WO2022270857A1 - Nadh:quinone 산화환원효소의 발현이 조절된 재조합 미생물 및 이를 이용한 o-포스포세린, 시스테인 및 이의 유도체의 생산방법 - Google Patents

Nadh:quinone 산화환원효소의 발현이 조절된 재조합 미생물 및 이를 이용한 o-포스포세린, 시스테인 및 이의 유도체의 생산방법 Download PDF

Info

Publication number
WO2022270857A1
WO2022270857A1 PCT/KR2022/008745 KR2022008745W WO2022270857A1 WO 2022270857 A1 WO2022270857 A1 WO 2022270857A1 KR 2022008745 W KR2022008745 W KR 2022008745W WO 2022270857 A1 WO2022270857 A1 WO 2022270857A1
Authority
WO
WIPO (PCT)
Prior art keywords
activity
phosphoserine
microorganism
sequence
gene
Prior art date
Application number
PCT/KR2022/008745
Other languages
English (en)
French (fr)
Inventor
정휘민
박혜민
심희진
이진남
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to JP2023579425A priority Critical patent/JP2024522877A/ja
Priority to EP22828704.1A priority patent/EP4361276A1/en
Priority to AU2022297143A priority patent/AU2022297143A1/en
Priority to BR112023027397A priority patent/BR112023027397A2/pt
Priority to CN202280057073.7A priority patent/CN117897489A/zh
Priority to CA3223970A priority patent/CA3223970A1/en
Priority to MX2024000244A priority patent/MX2024000244A/es
Priority to US18/573,419 priority patent/US20240294955A1/en
Publication of WO2022270857A1 publication Critical patent/WO2022270857A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0036—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/12—Methionine; Cysteine; Cystine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y106/00—Oxidoreductases acting on NADH or NADPH (1.6)
    • C12Y106/99—Oxidoreductases acting on NADH or NADPH (1.6) with other acceptors (1.6.99)
    • C12Y106/99005—NADH dehydrogenase (quinone) (1.6.99.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/03003—Phosphoserine phosphatase (3.1.3.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y106/00—Oxidoreductases acting on NADH or NADPH (1.6)
    • C12Y106/05—Oxidoreductases acting on NADH or NADPH (1.6) with a quinone or similar compound as acceptor (1.6.5)
    • C12Y106/05009—NADH:ubiquinone reductase (non-electrogenic) (1.6.5.9)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
    • C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
    • C12Y205/01065—O-Phosphoserine sulfhydrylase (2.5.1.65)

Definitions

  • the present application relates to a recombinant microorganism whose expression of NADH:quinone oxidoreductase is regulated and a method for producing O-phosphoserine, cysteine and cysteine derivatives using the same.
  • L-cysteine is an important amino acid in the sulfur metabolism of all organisms. It is used in the synthesis of proteins, glutathione, biotin, methionine and other sulfur-containing metabolites in vivo, such as keratin in hair, and is used as a precursor for coenzyme A biosynthesis. do.
  • O-phosphoserine Method of converting L-cysteine by fermenting production of hereinafter "OPS" and then reacting with sulfide under the catalytic action of O-phosphoserine sulfhydrylase (hereinafter "OPSS”) (US 2012-0190081 A1) is known.
  • An object of the present application is to provide a recombinant microorganism whose expression of NADH:quinone oxidoreductase is regulated and a method for producing O-phosphoserine, cysteine and cysteine derivatives using the same.
  • An object of the present application is to provide a recombinant microorganism of the genus Escherichia having enhanced activity of NADH:quinone oxidoreductase and an ability to produce O-phosphoserine.
  • Another object of the present application is to provide a method for producing O-phosphoserine, including culturing the O-phosphoserine-producing microorganism of the present application in a medium.
  • Another object of the present application is a) NADH: culturing an O-phosphoserine-producing microorganism in a culture medium in which the activity of quinone oxidoreductase is enhanced to produce O-phosphoserine or a medium containing the same; and b) reacting O-phosphoserine produced in step a) or a medium containing the same with sulfide in the presence of O-phosphoserine sulfhydrylase (OPSS) or a microorganism expressing the same.
  • OPSS O-phosphoserine sulfhydrylase
  • the OPS-producing microorganism with enhanced activity of the NADH:quinone oxidoreductase of the present application can produce OPS with high efficiency.
  • One aspect of the present application is to provide a microorganism that produces O-phosphoserine, in which the activity of NADH:quinone oxidoreductase is enhanced.
  • OPS O-phosphoserine
  • OPSS O-phosphoserine sulfhydrylase
  • NADH:quinone oxidoreductase (NADH:quinone oxidoreductase, hereinafter, "Nuo")
  • NADH:quinone oxidoreductase hereinafter, "Nuo”
  • the enzyme protein may also be named NADH dehydrogenase-1 (NDH-1).
  • the gene encoding the protein may be, for example, the nuoABCEFGHIJKLMN gene cluster, but is not limited thereto.
  • the nuoABCEFGHIJKLMN gene cluster constitutes the nuo operon, and its expression can be controlled by a promoter at the front of the operon and a polynucleotide at the ribosome binding site.
  • 'nuoABCEFGHIJKLMN gene' may be used interchangeably with 'NADH: quinone oxidoreductase encoding gene', 'nuoABCEFGHIJKLMN gene', 'nuo operon', and 'nuo gene'.
  • operon refers to a functional unit of DNA including a group of genes whose expression is regulated by one expression control sequence, specifically, one promoter.
  • the mRNA transcribed by the operon may be polycistronic mRNA in which a single mRNA molecule encodes more than one protein, or monocistronic mRNA in which a single mRNA molecule encodes one protein.
  • Nuo is a complex of 13 subunit proteins (NuoA, NuoB, NuoC, NuoE, NuoF, NuoG, NuoH, NuoI, NuoJ, NuoK, NuoL, NuoM, NuoN), and each subunit protein has two types of translation.
  • the operons of nuoABCEFGHIJKL and nuoMN are used as templates.
  • the structure of the nuo operon can be found in EcoCyc ( www.biocyc.org ) (accession number: EG12082). It is known that the nuo operon includes a structure gene and a regulatory region.
  • the "expression control region" of the nuo operon refers to a region present upstream of structural genes constituting the nuo operon and capable of controlling the expression of structural genes.
  • the expression control region of the nuo operon may include a promoter (nuoA promoter and/or nuoM promoter) and an operator excluding structural genes, and may specifically include a promoter.
  • the nuo operon has at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology to the amino acid sequence represented by SEQ ID NO: 26 to SEQ ID NO: 38 ) or a base sequence encoding an amino acid sequence having identity.
  • the nuo operon includes SEQ ID NOs: 26 to 38 or a structural gene sequence encoding an amino acid sequence having homology or identity thereto and exhibiting a function corresponding thereto; and an expression control region for regulating the expression of the structural gene sequence.
  • the sequences of SEQ ID NOs: 26 to 38 can be identified in a known database, NCBI Genbank.
  • the nuo operon has at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology with SEQ ID NO: 1 and / or SEQ ID NO: 1 ( It may be a nucleotide sequence having homology or identity.
  • SEQ ID NO: 1 and / or SEQ ID NO: 1 may be a nucleotide sequence having homology or identity.
  • nucleotide sequence has such homology or identity and exhibits a function corresponding to the nuo operon, it is obvious that nucleotide sequences in which some sequences are deleted, modified, substituted, or added are also included within the scope of the present application.
  • Sequence homology or identity of conserved polynucleotides or polypeptides can be determined by standard alignment algorithms, together with default gap penalties established by the program used. Substantially homologous or identical sequences are usually at least about 50%, 60%, 70%, 80% of the entirety or full-length sequence under moderate or high stringent conditions. or more than 90% hybrid. Hybridization is also contemplated for polynucleotides that contain degenerate codons in lieu of codons in the polynucleotide.
  • Homology or identity to the polypeptide or polynucleotide sequence can be determined, for example, by the algorithm BLAST according to the literature [Kalin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)], or FASTA by Pearson (Methods Enzymol., 183, 63, 1990). Based on this algorithm BLAST, a program called BLASTN or BLASTX has been developed (see: http://www.ncbi.nlm.nih.gov).
  • the type of microorganism of the present application is not particularly limited as long as it can produce OPS, and both prokaryotic and eukaryotic cells are possible, but may specifically be prokaryotic cells.
  • the prokaryotic cells are, for example, Escherichia genus, Erwinia genus, Seratia genus, Providencia genus, Corynebacterium genus, and Brevibacterium genus. ( Brevibacterium ) It may include microbial strains belonging to the genus, specifically Escherichia genus microorganisms, more specifically Escherichia coli ( Escherichia coli ), but it may be, but is not limited thereto.
  • OPS and L-serine can be produced through SerA, SerC, and SerB, which are enzymes in the biosynthetic pathway of L-serine (Ahmed Zahoor, Computational and structural biotechnology journal, vol 3 , 2012 October;Wendisch VF et al., Curr Opin Microbiol.2006 Jun;9(3):268-74;Peters-Wendisch P et al., Appl Environ Microbiol.2005 Nov;71(ll):7 139-44 .).
  • microorganism producing O-phosphoserine in the present application means a microorganism naturally having the ability to produce O-phosphoserine or a microorganism endowed with the ability to produce O-phosphoserine to a parent strain without the ability to produce O-phosphoserine.
  • the microorganism may be a microorganism that produces O-phosphoserine with enhanced Nuo activity due to natural or artificial genetic modification.
  • the O-phosphoserine-producing microorganism is any microorganism capable of producing O-phosphoserine by enhancing Nuo activity by the method disclosed in the present application.
  • the "microorganism producing O-phosphoserine” may be used interchangeably with "microorganisms producing O-phosphoserine” and "microorganisms capable of producing O-phosphoserine”.
  • the O-phosphoserine-producing microorganism of the present application may be a genetically modified microorganism or a recombinant microorganism in which the activity of Nuo is enhanced and the desired O-phosphoserine-producing ability is increased, but is limited thereto. It doesn't work.
  • enhancing activity of a protein in the present application means that the activity of a protein is increased compared to its intrinsic activity.
  • intrinsic activity refers to the activity of a specific protein originally possessed by a parent strain or unmodified microorganism before transformation when a character is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activation before transformation”.
  • Increased activity of a protein compared to its intrinsic activity means that it is enhanced compared to the activity of a specific protein originally possessed by the parent strain or non-transformed microorganism before transformation.
  • the parent strain may be Escherichia coli ATCC27325.
  • the parent strain may be a strain containing a modification to increase OPS production ability, for example, CA07-0012 (KCCM 11212P; US2012-0190081A) or CA07-4821, but is not limited thereto.
  • the "increase in activity” may be achieved by introducing an exogenous protein or enhancing the activity of an endogenous protein, but specifically, it may be achieved by enhancing the activity of an endogenous protein. Whether or not the activity of the protein is enhanced can be confirmed from an increase in the activity level, expression level, or amount of a product produced from the protein.
  • the enhancement of the activity can be applied by various methods well known in the art, and is not limited as long as the activity of the target protein can be enhanced compared to that of the microorganism before transformation. Specifically, it may be using genetic engineering and / or protein engineering, which is well known to those skilled in the art, which is a routine method of molecular biology, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
  • the protein to be enhanced that is, the target protein
  • the protein to be enhanced may be Nuo, but is not limited thereto as long as it is encoded by the nuo operon and consumes NADH or consumes NADH to form a proton motive force.
  • the enhancement of Nuo activity of the present application includes enhancing the activity of one or more of the subunit proteins constituting the Nuo protein complex.
  • modification of the polynucleotide sequence encoding the protein to enhance protein activity eg, modification of the gene sequence encoding the protein to encode the modified protein to enhance activity
  • It may be a combination of two or more selected from 1) to 8), but is not limited thereto.
  • the 1) increase in the intracellular copy number of the gene encoding the protein is performed by any method known in the art, for example, the gene encoding the protein is operably linked, replicated and functions independently of the host. This can be performed by introducing a vector that can do this into a host cell.
  • the vector capable of inserting the gene into the chromosome of the host cell to which the gene is operably linked may be introduced into the host cell, but is not limited thereto.
  • the term "vector” refers to a DNA preparation containing a polynucleotide sequence encoding a protein of interest in a form operably linked to regulatory sequences suitable for expressing the protein of interest in a suitable host.
  • the expression control sequence may include a promoter capable of initiating transcription, an arbitrary operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating termination of transcription and translation. After transformation into a suitable host cell, the vector can replicate or function independently of the host genome and can integrate into the genome itself.
  • the vector used in the present application is not particularly limited as long as it can be replicated in a host cell, and any vector known in the art may be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pBR-based, pUC-based, and pBluescriptII-based plasmid vectors , pGEM-based, pTZ-based, pCL-based, pSK-based, pSKH-based, pET-based, and the like can be used.
  • pCL, pSK, pSKH130, pDZ, pACYC177, pACYC184, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like may be used.
  • Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • the term "transformation” means introducing a recombinant vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide may be inserted into and located in the chromosome of the host cell or located outside the chromosome.
  • the transformation method includes any method of introducing a nucleic acid into a cell, and can be performed by selecting an appropriate standard technique as known in the art according to the host cell.
  • operably linked means that the polynucleotide sequence is functionally linked to a promoter sequence or an expression control region that initiates and mediates the transcription of a polynucleotide encoding a target protein of the present application. do. Operable linkages can be prepared using genetic recombination techniques known in the art, and site-specific DNA cleavage and linkage can be prepared using cutting and linking enzymes in the art, but are not limited thereto.
  • the method of modifying the gene expression control sequence on the chromosome encoding the protein may be any method known in the art, for example, deletion, insertion, or non-conservative nucleic acid sequence to further enhance the activity of the expression control sequence. Alternatively, it may be performed by inducing a mutation in the sequence by conservative substitution or a combination thereof, or by replacing or inserting a nucleic acid sequence having a stronger activity.
  • the expression control sequence may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence controlling termination of transcription and translation, and the like. The above method may specifically insert a strong heterologous promoter behind the original promoter, but is not limited thereto.
  • Examples of known strong promoters may include the CJ1 to CJ7 promoter (US Patent US 7662943 B2), lac promoter, Trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter and rmf promoter, It includes, but is not limited to, substitution with a promoter that is strong compared to the intrinsic activity.
  • Modification of the nucleotide sequence of the initiation codon or 5'-UTR region of the gene transcript encoding the protein is carried out by any method known in the art, for example, compared to the endogenous initiation codon of the protein. It may be substituted with another initiation codon having a higher protein expression rate, but is not limited thereto.
  • Modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above can be performed by any method known in the art, for example, deletion, insertion, non-conservative or It can be carried out by inducing mutations on the expression control sequence by conservative substitution or a combination thereof, or by replacing it with an improved polynucleotide sequence to have a stronger activity.
  • the replacement may specifically be the insertion of the gene into the chromosome by homologous recombination, but is not limited thereto.
  • the vector used at this time may further include a selection marker for checking whether the chromosome is inserted.
  • Selectable markers are used to select cells transformed with a vector, that is, to check whether a gene to be introduced is inserted or not, and selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of surface proteins can be determined. Markers that impart may be used, but are not limited thereto. In an environment treated with a selective agent, only cells expressing the selectable marker survive or exhibit other phenotypes, so transformed cells can be selected.
  • the introduction of a foreign polynucleotide exhibiting the activity of the protein may be performed by any method known in the art, for example, a foreign polynucleotide encoding a protein exhibiting the same/similar activity as the protein, or a codon-optimized mutation thereof. It can be carried out by introducing the type polynucleotide into a host cell.
  • the foreign polynucleotide may be used without limitation in its origin or sequence as long as it exhibits the same/similar activity as the protein.
  • codons of the introduced foreign polynucleotide may be optimized and introduced into the host cell so that transcription and translation are optimized in the host cell.
  • the introduction may be performed by appropriately selecting a known transformation method by a person skilled in the art, and expression of the introduced polynucleotide in a host cell may produce a protein and increase its activity.
  • Codon optimization of polynucleotides encoding proteins is codon optimization of endogenous polynucleotides to increase transcription or translation in host cells, or optimization of transcription and translation of exogenous polynucleotides in host cells. It may be that the codons of this have been optimized.
  • Analyzing the tertiary structure of a protein to select and modify or chemically modify the exposed site for example, by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored, depending on the degree of sequence similarity. It may be to determine a template protein candidate according to the method, confirm the structure based on this, and modify or modify an exposed portion to be chemically modified to be modified or modified.
  • the activity enhancement of the protein may be any one or more of 1) to 2) above.
  • the activity enhancement of the NADH:quinone oxidoreductase of the present application may be increased expression of the nuo operon.
  • the activity enhancement of the NADH:quinone oxidoreductase may include a gene expression control sequence with enhanced activity upstream of a gene encoding the NADH:quinone oxidoreductase.
  • the upstream of the gene encoding the NADH:quinone oxidoreductase may be upstream of the nuoA gene.
  • the activity enhancement of NADH: quinone oxidoreductase is performed by modifying one expression control sequence present in the nuo operon encoding the Nuo protein complex, thereby modifying one or more structural genes present in the operon, for example, 2 or more, 3 or more. It may be aberrant, or enhanced expression of the entire structural gene sequence.
  • the modification of the expression control sequence may be to additionally insert a gene expression control sequence with enhanced activity between the nuoA gene and the endogenous promoter of the nuo operon, for example, the gene expression control sequence may be a promoter , but not limited thereto.
  • Such enhancement of the activity of a protein may be an increase in the activity or concentration of the corresponding protein based on the activity or concentration of the protein expressed in the wild-type or pre-transformed microbial strain, or an increase in the amount of a product produced from the protein. However, it is not limited thereto.
  • pre-transformation strain or "pre-transformation microorganism” does not exclude strains containing mutations that may occur naturally in microorganisms, and are natural strains themselves, or genetic mutations caused by natural or artificial factors. Means the strain before the character change to . In the present application, the change in the trait may be enhancing the activity of Nuo.
  • the "pre-transformation strain” or “pre-transformation microorganism” may be used interchangeably with "non-transformation strain”, “non-transformation strain”, “non-transformation microorganism”, “non-transformation microorganism” or “reference microorganism”.
  • the microorganism of the present application further enhances the ability to produce OPS and/or to excrete it out of cells; It may include modifications that enhance the resolution and/or entrainment capabilities of the OPS.
  • Attenuation of a polypeptide is a concept that includes both decreased activity compared to intrinsic activity or no activity. The attenuation may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.
  • the attenuation is when the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide originally possessed by the microorganism due to mutation of the polynucleotide encoding the polypeptide, inhibition of gene expression of the polynucleotide encoding it, or translation into a polypeptide.
  • the overall level and/or concentration (expression level) of the polypeptide in the cell is lower than that of the native strain due to inhibition of translation, etc., when the polynucleotide is not expressed at all, and/or when the polynucleotide is expressed Even if there is no activity of the polypeptide, it may also be included.
  • the "intrinsic activity” refers to the activity of a specific polypeptide originally possessed by a parent strain, wild-type or unmodified microorganism before transformation when a character is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activation before transformation”. "Inactivation, depletion, reduction, downregulation, reduction, attenuation" of the activity of a polypeptide compared to its intrinsic activity means that it is lower than the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation.
  • Attenuation of the activity of such a polypeptide may be performed by any method known in the art, but is not limited thereto, and may be achieved by applying various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).
  • an antisense oligonucleotide eg, antisense RNA
  • an antisense oligonucleotide that binds complementarily to the transcript of the gene encoding the polypeptide
  • It may be a combination of two or more selected from 1) to 8), but is not particularly limited thereto.
  • Deletion of part or all of the gene encoding the polypeptide may include removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide in which some nucleotides are deleted, or replacement with a marker gene.
  • modification of the expression control region is a deletion, insertion, non-conservative or conservative substitution, or a combination thereof, resulting in mutations in the expression control region (or expression control sequence), or weaker It may be a replacement with an active sequence.
  • the expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence controlling termination of transcription and translation.
  • the 5) modification of the nucleotide sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a base encoding another initiation codon with a lower polypeptide expression rate than the endogenous initiation codon. It may be substituted with a sequence, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 3) and 4) above is a deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide.
  • a combination thereof may be a sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity or an amino acid sequence or polynucleotide sequence improved to have no activity, but is not limited thereto.
  • expression of a gene may be inhibited or attenuated by introducing a mutation in a polynucleotide sequence to form a stop codon, but is not limited thereto.
  • antisense oligonucleotide e.g., antisense RNA
  • antisense RNA complementary to the transcript of the gene encoding the polypeptide
  • Weintraub, H. et al. Antisense-RNA as a molecular tool. for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].
  • the SerB of the present application has an activity that converts OPS into L-serine, microorganisms mutated to weaken the SerB activity have the characteristic of accumulating OPS and can be usefully used for production of OPS.
  • the SerB of the present application may be a protein having or including the amino acid sequence represented by SEQ ID NO: 2, or a protein consisting of or essentially consisting of the amino acid sequence represented by SEQ ID NO: 2, but is not limited thereto.
  • the SerB of the present application has or contains an amino acid sequence having at least 70%, 80%, 90%, 95% or 99% or more homology or identity with the amino acid sequence shown in SEQ ID NO: 2, as long as it exhibits SerB activity. can do.
  • the SerB of the present application may consist of or consist essentially of an amino acid sequence having at least 70%, 80%, 90%, 95% or 99% or more homology or identity to the amino acid sequence shown in SEQ ID NO: 2, Not limited.
  • the polynucleotide encoding the SerB may have or include nucleotide sequence 3 encoding the amino acid sequence described in SEQ ID NO: 2.
  • the polynucleotide encoding the SerB may consist of or essentially consist of a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 2.
  • the polynucleotide encoding the SerB of the present application may vary in the coding region within a range that does not change the amino acid sequence of the SerB protein due to codon degeneracy or in consideration of codons preferred in organisms intended to express the SerB protein. Transformations can be made.
  • the polynucleotide encoding the SerB of the present application may have or contain a nucleotide sequence with at least 70%, 80%, 90%, 95% or 99% homology or identity with the nucleotide sequence of SEQ ID NO: 3, and less than 100%.
  • polynucleotide encoding SerB of the present application consists of a nucleotide sequence with at least 70%, 80%, 90%, 95% or 99% homology or identity with the nucleotide sequence of SEQ ID NO: 3, and less than 100%, or It may be configured as essential, but is not limited thereto.
  • YhhS of the present application has an activity of excreting OPS, microorganisms mutated to enhance the activity of YhhS have the characteristic of excreting OPS and thus can be usefully used for production of OPS.
  • YhhS of the present application may be a protein having or including the amino acid sequence represented by SEQ ID NO: 4, or a protein consisting of or essentially consisting of the amino acid sequence represented by SEQ ID NO: 4, but is not limited thereto.
  • YhhS of the present application has or contains an amino acid sequence having at least 70%, 80%, 90%, 95% or 99% or more homology or identity with the amino acid sequence shown in SEQ ID NO: 4, as long as it shows the activity of YhhS. can do.
  • YhhS of the present application may consist of or consist essentially of an amino acid sequence having at least 70%, 80%, 90%, 95% or 99% or more homology or identity with the amino acid sequence represented by SEQ ID NO: 4.
  • the polynucleotide encoding YhhS may have or include a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 4.
  • the polynucleotide encoding YhhS may consist of or essentially consist of a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 4.
  • the polynucleotide encoding YhhS of the present application may vary in the coding region within a range that does not change the amino acid sequence of the YhhS protein due to codon degeneracy or in consideration of codons preferred in organisms intended to express the YhhS protein. Transformations can be made.
  • the polynucleotide encoding YhhS of the present application may have or contain a nucleotide sequence with at least 70%, 80%, 90%, 95% or 99% homology or identity with the nucleotide sequence of SEQ ID NO: 5, and less than 100% can
  • the polynucleotide encoding YhhS of the present application consists of a nucleotide sequence with at least 70%, 80%, 90%, 95% or 99% homology or identity with the nucleotide sequence of SEQ ID NO: 5, and less than 100%, or It may be configured as essential, but is not limited thereto.
  • the ability to produce OPS and / or to enhance the ability to excrete out of the cell may be CA07-0012 (KCCM 11212P; US2012-0190081A) or CA07-4821, but is not limited thereto.
  • the microorganism containing a modification that enhances the decomposition and/or uptake of OPS may be CA07-0012 (KCCM 11212P; US2012-0190081A) or CA07-4821, but is not limited thereto.
  • Korean Patent Registration No. 1381048 or US Publication No. 2012-0190081 may be used as reference materials in this application, but is not limited thereto.
  • the present application provides a method for producing OPS, comprising culturing an OPS-producing microorganism in a medium in which the activity of NADH:quinone oxidoreductase is enhanced.
  • microorganisms are as described above.
  • the term "cultivation” means to grow the microorganisms in appropriately controlled environmental conditions.
  • the culturing process of the present application may be performed according to appropriate media and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art according to the selected strain.
  • the culture may be batch, continuous and fed-batch, but is not limited thereto.
  • glycine or serine may be further included in the medium.
  • Glycine may be provided in the form of purified glycine, yeast extract containing glycine, and tryptone, and the concentration contained in the culture medium may be usually 0.1 to 10 g/L, specifically 0.5 to 3 g/L.
  • serine may be provided in the form of purified serine, serine-containing yeast extract, tryptone, etc., and the concentration contained in the culture medium may be usually 0.1 to 5 g/L, specifically 0.1 to 1 g/L.
  • Carbon sources included in the medium include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil, palmitic acid, Fatty acids such as stearic acid and linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid may be included, and these materials may be used individually or as a mixture, but are not limited thereto.
  • sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose
  • oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil, palmitic acid
  • Fatty acids such as stearic acid and linoleic acid
  • alcohols such as glycerol and ethanol
  • organic acids such as acetic acid
  • Nitrogen sources included in the medium include organic nitrogen sources such as peptone, yeast extract, broth, malt extract, corn steep liquor and soybean wheat, and inorganic nitrogen sources such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. These nitrogen sources may be used alone or in combination, but are not limited thereto.
  • Persons included in the medium may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and corresponding sodium-containing salts, but are not limited thereto.
  • the medium may contain metal salts such as magnesium sulfate or iron sulfate, and may also contain amino acids, vitamins, and appropriate precursors. These media or precursors may be added to the culture in batches or continuously, but are not limited thereto.
  • chemicals such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid may be added to the culture in an appropriate manner to adjust the pH of the culture.
  • an antifoaming agent such as fatty acid polyglycol ester.
  • oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen or carbon dioxide gas may be injected without gas injection or to maintain the anaerobic and non-aerobic state.
  • the temperature of the culture may be usually 25 ° C to 40 ° C, specifically 30 ° C to 35 ° C.
  • the incubation period of the culture may be continued until the production of the desired useful material is obtained, and may be specifically 10 to 100 hours. However, it is not limited to these examples.
  • the present application may additionally include a step of preparing a medium prior to the culturing step in the method of the present application, but is not limited thereto.
  • the method may further include recovering OPS from a culture medium or microorganism.
  • the recovering step may be further included after the culturing step.
  • the method of recovering the OPS of the present application may be to collect the desired OPS from the culture medium using a suitable method known in the art according to the culture method. For example, centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC may be used, and the desired OPS may be recovered from a medium or microorganism using a suitable method known in the art.
  • the recovery step may include a purification process, and may be performed using a suitable method known in the art.
  • the recovered OPS may be a purified form or a microbial fermentation broth containing OPS.
  • the recovery of OPS can be efficiently performed.
  • the present application provides a) NADH: culturing an OPS-producing microorganism with enhanced activity of quinone oxidoreductase in a medium to produce OPS or a medium containing the same; b) reacting the OPS produced in step a) or a medium containing the same with a sulfide in the presence of O-phosphoserine sulfhydrylase (OPSS) or a microorganism expressing the same, A method for producing cysteine or a derivative thereof is provided.
  • OPS O-phosphoserine sulfhydrylase
  • Steps a) and b) are not necessarily performed consecutively or sequentially, and there is no time interval between these steps, they are performed simultaneously, or at intervals of several seconds, several minutes, several hours, or several days. can be performed with
  • OPS-producing microorganism with enhanced Nuo activity in a medium to produce OPS or a medium containing the same, and O-phosphoserine sulfliydrylase (OPSS) or a microorganism expressing the same
  • OPSS O-phosphoserine sulfliydrylase
  • It may be a method for producing cysteine or a derivative thereof, comprising reacting the OPS produced in the above step or a medium containing the same with a sulfide in the presence of a sulfide.
  • the NADH: quinone oxidoreductase activity is enhanced and the microorganisms that produce O-phosphoserine are as described above.
  • derivative refers to a similar compound obtained by chemically changing a part of a compound, usually a compound in which a hydrogen atom or a specific atomic group is substituted by another atom or atomic group.
  • cyste derivative refers to a compound in which a hydrogen atom or a specific atomic group of cysteine is substituted with another atom or atomic group.
  • other atoms or atomic groups may be attached to the nitrogen atom of the amine group (-NH 2) of cysteine or the sulfur atom of the thiol group (-SH), for example, NAC (N-acetylcysteine), SCMC (S -Carboxymetylcysteine), BOC-CYS(ME)-OH,(R)-S-(2-Amino-2-carboxyethyl)-L-homocysteine, (R)-2-Amino-3-sulfopropionic acid, D-2- Amino-4-(ethylthio)butyric acid, 3-sulfino-L-alanine, Fmoc-Cys(Boc-methyl)-OH, Seleno-L-cystine
  • cysteine is produced according to the method of the present application, conversion to cysteine derivatives can be easily converted into various cysteine derivatives by methods widely known in the art.
  • the method for producing the cysteine derivative may further include converting the cysteine produced in step b) into a cysteine derivative, for example, by reacting cysteine with an acetylation agent to obtain NAC ( N-acetylcysteine) may be synthesized or SCMC (S-Carboxymetylcysteine) may be synthesized by reacting cysteine with haloacetic acid under basic conditions, but is not limited thereto.
  • NAC N-acetylcysteine
  • SCMC S-Carboxymetylcysteine
  • the cysteine derivative is mainly used as a pharmaceutical raw material for antitussives, cough relievers, bronchitis, bronchial asthma and sore throat, but may be used as a treatment, but is not limited thereto.
  • OPS O-phosphoserine sulfhydrylase
  • OPSS thiol group
  • SH group thiol group
  • the enzymes are Aeropymm pernix , Mycobacterium tuberculosis , Mycobacterium megmatics , Trichomonas vaginalis (Mino K and Ishikawa K, FEBSletters, 551:133-138, 2003; Bums KE et al. J. Am. Chem. Soc, 127: 11602-11603, 2005).
  • the OPSS includes not only the wild-type OPSS protein, but also a sequence in which some of the polynucleotide sequences encoding the OPSS are deleted, substituted, or added, and a variant protein exhibiting biological activity equivalent to or higher than that of the wild-type OPSS protein.
  • OPSS proteins and variant proteins disclosed in US 2012-0190081 A1 and US 9127324 B2 may also be included.
  • the sulfide is provided in the form of a liquid or gas due to a difference in pH, pressure, and solubility as well as a solid commonly used in the art, and thus sulfide (S 2- ), thiosulfate (S 2 0 3 Any sulfide that can be converted to a thiol group (SH group) in the form of 2- ) can be used without limitation. Specifically, Na 2 S, NaSH, H 2 S, (NH 4 ) 2 S, NaSH and Na 2 S 2 O 3 that provide a thiol group to OPS may be used, but are not limited thereto.
  • the reaction is a reaction in which one thiol group is provided to one OPS reactor to produce one cysteine or cysteine derivative. In the reaction, the amount of sulfide added may be 0.1 to 3 times the mole concentration of OPS, specifically, 1 to 2 It may be twice, but is not limited thereto.
  • Another aspect of the present application provides a method for producing an O-phosphoserine-producing microorganism, comprising modifying a microorganism of the genus Escherichia to enhance the activity of NADH:quinone oxidoreductase.
  • Another object of the present application is to provide a method for producing O-phosphoserine, cysteine or a derivative thereof by a microorganism having enhanced activity of NADH:quinone oxidoreductase.
  • NADH quinone oxidoreductase, its activity enhancement, microorganisms and the like are as described above.
  • Example 1 Evaluation of OPS production ability of strains in which Nuo expression control region is mutated
  • E.coli ATCC27325 chromosomal DNA as a template and a pair of primers having the base sequences of SEQ ID NOs: 14 and 15
  • a gene fragment in the upstream region of the wild-type promoter of the nuo gene was obtained, and the base sequences of SEQ ID NOs: 18 and 19
  • a gene fragment in a region downstream of the promoter was obtained using a primer pair having the promoter.
  • the promoter region of the rmf gene was obtained using E.coli ATCC27325 chromosomal DNA as a template and a pair of primers having the nucleotide sequences of SEQ ID NOs: 16 and 17.
  • PCR was performed using the polymerase SolgTM Pfu-X DNA polymerase, and the PCR was denatured at 95 ° C for 2 minutes, denatured at 95 ° C for 30 seconds, annealed at 60 ° C for 30 seconds, and polymerized at 72 ° C for 60 seconds. After repeating 30 times, the polymerization reaction was carried out at 72 ° C. for 5 minutes.
  • the upstream and downstream fragments of the nuo promoter obtained through the above process, and the rmf promoter fragment were infused with the chromosomal transformation vector pSKH130 (SEQ ID NO: 39, US Patent Publication No. 2020-0048619) cut with EcoRV restriction enzyme
  • pSKH130_Prmf-nuoA A recombinant plasmid was obtained by cloning using an in-fusion cloning kit (Clontech Laboratories, Inc.), and was named pSKH130_Prmf-nuoA.
  • a primer pair having the base sequences of SEQ ID NOs: 14 and 20 was used to obtain a gene fragment in the upstream region of the wild-type promoter of the nuo gene, and the base sequences of SEQ ID NOs: 23 and 19 A gene fragment in the downstream region of the promoter was obtained using a primer pair having .
  • the promoter region of the idi gene was obtained using E.coli ATCC27325 chromosomal DNA as a template and a pair of primers having the nucleotide sequences of SEQ ID NOs: 21 and 22.
  • Example 1-1 PCR was performed under the same PCR conditions as in Example 1-1 to obtain the fragment, and a recombinant plasmid was obtained by cloning in the same manner as in Example 1-1 using the fragment. This was named pSKH130_Pidi-nuoA.
  • Table 2 shows primer sequences used in Examples 1-1 and 1-2.
  • sequence number designation Sequence (5' ⁇ 3') 14 UP F1 CTGCAGGAATTCGATCAACCACCAGAGATTCACGT 15 UP R1 GCTTCCTGACTCCAGTGCTACTCATCAAAAGTAG 16 Prmf F TTTGATGAGTAAGCACTGGAGTCAGGAAGCCGCTT 17 Prmf R TGTTGACATACTCATGCCTCGTTTCCCTCATACTG 18 Down F1 TGAGGGAAACGAGGCATGAGTATGTCAACATCCAC 19 Down R1 ACGGTGAGAACGACCGTTACATCACGCTAGTCGAC 20 UP R2 TCATTTTTCTTCAGCTGCTTACTCATCAAAAGTAG 21 Pidi F TTTGATGAGTAAGCAGCTGAAGAAAAATGAGCATG 22 Pidi R TGTTGACATACTCATAATTTCTCACATGTAATTCTGATC 23 Down F2 TACATGTGAGAAATTATGAGTATGTCAACATCCAC
  • CA07-0012 having OPS production ability (KCCM 11212P, US Patent Publication No. 2012-0190081), strain CA07-4826 in which the promoter sequence of the rmf gene was inserted at the end of the wild promoter sequence of the nuo gene through a secondary crossover process was obtained.
  • the pSKH130 vector contains the R6K replicon, SacB (Levansucrase) gene, and kanamycin resistance gene, which are dependent on the PI protein (pir gene), R6K and kanamycin were used in the first crossover. After securing a desired strain, a strain was prepared by removing antibiotics from a medium containing sucrose.
  • the CA07-4826 confirmed that the rmf promoter base sequence was inserted through PCR and genome sequencing using the primer pair of SEQ ID NOs: 24 and 25.
  • pSKH130_Pidi-nuoA prepared in Example 1-2 was transformed using the electroporation method (Appl. Microbiol. Biotechnol. (1999) 52:541-545), followed by a secondary crossing process.
  • Strain CA07-4827 was obtained in which the promoter sequence of the idi gene was inserted at the end of the wild promoter sequence of the nuo gene.
  • SEQ ID NOs: 24 and 25 it was confirmed that the idi promoter nucleotide sequence was inserted into the strain CA07-4827.
  • Primer sequences used herein are shown in Table 3 below.
  • sequence number designation Sequence (5' ⁇ 3') 24 NuoP Conf F GAGAGCTACCATAATCCGTG 25 NuoP Conf R CATCTCAACGTAACAGCAGG
  • OPS O-phosphoserine
  • the culture was cultured overnight in a 33 ° C. incubator after plating each strain on LB solid medium.
  • the strain cultured overnight in LB solid medium was inoculated into 25mL titer medium of Table 3, and then cultured in an incubator at 200 rpm at 33 ° C for 48 hours.
  • the OPS concentrations produced as a result are shown in Table 5.
  • strain name OPS (g/L) CA07-0012 1.95 CA07-4826 2.20 CA07-4827 0.40
  • CA07-4826 in which the nuo operon was enhanced by the rmf promoter, showed about 12.8% improved OPS production ability compared to the parent strain
  • CA07-4827 in which the nuo operon was weakened by the idi promoter, decreased about 79.5% compared to the parent strain. showed productivity.
  • Example 2 Evaluation of OPS production capacity according to enrichment of the nuo operon in strains with increased OPS production capacity
  • sequence number designation Sequence (5' ⁇ 3') 6 yhhS UP F CTGCAGGAATTCGATGAAGGTAACCACTTTTTCCG 7 yhhS UP R GAGTTGCAGCAAGCGGAGGATCACCACATTTTTAC 8 Ptrc F AATGTGGTGATCCTCCGCTTGCTGCAACTCTCTCA 9 Ptrc R TACGGGTTCGGGCATGATAGCTCTCCTGTGTGAAA 10 yhhS Down F CACAGGAGAGCTATCATGCCCGAACCCGTAGCCGA 11 yhhS Down R GTCGACTAGCGTGATAGCGGTTTGCCTTTACTGGC
  • the polymerase SolgTM Pfu-X DNA polymerase was used, and PCR amplification was denatured at 95 ° C for 2 minutes, denatured at 95 ° C for 30 seconds, annealed at 60 ° C for 30 seconds, and polymerized at 72 ° C for 60 seconds for 30 seconds. After repeated times, the polymerization reaction was performed at 72° C. for 5 minutes.
  • the upstream and downstream fragments of the yhhS promoter and the trc promoter fragment obtained in the above process were combined with the vector pSKH130 for chromosome transformation cut with EcoRV restriction enzyme and an in-fusion cloning kit (Clontech Laboratories, Inc. ) to obtain a recombinant plasmid by cloning, which was named pSKH130_Ptrc-yhhS.
  • the pSKH130_Ptrc-yhhS prepared in Example 2-1 was transformed into CA07-0012 using electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then subjected to a secondary crossing process.
  • Strain CA07-4821 was obtained in which the trc promoter nucleotide sequence was inserted at the end of the wild-type promoter nucleotide sequence of the yhhS gene. It was confirmed through PCR and genome sequencing using the primer pair of SEQ ID NO: 12 and SEQ ID NO: 13 (Table 7) that the trc promoter base sequence was inserted into the strain CA07-4821.
  • sequence number designation Sequence (5' ⁇ 3') 12 yhhSP Conf F AGTTGAGCAAAAACGCCAGT 13 yhhSP Conf R GCCATACCGTACAGCCAGAC
  • Example 2-2 In order to evaluate the OPS production ability of the strain CA07-4821 prepared in Example 2-2 and its parent strain CA07-0012, the evaluation was conducted in the same manner as in Example 1-4 using the medium (Table 4). .
  • CA07-4821 had about 26.7% improved OPS production ability compared to CA07-0012, which is shown in Table 8.
  • strain name OPS (g/L) CA07-0012 1.95 CA07-4821 2.47
  • pSKH130_Prmf-nuoA prepared in Example 1-1 was transformed into CA07-4821 prepared in Example 2-3 using electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545) Then, through a secondary crossover process, strain CA07-4828 was obtained in which the promoter sequence of the rmf gene was inserted at the end of the wild promoter sequence of the nuo gene.
  • the strain CA07-4828 was confirmed to have the rmf promoter nucleotide sequence inserted through PCR and genome sequencing using primer pairs of SEQ ID NOs: 24 and 25.
  • CA07-4821 was used as a control and evaluated in the same manner as in Examples 1-4, and the results are shown in Table 9.
  • strain name OPS (g/L) CA07-4821 2.47 CA07-4828 2.53
  • CA07-4828 in which YhhS and nuo operons were simultaneously enhanced showed about 2.4% improved OPS production ability compared to CA07-4821 in which only YhhS was enhanced. confirmed to increase.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

본 출원은 NADH:quinone 산화환원효소의 발현이 조절된 재조합 미생물 및 이를 이용한 O-포스포세린, 시스테인 및 시스테인의 유도체의 생산방법에 관한 것이다.

Description

NADH:QUINONE 산화환원효소의 발현이 조절된 재조합 미생물 및 이를 이용한 O-포스포세린, 시스테인 및 이의 유도체의 생산방법.
본 출원은 NADH:quinone 산화환원효소의 발현이 조절된 재조합 미생물 및 이를 이용한 O-포스포세린, 시스테인 및 시스테인의 유도체의 생산방법에 관한 것이다.
L-시스테인은 모든 생물체의 황 대사에 있어서 중요한 아미노산으로, 모발의 케라틴 등 생체 내 단백질, 글루타치온, 바이오틴, 메치오닌 및 기타 황을 함유한 대사산물의 합성에 사용될 뿐만 아니라 코엔자임 A 생합성의 전구 물질로 사용된다.
미생물을 이용하여 L-시스테인을 생산하는 방법으로 1) 미생물을 이용하여 D,L-ATC(D,L-2-aminothiazoline-4-carboxylic acid)를 생물학적으로 전환하는 방법, 2) 대장균을 이용한 L-시스테인을 생산하는 직접 발효 방법(유럽 등록특허 EP0885962B; Wada M andTakagi H , Appl. Microbiol. Biochem., 73:48-54, 2006), 3) 미생물을 이용하여 O-포스포세린(O-phosphoserine, 이하 "OPS")을 발효 생산한 후, O-포스포세린 설프하이드릴라아제(O-phosphoserine sulfhydrylase, 이하 "OPSS")의 촉매 작용 하에 황화물과 반응시켜 L-시스테인으로 전환시키는 방법(US 2012-0190081 A1)이 공지되어 있다.
이 때, 상기 3) 방법으로 고수율의 시스테인을 생산하기 위해서는 전구체인 OPS를 과량 생산하여야 할 필요가 존재하였다.
본 출원의 과제는 NADH:quinone 산화환원효소의 발현이 조절된 재조합 미생물 및 이를 이용한 O-포스포세린, 시스테인 및 시스테인의 유도체의 생산방법을 제공하는 것이다.
본 출원의 목적은 NADH:quinone 산화환원효소의 활성이 강화되고, O-포스포세린 생산능을 가진, 에스케리키아 속 재조합 미생물을 제공하는 것이다.
본 출원의 다른 하나의 목적은 본 출원의 O-포스포세린 생산 미생물을 배지에서 배양하는 단계를 포함하는, O-포스포세린의 생산 방법을 제공하는 것이다.
본 출원의 또 하나의 목적은 a) NADH:quinone 산화환원효소의 활성이 강화된, O-포스포세린 생산 미생물을 배지에서 배양하여 O-포스포세린 또는 이를 포함하는 배지를 생산하는 단계; 및 b) O-포스포세린 설프하이드릴라아제(O-phosphoserine sulfhydrylase, OPSS) 또는 이를 발현하는 미생물의 존재 하에, 상기 a) 단계에서 생산된 O-포스포세린 또는 이를 포함하는 배지를 황화물과 반응시키는 단계를 포함하는, 시스테인 또는 이의 유도체의 생산 방법을 제공하는 것이다.
본 출원의 NADH:quinone 산화환원효소의 활성이 강화된, OPS를 생산하는 미생물은 OPS를 고효율로 생산할 수 있다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다. 또한, 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 출원의 하나의 양태는, NADH:quinone 산화환원효소의 활성이 강화된, O-포스포세린을 생산하는 미생물을 제공하는 것이다.
본 출원에서 용어, "O-포스포세린(O-phosphoserine, 이하 "OPS")"은 세린의 인산(phosphoric acid) 에스테르로서, 여러 단백질의 구성요소이다. 상기 OPS는 L-시스테인의 전구체로서, O-포스포세린 설프하이드릴라아제(OPS sulfhydrylase, OPSS)의 촉매 작용 하에 황화물과 반응하여 시스테인으로 전환될 수 있으나, 이에 제한되지 않는다(US 2012-0190081 A1).
본 출원의 용어 "NADH:quinone 산화환원효소 (NADH:quinone oxidoreductase, 이하, "Nuo")"는 미생물의 전자전달계에서 NADH를 산화하여 세포내막의 quinone을 환원시키는 효소이다. 상기 효소 단백질은 NADH 탈수소화효소-1 (NADH dehydrogenase-1: NDH-1) 으로도 명명될 수 있다. 상기 단백질을 코딩하는 유전자는 그 예로 nuoABCEFGHIJKLMN 유전자 클러스터 일 수 있으나, 이에 제한되지 않는다. 상기 nuoABCEFGHIJKLMN 유전자 클러스터는 nuo 오페론을 구성하며, 상기 오페론 앞쪽의 프로모터와 리보좀 결합부위의 폴리뉴클레오타이드에 의해 발현이 조절될 수 있다. 본 출원에서 'nuoABCEFGHIJKLMN 유전자'는 'NADH:quinone 산화환원효소를 코딩하는 유전자' 및 'nuoABCEFGHIJKLMN 유전자', 'nuo 오페론', 'nuo 유전자'와 혼용되어 사용될 수 있다.
본 출원에서 "오페론" 은 하나의 발현 조절 서열, 구체적으로는 하나의 프로모터에 의해 발현이 조절되는 유전자군을 포함하는 DNA의 기능적 단위를 의미한다. 오페론에 의해 전사된 mRNA는 단일 mRNA 분자가 1개 이상의 단백질을 코딩하는 폴리시스트로닉(polycistronic) mRNA이거나, 단일 mRNA 분자가 1개의 단백질을 코딩하는 모노시스트로닉(monocistronic) mRNA일 수 있다.
Nuo는 13개의 아단위(subunit) 단백질의 복합체로 (NuoA, NuoB, NuoC, NuoE, NuoF, NuoG, NuoH, NuoI, NuoJ, NuoK, NuoL, NuoM, NuoN), 각 아단위 단백질의 번역은 두 종류의 오페론인 nuoABCEFGHIJKL 과 nuoMN을 주형으로 한다. 상기 nuo 오페론의 구조는 EcoCyc(www.biocyc.org)에서 확인할 수 있다(수납번호: EG12082). 상기 nuo 오페론은 구조 유전자(Structure Gene) 및 발현조절영역(regulatory region)을 포함하는 것으로 알려져 있다. 상기 nuo 오페론의 "발현조절영역"은 nuo 오페론을 구성하는 구조 유전자의 업스트림에 존재하여 구조 유전자의 발현을 조절할 수 있는 부위를 의미한다. nuo 오페론의 발현조절영역은 구조 유전자를 제외한 프로모터 (nuoA 프로모터 및/또는 nuoM 프로모터)와 오퍼레이터를 포함하는 것일 수 있고, 구체적으로는 프로모터를 포함할 수 있다.
상기 nuo 오페론은 서열번호 26 내지 서열번호 38로 기재되는 아미노산 서열과 적어도 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성(homology) 또는 동일성(identity)을 가지는 아미노산 서열을 코딩하는 염기서열을 포함하는 것일 수 있다. 구체적으로, 상기 nuo 오페론은 서열번호 26 내지 38 또는 이와 상동성 또는 동일성을 가지며 이에 상응하는 기능을 나타내는 아미노산 서열을 코딩하는 구조유전자 서열; 및 상기 구조유전자 서열의 발현을 조절하는 발현조절영역을 포함할 수 있다. 상기 서열번호 26 내지 38의 서열은 공지의 데이터 베이스인 NCBI Genbank에서 그 서열을 확인할 수 있다.
구체적으로, 상기 nuo 오페론은 서열번호 1 및/또는 상기 서열번호 1과 적어도 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성(homology) 또는 동일성(identity)을 가지는 염기 서열일 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 nuo 오페론에 상응하는 기능을 나타내는 염기 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 염기 서열도 본 출원의 범위 내에 포함됨은 자명하다.
본 출원의 용어 "상동성(homology) 및 동일성(identity)"은 두 개의 주어진 아미노산 서열 또는 염기 서열과 관련된 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 중간 또는 높은 엄격한 조건(stringent conditions)에서 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90% 이상으로 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려된다.
상기 폴리펩타이드 또는 폴리뉴클레오티드 서열에 대한 상동성 또는 동일성은 예를 들면, 문헌에 의한 알고리즘 BLAST[참조: Karlin 및 Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873(1993)], 또는 Pearson에 의한 FASTA(참조: Methods Enzymol., 183, 63, 1990)을 사용하여 결정할 수 있다. 이러한 알고리즘 BLAST에 기초하여, BLASTN이나 BLASTX라고 불리는 프로그램이 개발되어 있다(참조: http://www.ncbi.nlm.nih.gov). 또한, 임의의 아미노산 또는 폴리뉴클레오티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 정의된 엄격한 조건하에서 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려진 방법을 모두 포괄한다.(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology)
본 출원의 미생물은 OPS를 생산할 수 있다면 그 종류가 특별히 제한되지 않으며, 원핵세포 또는 진핵세포 모두 가능하나, 구체적으로 원핵세포일 수 있다. 상기 원핵세포는, 일 예로 에스케리키아(Escherichia) 속, 어위니아(Erwinia) 속, 세라티아(Seratia) 속, 프로비덴시아(Providencia)속, 코리네박테리움(Corynebacterium) 속 및 브레비박테리움(Brevibacterium) 속에 속하는 미생물 균주를 포함할 수 있으며, 구체적으로 에스케리키아 속 미생물, 보다 구체적으로 대장균(Escherichia coli)일 수 있으나, 이에 제한되지 않는다. 예를 들어, 에스케리키아 속 미생물의 경우, L-세린의 생합성 경로의 효소인 SerA, SerC 및 SerB를 통해, OPS 및 L-세린을 생산할 수 있다(Ahmed Zahoor, Computational and structural biotechnology journal, vol 3, 2012 October; Wendisch V F et al., Curr Opin Microbiol. 2006 Jun;9(3):268-74; Peters-Wendisch P et al., Appl Environ Microbiol. 2005 Nov;71(ll):7 139-44.).
본 출원의 "O-포스포세린을 생산하는 미생물"이란, 자연적으로 O-포스포세린의 생산능을 가지고 있는 미생물 또는 O-포스포세린의 생산능이 없는 모균주에 O-포스포세린의 생산능이 부여된 미생물을 의미한다. 구체적으로 상기 미생물은 자연적 또는 인위적으로 유전적 변형이 일어나 Nuo 활성이 강화된, O-포스포세린을 생산하는 미생물일 수 있다. 본 출원의 목적상, 상기 O-포스포세린을 생산하는 미생물은 본 출원에서 개시된 방법으로 Nuo 활성이 강화되어, O-포스포세린을 생산할 수 있는 미생물이라면 모두 가능하다. 본 출원에서 상기 "O-포스포세린을 생산하는 미생물"은 "O-포스포세린 생산 미생물", "O-포스포세린 생산능을 갖는 미생물"과 혼용되어 사용될 수 있다.
일 구현예로, 본 출원의 O-포스포세린을 생산하는 미생물은 상기 Nuo의 활성이 강화되어, 목적하는 O-포스포세린 생산능이 증가된, 유전적으로 변형된 미생물 또는 재조합 미생물일 수 있으나, 이에 제한되지 않는다.
본 출원의 용어 단백질의 "활성 강화"는, 단백질의 활성이 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 단백질의 활성을 의미한다. 이는 "변형전 활성"과 혼용되어 사용될 수 있다. 단백질의 활성이 내재적 활성에 비하여 "증가"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 단백질의 활성에 비하여 향상된 것을 의미한다. 예를 들어, 상기 모균주는 에스케리키아 콜라이 ATCC27325 일 수 있다. 다른 예로, 상기 모균주는 OPS 생산능이 증가되도록 하는 변형을 포함하는 균주일 수 있고, 예를 들어 CA07-0012 (KCCM 11212P; US2012-0190081A) 또는 CA07-4821일 수 있으나, 이에 제한되지 않는다.
상기 "활성 증가"는 외래의 단백질을 도입하거나, 내재적인 단백질의 활성 강화를 통해 달성할 수 있으나, 구체적으로는 내재적인 단백질의 활성 강화를 통해 달성하는 것일 수 있다. 상기 단백질의 활성 강화 여부는 해당 단백질의 활성 정도, 발현량 또는 해당 단백질로부터 생산되는 산물의 양의 증가로부터 확인할 수 있다.
상기 활성 강화는 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하며, 목적 단백질의 활성을 변형전 미생물보다 강화시킬 수 있는 한, 제한되지 않는다. 구체적으로, 분자생물학의 일상적 방법인 당업계의 통상의 기술자에게 잘 알려진 유전자 공학 및/또는 단백질 공학을 이용한 것일 수 있으나, 이로 제한되지 않는다(예컨대, Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012 등).
본 출원에 있어서, 상기 활성 강화의 대상이 되는 단백질, 즉, 목적 단백질은 Nuo일 수 있으나, nuo 오페론에 의해 코딩되어, NADH를 소모 또는 NADH를 소모하여 Proton motive force를 형성하는 단백질이라면 이에 제한되지 않는다.
본 출원의 Nuo 활성의 강화는, Nuo 단백질 복합체를 구성하는 아단위 단백질 중 1 이상의 활성이 강화되는 것을 포함한다.
구체적으로, 본 출원의 단백질 활성 강화는,
1) 단백질을 코딩하는 유전자의 세포 내 카피수 증가;
2) 단백질을 암호화하는 염색체상의 유전자 발현 조절 서열의 변형;
3) 단백질을 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역의 염기서열의 변형;
4) 단백질 활성이 강화되도록 아미노산 서열을 변형;
5) 단백질 활성이 강화되도록 상기 단백질을 코딩하는 폴리뉴클레오티드 서열의 변형 (예를 들어, 활성이 강화되도록 변형된 단백질을 코딩하도록 상기 단백질을 코딩하는 유전자 서열의 변형);
6) 단백질의 활성을 나타내는 외래 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드의 코돈 최적화된 변이형 폴리뉴클레오티드의 도입;
7) 단백질을 암호화하는 폴리뉴클레오티드의 코돈 최적화;
8) 단백질의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식; 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에 제한되지 않는다.
구체적으로, 상기 1) 단백질을 코딩하는 유전자의 세포 내 카피수 증가는, 당업계에 알려진 임의의 방법, 예를 들면, 해당 단백질을 코딩하는 유전자가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있다. 또는, 상기 유전자가 작동가능하게 연결된, 숙주세포 내의 염색체 내로 상기 유전자를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "벡터"는 적합한 숙주 내에서 목적하는 단백질을 코딩하는 폴리뉴클레오티드 서열을 목적 단백질을 발현시키기에 적합한 조절 서열에 작동 가능하게 연결된 형태로 함유하는 DNA 제조물을 의미한다. 상기 발현 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환 된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 숙주세포 내에서 복제 가능한 것이면 특별히 제한되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계, pSK계, pSKH계 및 pET계 등을 사용할 수 있다. 구체적으로 pCL, pSK, pSKH130, pDZ, pACYC177, pACYC184, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동 재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "형질전환"은 목적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 재조합 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드가 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 상기 형질전환 하는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법 (electroporation), 인산칼슘 (CaPO4) 침전, 염화칼슘 (CaCl2) 침전, 미세주입법 (microinjection), 폴리에틸렌글리콜 (PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열 또는 발현조절영역과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다. 작동 가능한 연결은 당업계의 공지된 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당업계의 절단 및 연결 효소 등을 사용하여 제작할 수 있으나, 이에 제한되지 않는다.
상기 2) 단백질을 암호화하는 염색체상의 유전자 발현 조절 서열을 변형하는 방법은, 당업계에 알려진 임의의 방법, 예를 들면, 상기 발현 조절 서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 가지는 핵산 서열로 교체하거나 이를 삽입함에 의하여 수행될 수 있다. 상기 발현 조절 서열은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다. 상기 방법은 구체적으로 본래의 프로모터 뒤에 강력한 이종 프로모터를 삽입한 것일 수 있으나, 이에 제한되지 않는다.
공지된 강력한 프로모터의 예에는 CJ1 내지 CJ7 프로모터(미국등록특허 US 7662943 B2), lac 프로모터, Trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터 및 rmf 프로모터가 포함될 수 있으나, 이에 제한되지 않고 내재적 활성에 비해 강력한 프로모터로 치환하는 것은 모두 포함한다.
상기 3) 단백질을 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역의 염기서열 변형은, 당업계에 알려진 임의의 방법, 예를 들면, 상기 단백질의 내재적 개시코돈을 상기 내재적 개시코돈에 비해 단백질 발현율이 더 높은 다른 개시코돈으로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은, 당업계에 알려진 임의의 방법, 예를 들면, 상기 폴리뉴클레오티드 서열의 활성을 더욱 강화하도록 폴리뉴클레오티드 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현조절 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함에 의하여 수행될 수 있다. 상기 교체는 구체적으로 상동재조합에 의하여 상기 유전자를 염색체내로 삽입하는 것일 수 있으나, 이에 제한되지 않는다.
이때 사용되는 벡터는 염색체 삽입 여부를 확인하기 위한 선별 마커 (selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 도입하고자 하는 유전자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있으며, 이에 한정되는 것은 아니다. 선택제 (selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환 된 세포를 선별할 수 있다.
상기 6) 단백질의 활성을 나타내는 외래 폴리뉴클레오티드의 도입은, 당업계에 알려진 임의의 방법, 예를 들면, 상기 단백질과 동일/유사한 활성을 나타내는 단백질을 암호화하는 외래 폴리뉴클레오티드, 또는 이의 코돈 최적화된 변이형 폴리뉴클레오티드를 숙주세포 내로 도입하여 수행될 수 있다. 상기 외래 폴리뉴클레오티드는 상기 단백질과 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한 없이 사용될 수 있다. 또한 도입된 상기 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화하여 숙주세포 내로 도입할 수 있다. 상기 도입은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 단백질이 생성되어 그 활성이 증가될 수 있다.
상기 7) 단백질을 암호화하는 폴리뉴클레오티드의 코돈 최적화는, 내재 폴리뉴클레오티드가 숙주세포 내에서 전사 또는 번역이 증가하도록 코돈 최적화한 것이거나, 또는 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화한 것일 수 있다.
상기 8) 단백질의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식하는 것은, 예를 들어 분석하고자 하는 폴리펩티드의 서열정보를 기지 단백질들의 서열정보가 저장된 데이터베이스와 비교함으로써 서열의 유사성 정도에 따라 주형 단백질 후보를 결정하고 이를 토대로 구조를 확인하여, 변형하거나 화학적으로 수식할 노출 부위를 선택하여 변형 또는 수식하는 것일 수 있다.
일 구현예로, 상기 단백질의 활성 강화는 상기 1) 내지 2) 중 어느 하나 이상일 수 있다.
전술한 구현예 중의 어느 하나의 구현예로, 본 출원의 NADH:quinone 산화환원효소의 활성 강화는, nuo 오페론의 발현 증가일 수 있다. 전술한 구현예 중의 어느 하나의 구현예로, 상기 NADH:quinone 산화환원효소의 활성 강화는 이를 코딩하는 유전자의 업스트림에 활성이 강화된 유전자 발현 조절 서열을 포함하는 것일 수 있다. 구체적으로 상기 NADH:quinone 산화환원효소를 코딩하는 유전자의 업스트림은 nuoA 유전자의 업스트림일 수 있다. 일 구현예로, NADH:quinone 산화환원효소의 활성 강화는 Nuo 단백질 복합체를 코딩하는 nuo 오페론에 존재하는 하나의 발현 조절 서열을 변형함으로써 오페론에 존재하는 1 이상의 구조 유전자, 예를 들어 2 이상, 3 이상, 또는 전체 구조 유전자 서열의 발현이 강화되는 것일 수 있다. 구체적으로, 상기 발현 조절 서열의 변형은 nuo 오페론의 내재적 프로모터와 nuoA 유전자 사이에 활성이 강화된 유전자 발현 조절 서열이 추가로 삽입되는 것일 수 있고, 예를 들어 상기 유전자 발현 조절 서열은 프로모터일 수 있으나, 이에 제한되지 않는다.
이와 같은 단백질의 활성 강화는, 상응하는 단백질의 활성 또는 농도가 야생형이나 변형전 미생물 균주에서 발현된 단백질의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 단백질로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "변형전 균주" 또는 "변형전 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 천연형 균주 자체이거나, 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미한다. 본 출원에 있어서, 상기 형질 변화는 Nuo의 활성 강화일 수 있다. 상기 "변형전 균주" 또는 "변형전 미생물"은 "비변이 균주", "비변형 균주", "비변이 미생물", "비변형 미생물" 또는 "기준 미생물"과 혼용될 수 있다.
본 출원의 미생물은 추가적으로 OPS의 생산능 및/또는 세포 밖으로의 배출 능력을 강화하거나; OPS의 분해능 및/또는 유입 능력을 강화하는 변형을 포함하는 것일 수 있다.
OPS의 생산능 및/또는 세포 밖으로의 배출 능력을 강화하거나; OPS의 분해능 및/또는 유입 능력을 강화하는 변형의 예시로, 포스포세린 포스포타아제(SerB)의 활성 약화; 포스포세린 배출단백질(YhhS) 활성 강화; 또는 이들 변형의 조합을 들 수 있으나, 이에 제한되는 것은 아니다.본 출원에서 용어, 폴리펩티드의 "약화" 는 내재적 활성에 비하여 활성이 감소되거나 또는 활성이 없는 것을 모두 포함하는 개념이다. 상기 약화는 불활성화(inactivation), 결핍(deficiency), 하향조절(down-regulation), 감소(decrease), 저하(reduce), 감쇠(attenuation) 등의 용어와 혼용될 수 있다.
상기 약화는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드의 변이 등으로 폴리펩티드 자체의 활성이 본래 미생물이 가지고 있는 폴리펩티드의 활성에 비해 감소 또는 제거된 경우, 이를 코딩하는 폴리뉴클레오티드의 유전자의 발현 저해 또는 폴리펩티드로의 번역(translation) 저해 등으로 세포 내에서 전체적인 폴리펩티드 활성 정도 및/또는 농도(발현량)가 천연형 균주에 비하여 낮은 경우, 상기 폴리뉴클레오티드의 발현이 전혀 이루어지지 않은 경우, 및/또는 폴리뉴클레오티드의 발현이 되더라도 폴리펩티드의 활성이 없는 경우 역시 포함할 수 있다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주, 야생형 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 "불활성화, 결핍, 감소, 하향조절, 저하, 감쇠"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성에 비하여 낮아진 것을 의미한다.
이러한 폴리펩티드의 활성의 약화는, 당업계에 알려진 임의의 방법에 의하여 수행될 수 있으나 이로 제한되는 것은 아니며, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다(예컨대, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드의 약화는
1) 폴리펩티드를 코딩하는 유전자 전체 또는 일부의 결손;
2) 폴리펩티드를 코딩하는 유전자의 발현이 감소하도록 발현조절영역(또는 발현조절서열)의 변형;
3) 폴리펩티드의 활성이 제거 또는 약화되도록 상기 폴리펩티드를 구성하는 아미노산 서열의 변형(예컨대, 아미노산 서열 상의 1 이상의 아미노산의 삭제/치환/부가);
4) 폴리펩티드의 활성이 제거 또는 약화되도록 상기 폴리펩티드를 코딩하는 유전자 서열의 변형 (예를 들어, 폴리펩티드의 활성이 제거 또는 약화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 핵산염기 서열 상의 1 이상의 핵산염기의 삭제/치환/부가);
5) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
6) 폴리펩티드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입;
7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩티드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가;
8) 폴리펩티드를 코딩하는 유전자 서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE); 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
예컨대,
상기 1) 폴리펩티드를 코딩하는 상기 유전자 일부 또는 전체의 결손은, 염색체 내 내재적 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드 전체의 제거, 일부 뉴클레오티드가 결실된 폴리뉴클레오티드로의 교체 또는 마커 유전자로 교체일 수 있다.
또한, 상기 2) 발현조절영역(또는 발현조절서열)의 변형은, 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 발현조절영역(또는 발현조절서열) 상의 변이 발생, 또는 더욱 약한 활성을 갖는 서열로의 교체일 수 있다. 상기 발현조절영역에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함하나, 이에 한정되는 것은 아니다.
또한, 상기 5) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 낮은 다른 개시코돈을 코딩하는 염기서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
또한, 상기 3) 및 4)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은 폴리펩티드의 활성을 약화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 약한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 없도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 예를 들면, 폴리뉴클레오티드 서열 내 변이를 도입하여 종결 코돈을 형성시킴으로써, 유전자의 발현을 저해하거나 약화시킬 수 있으나, 이에 제한되지 않는다.
상기 6) 폴리펩티드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입은 예를 들어 문헌 [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986]을 참고할 수 있다.
상기 7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩티드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가는 mRNA 번역을 불가능하게 하거나 속도를 저하시키는 것일 수 있다.
상기 8) 폴리펩티드를 코딩하는 유전자서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE)는 상기 폴리펩티드를 코딩하는 유전자의 전사체에 상보적인 안티센스 뉴클레오티드를 만들어 활성을 약화하는 것일 수 있다.
본 출원의 SerB는 OPS를 L-세린(L-serine)으로 전환시키는 활성을 지니므로, 상기 SerB 활성이 약화되도록 변이된 미생물은 OPS를 축적하는 특징을 지녀 OPS의 생산에 유용하게 사용될 수 있다. 본 출원의 SerB는 서열번호 2으로 기재되는 아미노산 서열을 가지거나 포함하는 단백질, 또는 서열번호 2으로 기재되는 아미노산 서열로 이루어지거나 필수적으로 구성되는 단백질일 수 있으나, 이에 제한되는 것은 아니다. 또한, 본 출원의 SerB는 SerB의 활성을 나타내는 한, 서열번호 2로 기재되는 아미노산 서열과 상동성 또는 동일성이 적어도 70%, 80%, 90%, 95% 또는 99% 이상인 아미노산 서열을 가지거나 포함할 수 있다. 더불어, 본 출원의 SerB는 서열번호 2으로 기재되는 아미노산 서열과 상동성 또는 동일성이 적어도 70%, 80%, 90%, 95% 또는 99% 이상인 아미노산 서열로 이루어지거나 필수적으로 구성될 수 있으나, 이에 제한되지 않는다. 또한, 상기 SerB를 코딩하는 폴리뉴클레오티드는 상기 서열번호 2에 기재된 아미노산 서열을 코딩하는 염기서열 3을 가지거나 포함할 수 있다. 더불어, 상기 SerB를 코딩하는 폴리뉴클레오티드는 서열번호 2에 기재된 아미노산 서열을 코딩하는 염기서열로 이루어지거나 필수적으로 구성될 수 있다. 본 출원의 SerB를 코딩하는 폴리뉴클레오티드는 코돈의 축퇴성으로 인하여 또는 상기 SerB 단백질을 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, SerB 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 본 출원의 SerB를 코딩하는 폴리뉴클레오티드는 서열번호 3의 염기서열과 상동성 또는 동일성이 적어도 70%, 80%, 90%, 95% 또는 99% 이상, 그리고 100% 미만인 염기서열을 가지거나 포함할 수 있다. 더불어, 본 출원의 SerB를 코딩하는 폴리뉴클레오티드는 서열번호 3의 염기서열과 상동성 또는 동일성이 적어도 70%, 80%, 90%, 95% 또는 99% 이상, 그리고 100% 미만인 염기서열로 이루어지거나 필수적으로 구성될 수 있으나, 이에 제한되지 않는다.
본 출원의 YhhS는 OPS를 배출하는 활성을 지니므로, 상기 YhhS 활성이 강화되도록 변이된 미생물은 OPS를 배출하는 특징을 지녀 OPS의 생산에 유용하게 사용될 수 있다. 본 출원의 YhhS는 서열번호 4으로 기재되는 아미노산 서열을 가지거나 포함하는 단백질, 또는 서열번호 4로 기재되는 아미노산 서열로 이루어지거나 필수적으로 구성되는 단백질일 수 있으나, 이에 제한되는 것은 아니다. 또한, 본 출원의 YhhS는 YhhS의 활성을 나타내는 한, 서열번호 4로 기재되는 아미노산 서열과 상동성 또는 동일성이 적어도 70%, 80%, 90%, 95% 또는 99% 이상인 아미노산 서열을 가지거나 포함할 수 있다. 더불어, 본 출원의 YhhS는 서열번호 4으로 기재되는 아미노산 서열과 상동성 또는 동일성이 적어도 70%, 80%, 90%, 95% 또는 99% 이상인 아미노산 서열로 이루어지거나 필수적으로 구성될 수 있으나, 이에 제한되지 않는다. 또한, 상기 YhhS를 코딩하는 폴리뉴클레오티드는 상기 서열번호 4에 기재된 아미노산 서열을 코딩하는 염기서열을 가지거나 포함할 수 있다. 더불어, 상기 YhhS를 코딩하는 폴리뉴클레오티드는 서열번호 4에 기재된 아미노산 서열을 코딩하는 염기서열로 이루어지거나 필수적으로 구성될 수 있다. 본 출원의 YhhS를 코딩하는 폴리뉴클레오티드는 코돈의 축퇴성으로 인하여 또는 상기 YhhS 단백질을 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, YhhS 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 본 출원의 YhhS를 코딩하는 폴리뉴클레오티드는 서열번호 5의 염기서열과 상동성 또는 동일성이 적어도 70%, 80%, 90%, 95% 또는 99% 이상, 그리고 100% 미만인 염기서열을 가지거나 포함할 수 있다. 더불어, 본 출원의 YhhS를 코딩하는 폴리뉴클레오티드는 서열번호 5의 염기서열과 상동성 또는 동일성이 적어도 70%, 80%, 90%, 95% 또는 99% 이상, 그리고 100% 미만인 염기서열로 이루어지거나 필수적으로 구성될 수 있으나, 이에 제한되지 않는다.
일 구현예로, OPS의 생산능 및/또는 세포 밖으로의 배출 능력을 강화하거나; OPS의 분해능 및/또는 유입 능력을 강화하는 변형을 포함하는 미생물은 CA07-0012 (KCCM 11212P; US2012-0190081A) 또는 CA07-4821 일 수 있으나, 이에 제한되지 않는다. 이와 같은 OPS 생산 미생물에 대한 내용은 상기에서 기술된 내용 외에도 한국등록특허 제1381048호 또는 미국공개공보 제2012-0190081호 등에 개시된 내용이 본 출원의 참고자료로서 사용될 수 있으나, 이에 제한되지 않는다.
본 출원의 다른 하나의 양태로, 본 출원은 NADH:quinone 산화환원효소의 활성이 강화된 OPS 생산 미생물을 배지에서 배양하는 단계를 포함하는, OPS의 생산 방법을 제공한다.
상기 미생물에 대해서는 전술한 바와 같다.
본 출원에서 용어, "배양"은 상기 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양 조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및 유가식 일 수 있으나, 이에 제한되는 것은 아니다.
상기 미생물의 배양은, 배지에 글리신 또는 세린이 추가로 포함될 수 있다. 글리신은 정제된 글리신, 글리신을 포함하는 이스트 추출물, 트립톤의 형태로 제공될 수 있으며 배양액에 포함되는 농도는 보통 0.1 내지 10g/L, 구체적으로 0.5 내지 3g/L일 수 있다. 또한 세린은 정제된 세린, 세린을 함유하는 이스트 추출물, 트립톤 등의 형태로 제공될 수 있으며 배양액에 포함되는 농도는 보통 0.1 내지 5g/L, 구체적으로 0.1 내지 1g/L 일 수 있다.
상기 배지에 포함되는 탄소원은 글루코즈, 수크로즈, 락토즈, 프락토즈, 말토즈, 전분, 셀룰로즈와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산을 포함할 수 있으며, 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있으나, 이에 제한되는 것은 아니다.
상기 배지에 포함되는 질소원으로서 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액 및 대두밀과 같은 유기 질소원 및 요소, 황산암모늄, 염화암모늄, 인산암모늄, 탄산안모늄 및 질산암모늄과 같은 무기 질소원이 포함될 수 있으며, 이들 질소원은 단독 또는 조합되어 사용될 수 있으나, 이에 제한되는 것은 아니다.
상기 배지에 포함되는 인원으로서 인산이수소칼륨, 인산수소이칼륨 및 대응되는 소듐 함유염이 포함될 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 배지는 황산마그네슘 또는 황산철과 같은 금속염을 포함할 수 있고, 그 외에 아미노산, 비타민 및 적절한 전구체등이 포함될 수 있다. 이들 배지 또는 전구체는 배양물에 회분식 또는 연속식으로 첨가될 수 있으나, 이에 제한되는 것은 아니다.
배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산 및 황산과 같은 화학물을 배양물에 적절한 방식으로 첨가하여, 배양물의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리클리콜에스테르와 같은 소포제를 사용하여 기포생성을 억제할 수 있다. 또한 배양물의 호기 상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있다. 배양물의 온도는 보통 25℃ 내지 40℃, 구체적으로 30℃ 내지 35℃일 수 있다. 배양물의 배양기간은 원하는 유용물질의 생산량이 수득될 때까지 계속될 수 있으며, 구체적으로 10 내지 100 시간일 수 있다. 그러나 이들 예시에 제한되는 것은 아니다.
본 출원은 본 출원의 방법에서 상기 배양하는 단계 이전, 배지를 준비하는 단계를 추가적으로 포함할 수 있으나, 이에 제한되지 않는다.
상기 방법은 배양에 따른 배지 또는 미생물로부터 OPS를 회수하는 단계를 더 포함하는 것일 수 있다. 상기 회수하는 단계는 상기 배양하는 단계 이후에 추가로 포함될 수 있다.
본 출원의 OPS를 회수하는 방법은 배양방법에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배양액으로부터 목적하는 OPS를 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 음이온 교환 크로마토그래피, 결정화 및 HPLC 등이 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 OPS를 회수 할 수 있다.
또한, 상기 회수 단계는 정제 공정을 포함할 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 수행될 수 있다. 따라서, 상기의 회수되는 OPS는 정제된 형태 또는 OPS를 함유한 미생물 발효액일 수 있다. 또한, 상기 배양 단계의 전후, 상기 회수 단계의 전후에 당해 분야에서 공지된 적합한 방법을 추가하여, OPS의 회수를 효율적으로 수행할 수 있다.
본 출원의 다른 하나의 양태로, 본 출원은 a) NADH:quinone 산화환원효소의 활성이 강화된 OPS 생산 미생물을 배지에서 배양하여 OPS 또는 이를 포함하는 배지를 생산하는 단계; b) O-포스포세린 설프하이드릴라아제(O-phosphoserine sulfliydrylase, OPSS) 또는 이를 발현하는 미생물의 존재 하에, 상기 a)단계에서 생산된 OPS 또는 이를 포함하는 배지를 황화물과 반응시키는 단계를 포함하는, 시스테인 또는 이의 유도체의 생산 방법을 제공한다.
상기 a)단계 및 b)단계는 반드시 연속적이거나 순서대로 수행되는 것에 제한되지는 않으며, 이들 단계 사이에는 시간적인 간격이 없거나, 동시에 수행되거나, 또는 수 초, 수 분, 수 시간, 수 일의 간격을 두고 수행될 수 있다.
구체적으로는 Nuo의 활성이 강화된 OPS 생산 미생물을 배지에서 배양하여 OPS 또는 이를 포함하는 배지를 생산하는 단계 및 O-포스포세린 설프하이드릴라아제(O-phosphoserine sulfliydrylase, OPSS) 또는 이를 발현하는 미생물의 존재 하에, 상기 단계에서 생산된 OPS 또는 이를 포함하는 배지를 황화물과 반응시키는 단계를 포함하는, 시스테인 또는 이의 유도체의 생산 방법일 수 있다. 상기 NADH:quinone 산화환원효소 활성 강화 및 O-포스포세린을 생산하는 미생물에 대해서는 전술한 바와 같다.
본 출원에서 용어, "유도체"는 어떤 화합물의 일부를 화학적으로 변화시켜서 얻어지는 유사한 화합물로서, 대개 화합물 중 수소원자 또는 특정 원자단이 다른 원자 또는 원자단에 의하여 치환된 화합물을 의미한다.
본 출원에서 용어, "시스테인 유도체"는 시스테인의 수소 원자 또는 특정 원자단이 다른 원자 또는 원자단에 의하여 치환된 화합물을 의미한다. 그 예로, 시스테인의 아민기 (-NH 2)의 질소 원자 또는 티올 기(-SH)의 황 원자에 다른 원자 또는 원자단이 부착된 형태일 수 있으며, 그 예로 NAC(N-acetylcysteine), SCMC(S-Carboxymetylcysteine), BOC-CYS(ME)-OH,(R)-S-(2-Amino-2-carboxyethyl)-L-homocysteine, (R)-2-Amino-3-sulfopropionic acid, D-2-Amino-4-(ethylthio)butyric acid, 3-sulfino-L-alanine, Fmoc-Cys(Boc-methyl)-OH, Seleno-L-cystine, S-(2-Thiazolyl)-L-cysteine, S-(2-Thienyl)-L-cysteine, S-(4-Tolyl)-L-cysteine 등이 있으나, 이에 제한되지 않는다.
본 출원의 방법에 따라 시스테인을 생산하기만 한다면, 시스테인 유도체로의 전환은 당업계에 널리 알려진 방법으로 용이하게 다양한 시스테인 유도체로의 전환이 가능할 수 있다.
구체적으로, 상기 시스테인 유도체의 생산 방법은 상기 b) 단계에서 생성된 시스테인을 시스테인 유도체로 전환시키는 단계를 추가로 포함하는 것일 수 있으며, 그 예로 시스테인을 아세틸레이션에이젼트(acetylation agent)와 반응시켜 NAC(N-acetylcysteine)를 합성하거나, 시스테인을 염기성 조건에서 할로아세틱에시드(haloacetic acid)와 반응시킴으로써 SCMC(S-Carboxymetylcysteine)를 합성할 수 있으나, 이에 제한되지 않는다.
상기 시스테인 유도체는 주로 제약원료로서 진해제, 기침 완화제, 기관지염, 기관지 천식과 인후염 등의 치료제로 사용될 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "O-포스포세린 설프하이드릴라아제(O-phosphoserine sulfhydrylase, OPSS)"는 OPS에 티올그룹(thiol, group, SH 기)을 제공하여 상기 OPS를 시스테인으로 전환하는 반응을 촉매하는 효소를 의미한다. 상기 효소는 애로피룸 페닉스(Aeropymm pernix), 마이코박테리움 투베쿨로시스(Mycobacterium tuberculosis), 마이코박테리움 메그마틱스(Mycobacterium megmatics), 트리코모나스 배기날리스(Trichomonas vaginalis)(Mino K and Ishikawa K, FEBSletters, 551:133-138, 2003; Bums K E et al. J. Am. Chem. Soc, 127: 11602-11603, 2005) 에서 처음으로 밝혀진 것일 수 있다. 또한, 상기 OPSS는 야생형 OPSS 단백질뿐만 아니라, 상기 OPSS를 코딩하는 폴리뉴클레오티드 서열 중 일부 서열이 결실, 치환 또는 부가된 서열로서, 야생형 OPSS 단백질의 생물학적 활성과 동등 또는 그 이상의 활성을 나타내는 변이체 단백질도 포함하며, US 2012-0190081 A1 및 US 9127324 B2호에 개시된 OPSS 단백질 및 이의 변이체 단백질도 모두 포함할 수 있다.
상기 황화물은 당해 기술 분야에서 통상적으로 사용하는 고형뿐 아니라, pH, 압력, 용해도의 차이로 인해 액체 또는 기체의 형태로 제공되어 설파이드(sulfide, S2-), 티올설페이트(thiosulfate, S203 2-)등의 형태로 티올그룹(thiol group, SH 기)으로 전환될 수 있는 황화물이라면 제한 없이 사용할 수 있다. 구체적으로, 티올 그룹을 OPS에 제공하는 Na2S, NaSH, H2S, (NH4)2S, NaSH 및 Na2S203를 사용할 수 있으나, 이에 제한되지 않는다. 상기 반응은 하나의 OPS 반응기에 하나의 티올기를 제공하여 하나의 시스테인 또는 시스테인 유도체를 제조하는 반응으로, 상기 반응 시 황화물의 첨가량은 OPS 몰농도의 0.1 내지 3배일 수 있으며, 구체적으로, 1 내지 2배일 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 다른 하나의 양태는 NADH:quinone 산화환원효소의 활성이 강화되도록 에스케리키아 속 미생물을 변형하는 것을 포함하는, O-포스포세린 생산 미생물의 제조방법을 제공한다.
본 출원의 다른 하나의 목적은 NADH:quinone 산화환원효소의 활성이 강화된 미생물의, O-포스포세린, 시스테인 또는 그 유도체의 생산 용도를 제공한다.
NADH:quinone 산화환원효소, 이의 활성 강화, 미생물 및 등에 대해서는 전술한 바와 같다.
이하 본 출원을 실시예에 의해 보다 상세하게 설명한다. 그러나 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로, 본 출원의 범위가 이들 실시예에 의해 제한되는 것은 아니며, 본 출원이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어 명백할 것이다.
실시예 1 : Nuo 발현조절영역이 변이된 균주의 OPS 생산능 평가
선행연구 결과, OPS 생산 호스트 균주에서 유전자 nuoA, rmf, idi의 평균 전사량은 각각 8986, 32205, 631 임을 알 수 있었으며 배양구간 별 구체적인 수치는 표 1에 나타난 바와 같다.
Gene
name		 Early Exponential Mid Exponential Late Exponential Stationary Average
idi 914 740 637 234 631
nuoA 6969 7517 8535 12922 8986
rmf 30725 28192 28109 41792 32205
rmf 전사량의 평균값은 nuoA에 비해 3.6배 수준임을 나타내고 있으며, idi 전사량의 평균값은 nuoA에 비해 0.07배 수준임을 확인할 수 있었다. 이는 nuoA의 프로모터에 대비 rmf 유전자의 프로모터는 강한 프로모터이며, idi 유전자의 프로모터는 약한 프로모터임을 나타낸다.
따라서 OPS 생산 미생물 내 nuo 오페론(서열번호 1)에 활성이 다른 rmf 프로모터와 idi 프로모터를 삽입함으로써 NADH:quinone 산화환원효소의 발현을 조절하였을 때 미생물의 OPS 생산능을 비교하고자 하였다.
1-1 : Nuo 발현조절영역을 강화시키기 위한 플라스미드 제작
E.coli ATCC27325 염색체 DNA를 주형으로 서열번호 14 및 15의 염기서열을 가진 프라이머 쌍을 이용하여 nuo 유전자의 야생형 프로모터 업스트림(Upstream) 지역의 유전자 단편을 수득하였고, 서열번호 18 및 19의 염기서열을 가진 프라이머 쌍을 이용하여 상기 프로모터의 다운스트림(Downstream) 지역의 유전자 단편을 수득하였다. 또한 E.coli ATCC27325 염색체 DNA를 주형으로, 서열번호 16 및 17의 염기서열을 가진 프라이머 쌍을 이용하여 rmf 유전자의 프로모터 부위를 수득하였다.
상기의 단편들을 획득하기 위해서 중합효소 SolgTM Pfu-X DNA 폴리머라제를 사용한 PCR을 실시하였고, PCR은 95℃에서 2분간 변성 후, 95℃ 30초 변성, 60℃ 30초 어닐링, 72℃ 60초 중합을 30회 반복한 후, 72℃에서 5분간 중합 반응하는 조건으로 수행하였다.
상기의 과정으로 획득된 nuo 프로모터의 업스트림 단편과 다운스트림 단편, 및 rmf 프로모터 단편은 EcoRV 제한효소로 절단된 염색체 형질전환용 벡터 pSKH130(서열번호 39, 미국 공개특허 제2020-0048619호)와 함께 인퓨전 클로닝 키트(in-fusion cloning kit, Clontech Laboratories, Inc.)를 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, 이를 pSKH130_Prmf-nuoA 로 명명하였다.
1-2 : Nuo 발현조절영역을 약화시키기 위한 플라스미드 제작
E.coli ATCC27325 염색체 DNA를 주형으로, 서열번호 14 및 20의 염기서열을 가진 프라이머 쌍을 이용하여 nuo 유전자의 야생형 프로모터 업스트림(Upstream) 지역의 유전자 단편을 수득하고, 서열번호 23 및 19의 염기서열을 가진 프라이머 쌍을 이용하여 상기 프로모터의 다운스트림(Downstream) 지역의 유전자 단편을 수득하였다. 또한 E.coli ATCC27325 염색체 DNA를 주형으로, 서열번호 21 및 22의 염기서열을 가진 프라이머 쌍을 이용하여 idi 유전자의 프로모터 부위를 수득하였다.
실시예 1-1과 동일한 PCR 조건으로 PCR을 진행하여 상기 단편을 획득하였고 상기 단편을 이용하여 실시예 1-1과 동일한 방법으로 클로닝을 진행함으로써 재조합 플라스미드를 획득하였다. 이를 pSKH130_Pidi-nuoA 로 명명하였다.
실시예 1-1과 실시예 1-2에서 사용한 프라이머 서열을 표 2에 나타내었다.
서열번호 명칭 서열(5'→ 3')
14 UP F1 CTGCAGGAATTCGATCAACCACCAGAGATTCACGT
15 UP R1 GCTTCCTGACTCCAGTGCTTACTCATCAAAAGTAG
16 Prmf F TTTGATGAGTAAGCACTGGAGTCAGGAAGCCGCTT
17 Prmf R TGTTGACATACTCATGCCTCGTTTCCCTCATACTG
18 Down F1 TGAGGGAAACGAGGCATGAGTATGTCAACATCCAC
19 Down R1 ACGGTGAGAACGACCGTTACATCACGCTAGTCGAC
20 UP R2 TCATTTTTCTTCAGCTGCTTACTCATCAAAAGTAG
21 Pidi F TTTGATGAGTAAGCAGCTGAAGAAAAATGAGCATG
22 Pidi R TGTTGACATACTCATAATTTCTCACATGTAATTCTGATC
23 Down F2 TACATGTGAGAAATTATGAGTATGTCAACATCCAC
1-3 : Nuo 발현조절영역 변이 균주 제작
실시예 1-1에서 제작한 pSKH130_Prmf-nuoA를 전기천공법(Appl. Microbiol.Biotechnol. (1999) 52:541-545) 을 이용하여 OPS 생산능을 갖는 CA07-0012 (KCCM 11212P, 미국 공개특허 제2012-0190081호)에 형질전환 한 후, 2차 교차 과정을 거쳐 nuo 유전자의 야생 프로모터 염기서열 말단에 rmf 유전자의 프로모터 염기서열이 삽입된 균주 CA07-4826를 얻었다.
구체적으로, pSKH130 벡터가 PI 단백질(pir 유전자)에 의존성을 가지는 R6K 리플리콘(replicon), SacB(Levansucrase) 유전자 및 카나마이신(kanamycin) 내성 유전자를 포함하고 있으므로, 1차 교차에서 R6K 및 카나마이신을 이용하여 원하는 균주를 확보한 후, 수크로스(sucrose)가 있는 배지에서 항생제를 제거하여 균주를 제작하였다.
상기 CA07-4826는 서열번호 24 및 25의 프라이머 쌍을 이용한 PCR 및 게놈 시퀀싱을 통해 rmf 프로모터 염기서열이 삽입되었음을 확인하였다.
같은 방식으로, 상기 실시예 1-2에서 제작한 pSKH130_Pidi-nuoA를 전기천공법(Appl. Microbiol.Biotechnol. (1999) 52:541-545)을 이용하여 형질전환 한 후, 2차 교차 과정을 거쳐 nuo 유전자의 야생 프로모터 염기서열 말단에 idi 유전자의 프로모터 염기서열이 삽입된 균주 CA07-4827를 얻었다. 서열번호 24 및 25의 프라이머 쌍을 이용한 PCR 및 게놈 시퀀싱을 통해 상기 균주 CA07-4827에 idi 프로모터 염기서열이 삽입되었음을 확인하였다. 여기에서 사용된 프라이머 서열은 하기 표 3과 같다.
서열번호 명칭 서열(5'→ 3')
24 NuoP Conf F GAGAGCTACCATAATCCGTG
25 NuoP Conf R CATCTCAACGTAACAGCAGG
1-4 : 역가배지를 이용한 nuo 오페론 강화 및 약화 균주의 OPS 생산능 비교
상기 실시예 1-3에서 제작한 2종 균주 CA07-4826, CA07-4827와 대조군 CA07-0012의 O-포스포세린(O-phosphoserine, 이하에서 OPS로 기재) 생산능을 평가하기 위해서 하기 배지(표 4)를 이용하여 평가를 진행하였다.
배지성분 조제량
포도당 40g
KH2PO4(KP1) 6g
(NH4)2SO4 17g
MgSO4.7H2O 1g
MnSO4.4H2O 5mg
FeSO4.7H2O 10mg
L-글리신 1.5g/L
효모액기스 2.5g/L
CaCO3 30g/L
pH 6.8
구체적으로, 배양은 각각의 균주를 LB 고체 배지에 도말한 후, 33℃ 배양기에서 밤새 배양하였다. LB 고체 배지에서 밤새 배양한 균주를 표 3의 25mL 역가배지에 접종한 다음, 이를 33℃ 온도에서 200rpm으로 배양기에서 48시간 동안 배양하였으며, 그 결과 생산된 OPS 농도를 표 5에 나타내었다.
균주 이름 OPS(g/L)
CA07-0012 1.95
CA07-4826 2.20
CA07-4827 0.40
rmf 프로모터에 의해 nuo 오페론이 강화된 CA07-4826은 모균주에 비해 약 12.8% 향상된 OPS 생산능을 보였으며, idi 프로모터에 의해 nuo 오페론이 약화된 CA07-4827는 모균주에 비해 약 79.5% 감소한 OPS 생산능을 보였다.
실시예 2 : OPS 생산능이 증가한 균주 내 nuo 오페론 강화에 따른 OPS 생산능 평가
OPS 배출능이 강화된 균주에서 Nuo 오페론을 강화하였을 때 추가로 OPS 생산능이 증가하는지 확인하고자 하였다. 이를 위하여 OPS 배출능을 지닌 단백질 YhhS(서열번호 4, 미국 등록특허 10323262 B2)이 강화된 균주에서 nuo 오페론을 추가로 강화시켰을 때 OPS 생산능을 평가하였다.
2-1 : OPS 생산 균주 내 YhhS 강화를 위한 플라스미드 제작
E.coli ATCC27325 염색체 DNA를 주형으로 서열번호 6 및 7의 염기서열을 갖는 프라이머 쌍을 이용하여 yhhS 유전자의 야생형 프로모터 업스트림(Upstream) 지역의 유전자 단편을 수득하였고 서열번호 8 및 9의 염기서열을 갖는 프라이머 쌍을 이용하여 yhhS 유전자의 야생형 프로모터 다운스트림(Downstream) 지역의 유전자 단편을 수득하였다. 또한 pCL_Ptrc-gfp(US 2017-0247727 A1)를 주형으로 서열번호 8 과 서열번호 9 프라이머 쌍을 이용하여 trc 프로모터(Ptrc)를 수득하였다. 상기에서 사용된 프라이머 서열은 하기 표 6과 같다.
서열번호 명칭 서열(5'→ 3')
6 yhhS UP F CTGCAGGAATTCGATGAAGGTAACCACTTTTTCCG
7 yhhS UP R GAGTTGCAGCAAGCGGAGGATCACCACATTTTTAC
8 Ptrc F AATGTGGTGATCCTCCGCTTGCTGCAACTCTCTCA
9 Ptrc R TACGGGTTCGGGCATGATAGCTCTCCTGTGTGAAA
10 yhhS Down F CACAGGAGAGCTATCATGCCCGAACCCGTAGCCGA
11 yhhS Down R GTCGACTAGCGTGATAGCGGTTTGCCTTTACTGGC
상기의 단편들을 획득하기 위해서 중합효소 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR 증폭은 95℃에서 2분간 변성 후, 95℃ 30초 변성, 60℃ 30초 어닐링, 72℃ 60초 중합을 30회 반복한 후, 72℃에서 5분간 중합 반응하는 조건으로 수행하였다.
상기의 과정으로 획득된 yhhS 프로모터의 업스트림 단편과 다운스트림 단편, 및 trc 프로모터 단편은 EcoRV 제한효소로 절단된 염색체 형질전환용 벡터 pSKH130와 함께 인퓨전 클로닝 키트(in-fusion cloning kit, Clontech Laboratories, Inc.)를 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, 이를 pSKH130_Ptrc-yhhS 로 명명하였다.
2-2 : YhhS 강화 균주 제작
상기 실시예 2-1에서 제작한 pSKH130_Ptrc-yhhS를 전기천공법(Appl. Microbiol.Biotechnol. (1999) 52:541-545) 을 이용하여 CA07-0012에 형질전환 한 후, 2차 교차 과정을 거쳐 yhhS 유전자의 야생형 프로모터 염기서열 말단에 trc 프로모터 염기서열이 삽입된 균주 CA07-4821를 얻었다. 서열번호 12 및 서열번호 13의 프라이머 쌍 (표 7) 을 이용하여 PCR 및 게놈 시퀀싱을 통해 상기 균주 CA07-4821에 trc 프로모터 염기서열이 삽입되었음을 확인하였다.
서열번호 명칭 서열(5'→ 3')
12 yhhSP Conf F AGTTGAGCAAAAACGCCAGT
13 yhhSP Conf R GCCATACCGTACAGCCAGAC
2-3 : 역가배지를 이용한 YhhS 강화 균주의 OPS 생산능 평가
상기 실시예 2-2에서 제작한 균주 CA07-4821 과 그 모균주인 CA07-0012의 OPS 생산능을 평가하기 위해서 배지(표 4)를 이용하여 실시예 1-4와 동일한 방법으로 평가를 진행하였다.
그 결과, CA07-4821의 경우 CA07-0012 대비 약 26.7% 향상된 OPS 생산능을 갖는 것을 확인하였으며, 이를 표 8 에 나타내었다.
균주 이름 OPS(g/L)
CA07-0012 1.95
CA07-4821 2.47
2-4 : YhhS 및 nuo 오페론이 강화된 균주 제작
실시예 1-1에서 제작한 pSKH130_Prmf-nuoA를 전기천공법(Appl. Microbiol.Biotechnol. (1999) 52:541-545) 을 이용하여 상기 실시예 2-3에서 제작한 CA07-4821에 형질전환 한 후, 2차 교차 과정을 거쳐 nuo 유전자의 야생 프로모터 염기서열 말단에 rmf 유전자의 프로모터 염기서열이 삽입된 균주 CA07-4828을 얻었다.
상기 균주 CA07-4828는 서열번호 24 및 25의 프라이머 쌍을 이용한 PCR 및 게놈 시퀀싱을 통해 rmf 프로모터 염기서열이 삽입되었음을 확인하였다.
2-5 : 역가배지를 이용한 YhhS 및 nuo 오페론이 강화된 균주의 OPS 생산능 평가
상기 CA07-4828의 OPS 생산능을 평가하기 위해서 CA07-4821을 대조군으로 실시예 1-4와 동일한 방법으로 평가를 진행하였고 그 결과를 표 9에 나타내었다.
균주 이름 OPS(g/L)
CA07-4821 2.47
CA07-4828 2.53
YhhS 및 nuo 오페론이 동시 강화된 CA07-4828의 경우 YhhS만이 강화된 CA07-4821 대비 약 2.4% 향상된 OPS 생산능을 보였으며, 이로써 OPS 생산능이 강화된 균주에서도 nuo 오페론 강화가 OPS 생산능을 추가로 증가시키는 것을 확인하였다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 및 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.

Claims (11)

  1. NADH:quinone 산화환원효소의 활성이 강화되고, O-포스포세린 생산능을 가진, 에스케리키아 속 재조합 미생물.
  2. 제 1항에 있어서, 상기 NADH:quinone 산화환원효소의 활성 강화는 nuo 오페론의 발현 증가인, 미생물.
  3. 제 1항에 있어서, 상기 NADH:quinone 산화환원효소의 활성 강화는 상기 NADH:quinone 산화환원효소를 코딩하는 유전자의 업스트림에 활성이 강화된 유전자 발현 조절 서열을 포함하는 것인, 미생물.
  4. 제3항에 있어서, 상기 NADH:quinone 산화환원효소를 코딩하는 유전자의 업스트림은 nuoA 유전자의 업스트림인, 미생물.
  5. 제1항에 있어서, 상기 미생물은 추가로 포스포세린 포스파타아제(SerB)의 활성이 약화된 미생물.
  6. 제1항에 있어서, 상기 미생물은 추가로 O-포스포세린 배출 단백질(YhhS) 의 활성이 강화된 미생물.
  7. 제1항에 있어서, 상기 미생물은 에스케리키아 콜라이(Escherichia coli)인, 미생물.
  8. 제1항 내지 제7항 중 어느 한 항의 미생물을 배지에서 배양하는 단계를 포함하는, O-포스포세린의 생산 방법.
  9. 제 8항에 있어서, 상기 방법은 상기 배양에 따른 배지 또는 미생물에서 O-포스포세린을 회수하는 단계를 추가로 포함하는, O-포스포세린의 생산 방법.
  10. a) NADH:quinone 산화환원효소의 활성이 강화된 O-포스포세린 생산 미생물을 배지에서 배양하여 O-포스포세린 또는 이를 포함하는 배지를 생산하는 단계; 및
    b) O-포스포세린 설프하이드릴라아제(OPSS) 또는 이를 발현하는 미생물의 존재 하에 a) 단계에서 생산된 O-포스포세린 또는 이를 포함하는 배지를 황화물과 반응시키는 단계를 포함하는, 시스테인 또는 이의 유도체의 생산 방법.
  11. 제10항에 있어서, 상기 황화물은 Na2S, NaSH, (NH4)2S, H2S 및 Na2S2O3로 이루어지는 군으로부터 선택되는 하나 이상인, 시스테인 또는 이의 유도체의 생산 방법.
PCT/KR2022/008745 2021-06-23 2022-06-21 Nadh:quinone 산화환원효소의 발현이 조절된 재조합 미생물 및 이를 이용한 o-포스포세린, 시스테인 및 이의 유도체의 생산방법 WO2022270857A1 (ko)

Priority Applications (8)

Application Number Priority Date Filing Date Title
JP2023579425A JP2024522877A (ja) 2021-06-23 2022-06-21 ＮＡＤＨ：ｑｕｉｎｏｎｅ酸化還元酵素の発現が調節された組換え微生物、並びにそれを用いたＯ－ホスホセリン、システイン及びその誘導体の生産方法。
EP22828704.1A EP4361276A1 (en) 2021-06-23 2022-06-21 Recombinant microorganism in which expression of nadh:quinone oxidoreductase is controlled, and method for producing o-phosphoserine, cysteine, and derivative thereof by using same
AU2022297143A AU2022297143A1 (en) 2021-06-23 2022-06-21 Recombinant microorganism in which expression of nadh:quinone oxidoreductase is controlled, and method for producing o-phosphoserine, cysteine, and derivative thereof by using same
BR112023027397A BR112023027397A2 (pt) 2021-06-23 2022-06-21 Microrganismo recombinante do gênero escherichia no qual a atividade de nadh:quinona oxidorredutase é melhorada, uso do mesmo para a produção de o-fosfosserina (ops), cisteína ou um derivado das mesmas e métodos para produzir o-fosfosserina, cisteína ou derivado da mesma e para produzir um microrganismo produtor de ops
CN202280057073.7A CN117897489A (zh) 2021-06-23 2022-06-21 控制nadh：醌氧化还原酶表达的重组微生物，以及通过使用重组微生物生产o-磷酸丝氨酸、半胱氨酸及其衍生物的方法
CA3223970A CA3223970A1 (en) 2021-06-23 2022-06-21 Recombinant microorganism in which expression of nadh:quinone oxidoreductase is controlled, and method for producing o-phosphoserine, cysteine, and derivative thereof by using same
MX2024000244A MX2024000244A (es) 2021-06-23 2022-06-21 Microorganismo recombinante en el cual se controla la expresion de nadh:quinona oxidorreductasa y metodo para producir o-fosfoserina, cisteina y derivado de la misma utilizando la misma.
US18/573,419 US20240294955A1 (en) 2021-06-23 2022-06-21 Recombinant microorganism in which expression of nadh:quinone oxidoreductase is controlled, and method for producing o-phosphoserine, cysteine, and derivative thereof by using same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0081785 2021-06-23
KR1020210081785A KR102654301B1 (ko) 2021-06-23 2021-06-23 NADH:quinone 산화환원효소의 발현이 조절된 재조합 미생물 및 이를 이용한 O-포스포세린, 시스테인 및 이의 유도체의 생산방법

Publications (1)

Publication Number Publication Date
WO2022270857A1 true WO2022270857A1 (ko) 2022-12-29

Family

ID=84538605

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/008745 WO2022270857A1 (ko) 2021-06-23 2022-06-21 Nadh:quinone 산화환원효소의 발현이 조절된 재조합 미생물 및 이를 이용한 o-포스포세린, 시스테인 및 이의 유도체의 생산방법

Country Status (12)

Country Link
US (1) US20240294955A1 (ko)
EP (1) EP4361276A1 (ko)
JP (1) JP2024522877A (ko)
KR (1) KR102654301B1 (ko)
CN (1) CN117897489A (ko)
AR (1) AR126213A1 (ko)
AU (1) AU2022297143A1 (ko)
BR (1) BR112023027397A2 (ko)
CA (1) CA3223970A1 (ko)
MX (1) MX2024000244A (ko)
TW (1) TWI843130B (ko)
WO (1) WO2022270857A1 (ko)

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0885962B1 (de) 1997-06-19 2005-04-13 Consortium für elektrochemische Industrie GmbH Mikroorganismen und Verfahren zur fermentativen Herstellung von L-Cystein, L-Cystin, N-Acetyl-Serin oder Thiazolindinderivaten
US20050124049A1 (en) * 2003-11-03 2005-06-09 Ziyatdinov Mikhail K. Method for producing L-cysteine using bacteria belonging to the genus Escherichia
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
US20120190081A1 (en) 2010-10-20 2012-07-26 Cj Cheiljedang Corporation Microorganism producing o-phosphoserine and method of producing l-cysteine or derivatives thereof from o-phosphoserine using the same
US9127324B2 (en) 2010-10-20 2015-09-08 CJ Cheildjedang Corporation O-phosphoserine sulfhydrylase mutants and method for production of cysteine using the same
KR101694632B1 (ko) * 2015-09-11 2017-01-10 씨제이제일제당 (주) 신규 ｏ-포스포세린 배출 단백질 변이체 및 이를 이용한 ｏ-포스포세린, 시스테인 및 이의 유도체의 생산방법
US20170247727A1 (en) 2014-06-03 2017-08-31 Cj Cheiljedang Corporation Microorganism having ability to produce o-succinylhomoserine or succinic acid, and method for producing succinic acid or o-succinylhomoserine by using same
US10323262B2 (en) 2014-08-12 2019-06-18 Cj Cheiljedang Corporation Microorganism producing O-phosphoserine and a method for producing O-phosphoserine or L-cysteine using the same
US20200048619A1 (en) 2018-08-07 2020-02-13 Cj Cheiljedang Corporation Nucleic Acid Molecules Comprising a Variant RpoC Coding Sequence

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0885962B1 (de) 1997-06-19 2005-04-13 Consortium für elektrochemische Industrie GmbH Mikroorganismen und Verfahren zur fermentativen Herstellung von L-Cystein, L-Cystin, N-Acetyl-Serin oder Thiazolindinderivaten
US20050124049A1 (en) * 2003-11-03 2005-06-09 Ziyatdinov Mikhail K. Method for producing L-cysteine using bacteria belonging to the genus Escherichia
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
US20120190081A1 (en) 2010-10-20 2012-07-26 Cj Cheiljedang Corporation Microorganism producing o-phosphoserine and method of producing l-cysteine or derivatives thereof from o-phosphoserine using the same
KR101381048B1 (ko) 2010-10-20 2014-04-14 씨제이제일제당 (주) Ｏ-포스포세린 생산 균주 및 이로부터 생산된 ｏ-포스포세린으로부터 ｌ-시스테인 또는 이의 유도체의 생산방법
US9127324B2 (en) 2010-10-20 2015-09-08 CJ Cheildjedang Corporation O-phosphoserine sulfhydrylase mutants and method for production of cysteine using the same
US20170247727A1 (en) 2014-06-03 2017-08-31 Cj Cheiljedang Corporation Microorganism having ability to produce o-succinylhomoserine or succinic acid, and method for producing succinic acid or o-succinylhomoserine by using same
US10323262B2 (en) 2014-08-12 2019-06-18 Cj Cheiljedang Corporation Microorganism producing O-phosphoserine and a method for producing O-phosphoserine or L-cysteine using the same
KR101694632B1 (ko) * 2015-09-11 2017-01-10 씨제이제일제당 (주) 신규 ｏ-포스포세린 배출 단백질 변이체 및 이를 이용한 ｏ-포스포세린, 시스테인 및 이의 유도체의 생산방법
US20200048619A1 (en) 2018-08-07 2020-02-13 Cj Cheiljedang Corporation Nucleic Acid Molecules Comprising a Variant RpoC Coding Sequence

Non-Patent Citations (17)

* Cited by examiner, † Cited by third party
Title
AHMED ZAHOOR, COMPUTATIONAL AND STRUCTURAL BIOTECHNOLOGY JOURNAL, vol. 3, October 2012 (2012-10-01)
APPL. MICROBIOL. BIOTECHNOL., vol. 52, 1999, pages 541 - 545
BURNS K. E. ET AL., J. AM. CHEM. SOC., vol. 127, 2005, pages 11602 - 11603
F. M. AUSUBEL ET AL., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY
J. SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
KARLINALTSCHUL, PRO. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873
METHODS ENZYMOL., vol. 183, 1990, pages 63
MINO K.ISHIKAWA K., FEBS LETTERS, vol. 551, 2003, pages 133 - 138
NAKASHIMA N ET AL.: "Bacterial cellular engineering by genome editing and gene silencing", INT J MOL SCI., vol. 15, no. 2, 2014, pages 2773 - 2793, XP055376889, DOI: 10.3390/ijms15022773
PETERS-WENDISCH P. ET AL., APPL ENVIRON MICROBIOL, vol. 7 1, no. II, November 2005 (2005-11-01), pages 139 - 44
SAMBROOK ET AL., MOLECULAR CLONING, 2012
SITNICKA ET AL.: "Functional Analysis of Genes", ADVANCES IN CELL BIOLOGY, vol. 2, 2010, pages 1 - 16
SPEHR VOLKER, SCHLITT ANGELA, SCHEIDE DIERK, GUÉNEBAUT VINCENT, FRIEDRICH THORSTEN: "Overexpression of the Escherichia coli nuo -Operon and Isolation of the Overproduced NADH:Ubiquinone Oxidoreductase (Complex I)", BIOCHEMISTRY, vol. 38, no. 49, 1 December 1999 (1999-12-01), pages 16261 - 16267, XP093017273, ISSN: 0006-2960, DOI: 10.1021/bi9919605 *
WADA, M.TAKAGI, H., APPL. MICROBIOL. BIOCHEM., vol. 73, 2006, pages 48 - 54
WEINTRAUB, H. ET AL.: "Antisense-RNA as a molecular tool for genetic analysis", REVIEWS - TRENDS IN GENETICS, vol. 1, no. 1, 1986
WENDISCH V. F. ET AL., CURR OPIN MICROBIOL, vol. 9, no. 3, June 2006 (2006-06-01), pages 268 - 74
WESTROP G D, GOODALL G, MOTTRAM JC, COOMBS G H: "Cysteine biosynthesis in Trichomonas vaginalis involves cysteine synthase utilizing O-phosphoserine.", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY, US, vol. 281, no. 35, 1 September 2006 (2006-09-01), US , pages 25062 - 25075, XP002741273, ISSN: 0021-9258, DOI: 10.1074/jbc.M600688200 *

Also Published As

Publication number Publication date
EP4361276A1 (en) 2024-05-01
KR102654301B1 (ko) 2024-04-04
US20240294955A1 (en) 2024-09-05
TWI843130B (zh) 2024-05-21
AR126213A1 (es) 2023-09-27
TW202313963A (zh) 2023-04-01
CA3223970A1 (en) 2022-12-29
JP2024522877A (ja) 2024-06-21
MX2024000244A (es) 2024-01-31
KR20220170657A (ko) 2022-12-30
BR112023027397A2 (pt) 2024-03-12
CN117897489A (zh) 2024-04-16
AU2022297143A1 (en) 2024-01-18

Similar Documents

Publication Publication Date Title
WO2016024771A1 (ko) O-포스포세린 생산 미생물 및 이를 이용한 o-포스포세린 또는 l-시스테인 생산 방법
WO2022163934A1 (ko) 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022231058A1 (ko) 신규한 수용성 피리딘 뉴클레오티드 트랜스수소효소 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022231368A1 (ko) 신규한 글루타메이트 합성 효소 서브 유니트 알파 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2017043915A1 (ko) 신규 ｏ-포스포세린 배출 단백질 변이체 및 이를 이용한 ｏ-포스포세린, 시스테인 및 이의 유도체의 생산방법
WO2022163917A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163920A1 (ko) 신규한 시스테인 설피네이트 디설피나제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163922A1 (ko) 신규한 아스파라긴 신타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163923A1 (ko) 신규한 atp 포스포리보실트랜스퍼라제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022225319A1 (ko) 신규한 l-세린 암모니아 분해 효소 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022225320A1 (ko) 신규한 포스포글리세린산 디하이드로게나제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022215800A1 (ko) 신규한 분지쇄아미노산 투과효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2022225100A1 (ko) 신규한 이중기능성 메틸렌테트라히드로폴레이트 탈수소효소/메테닐테트라하이드로폴레이트 사이클로하이드롤라아제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022270857A1 (ko) Nadh:quinone 산화환원효소의 발현이 조절된 재조합 미생물 및 이를 이용한 o-포스포세린, 시스테인 및 이의 유도체의 생산방법
WO2022158646A1 (ko) 신규한 쿠퍼익스포팅 p-type 에이티피에이즈 a 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022158652A1 (ko) 신규한 사이토신 퍼미에이즈 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022231057A1 (ko) 신규한 아이소시트르산 디하이드로게네이즈 키나아제/포스파타제 효소 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022158645A1 (ko) 신규한 데옥시구아노신트리포스페이트 트리포스포하이드로레이즈 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022158650A1 (ko) 신규한 페로체라테이즈 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022055192A1 (ko) 신규 o-포스포세린 배출 단백질 및 이를 이용한 o-포스포세린, 시스테인 및 이의 유도체의 생산 방법
WO2022260215A1 (ko) 신규한 mdth 변이체 및 이를 이용한 o-포스포세린, 시스테인 및 이의 유도체의 생산방법
WO2022163926A1 (ko) 신규한 프롤린 탈수소효소 변이체 및 이를 이용한 l-발린 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22828704

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 3223970

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2023579425

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 12023553511

Country of ref document: PH

Ref document number: 2301008409

Country of ref document: TH

WWE Wipo information: entry into national phase

Ref document number: 2022297143

Country of ref document: AU

Ref document number: AU2022297143

Country of ref document: AU

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023027397

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: MX/A/2024/000244

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2022297143

Country of ref document: AU

Date of ref document: 20220621

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2022828704

Country of ref document: EP

Ref document number: 2023136241

Country of ref document: RU

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022828704

Country of ref document: EP

Effective date: 20240123

WWE Wipo information: entry into national phase

Ref document number: 202280057073.7

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 112023027397

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20231222