the DNA is double-stranded DNA.
  • the nucleic acid molecule may have a length of at least 100 bp, 200 bp, or 300 bp.
  • the present invention relates to a pharmaceutical composition containing the above gene carrier.
  • the present invention relates to a composition for detecting a target substance containing the above gene carrier.
  • the present invention provides metal nanoparticles; and a composition for intracellular delivery of a gene of interest, including a nucleic acid molecule bound to the metal nanoparticle and containing one or more genes of interest that are delivered and expressed into cells.
  • the present invention includes the steps of modifying the surface of the metal nanoparticles by treating the metal nanoparticles with an acidic solution; and binding a nucleic acid molecule containing one or more genes of interest to be expressed by being delivered into cells to the surface of the metal nanoparticle.
  • the present invention relates to a method of expressing a gene of interest through a nucleic acid molecule bound to the surface of a metal nanoparticle and expressed alone within a cell.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Public Health (AREA)
  • General Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 세포 내로 전달되어 발현되는 금속 나노 입자 표면에 결합된 관심 유전자를 포함하는 핵산 분자를 포함하는 유전자 전달체, 이의 용도, 이를 이용한 유전자 발현 방법 및 이의 제조 방법에 대한 것이다.

Description

금속 나노 입자-핵산 결합체를 기반으로 하는 유전자 운반체
본 발명은 금속 나노 입자 및, 상기 나노 입자 표면에 결합된 이중 나선 형태의 핵산 분자를 포함하는 유전자 운반체, 이를 이용한 유전자 발현 방법 및 이의 제조 방법에 대한 것이다.
나노 입자는 나노 단위의 크기를 가지는 입자로, 크기가 작아 표면적이 높은 특성으로 다양한 물리 화학적 특성을 가진다. 가장 널리 사용되는 나노 입자인 금 나노 입자는 크기와 모양에 따라 가시광선 영역에서 흡광 및 산란에 의한 표면 전자기 공명(SPR)이 발생하므로 형광 표지에 따른 검출, 이미징 등에 활용되며, 표면작용기의 도입이 쉽고 생체 친화력과 안정성이 높아 DNA, RNA, 단백질, 항체 등의 생체 물질과 다양한 약물의 전달에도 사용될 수 있다.
세포 치료제와 같이 세포 내로 유전 물질을 전달하여 치료 또는 예방을 위한 항원이나 단백질을 생산하기 위한 기술이 꾸준히 연구 중이며, 특히 최근 팬더믹에 의한 백신 개발 기술이 눈에 띄게 성장하여 DNA 백신이나 mRNA 백신, 바이러스 백터 백신과 같은 다양한 유전자 백신이 개발되었다.
DNA는 가장 단순한 유전 물질로서, 유전학적 변형이 용이하여 백신 등의 치료제로 활용하기 위한 개발 기간을 단축할 수 있다. 또한 다른 백신 후보 물질인 바이러스, 단백질, RNA 보다 생산 설비 구축 및 생산 비용 측면에서 매우 경제적이며, 안정성이 우수하여 보관 및 유통이 용이한 장점을 가진다. 그러나, DNA 백신은 세포의 핵까지 전달되어 핵 내에서 직접 mRNA를 생산하도록 하는 과정이 필요하다. 핵 내로 주입된 DNA는 지속적으로 mRNA를 생산하며 항원 단백질을 꾸준히 생산할 수 있으나, 우리 몸 속 세포핵에 다른 유전자 형질을 주입하기 때문에 선천성 면역 반응 등의 부작용이 생길 우려가 있다. 또한 플라스미드를 통해 전달되는 경우, DNA는 항원 이외에 세균 유래 유전자를 전달하여 체내에서 돌연변이 등의 부작용을 일으킬 수 있다. 따라서, DNA를 안전하게 전달하기 위한 운반체 및 운반 기술에 대한 연구가 필요하다.
이에 본 발명자들은 세포 내로 전달되어 단독으로 발현될 수 있는 핵산 분자, 특히 이중나선 DNA (double stranded DNA; dsDNA)를 세포 내 핵으로 효율적으로 전달하기 위하여 핵산 전달 기술을 개발하고자 예의 연구 노력한 결과, 금속 나노 입자 표면에 관심 유전자를 포함하는 핵산 분자를 직접 공유 결합으로 부착하여 세포 내로 전달할 수 있는 운반 시스템, 이를 통한 유전자의 발현 방법 및 상기 운반 시스템의 제조 방법에 대한 본 발명을 완성하였다.
따라서 본 발명의 목적은 금속 나노 입자; 및 상기 금속 나노 입자에 결합하고, 세포 내로 전달되어 발현되는 하나 이상의 관심 유전자를 포함하는 핵산 분자를 포함하는 유전자 운반체를 제공하는 것이다.
또한 본 발명의 다른 목적은 상기 유전자 운반체를 포함하는 약학적 조성물을 제공하는 것이다.
또한 본 발명의 또 다른 목적은 상기 유전자 운반체를 포함하는 타겟 물질 검출용 조성물을 제공하는 것이다.
또한 본 발명의 또 다른 목적은 상기 유전자 운반체를 포함하는 관심 유전자의 세포 내 전달용 조성물을 제공하는 것이다.
또한 본 발명의 또 다른 목적은 금속 나노 입자에 산성 용액을 처리하여 상기 금속 나노 입자의 표면을 개질하는 단계; 및 상기 금속 나노 입자의 표면에 세포 내로 전달되어 발현되는 하나 이상의 관심 유전자를 포함하는 핵산 분자를 결합시키는 단계를 포함하는 유전자 운반체의 제조 방법을 제공하는 것이다.
또한 본 발명의 또 다른 목적은 금속 나노 입자의 표면에 결합되어, 세포 내에서 단독으로 발현되는 핵산 분자를 통한 관심 유전자의 발현 방법을 제공하는 것이다.
상기와 같은 목적을 달성하기 위하여, 본 발명은 금속 나노 입자; 및 상기 금속 나노 입자에 결합하고, 세포 내로 전달되어 발현되는 하나 이상의 관심 유전자를 포함하는 핵산 분자를 포함하는 유전자 운반체를 제공한다.
또한 본 발명의 다른 목적을 달성하기 위하여, 본 발명은 상기 유전자 운반체를 포함하는 약학적 조성물을 제공한다.
또한 본 발명의 또 다른 목적을 달성하기 위하여 본 발명은 상기 유전자 운반체를 포함하는 타겟 물질 검출용 조성물을 제공한다.
또한 본 발명의 또 다른 목적을 달성하기 위하여 본 발명은 상기 유전자 운반체를 포함하는 관심 유전자의 세포 내 전달용 조성물을 제공한다.
또한 본 발명의 또 다른 목적을 달성하기 위하여 본 발명은 금속 나노 입자에 산성 용액을 처리하여 상기 금속 나노 입자의 표면을 개질하는 단계; 및 상기 금속 나노 입자의 표면에 세포 내로 전달되어 발현되는 하나 이상의 관심 유전자를 포함하는 핵산 분자를 결합시키는 단계를 포함하는 유전자 운반체의 제조 방법을 제공한다.
또한 본 발명의 또 다른 목적을 달성하기 위하여 본 발명은 금속 나노 입자의 표면에 결합되어, 세포 내에서 단독으로 발현되는 핵산 분자를 통한 관심 유전자의 발현 방법을 제공한다.
이하, 본 발명을 상세하게 설명한다.
일 양태로서 본 발명은 금속 나노 입자; 및 상기 금속 나노 입자에 결합하고, 세포 내로 전달되어 발현되는 하나 이상의 관심 유전자를 포함하는 핵산 분자를 포함하는 유전자 운반체에 대한 것이다.
본 발명의 유전자 운반체는 금속 나노 입자를 포함한다. 상기 금속 나노 입자는 나노 단위의 직경을 가지는 것으로 그 크기에 제한되는 것은 아니나, 바람직하게는 5 내지 500 nm, 보다 바람직하게는 10 내지 200 nm의 직경을 가지며 이러한 크기의 나노 입자의 경우 안정한 입자의 형태로 제조가 쉬우며, 제조 공정상에서 크기 조절이 용이하다. 아울러, 상기 금속 나노 입자는 본 발명과 같이 유전자 운반체로 사용하기 위한 금속 나노 입자의 경우, 직경이 500 nm 이상으로 커지면 나노 입자로서의 특성이 소멸될 뿐 아니라 금속 표면과 작용기와의 결합이 약해지기 때문에 나노 입자를 이용한 전달체를 제조하기 어려운 단점을 가진다. 또한, 상기 금속 나노 입자는 바람직하게는 금 나노 입자일 수 있으며, 상기 금 나노 입자는 망간, 알루미늄, 카드늄, 납, 수은, 코발트, 니켈, 베릴륨 등의 중금속과 달리 인체에 무해하여 높은 생체 친화성을 가진다.
일 실시예로서, 본 발명에서 이용되는 금 나노 입자는 예컨대, 다음과 같이 제조될 수 있다: HAuCl4를 금 공급원으로 하고, 소듐 시트레이트를 환원제로 하여 HAuCl4를 환원시켜 금 나노 입자를 제조하였다. 이 경우, 금 나노 입자의 크기는 첨가하는 시트레이트를 달리해 줌으로써 조절이 가능하다. 즉, 시트레이트의 첨가량을 증가시킬수록 핵형성(nucleation)이 많이 되기 때문에 금 나노 입자의 크기는 감소한다.
본 발명의 상기 금속 나노 입자는 표면에 관심 유전자를 포함하는 핵산 분자가 결합된다. 상기 핵산 분자는 세포 내로 유입되어 단독으로 발현되기 위한 관심 유전자를 전달할 목적으로 금속 나노 입자 표면에 결합된다.
상기 핵산 분자는 그 종류에 제한되는 것은 아니다. 본 발명에서, 핵산 분자는 염기(base), 당(sugar) 및 인산 (phosphoric acid)이 포스포디에스테르 결합(phosphodiester bond)으로 연결되어 있는 구조를 가진 화합물을 의미하며, 이는2'-디옥시리보핵산(2'-deoxyribonucleic acid) (이후, "DNA") 및 리보핵산(ribonucleic acid) (이후 "RNA")와 같은 자연적으로 존재하는 올리고뉴클레오타이드, 및 변형된 당 잔기, 변형된 인산염 잔기, 또는 변형된 핵염기(necleobase)를 함유하는 핵산을 포함한다. 당 잔기에의 변형은 리보스 링(ribose ring)을 헥소스(hexose), 사이클로펜틸(cyclopentyl), 또는 사이클로헥실(cyclohexyl) 링 으로의 대체를 포함한다. 다른 한편으로, 자연적으로 존재하는 핵산의 D-리보스 링(D-ribose ring)은 L-리보스 링(L-ribose ring)으로 대체될 수 있거나, 또는 자연적으로 존재하는 핵산의 β-아노머(β-anomer)는 a-아노머(α-anomer)로 대체될 수 있다. 핵산 분자는 또한 하나 또는 그 이상의 무염기 잔기(abasic moieties)를 포함할 수 있다. 변형된 인산염 잔기에는 포스포로티오에이트(phosphorothioates),포스포로디티오에이트(phosphorodithioates), 메틸포스포네이트(methylphosphonates), 및 메틸인산염(methyl phosphate)을 또한 포함할 수 있다. 그러한 핵산 유사체(analogs)는 당업자에게 공지되어 있다. 상기 혼합물의 두 개 또는 그 이상의 혼합물을 포함하고 있는 핵산 분자는, 예를 들어, 디옥시리보- 또는 리보뉴클레오사이드의 혼합물로부터, 특히 2'-O-메틸 리보뉴클레오사이드 (2'-O-methyl ribonucleoside) 또는 2'-O-메톡시에틸 리보뉴클레오사이드(2'-O-methoxyethyl ribonucleoside)와 같은 디옥시리보뉴클레오사이드와 2'-O-치환된 리보뉴클레오사이드의 혼합물로부터 생산될 수 있다.
보다 구체적으로 상기 핵산 분자는 DNA, RNA 또는 DNA/RNA 분자 중 선택될 수 있으며, 더욱 구체적으로는 이중 나선 DNA일 수 있다. 상기 이중 나선 DNA는 단독으로 발현될 수 있는 cDNA, gDNA, 플라스미드 DNA 및 PCR DNA를 포함할 수 있다. 일 실시예로서, 상기 이중 나선 DNA는 이중 나선 상태로 금 나노 입자에 결합되는 것이며, 상기 이중나선 DNA를 세포 내로 운반하기 위한 것으로, 이는 단일 가닥의 DNA가 금 나노 입자에 결합된 후, 세포 내로 유입되어 상보적 가닥과 혼성화되는 것과는 차이가 있다.
또한 상기 핵산 분자는 하나 이상의 관심 유전자를 포함하여 세포 내로 유입된 후 단독으로 발현될 수 있다. 본 발명에서 용어 "관심 유전자"는 치료적, 진단적, 및/또는 예방적 효과를 가지고 및/또는 원하는 생물학적 및/또는 약리적 효과를 유도하는 임의의 핵산 또는 관심 기능적 펩타이드 또는 폴리펩타이드(단백질)(원상태 또는 변형된 펩타이드/단백질)를 인코딩하는 핵산을 포함한다.
본 발명에서 상기 '단독으로 발현'된다는 것은 주입된 세포의 게놈으로 통합되지 않고 상기 핵산 분자에 포함된 관심 유전자가 단독으로 전사 및/또는 번역되는 과정을 진행하는 것을 의미한다. 일 예로서, 이에 제한되는 것은 아니나, 단독으로 발현되기 위하여 상기 핵산 분자는 하나 이상의 프로모터, 오픈리딩프레임(open reading frame), 또는 터미네이터를 포함할 수 있으며, 보다 바람직하게는 관심 유전자와 작동 가능하게 연결된 하나 이상의 프로모터를 포함할 수 있다. 프로모터 서열은 종종 바이러스로부터 유래되거나 절단된 진핵생물 프로모터이며, 이에 따라 프로모터는 프로오피오멜라노코르틴 프로모터(POMC), 아데노바이러스 프로모터, 배큘로바이러스 프로모터, CMV 프로모터, 파보바이러스 프로모터, 헤르페스바이러스 프로모터, 폭스바이러스 프로모터, 아데노-연관 바이러스 프로모터, 셈리키 포레스트 바이러스 프로모터, SV40 프로모터, 백시니아 바이러스 프로모터, 또는 레트로바이러스 프로모터일 수 있다. 프로모터의 예에는 인간 심플렉스 바이러스 티미딘 키나제(HSV TK 또는 미니TK) 프로모터, 컬리플라워 모자이크 바이러스(CaMV) 35S 프로모터, 인간 사이토메갈로바이러스 CMV 프로모터(미니CMV), CMV53(상류 GC 박스가 부가된 minCMV), 시미안 바이러스 40 프로모터(minSV40), MLP(아데노바이러스 주요 후기 프로모터의 -38 내지 +6 영역), minP(TATA 박스 및 전사 시작 부위로 이루어진 합성 프로모터 - Promega 제품), pJB42CAT5(인간　junB　유전자 유래 프로모터), YB_TATA, 및 수퍼 코어 프로모터 1(SCP1) 프로모터가 포함된다. 몇몇 프로모터(때때로 "코어 프로모터"로도 불림)는 문헌(Ede 등, ACS Synth Biol. 2016 May 20; 5(5): 395-404)에 기재되어 있다.
용어 "작동 가능하게 배치된", "작동 가능하게 결합된" 및 "작동 가능하게 연결된"은 프로모터(및/또는 인핸서)가 그 핵산의 전사 개시 및 발현을 제어하기 위해 핵산 서열에 대한 정확한 기능적 위치 및 배향에 있음을 의미한다. 인핸서는 이것이 프로모터의 전사 활성을 증가시키기 위한 정확한 기능적 위치 및 배향에 있는 경우 프로모터에 "작동 가능하게 연결된다".
하나의 구현예에서, 상기 핵산 분자는 폴리아데닐화(폴리(A)) 서열을 추가로 포함한다. 폴리(A) 서열은 관심 핵산(전사체)의 적절한 폴리아데닐화를 일으킨다. 대표적인 폴리(A) 서열의 예에는 다양한 표적 세포에서 편리하고/하거나 잘 기능하는 것으로 알려진, SV40 폴리(A) 및/또는 소 성장 호르몬 폴리(A)가 포함된다.
하나의 구현예에서 상기 핵산 분자는 전사 종결 서열을 추가로 포함한다. "종결 신호" 또는 "종결인자"는 RNA 폴리머라제에 의한 RNA 전사체의 특이적 종결에 관여되는 DNA 서열로 이루어진다.
또한, 이에 제한되는 것은 아니나, 상기 핵산 분자는 전사 및/또는 번역되는 발현 과정을 통해 전사 및/또는 번역 산물을 생산할 수 있다. 상기 전사 및/또는 번역 산물은 이에 제한되는 것은 아니나, 예를 들어 mRNA, 논코딩(non-cording)RNA, 단백질, 항원 또는 항체 등을 포함할 수 있다.
본 발명의 상기 유전자 전달체는 핵산 분자가 금 나노 입자 표면에 결합되어 있는 것이다. 상기 핵산 분자는 금 나노 입자 표면 결합을 위하여 하나 이상의 작용기성(functionality)을 포함한다. 상기 작용기성은 그 종류에 제한되는 것은 아니며, 티올기 또는 아민기일 수 있으며, 전달 대상이 되는 핵산 분자의 하나 이상의 잔기에 포함될 수 있다. 본 발명의 일 실시예에서 상기 핵산 분자는 티올화된 잔기를 하나 이상 포함하며, 이를 통해 금 나노 입자 표면에 직접 결합한다. 상기 결합은 별도의 스페이서 또는 링커를 포함하지 않는다. 상기 티올화된 잔기는 3'말단, 5'말단 또는 핵산 분자의 염기 서열 내 포함되는 하나 이상의 염기일 수 있다.
또한, 상기 핵산 분자는 금 나노 입자 표면에 하나 이상 결합되며, 이에 제한되는 것은 아니나, 발현을 위하여 1 내지 20개의 핵산 분자가 금 나노 입자의 표면에 결합될 수 있다. 또한, 상기 결합되는 핵산 분자의 길이는 적어도 100 bp, 200 bp, 또는 300 bp 이상의 길이를 가지는 것이며, 그 길이에 제한되는 것은 아니다. 또한, 일부 경우에, 상기 핵산 분자는 30 초과 개의 뉴클레오타이드이다. 또 다른 구현예에서, 핵산 분자 분자는 35 초과 개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 40개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 45 뉴클레오타이드. 또 다른 구현예에서, 길이는 적어도 55 뉴클레오타이드. 또 다른 구현예에서, 길이는 적어도 50개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 60개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 80개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 90개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 100개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 120개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 140개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 160개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 180개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 200개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 250개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 300개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 350개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 400개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 450개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 500개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 600개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 700개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 800개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 900개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 1000개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 1100개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 1200개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 1300개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 1400개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 1500개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 1600개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 1800개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 2000개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 2500개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 3000개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 4000개의 뉴클레오타이드이다. 또 다른 구현예에서, 길이는 적어도 5000개의 뉴클레오타이드, 또는 5000 초과 개의 뉴클레오타이드이다.
본 발명의 다른 양태로서, 본 발명은 상기의 금 나노 입자 및 이중 나선 DNA를 포함하는 유전자 운반체를 포함하는 약학 조성물에 대한 것이다. 상기 약학 조성물은 질병의 예방, 개선 또는 치료를 위한 것으로, 그 종류에 제한되는 것은 아니며, 상기 금 나노 입자에 결합되는 이중 나선 DNA의 종류 및 발현 산물에 따라 용도를 달리할 수 있다.
상기 약학 조성물은 세포치료제, 유전자 변형 세포치료제, 유전자 치료제, RNA 치료제를 포함하는 세포유전자 치료제일 수 있으며, 상기 세포유전자 치료제는 백신, 항생제 및 항암제를 포함할 수 있다.
상기 세포치료제는 세포의 조직과 기능을 복원시키기 위하여 살아있는 자가(autologous), 동종(allogenic), 또는 이종(xenogeneic) 세포를 체외에서 증식, 선별하거나 여타한 방법으로 세포의 생물학적 특성을 변화시키는 등의 일련의 행위를 통해 치료, 진단 및 예방의 목적으로 사용되는 의약품을 의미하며, 세포 내 유전자를 변형하는 경우 유전자 변형 세포 치료제라고 구분하기도 한다.
또한, 상기 유전자 치료제는 유전자 재조합 등의 유전자 조작을 이용하여 정상 유전자 및 치료 유전자를 환자의 세포 안으로 이입시켜 결손 유전자를 교정하거나 세포에 새로운 기능을 추가하여 유전자 결함을 치료 또는 예방할 목적으로 제조된 의약품이다.
아울러, 상기 RNA 치료제는 표적 유전자로부터 질병을 유도하는 단백질 생성 과정을 억제하면서 약의 효능을 나타내는 것으로, mRNA, RNAi, ASO(Antisense oligonucleotide), RNA aptamer 등을 포함할 수 있다.
본 발명에 따른 약학적 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 상기 부형제는 예를 들어, 희석제, 결합제, 붕해제, 활택제, 흡착제, 보습제, 필름-코팅 물질, 및 제어방출첨가제로 이루어진 군으로부터 선택된 하나 이상일 수 있다.
본 발명에 따른 약학적 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 서방형 과립제, 장용과립제, 액제, 점안제, 엘실릭제, 유제, 현탁액제, 주정제, 트로키제, 방향수제, 리모나아데제, 정제, 서방형정제, 장용정제, 설하정, 경질캅셀제, 연질캅셀제, 서방캅셀제, 장용캅셀제, 환제, 틴크제, 연조엑스제, 건조엑스제, 유동엑스제, 주사제, 캡슐제, 관류액, 경고제, 로션제, 파스타제, 분무제, 흡입제, 패취제, 멸균주사용액, 또는에어로졸 등의 외용제 등의 형태로 제형화하여 사용될 수 있으며, 상기 외용제는 크림, 젤, 패치, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 또는 카타플라스마제 등의 제형을 가질 수 있다.
본 발명에 따른 약학적 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.
본 발명에 따른 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명에 따른 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 본 발명이 속하는 기술분야에 통상의 기술자에 의해 용이하게 결정될 수 있다.
본 발명의 약학적 조성물은 개체에게 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구 복용, 피하 주사, 복강 투여, 정맥 주사, 근육 주사, 척수 주위 공간(경막내) 주사, 설하 투여, 볼점막 투여, 직장 내 삽입, 질 내 삽입, 안구 투여, 귀 투여, 비강 투여, 흡입, 입 또는 코를 통한 분무, 피부 투여, 경피 투여 등에 따라 투여될 수 있다.
본 발명의 약학적 조성물은 치료할 질환, 투여 경로, 환자의 연령, 성별, 체중 및 질환의 중등도 등의 여러 관련 인자와 함께 활성 성분인 약물의 종류에 따라 결정된다.
본 발명에서 “개체”란 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는 인간 또는 비-인간인 영장류, 생쥐 (mouse), 쥐 (rat), 개, 고양이, 말, 및 소 등의 포유류를 의미한다.
본 발명에서 “투여”란 임의의 적절한 방법으로 개체에게 소정의 본 발명의 조성물을 제공하는 것을 의미한다.
본 발명에서 “예방”이란 목적하는 질환의 발병을 억제하거나 지연시키는 모든 행위를 의미하고, “치료”란 본 발명에 따른 약학적 조성물의 투여에 의해 목적하는 질환과 그에 따른 대사 이상 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미하며, “개선”이란 본 발명에 따른 조성물의 투여에 의해 목적하는 질환과 관련된 파라미터, 예를 들면 증상의 정도를 감소시키는 모든 행위를 의미한다.
본 발명의 일 양태로서 본 발명은 본 발명의 금속 나노 입자 및 관심 유전자를 포함하는 핵산 분자를 포함하는 유전자 운반체를 포함하는 백신 조성물을 제공한다. 상기 용어 '백신'은 개체에 면역을 주는 항원을 함유하는 생물학적인 제제로서, 질환 예방을 위하여 사람이나 동물에게 누여, 예컨대 주사하거나 경구 투여함으로써 면역을 발생시키는 면역 원성 또는 항원성 물질을 말한다.
상기 백신은 DNA 백신일 수 있다. 상기 'DNA백신'이라 함은, 병원균이나 바이러스 등의 유전자들 중 일부를 인공적으로 복제한 후 이를 투여함으로써 면역 반응을 야기하는 백신을 의미한다. 상기 백신 조성물은 다양한 감염 질환, 유전 질환, 기타 질환 또는 암에 대한 면역능을 형성하는 것일 수 있다.
상기 백신 조성물은 다양한 형태로 개체에 주입될 수 있다. 상기 '주입'은 피하주사, 근육내 주사, 피하내 주사, 복강 내 주사, 비강투여, 구강투여, 경피투여 및 경구투여로 구성된 군에서 선택된 어느 하나의 방법으로 수행될 수 있으며, 보다 바람직하게는 DNA 백신의 투여에 적합한 임의의 경로로서, 예를 들면 피하, 근육 내 주사, 복강 내 주사, 또는 정맥 내 주사에 의해 투여될 수 있다.
상기 백신 조성물은 면역 반응을 개선 또는 강화시키기 위하여 하나 이상의 보조제 등을 포함할 수 있다. 적절한 보조제에는 펩티드, 알루미늄 하이드록시드, 알루미늄 포스페이트, 알루미늄 옥시드 및 Marcol 52 같은 미네랄 오일 또는 식물성 오일 및 하나 이상의 유화제로 구성된 조성물 또는 리졸세시틴, 다가 양이온, 다가 음이온 같은 표면 활성물질 등이 포함될 수 있다.
본 발명의 다른 양태로서 본 발명은 상기의 금속 나노 입자 및 관심 유전자를 포함하는 핵산 분자를 포함하는 유전자 운반체를 포함하는 진단 또는 타겟 물질 검출용 조성물에 대한 것이다.
본 발명의 또 다른 양태로서 본 발명은 상기의 금속 나노 입자 및 관심 유전자를 포함하는 핵산 분자를 포함하는 관심 유전자의 세포 내 전달용 조성물에 대한 것이다.
또한 본 발명의 또 다른 양태로서, 본 발명은 금속 나노 입자에 산성 용액을 처리하여 상기 금속 나노 입자의 표면을 개질하는 단계; 상기 금속 나노 입자의 표면에 세포 내로 전달되어 발현되는 하나 이상의 관심 유전자를 포함하는 핵산 분자를 결합시키는 단계를 포함하는 유전자 운반체의 제조 방법에 대한 것이다.
또한 본 발명의 또 다른 양태로서, 본 발명은 금속 나노 입자의 표면에 결합되어, 세포 내에서 단독으로 발현되는 핵산 분자를 통한 관심 유전자의 발현 방법에 대한 것이다.
본 발명은 금속 나노 입자 및, 상기 금속 나노 입자 표면에 결합된 관심 유전자를 포함하는 핵산 분자를 포함하는 유전자 운반체, 이의 제조 방법 및 용도에 대한 것으로서, 하나 이상의 유전자를 포함하는 핵산 분자, 특히 이중 나선 DNA 형태의 핵산 분자가 공유 결합을 통해 직접 금 나노 입자 표면에 결합되어 세포 내로 전달되어 발현되는 것이며, 이를 통해 안정적인 전달 및 발현이 가능하며, 유전자 치료제, 백신 및 질병 진단용 조성물로서 활용될 수 있는 효과를 가진다.
도 1은 본 발명의 일 실시예에서 금 나노 입자에 결합된 관심 유전자를 포함하는 핵산 분자의 구조를 나타낸 모식도이다.
도 2는 본 발명의 금 나노 입자에 티올화된 잔기를 통해 결합된 핵산 분자의 결합 효율을 확인한 결과이다.
도 3은 본 발명의 금 나노 입자에 결합하는 이중나선 DNA 중 티올화된 가닥((+), (-))에 따른 유전자의 세포 내 전달 여부를 확인한 결과이다.
도 4는 다양한 길이를 가진 티올화된 이중 나선 DNA를 금 나노 입자에 결합시켜 세포 내 전달 및 발현이 가능한 AuNP-dsDNA에 대한 제조예이다.
도 5는 티올화된 이중나선 DNA를 금 나노 입자 표면에 기능화하여 결합시킨 결과를 확인한 것이다.
도 6은 서열번호 1 내지 4의 다양한 길이를 가지는 이중 나선 DNA가 탑재된 금 나노 운반체의 소동물 모델에서 유전자의 전달 및 발현 여부를 확인한 결과이다.
도 7은 루시퍼라아제(서열번호 5) 유전자를 금나노 입자 표면에 기능화한 결과를 확인한 것이다.
도 8은 루시퍼라아제 유전자가 금나노 운반체를 통해 세포 내 전달 및 발현되는지 여부를 확인한 결과이다.
이하, 본 명세서를 구체적으로 설명하기 위해 실시예를 들어 상세히 설명한다. 그러나, 본 명세서에 따른 실시예들은 여러 가지 다른 형태로 변형될 수 있으며, 본 명세서의 범위가 아래에서 상술하는 실시예들에 한정되는 것으로 해석되지는 않는다. 본 명세서의 실시예들은 당업계에서 평균적인 지식을 가진 자에게 본 명세서를 보다 완전하게 설명하기 위해 제공되는 것이다.
실시예 1. 이중 나선 DNA(GFP)가 결합된 금 나노 입자 (AuNP-dsDNA) 제조
세포 내에서 발현시키기 위한 티올화된 이중 나선 DNA를 금 나노 입자에 결합시켜 세포 내 전달 및 발현이 가능한 AuNP-dsDNA를 하기와 같은 단계로 제조하였으며, 이의 개략적인 모식도는 도 1에 나타내었다.
1-1. 세포 내 항원 발현이 가능한 dsDNA 제조
플라스미드 pcDNA3.1를 이용하여, 상기 플라스미드의 CMV 프로모터와 bGH 터미네이터 사이에 전달 대상 유전자를 클로닝하였다. 상기 유전자의 티올화된 잔기는 각각 티올화 프라이머(Thiolated primer)를 이용하여 PCR을 통해 각각 5'말단, 3'말단 또는 내부 잔기가 티올화된 이중 나선 DNA를 합성하였다.
상기 전달 대상 유전자로서, 상기 방법을 통해 서열번호 1의 eGFP 유전자를 클로닝하고, 5'말단, 3'말단 또는 내부 잔기를 티올화하기 위하여 하기 표 1의 5' 말단 티올화 프라이머 서열을 사용하였으며, eGFP의 티올화된 이중나선 DNA를 합성하였다.
Thiolation 유형 Thiolation 가닥 eGFP 서열
(+) (-)
5' 말단 - - 5' CTTAGGGTTAGGCGTTTTGC ~~ (eGFP 발현 시스템) ~~ GTATCCCCACGCGCCCTGTAG 3'
3' GAATCCCAATCCGCAAAACG ~~ (eGFP 발현 시스템) ~~ CATAGGGGTGCGCGGGACATC 5'
○ - 5' (Thiolation) CTTAGGGTTAGGCGTTTTGC ~~ (eGFP 발현 시스템) ~~ GTATCCCCACGCGCCCTGTAG 3'
3' GAATCCCAATCCGCAAAACG ~~ (eGFP 발현 시스템) ~~ CATAGGGGTGCGCGGGACATC 5'
- ○ 5' CTTAGGGTTAGGCGTTTTGC ~~ (eGFP 발현 시스템) ~~ GTATCCCCACGCGCCCTGTAG 3'
3' GAATCCCAATCCGCAAAACG ~~ (eGFP 발현 시스템) ~~ CATAGGGGTGCGCGGGACATC (Thiolation) 5'
○ ○ 5' (Thiolation) CTTAGGGTTAGGCGTTTTGC ~~ (eGFP 발현 시스템) ~~ GTATCCCCACGCGCCCTGTAG 3'
3' GAATCCCAATCCGCAAAACG ~~ (eGFP 발현 시스템) ~~ CATAGGGGTGCGCGGGACATC (Thiolation) 5'
내부잔기 - ○ 5' CTTAGGGTTAGGCGTTTTGC ~~ (eGFP 발현 시스템) ~~ GTATCCCCACGCGCCCTGTAG 3'
3' GAATCCCAATCCGCAAAACG ~~ (eGFP 발현 시스템) ~~ CA*T*A*G*G*GGTGCGCGGGACATC 5'
μl의 1N DTT(dithiothreitol)를 넣고, 실온에서 60분간 반응시켰다. 원하지 않은 티올기 분자를 포함한 DTT를 제거하기 위해, 에틸아세테이트(Ethyl acetate) 200 μl를 넣고 섞은 후, 원심분리 하여 상층액을 제거하였으며, 이 과정을 3회 반복하였다. 그리고 나서 에탄올 침전법(EtOH precipitating method)을 이용하여 티올화된 이중나선 DNA를 침전시켰다.
1-3 금 나노 입자의 dsDNA 기능화 (AuNP-dsDNA) 제조
상기 1-2 과정을 통해 전처리되어 침전된 티올화된 이중나선 DNA를 물에 녹인 후, 금 나노 입자에 첨가한 후 Salt aging 방법으로 결합시켰다. 구체적으로, 7 nM의 금 나노 입자에 티올화된 이중나선 DNA를 넣고 (AuNP : 티올화된 이중나선 DNA= 1:40) 충분히 섞은 후, 농도가 0.1M 이 되도록 NaCl을 첨가하여 4시간 혼합하였다. 4시간 후 농도가 0.2M 이 되도록 NaCl을 첨가하여 4시간 혼합하였다. 4시간 후 농도가 0.3M 이 되도록 NaCl을 첨가하여 12시간 혼합하였다.
12시간 후 티올화된 이중나선 DNA와 금 혼합물은 ~10,000 x g에서 20 분간 원심 분리하여 모은 뒤 상층액에 있는 반응하지 않은 이중나선 DNA를 제거하였고, 이 과정을 3회 반복하였다.
최종 AuNP-티올화된 이중나선 DNA 결합물(AuNP-thiolated dsDNA)은 0.1 M NaCl를 포함하는 10mM 인산 나트륨 버퍼(pH 7.4)에 넣고 분산시켰다. 제조된 AuNP-티올화된 이중 나선 DNA 결합물은 10% 아크릴아마이드 8M 우레아 겔에 전기 영동으로 분석하였고, 한 개의 금 나노 입자 당 1.98 내지 9.27개의 티올화된 이중나선 DNA 가 결합됨을 확인하였다 (도 2).
실시예 2. 소동물 모델에서 AuNP-dsDNA(GFP)에 의한 유전자의 전달 및 발현 확인
실험의 편의성을 위해 이종 이식 종양 모델을 이용하였다. 6주령 면역결핍 BALB/c-nu/nu 마우스(Central Lab Animal Inc, Korea)에 HeLa 세포를 주입하여 자궁경부암을 발생시키고, AuNP-thiolated dsDNA를 이종 이식 종양에 주입하였고 36시간 후, 이종 이식 종양을 적출하여 FOBI(Fluorescence In Vivo Imaging System) 로 주입된 GFP의 발현을 관찰하였다. 그 결과 (+) 가닥 또는 (-) 가닥 또는 (+),(-) 가닥의 5’ 말단에 티올화되거나 내부에 티올기를 가진 AuNP-thiolated dsDNA가 주입된 종양에서 발현되는 것이 확인되었다 (도 3).
실시예 3. 길이가 다른 dsDNA가 결합된 금 나노 입자 제조
다양한 길이를 가진 티올화된 이중 나선 DNA를 금 나노 입자에 결합시켜 세포 내 전달 및 발현이 가능한 AuNP-dsDNA를 제조하였으며, 이의 개략적인 모식도를 도 4에 나타내었다.
3-1. 세포 내 발현이 가능한 이중 나선 DNA 제조
플라스미드 pcDNA3.1를 이용하여, 상기 플라스미드의 CMV 프로모터와 bGH 터미네이터 사이에 포함되는 eGFP(서열 번호 1, 서열 번호 2), A3APO-FLAG(서열 번호 3) 및 pFOX-FLAG(서열 번호 4) 유전자를 각각 클로닝하였다. 상기 유전자들의 티올화된 잔기는 각각 5'-티올화 프라이머(Thiolated primer)를 이용하여 PCR을 통해 각각 5'말단, 3'말단 또는 내부(internal) 잔기 중 하나가 티올화된 이중 나선 DNA를 합성하였다.
합성한 상기 티올화된 이중 나선 DNA를 상기 실험예 1-2와 동일한 방법으로 전처리 하고, 에탄올 침전법(EtOH precipitating method)을 이용하여 티올화된 이중나선 DNA를 침전하였다.
3-2 금 나노 입자의 dsDNA 기능화 (AuNP-dsDNA) 제조
상기 3-1 과정을 통해 합성 및 전처리 되어 침전된 티올화된 이중 나선DNA를 상기 1-3과 동일한 과정을 통해 금 나노 입자 표면에 기능화하였다. 제조된 AuNP-thiolated dsDNA 결합물은 10% acrylamide 8M Urea gel에 전기 영동으로 분석하였고, 한 개의 금 나노 입자에 각각 2.38개~5.67개의 티올화된 이중 나선 DNA 가 결합됨을 확인하였다 (도 5).
실시예 4. 다양한 길이의dsDNA가 탑재된 금 나노 입자의 소동물 모델에서 유전자의 전달 및 발현 확인
실험의 편의성을 위해 이종이식 종양 모델을 이용하였다. 6주령 면역결핍 BALB/c-nu/nu 마우스(Central Lab Animal Inc, Korea)의 피하에 HeLa 세포를 주입하여 종양을 생성시키고, 서열번호 1 내지 4(6 kbp, 1.7 kbp, 또는 0.5 kbp)의 이중나선 DNA를 결합시킨 AuNP-thiolated dsDNA를 상기 종양 주변에 주입하였다. 주입 36시간 후, 이종 이식 종양 또는 비복근을 적출하여 동결 절편법으로 절편을 생성하고, 면역 형광 염색을 통하여 주입된 dsDNA에 의한 단백질의 발현을 관찰하였다. 그 결과, 상기 서열번호 1 내지 4의 6 kbp, 1.7 kbp, 또는 0.5 kbp의 dsDNA에 의한 단백질 발현이 마우스 종양 또는 비복근에서 각각 확인되었다. (도 6)
실시예 5. 루시퍼라아제(Luciferase)를 발현하는 금 나노 입자 제조
금 나노 입자 전달체가 마우스 생체 내(in vivo) 조직에서 잘 발현이 되는지 확인하기 위하여 루시퍼라아제를 발현하는 티올화된 이중 나선 DNA를 금 나노 입자에 결합시켜 세포 내 전달 및 발현이 가능한 AuNP-dsDNA를 제조하여 확인하였다.
5-1. 세포 내 발현이 가능한 이중 나선 DNA 제조
플라스미드 pcDNA3.1를 이용하여, 상기 플라스미드의 CMV 프로모터와 bGH 터미네이터 사이에 포함되는 Luciferase(서열 번호 5) 유전자를 클로닝하였다. 상기 유전자의 티올화된 잔기는 각각 5'-티올화 프라이머(Thiolated primer)를 이용하여 PCR을 통해 각각 5'말단, 3'말단 또는 내부(internal) 잔기 중 하나가 티올화된 이중 나선 DNA를 합성하였다.
합성한 상기 티올화된 이중 나선 DNA를 상기 실험예 1-2와 동일한 방법으로 전처리 하고, 에탄올 침전법(EtOH precipitating method)을 이용하여 티올화된 이중나선 DNA를 침전하였다.
5-2 금 나노 입자의 dsDNA 기능화 (AuNP-dsDNA) 제조
상기 5-1 과정을 통해 합성 및 전처리 되어 침전된 티올화된 이중 나선DNA를 상기 1-3과 동일한 과정을 통해 금 나노 입자 표면에 기능화하였다. 제조된 AuNP-thiolated dsDNA 결합물은 10% acrylamide 8M Urea gel에 전기 영동으로 분석하였고, 한 개의 금 나노 입자에 각각 2.4개의 티올화된 이중 나선 DNA 가 결합됨을 확인하였다.(도 7)
실시예 6. 소동물 모델에서 AuNP-dsDNA(루시퍼라아제)에 의한 유전자의 전달 및 발현 확인
7주령 Balb/c 마우스 양쪽 비복근에 생리식염수 또는 AuNP-thiolated dsDNA 주입하고, 비교군으로서 이에 대응하는 양의 AuNP 또는 luciferase dsDNA를 각각 주입하였다. 주입 후 12시간 또는 24시간마다 이소플루란을 이용하여 마취시키고 D-Luciferin을 복강주사하여 루시퍼라아제의 활성을 측정하였다. LUCI(Luciferase In Vivo Imaging System)을 이용하여 이미지화한 결과 AuNP에 결합된 루시퍼라아제 dsDNA가 주입된 비복근에서 루시퍼라아제의 효소 활성이 확인되었다.(도 8)
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.
본 발명의 일 양태로서, 본 발명은 금속 나노 입자; 및 상기 금속 나노 입자에 결합하고, 세포 내로 전달되어 발현되는 하나 이상의 관심 유전자를 포함하는 핵산 분자를 포함하는 유전자 운반체에 대한 것이다.
상기 핵산 분자는 관심 유전자와 작동 가능하게 연결된 프로모터를 포함한다.
상기 관심 유전자는 세포 내에서 복제되지 않는 것이다.
상기 관심 유전자는 주입된 세포의 게놈으로 통합되지 않는 것이다.
상기 관심 유전자는 세포 내에서 전사 및/또는 번역을 통해 산물을 생산하는 것이다.
상기 전사 및/또는 번역을 통해 생산되는 산물은 mRNA, non-coding RNA, 단백질, 항원 또는 항체를 포함하는 군으로부터 선택될 수 있다.
상기 핵산 분자는 세포 내에서 단독으로 또는 독립적으로 발현된다.
상기 핵산 분자는 하나 이상의 티올화된 잔기를 통해 상기 금속 나노 입자 표면에 결합한다.
상기 티올화된 잔기는 상기 핵산 분자의 3'말단, 5'말단 또는 상기 핵산 분자의 염기 서열 내에 하나 이상 포함될 수 있다.
상기 금속 나노 입자는 5 내지 500nm의 크기를 가지는 것이다.
상기 금속 나노 입자는 금 나노 입자일 수 있다.
상기 핵산 분자는 DNA, RNA 또는 DNA/RNA 분자 중 선택될 수 있다.
상기 DNA는 이중나선 DNA이다.
상기 핵산 분자는 적어도 100 bp, 200 bp, 또는 300 bp 이상의 길이를 가질 수 있다 .
본 발명의 다른 양태로서, 본 발명은 상기의 유전자 운반체를 포함하는 약학적 조성물에 대한 것이다.
본 발명의 또 다른 양태로서, 본 발명은 상기의 유전자 운반체를 포함하는 타겟 물질 검출용 조성물에 대한 것이다.
본 발명의 또 다른 양태로서, 본 발명은 금속 나노 입자; 및 상기 금속 나노 입자에 결합되고, 세포 내로 전달되어 발현되는 하나 이상의 관심 유전자를 포함하는 핵산 분자를 포함하는 관심 유전자의 세포 내 전달용 조성물에 대한 것이다.
본 발명의 또 다른 양태로서, 본 발명은 금속 나노 입자에 산성 용액을 처리하여 상기 금속 나노 입자의 표면을 개질하는 단계; 및 상기 금속 나노 입자의 표면에 세포 내로 전달되어 발현되는 하나 이상의 관심 유전자를 포함하는 핵산 분자를 결합시키는 단계를 포함하는 유전자 운반체의 제조 방법에 대한 것이다.
본 발명의 또 다른 양태로서, 본 발명은 금속 나노 입자의 표면에 결합되어, 세포 내에서 단독으로 발현되는 핵산 분자를 통한 관심 유전자의 발현 방법에 대한 것이다.

Claims (19)

  1. 금속 나노 입자; 및
    상기 금속 나노 입자에 결합하고, 세포 내로 전달되어 발현되는 하나 이상의 관심 유전자를 포함하는 핵산 분자를 포함하는 유전자 운반체.
  2. 제1항에 있어서,
    상기 핵산 분자는 관심 유전자와 작동 가능하게 연결된 프로모터를 포함하는 것인 유전자 운반체.
  3. 제1항에 있어서,
    상기 관심 유전자는 세포 내에서 복제되지 않는 것인 유전자 운반체.
  4. 제1항에 있어서,
    상기 관심 유전자는 주입된 세포의 게놈으로 통합되지 않는 것인 유전자 운반체.
  5. 제1항에 있어서,
    상기 관심 유전자는 세포 내에서 전사 및/또는 번역을 통해 산물을 생산하는 것인 유전자 운반체.
  6. 제5항에 있어서,
    상기 전사 및/또는 번역을 통해 생산되는 산물은 mRNA, non-coding RNA, 단백질, 항원 또는 항체를 포함하는 군으로부터 선택된 하나 이상인 것인 유전자 운반체.
  7. 제1항에 있어서,
    상기 핵산 분자는 세포 내에서 단독으로 또는 독립적으로 발현되는 것인 유전자 운반체.
  8. 제1항에 있어서,
    상기 핵산 분자는 하나 이상의 티올화된 잔기를 통해 상기 금속 나노 입자 표면에 결합하는 것인 유전자 운반체.
  9. 제8항에 있어서,
    상기 티올화된 잔기는 상기 핵산 분자의 3'말단, 5'말단 또는 상기 핵산 분자의 염기 서열 내에 하나 이상 포함되는 것인 유전자 운반체.
  10. 제1항에 있어서,
    상기 금속 나노 입자는 5 내지 500nm의 크기를 갖는 것인 유전자 운반체.
  11. 제1항에 있어서,
    상기 금속 나노 입자는 금 나노 입자인 유전자 운반체.
  12. 제1항에 있어서,
    상기 핵산 분자는 DNA, RNA 또는 DNA/RNA 분자 중 선택되는 것인 유전자 운반체.
  13. 제12항에 있어서,
    상기 DNA는 이중나선 DNA인 유전자 운반체.
  14. 제1항에 있어서,
    상기 핵산 분자는 적어도 100 bp, 200 bp, 또는 300 bp 이상의 길이를 가지는 것인 유전자 운반체.
  15. 제1항의 유전자 운반체를 포함하는 약학적 조성물.
  16. 제1항의 유전자 운반체를 포함하는 타겟 물질 검출용 조성물.
  17. 금속 나노 입자; 및
    상기 금속 나노 입자에 결합되고, 세포 내로 전달되어 발현되는 하나 이상의 관심 유전자를 포함하는 핵산 분자를 포함하는 관심 유전자의 세포 내 전달용 조성물.
  18. 금속 나노 입자에 산성 용액을 처리하여 상기 금속 나노 입자의 표면을 개질하는 단계; 및
    상기 금속 나노 입자의 표면에 세포 내로 전달되어 발현되는 하나 이상의 관심 유전자를 포함하는 핵산 분자를 결합시키는 단계를 포함하는 유전자 운반체의 제조 방법.
  19. 금속 나노 입자의 표면에 결합되어, 세포 내에서 단독으로 발현되는 핵산 분자를 통한 관심 유전자의 발현 방법.
PCT/KR2023/006697 2022-05-17 2023-05-17 금속 나노 입자-핵산 결합체를 기반으로 하는 유전자 운반체 WO2023224388A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20220059957 2022-05-17
KR10-2022-0059957 2022-05-17
KR1020230063360A KR20230161366A (ko) 2022-05-17 2023-05-16 금속 나노 입자-핵산 결합체를 기반으로 하는 유전자 운반체
KR10-2023-0063360 2023-05-16

Publications (1)

Publication Number Publication Date
WO2023224388A1 true WO2023224388A1 (ko) 2023-11-23

Family

ID=88835789

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/006697 WO2023224388A1 (ko) 2022-05-17 2023-05-17 금속 나노 입자-핵산 결합체를 기반으로 하는 유전자 운반체

Country Status (1)

Country Link
WO (1) WO2023224388A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100001091A (ko) * 2008-06-26 2010-01-06 한국생명공학연구원 항체를 세포내로 도입하는 융합 펩타이드，및 이를 이용한세포이미징 및 약물전달
KR20110050338A (ko) * 2009-11-06 2011-05-13 중앙대학교 산학협력단 나노입자-기반된 유전자 운반체
KR20120022938A (ko) * 2009-04-15 2012-03-12 노오쓰웨스턴 유니버시티 올리고뉴클레오티드 관능화된 나노입자의 전달
KR20170027076A (ko) * 2015-09-01 2017-03-09 한국과학기술원 금 나노입자의 광열효과를 이용한 효율적인 세포내 유전자 전달방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100001091A (ko) * 2008-06-26 2010-01-06 한국생명공학연구원 항체를 세포내로 도입하는 융합 펩타이드，및 이를 이용한세포이미징 및 약물전달
KR20120022938A (ko) * 2009-04-15 2012-03-12 노오쓰웨스턴 유니버시티 올리고뉴클레오티드 관능화된 나노입자의 전달
KR20110050338A (ko) * 2009-11-06 2011-05-13 중앙대학교 산학협력단 나노입자-기반된 유전자 운반체
KR20170027076A (ko) * 2015-09-01 2017-03-09 한국과학기술원 금 나노입자의 광열효과를 이용한 효율적인 세포내 유전자 전달방법

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
YA DING, ZIWEN JIANG, KRISHNENDU SAHA, CHANG SOO KIM, SUNG TAE KIM, RYAN F LANDIS, VINCENT M ROTELLO: "Gold Nanoparticles for Nucleic Acid Delivery", MOLECULAR THERAPY, ELSEVIER INC., US, vol. 22, no. 6, 1 June 2014 (2014-06-01), US , pages 1075 - 1083, XP055557657, ISSN: 1525-0016, DOI: 10.1038/mt.2014.30 *

Similar Documents

Publication Publication Date Title
JP7447073B2 (ja) Ｐｄ－ｌ１発現低減用のオリゴヌクレオチド
TWI639432B (zh) 寡聚物及寡聚物結合物
JP2021091689A (ja) 核酸ワクチン
US20210024907A1 (en) Nucleic acid-based therapeutics
RU2711249C2 (ru) Способы и продукты для экспрессии белков в клетках
Machhi et al. A role for extracellular vesicles in SARS-CoV-2 therapeutics and prevention
KR20170082534A (ko) 조절성 폴리뉴클레오티드
EP4079854A1 (en) Multi-targeted sirna for treating cancers
CN113563430B (zh) 用于治疗眼部疾病的基因递送系统及其应用
CN113480615B (zh) 高视网膜亲和性的新型腺相关病毒衣壳蛋白及其应用
JP2022524391A (ja) 合成腫瘍溶解性ｌｎｐレプリコンｒｎａおよびがん免疫治療のための使用
JP2003528138A5 (ko)
WO2022035243A1 (ko) 치료제가 봉입된 우유 엑소좀을 포함하는 경구형 조성물 및 이의 제조 방법
WO2023224388A1 (ko) 금속 나노 입자-핵산 결합체를 기반으로 하는 유전자 운반체
Kiselev et al. Suppression of nonsense mutations in the Dystrophin gene by a suppressor tRNA gene
WO2023229344A1 (ko) 나노입자-올리고t 결합체를 기반으로 하는 메신저 rna 운반체
WO2004035523B1 (en) Cationic cardiolipin analogs and use thereof
KR20210039495A (ko) 피드백이 가능한 합성 유전자, 표적 시드 매치 카세트, 및 그 용도
KR20230161366A (ko) 금속 나노 입자-핵산 결합체를 기반으로 하는 유전자 운반체
US20240000914A1 (en) Chicken anemia virus (cav)-based vectors
TW202235622A (zh) 包裹rna之指環病毒(anellovirus)蛋白殼之活體外組裝
EP3228322B1 (en) Adjuvant composition
WO2021115141A1 (zh) 一种抑制HTT基因表达的siRNA及其前体和应用
US20200318113A1 (en) Polynucleotide conjugates and uses thereof
TW202207950A (zh) 治療d型肝炎病毒感染之組合物及方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23807907

Country of ref document: EP

Kind code of ref document: A1