WO2022087013A1 - Virus-inspired compositions and methods of redirecting preexisting immune responses using the same for treatment of cancer - Google Patents

Virus-inspired compositions and methods of redirecting preexisting immune responses using the same for treatment of cancer Download PDF

Info

Publication number
WO2022087013A1
WO2022087013A1 PCT/US2021/055676 US2021055676W WO2022087013A1 WO 2022087013 A1 WO2022087013 A1 WO 2022087013A1 US 2021055676 W US2021055676 W US 2021055676W WO 2022087013 A1 WO2022087013 A1 WO 2022087013A1
Authority
WO
WIPO (PCT)
Prior art keywords
mpv
protein
capsid
irc
peptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/055676
Other languages
English (en)
French (fr)
Inventor
Joshua Weiyuan WANG
Ken Matsui
Philip STORM
Kristin Marie PETER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Verimmune Inc
Original Assignee
Verimmune Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Verimmune Inc filed Critical Verimmune Inc
Priority to CA3195963A priority Critical patent/CA3195963A1/en
Priority to EP21883734.2A priority patent/EP4228687A4/en
Priority to CN202180082211.2A priority patent/CN116583297A/zh
Priority to IL302190A priority patent/IL302190A/en
Priority to AU2021364548A priority patent/AU2021364548A1/en
Priority to KR1020237016812A priority patent/KR20230129379A/ko
Priority to JP2023524090A priority patent/JP2023552040A/ja
Priority to MX2023004465A priority patent/MX2023004465A/es
Publication of WO2022087013A1 publication Critical patent/WO2022087013A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/295Polyvalent viral antigens; Mixtures of viral and bacterial antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/46Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5258Virus-like particles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/58Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation
    • A61K2039/585Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation wherein the target is cancer
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/60Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031Proteins
    • A61K2039/6075Viral proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/60Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031Proteins
    • A61K2039/6081Albumin; Keyhole limpet haemocyanin [KLH]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/70Multivalent vaccine
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/50Fusion polypeptide containing protease site
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16111Cytomegalovirus, e.g. human herpesvirus 5
    • C12N2710/16134Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/20011Papillomaviridae
    • C12N2710/20022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/20011Papillomaviridae
    • C12N2710/20034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/20011Papillomaviridae
    • C12N2710/20051Methods of production or purification of viral material
    • C12N2710/20052Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • compositions comprising mutated papillomavirus proteins, especially the L1 major capsid protein, that form capsid backbones and are attached to one or more peptides comprising one or more antigens recognized by a subject’s preexisting immune system response memory, and their methods of use in treatment, prevention, and/or reduction in the incidence of cancer in a subject.
  • CROSS REFERENCE TO RELATED APPLICATIONS [0002]
  • Such therapies are attractive in that they are target specific and potentially less toxic without nonspecific autoimmunity. These targeted therapies are also considered less invasive or traumatic compared to surgery, radiation, or chemotherapy.
  • cancer vaccines based on cancer-associated antigens can have limited success due to poor clinical immunogenicity, immune tolerance, and off target effects, for example.
  • such methods typically require identifying a cancer-associated antigen specific to a given patient’s cancer to achieve effective targeting of the cancer.
  • this approach has failed on multiple occasions because most cancer-associated antigens are self- antigens that are tolerated by the immune system, resulting in poor immune responses.
  • CAR chimeric antigen receptor
  • CAR-T chimeric antigen receptor-transduced T cells
  • monoclonal antibodies that require the laborious identification of cancer-specific antigens and are applicable to only a subset of cancer types or subtypes.
  • adoptive transfer of tumor-specific lymphocytes expanded ex vivo is a methodology that aims to take advantage of naturally-occurring antitumor responses. All these approaches are similarly highly personalized and require the identification cancer epitopes of the subject’s specific cancer and/or expansion of patient autologous cells ex vivo.
  • successes demonstrated by these specific cancer antigen approaches in gold standard animal models have not been always translatable to humans.
  • a solution to the problem of individualized targeted treatment and elimination of cancer presents itself in the form of viral infection history.
  • a subject’s infection history is used to re-initiate a past viral infection immune response through cytotoxic memory T-cells.
  • Such therapies based on past viral infections are finely tune-able to target specific cancers by depositing on the cancer cells an epitope recognized by the subject’s own immunological memory.
  • Virus L1 proteins provide key functionality for delivering the epitope label onto the cancer cell target, thereby recruiting and activating the subject’s own preexisting immune system components to target and eliminate the labeled cancer cells.
  • capsid backbones comprised of twelve (12) capsomeres
  • compositions comprising a plurality of mutant mouse papillomavirus L1 proteins are disclosed.
  • the compositions further comprise one or more peptides that each comprise one or more epitopes from one or more pathogens other than a Papillomaviridae antigenic peptide.
  • the mutated amino acid sequence of the Papillomaviridae L1 protein comprises at least the following mutations with respect to the wild type L1 protein sequence: (a) a deletion of at least five amino acid residues from an amino-terminus, and (b) a deletion of at least ten amino acid residues from the helix four region.
  • the one or more peptides are attached to the plurality of virus proteins.
  • the plurality of virus proteins spontaneously assemble to form an icosahedron or dodecahedron capsid backbone having a triangulation number T equal to 1 that binds to proteoglycan expressed on tumor cells.
  • the compositions comprise a plurality of mutant Papillomaviridae proteins and one or more such peptides.
  • the compositions comprise one or more peptides attached to a plurality of mutant Papillomaviridae L1 proteins.
  • the mutant L1 proteins further comprise a deletion of at least thirty amino acid residues from the carboxy terminus of the L1 proteins.
  • the peptides are conjugated to the L1 proteins via disulphide, maleimide, or amide bond between the mutant Papillomaviridae L1 protein and a residue of the peptide.
  • from about 25% to about 85% (w/w) of the L1 proteins are attached to at least one of the peptides.
  • the peptides also comprise a protease cleavage sequence, optionally selected from a furin cleavage sequence, a matrix metalloprotease cleavage sequence, or a disintegrin and metalloprotease (ADAM) cleavage sequence.
  • the epitopes are not particularly limited other than that they should be from an antigen that the subject to be treated has been previously exposed to and to which the subject has developed an immune reactivity towards, or has an immune memory of the previous exposure such that upon re-exposure the subject’s immune system will recognize and attack the cells bearing the epitopes.
  • the epitope may be from a childhood vaccine. In other instances, the epitope may be from a past pathogenic infection the subject recovered from.
  • compositions comprising the Immune Redirector Capsid (IRC) molecules bind to heparin sulfate proteoglycan located on cell surfaces.
  • the mutant L1 proteins are from mouse L1 proteins.
  • Contemplated herein are methods of treating, preventing, and/or reducing the occurrence of cancer in a subject in need thereof, which comprises administering to the subject a pharmaceutically effective amount of the compositions described herein.
  • methods of inhibiting cancer tumor growth, progression, and/or metastasis in a subject in need thereof which comprises administering to the subject a pharmaceutically effective amount of the compositions described herein.
  • Such methods further comprise in some embodiments obtaining from the subject a tumor tissue sample and identifying in the tumor tissue a sequence of one or more MHC molecules expressed by one or more tumor cells in the tumor tissue sample.
  • the one or more epitopes are capable of complexing with one or more MHC molecules expressed by a tumor cell in a tumor tissue sample obtained from the subject.
  • Secondary uses of the described compositions are also contemplated, as in the use for manufacture of a medicament useful for such methods.
  • Further provided herein are processes for producing the described compositions.
  • the processes include various steps, such as: (a) transforming a prokaryotic cell with an expression vector encoding the L1 protein’s nuclei acid sequence; (b) culturing the transformed prokaryotic cell under conditions that promote expression of the L1 protein; (c) lysing the transformed prokaryotic cells to release expressed L1 protein; (d) separating cell debris from the expressed L1 protein and recovering the L1 protein as inclusion bodies; (e) optionally washing the L1 protein inclusion bodies; (f) solubilizing the L1 protein inclusion bodies; (g) refolding the L1 protein in refolding buffer in the presence of reducing agent; and (h) forming the icosahedron or dodecahedron capsid having a triangulation number T equal to 1 in the same refolding buffer.
  • Such processes further include conjugating in a conjugation buffer the one or more peptides to the assembled L1 protein by incubating the assembled L1 protein under reducing conditions in the presence of one or more peptides and/or removing denaturant from the assembly buffer but maintaining reducing agent when forming the icosahedron or dodecahedron capsid having a triangulation number T equal to 1.
  • FIG. 1A is a schematic gene map of wildtype mouse papillomavirus L1 (MPV L1) and associated regions.
  • FIG. 2 is an amino sequence alignment of MusPV L1 protein sequence (SEQ ID NO: 127) aligned with the corresponding human HPV16 L1 protein sequence (SEQ ID NO: 128).
  • FIG. 3 is a flow chart of process steps leading to the manufacture of MPV.10.34.d capsid backbones, which upon formation subsequently are conjugated to peptides to form immune regulatory capsids (IRCs).
  • MW standard molecular weight bands
  • numbers on the left-hand side of the gel indicate molecular weight in kiloDaltons (kDa)
  • top row numbers indicate amount of protein loaded in micrograms).
  • FIG.5 is a photograph of a transmission electron micrograph (TEM) image with a scale bar of 500 nm of the purified MPV.10.34.d capsid backbone following the production and purification steps as described in Figure 3 and Example 1.
  • the capsid backbone is approximately between 20 nm to 30 nm in diameter based on this image.
  • FIG. 6A is a dynamic light scattering (DLS) plot showing the intensity of the particle size distribution of the MPV.10.34.d capsid backbone after the refolding step but before the two-column chromatography purification.
  • the X-axis shows diameter size distribution (nm) and the Y-axis provides percent intensity data.
  • FIG 6B is a dynamic light scatting plot showing the population size of purified MPV.10.34.d capsid backbone after the refolding step but before two-column chromatography purification.
  • the X-axis shows diameter size distribution (nm) and the Y-axis provides volume percent data.
  • FIG. 7A is a dynamic light scattering plot showing MPV.10.34.d L1 protein refolding in buffer with the following added: 1 mM dithiothreitol (DTT), 1 mM ethylenediamine tetraacetic acid (ETDA), and 1 mM phenylmethylsulfonyl fluoride (PMSF).
  • DTT dithiothreitol
  • ETDA mM ethylenediamine tetraacetic acid
  • PMSF phenylmethylsulfonyl fluoride
  • FIG. 7B is a dynamic light scattering plot showing MPV.10.34.d L1 protein refolding in buffer with added 1mM DTT.
  • the X-axis shows diameter size distribution (nm) and the Y-axis provides volume percent data.
  • FIG. 7C is a dynamic light scattering plot showing MPV.10.34.d L1 protein refolding in buffer with added 1mM ETDA. The arrow indicates aggregated protein that is not correctly refolded as detected by the volume intensity plots, which measure population size of the sample as a whole.
  • FIG. 7D is a dynamic light scattering plot showing MPV.10.34.d L1 protein refolding in buffer without any added DTT, EDTA, or PMSF.
  • the arrow indicates aggregated protein that is not correctly refolded as detected by the volume intensity plots, which measure population size of the sample as a whole.
  • the X-axis shows diameter size distribution (nm) and the Y-axis provides volume percent data.
  • FIG.8A is a chromatogram showing capture of correctly refolded MPV.10.34.d L1 protein refolded buffer with added 1mM DTT, 1mM ETDA, and 1mM PMSF.
  • the Y-axis provides absorbance units (mAU) on the left and mS/cm on the right, with the X-axis indicating elution volume (mL).
  • FIG.8B is a chromatogram showing capture of correctly refolded MPV.10.34.d L1 protein refolded buffer with added 1mM DTT.
  • FIG.8C is a chromatogram showing capture of correctly refolded MPV.10.34.d L1 protein refolded buffer with added 1mM ETDA. The arrow indicates poor capture and elution, which indicates less correctly refolded MPV.10.34.d capsid backbone was observed under conditions C and D as compared with A and B.
  • the Y-axis provides absorbance units (mAU) on the left and mS/cm on the right, with the X-axis indicating elution volume (mL).
  • FIG.8D is a chromatogram showing capture of correctly refolded MPV.10.34.d L1 refolded in the presence of just buffer with no added DTT, EDTA, or PMSF.
  • the arrow indicates poor capture and elution, which indicates less correctly refolded MPV.10.34.d capsid backbone was observed under conditions C and D as compared with A and B.
  • the Y-axis provides absorbance units (mAU) on the left and mS/cm on the right, with the X-axis indicating elution volume (mL).
  • FIG. 9A is a dynamic light scattering plot showing MPV.10.34.d L1 protein showing particle size (diameter, nm) distribution (X-axis) based on intensity (Y-axis) for eluted MPV.10.34d L1 protein, indicating an average particle size of 20 nm to 30 nm.
  • FIG. 9A is a dynamic light scattering plot showing MPV.10.34.d L1 protein showing particle size (diameter, nm) distribution (X-axis) based on intensity (Y-axis) for eluted MPV.10.34d L1 protein, indicating an average particle size of 20 nm to 30 nm.
  • FIG. 9B is a dynamic light scattering plot showing MPV.10.34.d L1 protein showing particle size (diameter, nm) distribution (X-axis) based on volume (the relative proportion of refolded protein with respect to other contaminants, i.e., host bacterial cell proteins, Y-axis) for eluted MPV.10.34d L1 protein, indicating an average particle size of 20 nm to 30 nm.
  • FIG. 9C is a photograph of a transmission electron microscopy (TEM) micrograph including a scale bar of 100 nm showing highly purified soluble expressed MPV.10.34.d capsid backbone.
  • the Y-axis provides optical density at 450 nm, and the X-axis provides amount of MPV.10.34.d capsid backbone (ng).
  • FIG. 11 is a schematic representation of the steps to produce IRCs, i.e., conjugated MPV.10.34.d L1 capsid backbones.
  • FIG.12 shows a photograph of a stained SDS-PAGE gel showing unconjugated MPV.10.34.d capsid backbones (lane 3) and IRCs (lane 4). Lane 1 shows molecular weight standards and lane 2 was intentionally left blank.
  • FIG.13 is a photograph of a stained SDS-PAGE gel showing that MPV.10.34.d capsid backbones experience a higher degree of peptide conjugation (lane 5) compared to wild type HPV16 capsid backbones (lane 3). Lanes 2 and 4 are the unconjugated wild type HPV16 and MPV.10.34.d capsid backbones, respectively. Lane 1 shows molecular weight standards.
  • FIG.12 shows a photograph of a stained SDS-PAGE gel showing unconjugated MPV.10.34.d capsid backbones (lane 3) and IRCs (lane 4). Lane 1 shows molecular weight standards and lane 2 was intentionally left blank.
  • FIG.13 is a photograph of a
  • FIG. 14 is a photograph of a stained SDS-PAGE gel showing samples of wild type HPV16 IRC or MPV.10.34.d IRC or HPV16 capsid backbones in the presence of reducing agent added in a ratio of reducing agent to L1 protein of 0 (unconjugated controls, lanes 2 and 9), 10:1 (lanes 2 and 10), 100:1 (lanes 3 and 11), and 1000:1 (lanes 4 and 12). The samples were then subjected to 10 rounds of filtration and then analyzed by SDS-PAGE in the same manner.
  • FIG. 15A is a photograph of a TEM micrograph at 150,000X of wildtype HPV16 IRC subjected to 10 rounds of filtration resulting in the breakdown of the IRCs as seen in the circles.
  • FIG. 15B is a photograph of a TEM micrograph at 200,000X of wildtype HPV16 IRC subjected to 10 rounds of filtration resulting in the breakdown of the IRCs as seen in the circles.
  • FIG. 15A is a photograph of a TEM micrograph at 150,000X of wildtype HPV16 IRC subjected to 10 rounds of filtration resulting in the breakdown of the IRCs as seen in the circles.
  • FIG. 15B is a photograph of a TEM micrograph at 200,000X of wildtype HPV16 IRC subjected to 10 rounds of filtration resulting in the breakdown of the IRCs as seen in the circles.
  • FIG. 15C is a photograph of a TEM micrograph at 120,000X of MPV.10.34.d IRCs subjected to 10 rounds of filtration. The MPV.10.34.d IRCs did not display any breakdown.
  • FIG. 15D is a photograph of a TEM micrograph at 200,000X of MPV.10.34.d IRCs subjected to 10 rounds of filtration. The MPV.10.34.d IRCs did not display any breakdown. [0047] FIG.
  • 16 is a stained SDS-PAGE gel showing impact of peptide concentration on peptide conjugation of MPV.10.34.d L1 peptide backbones, where peptide is present during conjugation reactions in ratios of 5:1, 10:1, and 25:1 of peptide:L1 when reducing agent ((tris(2-carboxyethyl)phosphine, TCEP) is present at a ratio of 5:1 reducing agent to L1 concentration (lanes 1, 4, and 7). No dependence of conjugation rate on peptide concentration was seen in samples where the reducing agent to L1 ratio was 10:1 (lane 2, 5, and 8) or 20:1 (lanes 3, 6, and 9).
  • reducing agent (tris(2-carboxyethyl)phosphine, TCEP)
  • Lane 6 is a reference sample containing a ratio of 10:1 reducing agent to L1 protein and 10:1 peptide to L1 concentration. (See, Example 6). This is a condition that has consistently provided approximately 50% peptide conjugation as determined by densitometry.
  • the lane labelled CEX-FB035 (left side) is the MPV.10.34.d capsid backbone control. [0048] FIG.
  • 17 is a stained SDS-PGE gel showing impact of peptide concentration on peptide conjugation of MPV.10.34.d capsid backbones, where peptide is present during conjugation reactions in ratios of 5:1, 10:1, and 25:1 of peptide:L1 when reducing agent ((tris(2-carboxyethyl)phosphine, TCEP) is present at a ratio of 5:1 reducing agent to L1 concentration (lanes 3, 6, and 9). Lanes 1, 4, and 7 are samples exposed to a ratio of 1:1 reducing agent to L1 concentration. Lanes 2, 5, and 8 are samples exposed to a ratio of 2.5:1 reducing agent to L1 concentration.
  • reducing agent (tris(2-carboxyethyl)phosphine, TCEP)
  • FIG. 18A is a flow cytometer histogram of cell count vs. fluorescence intensity showing detection of the binding of MPV.10.34.d capsid backbones and a variety of MPV.10.34.d IRCs showing that the IRCs retain specificity to tumor cells via binding heparin sulfate proteoglycan (HSPG).
  • HSPG heparin sulfate proteoglycan
  • FIG. 18B is a flow cytometer histogram of cell count vs.
  • FIG. 10.34.d fluorescence intensity showing that all MPV.10.34.d IRCs do not bind to cells in which HSPG is not expressed.
  • Data include: MPV.10.34.d and corresponding CMV pp65 IRC (solid line), MPV.10.34.d and corresponding E7 IRC (thick solid line), MPV.10.34.d and corresponding OVA IRC (thick dashed line), and MPV.10.34.d capsid backbones (dashed-line). All samples exhibited specificity for tumor cells as evidenced by the shift of the peak to the right.
  • the positive control in these experiments was wildtype MPV capsid backbone (dotted line).
  • the negative control included no IRC and no L1 (long-dashed line).
  • FIG. 19 is a flow cytometer histogram of cell count vs. fluorescence intensity showing detection of the tumor cell surface display of OVA (SIINFEKL, SEQ ID NO: 95) / Kb (MHC-I) complex.
  • OVA SIINFEKL, SEQ ID NO: 95
  • MHC-I MHC-I complex
  • IRCs are able to load more epitopes onto tumor cell MHC receptors as compared with OVA (SIINFEKL, SEQ ID NO: 95)-conjugated HPV16 IRCs, when equivalent molarities of OVA-conjugated HPV16 IRCs (solid line) and OVA-conjugated MPV.10.34.d IRCs (thick solid line) were compared side-by-side.
  • FIG. 20A is a flow cytometer histogram of cell count vs. fluorescence intensity showing detection of the tumor cell surface cell count of CMV (NLAPMVATV, SEQ ID NO: 129) /HLA-A*0201 (MHC-I) complex showing CMV-conjugated MPV.10.34.d IRCs are able to load human CMV viral epitopes onto human tumor cell MHC receptors in HCT116 cells.
  • FIG. 20B is a flow cytometer histogram of cell count vs. fluorescence intensity showing detection of the tumor cell surface cell count of CMV (NLAPMVATV) (SEQ ID NO: 129) /HLA-A*0201 (MHC-I) complex.
  • FIG. 21A is a flow cytometer histogram of cell count vs.
  • FIG. 21B is a flow cytometer histogram of cell count vs. fluorescence intensity showing detection of the competitive inhibition of binding of OVA-conjugated MPV.10.34.d IRCs to MC38 tumor cells with 5 mg/mL soluble heparin (dashed line) pre-mixed into the sample.
  • FIG. 21C is a flow cytometer histogram of cell count vs. fluorescence intensity showing detection of the competitive inhibition of binding of OVA-conjugated MPV.10.34.d IRCs to MC38 tumor cells with 1 mg/mL soluble heparin (dashed line) pre-mixed into the sample.
  • the solid line is a negative control showing no OVA peptide loading.
  • FIG. 22A is a flow cytometer histogram of cell count vs. fluorescence intensity showing that furin inhibitor at concentration of 50 ⁇ M prevents OVA-conjugated MPV.10.34.d IRCs from loading OVA epitopes onto tumor cell MHC receptors (arrow pointing to dark line). Samples include untreated cells (thin line) or cells treated only with dimethyl sulfoxide (DMSO) and no furin inhibitor (dashed line), and negative control (thin line).
  • FIG. 22B is a flow cytometer histogram of cell count vs.
  • FIG. 22C is a flow cytometer histogram of cell count vs. fluorescence intensity showing that furin inhibitor at concentration of 0.5 ⁇ M prevents OVA-conjugated MPV.10.34.d IRCs from loading OVA epitopes onto tumor cell MHC receptors (arrow pointing to dark line).
  • FIG.23A is a bar graph showing that OVA-conjugated MPV.10.34.d IRCs elicit an immune redirection of OVA-specific murine T-cells similar to OVA-conjugated HPV16 IRC in murine tumor cell line ID8-Luc.
  • FIG.23B is a bar graph showing that OVA-conjugated MPV.10.34.d IRCs elicit an immune redirection of OVA-specific murine T-cells similar to OVA-conjugated HPV16 IRC in murine tumor cell lines B16-Luc.
  • FIG. 24A is a bar graph showing that E7-conjugated HPV16 IRCs elicit an immune redirection of OVA-specific murine T-cells similar to OVA-conjugated HPV16 IRC in murine tumor cell line ID8-Luc.
  • FIG. 24A is a bar graph showing that E7-conjugated HPV16 IRCs elicit an immune redirection of OVA-specific murine T-cells similar to OVA-conjugated HPV16 IRC in murine tumor cell line ID8-Luc.
  • FIG. 24B is a bar graph showing that E7-conjugated HPV16 IRCs elicit an immune redirection of OVA-specific murine T-cells similar to OVA-conjugated HPV16 IRC in murine tumor cell lines B16-Luc.
  • FIG. 25A is a bar graph showing that human CMV-conjugated MPV.10.34.d IRCs elicit an immune redirection of CMV-specific CD8 T-cells similar to CMV-conjugated HPV16 IRCs in human tumor cell line HCT-116.
  • FIG. 25A is a bar graph showing that human CMV-conjugated MPV.10.34.d IRCs elicit an immune redirection of CMV-specific CD8 T-cells similar to CMV-conjugated HPV16 IRCs in human tumor cell line HCT-116.
  • FIG. 25B is a bar graph showing that human CMV-conjugated MPV.10.34.d IRCs elicit an immune redirection of CMV-specific CD8 T-cells similar to CMV-conjugated HPV16 IRCs in human tumor cell line Ovarcar3.
  • FIG. 25C is a bar graph showing that human CMV-conjugated MPV.10.34.d IRCs elicit an immune redirection of CMV-specific CD8 T-cells similar to CMV-conjugated HPV16 IRCs in human tumor cell line MCF7.
  • FIG.26 is a graph demonstrating high statistical correlation of binding of OVA- conjugated MPV.10.34.d IRCs to tumor cells and peptide loading of OVA (SIINFEKL, SEQ ID NO: 95) onto tumor cell surface MHC-I molecules via OVA-conjugated MPV.10.34.d IRCs.
  • FIG. 27A is a graph of percent cytotoxicity vs. E:T ratio showing blocking of binding of 0.625 ⁇ g/mL OVA-conjugated MPV.10.34.d IRCs by incubation with heparin at concentration of 10 mg/mL, an immune redirection response of OVA-specific murine T-cells was not elicited (dashed line).
  • FIG. 27B is a graph of percent cytotoxicity vs. E:T ratio showing blocking of binding of 0.3125 ⁇ g/mL OVA-conjugated MPV.10.34.d IRCs by incubation with heparin at concentration of 10 mg/mL, an immune redirection response of OVA-specific murine T-cells was not elicited (dashed line).
  • the dotted line represents a negative control of MPV.10.34.d capsid backbones.
  • the solid line represents the positive control sample with no heparin.
  • FIG.28 is a table of data obtained from a dose titration of the cell-binding assays and cytotoxicity assays. The study was repeated twice (with at least 3 replicates each).
  • FIG.29 is a graph of percent cytotoxicity vs. MFI demonstrating high statistical correlation of OVA-conjugated MPV.10.34.d IRC binding and cytotoxicity.
  • FIG. 30A is a graph of percent cytotoxicity vs.
  • FIG. 30B is a graph of percent cytotoxicity vs. E:T ratio showing that co- incubation of GARDASIL®9-vaccinated sera (1:200) with OVA-conjugated MPV.10.34.d IRCs at 2.5 ⁇ g/mL did not inhibit immune redirection of OVA-specific murine T-cells.
  • FIG. 30B is a graph of percent cytotoxicity vs. E:T ratio showing that co- incubation of GARDASIL®9-vaccinated sera (1:200) with OVA-conjugated MPV.10.34.d IRCs at 0.625 ⁇ g/mL did not inhibit immune redirection of OVA-specific murine T-cells.
  • FIG. 30C is a graph of percent cytotoxicity vs.
  • FIG.31A is a graph of absorbance at 450 nm vs. dilution factor of data obtained from two ELISA assays testing the effect of incubation of anti-MPV.10.34.d sera with MPV.10.34.d on binding to target tumor cells.
  • FIG.31B is a graph of absorbance at 450 nm vs.
  • FIG. 32A is a graph of percent cytotoxicity vs. E:T ratio showing that co- incubation of MPV-specific sera (1:200) with OVA-conjugated MPV.10.34.d IRC at 2.5 ⁇ g/mL did not inhibit immune redirection of OVA-specific murine T-cells.
  • FIG. 32B is a graph of percent cytotoxicity vs.
  • FIG. 32C is a graph of percent cytotoxicity vs. E:T ratio showing that co- incubation of MPV-specific sera (1:200) with OVA-conjugated MPV.10.34.d IRC at 0.156 ⁇ g/mL did not inhibit immune redirection of OVA-specific murine T-cells.
  • FIG. 32D is a graph of percent cytotoxicity vs.
  • FIG. 32E is a graph of percent cytotoxicity vs.
  • FIG. 32F is a graph of percent cytotoxicity vs.
  • FIG.33A is a table of data corresponding to data graphed in Fig.32A, 32B, and 32C, showing detection of the binding of OVA-conjugated MPV.10.34.d IRC to tumor cells under different sample concentrations in the presence of MPV serum (1:200) dilution.
  • FIG.33B is a table of data corresponding to data graphed in Fig.32D, 32E, and 32F, showing detection of the binding of OVA-conjugated MPV.10.34.d IRC to tumor cells under different sample concentrations in the presence of anti-MPV.10.34.d IRC serum (1:200) dilution.
  • FIG. 34 is a graph of geometric mean fluorescence intensity vs. concentration of OVA-conjugated MPV.10.34.d IRCs (ng/mL) detecting tumor cell surface display of OVA(SIINFEKL, SEQ ID NO: 95) / Kb (MHC-I) complex.
  • the terms “comprise,” “comprises,” “comprising,” “contain,” “contains,” “containing,” “have,” “having,” “include,” “includes,” and “including,” and their variants, are not intended to be limiting, are inclusive or open-ended, and do not exclude additional, unrecited additives, components, integers, elements, or method steps.
  • a process, method, system, composition, kit, or apparatus that comprises a list of features is not necessarily limited only to those features but may include other features not expressly listed or inherent to such process, method, system, composition, kit, or apparatus.
  • “About” is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value.
  • “Immune redirector capsid” or “IRC” as used herein is a capsid backbone that also comprises a peptide bound, attached, or conjugated, to the capsid backbone.
  • “Cleavage sequence” as used herein includes, for example, specific peptide sequences, or more often, peptide motifs at which site-specific proteases cleave or cut the protein. Cleavage sites are used, for example, to cleave off an affinity tag, thereby restoring the natural protein sequence, or to inactivate a protein, or to activate proteins.
  • cleavage refers to proteolytic cleavage.
  • proteolytic cleavage is catalyzed by peptidases, proteases, or proteolytic cleavage enzymes before the final maturation of the protein. Proteins are also known to be cleaved as a result of intracellular processing of, for example, misfolded proteins. Another example of proteolytic processing of proteins is secretory proteins or proteins targeted to organelles, which have their signal peptide removed by specific signal peptidases before release to the extracellular environment or specific organelle.
  • the cleavage sequence is specifically recognized by furin which cleaves and releases the peptides from the IRC, making the peptide available for loading onto or binding by the tumor cell surface receptors.
  • the cleavage sequence is comprised of cysteine, lysine, and/or arginine residues, that not only allow the peptide to be cleaved from the capsid backbone, but also serve as anchors to conjugate the peptide to the capsid protein until release by the cleavage protein, such as furin, which are in some instances enriched in, or selectively present at, the site of the tumor, i.e., in the tumor microenvironment.
  • Epitope or “antigen” or “antigenic epitope” is a set of amino acid residues that create recognition by or are recognized by a particular immunoglobulin or, in the context of T cells, those residues necessary for recognition by T cell receptor proteins and/or major histocompatibility (MHC) receptors.
  • MHC major histocompatibility
  • an epitope are in some instances a composite of the collective features of a molecule, such as primary, secondary, and tertiary peptide structure, and charge, that together form a three-dimensional structure recognized by an immunoglobulin, T cell receptor, and/or human leukocyte (HLA) molecule.
  • HPV human papillomavirus
  • HPV human papillomavirus
  • HPV HPV
  • MMuPV1 MMuPV1
  • MPV mouse papillomavirus
  • Human vaccine as used herein means a biological preparation that improves immunity to a particular disease in a human.
  • a vaccine typically contains an antigenic agent(s) that resembles a disease-causing agent (pathogen), and is often made from weakened or killed forms of the microbe, its toxins, or one or multiple immunogenic surface proteins of the disease-causing agent.
  • the antigenic agent stimulates the body's immune system to recognize the disease-causing agent as foreign, destroy it, and "remember” it, so that the immune system can more easily recognize and destroy any of these pathogens should an actual future infection/exposure occur.
  • Human vaccines include vaccines against viral diseases and bacterial diseases.
  • vaccines against viral diseases include hepatitis A, B, E virus, human papillomavirus, influenza virus, Japanese encephalitis virus, measles virus, mumps virus, polio virus, rabies virus, rotavirus, rubella virus, tick-borne encephalitis virus, varicella zoster virus, variola virus, and yellow fever virus.
  • Human vaccines against viral diseases that are under development include, for example, dengue vaccine, eastern equine encephalitis virus, HTLV-1 T lymphocyte leukemia vaccine, and respiratory syncytial virus vaccine.
  • Such a vaccine includes, in some embodiments, current vaccines in development or currently United States Food and Drug Administration (FDA)-approved vaccinations.
  • FDA United States Food and Drug Administration
  • MHC or “major histocompatibility complex” is a group of genes that encode proteins found on the surfaces of cells that help the immune system recognize foreign substances. MHC proteins (receptors, or molecules) are expressed by all higher vertebrates. There are two main types of MHC molecules, MHC class I and MHC class II. In humans there are three different genetic loci that encode MHC class I molecules (the MHC-molecules of the human are also designated human leukocyte antigens (HLA)): HLA-A, HLA-B, and HLA-C. HLA-A*0l, HLA-A *02, and HLA-A * 11 are examples of different MHC class I alleles that can be expressed from these loci.
  • HLA human leukocyte antigens
  • PV Papillomavirus
  • PV refers to all members of the papillomavirus family (Papillomaviridae).
  • An extensive list of papillomavirus types and the ability to make the respective capsid backbones can be referenced using this publication: “Classification of papillomaviruses (PVs) based on 189 PV types and proposal of taxonomic amendments,” de Villers et al., 401(1):70-79, 2010, PMID: 20206957 (all the tables specifically incorporated herein by reference for all purposes).
  • Preferentially cleaved protein as used herein means that the peptide is preferentially cleaved from the capsid or capsomere or L1 protein at the site of a tumor or tumor microenvironment.
  • the preferential tumor-site cleavage is in some instances due to: (1) the unique cleavage sequence on the peptide, and/or (2) the unique tumor microenvironment.
  • the peptide comprises a cleavage sequence that is preferentially cleaved by the enzyme furin, which is known to be expressed in relatively higher concentrations around tumor cells as compared with elsewhere in an organism.
  • Protein “Protein,” “polypeptide,” and “peptide,” as used herein, are not restricted to any particular number of amino acids; these terms are sometimes used interchangeably herein.
  • the properties and amino acid sequences of the proteins described herein, and of the nucleic acids encoding them, are well-known and are determined routinely, as well as downloaded from various known databases. (See, e.g., the NCBI GenBank databases). Some peptide sequences are provided herein. However, some peptide sequence information is routinely updated, e.g., to correct mistakes in the previous entries, so updated (corrected) information about the proteins and nucleic acids encoding them is included in this application. Information provided in the sequence databases discussed herein is incorporated by reference.
  • An immune “response” is a humoral and/or cellular response of the subject’s immune system in which, in a cellular response, an antigen-primed cytotoxic T cell, Th1 T cell, Th2 T cell, and/or B cells primed by a vaccine or other pathogen present in the subject, or that the subject was previously exposed to, binds the epitope or antigen.
  • the term “preexisting immune response” as used herein means an immune response that is present in an individual prior to initiation of the inventive cancer treatment methods described herein.
  • an individual having a preexisting immune response has an immune response capacity stored within their memory T cells or other immune system components against an antigen, prior to the initiation of a method of treatment as described herein with the antigen to treat cancer.
  • a preexisting immune response is in some instances a naturally-occurring immune response. In other instances, the preexisting immune response is an induced immune response.
  • a naturally-occurring preexisting immune response is an immune response in an individual that was elicited in response to an antigen, such as a bacterial, fungal, parasitic, or viral antigen, with which the individual unintentionally contacted or contracted.
  • an individual having a preexisting immune response was, in some instances, not exposed to an antigen with the intent to generate an immune response to the antigen.
  • An induced preexisting immune response is an immune response resulting from an intentional exposure to an antigen, such as when receiving a vaccine.
  • the preexisting immune response is in some instances a naturally-occurring immune response, or in other instances the preexisting immune response is an induced immune response.
  • T cell response refers to the immune response elicited by T cells as they encounter antigens. Na ⁇ ve mature T cells are activated upon encountering antigen presented by B cells, macrophages, and dendritic cells, and then thereby produce armed effector T cells. Effector T cells are, in some instances, either CD8+ T cells that differentiate into cytotoxic T cells, or CD4+ T cells that primarily induce the humoral immune response.
  • the T cell immune response further generates immunological memory that gives protection from the subsequent challenge of the subject by the same or a similar pathogen comprising the same or similar epitopes.
  • the T cell response is at a threshold of at least 2-fold above the baseline of total CD8+ T cells.
  • the CD8+ T cells are CD69+ as well.
  • "Therapeutic compositions” are compositions that are designed and administered to patients for the use of treatment of a disease, such as cancer. Therapeutic compositions, e.g., therapeutic IRC-containing compositions, are used to treat benign or malignant tumors or patients/subjects at risk for such tumors, as well as non-solid cancers.
  • the IRCs are administered to a subject who previously had a tumor and is currently apparently tumor/cancer free, in an effort to enhance the inhibition or the recurrence of the tumor/cancer.
  • “Capsid backbone” refers to a multi-protein structure comprised of viral structural proteins, such as envelop or capsid proteins, such as an L1 protein, that in some instances self-assemble into a capsomere that resembles a virus but lack viral genetic material. Capsid backbones are non-infectious and non-replicating, yet morphologically similar to viruses. The capsid backbones disclosed herein bind to, or possess an inherent tropism for, tumor cells.
  • Viruses exist in many different morphologies and are generally smaller in size than bacteria, with a diameter between 20 nm and 300 nm, although some filoviruses possess filament lengths of up to 1400 nm. Visualization of viruses or virus capsid backbones requires transmission electron microscopes (TEM) that are more powerful than optical microscopes. Viruses are particle in shape and exist as virions having a nucleic acid surrounded by a protective coat of proteins called the capsid. These capsids are also in turn in some instances surrounded by a protective lipid bilayer that may include surface proteins, receptors, and the like. [0107] Capsids are formed from a plurality of identical capsomeres.
  • Capsids generally fall into helical or icosahedral structures, with the exception of bacteriophages that possess more complex structures.
  • the most common icosahedral shape is composed of 20 equilateral triangular faces and resembles a three-dimensional sphere in overall shape.
  • Helical capsids resemble a common spring shape in the form of a three-dimensional cylinder.
  • Each face of the capsid is comprised of anywhere from one to three different proteins or monomer units (protomers).
  • Capsids when not surrounding papillomavirus genomes, are commonly referred to in the art as virus-like particles, or herein referred to as capsid backbones.
  • Capsid backbones are excellent delivery molecules for treatment and/or prevention of various diseases, especially in the human body, because they are non-infectious and are optionally re-engineered to specifically target or bind to tumor cells, although most capsid backbone, as described above, possess an inherent tissue tropism without further engineering.
  • Capsomeres are formed from individual subunits or protomers. Native L1 protomers self-assemble through intermolecular disulfide bonds to form pentamers (capsomeres). As noted above, the capsid is comprised of many capsomeres.
  • capsomere is intended to mean a pentameric assembly of papillomavirus L1 polypeptides, including full-length L1 protein, or fragments and mutants thereof.
  • a standard icosahedral capsid is comprised of twenty faces and is a polyhedron including twelve vertices. The vertices are comprised of pentagonal capsomeres and the faces of the capsid are comprised of hexagonal capsomeres. There are always twelve pentagons (pentons) and a varying number of hexagons (hexons) in any given capsid depending on the virus type.
  • Capsids that do not have an exogenous peptide attached thereto are termed “capsid backbones” herein.
  • the icosahedral structure found in most viruses is very common and consists of twenty triangular faces and twelve fivefold vertexes as noted above.
  • the number of capsomeres included in a capsid follows well-known mathematical principles, such as found in the Goldberg polyhedron first described by Michael Goldberg in 1937.
  • the structures can be indexed by two integers h and k, with h being greater than or equal to one and k being greater than or equal to zero, the structure is visualized by taking h steps from the edge of a pentamer, turning 60 degrees counter-clockwise, then taking k steps to get to the next pentamer.
  • icosahedral capsids contain twelve pentamers plus 10(T ⁇ 1) hexamers. (See, Carrillo-Tripp, et al., Nuc. Acids Res., 37(Database issue):D436-D442, 2009).
  • T the “T” number, or triangulation number, is representative of the size and complexity of a given capsid.
  • viruses are enveloped and further comprise a lipid membrane coating surrounding the capsid structure.
  • the envelope is acquired from the host intracellular membrane.
  • the nucleic acid material is either DNA or RNA and can be either single stranded or double stranded.
  • the Papillomaviridae family of viruses is a non-enveloped double-stranded DNA virus. There are several hundred family members within the Papillomaviridae family, each of which is referred to as a “type” that infect most known mammals and other vertebrates such as birds, snakes, turtles, and fish.
  • the Papillomaviridae family members are considered to be relatively highly host- and tissue-tropic, meaning that its members usually possess a specific tissue tropism (preference for infection target) and a preference for host type, and are rarely transmitted between species.
  • tissue tropism preference for infection target
  • HPV human papillomavirus
  • HPV type 2 prefers tissues in the palms of the hands.
  • Papillomaviruses replicate exclusively in keratinocytes.
  • the papillomavirus has but a single protomer called L1 protein, or major capsid protein L1, that is both necessary and sufficient to form its capsid which is comprised of 72 star-shaped capsomers.
  • L1 protein or major capsid protein L1
  • the papillomavirus family member capsids are non-enveloped and icosahedral.
  • the papillomavirus genome also includes a second structural protein called L2 that is less abundantly expressed than L1.
  • L2 is less abundantly expressed than L1.
  • the presence of L2 in the capsid is optional and not necessary for virus function or for formation of the capsid.
  • All of the capsomeres of the Papillomaviridae family are made of pentamer interactions between proteins. [0114] As described herein, when describing mutant L1 proteins and the like, such mutants, and capsomers, and capsids made therefrom, are meant to include all Papillomaviridae family members and not just human or mouse family members. Thus, mutant L1 proteins as described herein are meant to encompass all L1 proteins in general, and in some instances specifically Papillomaviridae family L1 proteins in particular.
  • the overall structure of the papillomavirus L1 protein is presented in Figure 1A and Figure 1B and has a tertiary structure consisting generally of various secondary structures including a core of ⁇ -strands that form a classic “jelly roll” ⁇ -sandwich and five C-terminal ⁇ - helices that support five surface-exposed loop regions generally designated in the art as loops BC, DE, EF, FG, and HI. (See, Chen et al., Mol. Cell, 5:557-567, 2000, and Bissett et al., Scientific Reports, 6:39730, 2016).
  • h2, h3, and h4 form the surface of contact with other monomers and pentamers ( Figure 1B).
  • the five ⁇ -helices generally reside at the carboxy-terminus of the L1 sequence.
  • Design and Production of Mutant L1 Proteins [0118] Deletions of the MPV L1 sequence were made to facilitating the formation of 10 nm to 15 nm capsomeres made from five L1 proteins. It was previously shown that truncation of the amino-, helix-four, and carboxy-terminus residues of the HPV16 L1 protein results in capsomere formation. (See, Bishop et al., Virol.
  • T 1 icosahedral capsid backbones.
  • MPV L1 proteins were selected as the carrier vehicle construct instead of HPV L1 because humans have for the most part not been exposed to MPV and therefore it was postulated that virion-derived capsids from MPV would not be sensitive to innate immune response as is seen with HPV L1 proteins.
  • L1 proteins comprising the ⁇ N10 deletion were generated with a specific deletion of helix 4 for both HPV16 (residues 408 to 431) and HPV11 (residues 409 to 429).
  • mutant L1 protein means an L1 protein or protomer comprising one or more non-wild type sequences.
  • non-wild type sequences include truncations or deletions (internal or at the ends of the sequences), single residue substitutions, and the like.
  • a mutant L1 protein includes an L1 protein in which any of the following are true: 1) a certain number of the N-terminal residues are deleted, a certain number of the C-terminal residues are deleted, and/or 3) a certain number of internal residues are deleted, in some instances in more than one location internally within the sequence.
  • the mutant L1 protein is in some embodiments derived from a wild type papillomavirus L1 protein.
  • papillomavirus L1 protein is useful in the presently described compositions. L1 protein sequences are relatively conserved. Thus, description of mouse papillomavirus mutant L1 proteins, below, are exemplary and it is contemplated that the same mutations made in other L1 proteins of the papillomavirus family is expected to yield similar results.
  • a capsid backbone is provided comprising a papillomavirus L1 protein and/or a papillomavirus L2 protein.
  • the capsid backbone in some embodiments comprises both papilloma L1 and L2 proteins. In other embodiments, the capsid backbone is comprised of only L1 proteins.
  • the L1 protein is a hybrid or chimeric protein comprised of L1 sequences from more than one source merged together into a single L1 sequence.
  • the L1 protein sequences are known for substantially all papillomavirus genotypes identified to date, and any of these L1 sequences or fragments are contemplated as being included in the present compositions.
  • L1 polypeptides include, without limitation, full-length L1 polypeptides, e.g., HPV16 L1 polypeptide, SEQ ID NO: 128, L1 truncations that lack any one or more residues of the native C-terminus, L1 truncations that lack any one or more residues of the native N-terminus, and L1 truncations that lack any one or more internal domain residues in any one or more internal locations.
  • the L1 protein is in some instances exemplified as a modified L1 protein, e.g., a modified HPV16 or MPV16 L1 protein, wherein the HPV16 L2 amino acids 17 to 36 (the RG1 epitope) are inserted within the DE-surface loop of HPV16 L1.
  • a modified L1 protein e.g., a modified HPV16 or MPV16 L1 protein, wherein the HPV16 L2 amino acids 17 to 36 (the RG1 epitope) are inserted within the DE-surface loop of HPV16 L1.
  • the L2 polypeptide is in some embodiments full-length L2 protein or an L2 polypeptide fragment.
  • the L2 sequences are known for substantially all papillomavirus genotypes identified to date, and any of these L2 sequences or fragments can be employed in the present disclosure.
  • L2 polypeptides include, without limitation, full-length L2 polypeptides, e.g., HPV16 L2 polypeptide (SEQ ID NO: 1), or mouse papillomavirus L2 (SEQ ID NO: 2), L2 truncations that lack any one or more of the native C-terminus, L2 truncations that lack any one or more of the native N-terminus, and L2 truncations that lack any one or more internal domain residues in any one or more locations.
  • the papillomavirus capsid backbone is in some embodiments formed using the L1 and optionally L2 polypeptides from any animal papillomavirus, or derivatives or fragments thereof.
  • any known (or hereafter identified) L1 and optionally L2 sequences of human, bovine, equine, ovine, porcine, deer, canine, feline, rodent, rabbit, etc., papillomaviruses are employed to prepare the capsid backbones described herein. (See, de V Amsterdam et al., Virology, 324:17-27, 2004, for a current description of papillomavirus genotypes and their relatedness, incorporated herein by reference for all purposes).
  • the L1 and optionally L2 polypeptides that are used to form the capsid backbones are from a non-human papillomavirus or a human papillomavirus genotype other than HPV6, HPV11, HPV16, and HPV18.
  • the L1 and/or L2 proteins are in some embodiments from HPV 1, 2, 3, 4, 5, 6, 8, 9, 15, 17, 23, 27, 31, 33, 35, 38, 39, 45, 51, 52,58, 66, 68, 70, 76, or 92.
  • L1 and optionally L2 polypeptides that are used to form the capsid backbones are from a non-human papillomavirus or a human papillomavirus genotype other than HPV6, HPV11, HPV16, and HPV18.
  • the L1 and/or L2 proteins are in some embodiments from HPV 1, 2, 3, 4, 5, 6, 8, 9, 15, 17, 23, 27, 31, 33, 35, 38, 39, 45, 51, 52,58, 66,
  • the L1 mutant proteins described herein include N-terminal truncation L1 mutant proteins. The N terminus is truncated by at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids.
  • the N-terminal truncation is 5 amino acids. In some embodiments the N-truncation is 10 amino acids. In some embodiments the N-terminal truncation is 37, 38, 39, or even 40 amino acids.
  • the L1 mutant proteins described herein further include C-terminal truncation L1 mutant proteins. The C terminus is truncated by at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids. In some embodiments the C-terminal truncation is 5 amino acids. In some embodiments the C-truncation is 10 amino acids. [0131] The L1 mutant proteins described herein further include L1 mutants in which any number of internal residues are deleted.
  • the internal residues deleted in the described mutant L1 proteins are those shown in Figures 1 and 2.
  • Contemplated also are deletions of 34 residues in the helix 4 (H4) region.
  • the truncation of internal residues of L1 proteins is 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or even 40 residues in length.
  • L1 mutant proteins in which any one or more of the C-terminus and/or N-terminus and/or internal residues are deleted simultaneously.
  • the mutant L1 protein has both C- and N-terminal truncation mutations of similar or varying length.
  • the mutant L1 protein has a C- terminal truncation and an internal residue truncation.
  • the mutant L1 protein has an N-terminal truncation and an internal truncation.
  • the mutant L1 protein has truncations simultaneously in all three locations, C-terminus, N- terminals, and internal truncations.
  • mutant L1 proteins described herein are generally produced recombinantly but are also produced by any known protein expression methodology.
  • the mutant L1 proteins are generated by first designing DNA primers complimentary to the wild type L1 sequence and then performing PCR amplification of the sequence in the presence of the primers designed to truncate or otherwise mutate the wild type L1 sequence, as further explained in detail below, in the Examples section. (See also, Touze et al., J. Clin. Microbiol., 36(7):2046- 2051, 1998).
  • the design and implementation of proper primer sequences and PCR protocols are known and such methods are used to ultimately generate the desired mutant L1 protein nucleic acid sequence, from which the mutant L1 proteins are expressed.
  • mutant L1 protein nucleic acid sequence is then in some embodiments codon-optimized for better protein expression and production depending on the organism in which the expression is conducted. Utilization of different codon optimization methods for certain expression vectors and host expression systems are known in the art. (See, Mauro and Chappell, Trends in Molecular Medicine, 20(11):604-613, 2014, for instance). [0135] The mutant L1 protein nucleic acid sequence is then ligated into an acceptably prepared and commercially-available expression vector designed for protein expression. Expression vectors of various types possessing functionality for certain expression hosts are widely commercially available. Recombinant mutant L1 proteins described herein are expressed in bacterial as well as eukaryotic cells and in certain embodiments are expressible in vitro.
  • IBs inclusion bodies
  • recombinant mutant L1 protein expressed as IBs are solubilized using known procedures.
  • the solubilization of IBs of expressed mutant L1 proteins described herein includes the steps set forth, for instance, in Figure 3, and Example 3.
  • the processes include various steps, such as: (a) transforming a prokaryotic cell with an expression vector encoding the L1 protein; (b) culturing the transformed prokaryotic cell under conditions that promote expression of the L1 protein; (c) lysing the transformed prokaryotic cells to release expressed L1 protein; (d) separating cell debris from the expressed L1 protein and recovering the L1 protein in the form of IBs; (e) optionally washing the L1 protein IBs; (f) solubilizing the L1 protein IBs; (g) refolding the L1 protein optionally in the presence of one or more denaturants, reducing agents, and the like; and (h) forming the icosahedron or dodecahedron capsid having a triangulation number T equal to 1 by incubating the refolded L1 protein in assembly buffer.
  • Such processes further include conjugating in a conjugation buffer the one or more peptides to the assembled L1 protein by incubating the assembled L1 protein under reducing conditions in the presence of one or more peptides and/or removing denaturant from the conjugation buffer but maintaining reducing agent when forming the icosahedron or dodecahedron capsid having a triangulation number T equal to 1.
  • the described methods and processes for creating and purifying the described mutant L1 proteins is different in many aspects from such processes described in the art for assembly of papillomavirus capsids.
  • the efficiency with which the mutant capsid backbone, e.g., the MPV.10.34.d backbone, is able to be conjugated with peptide is from 25 to 85% (w/w). In some embodiments, the conjugation efficiency is about 25%. In other embodiments, the conjugation efficiency is about 25, about 35, about 45, about 55, about 65, about 75, or even about 85% (w/w).
  • mutant L1 protein is conjugated to another peptide.
  • additional peptides are conjugated to the surface of such capsids. These peptides add beneficial functionality to the capsid and result in added functionality such as treatment of cancer in subjects in need thereof.
  • the conjugated papillomavirus capsid backbone comprises an L1 capsid protein and a peptide.
  • the IRC comprises an (at least one) L1 capsid protein, an (at least one) L2 capsid protein, and at least one peptide.
  • the L1 polypeptide is in some embodiments a full length L1 protein or in other embodiments is an L1 polypeptide fragment.
  • the full-length L1 protein or L1 polypeptide fragment is capsid backbone assembly-competent; that is, the L1 polypeptide will self- assemble to form capsomeres under proper conditions that are competent for self-assembly into higher-order structural geometries, thereby forming a capsid backbone.
  • the capsid backbones comprise a fully assembled papillomavirus capsid, a structure of about 50 nm and composed of 72 capsomeres or 360 copies of L1 protein.
  • the IRC presented herein bind to, specifically or non- specifically, or otherwise contact, one or more cancer cells. This is in part due to the capsid backbone’s selectivity (tropism) for proteins and/or molecules that are in some instances specific to, or expressed in higher abundance by, tumor cells.
  • the IRC binds to a certain sub-family type of heparin sulfate proteoglycan (HSPG), which is preferentially expressed on tumor cells.
  • HSPG heparin sulfate proteoglycan
  • binding to a cancer cell refers to the formation of non-covalent interactions between the capsid protein of the IRC and the tumor cell such that the IRC comes into close proximity to the tumor cell and the peptide is cleaved from the capsid backbone, and then the peptide binds to, or is bound by, or otherwise interacts with, the MHC receptor present on the tumor cell surface.
  • the peptide is an epitope that is recognized by a T cell or T cell population that already exists in the subject. In various embodiments, this existing T cell or T cell population exists because of a prior infection or vaccination. In various embodiments, the peptide is an epitope that is capable of being bound by a T cell.
  • the peptide is an epitope capable of being bound by a T cell already present in a subject.
  • “capable of being bound” means that an "epitope" is presented on the surface of a cell, where it is bound to MHC molecules.
  • T cell epitopes presentable by MHC class I receptors are bound by the T cell receptor of cytotoxic CD8 T lymphocytes (CD8 T cells or CTLs).
  • T cell epitopes presentable by MHC class I molecules are typically peptides of about 9 to about 12 amino acids in length.
  • an IRC that releases a T cell response-eliciting peptide that upon release is directly bound by and consequently appropriately presentable by one or more MHC molecules expressed on the surface of one or more cancer or tumor cells.
  • the T cell response-eliciting peptides are presented on the surface of the target cell in a short amount of time. The process of release of such peptides from the IRC and subsequent binding of the peptides by the MHC molecules of target cells is akin to labelling, tagging, or otherwise “marking” these tumor or cancer cells.
  • the IRC in less than about 8.5 hours after administration of the IRC dose to the subject, the IRC will naturally migrate to the target cell after which the T cell response-eliciting peptide released from the IRC, is bound by the MHC molecule on the cancer cell, and then the peptide is presented on the surface of the target cell via an MHC class I molecule to other components of the subject’s immune system for recognition thereby.
  • the T cell response eliciting peptide is presented on the surface of the target cell via an MHC class I molecule.
  • the IRC is capable of mediating T cell cytotoxicity against the target cell within less than 6 hours after administration of the IRC to the target cell.
  • the peptide comprises one epitope or comprises at least two epitopes. The peptide epitopes are in some instances derived from different proteins, or in other embodiments they are epitopes from the same protein (or antigen).
  • the pathogen is a virus, a bacterium, a fungus, a parasite, or a combination thereof.
  • the subject’s preexisting T cells are specific to a vaccine epitope.
  • the epitope is derived from a childhood, early childhood, adolescent, or elderly (geriatric), vaccine.
  • the subject’s preexisting immunity is the result of prior administration of a human vaccine.
  • Antigens described herein that comprise epitopes incorporated into the peptides described herein are found in any of the known infectious agents, such as viruses, bacteria, parasites, fungi, and the like.
  • the peptide is selected from the list provided by Table 2.
  • viruses from which antigens bearing epitopes that are incorporated in some embodiments into the described peptides include, for instance, a vaccinia virus, a varicella zoster virus, a herpesvirus, e.g., herpes zoster virus or cytomegalovirus or Epstein-Barr virus, rubella, a hepatitis virus, e.g., hepatitis A virus or hepatitis B virus or hepatitis C virus, influenza, e.g., type A or type B, a measles virus, a mumps virus, a polio virus, a variola (smallpox) virus, a rabies virus, a coronavirus, Dengue virus, an Ebola virus, a West Nile virus, a yellow fever virus, or a zika virus.
  • a vaccinia virus e.g., a varicella zoster virus, a herpesvirus,
  • non-limiting examples of a bacteria from which antigens bearing epitopes that are incorporated in some embodiments into the described peptides include, for example, a Bordetella pertussis, chlamydia, trachomatis, Clostridium tetani, diphtheria, Hemophilus influenza, Meningococcus, pneumococcus, vibrio cholera, Mycobacterium tuberculosis, BCG, typhoid, E.
  • non-limiting examples of a parasite from which antigens bearing epitopes that are incorporated in some embodiments into the described peptides include, Entamoeba histolytica, Toxoplasma gondii, a Trichinella sp., e.g., Trichinella spiralis, a Trichomonas sp., e.g., Trichomonas vaginalis, a Trypanosoma sp., e.g., Trypanosoma brucei gambiense, Trypanosoma brucei rhodesiense, or a Trypanosoma cruzi, or a plasmodium, e.g., Plasmodium falciparum, Plasmodium vivax, or Plasmodium malariae.
  • Table 2 Epitope Peptide Sequences
  • the epitope is found in one or more known human vaccines, such as a childhood vaccine, early childhood, adolescent, or elderly (geriatric), vaccine.
  • the vaccine is an early childhood vaccine.
  • suitable vaccines from which such epitopes are found that are compatible with the described peptides are listed in Table 3.
  • Table 3 Human Vaccines Containing Peptide-Compatible Epitopes [0154]
  • the epitope is released following proteolytic cleavage of the peptide from the IRC. After proteolytic cleavage of the peptide from the IRC, the epitope binds to an MHC, optionally an MHC class I, molecule.
  • the MHC molecule is in some embodiments from the HLA-A, B, and/or HLA C families.
  • the specific epitope that binds to the MHC class I molecule is any of those recited in Table 2 or Table 3 or found elsewhere in the art.
  • the MHC class I molecule itself is, in some embodiments, one or more of the following non-limiting examples: HLA-A*02:01, HLA-A*03:01, HLA-A*11:01, HLA-A*201, HLA- A*020101, HLA-A*0203, HLA-A*0206, HLA-A2, HLA-A2.1, or HLA-A*02.
  • the epitope is about 8 amino acid to about 50 amino acids in length, or about 8 amino acid to about 45 amino acids in length, or about 8 amino acid to about 40 amino acids in length, about 8 amino acid to about 35 amino acids in length, or about 8 amino acid to about 30 amino acids in length, about 8 amino acid to about 25 amino acids in length, about 8 amino acid to about 20 amino acids in length, or is about 8 amino acid to about 15 amino acids in length.
  • the peptide is about 13 amino acid to about 50 amino acids in length, or about 13 amino acid to about 45 amino acids in length, or about 13 amino acid to about 40 amino acids in length, about 13 amino acid to about 35 amino acids in length, or about 13 amino acid to about 30 amino acids in length, about 13 amino acid to about 25 amino acids in length, about 13 amino acid to about 20 amino acids in length, or is about 13 amino acid to about 15 amino acids in length.
  • the CD8+ T cell epitope is, e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or about 17 amino acids in length.
  • one or more protease cleavage sequences are incorporated into the IRC that, upon cleavage, allows the peptide to be released from the IRC so that the peptide then is free to bind to the MHC on the tumor or cancer cell surface.
  • the IRC must escape the endosome, disassemble, and release their therapeutic cargo to the cytosol in a functional form.
  • the IRC and/or peptide of the IRC is susceptible to cleavage by a proteolytic enzyme within the tumor microenvironment, i.e., in the nearby interstitial space surrounding tumors or tumor cells, and the position of the target cleavage sequence in the IRC or peptide is such that the cleavage of the target site releases all or a portion of the peptide comprising the CD8+ T cell epitope from the IRC, which then is free to bind to, and/or form a complex with, an MHC molecule expressed on the surface of the tumor cell in the subject.
  • IRC insulin receptor reonucleic acid
  • pharmaceutically effective, or therapeutic amounts of IRC required to achieve this end goal are determined by the skilled artisan by known clinical methods utilizing in vitro cell culture techniques, animal model studies, and small scale to large scale human clinical trials. It will be appreciated that the amount of IRC administered to the subject in need thereof in the described methods and uses herein will depend on, e.g., the characteristics of the subject, e.g., age, weight, gender, and/or medical condition/history, genetic makeup, and other factors pertinent to the subject or class of subjects, and that the characteristics of the tumor, e.g., type, volume, and developmental status will also be taken into account when designing the dosage range finding clinical studies.
  • the characteristics of the subject e.g., age, weight, gender, and/or medical condition/history, genetic makeup, and other factors pertinent to the subject or class of subjects
  • the characteristics of the tumor e.g., type, volume, and developmental status will also be taken into account when designing the dosage range finding clinical studies.
  • the proteolytic cleavage sequence is in some embodiments recognized by any protease present in, on, around, or nearby a tumor cell. At least about 569 known proteases have been described. (See, Lopez-Otin, et al., Nature Reviews Cancer, 7(10):800–808, 2007). All human proteolytic enzymes identified to date are classifiable into five catalytic classes: metalloproteinases, serine, threonine, cysteine, and aspartic proteases. A non-limiting list of potential proteases is demonstrated in Table 4, which is a table summarizing exemplars of the most well-studied proteases distributed into the five noted classes.
  • the proteolytic cleavage sequence is recognized by the protease furin, a matrix metalloproteinase (MMP), of which several different members are identified, e.g., MMP, 1, 2, 3, 7, 8, 9, 11, 13, 14, or 19, an ADAM (a disintegrin and metalloproteinase), e.g., ADAMS 8, 9, 10, 15, 17, or 28, a cathepsin, e.g., cathepsin D, G, H, or N.
  • MMP matrix metalloproteinase
  • ADAM disintegrin and metalloproteinase
  • cathepsin e.g., cathepsin D, G, H, or N.
  • the proteases elastase, proteinase-3, azurocidin, and ADAMTS-1 are recognized by any one or more of the aforementioned proteases, and in a certain embodiment the sequence is recognized by a human furin protease.
  • the cleavage sequence comprises at least about 4 amino acid residues, at least about three of which are arginine residues.
  • the cleavage sequence comprises at least 4 amino acid residues, at least three of which are arginine residues and one of which is either a lysine residue or an arginine residue.
  • the cleavage sequence is R-X-R/K-R (SEQ ID NO: 89). In various embodiments, the cleavage sequence comprises additional residues. In various embodiments, the cleavage sequence further comprises about 1, 2, 3, 4, 5, 6, 7, 8, or about 9 additional arginine residues. It is known that arginines are positively charged and it has been discovered that a longer chain of positive charged arginine residues will bring the peptides closer to the surface of the capsid backbone which is more negatively charged. Table 4: Proteases and cancers associated with overexpressed proteases [0159] In various embodiments, the peptide is bound to the capsid backbone, as described in more detail below.
  • the cleavage sequence is chemically conjugated by way of a maleimide linkage or an amide linkage (discussed below).
  • the peptide is generally linked to any residue on the capsid backbone; however, disulfide linkages, maleimide linkages, and amide linkages are formed by conjugating the peptide to cysteine, lysine, or arginine residues of the mutant L1 proteins that comprise the capsid backbones.
  • the peptide comprises at least one protease cleavage sequence.
  • the protease cleavage sequence is any sequence capable of being preferentially cleaved by or near a tumor cell.
  • the insertion of this cleavage sequence into the peptide allows the protein to remain attached to the capsid backbone carrier until the IRC enters the tumor microenvironment.
  • the peptide is to a large extent not released from the capsid backbone and able to actively coat MHC receptors until the peptide enters the tumor microenvironment.
  • proteases are known in the art to be active in the tumor microenvironment. For example, several metallo-, cysteine and serine proteases are known.
  • the capsid backbones described herein are in some embodiments first functionalized to deliver an epitope containing on one or more peptides associated with the capsid backbone to the target cells, thereby labeling the tumor or cancer cells for destruction.
  • peptides are conjugated to the capsid backbone through cysteine residues on the capsid protein.
  • cysteine molecule are presented naturally, or by mutation, on the surface of the capsid backbone.
  • the capsid backbone is subjected to reducing conditions sufficient to reduce the sulfhydryl groups of cysteine residues on the surface of the capsid backbone while maintaining the capsid-like icosahedron structures of the capsid backbone. Because of its free sulfhydryl group, cysteine will readily and spontaneously form disulfide bonds with other sulfhydryl–containing ligands under oxidative conditions.
  • the peptide is associated with the capsid backbone via a maleimide linkage.
  • the peptide is conjugated to a lysine residue on the capsid backbone. Lysine residues are easily modified because of their primary amine moiety.
  • n-hydroxysuccinimide (NHS) ester reactions because NHS is released as prat of the reaction, amide bonds are formed at surface-exposed lysine residues on the capsid backbone.
  • the NHS reaction occurs spontaneously between about pH 7.2 and about pH 9.
  • the peptide is conjugated to an aspartate or glutamate residue.
  • chemically coupling to aspartate or glutamate residues requires multiple steps.
  • the carboxylic acid of the aspartate or glutamate is activated using 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC), or similar chemical cross-linking reagent. Once activated, this adduct will react with NHS to form an NHS ester. The NHS ester is then reacted with a ligand with an exposed primary amine to from a stable amide bond.
  • the capsid backbone comprises a region of negatively charged amino acids on a surface-exposed area that is capable of binding to the peptide comprising a region of positively charged amino acids.
  • the region of negatively charged amino acids is flanked, on one or on both sides, by one or more cysteine residues, referred to as polyanionic: cysteine or more specifically, polyglutamic acid:cysteine or polyaspartic acid:cysteine.
  • cysteine or more specifically, polyglutamic acid:cysteine or polyaspartic acid:cysteine.
  • the conjugation of the capsid backbone and the peptide would result from non-covalent binding between the complementary amino acid charges of the capsid backbone and the peptide and a disulfide bond between the cysteines.
  • the cysteine(s) are one or more amino acids away from the region of charged amino acids such that any secondary/tertiary structure would bring the charged amino acid region in close proximity to the cysteine(s).
  • the peptide comprises at least one peptide and a polyionic:cysteine for attaching the peptide to the capsid backbone comprising a complementary polyionic:cysteine sequence and an enzyme cleavage site positioned between the terminal cysteine and the CD8+ T cell epitope.
  • the peptide comprises, a terminal cysteine, at least one peptide, and an enzyme cleavage sequence positioned between the terminal cysteine and the peptide(s).
  • Negatively charged amino acids that are useful in producing the described IRC include, e.g., glutamic acid and aspartic acid.
  • the negatively charged region comprises glutamic acid.
  • the number of negatively charged amino acids can vary and can include about 4 to about 20 amino acids, about 6 to about 18 amino acids, or about 8 to about 16 amino acids, and the like.
  • the negatively charged region comprises about 8 negatively charged amino acids.
  • the negatively charged region comprises EEEEEEEEC (E8C, SEQ ID NO: 130).
  • the negatively charged region comprises CEEEEEEEEC (SEQ ID NO: 131).
  • a polyarginine-cysteine moiety on the peptide allows docking of the peptide to the polyanionic site (EEEEEEEEC, E8C, SEQ ID NO: 130) present in the various loops of the capsid backbone.
  • the polyanionic site EEEEEEEC, E8C, SEQ ID NO: 130
  • Covalent cross-linking between the two cysteine residues should render this association irreversible under oxidizing conditions.
  • conjugation buffer (20 mM Tris/HCl, pH 7.5, 150 mM NaCl, 5% glycerol, 0.5 mM CaC1 2 ) and then the peptide and the oxidizing reagents are added, allowing the reaction to proceed for 16 hrs at 4 °C.
  • the reaction mixtures are applied to a size-exclusion column (such as SEPHADEX® G-100, Pharmacia, New Jersey, US, volume 20 ml, flow rate 1 ml/min, 10 mM Tris/HCl (pH 7.4), 150 mM NaCl, 0.5 mM CaCl 2 ) to remove unconjugated peptide and exchange buffer.
  • a size-exclusion column such as SEPHADEX® G-100, Pharmacia, New Jersey, US, volume 20 ml, flow rate 1 ml/min, 10 mM Tris/HCl (pH 7.4), 150 mM NaCl, 0.5 mM CaCl 2
  • IRCs that elute in the void volume are identified by the presence of the L1 protein on SDS-PAGE.
  • the conjugated capsid backbones (IRC) are than optionally analyzed by electron microscopy.
  • the peptide is genetically fused to the L1 protein.
  • the peptide is either covalently or non-covalently linked to the capsid backbone.
  • a nucleic acid sequence encoding the peptide is inserted in some embodiments into the nucleic acid encoding the L1 protein such that upon expression a peptide is produced that is inserted into a loop of the capsid protein and displayed on the surface of the capsid backbone.
  • non-natural amino acids are used to conjugate the peptide to the capsid backbone.
  • AHA azidohomoalanine
  • pAF p-amino-phenylalanine
  • AHA is very similar to methionine
  • AHA will be incorporated at each AUG codon if the methionine supply is rate limiting, this is termed global methionine replacement.
  • Bacteria auxotrophic for methionine or cell-free protein synthesis can be used to limit-methionine availability.
  • the IRC comprises, at least one-tenth of the L1 proteins display a peptide. In various embodiments, at least one-fifth of the L1 proteins display a peptide.
  • the capsid backbone binds preferentially to tumor cells.
  • the capsid backbones’ tumor preference originates, in some embodiments, from several sources such as the capsid backbone’s charge (positive or negative), shape and size (different aspect ratio filaments and diameter spheres), shielding (self-proteins/peptides and polymers of various sizes and densities), and targeting (ligands for receptors or environmental factors displayed on different linkers at various densities).
  • the capsid backbone contains a positive surface charge. Positively charged capsid backbones have been shown in some studies to remain longer in circulation when injected into a subject.
  • IRCs Due to the abundant presence of proteoglycan in cell membranes that confer a negative charge to cell membranes, and collagen within the tumor interstitial space conferring a positive charge, positively charged IRCs are more likely to possess enhanced binding to mammalian cells as compared with non-charged or negatively charged IRCs, and therefor are better able to avoid aggregation and as a result, are able to better penetrate tumor tissue.
  • Some examples demonstrating these charge-based effects include polyarginine-decorated cowpea mosaic virus (CPMV) found to be taken up eight times more efficiently than native CPMV in a human cervical cancer. (Wen et al., Chem. Soc. Rev., 45(15):4074-4126, 2016).
  • CPMV polyarginine-decorated cowpea mosaic virus
  • the shape and flexibility of the capsid backbone in some instances plays an additional functional role in the ability of capsid backbones to diffuse throughout a tumor.
  • a comparison between the diffusion profiles of a spherical and rod-shaped particle was performed with CPMV and TMV using a spheroid model. It was shown in this study that the CPMV (spherical) experienced a steady diffusion profile, but the TMV (rod shaped) exhibited a two-phase diffusion behavior that entailed an extremely rapid early loading phase that could be attributed to its movement axially, like a needle. (Wen et al., Chem. Soc. Rev., 45(15):4074-4126, 2016).
  • elongated particles Some other advantageous properties that are conferred by elongated particles include better margination toward the vessel wall and stronger adherence due to greater surface area for interaction, which not only have implications for tumor homing but also for enhanced targeting of cardiovascular disease.
  • CPMV in particular exhibits unique specificity in interacting with surface vimentin, which is found on endothelial, cancer, and inflammatory cells.
  • CPMV canine parvovirus
  • TfR transferrin receptor
  • the capsid backbone targets a protein expressed preferentially on the tumor cell surface in the subject. Such proteins are typically overexpressed on the surface of tumor cells, but some if not all, are also found in the blood, i.e., serum.
  • Non- limiting examples of such surface markers include: CEA (carcinoembryonic antigen), E- cadherin, EMA (epithelial membrane antigen; aka MUC-1), vimentin, fibronectin, Her2/neu (human epidermal growth factor receptor type 2, also called Erb b2), ⁇ v ⁇ 3 integrin, EpCAM (epithelial cell adhesion molecule), FR- ⁇ (folate receptor-alpha), PAR (urokinase-type plasminogen activator receptor), and transferrin receptor (over expressed in tumor cells).
  • CEA carcinoembryonic antigen
  • E- cadherin EMA (epithelial membrane antigen; aka MUC-1)
  • vimentin fibronectin
  • Her2/neu human epidermal growth factor receptor type 2, also called Erb b2
  • ⁇ v ⁇ 3 integrin EpCAM (epithelial cell adhesion molecule)
  • FR- ⁇ folate receptor-alpha
  • PAR uro
  • RGD arginylglycylaspartic acid
  • fibronectin a glycoprotein that binds to integrins, and is involved in cell–cell and cell–extracellular matrix (ECM) attachment and signaling by binding collagen, fibrin, and proteoglycans.
  • ECM extracellular matrix
  • RGD peptides have the highest affinity for a type of cell surface integrins, ⁇ v ⁇ which are highly expressed in tumoral endothelial cells, but not in normal endothelial cells. In various embodiments such a peptide sequence is incorporated into the IRC.
  • Methods of treating cancers in a subject in need thereof by administering an IRC to patient in need thereof, and related uses of the described IRC compositions, are described herein.
  • the methods described herein comprise, for instance, administering the IRCs described herein to a subject in need thereof in an amount sufficient to inhibit tumor growth, progression or metastasis, i.e., a therapeutic amount or dose.
  • the IRC is administered to a subject in need thereof in amount sufficient to stimulate cytokine production and/or cellular immunity, particularly innate immunity, including stimulation of the cytotoxic activity of macrophages and natural killer cells.
  • a subject in need thereof is a subject who has been previously treated for a tumor and is currently deemed cancer-free or disease free in accordance with medical standards.
  • the IRC first bind to a tumor cell, in some embodiments the binding is specific. (See, Example 9, Figures 18A and 18B).
  • the peptide epitope on the IRC is then proteolytically cleaved by furin, in some embodiments, or by any other resident protease nearby the tumor cell, which is over-expressed in the tumor microenvironment.
  • epitope coating an MHC molecule expressed on the surface of the tumor cell (“epitope coating”).
  • epitope-coated tumor cell is then recognized as a pathogen-infected cell by one or more T-cells responsive to the specific peptide bound in the MHC molecules, and pre-existing CD8 T cells, yielding a triggered immune redirection response. (See, Examples 11 and 12). That is, this recognition event leads to triggering or activation of the subject’s preexisting immune memory against pathogens and childhood vaccines against the tumor, leading to the attacking and destroying of the subject’s tumor cells.
  • Destruction of tumor cells can result in components of the preexisting immune response being exposed to cancer cell antigens.
  • antigens released from the killed tumor cells will initiate a further immune response to recruit additional tumor-specific CD8 T cells, or a “second wave” of T cells that then proceed to attack additional tumor cells in the area.
  • This can result in elicitation of an endogenous immune response against the cancer cell antigens (referred in some instances to “epitope spreading”) and leads to anti-tumor immune memory.
  • epitopope spreading an endogenous immune response against the cancer cell antigens
  • the methods and uses described herein make use of the fact that subjects, in some instances, possess preexisting immune responses that were not originally elicited in response to a cancer, but that were elicited instead by routine vaccination or via natural infection by a parasite or pathogen. Because the cancer cells would not normally express such epitopes that elicit preexisting immune responses, it would not be expected that such an immune response would not normally, without exogeneous intervention, be capable of attacking any cancer cell. However, by way of the present methods and uses described herein, such preexisting immune responses are readily recruited to attack, kill, and clear a cancer in a subject.
  • the methods, uses, and compositions described herein act by recruiting a preexisting immune response in a subject to the site of a cancer, such that the preexisting immune response attacks and kills the cancer cells.
  • the dosage varies within this range depending on the dosage form employed and the route of administration utilized.
  • the therapeutically effective dose is capable of being estimated initially from cell culture assays.
  • a dose is formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (the concentration of the test composition that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information is then used to accurately determine useful doses in humans. Levels in plasma are measured, for example, by high performance liquid chromatography.
  • a method for stimulating the cytotoxic activity of macrophages and natural killer (NK) cells by administering to a subject in need thereof an effective amount of an IRC described herein.
  • the macrophages and natural killer cells are in some instances those that are present in the tumor microenvironment.
  • the IRCs are administered to the subject in an amount effective to stimulate the cytotoxic activity of macrophages and natural killer cells already present in the tumor microenvironment. In various other embodiments, the IRCs are administered to the subject in an amount effective to attract macrophages and natural killer cells to the tumor microenvironment. In various embodiments, the IRCs are administered to the subject in an amount effective to bind sufficient numbers of antibodies to the peptide or IRC capsid itself to attract and stimulate macrophages, neutrophils and natural killer cells.
  • methods and uses are provided for redirecting the cytotoxic activity of an existing memory CD8+ T cell to a tumor cell or tumor microenvironment by administering to a subject in need thereof an effective amount of the IRC described herein.
  • the T cell epitope of the peptide of the IRC is from a pathogen for which the subject has been vaccinated or from a pathogen that has previously infected the subject and the subject has memory CD8+ T cells that recognize the T cell epitope in complex with an MHC class I molecule on the tumor cells.
  • the effective or therapeutic amount of the IRC compositions described herein is an amount sufficient to attract the memory CD8+ T cell to the tumor microenvironment.
  • the effective amount of the IRC is an amount sufficient to stimulate the memory CD8+ T cell present in the tumor microenvironment.
  • the tumor is a small lung cell cancer, hepatocellular carcinoma, liver cancer, hepatocellular carcinoma, melanoma, metastatic melanoma, adrenal cancer, anal cancer, aplastic anemia, bile duct cancer, bladder cancer, bone cancer, brain/CNS cancer, breast cancer, cancer of unknown primary origin, Castleman disease, cervical cancer, colon/rectum cancer, endometrial cancer, esophagus cancer, Ewing family of tumors, eye cancer, gallbladder cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumor (gist), gestational trophoblastic disease, Hodgkin disease, Kaposi sarcoma, kidney cancer, laryngeal and hypopharyngeal cancer, leukemia, liver cancer, lung cancer, lymphoma, malignant mesothelioma, multiple my
  • the cancer is a breast cancer, a cervical cancer, an ovarian cancer, a pancreatic cancer or melanoma
  • the term "cancer” as used herein refers to proliferative diseases, such as lymphomas, lymphocytic leukemias, lung cancer, non-small cell lung (NSCL) cancer, bronchioloalveolar cell lung cancer, bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, gastric cancer, colon cancer, breast cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's Disease, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system cancer of the thyroid gland, cancer of the parathyroid gland,
  • An aspect described herein is a method for treating a cancer in a subject in need thereof by administering an IRC described herein to the subject wherein the CD8+ epitope of the peptide is of a failed therapeutic cancer vaccine against a viral-induced cancer, e.g., HPV cervical cancer, HPV+ oral cancer, EBV nasopharyngeal cancer (the “therapeutic vaccine”).
  • a viral-induced cancer e.g., HPV cervical cancer, HPV+ oral cancer, EBV nasopharyngeal cancer
  • the methods and uses described herein therefore comprise determining whether the subject has been actively vaccinated but did not respond with an anti-tumor effect to the treatment.
  • the IRC composition is then administering to the subject an effective amount of an IRC of this invention wherein the CD8+ epitope of the peptide is of the antigenic determinant in the vaccine previously administered to the subject that infected the subject.
  • Capsid backbones have inherent adjuvant properties.
  • the immunogenicity of the IRC compositions described herein are further enhanced by the combination with additional nonspecific stimulators of the immune response, known as adjuvants.
  • Suitable adjuvants include all acceptable immunostimulatory compounds, such as, but not limited to, cytokines, toxins, or synthetic compositions such as alum.
  • Adjuvants include, but are not limited to, oil-in-water emulsions, water-in-oil emulsions, mineral salts, polynucleotides, and natural substances. Specific adjuvants that may be used include IL-1, IL-2, IL-4, IL-7, IL-12, y-interferon, GM-CSF, BCG, aluminum salts, such as aluminum hydroxide or other aluminum compound, methylenedioxyphenyl (MDP) compounds, such as thur-MDP and nor-MOP, CGP (MTP-PE), lipid A, and monophosphoryl lipid A (MPL), or inactivated microbial agents.
  • MDP methylenedioxyphenyl
  • MTP-PE CGP
  • MPL monophosphoryl lipid A
  • RIBI which contains three components extracted from bacteria, MPL, trehalose dimycolate (TOM), and cell wall skeleton (CWS) in a 2% squalene/Tween 80 emulsion. MHC antigens may even be used.
  • MHC antigens may even be used.
  • Various methods of achieving adjuvant affect for the IRC compositions includes use of agents such as aluminum hydroxide or phosphate (alum), commonly used as about 0.05 to about 0.1 % solution in phosphate buffered saline, admixture with synthetic polymers of sugars (CARBOPOL®) used as an about 0.25% solution, aggregation of a protein in the composition by heat treatment with temperatures ranging between about 70°C to about 101 °C.
  • agents such as aluminum hydroxide or phosphate (alum), commonly used as about 0.05 to about 0.1 % solution in phosphate buffered saline, admixture with synthetic polymers of sugars (CARBOPOL
  • Fab pepsin- treated antibodies to albumin
  • mixture with bacterial cells e.g., C. parvum, endotoxins or lipopolysaccharide components of Gram-negative bacteria
  • emulsion in physiologically acceptable oil vehicles e.g., mannide monooleate (Aracel ATM), or emulsion with a 20% solution of a perfluorocarbon (FLUOSOL-DA®) used as a block substitute
  • FLUOSOL-DA® perfluorocarbon
  • a typical adjuvant is complete Freund's adjuvant (containing killed Mycobacterium tuberculosis), incomplete Freund's adjuvants, and aluminum hydroxide.
  • Suitable adjuvants will be evident to a skilled worker. These include, e.g., Alum-MPL as adjuvant, or the comparable formulation, ASO4, which is used in the approved HPV vaccine CERVARIX®, AS03, AS02, MF59, montanide, saponin-based adjuvants such as GPI-0100, CpG-based adjuvants, or imiquimod.
  • an adjuvant is physically coupled to the capsid backbone, or encapsulated by the capsid backbone, rather than simply mixed with them.
  • BRM biologic response modifiers
  • BRMs have been shown to upregulate T cell immunity or downregulate suppresser cell activity.
  • BRMs include, but are not limited to, Cimetidine (CIM; 1200 mg/d) (Smith/Kline, PA, US); or low-dose Cyclophosphamide (CYP; 300 mg/ml) (Johnson/Mead, NJ, US) and cytokines such as ⁇ -interferon, IL-2, or IL-12 or genes encoding proteins involved in immune helper functions, such as B-7.
  • these genes are encapsulated by the capsid backbone to facilitate their delivery into a subject.
  • compositions that contain polypeptide or peptide sequence(s) as active ingredients are generally well understood in the art.
  • such compositions are prepared as injectables either as liquid solutions or suspensions: solid forms suitable for solution in or suspension in liquid prior to injection may also be prepared.
  • the preparation is in some instances emulsified.
  • the active immunogenic ingredient is in some embodiments mixed with excipients that are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof.
  • compositions may contain amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, or adjuvants that enhance the effectiveness of the vaccines.
  • vaccines are formulated with a combination of substances.
  • the compositions comprising the IRCs of the present disclosure are intended to be in a biologically-compatible form that is suitable for administration in vivo to subjects.
  • the pharmaceutical compositions described herein further comprise one or more optional pharmaceutically acceptable carriers.
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government, e.g., the FDA, or listed in the U.S.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the capsid backbone is administered.
  • Such pharmaceutical carriers include, for example, sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, including but not limited to peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a carrier in some instances when the pharmaceutical composition described herein is administered orally. Saline and aqueous dextrose are carriers, for example, when the pharmaceutical composition is administered intravenously.
  • Saline solutions and aqueous dextrose and glycerol solutions are employed, for instance, as liquid carriers for injectable solutions.
  • suitable pharmaceutical excipients include, without limitation, starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried slim milk, glycerol, propylene, glycol, water, ethanol and the like.
  • the pharmaceutical composition in some embodiments optionally contains minor amounts of wetting or emulsifying agents, or pH buffering agents.
  • compositions comprising the IRCs of the present disclosure take the form of, for example, solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations, and the like.
  • Oral formulation includes in some embodiments standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc.
  • a pharmaceutical composition comprises an effective amount of an IRC of the present disclosure together with a suitable amount of a pharmaceutically acceptable carrier so as to provide the form for proper administration to the subject.
  • the formulation should suit the mode of administration.
  • compositions of the present disclosure are administered by any particular route of administration including, but not limited to, intravenous, intramuscular, intraarticular, intrabronchial, intraabdominal, intracapsular, intracartilaginous, intracavitary, intracelial, intracerebellar, intracerebroventricular, intracolic, intracervical, intragastric, intrahepatic, intramyocardial, intraosteal, intraosseous, intrapelvic, intrapericardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrarectal, intrarenal, intraretinal, intraspinal, intrasynovial, intrathoracic, intrauterine, intravesical, bolus, oral, parenteral, subcutaneous, vaginal, rectal, buccal, sublingual, intranasal, iontophoretic means, or transdermal means.
  • compositions are administered at or near the target area, e.g., intratumoral injection.
  • the compositions are administered at or near the target area, e.g., intratumoral injection.
  • parenteral administration in an aqueous solution for example, the solution should be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • aqueous solutions are especially suitable for intravenous, intramuscular, intratumoral, subcutaneous, and intraperitoneal administration.
  • sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure.
  • IRC-containing compositions described herein are administered by inhalation.
  • a composition is administered as an aerosol.
  • aerosol refers to a suspension of solid or liquid particles in a gas.
  • a composition that has been vaporized, nebulized, or otherwise converted from a solid or liquid form to an inhalable form including suspended solid or liquid drug particles.
  • aerosols can be used to deliver a composition via the respiratory system.
  • respiratory system refers to the system of organs in the body responsible for the intake of oxygen and the expiration of carbon dioxide. The system generally includes all the air passages from the nose to the pulmonary alveoli. In mammals it is generally considered to include the lungs, bronchi, bronchioles, trachea, nasal passages, and diaphragm.
  • delivery of a composition to the respiratory system indicates that a drug is delivered to one or more of the air passages of the respiratory system, in particular to the lungs.
  • Additional formulations that are suitable for other modes of administration include suppositories (for anal or vaginal application) and, in some cases, oral formulations.
  • suppositories traditional binders and carriers may include, for example, polyalkalene glycols or triglycerides: such suppositories may be formed from mixtures containing the active ingredient in the range of about 0.5% to about 10%, preferably about 1 % to about 2%.
  • Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations, or powders and contain about 10% to about 95% of active ingredient, preferably about 25% to about 70%. [0198]
  • the IRC compositions described herein are, in some instances, formulated into a vaccine as neutral or salt forms.
  • Pharmaceutically-acceptable salts include the acid addition salts (formed with the free amino groups of the peptide) and those that are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups may also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like. [0199]
  • the pharmaceutical compositions of the present disclosure also include, in certain embodiments, an effective amount of an additional adjuvant.
  • papillomavirus capsid backbones have adjuvant properties.
  • Suitable additional adjuvants include, but are not limited to, Freund's complete or incomplete, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, dinitrophenol, and potentially useful human adjuvants such as Bacille Calmette-Guerin (BCG), Corynebacterium parvum, and non-toxic cholera toxin.
  • BCG Bacille Calmette-Guerin
  • Corynebacterium parvum Corynebacterium parvum
  • non-toxic cholera toxin cholera toxin.
  • the carrier is in some embodiments a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity is maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants.
  • the prevention of the action of microorganisms is brought about in some instances by incorporation of various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • various antibacterial and antifungal agents for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions is achieved by the addition to the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions are prepared by incorporating the IRCs in the required amount in the appropriate solvent with various ingredients enumerated above, as required may be followed by filtered sterilization.
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum-drying and freeze-drying techniques, which yield a powder of the active ingredient, plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Different aspects of the present disclosure involve administering an effective amount of a composition comprising the IRCs to a subject in need thereof.
  • an IRC comprising a target peptide comprising a CD8+ T cell epitope is administered to the patient to treat a tumor or prevent the recurrence of such tumor.
  • Such compositions will generally be dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.
  • Design of IRC for Specific Uses [0204]
  • a method for providing an IRC to a subject in need thereof comprising: (1) measuring the preexisting immunity in a subject, and (2) selecting the appropriate IRC for administration of a subject in need. The appropriate IRC to administer to the subject will depend upon the patients T cell profile.
  • the appropriate IRC will be one that is capable of eliciting a T cell response that is at least twice the baseline total of CD8+ cells. In various embodiments, the appropriate IRC will be one that is capable of eliciting a T cell response that is twice the baseline total of CD8+ or total CD8+ CD69+ T cells.
  • the goal is to choose the appropriate IRC based on the subject’s vaccination history or prior exposure to a pathogen. Determining which IRC is appropriate is, for example, achieved through: (1) subject interviews; (2) review of a subject’s medical records; and/or (3) assessing the subject’s T cell profile. [0205] In various embodiments, more than one peptide is suitable for eliciting an immune response directed at a tumor.
  • an IRC carrying either peptide or a mixture of both peptides will be appropriate.
  • more than one peptide is expressed and bound to the capsid backbone.
  • a single peptide will comprise more than one peptide.
  • multiple peptides comprising different peptides will be conjugated to the capsid backbone.
  • the invention comprises a population of IRCs as described herein and a pharmaceutically acceptable excipient.
  • the IRCs administered to the subject are identical.
  • IRCs carrying different peptide(s) are administered to a subject. [0206] Selection Based on Prior Vaccination.
  • contemplated is also a method of selecting an appropriate IRC to administer to a subject in need thereof.
  • this involves ascertaining if the subject has been actively vaccinated against a given pathogen, e.g., a parasite, a bacterium, or virus, e.g., measles or polio, and then selecting and administering to the subject an IRC as disclosed herein wherein the CD8+ T cell epitope of the peptide is from the pathogen against which the subject has been immunized in the past.
  • a subject’s vaccination history is obtained by reviewing the subject’s medical record.
  • a subject’s vaccination history is obtained by interviewing the subject.
  • Selection Based on Prior Infection the method of selecting an appropriate IRC for administration to a subject in need thereof involves ascertaining if a subject has been previously infected with a given pathogen, e.g., a parasite, a bacterium, or virus, e.g., measles or polio, and resolved the infection.
  • the subject is then administered an IRC comprising a peptide which comprises said pathogen for which the subject has been previously infected.
  • Non-limiting examples of CD8+ T cell epitopes that bind to particular MHC class I molecules are set forth in Table 1.
  • the method also comprises, in certain embodiments, determining which MHC class I determinant(s) the subject’s cells express and then administering an IRC described herein wherein the CD8+ T cell epitope of the peptide is a CD8+ T cell epitope of the antigenic component of the pathogen in the vaccine or of the pathogen that previously infected the subject that forms a complex with the subject’s MHC class I determinant(s).
  • Measuring T cell Responses is also assessed in order to select an appropriate IRC using various techniques known in the art.
  • This profile is then used to guide selection of the appropriate IRC to administer to the subject.
  • Such techniques include, for example, measuring interferon- ⁇ levels, using flow cytometry to isolate Ag-specific CD8+ T cells, and/or cytotoxicity assays.
  • To measure interferon- ⁇ (a marker of T cell activation), intracellular staining of isolated T cells.
  • an enzyme-linked immunosorbent spot (ELISPOT) assay for interferon- ⁇ may be conducted. This technique allows for a high throughput assessment of a patient’s T cell profile. This method can potentially detect one in 100,000-300,000 cells.
  • a monoclonal antibody for a specific cytokine is pre-coated onto a polyvinylidene difluoride (PVDF)-backed microplate.
  • PVDF polyvinylidene difluoride
  • CD8+ T cells are pipetted into the wells along with dendritic cells and individual peptides and the microplate is placed into a humidified 37°C CO2 incubator for a period ranging from 24 to 48 h.
  • the immobilized antibody binds the cytokine secreted from the cells.
  • a detection antibody specific for the chosen analyte is added to the wells.
  • enzyme conjugated to streptavidin is added and a substrate is added.
  • a colored precipitate forms, according to the substrate utilized and appears as spot at the sites of cytokine secretion, with each individual spot representing a single producing cell.
  • methods of determining the appropriate IRC to administer to a subject in need thereof, by assessing the subject’s T cell profile comprising: (1) collecting PBMCs from subject (pre-vaccination sample), (2) preparing enzyme-linked immune absorbent spot (ELISPot) plates by coating with anti-IFN- ⁇ antibody (incubate overnight), (3) incubating PBMCs with one of the pool of peptides of interest, i.e., the peptides expected to elicit a T cell response (incubate for 1-2 days), (4) washing the plates, adding a biotinylated secondary antibody (incubating for a few hours), (5) washing the plates, adding avidin conjugated horseradish peroxidase and incubating, (6) washing plates, adding aminoethyl carbazole (AEC) for a
  • T cell proliferation is measured by 3H (tritiated)- thymidine.
  • Such methods are sensitive and can be used for high throughput assays.
  • Such techniques include, for instance, carboxyfluorescein succinimidyl ester (CFSE) and Ki64 intracellular staining.
  • CFSE carboxyfluorescein succinimidyl ester
  • Ki64 intracellular staining.
  • Selecting Peptides based on Tropism It is known in the art that some viruses display a tropism for particular type of tissue.
  • viruses that display a tropism for brain tissue include without limitation, JC virus, measles, LCM virus, arbovirus and rabies; viruses that display a tropism for eye tissue include without limitation herpes simplex virus, adenovirus, and cytomegalovirus; viruses that display a tropism for nasal tissue include without limitation, rhinoviruses, parainfluenza viruses, and respiratory syncytial virus; viruses that display a tropism for oral tissue, e.g., oral mucosa, gingiva, salivary glands, pharynx, include without limitation, herpes simplex virus type I and type II, mumps virus, Epstein Barr virus, and cytomegalovirus; viruses that display a tropism for lung tissue include without limitation, influenza virus type A and type B, parainfluenza virus, respiratory syncytial virus, adenovirus, and SARS coronavirus; viruses that display a tropism for nerve tissue, e.g., the spinal
  • a method for treating a cancer in a subject in need thereof is provided by administering an IRC described herein to the subject wherein the peptide is a CD8+ epitope of a pathogen that has a tropism for the tissue that is the source of the cancer (the “source tissue”).
  • the appropriate IRC is selected by first determining the source tissue of the tumor cell and then selecting a peptide: (1) to which the patient already has existing CD8+ T cells, and (2) that has a tropism for the source tissue of the tumor. The selected IRC(s) are then administered to the subject in need thereof.
  • a lung cancer comprising determining if a subject has been actively vaccinated against a pathogen that infects lung cells, e.g., an influenza virus, e.g., influenza virus type A or type B, then administering an effective amount of an IRC composition described herein, wherein the CD8+ T cell epitope of the peptide is of the antigenic determinants of the pathogen contained in the vaccine and which T cell epitope forms a complex with an MHC molecule class I of the subject.
  • a pathogen that infects lung cells e.g., an influenza virus, e.g., influenza virus type A or type B
  • the methods and uses described herein for treating a lung cancer includes, in some embodiments, determining if a subject has been infected with pathogen that infects lung cells, e.g., an influenza virus, e.g., influenza virus type A or type B, then administering an effective amount of an IRC composition described herein wherein the CD8+ T cell epitope of the peptide is of that pathogen and which T cell epitope forms a complex with an MHC class I molecule of the subject.
  • pathogen that infects lung cells
  • pathogen e.g., an influenza virus, e.g., influenza virus type A or type B
  • an oral cancer which are part of the group of cancers commonly referred to as head and neck cancers, by administering an IRC compositions described herein, wherein the CD8+ epitope of the peptide is of a pathogen that has a tropism for oral tissue, e.g., a mumps virus, Epstein Barr virus, cytomegalovirus, or a herpes simplex virus type 1.
  • a pathogen that has a tropism for oral tissue
  • the method comprises determining if a subject in need thereof has been actively vaccinated against, or infected with, e.g., a mumps virus, Epstein Barr virus, cytomegalovirus, or a herpes simplex virus type 1, and if the subject has been vaccinated or infected previously then administering to the subject an IRC composition described herein wherein the CD8+ epitope of the peptide is of a mumps virus or a measles virus or of the antigenic component of the vaccine the subject had received, or of the pathogen, i.e., mumps, measles, Epstein Barr virus, cytomegalovirus, or a herpes simplex virus type 1, that had previously infected the subject.
  • a subject in need thereof has been actively vaccinated against, or infected with, e.g., a mumps virus, Epstein Barr virus, cytomegalovirus, or a herpes simplex virus type 1, and if the subject
  • the IRC compositions described herein are co- administered with other cancer therapeutics.
  • the IRCs described herein are administered in conjunction with other cancer treatment therapies, e.g., radiotherapy, chemotherapy, surgery, and/or immunotherapy.
  • the IRC compositions described herein are administered in conjunction with checkpoint inhibitors.
  • the capsid backbone is administered in conjunction with an immune agonist.
  • the IRC is administered in conjunction with treatment with a therapeutic vaccine.
  • the IRC is administered in conjunction with treatment with a conjugated antigen receptor expressing T cell (CAR-T cell).
  • CAR-T cell conjugated antigen receptor expressing T cell
  • the IRC is administered in conjunction with treatment with another immuno-oncology product.
  • the IRCs of the present disclosure and other therapies or therapeutic agents are, in some embodiments, administered simultaneously or sequentially by the same or different routes of administration.
  • the determination of the identity and amount of therapeutic agent(s) for use in the methods of the present disclosure is readily made by ordinarily skilled medical practitioners using standard techniques known in the art. [0217] All of the references cited above, as well as all references cited herein, are incorporated herein by reference in their entireties for all purposes. [0218] While the methods, uses, and compositions described herein have been illustrated and described in detail in above, such illustration and description are to be considered illustrative or exemplary and not restrictive.
  • MPV.10.34.d This mutant MPV L1 protein is hereinafter referred to as “MPV.10.34.d.” (See, Figure 1B).
  • the wild type mouse (Mus musculus) L1 wild type protein sequence is depicted in Figure 1A and has the following protein sequence (SEQ ID NO: 132, NCBI Reference Sequence: YP_003778198.1, DNA: 9434943): Met Ala Met Trp Thr Pro Gln Thr Gly Lys Leu Tyr Leu Pro Pro Pro Thr Thr Pro Val Ala Lys Val Gln Ser Thr Asp Glu Tyr Val Tyr Pro Thr Ser Leu Phe Cys His Ala His Thr Asp Arg Leu Leu Thr Val Gly His Pro Phe Phe Ser Val Ile Asp Asn Asp Lys Val Thr Val Pro Lys Val Ser Gly Asn Gln Tyr Arg Val Phe Arg Leu Lys Phe Pro Asp Pro Asn Lys Phe Ala Leu Pro Gln Lys Asp
  • nucleic acid sequence (below) of MPV.10.34.d was optimized for expression. The sequence was optimized for codon usage within the target host as well as for expression level to maximize expression efficiency within the host.
  • nucleic acid sequences for MPV.10.34.d used herein (SEQ ID NO: 135): ATGCTGTACCTGCCGCCGACCACCCCGGTGGCGAAAGTTCAGAGCACCGACGAATACGTTTA TCCGACCAGCCTGTTCTGCCACGCGCACACCGATCGTCTGCTGACCGTGGGTCACCCGTTCT TTAGCGTTATCGACAACGATAAGGTGACCGTTCCGAAAGTGAGCGGCAACCAGTACCGTGTT TTTCGTCTGAAGTTCCCGGACCCGAACAAATTTGCGCTGCCGCAAAAGGACTTCTATGATCC GGAGAAGGAACGTCTGGTGTGGCGTCTGCGTGGTCTGGAAATTGGTCGTGGTGGCCCGCTGG GTATTGGTACCACCGGTCACCCGCTGTTCAACAA
  • the MPV.10.34.d nucleic acid sequence was generated from wild type mouse papillomavirus sequence via site-mutagenesis (Genscript Biotech, Piscataway, NJ) using the following primer sequence (SEQ ID NO: 137): AAGCTTGTCGACGGAGCTCGAATTCGGATCCTTATTACTGATACAGGAAT TTACGGCCCAGC [0227]
  • the MPV.10.34.d nucleic acid sequence was then cloned into the multicloning site of expression vector pet24a(+) (MilliporeSigma, Burlington, MA) using restriction endonucleases Ndel and BamH1 according to standard protocols.
  • sterile LB including 50 ⁇ g/mL kanamycin (Quality Biological, Gaithersburg, MD, US) was seeded with a single colony selected from the solid media and grown overnight at 37 °C with shaking. The seed culture was then diluted 1:25 and growth was continued at 37 °C until OD 600 reached about 0.6 to 0.8. Then about 1 mM final concentration of isopropyl ⁇ - d-1-thiogalactopyranoside (IPTG, Invitrogen, Carlsbad, CA, US) was added to the culture to induce expression from the plasmid.
  • IPTG isopropyl ⁇ - d-1-thiogalactopyranoside
  • MPV.10.34.d was expressed as inclusion bodies (IBs). To recover IB MPV.10.34.d, pellets were first thawed (if frozen) and then resuspended in 20 mL per 1 L pellet lysis buffer (50 mM Tris, pH 8.0, 500 mM NaCl, 1 mM EDTA, 1 mM protease inhibitor phenylmethylsulfonyl fluoride (PMSF).
  • IBs inclusion bodies
  • Resuspended material was then homogenized using a high pressured homogenizer (Avestin Emulsiflex C3TM, ATA Scientific, Taren Point, Australia) and cells were passed through the homogenizer and lysed 4 times at about 15,000 to 20,000 PSI. The lysed bacterial cells were then centrifuged at 25,000 x g at 4 °C for 20 min. Supernatant was then discarded and the inclusion body pellet was stored at -20 °C.
  • a high pressured homogenizer Horin Emulsiflex C3TM, ATA Scientific, Taren Point, Australia
  • the IB were solubilized by resuspending the pellet (50 mL per 1 L pellet) in of 6 M urea buffer (8 M Urea, 50 mM Tris, pH 8.0, 500 mM NaCl, 1 mM EDTA, 1 mM PMSF, and 1 mM DTT). Resuspended contents were once more passaged three to four times through the homogenizer (Avestin Emulsiflex C3TM, ATA Scientific, Taren Point, Australia) at about 15,000 to 20,000 PSI. The resolubilized samples were centrifuged at 25,000 x g at 4 °C for 20 min. The supernatant was collected into a container that is sufficiently large enough to hold the volume of a sample.
  • 6 M urea buffer 8 M Urea, 50 mM Tris, pH 8.0, 500 mM NaCl, 1 mM EDTA, 1 mM PMSF, and 1 mM DTT. Resuspended contents were once more passaged three to
  • the MPV.10.34.d was refolded by removal of the denaturant (6M Urea) in a step-gradient manner.
  • the solubilized samples were inserted into dialysis tubing (snakeskin dialysis tubing, 10,000 Da molecular weight cut off, 35 mm. (ThermoFisher Scientific, Waltham, MA, US). In general, about 100 to about 150 mL of resolubilized sample solution was dispensed into a single dialysis tube.
  • the samples were first dialyzed (sample to buffer ratio 1:12.5) against 4 M urea buffer (50 mM Tris, pH 8.0, 500 mM NaCl, 1 mM EDTA, 1 mM PMSF, 1 mM DTT, and 0.05% Tween®-80) for 3 ⁇ 1 hour in a cold room at about 4°C on a stir plate. Then, the samples were again dialyzed against a fresh 1 M urea buffer (50 mM Tris, pH 8.0, 500 mM NaCl, 1 mM EDTA, 1 mM PMSF, 1 mM DTT, and 0.05% Tween-80) for 3 ⁇ 1 hour in a cold room on a stir plate.
  • 4 M urea buffer 50 mM Tris, pH 8.0, 500 mM NaCl, 1 mM EDTA, 1 mM PMSF, 1 mM DTT, and 0.05% Tween®-80
  • the samples were dialyzed against 0 M urea buffer (50 mM Tris, pH 8.0, 500 mM NaCl, 1 mM EDTA, 1 mM PMSF, 1 mM DTT, and 0.05% Tween-80) overnight (about 16 to 18 hours) in a cold room at about 4°C on a stir plate.
  • the dialyzed / refolded sample solutions were aliquoted into 50 mL conical tubes and stored in a -20 °C freezer.
  • the CEX eluate was diluted with high-salt buffer to achieve loading conditions of 25 mM NaPO4, 3 M NaCl, pH 6.0, and applied to HIC resin (butyl-S-Sepharose® Fast Flow, GE Healthcare Life Sciences/Fisher Scientific, Waltham, MA, US).
  • HIC resin butyl-S-Sepharose® Fast Flow, GE Healthcare Life Sciences/Fisher Scientific, Waltham, MA, US.
  • the bound refolded MPV.10.34.d product was subjected to a pre-elution wash with 30% 25 mM NaPO 4 , 25 mM NaCl, pH 6.0, and then eluted with a single step gradient of 70% 25 mM NaPO 4 , 25 mM NaCl, pH 6.0.
  • the images of the gels were taken using the Bio-Rad Image Lab 6.01 software. Gel images were then uploaded into the software and the entire vertical lane containing the band of interest (“lane profile”) was analyzed using the image analysis software. The specific total density of the band of the protein of interest was calculated by drawing a box or freehand shape around the band. Subsequently, the total density of the entire lane was measured in the same manner. After obtaining the measurements, the background density of a suitably matched area on the gel in each case was subtracted. This background-corrected density of the protein band by the background-corrected density of the whole lane was then multiplied by 100 to obtain the percent purity.
  • Example 2 Determination of MPV.10.34.d Structure and Size [0236] DLS (dynamic light scattering) and TEM revealed that upon refolding MPV.10.34.d unexpectedly forms capsid backbones that are about 20 nm to 30 nm in diameter. (See, Figure 5). To analyze the refolded MPV.10.34.d samples, the purified samples were first analyzed by DLS to obtain determine whether refolding of MPV.10.34.d occurred.
  • the high performance of the Zetasizer Nano ZS also enables the measurement of the molecular weight and second virial coefficient, A 2 , of macromolecules and k D , the DLS interaction parameter.
  • the system can also be used in a flow configuration to operate as a size detector for SEC or FFF.
  • the sample was processed with the companion software (Zetasizer Nano Software, Malvern Panalytical).
  • the program was set to read the sample for a total of 5 runs to generate two plots. [0238]
  • the two plots generated were determine capsid backbone size and structure, intensity (Figure 6A), and volume ( Figure 6B).
  • the intensity distribution provides the amount of light scattered by the particles in the different sized bins.
  • the volume distribution demonstrates the total volume of particles in various sized bins.
  • the intensity plot ( Figure 6A) provides an assessment of the overall population sizes of MPV.10.34.d particles including host cell contaminants within the sample, whereas the volume plot ( Figure 6B) determines the relative proportion of refolded protein with respect to other contaminants, i.e., host bacterial cell proteins.
  • each individual plot line in the graphs of Figures 6A and 6B represent individual samples (five samples for each of A and B). If the volume curve was between about 10 to 15 nm (X-axis), the shell was determined to be a capsomer made up of 5 MPV.10.34.d units.
  • the volume curve plot is about 20 to 30 nm.
  • the volume curve plot was about 50 to 60 nm.
  • the intensity graph ( Figure 6A) there are two peaks, one lower at approximately 20 to 30 nm and one at approximately > 100 nm, whereas the volume graph ( Figure 6B) shows a single size of about 20 nm to 30 nm.
  • the mean particle size and distribution are calculated from the distribution of diffusion coefficients using the Stokes Einstein equation. Because the magnitude of the scattering intensity varies roughly with the 6 th power of the particle size, DLS is highly sensitive to the presence of small amounts of aggregates in a mixture of capsid backbones which is believed to be reflected in the intensity plot shown in Figure 6A.
  • TEM analysis was also employed to obtain further visual confirmation of the structure and size of the refolded proteins. Samples (10 ⁇ L) were adsorbed to glow discharged (EMS GloQube) carbon coated 400 mesh copper grids (EMS), by floatation for 2 min. Grids were quickly blotted and then rinsed in 3 drops (1 min each) of TBS.
  • EMS GloQube glow discharged carbon coated 400 mesh copper grids
  • Grids were negatively stained in 2 consecutive drops of 1% uranyl acetate with tylose (1% UAT, double filtered, 0.22 ⁇ m filter), blotted then quickly aspirated to obtain a thin layer of stain covering the sample.
  • Grids were imaged on a Phillips CM-120 TEM operating at 80 kV with an AMT XR80 CCD (8 megapixel).
  • TEM results revealed that MPV.10.34.d formed capsid backbones that had a markedly grooved appearance, with pentagonal/capsomer “towers.” (See, Figure 5). Measurements showed that these capsid backbones were approximate 30 nm is size (compare with the 500 nm scale on TEM micrograph, Figure 5).
  • DARA disassembly and re-assembly
  • the samples were then dialyzed against 4 M urea buffer with the general buffer recipe 50 mM Tris, pH 8.0, 500 mM NaCl and 0.05% Tween-80 for 3 ⁇ 1 hour in a cold room at about 4 °C on a stir plate. Then the samples were again dialyzed against a fresh 1 M urea buffer for 3 ⁇ 1 hour in a cold room on a stir plate. Subsequently, the samples were dialyzed against 0 M urea buffer overnight (about 16 to 18 hours) in a cold room at about 4 °C on a stir plate.
  • Example 4 Production Of Soluble MPV.10.34.d
  • a strategy was adopted to lower the induction temperature and IPTG concentrations to slow down expression, and thereby to prevent formation of IBs.
  • induction temperature was lowered from 37 °C to 16 °C at a concentration of IPTG of 100 ⁇ M and 1 mM.
  • freshly picked E. coli C2566 colonies transformed with the MPV.10.34d DNA were inoculated into LB with 50 ⁇ g/mL of kanamycin (henceforth LB+KAN) starter cultures, grown overnight at 37 °C and 250 rpm.
  • the next day the starter culture was used to inoculate a fresh 250 mL LB+KAN culture at 1:25 dilution and grown at 37 °C, 250 rpm, for about 1.5 to 2 hours, such that the culture reached an OD600 of about 0.5 to 0.7.
  • B 50 mM NaPO 4 , 1.5M NaCl, pH 7.0; which translates to a theoretical NaCl concentration of 0.075M, 0.15M, 0.225M, 0.3M, 0.375M, and 1.5M.
  • M Fractogel SO3
  • wash buffer (0.35 M NaCl, 1.5 mM KH2PO4, 6.5 mM Na2HPO4, 0.05% Tween-20) at room temperature for a total of three washes (200 ⁇ L per sample per wash).
  • a goat anti-mouse IgG-HRP antibody (Millipore Sigma, St. Louis, MO, US) was added at 1:7000 dilution in blocking buffer (4% dry milk, 0.2% Tween-20) to a final concentration of 82.9 ng/mL and the plates incubated for one hour at room temperature on an orbital shaker (300 rpm).
  • the plate was washed and incubated with a peroxidase substrate (3, 3', 5, 5' tetramethyl benzidine, SeraCare Life Sciences, Inc., Milford, MA, US) for 30 minutes, followed by the addition and incubation of stop solution (0.36 N H2SO4) (J.T. Baker / Avantor, Allentown, PA, US) for 20 minutes.
  • stop solution (0.36 N H2SO4) (J.T. Baker / Avantor, Allentown, PA, US) for 20 minutes.
  • the absorbance of the sample plates were read at 450 nm and 620 nm with a plate reader (BioTek, Winooski, VT, US).
  • Example 6 IRC Formation: MPV.10.34.d Capsid Backbone Conjugation [0260] To functionalize the MPV.10.34.d capsid backbones such that they are effective in recruiting preexisting immune system to attack cancer cells in the subject, the MPV.10.34.d capsid backbones were conjugated to various peptide epitopes including ovalbumin peptide SIINFEKL (OVA, SEQ ID NO: 95), HPV16 E7 protein (SEQ ID NO: 96), and CMV peptide pp65 (SEQ ID NO: 129) to form IRCs.
  • OVA ovalbumin peptide SIINFEKL
  • SEQ ID NO: 96 HPV16 E7 protein
  • CMV peptide pp65 SEQ ID NO: 129
  • the peptides are epitopes having a general length of about 8 to 10 amino acids that are preceded upstream by a protease recognition site. (See, Figure 11).
  • the following experiments incorporate an exemplary protease recognition site, the furin protease cleavage sequence R X R/K R (SEQ ID NO:89) which is designed to be located upstream of the epitope peptide.
  • the epitope peptide is chemically modified at the N-terminus to contain maleimide.
  • maleimide a sulfhydryl reactive reagent
  • the incorporation of maleimide, a sulfhydryl reactive reagent, to the N-terminus of the peptide antigen allows for conjugation of the protease / peptide to the reduced sulfhydryl groups, i.e., cysteines, on the MPV.10.34.d capsid backbones.
  • the end production of this reaction is a conjugated MPV.10.34.d capsid backbone.
  • the MPV.10.34.d were then treated with a mild reducing agent, tris(2-carboxyethyl)phosphine (TCEP), for 1 hour without shaking at room temperature (21 °C) at a TCEP:MPV.10.34.d ratio of 10:1. Subsequently, the peptide was then added to the reaction at a molar ratio of X10 the amount of MPV.10.34.d. The reaction was shaken at room temperature (21 °C), 200 rpm, for 1 hour. Following conjugation, to remove excess free peptide, contents from the reaction were subjected to 10 rounds of Amicon spin filtration (molecular cut-off 100 kDa) at 1000 rcf for 10 mins each round.
  • TCEP tris(2-carboxyethyl)phosphine
  • the conjugation of MPV.10.34.d yielded a conjugation efficiency of about 50% as determined by densitometry. (See, Figure 12, lane 4). Percent conjugation was calculated by densitometry. The gel images were scanned into the computer using manufacturer-recommended software. Subsequently, the total density of the upper band and lower band was calculated by drawing a box or freehand shape around each band. The total density of these regions corresponds to the total amount of protein in each band. Next, only the upper lane was measured in the same way. Background density of a suitably matched area on each gel was collected and subtracted from the band signals.
  • Example 7 Conjugation Efficiency of MPV.10.34.d and HPV16 Capsid Backbones [0264] Conjugation of HPV L1 particles using the same conjugation reaction steps as described in Example 6 has been previously described. (See, for instance, WO 2018/237115 and WO 2020/139978). Conjugation experiments were conducted on HPV16 capsid backbones and MPV.10.34.d capsid backbones in the manner described in Example 6.
  • the peptide epitope conjugated to the capsid backbones was the HLA-A*0201 restricted epitope NLVPMVATV (NLV, SEQ ID NO: 138) from the HLA-A2 supertype derived from the CMV pp65 antigen.
  • NLVPMVATV NLV, SEQ ID NO: 138
  • the MPV.10.34.d capsid backbones exhibited a higher conjugation percentage (50%, Figure 13, lane 5) as compared to HPV16 (approximately 20%, Figure 13, lane 3). Percent conjugation was determined by densitometry as described above.
  • the percent peptide conjugation is believed to depend on at least two factors: (1) the ratio of reducing agent to L1 protein, and (2) the amount of free peptide added to the conjugation reaction.
  • a ratio of reducing agent to L1 of 100:1 and 1000:1 yielded a lower percent conjugation, and in some instances even no detectable conjugation, as compared with the standard 10:1 reducing agent to L1 protein ratio.
  • excess reducing agent reacts with the peptides to form an -ylene by-product with approximately the same rate as conjugation of peptides to L1 surface thiols. Such a phenomenon could result in depletion of peptides available for conjugation to L1.
  • the relative stability of IRC was also assessed. Following conjugation, the IRC samples were filtered with an Amicon 10 kDa filter spin column to remove excess free peptide.
  • Figure 14 lanes 6 to 8 and lanes 13 to 15, for HPV16 IRC or MPV.10.34.d IRC, respectively.
  • the samples were then analyzed by TEM as described in Example 2.
  • Figures 15A and 15B are exemplary TEM micrographs at 150,000X and 200,000X magnification, respectively, showing the breakdown of the HPV16 IRC after Amicon purification.
  • MPV.10.34.d IRC did not exhibit any breakdown, as shown in Figures 15C and 15D at 180,000X and 200,000X magnification, respectively.
  • Lane 6 is a reference point in which 10:1 reducing agent to L1 ratio and 10:1 peptide to L1 ratio were used, conditions under which an approximately 50% level of peptide conjugation is routinely observed as determined by densitometry.
  • the lane labelled “CEX-FB035” is a control containing only MPV.10.34.d capsid backbones.
  • lane R is a reference point sample in which a peptide to L1 ratio of 10:1 was included as well as reducing agent to L1 ratio of 10:1, which typically yields an approximately 50% level of peptide conjugation.
  • the lane labelled “CEX-FB035” is a control containing only MPV.10.34.d capsid backbones.
  • Example 8 Binding of IRC to Tumor Cells via HSPG [0274] To assess whether IRC bind to tumor cells, an in vitro cell binding assay was conducted. Specifically, both MPV.10.34.d capsid backbones (unconjugated) as well as different conjugated IRC (human CMV pp65, murine E7, and murine OVA peptide) were examined.
  • MC38 cells murine colon adenocarcinoma, # ENH204-FP Kerafast, Inc., Boston MA
  • pgsA-745 cells Choinese hamster ovary cell mutant deficient in xylosyltransferase (UDP-D-xylose:serine-1,3-D-xylosyltransferase, ATCC CRL-2242) in which heparin sulfate proteoglycan (HSPG) expression is knocked out, were seeded overnight.
  • HSPG heparin sulfate proteoglycan
  • the cells were treated with human CMV pp65, murine HPV16 E7, and murine OVA peptide, as well as the MPV.10.34.d capsid backbone for one hour at 37 °C.
  • Cells were then washed twice with 2 to 3 mL of a fluorescence activated cell sorting (FACS) buffer (1% bovine serum albumin in PBS) and then stained with 1 mL of rabbit anti-musPsV serum antibodies for 30 minutes at 4 °C. Following this, samples were washed once with 3 mL FACS buffer and stained with 0.5 mL of donkey anti-rabbit IgG-PE antibody (Biolegend, San Diego, CA) for 30 min at 4 °C in the dark.
  • FACS fluorescence activated cell sorting
  • the cleavage event occurs, in some embodiments, upon contact with a tumor-specific protease, i.e., a protease present, in some embodiments at relatively higher concentrations than elsewhere in the subject’s system, on or nearby a tumor cell.
  • This cleavage event then is designed to result in the loading, or binding, of the peptide by MHC molecules expressed on the surface of tumor cells.
  • the following experiments are designed to test this mode of operation and whether the designed IRC operate in the manner expected. [0279]
  • an MHC class I molecule loading assay was developed that directly detects peptide loading from IRC onto MHC class I molecules expressed on the surface of tumor cells.
  • This assay involves the use of an antibody that specifically recognizes an OVA peptide (SIINFEKL, SEQ ID NO:95) - MHC class I alloantigen H-2K b molecule complex but not free peptide, empty MHC class 1 molecules, or peptides conjugated to the IRC. (See, Zhang et al., Proc. Nat’l. Acad. Sci. USA, 89:8403-84-7, 1992). [0280] In this experiment, the OVA conjugated MPV.10.34.d IRC from Example 6 were examined side-by-side with OVA conjugated HPV16 IRC at equivalent molarity based on concentration of conjugated peptide.
  • OVA conjugated MPV.10.34.d IRC from Example 6 were examined side-by-side with OVA conjugated HPV16 IRC at equivalent molarity based on concentration of conjugated peptide.
  • 0.1 to 0.2 x 10 6 MC38 tumor cells (C57BL6 murine colon adenocarcinoma-derived cells, # ENH204-FP, Kerafast, Inc., Boston MA) were incubated with the IRC for one hour at 37 °C. A positive control including just free peptide and a negative control including no peptide or IRC were also tested. Cells were then washed twice with 2 to 3 mL FACS buffer and then stained with PE-conjugated-mouse anti-mouse MHC I bounded with OVA (SIINFEKL, SEQ ID NO:95) monoclonal antibody (Biolegend, San Diego, CA) for 30 minutes at 4 °C.
  • OVA SIINFEKL, SEQ ID NO:95
  • HCT116 human colorectal carcinoma cell line, HCT 116, ATCC, CCL-247
  • MCF7 human breast cancer cell line, MCF7, ATCC, HTB-22
  • an unrelated hepatitis B peptide was used as a negative control (thin dashed line, 10 ⁇ g/mL), unconjugated MPV.10.34.d capsid backbones were used as a further negative control (thin solid line, 100 ⁇ g/mL), CMV conjugated MPV.10.34.d IRC is represented as a thick solid line (100 ⁇ g/mL, at about 1.7 ⁇ g / mL of hCMV peptide conjugated), hCMV free peptide is represented as a thick dashed line (1 ⁇ g / mL).
  • FIGS. 19 and 20 show that incubation of the MPV.10.34.d IRC in vitro with the indicated cell lines leads to release of the peptide and binding to the tumor cell surface MHC Class 1 molecules.
  • soluble heparin Sigma Aldrich, St. Louis, MO
  • soluble heparin Sigma Aldrich, St. Louis, MO
  • IRC OVA-conjugated MPV.10.34.d IRC for 1 hour at 37 °C, 5% CO 2 in the presence of 2 x 10 5 MC38 cells in a FACs tube.
  • the final volume of the cells with the sample was 200 ⁇ L.
  • a positive control sample was included which contained no soluble heparin as well as a negative control that contained no IRC or heparin.
  • Example 10 In Vitro Cytotoxic Killing Assays with MPV.10.34.d IRC [0289] Since it was shown in Example 9, that in vitro MPV.10.34.d IRC were able to deposit peptide epitopes onto murine and human MHC Class I molecules and that this mechanism was dependent on furin activity, additional experiments were designed to determine whether labelling these cancer cells would trigger activation and redirection of cellular immune system components against target tumor cells. Upon activation and redirection, the goal is delivery of a cytotoxic signal to the tumor cells and tumor cell death.
  • cytotoxic T-cell-dependent tumor cell killing assays were designed involving the co-culture of tumor cells and viral antigen-specific CD8 + T cells in the presence or absence of MPV.10.34.d IRC.
  • the three CD8 T-cells were tested, including: (1) murine OVA-specific preclinical CD8+ T cells, (2) murine HPV16 E7-specific CD8 + T cells, and (3) human HLA-A*0201-restricted CMV-specific T cells (Astarte Biologicals, cat#1049-4367JY19). (See, Example 12, for (3)).
  • Murine B16 (melanoma/skin) (B16-F10 (ATCC® CRL-6475TM), and murine ID8 (ovarian) tumor cells (Hung et al., Gene Ther., 14(12):921-020, 2007) overexpressing luciferase gene (B16-luc and ID8-luc) were grown in culture. Under normal circumstances, murine tumor cell lines B16 and ID8 will not be killed by murine OVA-specific CD8+ T cells since these cell lines do not express the murine OVA (SIINFIKEL, SEQ ID NO: 95) antigen.
  • SIINFIKEL SEQ ID NO: 95
  • B16-luc B16-luciferase mutant
  • ID8-luc ID8-luciferase mutant
  • the cells were then treated with 100 ⁇ L of 2.5 ⁇ g/mL of MPV.10.34.d capsid backbones, OVA-conjugated MPV.10.34.d IRC, OVA-conjugated HPV16 IRC, and positive control containing 1 ⁇ g/mL of free OVA peptide (SIINFIKEL, SEQ ID NO: 95), for one hour at 37 °C in a final volume of 200 ⁇ L per well. Cells not receiving any antigen were included as negative control (No Ag). The cells were then washed twice with 200 ⁇ L of Roswell Park Memorial Institute (RPMI) media and co-incubated with OVA-specific CD8+ T-cells (Jackson, stock no.
  • RPMI Roswell Park Memorial Institute
  • E:T Ratio effector to target cell ratio
  • HCMV establishes a life-long persistent infection that requires long-lived cellular immunity to prevent disease.
  • a complex adaptive cell-mediated anti-viral immunity developed over many years to strongly control a viral infection in an aging person can be repurposed and harnessed to treat cancer.
  • each cell line was incubated for one hour at 37 °C under the following conditions: (1) CMV peptide at a final concentration of 1 ⁇ g/mL (positive control), (2) MPV.10.34.d at a final concentration of 2.5 ⁇ g/mL (negative control), (3) CMV-conjugated MPV.10.34.d IRC at a final concentration of 2.5 ⁇ g/mL, (4) CMV-conjugated HPV16 IRC at a final concentration of 2.5 ⁇ g/mL, and (5) no antigen (negative control). After 1 hour, the cells were washed vigorously with 200 ⁇ L of media for three times to remove non-specific binding.
  • CMV T cells Human patient donor CMV T cells (ASTARTE Biologics, Seattle, WA, US) were added at the E:T (effector cell:target cell) ratio of 10:1 and incubated in a tissue culture incubator for 24 hrs at 37C, 5% CO2. The total final volume of each sample after co-culture was 200 ⁇ L. Cell viability was measured after co-culturing. Cell viability was measured with CELLTITER- GLO® (Promega, Madison, WI, US). This assay provides a luciferase-expressing chemical probe that detects and binds to ATP, a marker of cell viability. The amount of ATP generated from tumor cells was quantified according to manufacturer protocols.
  • CMV-conjugated MPV.10.34.d IRC (“VERI-101” in Figures 25A, 25B, and 25C) was equally effective as CMV-conjugated HPV16 IRC (“CMV AIR-VLP” in Figures 25A, 25B, and 25C) in redirecting human healthy donor CMV pp65-specific CD8+ T-cells (Astarte Biologics, Inc., Bothell, WA, US) to kill immortalized HLA.A2 positive human colon cancer cells (HCT116), human ovarian cancer cells (OVCAR3), and human breast cancer cells (MCF7).
  • HCT116 human colon cancer cells
  • OFVCAR3 human ovarian cancer cells
  • MCF7 human breast cancer cells
  • Example 12 Sequential Mechanism of MPV.10.34.d IRC Binding and Peptide Cleavage [0300]
  • Example 9 demonstrates that MPV.10.34.d IRC binding must occur prior to furin-dependent cleavage of the peptide and peptide loading onto target tumor cells.
  • Example 13 Sequential Mechanism of MPV.10.34.d IRC Binding and Tumor Cell Death
  • Example 9 shows that inhibition of OVA-conjugated MPV.10.34.d IRC binding results in inhibition of furin-dependent cleavage of the peptide from the IRC and OVA peptide loading onto tumor cell surfaces.
  • cytotoxicity studies conducted as in Example 10 were performed in the presence and absence of soluble heparin, a competitor of HSPG binding.
  • MPV.10.34.d capsid backbones (thin dash line, “ViP” only) was included as a negative control. After 1 hour, the samples were added to the TC-1 cells and co-incubated for a further 30 minutes in a cell culture incubator at 37 °C, 5% CO 2 . Following this, treated cells were washed 3 times with just AIM-V media before being incubated with OT-1 T-cells at an effector to target (E:T) ratio of 18:1, 9:1, or 4.5:1. This co-culture was then incubated for a further 3 hours at 37 °C, 5% CO2.
  • Example 14 GARDASIL®9-Generated Antibodies do Not Inhibit MPV.10.34.d IRC Effects [0309] Vaccination with GARDASIL®9 results in long term (>10 years) of sustained HPV L1 capsid-specific antibodies that are able to prevent HPV infection and subsequently, prevent HPV-associated cervical cancers. Although GARDASIL®9 has been reported to be only effective against nine types of HPVs, some cross-neutralization against other types of papillomavirus capsids may be expected.
  • IRC OVA-conjugated MPV.10.34.d IRC was diluted in the same AIM-V media + 2% BSA into 0.625 ⁇ g/mL, 0.3125 ⁇ g/mL, and 0.156 ⁇ g/mL, and each sample was incubated with a 1:200 dilution of GARDASIL®9 serum (thick-dashed lines) or without (solid line) for 1 hour at 2 °C to 8 °C.
  • MPV.10.34.d alone was also included as a negative control. (See, Figures 30A, 30B, and 30C).
  • the samples were added to the TC-1 cells and co-incubated for 30 minutes in a cell culture incubator at 37 °C, 5% CO2.
  • treated cells were washed 3 times with just AIM-V media before being incubated with OT-1 T-cells at an effector to target (E: T) ratio of 18:1, 9:1, or 4.5:1.
  • E: T effector to target
  • Example 15 Anti-MPV.10.34.d IRC Antibodies do Not Inhibit Tumor Cell Cytotoxicity [0313] Since MPV.10.34.d IRC sequences are based on MPV L1 capsids, it was desirable to test whether antibodies generated against wild type MPV or MPV.10.34.d IRC affect the mechanism of action of MPV.10.34.d IRCs against tumors. [0314] Antibodies against wild type MPV were generated as follows: New Zealand white rabbits (n 3) were administered three intra-muscular vaccinations of 50 ⁇ g of wild type mouse papillomavirus particles per dose. Rabbits were vaccinated at months 0, 1, and 2. After two weeks post final vaccination, rabbits were bled to obtain the anti-MPV sera.
  • the assays were performed as described in Example 5 with the following differences: serum samples were tested at a 1:100 dilution factor and two-fold serial dilutions. Goat anti-mouse IgG-HRP secondary antibody was used in the ELISA (1:7000). Binding of anti-MPV.10.34.d IRC sera (Figure 31) and anti-MPV serum (data not shown) to both MPV.10.34.d capsid backbone ( Figure 31A) and MPV.10.34.d IRC ( Figure 31B) was observed.
  • Results of these tests reveals that incubation of samples with anti-MPV rabbit IgG serum ( Figure 33A) or anti-MPV.10.34.d IRC mouse IgG serum ( Figure 33B) are still able to bind to target tumor cells.
  • the results from Example 15 collectively show that antibodies specific for MPV.10.34.d IRCs elicited in vivo bind specifically to the MPV.10.34.d IRCs. However, these antibodies do not block MPV.10.34.d IRCs from binding to tumor cells ( Figure 33) and thus, also do not inhibit the overall cytotoxic mechanism of the MPV.10.34.d IRCs ( Figure 32).
  • Example 16 Peptide Loading on Cells Deficient in MHC Class 1 Intracellular Pathway Components [0320]
  • Example 9 demonstrates loading of peptide from IRCs onto the tumor cell surface.
  • peptide loading assays were performed with a cell line (RMA-S cells) that is genetically deficient (TAP-deficient) in intracellular MHC Class 1 processing proteins. If peptide loading onto the tumor cell surface still occurs in this context, it must be through extracellular mechanisms. [0321] A range of OVA-conjugated MPV.10.34.d IRC concentrations (0.625 ⁇ g/mL to 10 ⁇ g/mL) was tested for their ability to load RMA-S cells with peptide. These binding assays were conducted as previously described.
  • RMA-S cells at 2 x 10 6 cells/mL were resuspended into a single cell suspension and 100 ⁇ L (0.2 x 10 6 of RMA-S cells) was dispensed into FACS tubes. Varying amounts of OVA-conjugated MPV.10.34.d IRC was added (0.625 ⁇ g/mL to 10 ⁇ g/mL) to the samples and the samples were then incubated at 37 °C, 5% CO 2 for one hour. Afterwards, the cells were washed twice in 2 mL of FACS buffer (PBS, pH7.0, 1% BSA).
  • FACS buffer PBS, pH7.0, 1% BSA
  • the cells were stained with 1 ⁇ L of PE-conjugated anti-SIINFEKL (SEQ ID NO:95) / Kb antibody.
  • the cells were washed twice in 2 mL of FACS buffer (PBS, pH7.0, 1% BSA). The samples were then resuspended in about 250 ⁇ L of FACS buffer and peptide binding was analyzed via MFI.
  • FACS buffer PBS, pH7.0, 1% BSA
  • the samples were then resuspended in about 250 ⁇ L of FACS buffer and peptide binding was analyzed via MFI.
  • the data reveal that increasing levels of OVA peptide-MHC complex in these cells as higher concentrations of OVA-conjugated MPV.10.34.d IRCs were added. These data appear to establish that the MPV.10.34.d IRCs label target tumor cells by an extracellular mechanism.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Oncology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2021/055676 2020-10-19 2021-10-19 Virus-inspired compositions and methods of redirecting preexisting immune responses using the same for treatment of cancer Ceased WO2022087013A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
CA3195963A CA3195963A1 (en) 2020-10-19 2021-10-19 Virus-inspired compositions and methods of redirecting preexisting immune responses using the same for treatment of cancer
EP21883734.2A EP4228687A4 (en) 2020-10-19 2021-10-19 VIRUS-INSPIRED COMPOSITIONS AND METHODS FOR REROUTERING PRE-EXISTING IMMUNE RESPONSES AND THEREBY FOR THE TREATMENT OF CANCER
CN202180082211.2A CN116583297A (zh) 2020-10-19 2021-10-19 病毒启发的组合物和使用其重定向预先存在的免疫反应以治疗癌症的方法
IL302190A IL302190A (en) 2020-10-19 2021-10-19 Virus-induced preparations and methods for redirecting immune responses in the use of said preparations for cancer treatment
AU2021364548A AU2021364548A1 (en) 2020-10-19 2021-10-19 Virus-inspired compositions and methods of redirecting preexisting immune responses using the same for treatment of cancer
KR1020237016812A KR20230129379A (ko) 2020-10-19 2021-10-19 바이러스에 영향받은 조성물 및 암 치료를 위해 이를 사용하여 기존 면역 반응을 재지향시키는 방법
JP2023524090A JP2023552040A (ja) 2020-10-19 2021-10-19 ウイルスにインスパイアされた組成物及びがんの治療のために同じものを使用して、既存の免疫応答をリダイレクトする方法
MX2023004465A MX2023004465A (es) 2020-10-19 2021-10-19 Composiciones basadas en virus y métodos para redirigir respuestas inmunitarias preexistentes mediante su uso para el tratamiento del cáncer.

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202063093525P 2020-10-19 2020-10-19
US63/093,525 2020-10-19
US202163220485P 2021-07-10 2021-07-10
US63/220,485 2021-07-10

Publications (1)

Publication Number Publication Date
WO2022087013A1 true WO2022087013A1 (en) 2022-04-28

Family

ID=81291907

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/055676 Ceased WO2022087013A1 (en) 2020-10-19 2021-10-19 Virus-inspired compositions and methods of redirecting preexisting immune responses using the same for treatment of cancer

Country Status (9)

Country Link
US (2) US11858964B2 (cg-RX-API-DMAC7.html)
EP (1) EP4228687A4 (cg-RX-API-DMAC7.html)
JP (1) JP2023552040A (cg-RX-API-DMAC7.html)
KR (1) KR20230129379A (cg-RX-API-DMAC7.html)
AU (1) AU2021364548A1 (cg-RX-API-DMAC7.html)
CA (1) CA3195963A1 (cg-RX-API-DMAC7.html)
IL (1) IL302190A (cg-RX-API-DMAC7.html)
MX (1) MX2023004465A (cg-RX-API-DMAC7.html)
WO (1) WO2022087013A1 (cg-RX-API-DMAC7.html)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110891602A (zh) * 2017-06-23 2020-03-17 帕多瓦有限责任公司 嵌合病毒样颗粒以及其作为免疫反应的抗原特异性重定向剂的用途
CN116970574A (zh) * 2023-06-26 2023-10-31 广东省农业科学院动物卫生研究所 一种鹅源波形蛋白的用途、促进增殖鹅星状病毒的方法及用途、疫苗

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20240076320A1 (en) * 2022-09-01 2024-03-07 Novavax, Inc. Downstream process for purification of viral proteins with hydrophobic membrane domain for use in vaccine compositions
WO2024254149A2 (en) * 2023-06-06 2024-12-12 Verlmmune Inc. Virus-inspired compositions comprising virus-like proteins and checkpoint inhibitors, and methods of use thereof to treat cancer

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130295125A1 (en) * 2012-05-04 2013-11-07 University Of Louisville Research Foundation Compositions and methods relating to mouse papilloma virus
US20200113996A1 (en) * 2017-06-23 2020-04-16 Pathovax Llc Chimeric virus-like particles and uses thereof as antigen-specific redirectors of immune responses
US20200291072A1 (en) * 2018-12-27 2020-09-17 Verimmune Inc. Conjugated virus-like particles and uses thereof as anti-tumor immune redirectors

Family Cites Families (48)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020164350A1 (en) 1992-09-03 2002-11-07 Lowy Douglas R. Chimeric papillomavirus-like particles
US8062642B1 (en) 1993-03-09 2011-11-22 University Of Rochester Production of papillomavirus capsid protein and virus-like particles
US20020039584A1 (en) 1998-02-20 2002-04-04 Medigene Ag Papilloma virus capsomere vaccine formulations and methods of use
TR200102423T2 (tr) 1998-12-04 2002-02-21 Biogen, Inc. Peptid ligandları yoluyla bağlı birden fazla imünojenik bileşeni olan HBV çekirdek antijeni parçacıkları
SE514982C2 (sv) 1999-09-30 2001-05-28 Active Biotech Ab Bärare innehållande ett huvudkapsidprotein L1 från humant papillomavirus samt dess användning
US9045727B2 (en) 2002-05-17 2015-06-02 Emory University Virus-like particles, methods of preparation, and immunogenic compositions
GB2392158B (en) 2002-08-21 2005-02-16 Proimmune Ltd Chimeric MHC protein and oligomer thereof
KR20050114225A (ko) 2003-03-07 2005-12-05 머크 앤드 캄파니 인코포레이티드 인플루엔자 바이러스 백신
WO2004101598A2 (en) 2003-05-09 2004-11-25 Research Development Foundation Insertion of furin protease cleavage sites in membrane proteins and uses thereof
US20070160628A1 (en) 2005-08-31 2007-07-12 Birkett Ashley J Stabilized virus-like particles and epitope display systems
US20070104689A1 (en) 2005-09-27 2007-05-10 Merck Patent Gmbh Compositions and methods for treating tumors presenting survivin antigens
MX2008007292A (es) 2005-12-08 2008-10-17 Univ Louisville Res Found Composiciones inmunoestimuladoras y metodos.
WO2008082719A2 (en) 2006-08-30 2008-07-10 University Of Rochester Combined human papillomavirus vlp/gene delivery system and use thereof as a vaccine for prophylaxis and immunotherapy of infectious diseases and tumors
PT2145189E (pt) 2007-05-08 2016-06-16 Us Health Pseudovírus de papilomavírus para deteção e terapêutica de tumores
EP2217699A4 (en) 2007-10-22 2012-11-28 Univ Rochester RESPIRATORY SYNCYTIAL VIRUS VACCINE BASED ON CHIMERIC PAPILLOMAVIRUS-SIMILAR PARTICLES OR CAPSOMERS
WO2009092113A2 (en) 2008-01-19 2009-07-23 Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods and compositions for the delivery of vaccines to disrupted epithelium
BRPI0915076A2 (pt) 2008-06-09 2017-03-14 Bharat Biotech Int Ltd composições de vacina, composição imunogênica, método para expressão dos antígenos quiméricos de hpv-hbsag supramencionados, composição farmacêutica, método para ocasionar resposta de anticorpo protetor para composição antigênica e/ou resposta de célula t citotóxica, uso das formulações antigênicas supramencionadas.
CN107080833A (zh) 2009-04-10 2017-08-22 约翰·霍普金斯大学 作为广谱人类乳头状瘤病毒(hpv)疫苗的乳头状瘤病毒样颗粒(vlp)
CN107252489A (zh) 2009-04-13 2017-10-17 法国健康和医学研究院 Hpv颗粒及其用途
US20120052088A1 (en) 2009-04-30 2012-03-01 Coley Pharmaceutical Group, Inc. Pneumococcal vaccine and uses thereof
US9580474B2 (en) 2010-09-08 2017-02-28 The Johns Hopkins University Polyionic papilloma virus-like particle (VLP) vaccines
CN103561771B (zh) 2011-03-17 2019-01-04 伯明翰大学 重新定向的免疫治疗
KR20140050698A (ko) 2011-07-29 2014-04-29 셀렉타 바이오사이언시즈, 인크. 체액성 및 세포독성 t 림프구(ctl) 면역 반응을 발생시키는 합성 나노운반체
US9771397B2 (en) 2011-12-01 2017-09-26 University Of Cape Town HPV chimaeric particle
WO2013119877A1 (en) 2012-02-07 2013-08-15 Aura Biosciences, Inc. Virion-derived nanospheres for selective delivery of therapeutic and diagnostic agents to cancer cells
US9561275B2 (en) 2012-09-14 2017-02-07 The Johns Hopkins University Compositions and methods for rendering tumor cells susceptible to CD8+ T cell-mediated killing
CA2942654A1 (en) 2013-03-15 2014-09-18 Bullet Biotechnology, Inc. Specific multivalent virus-like particle vaccines and uses thereof
EP3046583B1 (en) 2013-09-18 2019-02-13 Aura Biosciences, Inc. Virus-like particle conjugates for treatment of tumors
ES2738582T3 (es) 2014-02-14 2020-01-23 Immune Design Corp Inmunoterapia del cáncer a través de combinación de inmunoestimulación local y sistémica
WO2015196112A1 (en) 2014-06-19 2015-12-23 The Regents Of The University Of Colorado, A Body Corporate Human papilloma virus constructs
ES2727552T3 (es) 2015-02-18 2019-10-17 Hoffmann La Roche Inmunoconjugados para la inducción específica de la citotoxicidad de los linfocitos T frente a una célula diana
US11213577B2 (en) 2015-04-28 2022-01-04 Albert Einstein College Of Medicine, Inc. Treatment of cancer using recall antigens delivered by attenuated bacteria
WO2017020570A1 (en) 2015-08-06 2017-02-09 Medigen Biotechnology Corp. Virus-like particle vaccines
WO2017075615A1 (en) 2015-10-29 2017-05-04 Bullet Biotechnology, Inc. Virus-like particle intermediates, agents attached thereto, methods for making and uses thereof
WO2017075399A1 (en) 2015-10-30 2017-05-04 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Targeted cancer therapy
JP2018532801A (ja) 2015-10-30 2018-11-08 ザ ユナイテッド ステイツ オブ アメリカ, アズ リプレゼンテッド バイ ザ セクレタリー, デパートメント オブ ヘルス アンド ヒューマン サービシーズ 標的化がん療法
EP3368068B1 (en) 2015-10-30 2020-11-18 University of Copenhagen Virus like particle with efficient epitope display
EP3370755B1 (en) 2015-11-06 2021-09-29 Regents of the University of Minnesota Activation of resident memory t cells for cancer immunotherapy
FI3377103T4 (fi) 2015-11-19 2025-04-16 Revitope Limited Funktionaalinen vasta-ainefragmenttikomplementointi kaksikomponenttiselle järjestelmälle epätoivottujen solujen uudelleenohjattua tappamista varten
WO2017112830A1 (en) 2015-12-21 2017-06-29 La Jolla Institute For Allergy And Immunology Leveraging immune memory from common childhood vaccines to fight disease
WO2017112797A1 (en) 2015-12-22 2017-06-29 Thomas Jefferson University Intra-lesional cmv-based cancer vaccines
WO2017177204A1 (en) 2016-04-09 2017-10-12 La Jolla Institute For Allergy And Immunology Leveraging immune memory from common childhood vaccines to fight disease
WO2018106972A1 (en) 2016-12-07 2018-06-14 La Jolla Institute For Allergy And Immunology Compositions for cancer treatment and methods and uses for cancer treatment and prognosis
US11197890B2 (en) 2016-12-12 2021-12-14 New York Society For The Relief Of The Ruptured And Crippled, Maintaining The Hospital For Special Surgery Methods of treating cancer, infectious disease, and autoimmune disease using CXC chemokines
EP3661550A4 (en) 2017-08-03 2021-08-04 Regents of the University of Minnesota ACTIVATION OF LYMPHOCYTES T MEMORY RESIDENTS FOR THE TREATMENT OF CANCER
KR20250044945A (ko) 2017-11-06 2025-04-01 더 유나이티드 스테이츠 오브 어메리카, 애즈 리프리젠티드 바이 더 세크러테리, 디파트먼트 오브 헬쓰 앤드 휴먼 서비씨즈 기존의 미생물 면역을 활용한 암 치료
WO2020017962A1 (en) 2018-07-16 2020-01-23 Dcprime B.V. A combination product for use in tumor vaccination.
AU2020248407C1 (en) 2019-03-26 2025-12-04 Aura Biosciences, Inc. Human papillomavirus nanoparticle formulations

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130295125A1 (en) * 2012-05-04 2013-11-07 University Of Louisville Research Foundation Compositions and methods relating to mouse papilloma virus
US20200113996A1 (en) * 2017-06-23 2020-04-16 Pathovax Llc Chimeric virus-like particles and uses thereof as antigen-specific redirectors of immune responses
US20200291072A1 (en) * 2018-12-27 2020-09-17 Verimmune Inc. Conjugated virus-like particles and uses thereof as anti-tumor immune redirectors

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP4228687A4 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110891602A (zh) * 2017-06-23 2020-03-17 帕多瓦有限责任公司 嵌合病毒样颗粒以及其作为免疫反应的抗原特异性重定向剂的用途
CN116970574A (zh) * 2023-06-26 2023-10-31 广东省农业科学院动物卫生研究所 一种鹅源波形蛋白的用途、促进增殖鹅星状病毒的方法及用途、疫苗
CN116970574B (zh) * 2023-06-26 2024-02-09 广东省农业科学院动物卫生研究所 一种鹅源波形蛋白的用途、促进增殖鹅星状病毒的方法及用途、疫苗

Also Published As

Publication number Publication date
EP4228687A1 (en) 2023-08-23
KR20230129379A (ko) 2023-09-08
US12344637B2 (en) 2025-07-01
US20240294577A1 (en) 2024-09-05
US20220135624A1 (en) 2022-05-05
AU2021364548A1 (en) 2023-06-08
MX2023004465A (es) 2023-06-19
US11858964B2 (en) 2024-01-02
EP4228687A4 (en) 2025-05-07
JP2023552040A (ja) 2023-12-14
IL302190A (en) 2023-06-01
CA3195963A1 (en) 2022-04-28

Similar Documents

Publication Publication Date Title
US12528839B2 (en) Conjugated virus-like particles and uses thereof as anti-tumor immune redirectors
US12344637B2 (en) Virus-inspired compositions and methods of redirecting preexisting immune responses using the same for treatment of cancer
JP7614841B2 (ja) 抗原性呼吸器合胞体ウイルスポリペプチド
US11944677B2 (en) Chimeric virus-like particles and uses thereof as antigen-specific redirectors of immune responses
JP5545209B2 (ja) 免疫原性を有する物質
Zhang et al. A rationally designed flagellin-L2 fusion protein induced serum and mucosal neutralizing antibodies against multiple HPV types
CN116583297A (zh) 病毒启发的组合物和使用其重定向预先存在的免疫反应以治疗癌症的方法
WO2024254149A2 (en) Virus-inspired compositions comprising virus-like proteins and checkpoint inhibitors, and methods of use thereof to treat cancer
CN117777304A (zh) 呼吸道相关病毒纳米蛋白颗粒及其制备方法和用途
EA050293B1 (ru) Химерные вирусоподобные частицы и их применение в качестве антигенспецифичных агентов, перенаправляющих иммунные ответы

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21883734

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3195963

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2023524090

Country of ref document: JP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023007397

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 202327034300

Country of ref document: IN

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021883734

Country of ref document: EP

Effective date: 20230519

WWE Wipo information: entry into national phase

Ref document number: 202180082211.2

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 2021364548

Country of ref document: AU

Date of ref document: 20211019

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112023007397

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230419