WO2023003130A1 - 분리된 미토콘드리아를 유효성분으로 포함하는 아셔만 증후군 예방 또는 치료용 약학 조성물 - Google Patents

분리된 미토콘드리아를 유효성분으로 포함하는 아셔만 증후군 예방 또는 치료용 약학 조성물 Download PDF

Info

Publication number
WO2023003130A1
WO2023003130A1 PCT/KR2022/004637 KR2022004637W WO2023003130A1 WO 2023003130 A1 WO2023003130 A1 WO 2023003130A1 KR 2022004637 W KR2022004637 W KR 2022004637W WO 2023003130 A1 WO2023003130 A1 WO 2023003130A1
Authority
WO
WIPO (PCT)
Prior art keywords
mitochondria
syndrome
asherman
pharmaceutical composition
complications
Prior art date
Application number
PCT/KR2022/004637
Other languages
English (en)
French (fr)
Inventor
최용수
송행석
김미진
박미라
Original Assignee
차의과학대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 차의과학대학교 산학협력단 filed Critical 차의과학대학교 산학협력단
Priority to CN202280064143.1A priority Critical patent/CN117979980A/zh
Publication of WO2023003130A1 publication Critical patent/WO2023003130A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/16—Blood plasma; Blood serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A61P15/02—Drugs for genital or sexual disorders; Contraceptives for disorders of the vagina
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A61P15/08—Drugs for genital or sexual disorders; Contraceptives for gonadal disorders or for enhancing fertility, e.g. inducers of ovulation or of spermatogenesis

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating Asherman syndrome or its complications, comprising isolated mitochondria as an active ingredient.
  • Asherman's syndrome also known as intrauterine adhesions (IUAs) is a deprivation and defect of the basal layer of the endometrium and partial or extensive adhesions of the uterine cavity. Asherman syndrome is characterized by symptoms such as infertility, habitual miscarriage or premature birth, amenorrhea, hypomenorrhea, or dysmenorrhea.
  • Known treatment methods for Asherman syndrome include adhesion detachment by dura or laparotomy, insertion of an intrauterine contraceptive device (IUD) or administration of hormones, but many intrauterine reattachments occur after surgery, requiring multiple surgeries. In severe cases, there were problems such as infertility due to repeated surgery.
  • This uterine adhesion causes discomfort in daily life due to extreme pain, and even though it is a disease that leads to infertility in severe cases, fundamental prevention and treatment methods do not yet exist, and related studies are lacking.
  • mitochondria are essential organelles for the survival of eukaryotic cells that are involved in the synthesis and regulation of adenosine triphosphate (ATP) as an energy source.
  • Mitochondria are important organelles involved in various metabolic pathways in vivo, such as cell signaling, cell differentiation, cell death, as well as control of the cell cycle and cell growth.
  • ATP adenosine triphosphate
  • compositions for the treatment of Asherman syndrome or its complications which includes isolated mitochondria as an active ingredient for the treatment of Asherman syndrome or its complications, thereby fundamentally treating Asherman syndrome or its complications. developed to solve the above problems.
  • One aspect of the present invention provides a pharmaceutical composition for preventing or treating Asherman syndrome or its complications, comprising isolated mitochondria as an active ingredient.
  • Another aspect of the present invention provides a treatment method for preventing or treating Asherman's syndrome or its complications, comprising the step of administering the pharmaceutical composition of any one of claims to a subject.
  • Another aspect of the present invention provides use of isolated mitochondria for the prevention or treatment of Asherman syndrome or complications thereof.
  • a pharmaceutical composition containing mitochondria as an active ingredient can induce proliferation of endometrial vascular cells and suppress inflammation. Therefore, uterine diseases induced by uterine fibrosis can be effectively treated or prevented. Accordingly, the pharmaceutical composition can be effectively used to effectively treat Asherman syndrome or infertility, infertility, and premature birth caused by Asherman syndrome.
  • 1 is a graph showing the amount of protein of stem cell-derived mitochondria.
  • 2 is a graph showing the size distribution of stem cell-derived mitochondria.
  • 3 is an image of stem cell-derived mitochondria observed under a fluorescence microscope.
  • 6 is a graph confirming the ATP synthesis ability of stem cell-derived mitochondria.
  • FIG. 7 is a graph showing ROS production of stem cell-derived mitochondria.
  • FIG. 9 is a graph showing the ATP synthesis ability of stem cell-derived mitochondria.
  • FIG. 10 is a schematic diagram of an experiment for confirming changes in the fibrotic state and histological shape by administration of stem cell-derived mitochondria (MT) in an Asherman syndrome mouse model (AS).
  • MT stem cell-derived mitochondria
  • FIG. 11 is an image showing the degree of abnormality in fibrotic state and histological shape by administration of stem cell-derived mitochondria (MT) in an Asherman syndrome mouse model (AS).
  • MT stem cell-derived mitochondria
  • FIG. 12 is a graph showing mRNA expression of fibrosis factors (Col1a1, Col3a1, Timp1 and Tgf ⁇ 1) by administration of stem cell-derived mitochondria (MT).
  • MT stem cell-derived mitochondria
  • FIG. 13 is a graph showing protein expression of fibrosis factors (Col1a1, Col3a1, Timp1 and Tgf ⁇ 1) by administration of stem cell-derived mitochondria (MT).
  • MT stem cell-derived mitochondria
  • FIG. 14 is a schematic diagram of an experiment for confirming pregnancy-related indicators by administration of stem cell-derived mitochondria (MT) in an Asherman syndrome mouse model (AS).
  • MT stem cell-derived mitochondria
  • AS Asherman syndrome mouse model
  • FIG. 15 is a graph showing the number of implanted embryos in the second trimester of Asherman syndrome mouse model (AS) by administration of stem cell-derived mitochondria (MT).
  • AS Asherman syndrome mouse model
  • MT stem cell-derived mitochondria
  • FIG. 16 is a graph showing the weight of implanted embryos in the second trimester of pregnancy in an Asherman syndrome mouse model (AS) by administration of stem cell-derived mitochondria (MT).
  • AS Asherman syndrome mouse model
  • MT stem cell-derived mitochondria
  • FIG 17 is a graph showing the time to conceive of an Asherman syndrome mouse model (AS) by administration of stem cell-derived mitochondria (MT).
  • AS Asherman syndrome mouse model
  • MT stem cell-derived mitochondria
  • FIG. 18 is a graph showing the birth rate at the end of pregnancy in an Asherman syndrome mouse model (AS) by administration of stem cell-derived mitochondria (MT).
  • AS Asherman syndrome mouse model
  • MT stem cell-derived mitochondria
  • FIG. 19 is a graph showing the number of live births at the end of pregnancy in an Asherman syndrome mouse model (AS) by administration of stem cell-derived mitochondria (MT).
  • AS Asherman syndrome mouse model
  • MT stem cell-derived mitochondria
  • FIG 20 is a graph showing the number of implanted uterus and implanted embryos in the early stage of pregnancy in an Asherman syndrome mouse model (AS) by administration of stem cell-derived mitochondria (MT).
  • AS Asherman syndrome mouse model
  • MT stem cell-derived mitochondria
  • 21 is a graph showing mRNA expression of vascular endothelial cell markers Hgf, Igf1, Ang1, Vegfa, Hif1 ⁇ and Hif2 ⁇ by the administration of stem cell-derived mitochondria (MT).
  • MT stem cell-derived mitochondria
  • vascular endothelial cell markers Hgf, Igf1, Ang1, Vegfa, Hif1 ⁇ and Hif2 ⁇ by the administration of stem cell-derived mitochondria (MT).
  • FIG 23 is an immunofluorescence staining image showing the cell proliferation effect by administration of stem cell-derived mitochondria (MT).
  • MT stem cell-derived mitochondria
  • 24 is a graph quantitatively showing the ratio of KI-67 + expressing proliferative cells among CD31 + expressing vascular cells in the endometrium to which stem cell-derived mitochondria (MT) was administered.
  • MT stem cell-derived mitochondria
  • 25 is a graph showing the mRNA expression of fibrosis factors (Col1a1, Col3a1, Timp1 and Tgf ⁇ 1) when dead MT and live MT were injected under the same conditions.
  • 26 is a graph showing mRNA expression of fibrosis factors (Col1a1, Col3a1, Timp1, and Tgf ⁇ 1) at the time of injection of stem cell-derived mitochondria (MT) by injection method and injection volume.
  • FIG. 27 is a schematic diagram of an experiment to confirm the effect of intravenous injection of stem cell-derived mitochondria (MT).
  • MT stem cell-derived mitochondria
  • MT stem cell-derived mitochondria
  • 29 is a graph showing real-time RT-PCR results for fibrosis-related factors after stem cell-derived mitochondria (MT) delivery.
  • MT stem cell-derived mitochondria
  • FIG 30 is an image showing changes in CD45 expression of immune cells by administration of stem cell-derived mitochondria (MT).
  • MT stem cell-derived mitochondria
  • FIG. 31 is an image showing the ratio of total macrophages expressing F4/80, the ratio of M1 macrophages expressing CD80, and the ratio of M2 macrophages expressing CD206 by the administration of stem cell-derived mitochondria (MT).
  • MT stem cell-derived mitochondria
  • 32 is a schematic view of an experiment to confirm the effect of macrophage depletion.
  • 33 is a graph showing the number of macrophages after depletion of macrophages expressing F4/80.
  • 34 is an image showing, through fluorescence staining, that there is no endometrial regeneration effect by MT in a macrophage-depleted environment.
  • 35 is a graph showing the absence of endometrial regeneration effect by MT in a macrophage-depleted environment through changes in mRNA expression.
  • FIG. 36 is a schematic diagram of an experiment for confirming M2 polarization of macrophages by treatment with stem cell-derived mitochondria (MT).
  • MT stem cell-derived mitochondria
  • FIG. 37 is an image showing M2 polarization of macrophages by treatment with stem cell-derived mitochondria (MT).
  • MT stem cell-derived mitochondria
  • MT 38 is a graph showing changes in expression of macrophage M1 markers iNOS and Socs3, and M2 markers Arg1 and Mrc1 by treatment with stem cell-derived mitochondria (MT).
  • MT stem cell-derived mitochondria
  • 39 is an immunocytochemistry image showing M2 polarization of macrophages by treatment with stem cell-derived mitochondria (MT).
  • MT stem cell-derived mitochondria
  • FIG 40 is a flow cytometry graph showing M2 polarization of macrophages by treatment with stem cell-derived mitochondria (MT).
  • MT stem cell-derived mitochondria
  • FIG. 41 is a schematic diagram of an experiment to confirm whether M2 macrophages polarized by administration of stem cell-derived mitochondria (MT) promote migration and formation of human umbilical vein endothelial cells (HUVEC).
  • MT stem cell-derived mitochondria
  • 43 is an image showing the degree of angiogenesis in each experimental group when polarized M2 macrophages and HUVECs were co-cultured.
  • 44 is a graph showing the degree of angiogenesis in each experimental group when polarized M2 macrophages and HUVECs were co-cultured.
  • 45 is a schematic diagram of the functional improvement of the damaged endometrium of stem cell-derived mitochondria.
  • 46 is a graph showing the protein content of hepatocyte-derived mitochondria.
  • 47 is a graph showing the protein content of peripheral blood mononuclear cell-derived mitochondria.
  • 48 is a graph showing the ATP synthesis ability of hepatocyte-derived mitochondria.
  • 49 is a graph showing the ATP synthesis ability of mitochondria derived from peripheral blood mononuclear cells.
  • One aspect of the present invention provides a pharmaceutical composition for preventing or treating Asherman syndrome or its complications, comprising isolated mitochondria as an active ingredient.
  • mitochondria is a double-membrane bound organelle found in most eukaryotic organisms and produces most of the intracellular adenosine triphosphate (ATP).
  • ATP adenosine triphosphate
  • isolated mitochondria refers to mitochondria obtained from an autologous, allogeneic or xenogeneic source.
  • autologous mitochondria refers to mitochondria obtained from plasma, tissue, bone marrow or cells of the same individual.
  • homologous mitochondria refers to mitochondria obtained from plasma, tissue, bone marrow, or cells of an individual belonging to the same species as the individual and having different genotypes for alleles.
  • heterologous mitochondria refers to mitochondria obtained from plasma, tissue, bone marrow or cells of an individual belonging to a species different from that of the individual.
  • the subject may be a mammal, preferably a human.
  • the mitochondria may be isolated from cells, bone marrow or plasma of an individual.
  • the mitochondria may be obtained from autologous or foreign cells cultured in vitro. At this time, the cells, bone marrow or plasma may have normal biological activity.
  • the term “cell” refers to a structural or functional unit constituting an organism, composed of a cytoplasm surrounded by a cell membrane, and containing biomolecules such as proteins and nucleic acids.
  • the cell refers to a cell containing mitochondria inside a cell membrane.
  • the mitochondria may be isolated and used after concentrating tissue, plasma, bone marrow, or cells, disrupted, or separated from frozen tissue, plasma, bone marrow, or cell samples after being disrupted and thawed.
  • the cells may be any one selected from the group consisting of stem cells, somatic cells, germ cells and platelets.
  • stem cell refers to undifferentiated cells having the ability to differentiate into various types of tissue cells.
  • the stem cells may be any one selected from the group consisting of mesenchymal stem cells, adult stem cells, dedifferentiated stem cells, embryonic stem cells, bone marrow stem cells, neural stem cells, limbal stem cells, and tissue-derived stem cells.
  • the mesenchymal stem cells may be any one selected from the group consisting of umbilical cord, cord blood, bone marrow, fat, muscle, nerve, skin, amnion, and placenta. Preferably, it may be derived from human umbilical cord.
  • somatic cell refers to cells other than reproductive cells among cells constituting an individual.
  • the somatic cells may be one selected from the group consisting of muscle cells, hepatocytes, fibroblasts, epithelial cells, nerve cells, adipocytes, bone cells, periosteal cells, leukocytes, lymphocytes and mucosal cells.
  • muscle cells or hepatocytes with excellent mitochondrial activity.
  • it may be obtained from autologous or foreign blood PBMC cells.
  • gamete cell refers to a cell that forms a zygote during reproduction in a sexually reproductive organism.
  • the mitochondria may be obtained from autologous or heterogeneous reproductive cells.
  • the reproductive cell may be a sperm or an egg.
  • platelet means a solid component that plays an important role in blood coagulation by binding fibrin in blood to form clots.
  • the mitochondria may be obtained from autologous or allogeneic platelets.
  • bone marrow refers to the semi-solid tissue found in the spongy portion of bone.
  • the bone marrow of a human produces about 500 billion blood cells per day.
  • bone marrow contains mitochondria with normal activity.
  • plasma is a liquid component of blood other than blood cells, and refers to the intravascular portion of extracellular fluid.
  • the plasma contains up to 95% water, 6-8% soluble proteins or electrolytes, and the like.
  • plasma contains mitochondria with normal activity.
  • the plasma can be obtained by separating from blood. Specifically, the blood containing the anticoagulant may be rotated in a centrifuge to separate the supernatant from the blood. In addition, plasma can be extracted from blood through filtration or coagulation. In addition, the plasma can be classified according to the blood from which it is derived. In one embodiment, the plasma may be plasma separated from umbilical cord blood or peripheral blood. Preferably, it may be isolated from umbilical cord blood.
  • the plasma or bone marrow may be obtained and stored from an individual. Specifically, the plasma or bone marrow may be frozen.
  • the isolated mitochondria may have normal biological activity.
  • the mitochondria with normal biological activity (i) have a membrane potential, (ii) produce ATP in mitochondria, and (iii) remove ROS or reduce the activity of ROS in mitochondria. It may have one or more characteristics from
  • direct or intrauterine administration of the composition containing the isolated mitochondria of the present invention as an active ingredient promotes intrauterine regeneration and reduces fibrosis index. Therefore, the composition containing isolated mitochondria of the present invention as an active ingredient can alleviate or treat intrauterine fibrosis or uterine adhesions, and thus has a preventive or therapeutic effect on complications of Asherman's syndrome.
  • IUAs intrauterine adhesions
  • the Asherman syndrome occurs mainly in patients with a history of surgery such as endometrial curettage, cervical conical biopsy, and electrocautery, patients with a history of pelvic inflammatory disease, and patients with infection due to intrauterine contraceptives, etc. damage to the endometrium, destruction of the endometrium, and adhesions of the uterine cavity.
  • Asherman's syndrome in the uterus is generally accompanied by complications, such as decreased menstruation, amenorrhea, uterine pain, infertility, subfertility, and the like.
  • Complications of Asherman syndrome refers to diseases that may accompany Asherman syndrome or collectively refers to diseases that may increase the risk of Asherman syndrome. Specifically, it includes diseases or conditions that accompany uterine adhesions or may increase the risk of uterine adhesions.
  • the Asherman syndrome complication is at least one selected from the group consisting of uterine adhesions, uterine fibroids, endometriosis, ectopic pregnancy miscarriage, ovarian cysts, menstrual disorders, infertility, infertility, pelvic adhesions, pelvic pain, and pelvic inflammatory disease. It may be, but is not limited thereto.
  • intrauterine adhesion is also referred to as intrauterine synechiae, and refers to a disease in which the endometrium is damaged or the endometrium of the uterus adheres to each other and becomes hard.
  • the term "leiomyoma of uterus” means a benign tumor that occurs in the muscle layer constituting the uterus. uterine fibroids can contribute to infertility or recurrent miscarriages.
  • endometriosis refers to a disease in which endometrial tissue is present outside the uterus and causes the disease.
  • the endometriosis is a disease in which ectopic endometrial cells located outside the uterus cause bleeding or inflammatory reactions according to the menstrual cycle, resulting in fibrosis or adhesions.
  • ectopic pregnancy means that a fertilized egg is implanted in a site other than the uterine cavity.
  • the ectopic pregnancy is a tubal pregnancy in which more than 95% is implanted in the ampulla, and is caused by a narrowing of the fallopian tube due to some factor or an increase in the capacity of the fallopian tube mucosa for a fertilized egg.
  • menstrual disorder is also referred to as menstrual disorder, and means accompanied by abnormal uterine bleeding, amenorrhea, dysmenorrhea, early menopause (primary ovarian insufficiency) or premenstrual syndrome during the childbearing period.
  • ovarian cystic tumor means that a cyst is formed in an ovary. These cysts are filled with a fluid component and are classified into functional cysts and benign ovarian tumors. The ovarian cyst may cause uterine adhesion, infertility, or infertility.
  • infertility refers to not being able to become pregnant for one year or more even if you have a normal sexual life without contraception, or a woman over the age of 35 who has a normal sexual life without using contraception. If you do, it means that you are not pregnant by 6 months.
  • pelvic adhesions is also referred to as pelvic organ adhesions, and refers to a state in which different tissues or organs are attached to each other in the pelvis by being connected by fibrous tissue.
  • the organ may be a uterus, ovary, fallopian tube, or peritoneum.
  • pelvic inflammatory disorder PID
  • pelvic inflammatory disease refers to an infection in the upper part of the female reproductive system, such as the uterus, fallopian tubes, ovaries, or inside the pelvis.
  • chronic pelvic pain means that pain occurs due to inflammation in the pelvis.
  • treatment may be used to include both therapeutic treatment and prophylactic treatment. At this time, prevention may be used in the sense of alleviating or reducing the pathological condition or disease of the subject.
  • active ingredient refers to a component that exhibits activity alone or together with an adjuvant (carrier) that is inactive by itself.
  • Mitochondria isolated as the active ingredient may prevent excessive uterine fibrosis or reduce uterine fibrosis. Specifically, the mitochondria may reduce the expression of fibrosis factors in the uterus.
  • fibrosis refers to a phenomenon in which extracellular matrix components such as collagen are excessively accumulated by fibroblasts during repetitive injury, chronic inflammation, or recovery thereof. Fibrosis may be progressed by the release of fibrotic factors by macrophages.
  • fibrosis factor refers to proteins that stimulate fibroblasts.
  • the fibrosis factor may be one or more selected from the group consisting of COL1A1, COL3A1, TIMP1 and TGF ⁇ 1.
  • the COL1A1 refers to type I collagen present in most connective tissues. Type I collagen may be that which in humans is encoded by the COL1A1 gene.
  • the COL3A1 refers to type III collagen synthesized as pre-procollagen by cells.
  • the type III collagen may be encoded by the COL3A1 gene in humans.
  • the TIMP1 is a glycoprotein that can promote cell proliferation in a wide range of cell types and has an anti-apoptotic function, and is also named TIMP metallopeptidase inhibitor 1.
  • the TIMP1 may be encoded by the TIMP1 gene in humans.
  • the TGF ⁇ 1 is a member of the transforming growth factor beta superfamily of cytokines.
  • the TGF ⁇ 1 performs many cellular functions including control of cell growth, cell proliferation, cell differentiation and cell death.
  • the TGF ⁇ 1 may be encoded by the TGFB1 gene in humans.
  • the isolated mitochondria may reduce the expression of at least one protein selected from the group consisting of COL1A1, COL3A1, TIMP1 and TGF ⁇ 1 or a gene encoding the same in the uterus.
  • the mitochondria may increase vascular endothelial cells.
  • the mitochondria may increase the ratio of vascular cells proliferating in blood vessels in the uterus. Specifically, it may be to increase the ratio of KI-67-expressing cells among CD31-expressing vascular cells in intrauterine blood vessels.
  • vascular endothelial cell marker may be one or more selected from the group consisting of HGF, IGF1, ANG1, VEGF-A, HIF1 ⁇ and HIF2 ⁇ .
  • the HGF is a hepatocyte growth factor, and refers to a cytokine that induces angiogenesis, tumorigenesis, and tissue regeneration by increasing mitosis, cell motility, and matrix invasion.
  • the HGF may be oxidized by the HGF gene in humans.
  • IGF1 is insulin-like growth factor 1, which is also called somatomedin C, and refers to a protein with high sequence similarity to insulin.
  • the IGF1 may be encoded by the IGF1 gene in humans.
  • ANG1 is angiopoietin 1, which means a protein that plays an important role in blood vessel development and angiogenesis.
  • the ANG1 may be encoded by the ANGPT1 gene in humans.
  • the VEGF-A is vascular endothelial growth factor A (vascular endothelial growth factor A).
  • the VEGF-A specifically acts on endothelial cells to mediate increased vascular permeability, induces angiogenesis, angiogenesis and endothelial cell growth, promotes cell migration, and inhibits apoptosis.
  • the VEGF-A may be encoded by the VEGFA gene in humans.
  • HIF1 ⁇ is hypoxia-inducible factor 1-alpha, and is a protein that induces transcription of genes encoding VEGF and erythropoietin, which have functions such as angiogenesis and red blood cell production.
  • the HIF1 ⁇ promotes and increases oxygen transport.
  • the HIF1 ⁇ may be encoded by the HIF1A gene in humans.
  • HIF2 ⁇ is hypoxia-inducible factor-2alpha, a protein that improves oxygen transport, and is also referred to as EPAS1 (Endothelial PAS domain-containing protein 1).
  • the HIF2 ⁇ may be encoded by the EPAS1 gene in humans.
  • the isolated mitochondria may increase the expression of one or more proteins selected from the group consisting of HGF, IG1F, ANG1, VEGF-A, HIF1 ⁇ and HIF2 ⁇ or genes encoding them.
  • the mitochondria may reduce inflammation in the uterus. Specifically, it may decrease gene expression of inflammatory factors iNOS, SOCS3, or a combination thereof, or increase gene expression of anti-inflammatory factors ARG1, MRC1, or a combination thereof.
  • the iNOS refers to an inducible isomer involved in an immune response of nitric oxide synthases.
  • the iNOS is an inflammatory factor that generates NO by inflammatory cytokines (eg, interleukin-1, tumor necrosis factor alpha, and interferon gamma).
  • inflammatory cytokines eg, interleukin-1, tumor necrosis factor alpha, and interferon gamma
  • the SOCS3 is an inflammatory factor induced by various cytokines including IL-6, IL-10, and interferon (IFN)-gamma in humans.
  • ARG1 is a gene encoding an arginase protein, and arginase catalyzes the hydrolysis of arginine into ornithine and urea.
  • the MRC1 is macrophage mannose receptor 1, and is also referred to as CD206.
  • the CD206 is present on the surface of macrophages, and the degree of expression may vary depending on the polarization of macrophages.
  • the mitochondria may promote the polarization of macrophages in the uterus.
  • macrophage refers to an immune cell that defends a host from infection through phagocytosis. Macrophages are classified according to their basic functions and activation, and are classified into activated macrophages (M1 macrophages), wound healing macrophages (M2 macrophages), and regulatory macrophages.
  • M1 macrophages activated macrophages
  • M2 macrophages wound healing macrophages
  • regulatory macrophages regulatory macrophages
  • the M1 macrophages are activated by LPS and IFN-gamma and secrete higher levels of IL-12 and lower levels of IL-10 compared to M2 macrophages.
  • M1 macrophages promote inflammation and have bactericidal and phagocytic functions.
  • M1 macrophages may have high CD80 expression and low CD206 expression compared to M2 macrophages.
  • M2 macrophages secrete a higher level of IL-10 and a lower level of IL-12 compared to M1 macrophages.
  • M2 macrophages produce anti-inflammatory cytokines to heal wounds and repair tissue.
  • M2 macrophages may have low CD80 expression and high CD206 expression compared to M1 macrophages.
  • the macrophages may be polarized from M1 macrophages to M2 macrophages by IL-4 cytokine.
  • the mitochondria may polarize intrauterine macrophages from M1 macrophages to M2 macrophages.
  • CD80 expression of intrauterine macrophages may be decreased, and CD206 expression may be increased.
  • the mitochondria may induce regeneration of the uterus.
  • the mitochondria may induce regeneration of the damaged endometrium by suppressing excessive fibrosis in the uterus, promoting the formation and movement of blood vessels, suppressing inflammation and promoting polarization of macrophages.
  • the mitochondria may promote the formation of an umbilical cord. Specifically, it may promote movement of blood vessels in the umbilical cord of an implanted fetus or promote blood vessel formation.
  • the mitochondria When the mitochondria are separated from a specific cell, they can be separated through various known methods, such as using a specific buffer solution or using a potential difference and a magnetic field.
  • the mitochondrial separation may include centrifuging and filtering plasma to remove all cellular components, and centrifuging the filtered plasma.
  • the mitochondrial separation can be obtained by disrupting and centrifuging cells in terms of maintaining mitochondrial activity. At this time, centrifugation may be performed in the first to third order.
  • the step of culturing the cells and first centrifuging the pharmaceutical composition containing these cells to produce a pellet, resuspending the pellet in a buffer solution and homogenizing, the homogenized solution It may be performed by preparing a supernatant by second centrifugation and purifying mitochondria by third centrifugation of the supernatant. At this time, it is preferable to adjust the time for the second centrifugation to be shorter than the time for the first and third centrifugation in terms of maintaining cell activity, and in the first centrifugation to the third centrifugation You can speed up as you go.
  • the mitochondria When the mitochondria are separated from plasma, they can be separated through various known methods, such as using a specific buffer solution, ultrasound, concentration gradient, and magnetic field, for example.
  • Separating the mitochondria may include removing cells or organelles from plasma; Purifying the mitochondria.
  • the mitochondrial separation may include physically separating the endoplasmic reticulum, mitochondria-associated membrane fragments, and mitochondria.
  • the separation may be by centrifugation. Specifically, the separation step of removing cells in the plasma by first centrifuging the plasma at low speed; filtering the plasma to remove cell debris; It may be performed through the step of second centrifuging the supernatant of the plasma.
  • the separation may be by discontinuous concentration gradient and centrifugation.
  • the discontinuous concentration gradient may use a sucrose or Percoll concentration gradient.
  • the first to third centrifugation may be performed at a temperature of 0 to 10 °C, preferably at a temperature of 3 to 5 °C.
  • the time for performing the centrifugation may be 1 to 50 minutes, and may be appropriately adjusted according to the number of centrifugation and the content of the sample.
  • the first centrifugation may be performed at a speed of 100 to 1,000xg, or 200 to 700xg, or 300 to 450xg.
  • the second centrifugation or the third centrifugation may be performed at a speed of 1 to 2,000xg, 25 to 1,800xg, or 500 to 1,600xg, 100 to 20,000xg, 500 to 18,000xg, or 800 to 15,000xg. can
  • Mitochondria can be quantified by quantifying membrane proteins of the isolated mitochondria.
  • the isolated mitochondria can be quantified through a BCA (bicinchoninic acid assay) analysis method.
  • the mitochondria in the pharmaceutical composition is 0.1 ⁇ g / ml to 1,000 ⁇ g / ml, 1 ⁇ g / ml to 750 ⁇ g / ml, 25 ⁇ g / ml to 500 ⁇ g / ml, 25 ⁇ g / ml to 150 ⁇ g / ml or 25 ⁇ g /ml to 100 ⁇ g/ml.
  • a concentration of 25 ⁇ g/ml or 50 ⁇ g/ml was used.
  • the mitochondria may have an intact form, a disrupted form, or a combination thereof. In one embodiment, even when the mitochondria are in a disrupted form, pharmacological effects may be exhibited when they have mitochondrial activity.
  • the number of separated mitochondria can be measured through a particle counter (Multisizer 4e, Beckman Coulter).
  • the mitochondria in the pharmaceutical composition may be included in an amount of 1 ⁇ 10 5 mitochondria/ml to 9 ⁇ 10 9 mitochondria/ml.
  • the mitochondria in the pharmaceutical composition is 1 ⁇ 10 5 /mL to 5 ⁇ 10 9 /mL, 2 ⁇ 10 5 /mL to 2 ⁇ 10 9 /mL, 5 ⁇ 10 5 /mL to 1 ⁇ 10 9 /mL , 1 ⁇ 10 6 /ml to 5 ⁇ 10 8 /ml, 2 ⁇ 10 6 /ml to 2 ⁇ 10 8 /ml, 5 ⁇ 10 6 /ml to 1 ⁇ 10 8 /ml or 1 ⁇ 10 7 /ml to It may be included in an amount of 5 ⁇ 10 7 /ml.
  • the pharmaceutical composition may be a preparation for direct administration into the uterus of a subject, an injection for intravenous, intramuscular or subcutaneous administration, preferably a preparation for direct administration into the uterus or an injection for subcutaneous administration.
  • the pharmaceutical composition may further include a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier may be any carrier as long as it is a non-toxic material suitable for delivery to a patient. Distilled water, alcohol, fats, waxes and inert solids may be included as carriers. A pharmacologically acceptable adjuvant (buffer, dispersant) may also be included in the pharmaceutical composition.
  • Another aspect of the present invention provides a method for treating and/or preventing Asherman syndrome or its complications, comprising administering mitochondria to a subject.
  • the administration may be a formulation for direct intrauterine administration or an injection that can be administered intravenously, intramuscularly or subcutaneously, preferably a formulation for direct intrauterine administration or intravenous injection.
  • the pharmaceutical composition according to the present invention can be manufactured as a physically or chemically very stable injection by adjusting the pH using a buffer solution such as an aqueous acid solution or a phosphate that can be used as an injection in order to secure product stability according to distribution of the injection prescription.
  • a buffer solution such as an aqueous acid solution or a phosphate that can be used as an injection in order to secure product stability according to distribution of the injection prescription.
  • the injection may further include a preservative, pain reliever, solubilizer or stabilizer.
  • the pharmaceutical composition of the present invention may include water for injection.
  • the water for injection is distilled water made for dissolving solid injections or diluting water-soluble injections, glucose injection, xylitol injection, D-mannitol injection, fructose injection, physiological saline, dextran 40 injection, dextran 70 injection, amino acid injection, It may be Ringer's solution, lactic acid-Ringer's solution, or a phosphate buffer solution or sodium dihydrogenphosphate-citrate buffer solution in the range of pH 3.5 to 7.5.
  • the preferred dosage of the pharmaceutical composition may vary depending on the patient's condition, weight, sex, age, severity of the patient, and route of administration, and administration may be performed once a day or divided into several times. Specifically, the pharmaceutical composition may be administered 1 to 10 times, 3 to 8 times, or 5 to 6 times.
  • the pharmaceutical composition may be administered to a subject suffering from Asherman syndrome or its complications, confirmed or confirmed, or Asherman syndrome or its complications.
  • the "subject" may be an individual having Asherman syndrome and/or Asherman syndrome complications, the symptoms of which may be improved by administration of the therapeutic composition according to the present invention, and the subject may have a uterus. It may be a mammal. In one embodiment, the subject includes animals such as horses, sheep, pigs, goats, camels, antelopes, dogs, or humans.
  • the pharmaceutical composition may additionally include a known preventive or therapeutic agent for Asherman's syndrome, an agent for preventing or treating infertility, or an agent for preventing or treating infertility.
  • administration of the pharmaceutical composition may be additionally combined with Asherman syndrome treatment, infertility treatment, or infertility treatment.
  • Treatment of Asherman's syndrome may include resection through hysteroscopy, intrauterine catheter installation, estrogen or progesterone treatment, and the like.
  • Another aspect of the present invention provides use of mitochondria to treat Asherman syndrome or complications thereof.
  • Another aspect of the present invention provides the use of mitochondria for preparing a medicament for the treatment or prevention of Asherman's syndrome or its complications.
  • Example 1 Obtaining umbilical cord-derived mesenchymal stem cell mitochondria
  • Umbilical cord-derived mesenchymal stem cells (IRB number: No.201411-BR-022-02 or No.201806-BR-029-03) were obtained from Wharton's jelly of the umbilical cord and used in the experiment.
  • Minimum Essential Medium Alpha containing 10% fetal bovine serum (FBS; Gibco, Waltham, USA) and 1% penicillin/streptomycin antibiotics (P/S, Hyclone, Logan, USA) using isolated umbilical cord-derived mesenchymal stem cells It was cultured using Modification (MEM Alpha Modification, Hyclone) medium and T-175 culture flask. While maintaining the cells at 37° C., 5% CO 2 conditions, the next subculture was performed when the cell density reached about 80% to 90%.
  • FBS fetal bovine serum
  • P/S penicillin/streptomycin antibiotics
  • Example 1.2 Isolation of umbilical cord-derived mesenchymal stem cell mitochondria
  • Mitochondria were isolated using the umbilical cord-derived mesenchymal stem cells cultured in Example 1.1. Based on 2 x 10 7 cells, SHE buffer [0.25 M Sucrose, 20 mM HEPES (pH 7.4), 2 mM EGTA, 10 mM KCl, 1.5 mM MgCl 2 , 0.1% defatted bovine serum albumin (BSA), pH 7.4] 400 After adding ⁇ l to suspend the cells, they were incubated at 4° C. for 5 minutes. The cell membrane was disrupted using a 1 ml syringe (Koreavaccine, Seoul, South Korea).
  • Example 2 Obtaining human peripheral blood mononuclear cells and plasma-derived mitochondria Obtaining mitochondria
  • Example 2.1 Isolation and culture of human peripheral blood mononuclear cells
  • the donor's blood was transported in a heparin tube and used for the experiment. 15 ml to 25 ml of Ficoll-Paque tm PLUS (GE Healthcare, Chicago, USA) was put in a Leucosep tube (Greiner bio-one, Kremsmunster, Austria) and centrifuged at 1,500 rpm for 1 minute. Thereafter, on top of the added Ficoll-Paque solution, the donor's blood was added in a volume of 1 to 2 times without mixing with Ficoll-Paque to form two density gradient layers.
  • Ficoll-Paque tm PLUS GE Healthcare, Chicago, USA
  • PBMC peripheral blood mononuclear cells
  • Ficoll-paque + granulocyte Ficoll-paque + granulocyte
  • RBC red blood cells
  • the collected peripheral blood mononuclear cells were centrifuged at 1,200 xg for 10 minutes, and after removing the supernatant, 5 ml of RBC lysis buffer (Biolegend, San Diego, USA) was added and allowed to stand at 37°C and 5% CO 2 for 5 minutes. After adding 45 ml of DPBS, centrifugation was performed at 1,200 xg for 10 minutes. After removing the supernatant, 20 ml of DPBS was added and centrifuged at 1,200 xg for 10 minutes. Finally, after removing the supernatant, blood mononuclear cells obtained as pellets were obtained. After adding DPBS to the cells, the cells were suspended and the number of cells was measured.
  • RBC lysis buffer Biolegend, San Diego, USA
  • Peripheral blood mononuclear cells isolated from human blood were cultured using RPMI-1640 (Hyclone, Logan, USA) medium containing 10% FBS and 1% P/S (Penicillin/Streptomycin) and T-175 Culture Flask. . The cells were maintained at 37° C., 5% CO 2 conditions, and the next subculture was performed when the cell density reached about 80 to 90%.
  • Example 2.2 Isolation of human peripheral blood mononuclear cell mitochondria
  • Mitochondria were obtained from human peripheral blood mononuclear cells in the same manner as in Example 1.2, except that mitochondria were used using human peripheral blood mononuclear cells cultured in Example 2.1.
  • Example 2.1 The plasma obtained in Example 2.1 was centrifuged at 25,000 xg and 4° C. for 20 minutes to precipitate cell-derived substances present in the plasma, and then the supernatant was removed. Then, mitochondria were obtained in the same manner using the SHE buffer used in Example 1.2.
  • Example 3 Obtaining human-derived hepatocyte mitochondria
  • WRL 68 human-derived hepatocyte cell line, WRL 68 (CL-48), was purchased from ATCC and used in the experiment. WRL 68 was cultured using Dulbecco's Modified Eagle's Medium high glucose (DMEM; Hyclone) medium containing 10% FBS and 1% P/S in a T-175 culture flask. The cells were maintained at 37° C. and 5% CO 2 conditions, and the next subculture was performed when the cell density reached about 80 to 90%.
  • DMEM Dulbecco's Modified Eagle's Medium high glucose
  • Example 3.2 Isolation of human-derived hepatocyte mitochondria
  • Mitochondria were obtained from human-derived hepatocytes in the same manner as in Example 1.2, except that mitochondria were used using human-derived hepatocytes cultured in Example 3.1.
  • Example 4.1 Protein measurement of isolated mitochondria and mitochondrial size measurement
  • Bicinchoninic acid assay (BCA assay; Pierce, Rockford, USA) was used. The concentration was measured according to the kit protocol using a 10 ⁇ l sample from mitochondria suspended in 200 ⁇ l of DPBS. The mitochondrial content obtained from 2 x 10 7 cells was calculated as protein concentration through a BSA standard curve.
  • the mitochondria were stained with a mitochondrial membrane potential (MMP)-dependent MitoTracker CMXRos Red probe, followed by fluorescence microscopy and flow cytometry analysis. .
  • MMP mitochondrial membrane potential
  • CMXRos Red mitochondria-specific marker
  • MMP mitochondrial membrane potential
  • Example 1 The purity of the umbilical cord-derived mesenchymal stem cell mitochondria isolated in Example 1 was confirmed.
  • mitochondria-specific markers [cytochrome C oxidase (COX IV), cytochrome C, Translocase of outer mitochondrial membrane 20 (TOMM20) and Apoptosis inducing factor (AIF)] and other organelle markers.
  • COX IV cytochrome C oxidase
  • TOMM20 Translocase of outer mitochondrial membrane 20
  • AIF Apoptosis inducing factor
  • the isolated mitochondria were heat-treated at 100° C. for 3 minutes using SDS-PAGE loading buffer (LPS solution, Daejeon, South Korea). After separating proteins by size using a 12% SDS-PAGE gel, they were transferred to a PVDF membrane at 0.35 mA for 120 minutes. The PVDF membrane on which the protein migrated was blocked with TBS-T [Water, 150 mM NaCl, 10 mM Tris-HCl, 0.1% (v/v) Tween-20, pH 7.6] containing 3% BSA at room temperature for 90 minutes. .
  • KDEL Invitrogen, PA1-013
  • PCNA Purified Biotechnology, sc-56
  • Cytochrome c Santa Cruz Biotechnology, sc-13156
  • COX IV Abcam , ab33985
  • TOMM20 Sura Cruz Biotechnology, sc-17764
  • AIF Antibody Synthesis, sc-13116
  • mitochondrial proteins As a result, as shown in FIG. 5, the presence of mitochondrial proteins was confirmed in all mitochondrial-specific markers (COX IV, cytochrome C, TOMM20, AIF) in the mitochondrial fraction, but other organelle markers, KDEL and PCNA, did not exist. confirmed that In this case, in FIG. 5, M indicates a fraction containing mitochondria, and C indicates a cell fraction not containing mitochondria.
  • Example 1 The activity of the mitochondria of the umbilical cord-derived mesenchymal stem cells isolated in Example 1 was confirmed. Specifically, mitochondrial ATP content, ROS generation, membrane potential, and ATP synthesis ability were confirmed.
  • the isolated mitochondria were performed using the CellTiter-Glo luminescence assay kit (Promega, Madison, WI). Dispense 10 ⁇ g of DPBS (MT (-)) and mitochondria suspended in 100 ⁇ l of DPBS (MT (+)) into a white 96-well plate, respectively, and use the sample to add 100 ⁇ l of CellTiter-Glo reagent according to the kit protocol. After mixing on a shaker for 2 minutes, it was reacted after blocking light for 10 minutes. Luminescence values were measured using a Luminescence microplate reader (Epoch Spectrometer, BioTek Inc.).
  • mitochondrial ROS mitochondrial ROS
  • MitoSOX Red Invitrogen, Carlsbad, CA
  • the MT(+) group containing isolated mitochondria and the MT(-) group containing the same volume of PBS were dispensed into 96-well black plates, treated with 1 ⁇ M MitoSOX Red, and incubated at 37°C and 5% CO 2 for 30 days. reacted for a minute. Fluorescence intensity was measured at an absorption wavelength of 510 nm/emission wavelength of 528 nm using a fluorescence microplate reader (BioTek Inc.).
  • JC-1 Invitrogen
  • MT(+) group containing isolated mitochondria MT(-) group consisting of only the same volume of PBS, and MT(+) + CCCP treated with CCCP (carbonyl cyanide m-chlorophenyl hydrazone, Sigma Aldrich) to isolated mitochondria
  • CCCP carbonyl cyanide m-chlorophenyl hydrazone
  • JC-1 accumulated in mitochondria in a membrane potential (MMP)-dependent manner and changed the fluorescence value in the green emission wavelength band (absorption 485 nm/emission 516 nm) to red (absorption 579 nm/emission 599 nm). MMP was determined as a ratio of fluorescence values, which were measured with a fluorescence microplate reader.
  • damaged mitochondria damaged MTs or dead MTs
  • CCCP positive control group as mitochondrial oxidative phosphorylation uncoupler
  • Mitochondria prepared as described above were suspended in 100 ⁇ l of DPBS, respectively, and 10 ⁇ g of mitochondria was prepared in a White 96-well plate, 5 mM ADP was added, and reacted in a 37° C. incubator. After 45 minutes, 100 ⁇ l of CellTiter-Glo reagent was added and mixed on a shaker for 2 minutes, followed by blocking the light for 10 minutes and reacting.
  • Luminescence values were measured using a Luminescence microplate reader.
  • Example 5 Analyzing the effects of uterine regeneration and fibrosis reduction by isolated mitochondria
  • mice were managed under temperature and light control conditions for 12 hours every day at the Laboratory Animal Center of Cha University. After administering an anesthetic (Avertin) to the mouse by intraperitoneal injection, the mouse ex/endothelium was vertically incised and the uterus was exposed. Next, after a small incision was made in the uterus located at the fallopian tube junction in the mouse, a 26 gauge needle was inserted into the uterus, rotated to induce trauma, and recovered to obtain an Asherman syndrome mouse model.
  • an anesthetic Avertin
  • Table 1 below shows the primer sequences used in the experiment.
  • Example 6.1 Analysis of implantation rate, fertility rate and number of offspring by administration of isolated mitochondria
  • mice were sacrificed using CO 2 in the morning of the 12th day of pregnancy, and the uterus was completely exposed by vertically incising the outer/endothelium from the abdominal side. Next, the number of embryos implanted in the exposed uterus was identified and plotted.
  • the AS group had a relatively long time to conceive, similar to the irregular reproductive cycle observed in actual Asherman syndrome patients, but the MT group was a normal group (Sham). It was confirmed that the time was shortened to a similar extent to In addition, as shown in FIGS. 18 and 19, the MT group also improved the fertility rate and number of live births to a similar extent to the MSC group.
  • Example 7 Analysis of early embryo implantation rate by administration of isolated mitochondria
  • Example 6.1 The number of embryos implanted in the early stage of pregnancy of the Asherman mouse model treated in the same manner as in Example 6.1 was confirmed. Specifically, Chicago blue solution was intravenously injected into the mouse model on the 5th day of pregnancy, corresponding to the early stage of pregnancy, to increase the permeability of blood vessels around embryo implantation, thereby confirming the stained implantation site.
  • Example 8.1 Immunofluorescence staining analysis of vascular endothelial cell markers
  • immunofluorescence staining was performed by administering the mesenchymal stem cell-derived mitochondria of Example 1 to the uterus of the mouse model of Experimental Example 5.1. Specifically, in the uterus of the mouse model, blood vessels were stained using the vascular endothelial cell marker CD31, and proliferating cells were stained using the cell proliferation marker KI-67.
  • the method of obtaining a sample required for staining is as follows.
  • the mitochondria-injected uterus was excised, fixed in a fixative, and infiltrated to prepare a paraffin block. After attaching 5 ⁇ m thin sections to the slides using a paraffin block cutter, staining was performed. The stained sections were observed and photographed using a fluorescence microscope, and a number of people counted the total number of cells and cells stained with each antibody using the same photograph, and graphed them.
  • Table 2 below shows the primer sequences used in the experiment.
  • the mRNA expression of Hgf, Igf1, Ang1, Vegfa, Hif1 ⁇ , and Hif2 ⁇ known as vascular endothelial cell markers, was significantly increased in the MT group compared to the AS group, and the degree of increase was similar to the MSC group.
  • the fibrotic state was not reduced at all when dead MT was injected, but the fibrotic state was reduced when live MT was injected.
  • the injection volume was determined by quantifying the mitochondrial protein content as in Example 4.1.
  • Example 9 Analysis of fibrosis index change by administration method and concentration of isolated mitochondria
  • the stem cell-derived mitochondria were injected into the mouse model of Example 5.1 by intravenous administration.
  • mice changes in immune cells in mice by intravenous administration of isolated mitochondria were confirmed. Specifically, the blood of the mouse and the immune cells in the uterus were separated, and the difference in the quantitative change of the immune cells was observed through flow cytometry.
  • FIGS. 30 and 31 various changes were observed in the blood and immune cells of the uterus of AS mice to which mitochondria were administered.
  • FIG. 30 infiltration of all immune cells expressing CD45 was significantly observed in the uterus.
  • FIG. 31 the expression of the macrophage marker F4/80 increased in mice administered with mitochondria, the expression of the inflammatory marker CD80 decreased similarly to the group administered with MSC, and the anti-inflammatory marker CD206 It was confirmed that the expression of was increased similarly to the group administered with MSC.
  • an M1 polarization environment which is an inflammatory environment
  • an M2 polarization environment in which the inflammatory environment was relieved was created by treating isolated mitochondria with 10 ⁇ g (quantification based on mitochondrial protein).
  • FIG. 37 it was confirmed that the treated mitochondria (red) were located within macrophages (green) within 4 to 6 hours. Mitochondria were used to locate the mitochondria by staining them in different colors using Mito tracker.
  • FIG. 38 it was confirmed at the mRNA level that the expression of inflammatory factors (iNOS, Socs3) decreased in the MT-treated group, and the expression of anti-inflammatory factors (Arg1, Mrc1) increased in the MT-treated group. .
  • the inflammatory marker CD80 decreased and the anti-inflammatory marker CD206 increased, similar to the group in which the M2 polarity of macrophages was induced by IL-4 treatment.
  • IL-4 was treated with cells for 12 hours at a concentration of 10 ng/ml.
  • Cells treated with the material were fixed using a fixative, and blocked with 4% BSA at room temperature for 1 hour.
  • CD80 and CD206 were each diluted 1:200 in 4% BSA and reacted on the cells. 4 °C refrigerated storage was carried out for one day, each secondary antibody was diluted 1:1000 in 4% BSA and reacted at room temperature for 1 hour, after which mounting was performed and the image of FIG. 39 was obtained using a fluorescence microscope. Finally, the same results were confirmed through FACS experiments.
  • the fluorescently attached antibody is diluted 1:200 in FACS buffer (DPBS + 0.2% BSA) and reacted with the cells. After 30 minutes, the number of cells reacting to the antibody was analyzed as shown in FIG. 40 through a FACS machine after washing twice using FACS buffer.
  • Example 10 Using the method of Example 10, it was confirmed whether the mitochondria isolated in Example 1 affect the migration and tube formation of human umbilical vein endothelial cells (HUVEC).
  • HAVEC human umbilical vein endothelial cells
  • FIG. 41 migration of HUVEC cells and tube formation were observed by co-cultivating macrophages whose polarity was induced by MT treatment with HUVEC cells. At this time, co-culture was performed after space was created at regular intervals to observe the migration of HUVEC cells. At this time, the control group was treated with IL-4 to induce the M2 polarity of macrophages.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Cell Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Hematology (AREA)
  • Epidemiology (AREA)
  • Zoology (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Reproductive Health (AREA)
  • Endocrinology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gynecology & Obstetrics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pregnancy & Childbirth (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

미토콘드리아를 유효성분으로 포함하는 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 약학 조성물을 제공한다. 상기 약학 조성물은 자궁 내막의 유착을 완화 또는 치료할 뿐 아니라, 자궁 내막의 섬유화를 완화 또는 치료할 수 있다. 따라서, 상기 약학 조성물은 자궁 내막 유착 질환, 구체적으로 아셔만 증후군과 같은 질환의 치료 및 예방에 효과적으로 활용할 수 있어 산업적 활용 가능성이 높다.

Description

분리된 미토콘드리아를 유효성분으로 포함하는 아셔만 증후군 예방 또는 치료용 약학 조성물
본 발명은 분리된 미토콘드리아를 유효성분으로 포함하는 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 약학 조성물에 관한 것이다.
아셔만 증후군은 자궁내강유착증(Intrauterine adhesions, IUAs)으로도 알려져 있으며, 자궁내막기저층의 박탈 및 결손이 생기고 자궁강의 부분적 또는 광범한 유착이 발생된 것이다. 아셔만 증후군은 불임증, 습관성 유산이나 조산, 무월경, 과소월경 또는 월경곤란증 등이 증상으로 나타난다. 아셔만 증후군의 공지된 치료방법으로는 경질 또는 개복에 의한 유착박리, 자궁내피임기구(IUD)의 삽입 또는 호르몬제 투여 등이 있으나, 수술 후 상당수 자궁 내 재유착이 발생하게 되어 여러 번의 수술을 필요로 하고, 중증의 경우 반복되는 수술로 인해 불임이 될 수 있는 등의 문제점이 있었다.
이외에도 아셔만 증후군의 공지된 치료방법으로 통증완화를 위해 진통제 및 소염제를 사용하는 보존적 요법, 또는 다나졸(danazol), 프로게스테론(progesterone), 성선자극호르몬분비호르몬(Gonadotropin-releasing hormone, GnRH)을 사용하여 생리주기를 제어하는 호르몬치료 요법이 있으나 이들은 근본적 치료법이 아닌 증상을 개선시키는 한계가 있고, 호르몬의 장기적 사용은 여러 가지 부작용(체중의 증가, 수분 축적, 피로, 여드름, 지성 피부, 조모증, 위축성 질염, 안면 홍조, 근육 경련, 불안정한 감정 상태, 간세포 독성)을 야기하고, 재발률이 매우 높다(중국특허출원 공개번호 제107073040호).
이러한 자궁유착은 극심한 통증으로 인해 일상 생활에 불편함을 발생시키며, 심한 경우 불임에까지 이르는 질병임에도 불구하고 아직까지 근본적인 예방 및 치료방법이 존재하지 않으며, 관련 연구도 부족한 실정이다.
한편, 미토콘드리아는 에너지 공급원으로서 아데노신 트라이포스페이트(adenosine triphosphate, ATP) 합성 및 조절에 관여하는 진핵 세포의 생존에 필수적인 세포 소기관이다. 미토콘드리아는 생체 내 다양한 대사 경로, 예를 들어, 세포 신호처리, 세포 분화, 세포 사멸뿐만 아니라 세포 주기 및 세포 성장의 제어와 연관이 있는 중요한 세포 소기관이다. 이러한 미토콘드리아를 유효성분으로 하는 약학 조성물의 경우 자궁 유착의 치료와 연관성이 있을 수 있음은 연구된 바가 없었다.
이에, 본 발명자들은 아셔만 증후군 또는 이의 합병증의 치료를 위해 분리된 미토콘드리아를 유효성분으로 포함하는 아셔만 증후군 또는 이의 합병증의 치료용 조성물을 개발함으로써 아셔만 증후군 또는 이의 합병증을 근본적으로 치료할 수 있는 방법을 개발하여 위와 같은 문제점을 해결하였다.
본 발명의 일 측면은, 분리된 미토콘드리아를 유효성분으로 포함하는 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 약학 조성물을 제공한다.
본 발명의 다른 측면은, 어느 한 항의 약학 조성물을 개체에 투여하는 단계를 포함하는 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 치료 방법을 제공한다.
본 발명의 다른 측면은, 아셔만 증후군 또는 이의 합병증의 예방 또는 치료를 위한 분리된 미토콘드리아의 용도를 제공한다.
미토콘드리아를 유효성분으로 포함하는 약학 조성물은 자궁 내막의 혈관 세포의 증식을 유도하고, 염증을 억제할 수 있다. 따라서, 자궁 섬유화에 의해 유도되는 자궁 질환을 효과적으로 치료 또는 예방할 수 있다. 따라서, 상기 약학 조성물은 효율적으로 아셔만 증후군 또는 아셔만 증후군으로 유발되는 불임, 난임 및 조산을 모두 효과적으로 치료하는 데 유용하게 사용될 수 있다.
도 1은 줄기세포 유래 미토콘드리아의 단백질의 양을 나타낸 그래프이다.
도 2는 줄기세포 유래 미토콘드리아의 크기 분포를 나타낸 그래프이다.
도 3은 줄기세포 유래 미토콘드리아를 형광 현미경으로 관찰한 이미지이다.
도 4는 유세포분석(Flow cytometry)을 통해 줄기세포 유래 미토콘드리아를 확인한 그래프이다.
도 5는 미토콘드리아 마커를 이용하여 미토콘드리아의 순도를 나타낸 이미지이다.
도 6은 줄기세포 유래 미토콘드리아의 ATP 합성능을 확인한 그래프이다.
도 7은 줄기세포 유래 미토콘드리아의 ROS 생성을 나타낸 그래프이다.
도 8은 줄기세포 유래 미토콘드리아의 막 전위를 나타낸 그래프이다.
도 9는 줄기세포 유래 미토콘드리아의 ATP 합성능을 나타낸 그래프이다.
도 10은 아셔만 증후군 마우스 모델(AS)에서의 줄기세포 유래 미토콘드리아(MT) 투여에 의한 섬유화 상태 및 조직학적 모양의 변화를 확인하기 위한 실험의 모식도이다.
도 11은 아셔만 증후군 마우스 모델(AS)에서의 줄기세포 유래 미토콘드리아(MT) 투여에 의한 섬유화 상태 및 조직학적 모양의 이상 정도를 나타낸 이미지이다.
도 12는 줄기세포 유래 미토콘드리아(MT) 투여에 의한 섬유화 인자들(Col1a1, Col3a1, Timp1 및 Tgfβ1)의 mRNA 발현을 나타낸 그래프이다.
도 13은 줄기세포 유래 미토콘드리아(MT) 투여에 의한 섬유화 인자들(Col1a1, Col3a1, Timp1 및 Tgfβ1)의 단백질 발현을 나타낸 그래프이다.
도 14는 아셔만 증후군 마우스 모델(AS)에서의 줄기세포 유래 미토콘드리아(MT) 투여에 의한 임신 관련 지표를 확인하기 위한 실험의 모식도이다.
도 15는 줄기세포 유래 미토콘드리아(MT) 투여에 의한 아셔만 증후군 마우스 모델(AS) 임신 중기의 착상된 배아의 수를 나타낸 그래프이다.
도 16은 줄기세포 유래 미토콘드리아(MT) 투여에 의한 아셔만 증후군 마우스 모델(AS) 임신 중기의 착상된 배아 무게를 나타낸 그래프이다.
도 17은 줄기세포 유래 미토콘드리아(MT) 투여에 의한 아셔만 증후군 마우스 모델(AS)의 임신까지 걸리는 시간(Time to conceive)을 나타낸 그래프이다.
도 18은 줄기세포 유래 미토콘드리아(MT) 투여에 의한 아셔만 증후군 마우스 모델(AS) 임신 말기의 출산율을 나타낸 그래프이다.
도 19는 줄기세포 유래 미토콘드리아(MT) 투여에 의한 아셔만 증후군 마우스 모델(AS) 임신 말기의 산자수를 나타낸 그래프이다.
도 20은 줄기세포 유래 미토콘드리아(MT) 투여에 의한 아셔만 증후군 마우스 모델(AS) 임신 초기의 착상된 자궁 및 착상된 배아의 수를 나타낸 그래프이다.
도 21은 줄기세포 유래 미토콘드리아(MT) 투여에 의한 혈관내피세포 표지인자인 Hgf, Igf1, Ang1, Vegfa, Hif1α 및 Hif2α의 mRNA 발현을 나타낸 그래프이다.
도 22는 줄기세포 유래 미토콘드리아(MT) 투여에 의한 혈관내피세포 표지인자인 Hgf, Igf1, Ang1, Vegfa, Hif1α 및 Hif2α의 단백질 발현을 나타낸 이미지이다.
도 23은 줄기세포 유래 미토콘드리아(MT) 투여에 의한 세포증식 효과를 나타낸 면역형광염색 이미지이다.
도 24는 줄기세포 유래 미토콘드리아(MT) 투여한 자궁 내막의 CD31+ 발현 혈관세포 중 KI-67+ 발현 증식세포의 비율을 정량적으로 나타낸 그래프이다.
도 25는 동일한 조건 하에서 Dead MT 및 live MT를 주입하였을 경우의 섬유화 인자들(Col1a1, Col3a1, Timp1 및 Tgfβ1)의 mRNA 발현을 나타낸 그래프이다.
도 26은 줄기세포 유래 미토콘드리아(MT)의 주입 방법 및 주입 용량별 투입 시의 섬유화 인자(Col1a1, Col3a1, Timp1 및 Tgfβ1)의 mRNA 발현을 나타낸 그래프이다.
도 27은 줄기세포 유래 미토콘드리아(MT)의 정맥 내 주입시 효과를 확인하기 위한 실험의 모식도이다.
도 28은 줄기세포 유래 미토콘드리아(MT)의 정맥 내 주입시 자궁 섬유증 개선 효과를 나타낸 이미지이다.
도 29는 줄기세포 유래 미토콘드리아(MT) 전달 후 섬유증 관련 인자에 대한 real-time RT-PCR 결과를 나타낸 그래프이다.
도 30은 줄기세포 유래 미토콘드리아(MT) 투여에 의한 면역 세포의 CD45 발현 변화를 나타낸 이미지이다.
도 31은 줄기세포 유래 미토콘드리아(MT) 투여에 의한 F4/80를 발현하는 총 대식세포 비율, CD80을 발현하는 M1 대식세포 비율 및 CD206를 발현하는 M2 대식세포 비율을 나타낸 이미지이다.
도 32는 대식세포 고갈에 의한 효과를 확인하기 위한 실험의 모식도이다.
도 33은 F4/80를 발현하는 대식세포의 고갈 후 대식세포의 수를 나타낸 그래프이다.
도 34는 대식세포 고갈환경에서 MT에 의한 자궁내막 재생 효과가 없음을 형광염색을 통해 나타낸 이미지이다.
도 35는 대식세포 고갈환경에서 MT에 의한 자궁내막 재생 효과가 없음을 mRNA 발현 변화를 통해 나타낸 그래프이다.
도 36은 줄기세포 유래 미토콘드리아(MT) 처리에 의한 대식세포의 M2 분극화를 확인하기 위한 실험의 모식도이다.
도 37은 줄기세포 유래 미토콘드리아(MT) 처리에 의한 대식세포의 M2 분극화를 나타낸 이미지이다.
도 38은 줄기세포 유래 미토콘드리아(MT) 처리에 의한 대식세포의 M1 마커인 iNOS, Socs3, M2 마커인 Arg1 및 Mrc1의 발현 변화를 나타낸 그래프이다.
도 39는 줄기세포 유래 미토콘드리아(MT) 처리에 의한 대식세포의 M2 분극화를 나타낸 면역세포화학 이미지이다.
도 40은 줄기세포 유래 미토콘드리아(MT) 처리에 의한 대식세포의 M2 분극화를 나타낸 유세포분석 그래프이다.
도 41은 줄기세포 유래 미토콘드리아(MT) 투여에 의해 분극화된 M2 대식세포가 인간 제대 정맥 내피 세포(HUVEC)의 이동 및 형성을 촉진하는지 확인하기 위한 실험의 모식도이다.
도 42는 분극화된 M2 대식세포 및 HUVEC을 공동배양한 경우 각 실험군의 이동 속도를 나타낸 이미지이다.
도 43은 분극화된 M2 대식세포 및 HUVEC을 공동배양한 경우 각 실험군의 혈관신생 정도를 나타낸 이미지이다.
도 44는 분극화된 M2 대식세포 및 HUVEC을 공동배양한 경우 각 실험군의 혈관신생 정도를 나타낸 그래프이다.
도 45는 줄기세포 유래 미토콘드리아의 손상된 자궁내막의 기능적 개선을 도식화한 것이다.
도 46은 간세포 유래 미토콘드리아의 단백질 함량을 나타낸 그래프이다.
도 47은 말초혈액 단핵세포 유래 미토콘드리아의 단백질 함량을 나타낸 그래프이다.
도 48은 간세포 유래 미토콘드리아의 ATP 합성능을 나타낸 그래프이다.
도 49는 말초혈액 단핵세포 유래 미토콘드리아의 ATP 합성능을 나타낸 그래프이다.
분리된 미토콘드리아를 유효성분으로 포함하는 아셔만 증후군 또는 이의 합병증의 치료제
본 발명의 일 측면은, 분리된 미토콘드리아를 유효성분으로 포함하는 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 약학 조성물을 제공한다.
본 명세서에서 사용된 용어, "미토콘드리아(mitochondria)"는 대부분의 진핵 생물에서 발견되는 이중막 결합 소기관으로, 세포 내 아데노신 삼인산(ATP)의 대부분을 생성한다.
본 명세서에서 사용된 용어, "분리된 미토콘드리아"는 자가(autologous), 동종(allogeneic) 또는 이종(xenogeneic)으로부터 수득된 미토콘드리아를 의미한다.
본 명세서에서 사용된 용어, "자가 미토콘드리아"는 동일 개체의 혈장, 조직, 골수 또는 세포로부터 수득된 미토콘드리아를 의미한다. 또한, 용어 "동종 미토콘드리아"는 개체와 같은 종에 속하고, 대립유전자에 대해서는 다른 유전자형을 가지는 개체의 혈장, 조직, 골수 또는 세포로부터 수득된 미토콘드리아를 의미한다. 또한, 용어 "이종 미토콘드리아"는 개체와 다른 종에 속하는 개체의 혈장, 조직, 골수 또는 세포로부터 수득된 미토콘드리아를 의미한다.
이때, 상기 개체는 포유동물일 수 있으며, 바람직하게는 인간일 수 있다.
상기 미토콘드리아는 개체의 세포, 골수 또는 혈장으로부터 분리된 것일 수 있다. 상기 미토콘드리아는 체외에서 배양된 자가 또는 타가 세포로부터 수득된 것일 수 있다. 이때, 세포, 골수 또는 혈장은 생물학적 활성이 정상인 것일 수 있다.
본 명세서에서 사용된 용어, "세포(cell)"은 생물을 구성하는 구조적 또는 기능적 단위로서, 세포막으로 둘러싸인 세포질로 구성되어 있고, 단백질 및 핵산 등의 생체분자를 포함하는 것을 의미한다. 상기 세포는 세포막 내부에 미토콘드리아를 포함하는 세포를 의미한다.
또한, 상기 미토콘드리아는 조직, 혈장, 골수 또는 세포를 농축하여 파쇄 후 분리하여 사용하거나 동결 보관한 후 해동한 조직, 혈장, 골수 또는 세포 시료로부터 파쇄 후 분리된 것일 수 있다.
일 구체예에 있어서, 상기 세포는 줄기세포, 체세포, 생식세포 및 혈소판으로 구성된 군으로부터 선택되는 어느 하나일 수 있다.
본 명세서에서 사용된 용어, "줄기세포"는 여러 종류의 조직 세포로 분화할 수 있는 능력을 가진 미분화 세포를 의미한다. 상기 줄기세포는 중간엽줄기세포, 성체줄기세포, 역분화줄기세포, 배아줄기세포, 골수줄기세포, 신경줄기세포, 윤부줄기세포 및 조직 유래 줄기세포로 구성된 군으로부터 선택되는 어느 하나일 수 있다.
이때, 상기 중간엽줄기세포는 탯줄, 제대혈, 골수, 지방, 근육, 신경, 피부, 양막 및 태반으로 구성된 군으로부터 선택되는 어느 하나일 수 있다. 바람직하게는, 인간 탯줄 유래일 수 있다.
본 명세서에서 사용된 용어, "체세포"는 개체를 구성하는 세포 중 생식세포를 제외한 세포를 의미한다. 상기 체세포는 근육세포, 간세포, 섬유아세포, 상피세포, 신경세포, 지방세포, 골세포, 골막세포, 백혈구, 림프구 및 점막세포로 구성된 군으로부터 선택되는 하나일 수 있다. 바람직하게는, 미토콘드리아 활성이 뛰어난 근육세포 또는 간세포로부터 수득된 것일 수 있다. 또한, 자가 또는 타가 혈액 PBMC 세포로부터 수득된 것일 수 있다.
본 명세서에서 사용된 용어, "생식세포"는 유성 생식을 하는 개체에서 생식 시, 접합자(zygote)를 형성하는 세포를 의미한다. 상기 미토콘드리아는 자가 또는 타가 생식세포에서 수득된 것일 수 있다. 상기 생식세포는 정자 또는 난자일 수 있다.
본 명세서에서 사용된 용어, "혈소판"은 혈액에서 섬유소 묶어 응혈을 형성함으로써 혈액 응고에 중요한 역할을 하는 고형 성분을 의미한다. 상기 미토콘드리아는 자가 또는 타가 혈소판에서 수득된 것일 수 있다.
본 명세서에서 사용된 용어, "골수"는 골수는 뼈의 해면질 부분에서 발견되는 반고체 조직을 의미한다. 상기 골수는 인간의 골수는 하루에 약 5000억 개의 혈액 세포를 생성한다. 특히, 골수는 활성이 정상적인 미토콘드리아를 포함한다.
본 명세서에서 사용된 용어, "혈장"은 혈구를 제외한 혈액의 액체 성분으로, 세포외액의 혈관 내 부분을 의미한다. 상기 혈장은 최대 95%의 물, 6 내지 8%의 용해 단백질 또는 전해질 등을 포함한다. 특히, 혈장은 활성이 정상적인 미토콘드리아를 포함한다.
상기 혈장은 혈액으로부터 분리하여 수득할 수 있다. 구체적으로, 항응고제를 포함하는 혈액을 원심 분리기에서 회전시켜 혈액에서 상청액을 분리하여 수득할 수 있다. 또한, 여과 또는 응집을 통해 혈액에서 혈장을 추출할 수 있다. 또한, 상기 혈장은 유래된 혈액에 따라 분류할 수 있다. 일 구체예에 있어서, 상기 혈장은 제대혈 또는 말초혈액으로부터 분리한 혈장일 수 있다. 바람직하게는, 제대혈으로부터 분리한 것일 수 있다.
일 구체예에 있어서, 상기 혈장 또는 골수는 개체로부터 수득되어 보관된 것일 수 있다. 구체적으로, 상기 혈장 또는 골수는 냉동된 것일 수 있다.
또한, 상기 분리된 미토콘드리아는 생물학적 활성이 정상인 것일 수 있다. 구체적으로, 상기 생물학적 활성이 정상인 미토콘드리아는 (i) 막 전위를 가지는 것, (ii) 미토콘드리아 내에서 ATP를 생성하는 것 및 (iii) 미토콘드리아 내에서 ROS를 제거하거나 ROS의 활성을 감소시키는 것으로 구성된 군으로부터 하나 이상의 특성을 가지는 것일 수 있다.
일 실시예에서, 본 발명의 분리된 미토콘드리아를 유효성분으로 포함하는 조성물을 자궁 내 직접 투여 혹은 정맥 투여할 경우, 자궁 내 재생이 촉진되고, 섬유화 지표가 감소하였다. 따라서, 본 발명의 분리된 미토콘드리아를 유효성분으로 포함하는 조성물은 자궁 내 섬유화 또는 자궁유착을 완화 또는 치료할 수 있어, 아셔만 증후군의 합병증에 예방 또는 치료 효과가 있다.
본 명세서에서 사용된 용어, "아셔만 증후군(Asherman's syndrome)"은 자궁내강유착증(Intrauterine adhesions, IUAs)으로도 알려져 있으며, 자궁내막 기저층이 떨어지고 정상적인 재생이 어려워지면서 자궁에 유착이 생긴 것을 말한다.
상기 아셔만 증후군은 자궁내막소파술, 자궁경부 원추형 생검술, 전기소작술 등의 수술 병력이 있는 환자, 골반염 병력 환자, 자궁 내 피임장치 등으로 인한 감염 환자에게서 주로 발병하며, 자궁내막의 섬유화, 자궁경관의 손상, 자궁내막의 파괴, 자궁강의 유착이 나타난다. 또한, 자궁 내에서의 아셔만 증후군은 합병증과 동반되는 경우가 일반적으로, 월경의 감소, 무월경, 자궁통증, 불임, 난임 등이 발생할 수 있다.
본 명세서에서 사용된 용어, "아셔만 증후군 합병증"은 아셔만 증후군과 동반될 수 있는 질환을 의미하거나, 아셔만 증후군의 위험을 높일 수 있는 질병을 총칭한다. 구체적으로, 자궁 유착을 동반하거나 혹은 자궁 유착의 위험을 높일 수 있는 질병 또는 증상을 포함한다.
일 구체예에 있어서, 상기 아셔만 증후군 합병증은 자궁유착, 자궁근종, 자궁내막증, 자궁 외 임신유산, 난소낭종, 생리장애, 난임, 불임, 골반유착, 골반통 및 골반염으로 이루어진 군에서 선택되는 하나 이상인 것일 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에서 사용된 용어, "자궁 유착(intrauterine adhesion)"은 intrauterine synechiae라고도 명명하며, 자궁 내막이 손상되거나 자궁의 내벽이 서로 달라붙어 딱딱하게 변한 질병을 의미한다.
본 명세서에서 사용된 용어, "자궁 근종(leiomyoma of uterus)은, 자궁을 이루고 있는 근육층에 생기는 양성 종양을 의미한다. 자궁근종은 근종이 생긴 위치에 따라 자궁체부근종, 자궁경부근종 또는 자궁질부근종으로 분류된다. 자궁근종은 불임이나 반복적인 유산에 영향을 미칠 수 있다.
본 명세서에서 사용된 용어, "자궁내막증(endometriosis)"은 자궁내막 조직이 자궁 밖에 존재하여 질환을 유발하는 질병을 의미한다. 상기 자궁내막증은 자궁 밖에 위치한 이소성 자궁내막 세포로 인해, 월경 주기에 따라 출혈 또는 염증 반응이 생겨 결과적으로는 섬유화 또는 유착 등이 발생할 수 있는 질병이다.
본 명세서에서 사용된 용어, "자궁 외 임신(ectopic pregnancy)"은 수정란이 자궁간 이외 다른 부위에 착상하는 것을 의미한다. 상기 자궁외 임신은 95% 이상이 팽대부에 착상하는 난관임신으로, 어떠한 요인으로 인해 난관이 좁아졌거나 난관점막이 수정란에 대한 수용력이 증가되어 발생한다.
본 명세서에서 사용된 용어, "생리장애"는 월경장애라고도 명명하며, 가임기 동안 비정상 자궁 출혈, 무월경, 월경통, 조기 폐경(원발성 난소 부전) 또는 월경 전 증후군을 동반하는 것을 의미한다.
본 명세서에서 사용된 용어, "난소낭종(ovarian cystic tumor)"은 난소에 물혹이 생긴 것을 의미한다. 상기 낭종은 수액 성분으로 차 있으며, 기능성 낭종과 양성 난소 종양으로 분류된다. 상기 난소낭종은 자궁유착, 불임 또는 난임의 원인이 될 수 있다.
본 명세서에서 사용된 용어, "난임(infertility)"또는 불임(sterility)은 피임을 하지 않고 정상적으로 성생활을 하는 경우에도 1년 이상 임신이 되지 않는 것, 또는 35세 이상의 여성이 피임을 하지 않고 정상적으로 성생활을 하는 경우 6개월을 기준으로 임신이 되지 않는 것을 의미한다.
본 명세서에서 사용된 용어, "골반유착"은 골반 장기 유착이라고도 명명하며, 골반 안에서 서로 다른 조직이나 장기가 섬유 조직으로 연결되어서 붙어 있는 상태를 의미한다. 상기 장기는 자궁, 난소, 난관, 복막일 수 있다.
본 명세서에서 사용된 용어, "골반염(pelvic inflammatory disorder, PID)"은 골반내염증이라고도 명명하며, 여성의 생식 기관의 상부인 자궁, 나팔관, 난소 또는 골반 내부에 감염이 일어난 것을 의미한다. 또한, 용어 "골반통(chronic pelvic pain)"은 골반에 생긴 염증 등으로 인해, 통증이 생기는 것을 의미한다.
본 명세서에서 사용된 용어, "치료"는 치료학적 처리 및 예방적 처리를 모두 포함하는 의미로 사용될 수 있다. 이때, 예방은 개체의 병리학적 상태 또는 질환을 완화시키거나 감소시키는 의미로 사용될 수 있다.
본 명세서에서 사용된 용어, "유효성분"은 단독으로 활성을 나타내거나 또는 그 자체로는 활성이 없는 보조제(담체)와 함께 활성을 나타내는 성분을 지칭한다.
상기 유효성분으로서 분리된 미토콘드리아는 자궁의 과도한 섬유화를 방지하거나 자궁의 섬유화를 감소시키는 것일 수 있다. 구체적으로, 상기 미토콘드리아는 자궁에서 섬유화 인자의 발현을 감소시키는 것일 수 있다.
본 명세서에서 용어 "섬유화"는 반복적인 부상, 만성 염증 또는 이의 회복 과정에서 섬유아세포에 의해 콜라겐과 같은 세포외 기질 성분이 과도하게 축적되는 현상을 의미한다. 섬유화는 대식세포가 섬유화 인자를 방출하여 진행되는 것일 수 있다.
본 명세서에서 용어 "섬유화 인자"는 섬유아세포를 자극하는 단백질을 총칭한다. 상기 섬유화 인자는 COL1A1, COL3A1, TIMP1 및 TGFβ1으로 구성된 군으로부터 선택된 하나 이상일 수 있다.
상기 COL1A1은 대부분의 결합조직에 존재하는 I형 콜라겐을 의미한다. I형 콜라겐은 인간에서 COL1A1 유전자에 의해 암호화되는 것일 수 있다.
상기 COL3A1은 세포에 의해 사전 프로콜라겐(pre-procollagen)으로 합성되는 III형 콜라겐(Type III Collagen)을 의미한다. 상기 III형 콜라겐은 인간에서 COL3A1 유전자에 의해 암호화되는 것일 수 있다.
상기 TIMP1은 광범위한 세포 유형에서 세포 증식을 촉진할 수 있으며 항-세포자멸사 기능을 가지는 당단백질로서, TIMP 메탈로펩티다제 억제제 1이라고도 명명된다. 상기 TIMP1은 인간에서 TIMP1 유전자에 의해 암호화되는 것일 수 있다.
상기 TGFβ1은 사이토카인의 변형 성장 인자 베타 슈퍼패밀리의 구성원이다. 상기 TGFβ1은 세포 성장, 세포 증식, 세포 분화 및 세포 사멸의 제어를 포함하여 많은 세포 기능을 수행한다. 상기 TGFβ1은 인간에서 TGFB1 유전자에 의해 암호화되는 것일 수 있다.
일 구체예에 있어서, 상기 분리된 미토콘드리아는 자궁에서 COL1A1, COL3A1, TIMP1 및 TGFβ1으로 구성된 군으로부터 선택된 하나 이상의 단백질 또는 이를 암호화하는 유전자의 발현을 감소시키는 것일 수 있다.
또한, 상기 미토콘드리아는 혈관 내피세포를 증가시키는 것일 수 있다. 또한, 상기 미토콘드리아는 자궁 내 혈관에서 증식 중인 혈관세포의 비율을 증가시키는 것일 수 있다. 구체적으로, 자궁 내 혈관에서 CD31을 발현하는 혈관 세포 중 KI-67를 발현하는 세포의 비율을 증가시키는 것일 수 있다.
일 구체예에 있어서, 자궁에서 혈관내피세포 표지인자의 발현을 증가시키는 것일 수 있다. 상기 혈관내피세포 표지인자는 HGF, IGF1, ANG1, VEGF-A, HIF1α 및 HIF2α로 구성된 군으로부터 선택된 하나 이상일 수 있다.
상기 HGF는 간세포 성장 인자(hepatocyte growth factor)로서, 유사분열, 세포 운동성 및 기질 침습을 증가시켜 혈관신생, 종양형성 및 조직 재생을 유도하는 사이토카인을 의미한다. 상기 HGF는 인간에서 HGF 유전자에 의해 화되는 것일 수 있다.
상기 IGF1는 인슐린 유사 성장 인자 1(insulin-like growth factor 1)로서, 소마토메딘 C(somatomedin C)라고도 명명하며, 인슐린과 서열 유사성이 높은 단백질을 의미한다. 상기 IGF1은 인간에서 IGF1 유전자에 의해 암호화되는 것일 수 있다.
상기 ANG1은 안지오포이에틴 1(angiopoietin 1)으로서, 혈관 발달과 혈관 신생에 중요한 역할을 하는 단백질을 의미한다. 상기 ANG1는 인간에서 ANGPT1 유전자에 의해 암호화되는 것일 수 있다.
상기 VEGF-A는 혈관 내피 성장 인자 A(vascular endothelial growth factor A)이다. 상기 VEGF-A는 내피세포에 특이적으로 작용하여 증가된 혈관투과성을 매개하고, 혈관신생, 혈관신생 및 내피세포 성장을 유도하고, 세포이동을 촉진하고, 세포자멸사를 억제한다. 상기 VEGF-A는 인간에서 VEGFA 유전자에 의해 암호화되는 것일 수 있다.
상기 HIF1α는 저산소증 유발 인자 1-알파(hypoxia-inducible factor 1-alpha)로서, 혈관신생 및 적혈구 생성과 같은 기능을 가지는 VEGF 및 에리트로포이에틴 등을 암호화하는 유전자의 전사를 유도하는 단백질이다. 상기 HIF1α는 산소 전달을 촉진하고 증가시킨다. 상기 HIF1α는 인간에서 HIF1A 유전자에 의해 암호화되는 것일 수 있다.
상기 HIF2α는 저산소증 유도 인자-2알파(hypoxia-inducible factor-2alpha)로서, 산소 수송을 개선하는 단백질로서, EPAS1(Endothelial PAS domain-containing protein 1)라고도 명명된다. 상기 HIF2α는 인간에서 EPAS1 유전자에 의해 암호화되는 것일 수 있다.
일 구체예에 있어서, 상기 분리된 미토콘드리아는 HGF, IG1F, ANG1, VEGF-A, HIF1α 및 HIF2α로 구성된 군으로부터 선택된 하나 이상의 단백질 또는 이를 암호화하는 유전자의 발현을 증가시키는 것일 수 있다.
상기 미토콘드리아는 자궁의 염증을 감소시키는 것일 수 있다. 구체적으로, 염증성 인자인 iNOS, SOCS3 또는 이의 조합의 유전자 발현을 감소시키거나, 항 염증성 인자인 ARG1, MRC1 또는 이의 조합의 유전자 발현을 증가시키는 것일 수 있다.
상기 iNOS는 산화질소 합성효소(nitric oxide synthases)의 면역 반응에 관여하는 유도성 이성질체를 의미한다. 상기 iNOS는 iNOS는 염증 유발 사이토카인(예: 인터루킨-1, 종양 괴사 인자 알파 및 인터페론 감마)에 의해 NO를 생성하는 염증성 인자이다.
상기 SOCS3은 인간에서 IL-6, IL-10, 인터페론(IFN)-감마를 포함한 다양한 사이토카인에 의해 유도되는 염증성 인자이다.
상기 ARG1은 아르기나아제 단백질(arginase protein)을 암호화하는 유전자로서, 아르기나아제는 아르기닌이 오르니틴과 요소로 가수분해되는 것을 촉매한다.
상기 MRC1은 대식세포 만노스 수용체 1(Macrophage mannose receptor 1)으로서, CD206이라고도 명명한다. 상기 CD206은 대식세포의 표면에 존재하며, 대식세포의 분극화에 따라 발현의 정도가 달라지는 것일 수 있다.
상기 미토콘드리아는 자궁 내 대식세포의 분극화를 촉진하는 것일 수 있다.
본 명세서에서 용어 "대식세포(macrophage)"는 식균작용(phagocytosis)을 통해 감염으로부터 숙주를 방어하는 면역세포를 의미한다. 대식세포는 기본적인 기능과 활성화에 따라 분류되며, 활성화된 대식세포(M1 대식세포), 상처 치유 대식세포(M2 대식세포) 및 조절 대식세포로 분류된다.
상기 M1 대식세포는 LPS 및 IFN-감마에 의해 활성화되고 M2 대식세포와 비교하여 높은 수준의 IL-12와 낮은 수준의 IL-10을 분비한다. M1 대식세포는 염증을 촉진하며, 살균 및 식세포 기능을 가진다. 일 구체예에 있어서, M1 대식세포는 M2 대식세포와 비교하여 CD80 발현은 높고, CD206 발현은 낮은 것일 수 있다.
상기 M2 대식세포는 M1 대식세포와 비교하여 높은 수준의 IL-10, 낮은 수준의 IL-12를 분비한다. M2 대식세포는 항염증성 사이토카인을 생성하여 상처를 치유하고 조직을 복구한다. 일 구체예에 있어서, M2 대식세포는 M1 대식세포와 비교하여 CD80 발현은 낮고, CD206 발현은 높은 것일 수 있다.
또한, 상기 대식세포는 IL-4 사이토카인에 의해 M1 대식세포에서 M2 대식세포로 분극화되는 것일 수 있다.
일 구체예에 있어서, 상기 미토콘드리아는 자궁 내 대식세포를 M1 대식세포에서 M2 대식세포로 분극화시키는 것일 수 있다. 또한, 자궁 내 대식세포의 CD80 발현을 감소시키고, CD206 발현은 증가시키는 것일 수 있다.
또한, 상기 미토콘드리아는 자궁의 재생을 유도하는 것일 수 있다. 구체적으로, 상기 미토콘드리아는 자궁 내 과도한 섬유화를 억제하고, 혈관의 형성 및 이동을 촉진하며, 염증을 억제하고 대식세포의 분극화를 촉진함으로써, 손상된 자궁 내벽의 재생을 유도하는 것일 수 있다.
더불어, 상기 미토콘드리아는 탯줄의 형성을 촉진하는 것일 수 있다. 구체적으로, 착상된 태아의 탯줄 혈관의 이동을 촉진하거나, 혈관 형성을 촉진하는 것일 수 있다.
상기 미토콘드리아를 특정 세포로부터 분리하는 경우에는, 예를 들어, 특정 버퍼 용액을 사용하거나 전위차 및 자기장을 이용하는 등 공지된 다양한 방법을 통해 분리할 수 있다. 또한, 상기 미토콘드리아 분리는 혈장을 원심분리 및 여과하여 모든 세포 성분을 제거하는 단계, 여과된 혈장을 원심분리하는 단계를 포함할 수 있다.
상기 미토콘드리아 분리는 미토콘드리아 활성 유지 측면에서, 세포를 파쇄하고 원심분리하여 수득할 수 있다. 이때, 원심분리는 제1차 내지 제3차로 수행되는 것일 수 있다.
일 구체예에 있어서, 세포를 배양하고, 이러한 세포를 포함하는 약학 조성물을 제1차 원심 분리하여 펠렛을 생성하는 단계, 상기 펠렛을 버퍼 용액에 재현탁시키고, 균질화 하는 단계, 상기 균질화 된 용액을 제2차 원심분리하여 상청액을 제조하는 단계 및 상기 상청액을 제3차 원심분리하여 미토콘드리아를 정제하는 단계로 수행될 수 있다. 이때, 제2차 원심분리가 수행되는 시간은 제1차 및 제3차 원심분리가 수행되는 시간보다 짧도록 조절되는 것이 세포 활성 유지 면에서 바람직하며, 제1차 원심분리에서 제3차 원심분리로 갈수록 속도를 높일 수 있다.
상기 미토콘드리아를 혈장으로부터 분리하는 경우에는, 예를 들어, 특정 버퍼 용액을 사용하거나, 초음파, 농도 구배 및 자기장을 이용하는 등 공지된 다양한 방법을 통해 분리할 수 있다.
상기 미토콘드리아 분리는 혈장에서 세포 또는 세포소기관 등을 제거하는 단계; 미토콘드리아를 정제하는 단계를 포함한다. 더불어, 상기 미토콘드리아 분리는 소포체, 미토콘드리아-관련 막 파편 및 미토콘드리아를 물리적으로 분리하는 단계를 포함할 수 있다.
일 구체예에 있어서, 상기 분리는 원심분리에 의한 것일 수 있다. 구체적으로, 상기 분리는 혈장을 저속 1차 원심분리하여 혈장 내 세포를 제거하는 단계; 혈장을 필터링하여 세포 파편을 제거하는 단계; 상기 혈장의 상층액을 2차 원심분리하는 단계를 통해 수행될 수 있다.
일 구체예에 있어서, 상기 분리는 불연속적 농도 구배 및 원심분리에 의한 것일 수 있다. 상기 불연속적 농도 구배는 수크로오즈 또는 Percoll 농도 구배를 이용하는 것일 수 있다. 구체적으로, 상기 분리는 초음파를 이용하여 세포를 용해하는 단계; 혈장을 저속 1차 원심분리하여 혈장 내 세포를 제거하는 단계; 혈장을 2차 원심분리하여 소포체를 제거하는 단계; 혈장의 상층액을 비연속 농도 구배에 로딩하는 단계; 분리된 결과물을 3차 원심분리하는 단계를 통해 수행될 수 있다.
상기 제1차 내지 제3차 원심분리는 0 내지 10℃의 온도, 바람직하게는 3 내지 5℃의 온도에서 수행될 수 있다. 또한, 상기 원심분리가 수행되는 시간은 1 내지 50분일 수 있으며, 원심분리 횟수 및 샘플의 함량 등에 따라 적절히 조정될 수 있다. 아울러, 상기 제1차 원심분리는 100 내지 1,000xg, 또는 200 내지 700xg, 또는 300 내지 450xg의 속도로 수행될 수 있다. 또한, 상기 제2차 원심분리 또는 3차 원심분리는 1 내지 2,000xg, 25 내지 1,800xg, 또는 500 내지 1,600xg, 100 내지 20,000xg, 500 내지 18,000xg, 또는 800 내지 15,000xg의 속도로 수행될 수 있다.
상기 분리된 미토콘드리아의 막 단백질을 정량하여 미토콘드리아를 정량할 수 있다. 구체적으로, 상기 분리된 미토콘드리아를 BCA(bicinchoninic acid assay) 분석법을 통해 정량할 수 있다. 이때, 상기 약학 조성물 내 미토콘드리아는 0.1 ㎍/㎖ 내지 1,000 ㎍/㎖, 1 ㎍/㎖ 내지 750 ㎍/㎖, 25 ㎍/㎖ 내지 500 ㎍/㎖, 25 ㎍/㎖ 내지 150 ㎍/㎖ 또는 25 ㎍/㎖ 내지 100 ㎍/㎖의 농도로 포함될 수 있다. 본 발명의 일 실시예에서는, 25 ㎍/㎖ 또는 50 ㎍/㎖ 농도로 사용하였다.
또한, 상기 미토콘드리아는 온전한 형태, 파쇄된 형태 또는 이의 조합을 가지는 것일 수 있다. 일 구체예에 있어서, 상기 미토콘드리아는 파쇄된 형태인 경우에도 미토콘드리아의 활성을 가지는 경우에는 약리효과를 나타낼 수 있다.
또한, 상기 분리된 미토콘드리아를 파티클 카운터(Multisizer 4e, Beckman Coulter)를 통해 개수를 측정할 수 있다.
일 구체예에 있어서, 상기 약학 조성물 내　미토콘드리아는 1×105　미토콘드리아　개수/㎖ 내지 9×109　미토콘드리아　개수/㎖의 함량으로 포함될 수 있다. 구체적으로, 상기 약학 조성물 내　미토콘드리아는 1×105/㎖ 내지 5×109/㎖, 2×105/㎖ 내지 2×109/㎖, 5×105/㎖ 내지 1×109/㎖, 1×106/㎖ 내지 5×108/㎖, 2×106/㎖ 내지 2×108/㎖, 5×106/㎖ 내지 1×108/㎖ 또는 1×107/㎖ 내지 5×107/㎖의 함량으로 포함될 수 있다.
일 구체예에 있어서, 상기 약학 조성물은 개체의 자궁 내 직접 투여 제제, 정맥, 근육 또는 피하 투여용 주사제일 수 있으며, 바람직하게는 자궁 내 직접 투여 제제 또는 피하 투여용 주사제일 수 있다.
이때, 상기 약학 조성물은 약학적으로 허용 가능한 담체를 더 포함할 수 있다. 상기 약학적으로 허용 가능한 담체는 환자에게 전달하기에 적절한 비-독성 물질이면 어떠한 담체라도 가능하다. 증류수, 알코올, 지방, 왁스 및 비활성 고체가 담체로 포함될 수 있다. 약물학적으로 허용되는 애쥬번트(완충제, 분산제) 또한 약학 조성물에 포함될 수 있다.
본 발명의 또 다른 측면은, 미토콘드리아를 개체에 투여하는 단계를 포함하는 아셔만 증후군 또는 이의 합병증을 치료 및/또는 예방하는 방법을 제공한다.
상기 미토콘드리아, 아셔만 증후군 및 이의 합병증은 전술한 바와 같다.
상기 투여는 자궁 내 직접 투여 제제일 수 있고 또는 정맥, 근육 또는 피하 투여될 수 있는 주사제일 수 있고, 바람직하게는 자궁 내 직접 투여용 제제 또는 정맥 주사용 제제일 수 있다.
본 발명에 따른 약학 조성물은 주사제 처방의 유통에 따른 제품 안정성을 확보하기 위하여, 주사제로 사용 가능한 산수용액 또는 인산염 등의 완충용액을 사용하여 pH를 조절함으로써, 물리적으로나 화학적으로 매우 안정한 주사제로 제조될 수 있다. 상기 주사제는 보존제, 무통화제, 가용화제 또는 안정화제 등을 추가로 포함할 수 있다.
구체적으로, 본 발명의 약학 조성물은 주사용수를 포함할 수 있다. 상기 주사용수는 고형주사제의 용해나 수용성 주사제를 희석하기 위하여 만들어진 증류수로서, 글루코스 주사, 자일리톨 주사, D-만니톨 주사, 프룩토스 주사, 생리식염수, 덱스트란 40 주사, 덱스트란 70 주사, 아미노산 주사, 링거액, 락트산-링거액 또는 pH 3.5 내지 7.5 범위의 인산염 완충용액 또는 인산이수소나트륨-구연산 완충용액 등 일 수 있다.
상기 약학 조성물의 바람직한 투여량은 환자의 상태, 체중, 성별, 연령, 환자의 중증도, 투여 경로에 따라 달라질 수 있으며, 투여는 1일 1회 또는 수회로 나누어 이루어질 수 있다. 구체적으로, 또한, 상기 약학 조성물은 1회 내지 10회, 3회 내지 8회 또는 5회 내지 6회 투여할 수 있다.
상기 약학 조성물은 아셔만 증후군 또는 이의 합병증이 확진되거나, 아셔만 증후군 또는 이의 합병증을 앓고 있는 개체에 대하여 투여될 수 있다. 구체적으로, 상기 "개체"는, 본 발명에 따른 치료용 조성물의 투여에 의해 증상이 호전될 수 있는 아셔만 증후군 및/또는 아셔만 증후군 합병증을 가진 개체일 수 있으며, 상기 개체는 자궁을 가지는 것일 수 있고, 포유동물일 수 있다. 일 구체예에 있어서, 상기 개체는 말, 양, 돼지, 염소, 낙타, 영양, 개 등의 동물 또는 인간을 포함한다. 상기 약학 조성물을 개체에게 투여함으로써, 아셔만 증후군 및/또는 아셔만 증후군 합병증을 효과적으로 예방 및 치료할 수 있다.
또한, 상기 약학 조성물은 공지된 아셔만 증후군 예방 또는 치료제, 불임 예방 또는 치료제 또는 난임 예방 또는 치료제를 추가적으로 포함할 수 있다.
또한, 상기 약학 조성물의 투여는 추가적으로 아셔만 증후군 치료, 불임 치료 또는 난임 치료와 병행될 수 있다. 상기 아셔만 증후군의 치료는 자궁경 수술을 통한 절제술, 자궁 내 카테터의 설치, 에스트로겐 또는 프로게스테론 치료 등일 수 있다.
본 발명의 또 다른 측면은, 아셔만 증후군 또는 이의 합병증을 치료하기 위한 미토콘드리아의 용도를 제공한다.
본 발명의 또 다른 측면은, 아셔만 증후군 또는 이의 합병증 치료 또는 예방용 약제를 제조하기 위한 미토콘드리아의 용도를 제공한다.
일 실시예에 있어서, 미토콘드리아를 유효성분으로 포함하는 약학 조성물을 자궁 내 직접 주입 또는 혈관 내 주입한 경우, 자궁 내 섬유화가 억제되고, 아셔만 증후군 마우스 모델에서 착상률 및 배아발달이 모두 개선됨을 확인하였다. 이러한 결과는, 일 구체예의 약학 조성물이 아셔만 증후군 및 아셔만 증후군의 합병증에까지 예방, 치료 또는 개선 효과를 나타낼 수 있음을 의미한다.
이하, 본 발명을 하기 실시예에 의하여 더욱 상세하게 설명한다. 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 본 발명의 범위가 이들만으로 한정되는 것은 아니다.
실시예 1. 탯줄 유래 중간엽줄기세포 미토콘드리아의 수득
실시예 1.1. 탯줄 유래 줄기세포의 배양
탯줄 유래 중간엽줄기세포(IRB number: No.201411-BR-022-02 또는 No.201806-BR-029-03)를 탯줄의 와튼 젤리에서 획득하여 실험에 사용하였다. 분리된 탯줄 유래 중간엽줄기세포를 10% 우태아혈청(FBS; Gibco, Waltham, USA)과 1% 페니실린/스트렙토마이신 항생제(P/S, Hyclone, Logan, USA)가 포함되어 있는 Minimum Essential Medium Alpha Modification(MEM Alpha Modification, Hyclone) 배지와 T-175 배양 플라스크를 이용하여 배양하였다. 세포를 37℃, 5% CO2 조건에서 유지하면서 세포의 밀도가 약 80% 내지 90% 되었을 때 다음 계대배양을 진행하였다.
실시예 1.2. 탯줄 유래 중간엽줄기세포 미토콘드리아의 분리
상기 실시예 1.1에서 배양한 탯줄 유래 중간엽줄기세포를 이용하여 미토콘드리아를 분리하였다. 2 x 107 개의 세포 기준으로 SHE buffer [0.25 M Sucrose, 20 mM HEPES(pH 7.4), 2 mM EGTA, 10 mM KCl, 1.5 mM MgCl2, 0.1% defatted bovine serum albumin(BSA), pH 7.4] 400 μl를 첨가하여 세포를 부유시킨 뒤 4℃에서 5분간 배양하였다. 1 ml syringe(Koreavaccine, Seoul, South Korea)를 이용하여 세포막을 파쇄하였다. 파쇄되지 않은 세포와 핵을 제거하기 위해 1,500 xg, 4℃에서 5분간 원심분리하였다. 상층액을 회수한 후 20,000 xg, 4℃에서 10분간 원심분리하였다. 분리된 미토콘드리아를 세척하기 위해 BSA를 첨가하지 않은 SHE buffer 2 ml을 넣고 20,000 xg, 4℃에서 10분간 원심분리하였다. 상층액을 제거한 후 미토콘드리아 펠렛을 Dulbecco's phosphate-buffered saline(DPBS; Welgene, South Korea)로 2회 세척하였다. 이후, 이에 DPBS를 200 μl를 넣어 부유시킨 뒤 4℃에서 보관하여 탯줄 유래 중간엽줄기세포 미토콘드리아를 수득하였다. 분리된 미토콘드리아는 연한 백색의 현탁액의 성상을 가지는 것을 확인하였다.
실시예 2. 인간 말초혈액 단핵세포 및 혈장 유래 미토콘드리아의 수득 미토콘드리아의 수득
실시예 2.1. 인간 말초혈액 단핵세포의 분리 및 배양
공여자의 혈액을 헤파린 튜브에 넣어 운반하여 실험에 사용하였다. Leucosep tube(Greiner bio-one, Kremsmunster, Austria)에 Ficoll-Paquetm PLUS(GE Healthcare, Chicago, USA) 15 ml 내지 25 ml을 넣고 1,500 rpm에서 1분간 원심분리하였다. 이후, 첨가된 Ficoll-Paque 용액 위로 공여자의 혈액을 1 내지 2 배수의 부피로 Ficoll-Paque와 섞이지 않게 첨가하여 2개의 밀도구배 층을 형성하였다. 이후 2,000 rpm에서 20분 동안 원심분리를 수행하였으며, 원심분리 후 혈장(plasma), 말초혈액 단핵세포(PBMC), Ficoll-paque가 함유된 과립성 백혈구(Ficoll-paque+granulocyte) 및 적혈구(RBC)의 순서로 형성된 4개의 밀도구배 층을 확인하였다. 상기 형성된 밀도 구배 층에서 혈장과 말초 혈액 단핵 세포를 각각 새로운 50 ml 튜브에 분리하여 수득하였다.
회수한 말초혈액 단핵세포는 1,200 xg에서 10분간 원심분리하고, 상층액을 제거한 후 RBC lysis buffer(Biolegend, San Diego, USA) 5 ml을 넣어 37℃, 5% CO2에서 5분간 정치하였다. DPBS 45 ml을 더 넣어준 뒤 1,200 xg에서 10분간 원심분리하였다. 상층액 제거 후 DPBS 20 ml을 넣은 뒤 1,200 xg에서 10분간 원심분리하였다. 최종적으로 상층액 제거 후 펠렛으로 얻어진 혈액 단핵세포를 확보하였다. 상기 세포에 DPBS를 넣은 뒤 세포를 부유시켜 세포수를 측정하였다.
인간 혈액으로부터 분리된 말초혈액 단핵세포는 10% FBS와 1% P/S(Penicillin/Streptomycin)가 포함되어 있는 RPMI-1640(Hyclone, Logan, USA) 배지와 T-175 Culture Flask를 이용하여 배양하였다. 세포는 37℃, 5% CO2 조건에서 유지하였고, 세포의 밀도가 약 80 내지 90% 정도 되었을 때 다음 계대배양을 진행하였다.
실시예 2.2. 인간 말초혈액 단핵세포 미토콘드리아 분리
실시예 2.1에서 배양한 인간 말초혈액 단핵세포를 이용하여 미토콘드리아를 사용하였다는 것 이외에는, 상기 실시예 1.2와 동일한 방법으로 인간 말초혈액 단핵세포에서 미토콘드리아를 수득하였다.
실시예 2.3. 인간 혈장 유래 미토콘드리아 분리
실시예 2.1에서 수득한 혈장은 25,000 xg, 4℃에서 20분간 원심분리하여 혈장에 존재하는 세포 유래 물질을 침전시킨 후 상등액을 제거하였다. 이 후 실시예 1.2에서 사용한 SHE 버퍼를 이용하여 동일한 방법으로 미토콘드리아를 수득하였다.
실시예 3. 인간 유래 간세포 미토콘드리아의 수득
실시예 3.1. 간세포 배양
인간 유래 간세포주인 WRL 68(CL-48)을 ATCC에서 구매하여 실험에 사용하였다. WRL 68을 10% FBS와 1% P/S가 포함되어 있는 Dulbecco's Modified Eagle's Medium high glucose(DMEM; Hyclone) 배지와 T-175 배양 플라스크를 이용하여 배양하였다. 세포는 37℃, 5% CO2 조건에서 유지하였고, 세포의 밀도가 약 80 내지 90% 정도 되었을 때 다음 계대 배양을 진행하였다.
실시예 3.2. 인간 유래 간세포 미토콘드리아 분리
실시예 3.1에서 배양한 인간 유래 간세포를 이용하여 미토콘드리아를 사용하였다는 것 이외에는, 상기 실시예 1.2와 동일한 방법으로 인간 유래 간세포에서 미토콘드리아를 수득하였다.
실시예 4. 중간엽 줄기세포 유래 미토콘드리아의 특성
실시예 4.1. 분리된 미토콘드리아의 단백질 측정 및 미토콘드리아의 크기 측정
상기 실시예 1 내지 3에서 분리한 미토콘드리아의 단백질을 측정하기 위해, Bicinchoninic acid assay(BCA assay; Pierce, Rockford, USA) 방법을 사용하였다. DPBS 200 μl에 부유되어 있는 미토콘드리아에서 10 μl 샘플을 이용하여 키트 프로토콜에 따라 농도를 측정하였다. BSA 표준곡선(standard curve)을 통해 2 x 107 개의 세포로부터 얻은 미토콘드리아 함량을 단백질 농도로 산출하였다.
그 결과, 도 1, 도 46 및 도 47에 나타낸 것과 같이, 탯줄 유래, 간세포 유래 및 말초혈액 단핵세포 유래 중간엽 줄기세포가 모두 충분한 미토콘드리아 단백질 함량을 가지는 것을 확인하였다. 또한, 도 1에 나타낸 것과 같이, 탯줄 유래 중간엽 줄기세포의 미토콘드리아 단백질 함량은 484 ± 28.3 μg임을 확인하였다.
상기 실시예 1에서 분리한 탯줄 유래 중간엽 줄기세포 미토콘드리아의 크기와 분포를 측정하기 위해, Dynamic light scattering(DLS; Dynals, Protein solution Inc., Charlottesville, VA) 장비를 이용하여 분석하였다.
그 결과, 도 2에 나타낸 것과 같이, 미토콘드리아의 크기는 650 ± 108 nm임을 확인하였다.
실시예 4.2. 분리된 미토콘드리아의 생존 확인
상기 실시예 1에서 분리한 탯줄 유래 중간엽 줄기세포 미토콘드리아를 확인하기 위하여, 미토콘드리아를 막전위(MMP; mitochondrial membrane potential)에 의존적인 MitoTracker CMXRos Red 프로브로 염색한 후, 형광현미경 관찰과 유세포 분석을 수행하였다.
구체적으로, 분리된 미토콘드리아는 각각 미토콘드리아 특이적 인지자인 Mitotracker CMXRos Red(Thermo Fisher, Waltham, USA; 300 nM)로 4℃에서 30분간 염색하였다. 이때, MitoTraker CMXRos Red는 미토콘드리아 막전위(MMP; mitochondrial membrane potential) 의존적으로 미토콘드리아에 염색되는 표지자로서, 상기 표지자의 확인은 분리된 미토콘드리아가 막전위를 유지하고 있고, 살아있음(viable)을 확인하기 위한 실험이다. 다음으로, 미토콘드리아를 DPBS로 2회 세척하였으며 DPBS 200 μl을 넣어 부유시킨 뒤, 형광 신호를 측정하였다.
그 결과, 도 3에 나타낸 것과 같이, 분리된 미토콘드리아가 MitoTracker 프로브와 결합하였음을 확인하였다. 또한, 도 4에 나타낸 것과 같이, 분리된 미토콘드리아가 특이적 인지자(Mitotracker CMXRos Red)와 결합하였음을 확인하였다.
실시예 4.3. 분리된 미토콘드리아의 순도 확인
상기 실시예 1에서 분리한 탯줄 유래 중간엽줄기세포 미토콘드리아의 순도를 확인하였다.
분리된 미토콘드리아의 순도를 확인하기 위하여, 미토콘드리아 특이적 마커[cytochrome C oxidase(COX IV), cytochrome C, Translocase of outer mitochondrial membrane 20(TOMM20) and Apoptosis inducing factor(AIF)]의 존재와 다른 세포소기관 마커[KDEL (ER marker) and Proliferating Cell Nuclear Antigen (PCNA; nuclear marker)]의 부재를 확인하였다.
구체적으로, 순도를 확인하기 위하여, 분리된 미토콘드리아는 SDS-PAGE 로딩 버퍼(LPS solution, Daejeon, South Korea)를 이용하여 100℃에서 3분간 열처리하였다. 12% SDS-PAGE 겔을 사용하여 단백질을 크기 별로 분리한 후, PVDF 멤브레인으로 0.35 mA에서 120분간 이동하였다. 단백질이 이동한 PVDF 멤브레인은 상온에서 3% BSA가 포함된 TBS-T [Water, 150 mM NaCl, 10 mM Tris-HCl, 0.1%(v/v) Tween-20, pH 7.6]으로 90분간 블록킹하였다. 블록킹이 끝난 후, 버퍼를 제거하지 않고 1차 항체에 KDEL(Invitrogen, PA1-013), PCNA(Santa Cruz Biotechnology, sc-56), Cytochrome c(Santa Cruz Biotechnology, sc-13156), COX IV(Abcam, ab33985), TOMM20(Santa Cruz Biotechnology, sc-17764) 및 AIF(Santa Cruz Biotechnology, sc-13116)를 1:1,000 비율로 처리하여 4℃에서 밤새 반응시켰다.
그 결과, 도 5에 나타낸 것과 같이, 미토콘드리아 분획 내 모든 미토콘드리아 특이적 마커(COX IV, cytochrome C, TOMM20, AIF)에서 미토콘드리아 단백질의 존재가 확인되었으나, 다른 세포 소기관 마커인 KDEL 및 PCNA는 존재하지 않는 것을 확인하였다. 이때, 도 5에서 M은 미토콘드리아가 포함된 분획이며, C는 미토콘드리아가 포함되지 않은 세포 분획을 나타낸다.
실시예 4.4. 분리된 미토콘드리아의 활성 확인
상기 실시예 1에서 분리한 탯줄 유래 중간엽줄기세포 미토콘드리아의 활성을 확인하였다. 구체적으로, 미토콘드리아의 ATP 함량, ROS 생성, 막 전위 및 ATP 합성능을 확인하였다.
실시예 4.4.1. 미토콘드리아 내에 포함된 ATP 함량 확인
ATP 함량을 확인하기 위해, 분리된 미토콘드리아는 CellTiter-Glo luminescence assay kit(Promega, Madison, WI)를 이용하여 수행하였다. White 96-well plate에 각각 DPBS(MT (-))와 DPBS 100 μl에 부유되어 있는 미토콘드리아 10 μg을 분주(MT (+))하고 샘플을 이용하여 키트 프로토콜에 따라 CellTiter-Glo reagent 100 μl씩 첨가하여 2분간 Shaker 위에서 섞어준 뒤, 10분간 빛을 차단하고 반응시켰다. 발광 값은 Luminescence microplate reader (Epoch Spectrometer, BioTek Inc.)를 이용하여 측정하였다.
실시예 4.4.2. 미토콘드리아의 ROS 생성 확인
Mitochondrial ROS 생성을 확인하기 위해, 미토콘드리아의 superoxide indicator인 MitoSOX Red(Invitrogen, Carlsbad, CA)를 이용하여 미토콘드리아 ROS(mROS)를 측정하였다. 분리된 미토콘드리아가 들어있는 MT(+)군과 동일 부피의 PBS가 들어있는 MT(-)군을 96-well black plates에 분주한 후 1 μM MitoSOX Red를 처리하여 37℃, 5% CO2에서 30분간 반응시켰다. 형광 세기는 fluorescence microplate reader(BioTek Inc.)를 사용하여 흡수파장 510 nm/방출파장 528 nm으로 측정하였다.
실시예 4.4.3. 미토콘드리아의 막 전위 확인
미토콘드리아의 막 전위를 확인하기 위해, JC-1(Invitrogen)을 이용하여 미토콘드리아의 막전위를 측정하였다. 분리된 미토콘드리아가 함유된 MT(+) 군과 동일한 부피의 PBS만으로 이루어진 MT(-)군, 그리고 분리된 미토콘드리아에 CCCP(carbonyl cyanide m-chlorophenyl hydrazone, Sigma Aldrich)를 처리한 MT(+) + CCCP 군을 96-well black plate에 넣고, 1 μM JC-1 dye을 처리하여 37℃ 5% CO2에서 30분간 반응시켰다. JC-1은 막전위(MMP)에 의존적으로 미토콘드리아에 축적되어, 녹색의 방출 파장대(흡수 485 nm/방출 516 nm)의 형광값을 붉은색(흡수 579 nm/방출 599 nm)으로 변화시켰다. MMP는 형광값의 비율로 결정하였고, 이는 형광 마이크로플레이트 리더(fluorescence microplate reader)로 측정하였다.
실시예 4.4.4. 미토콘드리아 ATP 합성능 확인
ATP 합성능을 확인하기 위해, 손상되지 않은 미토콘드리아(intact MT)와 손상을 가한 미토콘드리아(damaged MT) 그룹으로 나누어 준비하였다.
구체적으로, 50 μM CCCP(positive control group as mitochondrial oxidative phosphorylation uncoupler)를 처리하여 손상된 미토콘드리아(damaged MT 또는 dead MT)를 제조하였다. 이와 같이 준비된 미토콘드리아는 각각 DPBS 100 μl에 부유시켜 미토콘드리아 10 μg을 White 96웰 플레이트에 준비하고, 5 mM ADP를 첨가한 뒤 37℃ 인큐베이터에서 반응시켰다. 45분 뒤, CellTiter-Glo reagent 100 μl씩 첨가하여 2분간 Shaker 위에서 섞어준 뒤, 10분간 빛을 차단하고 반응시켰다. 발광 값은 Luminescence microplate reader를 이용하여 측정하였다.
그 결과, 도 6, 도 48 및 도 49에 나타낸 것과 같이, 미토콘드리아가 존재하지 않은 상태[MT(-)]와 비교하여, 분리된 미토콘드리아에서 ATP 함량이 높게 측정됨을 확인하였다. 또한, 도 7에 나타낸 것과 같이, 미토콘드리아 내의 ROS의 활성이 낮음을 확인하였다.
또한, 도 8에 나타낸 것과 같이, 미토콘드리아 그룹에서 막 전위를 확인하였다. 또한, 도 9에 나타낸 것과 같이, 분리된 미토콘드리아의 ATP 합성 능력을 확인하였다. 또한, CCCP 처리에 의한 미토콘드리아 기능 손실에 의해 막 전위의 감소와 ATP 합성능력의 저하를 확인하였다. 이러한 결과는, 본 발명의 분리된 미토콘드리아가 미토콘드리아의 활성을 유지하고 있음을 의미한다.
실시예 5. 분리된 미토콘드리아에 의한 자궁 재생 및 섬유증 감소 효과 분석
실시예 5.1. 아셔만 증후군 마우스 모델의 제작
8주령 암컷 마우스를 사용하여 아셔만 증후군 마우스 모델을 제작하였다. 이 연구는 동물 관리 및 사용위원회(IACUC, 승인 번호 200159)의 승인을 받아 실험을 진행하였다. 실험 동물에 대한 제도적 지침에 따라, 마우스는 차의과학대학교 실험동물센터에서 매일 12시간 동안 온도 및 조명 제어 조건으로 관리되었다. 마우스에 복강 내 주사로 마취제(Avertin)를 투여한 후, 마우스 외/내피를 수직 절개하고 자궁을 노출시켰다. 다음으로, 마우스에 난관 접합부에 위치한 자궁을 작게 절개한 후 자궁 내에 26 게이지 바늘을 삽입하고 회전하여 외상을 유도한 뒤 회수하여 아셔만 증후군 마우스 모델을 수득하였다.
실시예 5.2. 섬유화 지표 변화의 분석
분리된 미토콘드리아 투여에 의한 조직학적 개선효과를 확인하기 위하여, 분리된 미토콘드리아 투여에 의한 섬유화 지표 변화를 분석하였다.
구체적으로, 도 10에 나타낸 것과 같이, 아셔만 마우스 모델의 제작 후 7일차에 상기 실시예 1의 중간엽줄기세포 유래 미토콘드리아 10 μg을 마우스 모델의 자궁내막에 직접 전달하는 방식으로 투여한 후, 14일차에 자궁을 수득하였다.
다음으로, 조직학적 분석을 위해 면역염색을 수행하였다. 조직을 고정액에서 1주일 고정한 뒤, 파라핀 용액에서 침투 과정을 거쳐 블록을 제작하였다. 이를 5 um의 얇은 절편으로 잘라 슬라이드에 붙인 뒤 염색을 진행하였다. 분자생물학적 분석을 위해 섬유화 관련 인자인 Co1a1, Col3a1, Timp1, 및 Tgfβ1의 발현 정도를 분석하고자 real-time RT-PCR을 진행하여 정량화하였다. 조직으로부터 Trizol을 이용하여 RNA를 분리한 뒤, cDNA를 합성하였다. mRNA의 발현을 보기위해 프라이머를 디자인하여 PCR을 수행하였다. 실험에 사용된 프라이머 서열은 아래와 같다.
하기 표 1은 실험에 사용된 프라이머 서열을 나타낸 것이다.
Gene Sequence (5'-3') Size (bp)
Col1a1 Forward CTGGCGGTTCAGGTCCAAT(서열번호 1) 141
Reverse TTCCAGGCAATCCACGAGC(서열번호 2)
Col3a1 Forward ACGTAGATGAATTGGGATGCAG(서열번호 3) 154
Reverse GGGTTGGGGCAGTCTAGTGGC(서열번호 4)
Timp1 Forward GGGTTCCCCAGAAATCAACGAG(서열번호 5) 139
Reverse ACAGAGGCTTTCCATGACTGGGGTG(서열번호 6)
Tgfβ1 Forward GTGAAACGGAAGCGCATCGAAG(서열번호 7) 193
Reverse CATAGTAGTCCGCTTCGGGCTCC(서열번호 8)
그 결과, 도 11에 나타낸 것과 같이, Masson's trichrome 염색에 의해 파란색으로 나타나는 COL1A1(콜라겐)의 축적이 아셔만 증후군 자궁군(AS)에서 증가하였으나, MT 처리에 의해 감소함을 확인하였다. 이러한 결과는, 섬유성 병변이 MT 처리로 인해 감소하였음을 의미하는 것이다.
또한, 도 12 및 도 13에 나타낸 것과 같이, mRNA level과 단백질 수준에서 섬유화 인자들(Col1a1, Col3a1, Timp1 및 Tgfβ1)의 발현이 AS 군에서 증가하며 MT를 처리한 군의 경우 MSC를 처리한 군과 비슷하게 감소됨을 확인하였다. 이러한 결과는, 아셔만 증후군의 섬유화 표현형이 MT를 주입한 아셔만 증후군 마우스 모델의 자궁에서 현저하게 감소하였음을 의미한다.
실시예 6. 분리된 미토콘드리아 투여에 의한 기능적 개선 효과 분석
실시예 6.1. 분리된 미토콘드리아 투여에 의한 착상률, 출산율 및 산자 수의 분석
분리된 미토콘드리아 투여에 의한 기능적 개선효과를 확인하기 위하여, 도 14에 나타낸 것과 같은 방법으로 실험을 수행하였다. 구체적으로, 상기 실시예 5.1의 마우스 모델 유도 후 7일차에 상기 실시예 1의 미토콘드리아를 자궁내막에 10 μg을 직접 전달하는 방식으로 투여하였다.
다음으로, 투여 후 7일 뒤에 수컷 마우스와의 교배를 위해 합사하였고, 매일 아침 정상적인 교배 후 암컷의 생식기에서 관찰되는 플러그를 확인하여 교배 여부를 확인하였다. 플러그가 확인된 날을 1일로 하였을 때, 임신 중기에 해당되는 임신 12일차에 착상된 배아의 수 및 무게를 관찰하였다.
그 결과, 도 15에 나타낸 것과 같이, 사람의 임신 중기를 대변하는 마우스 모델 임신 12일째를 통해 분리된 미토콘드리아(MT) 투여에 따라 착상된 배아의 수가 증가함을 확인하였다. 또한, 도 16에 나타낸 것과 같이, 착상된 배아만을 획득하여 무게를 측정한 결과 아셔만 증후군(AS) 군과 비교했을 때, 무게 또한 증가하였다.
실시예 6.2. 분리된 미토콘드리아 투여에 의한 배아 발달 분석
분리된 미토콘드리아 투여에 의한 임신 말기의 배아 발달 정도를 확인하기 위하여, 임신 12일차 오전에 CO2를 이용하여 마우스를 희생시키고, 복부 면에서 외/내피를 수직 절개하여 자궁을 완전히 노출시켰다. 다음으로 노출된 자궁에 착상된 배아의 수를 파악하여 도식화하였다.
그 결과, 도 17에 나타낸 것과 같이, AS 군은 실제 아셔만 증후군 환자에서 관찰되는 불규칙한 생식주기와 유사하게 임신까지 걸리는 시간(Time to conceive)이 상대적으로 길었으나, MT 군은 정상군(Sham)과 유사한 정도로 시간이 단축되는 것을 확인하였다. 또한, 도 18 및 도 19에 나타낸 것과 같이, MT 군은 MSC 군과 비슷한 정도로 출산율 및 산자수 또한 개선되었다.
실시예 7. 분리된 미토콘드리아 투여에 의한 초기 배아 착상률 분석
상기 실시예 6.1과 동일하게 처리된 아셔만 마우스 모델의 임신 초기 착상된 배아의 수를 확인하였다. 구체적으로, 임신 초기에 해당하는 임신 5일차에 마우스 모델에 시카고 블루 용액을 정맥 주사하여 배아 착상 주변 혈관의 침투성을 증가시킴으로써 염색된 착상 위치를 확인하였다.
그 결과, 도 20에 나타낸 것과 같이, AS 군의 자궁에서는 착상되지 못한 배아가 확인되었으나 MT 군의 경우 배아의 착상이 정상적인 시점에 이루어졌으며, MT 군의 경우 임신 5일째 착상된 배아의 수가 증가되었다.
실시예 8. 분리된 미토콘드리아 투여에 의한 세포증식 효과 분석
실시예 8.1. 혈관내피세포 마커의 면역형광염색 분석
분리된 미토콘드리아 투여에 의한 세포증식 효과를 확인하기 위하여, 상기 실험예 5.1의 마우스 모델의 자궁에 상기 실시예 1의 중간엽줄기세포 유래 미토콘드리아를 투여하여 면역형광염색을 수행하였다. 구체적으로, 마우스 모델의 자궁을 혈관내피세포 마커 CD31을 이용하여 혈관을 염색하고, 세포증식 마커인 KI-67을 이용하여 증식하는 세포를 염색하였다.
염색에 필요한 샘플을 얻는 방법은 다음과 같다. 미토콘드리아를 투여한 자궁을 적출하여 고정액에서 고정한 후 침투과정을 수행하여 파라핀 블록을 제작하였다. 파라핀 블록 절단기를 이용하여 5 μm의 얇은 절편을 슬라이드에 부착한 뒤 염색을 진행하였다. 염색된 절편은 형광현미경을 이용하여 관찰 및 촬영을 진행하였고, 다수의 사람이 동일한 촬영 사진을 이용하여 전체 세포 수 및 각 항체가 염색된 세포를 계수하였으며 이를 그래프화 하였다.
그 결과, 도 23 및 도 24에 나타낸 것과 같이, CD31+ 혈관세포 중의 KI-67+ 증식세포를 계수하였고, 그 수를 %로 정리한 결과, 전체 혈관세포 중에서 60%로, 증식하는 혈관세포의 비율이 높음을 확인하였다. 이러한 결과는, 분리된 미토콘드리아를 투여할 경우, 자궁 내막의 혈관내피세포가 효과적으로 증식함을 의미한다.
실시예 8.2. 혈관내피세포 표지인자 확인
분리된 미토콘드리아 투여에 의한 세포증식 효과를 확인하기 위하여, 상기 실시예 5.1과 동일한 조건에서 수득한 마우스 모델 자궁의 혈관내피세포 표지인자의 발현을 mRNA 수준에서 확인하였다.
하기 표 2는 실험에 사용된 프라이머 서열을 나타낸 것이다.
Gene Sequence (5'-3') Size (bp)
Hgf Forward CTGACCCAAACATCCGAGTTG(서열번호 9) 125
Reverse TTCCCATTGCCACGATAACAA(서열번호 10)
Igf1 Forward TGCTTCCGGAGCTGTGATCT(서열번호 11) 125
Reverse CGGGCTGCTTTTGTAGGCT(서열번호 12)
Ang1 Forward GGGACAGCAGGCAAACAGA(서열번호 13) 110
Reverse TGTCGTTATCAGCATCCTTCGT(서열번호 14)
Vegfa Forward GCAGGCTGCTGTAACGATGA(서열번호 15) 105
Reverse GCATGATCTGCATGGTGATGTT(서열번호 16)
Hif1α Forward ACAAGTCACCACAGGACAG(서열번호 17) 168
Reverse AGGGAGAAAATCAAGTCG(서열번호 18)
Hif2α Forward AATGACAGCTGACAAGGAGAAAAA(서열번호 19) 257
Reverse GAGTGAAGTCAAAGATGCTGTGTC(서열번호 20)
그 결과, 도 21 및 도 22에 나타낸 것과 같이, 혈관내피세포 표지인자로 알려진 Hgf, Igf1, Ang1, Vegfa, Hif1α 및 Hif2α의 mRNA 발현이 AS 군에 비해 MT 군에서 유의적으로 증가하였으며, 증가 정도는 MSC 군과 비슷하였다.
실시예 8.3 Dead MT 투여에 의한 섬유화지표 변화 분석
분리된 미토콘드리아의 활성 유무에 따른 섬유화지표 변화의 차이를 확인하기 위하여, 상기 실시예 4.4.4와 동일한 방법으로 줄기세포 유래 MT의 인위적 dead를 유도한 뒤 상기 실시예 5.1의 마우스 모델에 주입하였다. 다음으로, 상기 실시예 5.2와 동일한 방법으로 섬유화 관련 인자인 Col1a1, Col3a1, Timp1 및 Tgfβ1의 발현을 RT-PCR 및 real-time RT-PCR을 통해 분석하였다.
그 결과, 도 25에 나타낸 것과 같이, Dead MT를 주입하였을 때는 섬유화 상태가 전혀 감소되지 않았으나, live MT을 주입할 경우에는 섬유화 상태가 감소하였다. 또한, 도 26에 나타낸 것과 같이, 주입 용량별 섬유화 개선 효과가 있음을 확인하였다. 상기 주입 용량은 실시예 4.1과 같이 미토콘드리아 단백질 함량을 정량한 것이다.
실시예 9. 분리된 미토콘드리아의 투여 방법별 및 농도별 섬유화지표 변화의 분석
분리된 미토콘드리아의 투여방법별 및 농도별 섬유화지표 변화의 차이를 확인하기 위하여, 도 27에 나타낸 것과 같이, 줄기세포 유래 미토콘드리아를 정맥 내 투여 방식으로 상기 실시예 5.1의 마우스 모델에 주입하였다.
구체적으로, 도 27에 나타낸 것과 같이, 아셔만 마우스 모델의 제작 후 7일차에 줄기세포 유래 미토콘드리아 10 μg을 마우스 모델의 꼬리에 위치한 정맥에 주사하여 전달하는 방식으로 투여한 후, 14일차에 자궁을 수득하였다.
다음으로, 조직학적 분석을 위해 면역염색을 수행하였다. 조직을 고정액에서 1주일 고정한 뒤, 파라핀 용액에서 침투 과정을 거쳐 블록을 제작하였다. 이를 5 um의 얇은 절편으로 잘라 슬라이드에 붙인 뒤 염색을 진행하였다. 분자생물학적 분석을 위해 섬유화 관련 인자인 Co1a1, Col3a1, Timp1, 및 Tgfβ1의 발현 정도를 분석하고자 real-time RT-PCR을 진행하여 정량화하였다. 조직으로부터 Trizol을 이용하여 RNA를 분리한 뒤, cDNA를 합성하였다. mRNA의 발현을 보기위해 프라이머를 디자인하여 PCR을 수행하였다.
그 결과, 도 28에 나타낸 것과 같이, 분리된 미토콘드리아의 전달 방식을 정맥 내 투여(intravenous)로 변경하였을 때에도, 면역염색을 통해서 확인할 수 있듯이 COL1A1의 발현이 MT 주입에 의해서 감소되는 것을 확인하였다. 또한, 도 29에서 나타낸 것과 같이, mRNA level에서 관찰한 결과에서 Col1a1, Col3a1, Timp1 및 Tgfβ1의 발현이 MT 군에서 낮아지므로 섬유화 개선효과가 있음을 확인하였다. 이러한 결과는, 분리된 미토콘드리아를 손상된 조직에 직접 주입하는 방식 및 정맥주사로 주입하는 방식 모두 미토콘드리아에 의한 섬유화 개선효과가 있음을 의미한다.
더불어, 분리된 미토콘드리아의 정맥 내 투여에 의한 마우스 내의 면역세포의 변화를 확인하였다. 구체적으로, 마우스의 혈액과 자궁내의 면역세포를 분리하였고, 이를 유세포분석을 통해 면역세포의 양적 변화에 차이가 있는지 관찰하였다.
그 결과, 도 30 및 도 31에 나타낸 것과 같이, 미토콘드리아를 투여한 AS 마우스의 혈액 및 자궁의 면역 세포에서 다양한 변화가 관찰되었다. 특히 도 30에 나타낸 것과 같이, CD45를 발현하는 전체 면역세포의 침윤이 자궁 내에서 유의하게 관찰되었다. 또한, 도 31에 나타낸 것과 같이, 미토콘드리아를 투여한 마우스에서 대식세포 마커인 F4/80의 발현이 증가하였으며, 염증성 마커인 CD80의 발현이 MSC를 투여한 군과 비슷하게 감소하고, 항염증성 마커인 CD206의 발현은 MSC를 투여한 군과 비슷하게 증가함을 확인하였다.
다음으로, 미토콘드리아의 투여에 따른 손상된 자궁의 재생 과정에서 대식세포의 중요성을 확인하기 위하여, 도 32에 나타낸 것과 같이, 클로드로네이트(clodronate, CL)라는 독성 물질이 함유된 리포좀을 정맥주사를 통해 전달하여 상기 실시예 5.1의 마우스 모델에서 대식세포 결핍환경을 조성하였다.
아셔만 마우스 모델의 제작 후 7일차에 줄기세포 유래 미토콘드리아 10 μg를 마우스 모델의 꼬리에 위치한 정맥에 주사하여 전달하는 방식으로 투여한 후, 14일차에 자궁을 수득하였다.
다음으로, 조직학적 분석을 위해 면역염색을 수행하였다. 구체적으로, 조직을 고정액에서 1주일 고정한 뒤, 파라핀 용액에서 침투 과정을 거쳐 블록을 제작하였다. 이를 5 μm의 얇은 절편으로 잘라 슬라이드에 붙인 뒤 염색을 진행하였다. 또한, 분자생물학적 분석을 위해 섬유화 관련 인자인 Co1a1, Col3a1의 발현 정도를 분석하고자 real-time RT-PCR을 진행하여 정량화하였다. 조직으로부터 Trizol을 이용하여 RNA를 분리한 뒤, cDNA를 합성하였다. mRNA의 발현을 보기 위해 프라이머를 디자인하여 PCR을 수행하였다.
그 결과, 도 33에 나타낸 것과 같이, 대식세포 마커인 F4/80의 발현이 확인되지 않아, 모든 군의 자궁 내 대식세포가 결핍되었음을 확인하였다. 또한, 도 34와 도 35에 나타낸 것과 같이, COL1A1 형광면역 염색과 Realtime RT-PCR을 통해 대식세포가 결핍된 상태에서는 MT를 주입하여도 조직이 재생되지 않음을 확인하였다. 이러한 결과는, 미토콘드리아 투여에 의한 섬유화 조절이 대식세포와 관련성이 높음을 의미한다.
실시예 10. 분리된 미토콘드리아의 대식세포 극성 조절 확인
마우스 대식세포주인 RAW264.7을 이용하여 분리된 미토콘드리아가 대식세포의 분극화에 영향을 미치는지 확인하였다.
구체적으로, 도 36에 나타낸 것과 같이, LPS를 이용하여 염증성 환경인 M1 분극 상태를 조성하였고, 분리된 미토콘드리아 10 μg 처리를 통해 염증성 환경이 완화된 M2 분극 환경을 조성하였다(미토콘드리아 단백질 기준 정량).
그 결과, 도 37에 나타낸 것과 같이, 처리한 미토콘드리아(붉은색)가 4시간부터 6시간내에 대식세포 내(초록색)로 위치하는 것을 확인하였다. 미토콘드리아는 Mito tracker를 이용하여 서로 다른 색으로 염색함으로써 위치를 파악하는데 활용하였다. 또한 도 38에 나타낸 것과 같이, 염증성 인자들(iNOS, Socs3)의 발현이 MT 처리군에서 감소하고, 항 염증성 인자들(Arg1, Mrc1)의 발현은 MT 처리 군에서 증가함을 mRNA level에서 확인하였다.
또한, MT 처리군은 IL-4 처리를 하여 대식세포의 M2 극성을 유도한 군과 비슷하게 염증성 마커인 CD80은 감소하였고, 항 염증성 마커인 CD206은 증가하였다. 이때, IL-4는 10 ng/ml의 농도로 12시간 동안 세포에 처리하였다. 물질이 처리된 세포는 고정액을 이용해 고정하였고, 4% BSA로 상온에서 1시간 블록킹을 진행하였다. 이후 CD80과 CD206을 각각 4% BSA에 1:200으로 희석한 뒤 세포에 반응시켰다. 4℃ 냉장보관을 하루 진행하였고, 2차 항체를 각각 4% BSA에 1:1000으로 희석하여 상온에서 1시간 반응하였고 이 후 마운팅을 수행하여 형광현미경을 이용하여 도 39의 이미지를 얻었다. 최종적으로 FACS 실험을 통해서도 동일한 결과를 확인하였다.
물질이 처리된 세포를 트립신을 이용하여 튜브에 모은 뒤, 형광이 부착된 항체를 각각 1:200으로 FACS buffer (DPBS + 0.2% BSA)에 희석하여 세포와 반응시킨다. 30분 뒤, FACS buffer를 이용하여 2번의 wash 과정 후 FACS 기기를 통해 항체에 반응하는 세포의 수를 도 40과 같이 분석하였다. 이러한 결과는, 대식세포에 분리된 미토콘드리아를 처리하였을 때 CD80의 발현은 감소하였고 CD206의 발현은 증가하였으므로, 미토콘드리아가 대식세포를 M1에서 M2로 분극화 시켰음을 의미한다.
실시예 11. 분리된 미토콘드리아의 HUVEC 이동 및 형성 촉진 확인
실시예 10의 방법을 이용하여 실시예 1의 분리된 미토콘드리아가 인간 제대 정맥 내피 세포(HUVEC)의 이동(migration)과 관 형성(tube formation)에 영향을 미치는지 확인하였다.
구체적으로, 도 41에 나타낸 것과 같이, MT 처리에 따라 극성이 유도된 대식세포를 HUVEC 세포와 공배양을 함으로써 HUVEC 세포의 이동과 관 형성을 관찰하였다. 이때, HUVEC 세포의 이동 관찰을 위해 일정한 간격으로 공간을 만든 뒤 공배양을 수행하였다. 이때, 대조군은 IL-4 처리를 하여 대식세포의 M2 극성을 유도하였다.
그 결과, 도 42에 나타낸 것과 같이, MT에 의해 M2 극성을 나타내는 대식세포와 공배양한 경우, IL-4 처리를 통해 M2 극성이 유도된 대조군과 유사하게 세포의 이동을 촉진시킴을 확인하였다. 또한, 도 43 및 도 44에 나타낸 것과 같이, MT에 의해 M2 극성을 나타내는 대식세포와 공배양한 경우, 대조군보다도 현저하게 관 형성도 촉진됨을 확인하였다.

Claims (16)

  1. 분리된 미토콘드리아를 유효성분으로 포함하는 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 약학 조성물.
  2. 제1항에 있어서,
    상기 미토콘드리아는 세포 또는 혈장으로부터 분리된 것인, 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 약학 조성물.
  3. 제2항에 있어서,
    상기 세포는 체세포, 생식세포, 줄기세포, 혈액세포 또는 이들의 조합인 것인, 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 약학 조성물.
  4. 제3항에 있어서,
    상기 줄기세포가 중간엽줄기세포, 역분화줄기세포, 배아줄기세포 또는 이들의 조합인 것인, 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 약학 조성물.
  5. 제4항에 있어서,
    상기 중간엽줄기세포는 탯줄, 제대혈, 골수, 지방, 근육, 신경, 피부, 양막, 태반, 활액, 정소, 골막 또는 이들의 조합인 것인, 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 약학 조성물.
  6. 제2항에 있어서,
    상기 혈장은 골수, 제대혈 또는 말초혈액의 혈장인 것인, 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 약학 조성물.
  7. 제1항에 있어서,
    상기 약학 조성물은 섬유화 인자의 발현을 감소시키는 것인, 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 약학 조성물.
  8. 제7항에 있어서,
    상기 섬유화 인자는 Col1a1, Col3a1, Timp1 및 Tgfβ1으로 구성된 군으로부터 선택된 하나 이상의 것인, 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 약학 조성물.
  9. 제1항에 있어서,
    상기 약학 조성물은 Hgf, Igf1, Ang1, Vegf-A, Hif1α 및 Hif2α로 구성된 군으로부터 선택된 하나 이상의 혈관내피세포 표지인자의 발현을 증가시키는 것인, 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 약학 조성물.
  10. 제1항에 있어서,
    상기 약학 조성물은 자궁 내 직접 투여 제제, 정맥, 근육 또는 피하 투여용 주사제인 것인, 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 약학 조성물.
  11. 제1항에 있어서,
    상기 아셔만 증후군 합병증은 자궁유착, 자궁근종, 자궁내막증, 자궁외 임신, 유산, 난소낭종, 생리장애, 난임, 불임, 골반유착, 골반통 및 골반염으로 이루어진 군에서 선택되는 하나 이상인 것인, 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 약학 조성물.
  12. 제1항에 있어서,
    상기 약학 조성물 내 미토콘드리아는 0.1 ㎍/㎖ 내지 1,000 ㎍/㎖ 농도로 포함되는 것인, 아셔만 증후군 또는 이의 합병증의 예방 또는 치료용 약학 조성물.
  13. 제1항 내지 제12항 중 어느 한 항의 약학 조성물을 개체에 투여하는 단계를 포함하는 아셔만 증후군 또는 이의 합병증의 예방 또는 치료 방법.
  14. 제13항에 있어서,
    상기 투여하는 단계는 약학 조성물을 개체의 자궁내 직접 투여, 정맥, 근육 또는 피하 투여하는 단계인 것인, 아셔만 증후군 합병증의 예방 또는 치료 방법.
  15. 아셔만 증후군 또는 이의 합병증의 예방 또는 치료를 위한 분리된 미토콘드리아의 용도.
  16. 아셔만 증후군 또는 이의 합병증의 치료 또는 예방용 약제를 제조하기 위한 분리된 미토콘드리아의 용도.
PCT/KR2022/004637 2021-07-23 2022-03-31 분리된 미토콘드리아를 유효성분으로 포함하는 아셔만 증후군 예방 또는 치료용 약학 조성물 WO2023003130A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202280064143.1A CN117979980A (zh) 2021-07-23 2022-03-31 用于预防或治疗阿谢曼综合征的包含分离的线粒体作为活性成分的药物组合物

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20210097096 2021-07-23
KR10-2021-0097096 2021-07-23

Publications (1)

Publication Number Publication Date
WO2023003130A1 true WO2023003130A1 (ko) 2023-01-26

Family

ID=84980351

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/004637 WO2023003130A1 (ko) 2021-07-23 2022-03-31 분리된 미토콘드리아를 유효성분으로 포함하는 아셔만 증후군 예방 또는 치료용 약학 조성물

Country Status (3)

Country Link
KR (1) KR20230015832A (ko)
CN (1) CN117979980A (ko)
WO (1) WO2023003130A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190124656A (ko) * 2018-04-26 2019-11-05 주식회사 파이안바이오테크놀로지 개질된 미토콘드리아 및 이의 용도
KR20200049676A (ko) * 2018-10-31 2020-05-08 차의과학대학교 산학협력단 분리된 미토콘드리아를 포함하는 건병증 예방 또는 치료용 약학 조성물
WO2020222866A1 (en) * 2019-05-02 2020-11-05 Children's Medical Center Corporation Prophylactic and therapeutic use of mitochondria and combined mitochondrial agents
WO2021009658A1 (en) * 2019-07-12 2021-01-21 Vasanthi Palanivel Compositions for treatment of asherman's syndrome, methods for preparing the same and applications thereof
KR20210058334A (ko) * 2019-11-14 2021-05-24 강원대학교산학협력단 혈관외피줄기세포 배양액 또는 사이클로필린 a를 포함하는 아셔만 증후군 치료용 조성물

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2725006C2 (ru) 2014-06-17 2020-06-29 Айдженомикс, С.Л. Терапия стволовыми клетками при патологиях эндометрия

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190124656A (ko) * 2018-04-26 2019-11-05 주식회사 파이안바이오테크놀로지 개질된 미토콘드리아 및 이의 용도
KR20200049676A (ko) * 2018-10-31 2020-05-08 차의과학대학교 산학협력단 분리된 미토콘드리아를 포함하는 건병증 예방 또는 치료용 약학 조성물
WO2020222866A1 (en) * 2019-05-02 2020-11-05 Children's Medical Center Corporation Prophylactic and therapeutic use of mitochondria and combined mitochondrial agents
WO2021009658A1 (en) * 2019-07-12 2021-01-21 Vasanthi Palanivel Compositions for treatment of asherman's syndrome, methods for preparing the same and applications thereof
KR20210058334A (ko) * 2019-11-14 2021-05-24 강원대학교산학협력단 혈관외피줄기세포 배양액 또는 사이클로필린 a를 포함하는 아셔만 증후군 치료용 조성물

Also Published As

Publication number Publication date
KR20230015832A (ko) 2023-01-31
CN117979980A (zh) 2024-05-03

Similar Documents

Publication Publication Date Title
WO2018101708A1 (ko) 미토콘드리아를 포함하는 약학 조성물
WO2012026712A2 (ko) Ｎｏｄ２의 아고니스트를 처리한 줄기세포 또는 그 배양물을 포함하는 면역질환 또는 염증질환의 예방 또는 치료용 약학조성물
Shooner et al. TGF-beta expression during rat pregnancy and activity on decidual cell survival
WO2018097540A9 (ko) 무혈청면역세포배양용 배지첨가키트, 상기 키트를 이용한 면역세포배양방법, 상기 키트 또는 배양방법에 의해 얻어진 무혈청면역세포배양액 및 상기 배양액을 포함하는 화장료조성물
WO2017057892A1 (ko) 스페로이드형 세포집합체를 함유하는 난소기능 개선용 약학조성물 및 이의 제조방법
WO2019117633A1 (ko) 아토피성 피부염, 탈모, 상처 또는 피부 주름의 개선용 화장료 조성물 및 약학 조성물
WO2012067437A2 (ko) 간 절제를 위한 간 부피 증가용 조성물
Zhao et al. Human umbilical cord mesenchymal stem cell-derived exosomes inhibit ovarian granulosa cells inflammatory response through inhibition of NF-κB signaling in polycystic ovary syndrome
WO2018056706A1 (ko) 티오레독신 결합단백질 유래 펩타이드 또는 이를 암호화 하는 폴리뉴클레오타이드를 유효성분으로 함유하는 노화 줄기세포의 역노화용 조성물 및 이의 용도
Wilsher et al. The immunolocalization of Galectin-1 and Progesterone-Induced Blocking Factor (PIBF) in equine trophoblast: Possible roles in trophoblast invasion and the immunological protection of pregnancy
WO2023003130A1 (ko) 분리된 미토콘드리아를 유효성분으로 포함하는 아셔만 증후군 예방 또는 치료용 약학 조성물
WO2020091463A1 (ko) 분리된 미토콘드리아를 포함하는 건병증 예방 또는 치료용 약학 조성물
KR102477288B1 (ko) 혈관외피줄기세포 배양액 또는 사이클로필린 a를 포함하는 아셔만 증후군 치료용 조성물
WO2023033500A1 (ko) 세포 밖 소포체 함유 안표면 염증 질환 예방 또는 치료용 조성물
WO2022108165A1 (ko) 역분화 줄기세포 유래 중간엽 줄기세포로부터 분리된 엑소좀의 제조방법 및 이의 용도
WO2016027990A1 (ko) Ｄｕｓｐ５를 유효성분으로 모두 포함하는 골대사성 질환의 예방 또는 치료용 약학적 조성물
WO2013162330A1 (ko) 키메라 중간엽 줄기세포군, 그의 제조방법 및 편도줄기세포를 이용하여 부갑상선 호르몬을 생산하는 방법
WO2015023147A1 (ko) mTOR/STAT3 신호억제제 처리된 면역조절능을 갖는 간엽 줄기세포 및 이를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물
WO2015023165A1 (ko) 염증조절복합체 및 ｓｔａｔ３ 신호분자 차단을 통한 면역조절능 최적화된 안정화 중간엽줄기세포
WO2021125844A1 (ko) 인간 만능 줄기세포로부터 제작된 3d 오가노이드를 해체하여 희소돌기아교세포를 다량 확보하는 분화방법
WO2020222566A1 (ko) 분리된 미토콘드리아를 유효성분으로 포함하는 근염 예방 또는 치료용 약학 조성물
WO2020122498A1 (ko) 클로날 줄기세포를 포함하는 췌장염 치료용 약학적 조성물
WO2019212123A1 (ko) 수지상세포의 이동능을 증가시키는 방법 및 이의 용도
Quintar et al. Increased expression of uteroglobin associated with tubal inflammation and ectopic pregnancy
WO2018143615A1 (ko) 페록시레독신 1 단백질의 활성 억제제를 유효성분으로 함유하는 골질환의 예방 또는 치료용 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22846002

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 202280064143.1

Country of ref document: CN