WO2022098014A1 - 유전자 교정을 이용한 조로증 및 자연노화의 예방 또는 치료용 조성물 - Google Patents

유전자 교정을 이용한 조로증 및 자연노화의 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2022098014A1
WO2022098014A1 PCT/KR2021/015531 KR2021015531W WO2022098014A1 WO 2022098014 A1 WO2022098014 A1 WO 2022098014A1 KR 2021015531 W KR2021015531 W KR 2021015531W WO 2022098014 A1 WO2022098014 A1 WO 2022098014A1
Authority
WO
WIPO (PCT)
Prior art keywords
progerin
present
composition
mrna
expression vector
Prior art date
Application number
PCT/KR2021/015531
Other languages
English (en)
French (fr)
Inventor
김선욱
박영호
이승환
이종희
차재진
김한섭
채운빈
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020210145418A external-priority patent/KR20220059913A/ko
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Publication of WO2022098014A1 publication Critical patent/WO2022098014A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00—General protective or antinoxious agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses

Definitions

  • the present invention relates to a composition for preventing or treating progeria and natural aging using gene editing.
  • HGPS Hutchinson-Gilford Progeria Syndrome
  • LMNA lamin A
  • Progeria is a rare genetic disease caused by point mutations (p.G608G, c.C1824T) on the lamin A (LMNA) genetic locus.
  • LMNA lamin A
  • This gene mutation unlike normal gene expression, induces alternative splicing to express abnormal lamin A protein (progerin, progerin), accumulates in the nuclear membrane and interferes with normal lamin A function, thereby causing cell damage. induce death.
  • RNAi RNA interference
  • HR homologous recombination
  • CRISPR/Cas9 does not distinguish between lamin A and progerin on DNA, not only target cutting only progerin, which causes HGPS disease, but also normal lamin A was reduced. And, the biggest drawback of the CRISPR/Cas9 system is that it is impossible to restore the already cut DNA back to its original state because it binds to and cuts off-targets, so stability problems always follow.
  • RNA gene targeting system CRISPR/Cas13
  • CRISPR/Cas13 RNA gene targeting system
  • the RNA gene targeting system is a type of bacterial immune system that operates based on a protein called Cas13 and a guide RNA complementary to the target RNA.
  • the present invention was designed to enable non-permanent and effective treatment by targeting progeria-induced gene mutations at the RNA level based on a target-specific RNA gene targeting system (CRISPR/Cas13).
  • An aspect of the present invention is to provide a polynucleotide encoding a gRNA that hybridizes to progerin mRNA, wherein the polynucleotide is any one of SEQ ID NOs: 1 to 5.
  • Another aspect of the present invention is to provide a gRNA derived from the polynucleotide of any one of SEQ ID NOs: 1 to 5.
  • Another aspect of the present invention is gRNA derived from the polynucleotide of any one of SEQ ID NOs: 1 to 5; And an object of the present invention is to provide a composition for inhibiting progerin expression comprising Cas13 mRNA or Cas 13 protein derived therefrom.
  • Another aspect of the present invention is to provide a recombinant expression vector comprising a polynucleotide sequence of any one of SEQ ID NOs: 1 to 5 or a sequence complementary thereto, which encodes a gRNA that hybridizes to progerin mRNA.
  • Another aspect of the present invention is to provide a composition for inhibiting progerin expression comprising the recombinant expression vector as an active ingredient or a composition for inhibiting progerin expression comprising the recombinant expression vector and Cas13 expression vector.
  • Another aspect of the present invention aims to provide a pharmaceutical composition for preventing or treating premature aging and natural aging comprising the composition as an active ingredient.
  • Another aspect of the present invention aims to provide a method for improving or treating progeria and natural aging comprising administering the composition to a subject to be treated.
  • another aspect of the present invention aims to provide a use of the composition for the improvement or treatment of progeria and natural aging.
  • another aspect of the present invention aims to provide a use of the composition for preparing a pharmaceutical composition for improving or treating progeria and natural aging.
  • the present invention provides a polynucleotide encoding a gRNA that hybridizes to progerin mRNA, wherein the polynucleotide is any one of SEQ ID NOs: 1 to 5.
  • the present invention provides a gRNA derived from the polynucleotide of any one of SEQ ID NOs: 1 to 5.
  • the gRNA may hybridize to genes encoding exon 11 and exon 12 of the LMNA gene.
  • the present invention provides a gRNA derived from the polynucleotide of any one of SEQ ID NOs: 1 to 5; And it provides a composition for inhibiting progerin expression comprising Cas13 mRNA or a Cas 13 protein derived therefrom.
  • the present invention provides a recombinant expression vector comprising the polynucleotide sequence of any one of SEQ ID NOs: 1 to 5 or a sequence complementary thereto, which encodes a gRNA that hybridizes to progerin mRNA.
  • the recombinant expression vector may further include a polynucleotide sequence encoding Cas13.
  • the recombinant expression vector may be composed of any one of SEQ ID NOs: 6 to 10.
  • the present invention provides a composition for inhibiting progerin expression comprising the recombinant expression vector as an active ingredient.
  • the present invention provides a composition for inhibiting progerin expression comprising the recombinant expression vector and the Cas13 expression vector.
  • the present invention provides a pharmaceutical composition for preventing or treating premature aging and natural aging comprising the composition as an active ingredient.
  • the present invention provides a method for improving or treating progeria and natural aging comprising administering the composition to a subject to be treated.
  • the present invention provides the use of the composition for the amelioration or treatment of progeria and natural aging.
  • the present invention provides a use of the composition for preparing a pharmaceutical composition for improving or treating progeria and natural aging.
  • the recombinant expression vector of the present invention and a pharmaceutical composition for preventing or treating progeria and natural aging comprising the same include sgRNA hybridized to mRNA encoding progerin, a cause of progeria, and a gene encoding Cas13 protein acting thereon Therefore, it selectively cuts only the mRNA that is introduced into the cells of the treatment target and encodes progerin.
  • FTI farnesyltransferase inhibitor
  • RNAi RNA interference
  • 1 is a diagram showing mutations that cause progeria.
  • FIG. 2 is a diagram showing the mechanism of action of Cas13 used in the present invention.
  • FIG. 3 is a diagram showing the position in the progerin mRNA to which the sgRNA encoded by SEQ ID NOs: 1 to 5 of the present invention is hybridized.
  • FIGS. 4 to 9 are diagrams showing the vector used in the recombinant expression vector of the present invention in Example 1 (Fig. 4) and the recombinant expression vector of the present invention (Fig. 5 to Fig. 9).
  • FIG. 10 and 11 are a lamin A overexpression vector (FIG. 10) and a progerin overexpression vector (FIG. 11) used in Experimental Example 2-1.
  • FIG. 12 shows the vectors used for the LMNA and Progerin conditional overexpression cell lines in Experimental Example 2-2.
  • AAVS1 all-in one, H11 all-in one, ERT2CreERT2, and Conditional LMNA vectors were used for each LMNA conditional overexpression cell line.
  • AAVS1 all-in one, H11 all-in one, ERT2CreERT2, Conditional Progerin vectors were used to construct a cell line conditionally overexpressing Progerin.
  • FIG. 13 is a schematic diagram illustrating the verification of LMNA and Progerin conditionally overexpressing cell lines in Experimental Example 2-2.
  • the WT band is a cell line in which the exogenous overexpression vector is not inserted, and the two bands, WT and Tg, confirm that only one allele is inserted into the gene (heterogeneous).
  • 16 is a diagram showing the position on the gene of the LMNA semi RT-PCR primer in Experimental Example 2-2.
  • 17 is a diagram showing the position on the gene of the Progerin semi RT-PCR primer in Experimental Example 2-2.
  • FIG. 18 is a diagram showing the position on the gene of the LMNA-specific RT-PCR primer in Experimental Example 2-3.
  • FIG. 19 is a diagram showing the position on the gene of the Progerin-specific RT-PCR primer in Experimental Example 2-3.
  • 25 and 26 are the results of Experimental Example 4-2., it can be confirmed that the decrease in progerin and aging-related gene expression in the experimental group introduced with the recombinant expression vector of the present invention.
  • One aspect of the present invention provides a polynucleotide encoding a gRNA that hybridizes to progerin mRNA, wherein the polynucleotide is any one of SEQ ID NOs: 1 to 5.
  • the term 'progerin' is an abnormal expression form of lamin A protein, specifically, abnormal expression with point mutations (p. G608G, c.C1824T) on the locus encoding lamin A protein. It is a lamin A protein. If the above-mentioned lamin A gene is mutated, the amino acid sequence required for protein formation is not changed, but abnormal splicing (alternative splicing) is formed in the mRNA transcription process, and a portion of the COOH end of exon 11 is Abnormal lamin A (progerin) is produced in the deleted (150 bp deletion) form.
  • Progerin thus formed operates in vivo in a dominant negative manner, showing abnormal nuclear membrane formation at the cell level, and phenotypes related to progeria (dwarfism, hair loss, skin disease, weight loss, fat abnormality, etc.) at the individual level.
  • lamin A' is a kind of lamin protein.
  • Lamin protein is a protein connected to the inner membrane of the nuclear membrane. It is an essential structure of the nuclear membrane and an intermediate filament that plays an important role in maintaining the nuclear structure of the interphase. is a kind of They, like other intermediate fibers, consist of a central alpha linear rod domain flanked by small (about 20 residues) non-linear amino terminal sequences and a larger carboxy-terminal globular domain.
  • lamin A protein is produced together with lamin C protein by alternative splicing from a single primary transcription of lamin A gene (LMNA).
  • 'progerin mRNA' refers to the above-described progerin, that is, mRNA encoding the abnormally expressed lamin A protein, and specifically, a point mutation (p. G608G, c.C1824T), specifically, refers to a sieve-translated mRNA having a point mutation (p. G608G).
  • gRNA guide RNA, guide RNA
  • the gRNA may be crRNA and tracrRNA, or may be a gRNA in which crRNA and tracrRNA are linked together.
  • a gRNA hybridizing to progerin mRNA may be prepared by transcription of any one of the polynucleotides of SEQ ID NOs: 1 to 5, and the gRNA may act with CRISRP/Cas13 to selectively cleave progerin mRNA.
  • gRNA transcribed from the nucleotide encoding any one of SEQ ID NOs: 1 to 5 does not bind to mRNA encoding the normal lamin A protein and non-specific target (off-target), so more precise treatment and reversible treatment is possible
  • the polynucleotide sequence of any one of SEQ ID NOs: 1 to 5 of the present invention contains not only the corresponding sequence, but also 40% or more, preferably 60% or more, more preferably 80% or more, even more preferably 90% of the above sequence. It is possible to transcribe progerin mRNA or gRNA hybridizing to a gene encoding exon 11 and exon 12 of a progerin mRNA or LMNA gene as a polynucleotide sequence exhibiting more than, more preferably 95% or more, and most preferably 99% or more homology.
  • Another aspect of the present invention provides a gRNA derived from the polynucleotide of any one of SEQ ID NOs: 1 to 5.
  • the gRNA of the present invention can be obtained by transcription of any one of the polynucleotides of SEQ ID NOs: 1 to 5, hybridize to progerin mRNA, and then act with CRISRP/Cas13 to selectively cut progerin mRNA.
  • the gRNA may hybridize to genes encoding exon 11 and exon 12 of the LMNA gene.
  • progerin is expressed with point mutations (p. G608G, c.C1824T) on the locus encoding the lamin A protein, and the mRNA encoding progerin is caused by abnormal splicing in the transcription process. Due to this, a portion of the COOH end of exon 11 is deleted (150 bp deletion).
  • the gRNA hybridizing to the progerin mRNA of the present invention is hybridized to the genes encoding exon 11 and exon 12 of the LMNA gene, and can selectively cut progerin mRNA by acting with CRISRP/Cas13.
  • Another aspect of the present invention is gRNA derived from any one of SEQ ID NOs: 1 to 5 polynucleotides; And it provides a composition for inhibiting progerin expression comprising Cas13 mRNA or a Cas 13 protein derived therefrom.
  • the gRNA derived from the polynucleotide of any one of SEQ ID NOs: 1 to 5 is as described above.
  • the Cas13 mRNA or Cas 13 protein derived therefrom works as a CRISPR/Cas13 system together with the gRNA derived from the polynucleotide of any one of SEQ ID NOs: 1 to 5. Specifically, the gRNA hybridizes to genes encoding exon 11 and exon 12 of the LMNA gene, and can selectively cleave progerin mRNA by interacting with CRISRP/Cas13.
  • the "CRISPR/Cas13 system” is a third-generation gene scissors composed of a Cas13 protein and a single guide RNA, and a desired gene using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system known as the immune system of microorganisms.
  • An artificial restriction enzyme designed to cut a nucleotide sequence.
  • RNA which is a foreign gene, mainly according to bacterial phage infection.
  • crRNA crisprRNA
  • containing the base sequence complementary to the effector protein Cas13 and the foreign virus is mainly expressed in a region known as the CRISPR cluster of the bacterial genome.
  • the viral RNA binds to the viral RNA and have the function of removing the target by cutting off the target, and are known as the adaptive immune system that recognizes and responds to each target RNA gene in various ways.
  • the expression of the target RNA can be controlled by delivering it into higher cells like the CRISPR-Cas13 protein.
  • Cas13 protein is an essential protein element in the CRISPR/Cas13 system, and is largely composed of a REC domain (REC lobe) and a NUC domain (NUC lobe), and each contributes to binding to and cleavage of target mRNA. do.
  • specific amino acid residues of the HEPN domain bind to and cut the scissile bond of the nucleic acid of the mRNA to remove the target RNA.
  • a specific portion of the target RNA to which crRNA bound to CRISPR-Cas13 complementarily binds is called a protospacer sequence, and is a major factor recognized as a target.
  • the crRNA stem loop structure is recognized and bound to the REC lobe of the CRISPR-Cas13 protein.
  • the protospacer a target RNA region complementary to crRNA and forming a double helix, is recognized by the remaining NUC lobes and cleavage occurs.
  • the CRISPR-Cas13 family it has been reported that the CRISPR-Cas13a type has high target RNA cleavage efficiency in higher animal cells and operates accurately without off-target cleavage [2017, Nature, Omar O. Abudayyeh et al.].
  • the Cas13 protein can solve the problems of the conventional Cas9 protein (the problem of inability to distinguish lamin A from progerin on DNA, and the problem of binding to off-target and irreversible problems).
  • the Cas13 protein includes Cas13a, Cas13b, and Cas13c, and may specifically be Cas13a in the present invention.
  • an aspect of the present invention provides a recombinant expression vector comprising a polynucleotide sequence of any one of SEQ ID NOs: 1 to 5 or a sequence complementary thereto, which encodes a gRNA that hybridizes to progerin mRNA.
  • polynucleotide sequence of any one of SEQ ID NOs: 1 to 5 encoding the gRNA hybridizing to the progerin mRNA is as described above.
  • the "recombinant expression vector” refers to a recombinant DNA molecule comprising a desired coding sequence and an appropriate nucleic acid sequence essential for expressing a coding sequence operably linked in a specific host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotes are known.
  • the recombinant expression vector may further include a polynucleotide sequence encoding Cas13.
  • the polynucleotide sequence encoding Cas13 means a sequence encoding the aforementioned Cas13 mRNA or protein.
  • progerin mRNA is removed using a gene scissors that specifically acts on progerin mRNA using the CRISPR/Cas13 system.
  • the gene encoding the abnormal lamin A protein progerin, progerin
  • the progerin mRNA is different from the normal mRNA in the nucleotide sequence at the end of exon 11 and at the border of exon 12. Therefore, when complementary sgRNA corresponding to the mutated nucleotide sequence is prepared and delivered into the cells of a progeria patient together with CRISPR/CAS13, only progerin mRNA by the mutated gene can be selectively removed.
  • the expression vector of the present invention may further include a promoter operably linked to the polynucleotide sequence.
  • operably linked refers to a functional linkage between a gene expression control sequence and another nucleotide sequence.
  • the gene expression control sequence may be at least one selected from the group consisting of an origin of replication, a promoter, and a terminator.
  • the transcription termination sequence may be a polyadenylation sequence (pA)
  • the origin of replication may be an f1 origin of replication, an SV40 origin of replication, a pMB1 origin of replication, an adeno origin of replication, an AAV origin of replication, or a BBV origin of replication, but is not limited thereto. .
  • promoter refers to a region upstream of DNA from a structural gene, and refers to a DNA molecule to which RNA polymerase binds to initiate transcription.
  • the promoter according to one embodiment of the present invention is one of the transcription control sequences that regulate the transcription initiation of a specific gene, and may be a polynucleotide fragment of about 100 bp to about 2500 bp in length.
  • a promoter can be used without limitation as long as it can regulate transcription initiation in a cell, such as a eukaryotic cell (eg, a plant cell, or an animal cell (eg, a mammalian cell such as a human, a mouse, etc.), etc.).
  • the promoter may be a CMV promoter (cytomegalovirus promoter (eg human or mouse CMV immediate-early promoter), U6 promoter, elongation factor 1-a (EF1-alpha) promoter, EF1-alpha short (EFS) promoter, SV40 promoter, adenovirus promoter (major late promoter), pL ⁇ promoter, trp promoter, lac promoter, tac promoter, T7 promoter, vaccinia virus 7.5K promoter, HSV tk promoter, SV40E1 promoter, respiratory syncytial virus; RSV) promoter, metallotionin promoter, ⁇ -actin promoter, ubiquitin C promoter, human interleukin-2 (IL-2) gene promoter, human lymphotoxin gene promoter, and human GM -CSF (human granulocyte-macrophage colony stimulating factor) may be selected from the group consisting of gene promoters, but is not limited thereto
  • the recombinant expression vector according to an embodiment of the present invention may be selected from the group consisting of viral vectors such as plasmid vectors, cosmid vectors and bacteriophage vectors, adenoviral vectors, retroviral vectors and adeno-associated viral vectors.
  • viral vectors such as plasmid vectors, cosmid vectors and bacteriophage vectors, adenoviral vectors, retroviral vectors and adeno-associated viral vectors.
  • Vectors that can be used as recombinant expression vectors include plasmids used in the art (eg, pcDNA series, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1).
  • phage eg, ⁇ gt4 ⁇ B, ⁇ -Charon, ⁇ z1, M13, etc.
  • viral vectors eg, adeno-associated virus (AAV) vectors, etc. It may be manufactured based on, but is not limited thereto.
  • the recombinant expression vector of the present invention may further include one or more selectable markers.
  • the marker is a nucleic acid sequence having characteristics that can be selected by conventional chemical methods, and includes all genes capable of distinguishing a transfected cell from a non-transfected cell.
  • herbicide resistance genes such as glyphosate, glufosinate ammonium or phosphinothricin, ampicillin, kanamycin, G418, Bleomycin ), hygromycin (hygromycin), may be an antibiotic resistance gene such as chloramphenicol (chloramphenicol), but is not limited thereto.
  • the production of the recombinant expression vector of the present invention can be prepared using a genetic recombination technique well known in the art, and site-specific DNA cleavage and ligation can be performed using enzymes generally known in the art. there is.
  • the recombinant expression vector may consist of any one sequence of SEQ ID NOs: 6 to 10, and any one sequence of SEQ ID NOs: 6 to 10 of the present invention is not only the corresponding sequence, but also the sequence and As a sequence exhibiting at least 40%, preferably at least 60%, more preferably at least 80%, still more preferably at least 90%, even more preferably at least 95%, most preferably at least 99% homology. As long as the sequence has substantially the same or corresponding biological activity to any one of SEQ ID NOs: 6 to 10, it is included in the scope of the present invention even if some sequences have deleted, modified, substituted or added sequences.
  • the recombinant expression vector is introduced into a target cell through a known method, and the recombinant expression vector is expressed and the sgRNA hybridized to progerin mRNA binds to progerin mRNA (specifically, exon 11 and exon 12) expressed in the target cell. and Cas13 protein expressed in a recombinant expression vector acts here to cut progerin mRNA, thereby treating progeria.
  • compositions for inhibiting progerin expression comprising the recombinant expression vector or the recombinant expression vector and the Cas13 expression vector.
  • the composition of the present invention uses, as the recombinant expression vector, a recombinant expression vector alone comprising a polynucleotide of any one of SEQ ID NOs: 1 to 5 as an active ingredient, or encodes a polynucleotide of any one of SEQ ID NOs: 1 to 5 and Cas13 Using a recombinant expression vector containing a polynucleotide sequence of A recombinant expression vector may be used as an active ingredient.
  • composition of the present invention may further include a known substance as long as it does not interfere with the purpose of inhibiting progerin expression.
  • Another aspect of the present invention provides a pharmaceutical composition for preventing or treating premature aging and natural aging comprising the recombinant expression vector as an active ingredient.
  • HGPS Humanchinson Gilford progeria syndrome
  • “improvement” includes all acts of suppressing or delaying the onset of a disease by administration of the composition.
  • treatment includes any action in which the symptoms of the disease are improved or beneficial by administration of the composition.
  • the pharmaceutical composition is a suitable carrier, excipient, disintegrant, sweetener, coating agent, swelling agent, lubricant, glidant, flavoring agent, antioxidant, buffer, bacteriostatic agent, diluent, dispersing agent, surfactant commonly used in the preparation of pharmaceutical compositions. It may further include one or more additives selected from the group consisting of agents, binders and lubricants.
  • carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline Cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil can be used, and solid preparations for oral administration include tablets, pills, powders, granules, and capsules.
  • the solid preparation may be prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, and the like in the composition.
  • excipients for example, starch, calcium carbonate, sucrose or lactose, gelatin, and the like
  • lubricants such as magnesium stearate and talc can also be used.
  • Liquid preparations for oral use include suspensions, solutions, emulsions, syrups, and the like, and various excipients such as wetting agents, sweeteners, fragrances, preservatives, etc. may be included in addition to commonly used simple diluents such as water and liquid paraffin.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, and the like.
  • Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • As a base material for the suppository witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.
  • the pharmaceutical composition is administered intravenously, intraarterially, intraperitoneally, intramuscularly, intraarterially, intraperitoneally, intrasternally, transdermally, intranasally, inhalational, topical, rectal, oral, intraocular or intradermal
  • the route may be administered to a subject in a conventional manner.
  • a preferred dosage of the pharmaceutical composition may vary depending on the condition and weight of the subject, the type and extent of the disease, the drug form, the route and duration of administration, and may be appropriately selected by those skilled in the art.
  • the daily dose may be 0.01 to 200 mg/kg, specifically 0.1 to 200 mg/kg, and more specifically 0.1 to 100 mg/kg.
  • Administration may be administered once a day or may be administered in several divided doses, thereby not limiting the scope of the present invention.
  • Another aspect of the present invention provides a method for improving or treating progeria and natural aging comprising administering the composition to a subject to be treated.
  • compositions for the improvement or treatment of progeria and natural aging.
  • another aspect of the present invention provides the use of the composition for preparing a pharmaceutical composition for improving or treating progeria and natural aging.
  • sgRNA specifically, crRNA
  • the sgRNA nucleotide sequence targeting progerin targets the site abnormally bound to exon 12 due to mutation in exon 11, and the nucleotide sequence separated from normal lamin A was designed for Cas13a.
  • CHOPCHOP http://chopchop.cbu.uib.no/
  • CRISPR-RT http://bioinfolab.miamioh.edu/CRISPR-RT/interface/C2c2.php
  • sgRNAs hybridizing to exons 11 and 12 in progerin mRNA were selected, and it was confirmed that the nucleotide sequences of SEQ ID NOs: 1 to 5 were nucleotide sequences encoding the sgRNA.
  • a recombinant expression vector comprising sgRNA hybridizing to exons 11 and 12 in the progerin mRNA identified in Experimental Example 1, a nucleotide sequence encoding Cas13, and a promoter was prepared.
  • the backbone vector was created by cloning an all-in one backbone lentiviral vector that simultaneously expresses Cas13a and sgRNA by cloning each required site and reconstituting it by itself.
  • Backbone vector is a vector for lentivirus (using LTR, HIV-1 ⁇ , cPPT/CTS, RRE components), CAG (CMV enhancer/chicken ⁇ -actin promoter/chimeric intron) promoter, Cas13a gene, U6 promoter, and BsmBI restriction enzyme.
  • the nucleotide sequence and the spacer nucleotide sequence necessary for inserting the target sgRNA were prepared through oligo synthesis (see FIG. 4 ).
  • the vector was prepared by cloning the three selected sgRNA nucleotide sequences prepared by oligo synthesis into the BsmBI site of the backbone vector, and it was verified whether the target sgRNAs were correctly entered by Sanger's sequencing method (see FIGS. 5 to 9).
  • normal lamin A and progerin overexpression vectors were prepared. Specifically, 4-Hydroxytamoxifen (4-OHT) was treated using a conditional system (Conditional Cre-loxP) to prepare a stable cell line because the cells do not grow well and die when progerin is overexpressed in the cells. It was designed so that progerin was expressed only when it became available.
  • 4-Hydroxytamoxifen (4-OHT) was treated using a conditional system (Conditional Cre-loxP) to prepare a stable cell line because the cells do not grow well and die when progerin is overexpressed in the cells. It was designed so that progerin was expressed only when it became available.
  • the LMNA overexpression vector and progerin overexpression vector were cloned by oligo synthesis of the Loxp-RFP-2A-puro-3x poly-Loxp base sequence for conditional expression, and IRES to confirm when the target gene was conditionally expressed. It was designed to express GFP fluorescence through (internal ribosome entry site) and conditionally cloned human lamin A (LMNA) and progerin in the coding sequence (CDS, coding sequence) region in which the gene is expressed in this self-made backbone vector. An overexpression vector was constructed (see FIGS. 10 and 11).
  • LMNA normal lamin A
  • progerin overexpression vectors having the same structures as in FIGS. 10 and 11 were prepared.
  • Normal lamin A and progerin-overexpressing cell lines were prepared by using the normal lamin A and progerin-overexpressing vector prepared in Experimental Example 2-1 to confirm the effect of the recombinant vector of the present invention ( FIG. 13 ).
  • each of the above-described overexpression vectors was inserted into the AAVS1 locus into HEK293 cells using gene scissors (sgRNA sequence: GTGAGAGTTATCTGACCGTAAGG), and conditionally Lamin A and progerin were inserted into the AAVS1 locus.
  • the ERT2CreERT2 conditional vector which controls the gerin overexpression vector, is inserted into the H11 locus using gene scissors (sgRNA sequence: CAAAATAGGTTAGCCTTGCGGGG), selected with hygromycin and puromycin, and only live cells are selected and single cells are placed in 96 wells, and then each Cells were verified by genotyping to verify that the desired vector for overexpression and the vector that conditionally control overexpression were inserted.
  • gene scissors sgRNA sequence: CAAAATAGGTTAGCCTTGCGGGG
  • AAVS1 WT PCR product 339 bp (F: CCCCTATGTCCACTTCAGGA, R: AGGATCCTCTCTGGCTCCAT)
  • AAVS1 Progerin/LMNA product 517 bp (F: CCCCTATGTCCACTTCAGGA, R: TGGTCATAGCTGTTTCCTGTG)
  • H11 WT PCR product: 221bp (F: ACTTATGGGAACCCCTTCCA, R: ATTTGTTCAGGGCTCCACAG)
  • ERT2CreERT2 product Product size is variable because of HITI method (F: ACTTATGGGAACCCCTTCCA, R: PCR using GATAAATCTGGAGCCGGTGA)
  • conditional gene expression using the vector of the inserted vector was verified through fluorescence or RT-PCR method.
  • RFP was expressed before LMNA or progerin-overexpressed genes were expressed, and after 4-0HT (Tamoxifen) treatment, loxp-RFP-2A-Puro-3X SV40 polyA-loxp was removed and LMNA in RFP fluorescence. Alternatively, it was verified that GFP was expressed together with progerin to conditionally express the gene.
  • Progerin mRNA and protein expression were confirmed during progerin overexpression and treatment with the recombinant expression vector of the present invention in the normal lamin A and progerin-overexpressing cell lines prepared in Experimental Example 2-2.
  • RT-PCR was performed using the primers in Table 2 below ( FIGS. 18 and 19 ).
  • the progerin-specific RT-PCR primer is not expressed in normal LMNA because the primer F (forward) was designed at the junction of exon 11 and exon 12 deleted by mutation. was confirmed to come out.
  • composition of the present invention is also effective in animals (in vivo).
  • mice obtained in Experimental Example 3-1 were crossed with each other, mouse embryonic fibroblasts (MEF) were prepared from fetuses at 13.5 days old, and then genotyping method Only the wild-type (WT) and progerin homozygote (HO) identified through the experimental group (Progeria (HO) sgRNA of FIG. 12) introduced the composition of the present invention (CRISPR-Cas13a #2 lentivirus) in the same manner as in Experimental Example 2-3 #2 (+)) and a non-introduced mouse embryonic fibroblast experimental group (Progeria (HO) sgRNA #2 (-) in FIG. 12) were prepared.
  • WT wild-type
  • HO progerin homozygote
  • the experimental group (WT sgRNA #2 (+) in FIG. 20) introduced the composition of the present invention (CRISPR-Cas13a #2 lentivirus) in the same manner as in Experimental Example 2-3 into mouse embryonic fibroblasts of wild-type (WT) mice. ) and the non-transduced mouse embryonic fibroblast experimental group (WT sgRNA #2 (-) in FIG. 20).
  • mouse embryonic fibroblasts of wild-type mice can confirm a significant age-related gene expression difference regardless of whether or not the composition of the present invention (CRISPR-Cas13a #2 lentivirus) is introduced. None (WT sgRNA #2 (-) and (+) in FIG. 20).
  • the mouse embryonic fibroblast test group Progeria (HO) sgRNA #2 (-) in FIG. It can be seen that the expression of senescence-related genes (PAI-1, MMP3, SMP30) is increased compared to the wild-type cell line.
  • the experimental group Progeria (HO) sgRNA #2 (+) in FIG.
  • composition of the present invention CRISPR-Cas13a #2 lentivirus
  • PAI-1, MMP3, SMP30 senescence-related genes
  • progeria Ho mice of 7 months of age (date of birth, 2019.10.21, virus injection (2020.04.24)
  • control backbone without target sgRNA sequence
  • sgRNA #2 virus was injected through the tail vein, and the weight change by progeria was measured at regular intervals from the start date of the experiment (2020.04.24).
  • Progeria HO After introduction of 293FT (Invitrogen #R70007) cells using the control and recombinant expression vector of any one of SEQ ID NOs: 6 to 10 and pMD2.G (Addgene #12259), psPAX2 (Addgene #12260) vectors to MEF of the mouse From the 4th to the 5th day, the lentiviruses produced in the supernatant of each cell culture were infected twice with MEFs of Progeria HO mice, and the expression of CRISPR-Cas13a was confirmed through GFP fluorescence.
  • the recombinant expression vector (CRISPR-Cas13a # CRISPR-Cas13a # 1 to #5 lentivirus, SEQ ID NOs: 6 to 10) were introduced. And, progerin and aging-related gene expression changes were confirmed by Western blot analysis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Toxicology (AREA)
  • Virology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 유전자 교정을 이용한 조로증의 예방 또는 치료용 조성물에 관한 것으로, 조로증의 원인이 되는 프로게린을 암호화하는 mRNA에 혼성화되는 sgRNA 및 이에 작용하는 Cas13 단백질을 암호화하는 유전자를 포함하고 있어, 치료 대상의 세포 내에 도입되어 프로게린을 암호화하는 mRNA만을 선택적으로 절단한다. 이는 종래 farnesyltransferase inhibitor(FTI)를 사용한 방법에 비하여 다른 치료제와의 복합 처방이 필요 없고, 부작용도 적다. 또한, DNA 수준에서 상동 재조합(homologous recombination, HR)을 이용한 치료보다 효율이 높고, 가역적으로 이루어질 수 있고, RNAi(RNA interference)를 이용한 표적 치료에 비해 특이적으로 적용할 수 있으면서 부작용도 적다. 또한, DNA에 직접 작용하여 비가역적이 결과를 나타내는 CRISPR/Cas9을 이용한 치료에 비해 가역적이면서 프로게린을 암호화하는 mRNA만을 선택적으로 절단할 수 있어 안전성을 확보할 수 있다.

Description

유전자 교정을 이용한 조로증 및 자연노화의 예방 또는 치료용 조성물
본 발명은 유전자 교정을 이용한 조로증 및 자연노화의 예방 또는 치료용 조성물에 관한 것이다.
조로증(HGPS: Hutchinson-Gilford Progeria Syndrome)은 lamin A(LMNA) 유전좌상의 점돌연변이(p.G608G, c.C1824T)에 의한 희귀 유전질환이다. 현재까지 조사된 환자중에서 높은 비율의 환자수가 LMNA 유전자의 점 돌연변이(p.G608G, c.C1824T)를 가지고 있다. 이러한 유전자 변이는 정상적인 유전자 발현과는 달리, 선택적 스플라이싱(alternative splicing)을 유도하여 비정상적인 lamin A 단백질 (progerin, 프로게린)을 발현시키고, 핵막에 축적되고 정상적인 lamin A의 기능을 방해하여 세포의 사멸을 유도한다. 또한 정상적인 사람들이 나이가 들거나 자외선(UV)에 노출에 의해서도 프로게린이 증가되어 노화를 일으키는 원인으로 보고되는 연구들이 소개되었다[2014, Aging, Pacheco et al., 2013, J Invest Dermatol, Takeuchi et al., 2011, J Clin Invest, Cao et al.]. 이에 따라 나타나는 표현형으로 조로증이라 명명되고 있고 이를 치료하기 위한 다양한 방법들이 시도되고 있다.
최근 치료제의 부작용이나 내성을 줄이고자 유전자 수준에서 변형된 단백질을 적중시키려는 시도가 있었다. 이중에 대표적인 시도가 RNAi(RNA interference) 혹은 HR(Homologous recombination)을 이용한 방법이다[2005, Hum Genet, Shurong Huang et al., 2011, Cell Stem Cell, Guang-Hui Liu et al.]. 그러나 기존 RNAi 혹은 HR을 이용한 방법들은 효율이 낮거나 특정 유전자 적중이 부정확하다는 문제점이 존재했다. 최근 CRISPR/Cas9 기술의 발달함에 따라 정교하게 프로게린을 치료하는 연구가 보고되었다[2019, Nat Med, Ergin Beyret et al., 2019 Nat Med, OlayaSantiago-Fernandez et al.]. 하지만 DNA상에서는 CRISPR/Cas9이 lamin A와 프로게린을 구분하지 못하기 때문에 HGPS 질병의 원인이 되는 프로게린만을 타겟으로 자르는 것뿐만 아니라 정상적인 lamin A도 줄어들게 되었다. 그리고 CRISPR/Cas9 시스템의 가장 큰 단점은 비특이적 타겟(off-target)에 대해서도 결합하여 자르기 때문에 이미 잘린 DNA는 다시 원래대로 수복되는 것은 불가능하기 때문에 안정성 문제가 항상 뒤따른다.
따라서 이를 극복하고자 이와 같은 비가역적인 CRISPR/Cas9의 한계를 극복하고 정확히 HGPS의 문제를 일으키는 프로게린(구체적으로, 프로게린 mRNA)만을 선별하는 RNA 유전자 적중 시스템(CRISPR/Cas13)을 도입하였다. RNA 유전자 적중 시스템(CRISPR/Cas13)은 박테리아 면역시스템의 일종으로, Cas13 라는 단백질과 표적 RNA에 상보적인 가이드 RNA를 기반으로 작동하며, 표적 RNA를 정확하게 잘라내어 발현을 조절할 수 있는 특징이 있다. 본 발명은 표적 특이적인 RNA 유전자 적중 시스템(CRISPR/Cas13)을 기반으로 조로증 유발 유전자 변이를 RNA수준에서 적중하여 비영구적이고 효과적인 치료가 가능하도록 고안하였다.
본 발명의 일 양상은 프로게린 mRNA에 혼성화하는 gRNA를 암호화하는 폴리뉴클레오티드로서, 상기 폴리뉴클레오티드는 서열번호 1 내지 5 중 어느 하나인 것을 특징으로 하는 폴리뉴클레오티드를 제공하는 것을 목적으로 한다.
본 발명의 다른 일 양상은 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드로부터 유래된 gRNA를 제공하는 것을 목적으로 한다.
본 발명의 다른 일 양상은 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드로부터 유래된 gRNA; 및 Cas13 mRNA 또는 이로부터 유래된 Cas 13 단백질을 포함하는 프로게린 발현 저해용 조성물을 제공하는 것을 목적으로 한다.
본 발명의 다른 일 양상은 프로게린 mRNA에 혼성화하는 gRNA를 암호화하는 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드 서열 또는 이와 상보적인 서열을 포함하는 재조합 발현 벡터를 제공하는 것을 목적으로 한다.
본 발명의 다른 일 양상은 상기 재조합 발현벡터를 유효성분으로 포함하는 프로게린 발현 저해용 조성물 또는 상기 재조합 발현벡터 및 Cas13 발현벡터를 포함하는 프로게린 발현 저해용 조성물을 제공하는 것을 목적으로 한다.
본 발명의 다른 일 양상은 상기 조성물을 유효성분으로 포함하는 조로증 및 자연노화 예방 또는 치료용 약학적 조성물을 제공하는 것을 목적으로 한다.
본 발명의 다른 일 양상은 상기 조성물을 치료 대상에게 투여하는 단계를 포함하는 조로증 및 자연노화 개선 또는 치료 방법을 제공하는 것을 목적으로 한다.
또한, 본 발명의 다른 일 양상은 조로증 및 자연노화 개선 또는 치료를 위한 상기 조성물의 용도를 제공하는 것을 목적으로 한다.
그리고, 본 발명의 다른 일 양상은 조로증 및 자연노화 개선 또는 치료용 약학적 조성물을 제조하기 위한 상기 조성물의 용도를 제공하는 것을 목적으로 한다.
상기한 목적을 달성하기 위해 본 발명은 프로게린 mRNA에 혼성화하는 gRNA를 암호화하는 폴리뉴클레오티드로서, 상기 폴리뉴클레오티드는 서열번호 1 내지 5 중 어느 하나인 것을 특징으로 하는 폴리뉴클레오티드를 제공한다.
또한, 본 발명은 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드로부터 유래된 gRNA를 제공한다.
본 발명의 일 구체예로 상기 gRNA는 LMNA 유전자의 엑손 11 및 엑손 12을 암호화하는 유전자에 혼성화하는 것일 수 있다.
본 발명은 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드로부터 유래된 gRNA; 및 Cas13 mRNA 또는 이로부터 유래된 Cas 13 단백질을 포함하는 프로게린 발현 저해용 조성물을 제공한다.
본 발명은 프로게린 mRNA에 혼성화하는 gRNA를 암호화하는 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드 서열 또는 이와 상보적인 서열을 포함하는 재조합 발현 벡터를 제공한다.
본 발명의 일 구체예로 상기 재조합 발현 벡터는 Cas13을 암호화하는 폴리뉴클레오티드 서열을 더 포함하는 것일 수 있다.
또한, 본 발명의 일 구체예로 상기 재조합 발현 벡터는 서열번호 6 내지 10 중 어느 하나의 서열로 이루어지는 것일 수 있다.
본 발명은 상기 재조합 발현벡터를 유효성분으로 포함하는 프로게린 발현 저해용 조성물을 제공한다.
본 발명은 상기 재조합 발현벡터 및 Cas13 발현벡터를 포함하는 프로게린 발현 저해용 조성물을 제공한다.
본 발명은 상기 조성물을 유효성분으로 포함하는 조로증 및 자연노화 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명은 상기 조성물을 치료 대상에게 투여하는 단계를 포함하는 조로증 및 자연노화 개선 또는 치료 방법을 제공한다.
본 발명은 조로증 및 자연노화 개선 또는 치료을 위한 상기 조성물의 용도를 제공한다.
본 발명은 조로증 및 자연노화 개선 또는 치료용 약학적 조성물을 제조하기 위한 상기 조성물의 용도를 제공한다.
본 발명의 재조합 발현 벡터 및 이를 포함하는 조로증 및 자연노화의 예방 또는 치료용 약학적 조성물은 조로증의 원인이 되는 프로게린을 암호화하는 mRNA에 혼성화되는 sgRNA 및 이에 작용하는 Cas13 단백질을 암호화하는 유전자를 포함하고 있어, 치료 대상의 세포 내에 도입되어 프로게린을 암호화하는 mRNA만을 선택적으로 절단한다. 이는 종래 farnesyltransferase inhibitor(FTI)를 사용한 방법에 비하여 다른 치료제와의 복합 처방이 필요 없고, 부작용도 적다. 또한, DNA 수준에서 상동 재조합 (homologous recombination, HR)을 이용한 치료보다 효율이 높고, 가역적으로 이루어질 수 있고, RNAi(RNA interference)를 이용한 표적 치료에 비해 특이적으로 적용할 수 있으면서 부작용도 적다. 또한, DNA에 직접 작용하여 비가역적이 결과를 나타내는 CRISPR/Cas9을 이용한 치료에 비해 가역적이면서 프로게린을 암호화하는 mRNA만을 선택적으로 절단할 수 있어 안전성을 확보할 수 있다.
도 1은 조로증의 발생원인이 되는 돌연변이를 나타내는 도면이다.
도 2는 본 발명에서 이용되는 Cas13의 작용 기전을 나타내는 도면이다.
도 3은 본 발명의 서열번호 1 내지 5에 의해 암호화되는 sgRNA가 혼성화 되는 프로게린 mRNA 내 위치를 나타내는 도면이다.
도 4 내지 9은 실시예 1에서 본 발명의 재조합 발현벡터에 사용된 벡터 (도4) 및 본 발명의 재조합 발현벡터(도 5 내지 도 9)를 나타내는 도면이다.
도 10 및 도 11는 실험예 2-1에 사용된 lamin A 과발현 벡터(도 10) 및 프로게린 과발현 벡터(도 11)이다.
도 12은 실험예 2-2에서 LMNA, Progerin 조건부 과발현 세포주에 이용된 벡터를 나타낸 것으로, 각각 LMNA 조건부 과발현 세포주 제작을 위해 AAVS1 all-in one, H11 all-in one, ERT2CreERT2, Conditional LMNA 벡터를 사용하였고, Progerin 조건부 과발현 세포주 제작을 위해 AAVS1 all-in one, H11 all-in one, ERT2CreERT2, Conditional Progerin 벡터를 사용하였다.
도 13은 실험예 2-2의 LMNA, Progerin 조건부 과발현 세포주 검증 삽입 모식도를 나타낸 것이다.
도 14는 실험예 2-2에 따라 LMNA, Progerin 조건부 과발현 세포주 내 염기서열 삽입 여부를 확인한 결과이다. 구체적으로, WT의 밴드는 외구 과발현 벡터가 삽입되지 않은 세포주이고, WT, Tg 의 2개 밴드로 나타나는 것은 한쪽 allele만 유전자가 삽입된 것을 확인하였다 Heterogeneous).
도 15은 실험예 2-2에 따라 삽입된 벡터가 조건부로 유전자를 발현하는지를 형광 또는 RT-PCR 방법을 통해 검증한 결과를 나타낸 것이다.
도 16는 실험예 2-2에서 LMNA semi RT-PCR primer의 유전자상에 위치를 나타내는 도면이다.
도 17는 실험예 2-2에서 Progerin semi RT-PCR primer의 유전자상에 위치를 나타내는 도면이다.
도 18은 실험예 2-3에서 LMNA 특이적 RT-PCR primer의 유전자상에 위치를 나타내는 도면이다.
도 19은 실험예 2-3에서 Progerin 특이적 RT-PCR primer의 유전자상에 위치를 나타내는 도면이다.
도 20 및 도 21은 실험예 2-3의 in vitro 결과로서, 본 발명의 재조합 발현벡터를 사용하였을 때 프로게린 mRNA 및 단백질 감소효과를 확인할 수 있다.
도 22 및 도 23은 실험예 3의 결과로서, 본 발명의 재조합 발현벡터를 사용하였을 때 프로게린 mRNA 및 단백질 감소효과를 확인할 수 있다.
도 24는 실험예 4-1.의 결과로서, 본 발명의 재조합 발현벡터를 도입한 실험군의 형광 분석 결과를 확인할 수 있다.
도 25 및 26은 실험예 4-2.의 결과로서, 본 발명의 재조합 발현벡터를 도입한 실험군에서 프로게린 및 노화 관련 유전자 발현 감소를 확인할 수 있다.
본 발명의 일 양상은 프로게린 mRNA에 혼성화하는 gRNA를 암호화하는 폴리뉴클레오티드로서, 상기 폴리뉴클레오티드는 서열번호 1 내지 5 중 어느 하나인 것을 특징으로 하는 폴리뉴클레오티드를 제공한다.
본 발명에 사용되는 용어, '프로게린'은 lamin A 단백질의 비정상적 발현 형태로서, 구체적으로 lamin A 단백질을 암호화하는 유전좌 상의 점돌연변이(p. G608G, c.C1824T)가 발생된 채 발현되는 비정상 lamin A 단백질이다. 전술한 lamin A의 유전자에 돌연변이가 발생하면 단백질 형성에 필요한 아미노산 서열을 바꾸지는 않지만, mRNA의 전사과정에서 비정상적 스플라이싱(선택적 스플라이싱, alternative splicing)이 형성되어 엑손 11 번의 COOH 말단 일부분이 결손된(150bp 결손) 형태로 비정상적 lamin A(프로게린, progerin)이 생성된다. 이렇게 형성된 프로게린은 dominant negative 한 방식으로 생체 내에서 작동하여 세포단위에서는 비정상적 핵막형성을 보이고, 개체 단위에서 조로증과 관련된 표현형(왜소증, 머리카락 빠짐, 피부질환, 몸무게 감소, 지방이상 등)이 나타난다.
본 발명에서 사용되는 용어, 'lamin A'는 라민단백질의 일종으로, 라민 단백질은 핵막의 내막에 연결된 단백질로 핵막의 필수적인 구조로서 간기의 핵 구조를 유지하는데 중요한 역할을 하는 중간섬유(intermediate filament)의 일종이다. 이들은 다른 중간 섬유처럼 작은(약 20잔기) 비-선형 아미노 말단 서열에 의해 플랭킹(flanking)되는 중심의 알파 선형 간상 도메인과 더욱 큰 카복시-말단 구형 도메인으로 구성된다. 또한, lamin A 단백질은 라민 A 유전자(LMNA)의 단일 1차 전사로부터 얼터너티브 스플라이싱(alternative splicing)에 의해 lamin C 단백질과 함께 생성된다.
본 발명에서 사용되는 용어 '프로게린 mRNA'는 전술한 프로게린, 즉 비정상적으로 발현된 lamin A 단백질을 암호화하는 mRNA를 의미하고, 구체적으로는 lamin A 단백질을 암호화하는 유전좌 상의 점돌연변이(p. G608G, c.C1824T), 구체적으로 점돌연변이(p. G608G)를 가진 체 번역된 mRNA를 의미한다.
본 발명에서 사용되는 용어, " gRNA (가이드 RNA, guide RNA) "는 표적 DNA에 특이적인 RNA로, gRNA는 Cas 단백질과 복합체를 형성할 수 있고, Cas 단백질을 표적 DNA에 가져올 수 있다. gRNA는 crRNA 및 tracrRNA일 수 있고, 또는, crRNA와 tracrRNA가 하나로 연결된 gRNA일 수 있다.
상기 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드를 전사하여 프로게린 mRNA에 혼성화하는 gRNA가 제조될 수 있고, 상기 gRNA는 CRISRP/Cas13과 작용하여 프로게린 mRNA를 선택적으로 절단할 수 있다. 또한, 상기 서열번호 1 내지 5 중 어느 하나의 염기서열을 암호화하는 뉴클레오티드로부터 전사되는 gRNA는 정상적인 lamin A 단백질을 암호화하는 mRNA 및 비특이적 타켓 (off-target)에는 결합하지 않아 더욱 정밀한 치료 및 가역적인 치료가 가능하다.
본 발명의 서열번호 1 내지 5중 어느 하나의 폴리뉴클레오티드 서열은 해당 서열 뿐만 아니라, 상기 서열과 40% 이상, 바람직하게는 60% 이상, 더욱 바람직하게는 80% 이상, 보다 더욱 바람직하게는 90% 이상, 더욱 더 바람직하게는 95% 이상, 가장 바람직하게는 99% 이상의 상동성을 나타내는 폴리뉴클레오티드 서열로서 프로게린 mRNA 또는 LMNA 유전자의 엑손 11 및 엑손 12을 암호화하는 유전자에 혼성화 하는 gRNA를 전사할 수 있는 서열이라면 제한없이 포함하며, 이러한 상동성을 갖는 서열로서 실질적으로 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드와 동일하거나 상응하는 생물학적 활성을 갖는 서열이라면 일부 서열이 결실, 변형, 치환 또는 부가된 서열을 갖는 경우에도 본 발명의 범주에 포함된다.
본 발명의 다른 일 양상은 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드로부터 유래된 gRNA를 제공한다.
상기한 바와 같이 본 발명의 상기 gRNA는 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드를 전사함으로써 얻어질 수 있고, 프로게린 mRNA에 혼성화한 뒤 CRISRP/Cas13과 작용하여 프로게린 mRNA를 선택적으로 절단할 수 있다.
본 발명의 일 구체예로, 상기 gRNA는 LMNA 유전자의 엑손 11 및 엑손 12을 암호화하는 유전자에 혼성화하는 것일 수 있다. 전술한 바와 같이 프로게린은 lamin A 단백질을 암호화하는 유전좌 상의 점돌연변이(p. G608G, c.C1824T)가 발생된 채 발현된 것으로, 프로게린을 암호화하는 mRNA는 전사과정에서 비정상적 스플라이싱으로 인해 엑손 11번의 COOH 말단 일부분이 결손된 채 생성된다(150bp 결손). 이 때 본 발명의 프로게린 mRNA에 혼성화하는 gRNA는 LMNA 유전자의 엑손 11 및 엑손 12을 암호화하는 유전자에 혼성화되고, CRISRP/Cas13과 작용하여 프로게린 mRNA를 선택적으로 절단할 수 있다.
본 발명의 다른 일 양상은, 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드로부터 유래된 gRNA; 및 Cas13 mRNA 또는 이로부터 유래된 Cas 13 단백질을 포함하는 프로게린 발현 저해용 조성물을 제공한다.
상기 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드로부터 유래된 gRNA는 전술한 바와 같다.
상기 Cas13 mRNA 또는 이로부터 유래된 Cas 13 단백질은 상기 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드로부터 유래된 gRNA와 함께 CRISPR/Cas13 시스템으로서 작동한다. 구체적으로, 상기 gRNA는 LMNA 유전자의 엑손 11 및 엑손 12을 암호화하는 유전자에 혼성화되고, CRISRP/Cas13과 작용하여 프로게린 mRNA를 선택적으로 절단할 수 있다.
상기 "CRISPR/Cas13 시스템"은 Cas13 단백질과 싱글 가이드 RNA(single guide RNA)로 구성되어 있는 제 3세대 유전자가위로써, 미생물의 면역체계로 알려진 CRISPR(Clustered Regularly Interspaced Short Palindromic Repeats) 시스템을 이용해 원하는 유전자 염기서열을 절단하도록 고안된 인공제한효소를 말한다. 구체적으로는 박테리아의 적응면역 시스템의 하나로서, 주로 박테리아 파지의 감염에 따른 외부 유전자인 RNA를 특이적으로 제거하는 시스템이다. 주로 박테리아 게놈의 CRISPR cluster로 알려진 영역에서 작용 단백질(effector protein) Cas13과 외부 바이러스에 상보적인 염기서열을 포함한 crRNA(crisprRNA)를 발현시킨다고 알려져 있다. 이들이 결합하여 바이러스 RNA에 바인딩하여 목표물을 잘라 냄으로써 제거하는 기능을 가지고 있고, 타겟 RNA 유전자마다 다양하게 인식하여 반응하는 적응 면역시스템으로 알려져 있다. 이를 응용하여 표적하는 RNA에 상보적인 염기서열을 포함한 crRNA를 제작함으로써 CRISPR-Cas13 단백질과 같이 고등 세포 내부로 전달시키면 표적 RNA의 발현을 제어할 수 있다.
본 발명에서 사용되는 용어, "Cas13 단백질"은 CRISPR/Cas13 시스템에서 필수적인 단백질 요소로써, 크게 REC 도메인(REC lobe)과 NUC 도메인 (NUC lobe)으로 구성되어 있으며 각각 표적 mRNA과의 결합, 절단에 기여한다. 특히 HEPN 도메인의 특정 아미노산 잔기는 mRNA의 핵산의 잘라지기 쉬운 결합(scissile bond)과 결합해 절단함으로써 표적 RNA를 제거한다. CRISPR-Cas13과 결합된 crRNA가 상보적으로 결합하는 표적 RNA의 특정 부분을 프로토스페이서(protospacer) 염기서열이라고 하고, 표적으로 인식되는 주요 인자이다. 표적 RNA를 정확하게 인식함에 있어서 우선 crRNA stem loop 구조는 CRISPR-Cas13 단백질의 REC lobe가 인식하여 바인딩한다. crRNA와 상보적 결합되어 이중나선을 형성한 표적 RNA 영역인 프로토스페이서(protospacer)는 나머지 NUC lobe에 인식되어 절단이 일어나게 된다. CRISPR-Cas13 계열 중에서도 CRISPR-Cas13a 유형은 고등동물 세포에서 표적 RNA 절단 효율성이 높고 비표적 절단이 없이 정확하게 작동한다는 보고가 있다[2017, Nature, Omar O. Abudayyeh et al.]. 또한, 상기 Cas13 단백질은 종래 Cas9 단백질이 가진 문제점 (DNA 상에서 lamin A 와 progerin을 구별하지 못하고, off-target에서도 결합하는 문제 및 비가역적인 문제)을 해결할 수 있다. 상기 Cas13 단백질은 Cas13a, Cas13b, Cas13c가 있으며, 본 발명에서는 구체적으로 Cas13a일 수 있다.
또한, 본 발명의 일 양상은 프로게린 mRNA에 혼성화하는 gRNA를 암호화하는 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드 서열 또는 이와 상보적인 서열을 포함하는 재조합 발현 벡터를 제공한다.
상기 프로게린 mRNA에 혼성화하는 gRNA를 암호화하는 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드 서열은 전술한 바와 같다.
상기 "재조합 발현벡터"는 목적한 코딩 서열과, 특정 숙주 생물에서 작동가능하게 연결된 코딩 서열을 발현하는데 필수적인 적정 핵산 서열을 포함하는 재조합 DNA 분자를 의미한다. 진핵세포에서 이용 가능한 프로모터, 인핸서, 종결신호 및 폴리아데닐레이션 신호는 공지되어 있다.
본 발명의 일 구체예로 상기 재조합 발현 벡터는 Cas13을 암호화하는 폴리뉴클레오티드 서열을 더 포함할 수 있다.
상기 Cas13을 암호화하는 폴리뉴클레오티드 서열은 전술한 Cas13 의 mRNA 또는 단백질을 암호화 하는 서열을 의미한다.
본 발명에서는 CRISPR/Cas13 시스템을 활용한 프로게린 mRNA에 특이적으로 작용하는 유전자가위를 이용하여 프로게린 mRNA를 제거한다. 구체적으로, 정상적인 lamin A 단백질을 암호화하는 유전자에 비하여 비정상적인 lamin A 단백질(progerin, 프로게린)을 암호화하는 유전자는 점돌연변이가 발생하여 각각 발현된 mRNA 염기서열의 엑손 11의 말단이 150bp가 제거된 상태로 엑손 12와 발현하게 된다. 이 때 프로게린의 mRNA는 엑손 11말단과 엑손 12의 경계 염기서열이 정상 mRNA와 상이하게 된다. 따라서, 변이 염기서열에 해당하는 상보적인 sgRNA를 제작하여 CRISPR/CAS13와 함께 조로증 환자의 세포 내부에 전달하였을 때, 변이 유전자에 의한 프로게린 mRNA만 선택적으로 제거할 수 있다.
본 발명의 상기 발현백터는 폴리뉴클레오티드 서열에 작동 가능하게 연결된 프로모터를 더 포함할 수 있다.
본 발명에서 사용되는 용어, "작동가능하게 연결된"은 유전자 발현 조절 서열과 다른 뉴클레오티드 서열사이의 기능적인 결합을 의미한다. 상기 유전자 발현 조절 서열은 복제원점(replication origin), 프로모터 및 전사 종결 서열(terminator) 등으로 이루어진 군으로부터 선택되는 1종 이상일 수 있다. 전사 종결 서열은 폴리아데닐화 서열(pA)일 수 있으며, 복제 원점은 f1 복제원점, SV40 복제원점, pMB1 복제원점, 아데노 복제원점, AAV 복제원점 또는 BBV 복제원점 등일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에서 사용되는 용어, "프로모터"는 구조 유전자로부터의 DNA 업스트림의 영역을 의미하며, 전사를 개시하기 위하여 RNA 폴리머라아제가 결합하는 DNA 분자를 말한다.
본 발명의 일 구체예에 따른 프로모터는 특정 유전자의 전사 개시를 조절하는 전사 조절 서열 중 하나로, 약 100bp 내지 약 2500bp 길이의 폴리뉴클레오티드 단편일 수 있다. 프로모터는 세포, 예컨대, 진핵 세포(예컨대, 식물 세포, 또는 동물 세포(예를 들어, 인간, 마우스 등의 포유류 세포 등) 등)에서 전사 개시를 조절할 수 있으면, 제한 없이 사용 가능하다. 예를 들어, 프로모터는 CMV 프로모터(cytomegalovirus promoter(예를 들어, 인간 또는 마우스 CMV immediate-early 프로모터), U6 프로모터, EF1-alpha(elongation factor 1-a) 프로모터, EF1-alpha short(EFS) 프로모터, SV40 프로모터, 아데노바이러스 프로모터(major late promoter), pL λ 프로모터, trp 프로모터, lac 프로모터, tac 프로모터, T7 프로모터, 백시니아 바이러스 7.5K 프로모터, HSV의 tk 프로모터, SV40E1 프로모터, 호흡기 세포융합 바이러스(Respiratory syncytial virus; RSV) 프로모터, 메탈로 티오닌 프로모터(metallothionin promoter), β-액틴 프로모터, 유비퀴틴 C 프로모터, 인간 IL-2(human interleukin-2) 유전자 프로모터, 인간 림포톡신(human lymphotoxin) 유전자 프로모터 및 인간 GM-CSF(human granulocyte-macrophage colony stimulating factor) 유전자 프로모터로 이루어진 군으로부터 선택되는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따른 재조합 발현벡터는 플라스미드 벡터, 코즈미드 벡터 및 박테리오파아지 벡터, 아데노바이러스 벡터, 레트로바이러스 벡터 및 아데노-연관 바이러스 벡터와 같은 바이러스 벡터로 이루어진 군으로부터 선택되는 것일 수 있다. 재조합 발현벡터로 사용될 수 있는 벡터는 당업계에서 사용되는 플라스미드(예를 들어, pcDNA 시리즈, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX 시리즈, pET 시리즈, pUC19 등), 파지(예를 들어, λgt4λB, λ-Charon, λΔz1, M13 등) 또는 바이러스 벡터(예를 들어, 아데노-연관 바이러스(AAV) 벡터 등) 등을 기본으로 하여 제작될 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 재조합 발현벡터는 하나 이상의 선택성 마커를 더 포함할 수 있다. 상기 마커는 통상적으로 화학적인 방법으로 선택될 수 있는 특성을 갖는 핵산 서열로, 형질주입된 세포를 비형질주입 세포로부터 구별할 수 있는 모든 유전자가 이에 해당된다. 예를 들어, 글리포세이트(glyphosate), 글루포시네이트암모늄(glufosinate ammonium) 또는 포스피노트리신(phosphinothricin)과 같은 제초제 저항성 유전자, 암피실린(ampicillin), 카나 마이신(kanamycin), G418, 블레오마이신(Bleomycin), 하이그로마이신(hygromycin), 클로람페니콜(chloramphenicol)과 같은 항생제 내성 유전자일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 재조합 발현벡터의 제작은 당해 기술 분야에서 잘 알려진 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당해 기술 분야에서 일반적으로 알려진 효소 등을 사용하여 수행될 수 있다.
본 발명의 일 구체예로 상기 재조합 발현 벡터는 서열번호 6 내지 10 중 어느 하나의 서열로 이루어진 것일 수 있고, 본 발명의 서열번호 6 내지 10중 어느 하나의 서열은 해당 서열 뿐만 아니라, 상기 서열과 40% 이상, 바람직하게는 60% 이상, 더욱 바람직하게는 80% 이상, 보다 더욱 바람직하게는 90% 이상, 더욱 더 바람직하게는 95% 이상, 가장 바람직하게는 99% 이상의 상동성을 나타내는 서열로서 실질적으로 서열번호 6 내지 10 중 어느 하나의 서열과 동일하거나 상응하는 생물학적 활성을 갖는 서열이라면 일부 서열이 결실, 변형, 치환 또는 부가된 서열을 갖는 경우에도 본 발명의 범주에 포함된다.
상기 재조합 발현 벡터는 공지의 방법을 통해 타겟 세포에 도입되고, 재조합 발현 벡터가 발현되어 프로게린 mRNA에 혼성화하는 sgRNA는 타겟 세포 내에서 발현되는 프로게린 mRNA (구체적으로 엑손 11 및 엑손 12)에 결합하고, 여기에 재조합 발현 벡터에서 발현된 Cas13 단백질이 작용하여 프로게린 mRNA를 절단함으로써 조로증을 치료할 수 있다.
본 발명의 다른 일 양상은 상기 재조합 발현벡터 또는 상기 재조합 발현벡터와 Cas13 발현벡터를 포함하는 프로게린 발현 저해용 조성물을 제공한다. 본 발명의 상기 조성물은 상기 재조합 발현벡터로서 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드를 포함하는 재조합 발현벡터 단독을 유효성분으로 하거나, 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드 및 Cas13을 암호화하는 폴리뉴클레오티드 서열을 포함하는 재조합 발현벡터를 유효성분으로 하거나, 재조합 발현벡터로서 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드를 단독으로 포함하는 재조합 발현벡터와 Cas13을 암호화하는 폴리뉴클레오티드 서열을 포함하는 재조합 발현벡터를 유효성분으로 할 수 있다.
본 발명의 상기 조성물을 프로게린 발현 저해의 목적을 방해하지 않는 한 공지의 물질을 더 포함 할 수 있다.
본 발명의 다른 일 양상은 상기 재조합 발현벡터를 유효성분으로 포함하는 조로증 및 자연노화 예방 또는 치료용 약학적 조성물을 제공한다.
상기 "조로증" 또는 "허친슨 길포드 증후군(Hutchinson Gilford progeria syndrome, HGPS)"은 어린 아이들에게 조기 노화 현상이 나타나는 치명적이고 희귀한 유전 질환으로, 구체적으로는 lamin A(LMNA) 유전좌상의 점돌연변이(p.G608G, c.C1824T)에 의한 유전질환이다.
본 발명에서 "개선"은 상기 조성물의 투여로 질환의 발병을 억제 또는 지연시키는 모든 행위를 포함한다.
본 발명에서 "치료"는 상기 조성물의 투여로 질환의 증세가 호전되거나 이롭게 되는 모든 행위를 포함한다.
상기 약학적 조성물은 약학조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제, 붕 해제, 감미제, 피복제, 팽창제, 윤활제, 활택제, 향미제, 항산화제, 완충액, 정균제, 희석제, 분산제, 계면활성 제, 결합제 및 윤활제로 이루어진 군에서 선택되는 하나 이상의 첨가제를 추가로 포함할 수 있다.
구체적으로 담체, 부형제 및 희석제는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 사용할 수 있으며, 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 조성물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘카보네이트, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제할 수 있다. 또한 단순한 부형제 이외에 마그네슘 스티레이트, 탈크 같은 윤활제들도 사용할 수 있다. 경구를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 있으며 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제 등이 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기재로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 일실시예에 따르면 상기 약학 조성물은 정맥내, 동맥내, 복강내, 근육내, 동맥내, 복강내, 흉골내, 경피, 비측내, 흡입, 국소, 직장, 경구, 안구내 또는 피내 경로를 통해 통상적인 방식으로 대상체로 투여할 수 있다.
상기 약학적 조성물의 바람직한 투여량은 대상체의 상태 및 체중, 질환의 종류 및 정도, 약물 형 태, 투여경로 및 기간에 따라 달라질 수 있으며 당업자에 의해 적절하게 선택될 수 있다. 본 발명의 일실시예에 따르면 이에 제한되는 것은 아니지만 1일 투여량이 0.01 내지 200 mg/kg, 구체적으로는 0.1 내지 200 mg/kg, 보다 구체적으로는 0.1 내지 100 mg/kg 일 수 있다. 투여는 하루에 한 번 투여할 수도 있고 수회로 나누어 투여할 수도 있으며, 이에 의해 본 발명의 범위가 제한되는 것은 아니다.
본 발명의 다른 일 양상은 상기 조성물을 치료 대상에게 투여하는 단계를 포함하는 조로증 및 자연노화 개선 또는 치료 방법을 제공한다.
또한, 본 발명의 다른 일 양상은 조로증 및 자연노화 개선 또는 치료를 위한 상기 조성물의 용도를 제공한다.
그리고, 본 발명의 다른 일 양상은 조로증 및 자연노화 개선 또는 치료용 약학적 조성물을 제조하기 위한 상기 조성물의 용도를 제공한다.
이하 하나 이상의 구체예를 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 하나 이상의 구체예를 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실험예 1: 프로게린 mRNA에 혼성화하는 sgRNA의 선별
조로증의 원인이 되는 프로게린을 암호화하는 mRNA에 혼성화 하는 sgRNA(구체적으로 crRNA)를 선별하였다.
구체적으로, 프로게린을 타겟으로 하는 sgRNA 염기서열은 엑손(exon) 11에서 돌연변이로 인해 엑손 12와 비정상적으로 결합된 부위를 타겟으로 하여 정상적인 lamin A과 구분되는 염기서열 부분을 Cas13a에 대한 디자인을 다음과 같은 두 CHOPCHOP (http://chopchop.cbu.uib.no/)와 CRISPR-RT (http://bioinfolab.miamioh.edu/CRISPR-RT/interface/C2c2.php) 사이트 등에서 off-target이 없고 cleavage 효율이 높은 5개의 타겟 sgRNA를 선정하였다.
그 결과, 도 3과 같이 프로게린 mRNA 내 엑손 11 및 12에 혼성화하는 sgRNA를 선별하였고, 서열번호 1 내지 5의 뉴클레오티드 서열이 상기 sgRNA를 암호화하는 뉴클레오티드 서열인 것을 확인하였다.
실시예 1: 재조합 발현벡터의 제조
실험예 1에서 확인된 프로게린 mRNA 내 엑손 11 및 12에 혼성화하는 sgRNA, Cas13을 암호화하는 뉴클레오티드 서열 및 프로모터를 포함하는 재조합 발현벡터를 제조하였다.
구체적으로, backbone 벡터는 Cas13a와 sgRNA가 동시에 발현하는 all-in one backbone 렌티바이러스 벡터는 각각의 필요 부위를 클로닝하여 자체적으로 재구성하여 만들었다. Backbone 벡터는 렌티바이러스용 벡터(LTR, HIV-1 Ψ, cPPT/CTS, RRE 구성 요소 이용)에 CAG(CMV enhancer/chicken β-actin promoter/chimeric intron)프로모터와 Cas13a 유전자와 U6 프로모터 그리고 BsmBI 제한효소 염기서열 및 타겟 sgRNA를 삽입하는 데 필요한 spacer 염기서열을 oligo 합성을 통해 제작하였다 (도 4 참조).
상기 backbone 벡터의 BsmBI site에 oligo 합성으로 제작한 선별된 3개의 sgRNA 염기서열들을 클로닝하여 벡터를 제작하였으며 Sanger's sequencing 방법으로 정확히 타겟 sgRNA들이 들어 갔는지 검증하였다 (도 5 내지 9 참조).
그 결과 도 5 내지 9의 재조합 발현벡터를 제조하였고 이는 서열번호 6 내지 10의 서열로 구성되어 있다.
실험예 2: 본 발명의 재조합 발현벡터의 프로게린 mRNA 및 단백질 감소효과 확인(in vitro)
실험예 2-1. 정상 lamin A 및 프로게린 과발현 벡터의 제조
조로증 치료 효과를 세포 수준에서 확인하기 위하여 정상 lamin A 및 프로게린 과발현 벡터의 제조하였다. 구체적으로, 세포에서 프로게린이 과발현될 경우 세포가 잘 자라지 않고 죽기 때문에 안정적인 세포주를 제조하기 위해 조건부 시스템(Conditional Cre-loxP)을 이용하여 4-하이드로타목시펜(4-Hydroxytamoxifen, 4-OHT)이 처리될 때만 프로게린이 발현되도록 제작하였다.
구체적으로, LMNA 과발현 벡터 및 프로게린 과발현 벡터는 조건부로 발현할 수 있도록 Loxp-RFP-2A-puro-3x poly-Loxp 염기서열을 oligo 합성하여 클로닝하였고 조건부로 타겟 유전자가 발현하였을 때 확인할 수 있도록 IRES(internal ribosome entry site)를 통해 GFP 형광이 발현하도록 고안하였으며 이렇게 자체 제작한 backbone 벡터에 유전자가 발현되는 코딩 시퀀스(CDS, coding　sequence)영역의 인간의 lamin A(LMNA)과 프로게린을 클로닝하여 조건부 과발현 벡터를 제작하였다 (도 10 및 11 참조).
그 결과, 도 10 및 도 11와 같은 구조의 정상 lamin A(LMNA) 및 프로게린 과발현 벡터를 제조하였다.
실험예 2-2. 정상 lamin A 및 프로게린 과발현 세포주의 제작
본 발명의 재조합 벡터의 효과를 확인할 수 있는 실험예 2-1에서 제조된 정상 lamin A 및 프로게린 과발현 벡터를 이용하여 정상 lamin A 및 프로게린 과발현 세포주를 제작하였다 (도 13).
구체적으로, Lamin A와 프로게린이 조건부로 과발현하는 세포주 제작은 HEK293 세포에 상기에서 기술한 각각의 과발현 벡터를 AAVS1 locus에 유전자 가위(sgRNA 서열: GTGAGAGTTATCTGACCGTAAGG)를 이용하여 삽입하며 조건부로 Lamin A와 프로게린 과발현 벡터를 조절하는 ERT2CreERT2 조건부 벡터는 H11 locus에 유전자 가위(sgRNA 서열: CAAAATAGGTTAGCCTTGCGGGG)를 이용하여 삽입한 후 hygromycin, puromycin으로 selection 되어 살아 있는 세포만을 선별하여 96 well에 단일세포를 넣어 키운 후 각각의 세포를 genotyping으로 검증하여 과발현을 원하는 벡터와 조건부로 조절시키는 벡터가 삽입되었는지 검증하였다.
구체적인 검증 위하여 각각의 AAVS1, H11 locus에 대해 아래 (1), (2), (3) 프라이머 3개를 넣어주어 PCR 과정을 진행하였다.
AAVS1 WT PCR product: 339 bp (F: CCCCTATGTCCACTTCAGGA, R: AGGATCCTCTCTGGCTCCAT)
AAVS1 Progerin/LMNA product: 517 bp (F: CCCCTATGTCCACTTCAGGA, R: TGGTCATAGCTGTTTCCTGTG)
H11 WT PCR product: 221bp (F: ACTTATGGGAACCCCTTCCA, R: ATTTGTTCAGGGCTCCACAG)
ERT2CreERT2 product: HITI 방법이기 때문에 product size 가변적(F: ACTTATGGGAACCCCTTCCA, R: GATAAATCTGGAGCCGGTGA을 이용해 PCR됨)
그 결과 도 14에서 확인되는 바와 같이 유전자의 삽입을 확인하였다.
또한, 삽입된 벡터의 벡터를 이용하여 조건부로 유전자가 발현되는 것을 형광 또는 RT-PCR 방법을 통해 검증하였다.
그 결과 LMNA 또는 프로게린 (progerin)이 과발현 유전자가 발현되기 전에는 RFP가 발현되고 4-0HT(Tamoxifen)을 처리한 후 loxp-RFP-2A-Puro-3X SV40 polyA-loxp가 제거되어 RFP 형광에서 LMNA 또는 프로게린과 함께 GFP가 발현되어 조건부로 유전자가 발현됨을 검증하였다.
또한 semi RT-PCR을 통해 4-0HT 처리 후 프로게린(progerin) 유전자가 발현됨을 확인하였다. semi RT-PCR에 사용된 프라이머 서열은 표 1과 같다.
Gene Name Accession No. Primer sequence (5′→3') Product size
LMNA NM_170707.4 F: CCTTGCTGACTTACCGGTTC
R: ACATGATGCTGCAGTTCTGG		 564 bp
Progerin NM_001282626.2:c.1818+6C>T F: CCTTGCTGACTTACCGGTTC
R: ACATGATGCTGCAGTTCTGG		 414 bp
그 결과, LMNA은 564 bp가 존재하지만 프로게린(progerin)은 mutation에 의해 exon 11에 150 bp가 잘려서 414 bp의 PCR product가 생성되는 것을 확인하였다 (도 15 내지 17 참조).
상기한 결과들을 통해 정상 lamin A 및 프로게린 과발현 세포주를 제조하였다.
실험예 2-3. 본 발명의 재조합 발현벡터의 progerin mRNA 및 단백질 감소효과 확인
실험예 2-2에서 제조된 정상 lamin A 및 프로게린 과발현 세포주에 프로게린 과발현 및 본 발명의 재조합 발현벡터 처리 시 프로게린 mRNA 및 단백질 발현을 확인하였다.
구체적으로, 프로게린이 조건부로 과발현되는 HEK293 세포에 프로게린을 타겟으로 하는 #1, #2, #3의 렌티바이러스를 도입하기 24시간 전에 4-OHT를 처리하여 프로게린 유전자를 유도한 후 과발현된 프로게린 유무를 72시간이 지난 후 RT-PCR과 Western blot으로 프로게린의 감소 유무를 확인하였다.
다음 표 2 의 프라이머를 이용하여 RT-PCR을 실시하였다 (도 18, 19).
Gene Name Accession No. Primer sequence (5′→3') Product size
LMNA NM_170707.4 F: TCTGCCTCCAGTGTCACG
R: ACATGATGCTGCAGTTCTGG		 148 bp
Progerin NM_001282626.2:c.1818+6C>T F: AGCCCAGAGCCCCCAGAA
R: CAAAGGGTTATTTTTCTTTGGCTTCAA		 154 bp
GAPDH NM_002046.7 F: TCAAGAAGGTGGTGAAGCAG
R: TCGCTGTTGAAGTCAGAGGA		 94 bp
그 결과, 프로게린 특이적 RT-PCR primer는 mutation으로 결손된 exon 11와 exon 12가 junction된 부분에서 primer F(forward)를 디자인하였기 때문에 정상적인 LMNA에서는 발현되지 않고 비정상적인 프로게린이 존재시에만 PCR product가 나온다는 것을 확인하였다.
또한, 상기한 결과들과 도 20 및 도 21에서 확인되는 바와 같이 대조군 HEK293 세포에서는 4-OHT의 처리 유무와 관계없이 일정 수준의 Lamin A 발현이 확인되었다. 그리고 프로게린 과발현 벡터가 도입된 실험군의 경우 4-OHT 가 처리되지 않았을 때는 유의적인 변화가 없었고, 4-OHT를 처리할 경우에도 Lamin A는 발현의 유의적 변화가 없었다. 다만, 4-OHT로 인한 프로게린 벡터의 작동으로 프로게린의 발현이 높아진 것을 확인할 수 있었다. 한편, 4-OHT의 처리로 프로게린의 발현을 유도하였음에도 본 발명의 재조합 발현벡터(#1, #2 및 #3)가 도입된 경우에는 도입되지 않은 실험군과 비교하여 유의적으로 낮은 프로게린 발현을 확인할 수 있었고, Lamin A의 발현 수준은 유의적 차이가 없었다. 한편, HEK293 대조군 세포주에서는 Lamin A 단백질 발현이 확인되지 않는데 이는 HEK293 세포주의 특성에서 기인한 것으로 판단된다(Chromosoma. 2017, Aug;126(4):501-517).
상기 결과를 통해 서열번호 2에 의해 암호화되는 sgRNA의 경우 가장 우수한 프로게린 mRNA 발현수준 저감 효과를 확인하였고, 단백질 발현을 다시 확인하였을 때도 유사한 결과를 나타내었다(도 21).
실험예 3: 본 발명의 조성물의 progerin mRNA 및 단백질 감소효과 확인(in vivo)]
본 발명의 조성물이 동물에게도 효과가 있는지 확인하였다(in vivo).
실험예 3-1. 실험동물의 준비
Jackson lab에서 구입한 마우스한 Progerin [C57BL/6-Tg LMNA (G608G) HClns/J, stock #010667)] 이형 접합체(heterozygote, He) 마우스의 암, 수를 교배 과정을 통해 산자(offspring)를 확보한 후 유전형 방법(genotyping 방법)을 통해 야생형(wild-type, WT)과 이형 접합체(heterozygote, He), 동형 접합체(homozygote, Ho) 마우스를 확보하였다.
실험예 3-2. 본 발명의 조성물 도입
상기 실험예 3-1에서 확보한 이형 접합체(He) 암, 수 마우스를 서로 교배한 후 13.5일 때의 태아(fetus)로부터 마우스 배아 섬유아세포(mouse embryonic fibroblast, MEF)를 제작한 후, 유전형 방법을 통해 확인한 야생형(WT)과 progerin 동형 접합체 (HO) 만을 실험예 2-3과 같은 방법으로 본 발명의 조성물(CRISPR-Cas13a #2 렌티바이러스)을 도입한 실험군(도 12의 Progeria (HO) sgRNA #2 (+))과 도입하지 않은 마우스 배아 섬유아세포 실험군(도 12의 Progeria (HO) sgRNA #2 (-))으로 제작하였다.
한편 야생형(WT) 마우스의 마우스 배아 섬유아세포에 대해서도 실험예 2-3과 같은 방법으로 본 발명의 조성물(CRISPR-Cas13a #2 렌티바이러스)을 도입한 실험군(도 20의 WT sgRNA #2 (+))과 도입하지 않은 마우스 배아 섬유아세포 실험군(도 20의 WT sgRNA #2 (-))으로 제작하였다.
실험예 3-3. 노화 관련 유전자 발현의 확인
상기 실험예 3-2에서 제작된 실험군들의 프로게린 및 노화 관련 유전자 (PAI-1, MMP3, SMP30) 발현을 확인하였다.
구체적으로, 노화 관련 유전자의 변화 관찰은 Western blot 분석방법을 통해 확인하였으며, Western blot 방법은 다음의 과정을 통해 검증하였다. 30-60μg의 protein lysates를 8-12 % sodium dodecyl sulfate-polyacrylamide gels에서 분리하고 0.45μm 니트로 셀룰로스 막(nitrocellulose membranes)으로 옮겼다 (Cat # HAWP04700, EMD Millipore, Burlington, MA, USA). 멤브레인(membranes)을 10mM Tris pH 7.4, 150mM NaCl 및 0.02 % Tween-20 (TBST)에서 5 % 탈지유(skim milk, Cat # 232100, BD Biosciences) 또는 소혈청 알부민(Bovine serum albumin, Cat # A9647, Sigma-Aldrich)으로 blokcing 한 후, 이들은 1 차 항체 (Lamin A/C, Cat #4777S, Cell signaling technology, 1:1000; PAI-1, Cat #ab66705, Abcam, 1:1000; MMP3, Cat #ab52915, Abcam, 1:1000; SMP30, Cat #48864S, Cell signaling technology, 1:1000; GAPDH, Cat #LF-MA0038, AB Frontier, 1:2000)와 함께 4 ºC에서 밤새 incubation 한다. 멤브레인을 TBST로 3 회 세척한 후 TBST에서 5 % 탈지유로 차단하고 horseradish peroxidase가 결합되어 있는 2차 항체를 이용하여 실온에서 1 시간 동안 incubation 한다. 블롯을 TBST로 세척한 후 제조업체의 지침에 따라 SuperSignal West Pico PLUS Chemiluminescent Substrate (Cat # 34580, Thermo Fisher Scientific)를 사용하여 항체 결합을 확인하였다.
그 결과, 도 22에서 확인되는 바와 같이, 야생형 마우스의 마우스 배아 섬유아세포는 본 발명의 조성물(CRISPR-Cas13a #2 렌티바이러스)를 도입 유, 무와 무관하게, 유의적인 노화 관련 유전자 발현 차이를 확인할 수 없었다(도 20의 WT sgRNA #2 (-) 및 (+)). 반면, 동형 접합체 (HO)에 있어서는 본 발명의 조성물 (CRISPR-Cas13a #2 렌티바이러스)을 도입하지 않은 마우스 배아 섬유아세포 실험군 (도 20의 Progeria (HO) sgRNA #2 (-))은 프로게린 및 노화 관련 유전자(PAI-1, MMP3, SMP30) 발현이 야생형 세포주에 비해 증가한 것을 확인할 수 있다. 그리고, 본 발명의 조성물(CRISPR-Cas13a #2 렌티바이러스)을 도입한 실험군(도 20의 Progeria (HO) sgRNA #2 (+))은 프로게린 및 노화 관련 유전자(PAI-1, MMP3, SMP30) 발현이 도입하지 않은 실험군에 비하여 감소한 것을 확인할 수 있다.
실험예 3-4. 본 발명의 조성물의 투여 및 효과 검증
상기 실시예 1에서 제조된 본 발명의 조성물(CRISPR-Cas13a #2 렌티바이러스)을 상기 실험예 3-1의 동형유전자 마우스에 투입한 실험군(아래 표 3의 F4 #08(HO, M, male) 및 F4 #13(HO, F, female)) 및 투입하지 않은 실험군(아래 표 3의 F4 #01(HO, M) 및 F4 #21(HO, M))을 조로증의 한 지표인 체중을 기준으로 비교하였다.
구체적으로, 7개월령(출생일(DOB; date of birth) 2019.10.21일생, 바이러스 주입시기(2020.04.24일))의 progeria Ho 마우스를 가지고 1, 2차에 걸쳐 control(타겟 sgRNA 염기서열이 없는 backbone 바이러스)과 sgRNA #2으로 제작한 바이러스를 꼬리 정맥혈관(tail vein)을 통해 주입한 후 progeria에 의한 몸무게 변화 추이를 실험 시작일(2020.04.24)일부터 일정간 간격으로 측정하였다.
그 결과, 표 3에서 확인되는 바와 같이 본 발명의 조성물을 투입하지 않은 실험군은 폐사되었으나, 본 발명의 조성물을 투입한 실험군은 약간의 체중 감소는 나타나지만 control에 비해 생존율이 증가함을 확인할 수 있었다.
Figure PCTKR2021015531-appb-T000001
한편, 상기 실험군들의 장기 조직(간, 폐, 신장)에서의 프로게린 및 노화 관련 유전자(PAI-1, MMP3, SMP30) 발현을 확인하였다.
구체적으로, 실험예 3-4의 마우스 개체의 간, 폐 및 신장 샘플에서 확인한 것 외에는 상기 실험예 3-3에서 사용한 방법과 동일한 방법을 사용하였다.
그 결과, 도 23에서 확인되는 바와 같이 본 발명의 조성물을 투여한 실험군에서는 투여하지 않은 실험군에 비하여, 간, 폐 및 신장에서의 프로게린 및 노화 관련 유전자(PAI-1, MMP3, SMP30) 발현이 감소한 것을 확인하였다.
실험예 4 : 프로게린 mRNA 타겟 염기서열의 유용성 확인
실험예 4-1. 형광분석
Progeria HO 마우스의 MEF에 control 및 본 발명의 서열번호 6 내지 10 중 어느 하나의 재조합 발현벡터와 pMD2.G (Addgene #12259), psPAX2 (Addgene #12260) 벡터들을 이용하여 293FT(Invitrogen #R70007) 세포 도입 후 4~5일 때부터 각각 세포배양액의 상층액에 생산된 렌티바이러스들을 Progeria HO 마우스의 MEF에 2회 감염시킨 후 CRISPR-Cas13a의 발현을 GFP 형광을 통해 확인하였다.
그 결과, 도 24 에서 확인되는 바와 같이 Cas13a와 fusion된 GFP 형광이 발현을 통해 재조합 렌티바이러스 (CRISPR-Cas13a #1내지 #5 렌티바이러스, 서열번호 6 내지 10)가 도입되어 발현됨을 확인하였다.
실험예 4-2. 프로게린 및 노화 관련 유전자 발현 확인
상기 실험예 2-3에서 구축한 프로게린이 조건부로 과발현되는 HEK293 세포와 상기 실험예 3-2에서 확보한 MEF에 실험예 2-3과 같은 방법으로 본 발명의 재조합 발현벡터 (CRISPR-Cas13a #1내지 #5 렌티바이러스, 서열번호 6 내지 10)를 도입하였다. 그리고, 프로게린 및 노화 관련 유전자 발현 변화를 Western blot 분석방법을 통해 확인 하였다.
그 결과 본 발명의 재조합 발현벡터를 도입한 실험군에서 도입하지 않은 세포보다 프로게린 및 노화 관련 유전자(PAI-1, MMP3, SMP30) 발현이 감소함을 확인 할 수 있다 (도 25, 26).
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.

Claims (13)

  1. 프로게린 mRNA에 혼성화하는 gRNA를 암호화하는 폴리뉴클레오티드로서,
    상기 폴리뉴클레오티드는 서열번호 1 내지 5 중 어느 하나인 것을 특징으로 하는 폴리뉴클레오티드.
  2. 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드로부터 유래된 gRNA.
  3. 제2항에 있어서,
    상기 gRNA는 LMNA 유전자의 엑손 11 및 엑손 12을 암호화하는 유전자에 혼성화하는 것인 gRNA.
  4. 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드로부터 유래된 gRNA; 및
    Cas13 mRNA 또는 이로부터 유래된 Cas 13 단백질을 포함하는 프로게린 발현 저해용 조성물.
  5. 프로게린 mRNA에 혼성화하는 gRNA를 암호화하는 서열번호 1 내지 5 중 어느 하나의 폴리뉴클레오티드 서열 또는 이와 상보적인 서열을 포함하는 재조합 발현 벡터.
  6. 제5항에 있어서,
    상기 재조합 발현 벡터는 Cas13을 암호화하는 폴리뉴클레오티드 서열을 더 포함하는 재조합 발현벡터.
  7. 제5항에 있어서,
    상기 재조합 발현 벡터는 서열번호 6 내지 10 중 어느 하나의 서열로 이루어진 재조합 발현벡터.
  8. 제5항의 재조합 발현벡터를 유효성분으로 포함하는 프로게린 발현 저해용 조성물.
  9. 제5항의 재조합 발현벡터 및 Cas13 발현벡터를 포함하는 프로게린 발현 저해용 조성물.
  10. 제4항, 제8항 및 제9항 중 어느 하나의 조성물을 유효성분으로 포함하는 조로증 및 자연노화 예방 또는 치료용 약학적 조성물.
  11. 제4항, 제8항 및 제9항 중 어느 하나의 조성물을 치료 대상에게 투여하는 단계를 포함하는 조로증 치료 및 자연노화 개선 방법.
  12. 조로증 치료 및 자연노화 개선을 위한 제 제4항, 제8항 및 제9항 중 어느 하나의 조성물의 용도.
  13. 조로증 및 자연노화 예방 또는 치료용 약학적 조성물을 제조하기 위한 제4항, 제8항 및 제9항 중 어느 하나의 조성물의 용도.
PCT/KR2021/015531 2020-11-03 2021-11-01 유전자 교정을 이용한 조로증 및 자연노화의 예방 또는 치료용 조성물 WO2022098014A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2020-0145160 2020-11-03
KR20200145160 2020-11-03
KR10-2021-0145418 2021-10-28
KR1020210145418A KR20220059913A (ko) 2020-11-03 2021-10-28 유전자 교정을 이용한 조로증 및 자연노화의 예방 또는 치료용 조성물

Publications (1)

Publication Number Publication Date
WO2022098014A1 true WO2022098014A1 (ko) 2022-05-12

Family

ID=81458029

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/015531 WO2022098014A1 (ko) 2020-11-03 2021-11-01 유전자 교정을 이용한 조로증 및 자연노화의 예방 또는 치료용 조성물

Country Status (1)

Country Link
WO (1) WO2022098014A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120106286A (ko) * 2011-03-18 2012-09-26 부산대학교 산학협력단 프로게린 발현 억제제를 유효성분으로 함유하는 노화 관련 질환 치료용 약학조성물 및 상기 프로게린 발현 억제제의 스크리닝 방법
KR20190025821A (ko) * 2016-04-29 2019-03-12 사렙타 쎄러퓨틱스, 인코퍼레이티드 인간 lmna를 표적화하는 올리고뉴클레오타이드 유사체
WO2019191341A1 (en) * 2018-03-27 2019-10-03 Factor Bioscience Inc. Nucleic acid-based therapeutics

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120106286A (ko) * 2011-03-18 2012-09-26 부산대학교 산학협력단 프로게린 발현 억제제를 유효성분으로 함유하는 노화 관련 질환 치료용 약학조성물 및 상기 프로게린 발현 억제제의 스크리닝 방법
KR20190025821A (ko) * 2016-04-29 2019-03-12 사렙타 쎄러퓨틱스, 인코퍼레이티드 인간 lmna를 표적화하는 올리고뉴클레오타이드 유사체
WO2019191341A1 (en) * 2018-03-27 2019-10-03 Factor Bioscience Inc. Nucleic acid-based therapeutics

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BEYRET ERGIN; LIAO HSIN-KAI; YAMAMOTO MAKO; HERNANDEZ-BENITEZ REYNA; FU YUNPENG; ERIKSON GALINA; REDDY PRADEEP; IZPISUA BELMONTE J: "Single-dose CRISPR–Cas9 therapy extends lifespan of mice with Hutchinson–Gilford progeria syndrome", NATURE MEDICINE, NATURE PUBLISHING GROUP US, NEW YORK, vol. 25, no. 3, 18 February 2019 (2019-02-18), New York, pages 419 - 422, XP036722143, ISSN: 1078-8956, DOI: 10.1038/s41591-019-0343-4 *
DATABASE GenBank NLM; . . : "Homo sapiens progerin mRNA, complete cds", XP055928794 *
SANTIAGO-FERNáNDEZ OLAYA; OSORIO FERNANDO G.; QUESADA VíCTOR; RODRíGUEZ FRANCISCO; BASSO SAMMY; MAESO DANIEL; ROLAS: "Development of a CRISPR/Cas9-based therapy for Hutchinson–Gilford progeria syndrome", NATURE MEDICINE, NATURE PUBLISHING GROUP US, NEW YORK, vol. 25, no. 3, 18 February 2019 (2019-02-18), New York, pages 423 - 426, XP036722141, ISSN: 1078-8956, DOI: 10.1038/s41591-018-0338-6 *

Similar Documents

Publication Publication Date Title
WO2013169077A1 (ko) 악액질 예방 또는 치료용 조성물
WO2012074277A2 (en) Novel hybrid promoter and recombinant vector comprising the same
WO2014208970A1 (ko) 트랜스케톨라아제 유전자 프로모터 변이체 및 이의 용도
WO2021096275A1 (ko) 변형된 인터루킨-7 및 tgf 베타 수용체 ii를 포함하는 융합단백질 및 이의 용도
WO2010002160A2 (ko) 돼지의 알파에스 1 카제인 유전자, 그 프로모터 및 그의 용도
JP2005524606A (ja) Ｉｌ−６阻害活性を有する新規のタンパク質
WO2022098014A1 (ko) 유전자 교정을 이용한 조로증 및 자연노화의 예방 또는 치료용 조성물
WO2022005174A1 (ko) 항-lag-3 항체 및 il-2를 포함하는 융합단백질 및 이의 용도
WO2019147036A1 (ko) 뇌유래-신경영양인자를 발현하는 중간엽줄기세포 및 이의 용도
Choi et al. Demethylation of somatic and testis-specific histone H2A and H2B genes in F9 embryonal carcinoma cells
WO2020159191A1 (ko) Mls-stat3를 포함하는 면역질환의 예방 또는 치료용 조성물
WO2013129852A1 (ko) 신규한 인터루킨-6에 대한 리피바디 및 그 용도
WO2023282688A1 (ko) 산화스트레스 저항성을 갖는 중간엽 줄기세포, 이의 제조방법 및 용도
WO2016027990A1 (ko) Ｄｕｓｐ５를 유효성분으로 모두 포함하는 골대사성 질환의 예방 또는 치료용 약학적 조성물
WO2021125840A1 (ko) Cpf1 및 키메릭 dna-rna 가이드를 포함하는 유전체 교정 또는 발현 억제용 조성물
WO2022092915A1 (ko) Gdf15를 유효성분으로 함유하는 면역질환의 예방 및 치료용 조성물
WO2022108148A1 (ko) 자가 항체에 대한 회피율 또는 활성이 증가된 adamts13 변이체
WO2014109617A1 (ko) HtrA2 단백질을 유효성분으로 포함하는 자가면역질환의 예방 또는 치료용 조성물
WO2020139031A1 (ko) Crispr-cas를 기반으로 하는 유전자 교정용 조성물
WO2020145465A1 (ko) Runx3 유전자 또는 단백질을 유효성분으로 함유하는 K-Ras 돌연변이 폐암의 예방 또는 치료용 약학 조성물
WO2016159695A1 (ko) Ssu72를 유효성분으로 포함하는 자가면역질환의 예방 또는 치료용 조성물
WO2024054006A1 (ko) 신규한 유전체 세이프 하버 및 이의 용도
WO2023008918A1 (ko) B2m 유전자의 발현이 저해된 유전적으로 조작된 줄기세포 및 이의 이용방법
WO2022169235A1 (ko) 교정 효율이 개선된 프라임에디팅용 조성물
WO2014178485A1 (ko) Ｃｍｐ-아세틸뉴라미닌산 히드록실라아제 타겟팅 벡터, 그 벡터가 도입된 이종간 이식용 형질전환 동물 및 그 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21889479

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21889479

Country of ref document: EP

Kind code of ref document: A1