WO2022075693A1 - 활성산소종 감응성을 가지는, 고분자가 코팅된 금 나노입자-압타머 나노구조체의 개발 및 응용 - Google Patents
활성산소종 감응성을 가지는, 고분자가 코팅된 금 나노입자-압타머 나노구조체의 개발 및 응용 Download PDFInfo
- Publication number
- WO2022075693A1 WO2022075693A1 PCT/KR2021/013605 KR2021013605W WO2022075693A1 WO 2022075693 A1 WO2022075693 A1 WO 2022075693A1 KR 2021013605 W KR2021013605 W KR 2021013605W WO 2022075693 A1 WO2022075693 A1 WO 2022075693A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- aptamer
- atp
- ppba
- nanostructure
- apt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
- A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
- A61K47/6921—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
- A61K47/6923—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being an inorganic particle, e.g. ceramic particles, silica particles, ferrite or synsorb
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
- A61K47/6921—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
- A61K47/6927—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
- A61K47/6929—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
- A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
- A61K9/51—Nanocapsules; Nanoparticles
- A61K9/5107—Excipients; Inactive ingredients
- A61K9/513—Organic macromolecular compounds; Dendrimers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
Definitions
- the present invention relates to the development and application of polymer-coated gold nanoparticles-aptamer nanostructures having reactive oxygen species sensitivity, and more particularly, related to disease progression through gold nanoparticles-modified aptamers. It relates to a nanostructure that can be used for various diseases such as inflammatory diseases through a polymer coating that can be controlled by reactive oxygen species, which is known to be capable of capturing disease-related factors such as cytokines and increasing the occurrence in inflammatory diseases.
- An aptamer is a single-stranded DNA or RNA oligonucleotide having a specific three-dimensional structure capable of binding to a specific target with high affinity and specificity like an antibody.
- targets for aptamers such as small molecule compounds, peptides, and proteins.
- the aptamer has advantages such as a smaller size, better tissue permeability, ease of chemical modification, and no immune response in the body.
- the aptamer when the aptamer is to be used in the body, it has a problem of poor stability in the body, so it is common to develop and utilize a hybrid material such as combining it with PEG (polyethylene glycol).
- PEG polyethylene glycol
- gold nanoparticles-aptamer hybrid materials are being actively studied for diagnostic and therapeutic purposes due to their ease of synthesis and application and high stability.
- the existing gold nanoparticle-aptamer hybrid materials do not fully utilize the functionality of the aptamer, and the case of forming a nanostructure by utilizing the aptamer's ability to capture the target material is largely unknown.
- Reactive oxygen species (ROS) and TNF- ⁇ are representative inflammatory factors, and are known to exacerbate diseases by being overexpressed in inflammatory diseases, etc., and reactive oxygen species and VEGF are related to neovascularization such as cancer and macular degeneration It is known that overexpression in the disease exacerbates the disease. Therefore, these diseases can obtain a therapeutic effect by inhibiting TNF- ⁇ or VEGF, and a TNF- ⁇ inhibitor or VEGF inhibitor is actually used for treatment.
- the polymer-coated gold nanoparticles-aptamer nanostructure of the present invention suppresses reactive oxygen species through a polymer coating capable of capturing reactive oxygen species, and inhibits TNF- ⁇ or VEGF through the aptamer to treat the disease can be treated
- Patent Document 1 Korean Patent Publication No. 10-2018-0064585 (Antibacterial nanostructure and its use)
- Patent Document 2 Korean Patent Registration No. 10-2023839 (High-efficiency aptamer complex including branched DNA and aptamer and uses thereof)
- the present invention prepares a polymer-coated gold nanoparticle-aptamer nanostructure by a simple process, wherein the polymer coating is removed by capturing active oxygen species only in the presence of active oxygen species, and the aptamer is removed after the polymer coating is removed.
- the goal is to realize an intelligent nanostructure that captures disease-related factors.
- the present invention provides a preparation and utilization of a nanostructure comprising gold nanoparticles, an aptamer bound to the surface of the gold nanoparticles, and a polymer bound to the aptamer around ATP.
- the gold nanoparticles may have a spherical shape and a size of 10 to 200 nm.
- aptamer two types of aptamers exist together in a single strand, and one aptamer is an aptamer that binds to a target disease-related factor and can capture the target, and the other aptamer is an aptamer that binds to ATP and interacts with ATP. It helps to form nanostructures.
- the target may be a cytokine overexpressed in a specific disease, and may be VEGF or TNF- ⁇ .
- the polymer is polymerized phenylboronic acid, and may be a copolymer in which phenylboronic acid is bonded to a maleic anhydride polymer, and forms a polymer-coated nanostructure by binding with ATP.
- the polymer can control the binding of the aptamer to the target by trapping reactive oxygen species.
- the present invention relates to the preparation and application of a nanostructure comprising gold nanoparticles, an aptamer binding to the surface of the gold nanoparticles, and a polymer binding to the aptamer with ATP as a center, wherein the nanostructure is a simple method can be synthesized, and the target material capture aptamer coated (blocking) with polymerized phenylboronic acid while effectively removing reactive oxygen species can be exposed, and the exposed aptamer can target substances such as TNF- ⁇ and VEGF Since it can be captured, it can be used for treatment of diseases such as inflammatory diseases, cancer, and macular degeneration diseases in which reactive oxygen species, TNF- ⁇ , VEGF, etc. are overexpressed.
- diseases such as inflammatory diseases, cancer, and macular degeneration diseases in which reactive oxygen species, TNF- ⁇ , VEGF, etc. are overexpressed.
- FIG. 1 is a diagram simulating the formation of polymer-coated gold nanoparticles-aptamer nanostructures and anti-inflammatory action in inflammatory diseases according to an embodiment of the present invention.
- FIG. 2 is a view showing a method for synthesizing gold nanoparticles and a result of a transmission electron microscope (TEM) analysis according to an embodiment of the present invention.
- TEM transmission electron microscope
- FIG. 3 is a view showing the number of aptamers modified in gold nanoparticles as a result of a method for synthesizing gold nanoparticles modified with aptamers and a result of dynamic light scattering (DLS) analysis according to an embodiment of the present invention
- FIG. 3 is a view showing the number of aptamers modified in gold nanoparticles as a result of a method for synthesizing gold nanoparticles modified with aptamers and a result of dynamic light scattering (DLS) analysis according to an embodiment of the present invention
- FIG. 4 is a view showing the results of transmission electron microscopy analysis and electron energy loss spectrometry analysis results of Au-Apt and Au-Ctrl.
- FIG. 5 is a view showing a method for synthesizing polymerized phenylboronic acid and a 1H nuclear magnetic resonance (Nuclear Magnetic Resonance) analysis result according to an embodiment of the present invention.
- FIG. 6 is a view showing a method for synthesizing a polymer-coated gold nanoparticle-aptamer nanostructure according to an embodiment of the present invention and an analysis result of an aptamer-modified gold nanoparticle-polymer interaction with or without ATP .
- FIG. 7 is a view showing a transmission electron microscope analysis result and electron energy loss spectroscopy analysis result according to the presence or absence of reactive oxygen species of Au-Apt-ATP-pPBA and Au-Ctrl-ATP-pPBA according to an embodiment of the present invention.
- FIG. 8 is a view showing the dynamic scattered light analysis results according to the presence or absence of reactive oxygen species of Au-Apt-ATP-pPBA and Au-Ctrl-ATP-pPBA according to an embodiment of the present invention.
- FIG. 9 is a view showing the evaluation results of the active oxygen species trapping ability of various samples including Au-Apt-ATP-pPBA according to an embodiment of the present invention.
- FIG. 10 is a view showing the evaluation results of the TNF- ⁇ trapping ability of various samples including Au-Apt-ATP-pPBA according to an embodiment of the present invention.
- 11 is a view showing the cytotoxicity evaluation results of Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA according to an embodiment of the present invention.
- FIG. 12 is a view showing the hemolysis test results of Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, and Au-Ctrl-ATP-pPBA according to an embodiment of the present invention.
- FIG. 13 shows the intracellular activity of the anti-inflammatory effects of Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, and Au-Ctrl-ATP-pPBA on cells activated by PMA according to an embodiment of the present invention; It is a diagram showing the results confirmed by the oxygen species fluorescence image.
- Figure 16 shows the anti-inflammatory effect of Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA on cells activated by H 2 O 2 according to an embodiment of the present invention; It is a diagram showing the results confirmed by the extracellular reactive oxygen species concentration, TNF- ⁇ concentration, and IL-6 concentration.
- 17 is a cytotoxicity according to the concentration of H 2 O 2 according to an embodiment of the present invention, and cytotoxicity evaluation results when a sample containing Au-Apt-ATP-pPBA is treated with H 2 O 2 It is a drawing.
- aptamer refers to 15-40 single-stranded oligonucleotides forming a specific three-dimensional structure, having a stem loop structure, and based on the three-dimensional structure, It has the property of specifically binding to a specific substance. Aptamers are chemically synthesized, chemically modified, stable to heat, and highly specific to a target. The sequence of the aptamer can be discovered by the SELEX (selective evolution of ligands by exponential enrichment) method, and hundreds of aptamer sequences have already been disclosed. Aptamers are often compared to antibodies in that they bind to target molecules with high affinity, but have the advantage of not having an in vivo immune response.
- Antibodies are protein molecules that are relatively large in size ( ⁇ 150 kDa), so they are expensive to produce, and modification (modification) is also not easy. It has the advantage of being easy to transform. Since the aptamer is composed of nucleic acid, it has very high stability compared to the antibody. In the case of protein or antibody drugs, it is impossible to store or transport them at room temperature, but aptamers are possible, and even after sterilization, they can maintain their functions. It is very easy to apply for diagnosis requiring repeated use.
- aptamers have disadvantages in that they are small in size and have low stability in the body due to the presence of various types of nucleic acid degrading enzymes in serum.
- cholesterol cholesterol
- biotin to the 5' or 3' end of the aptamer and attaching it to a streptavidin support, it can be used in the field of biosensors/chips (Dausse E. et al., Aptamers: a new class of oligonucleotides in the drug discovery pipeline?, Curr. Opin. Pharmacol, 2009).
- the present invention relates to the preparation and application of a polymer-coated gold nanoparticle-aptamer nanostructure that can be used in various fields such as inflammatory diseases.
- the gold nanoparticles are spherical and may have a size of 10 to 100 nm, 10 to 50 nm, or 10 to 20 nm, but the size of gold nanoparticles is well known to be controlled according to the synthesis method, so the size of the gold nanoparticles can be changed according to the purpose of use. Therefore, the size of the nanoparticles is not limited.
- the size refers to the diameter or diameter of the gold nanoparticles.
- the size of the gold nanoparticles can be analyzed by methods such as transmission electron microscopy or dynamic scattered light analysis.
- an aptamer is bound to the gold nanoparticles, and the aptamer includes an aptamer for a disease-related factor to be captured and a DNA aptamer for ATP for binding to ATP. Accordingly, the aptamer is generated by fusion of two types of aptamers. That is, the aptamer is a single-stranded DNA sequence capable of binding two types of target molecules by simultaneously possessing two types of aptamers.
- ATP has a characteristic of binding to phenylboronic acid
- gold nanoparticles combine with an aptamer for ATP attached to gold nanoparticles via ATP and polymerized phenylboronic acid
- a gold nanoparticle-aptamer nanostructure coated with a polymerized phenylboronic acid cage outside of the gold nanoparticles to which the aptamer is bound may be formed. Therefore, in the preparation of the gold nanoparticle-aptamer nanostructure of the present invention, the aptamer for ATP is essential for binding to ATP, but the aptamer for the disease-related factor is TNF- ⁇ , or VEGF shown as an example in the present invention. As long as it is an aptamer capable of trapping a specific target material as well as an aptamer, it may be changed without being limited depending on the use.
- the disease-related factor may be a biomarker that is known to be increased in expression according to a disease. Specifically, it may be one selected from IL-6, TNF- ⁇ , IL-1 ⁇ , MCP-1, and MIP-1 ⁇ , which are cytokines known to increase expression by an inflammatory response, but is not limited thereto.
- the disease-related factor may be VEGF.
- VEGF is an angiogenic factor, and when the expression of VEGF increases, abnormal angiogenesis increases. Specifically, overexpression of VEGF can be observed in diseases such as cancer and macular degeneration.
- the disease-related factor may be thrombin.
- thrombin is a factor directly involved in blood coagulation, and is involved in thrombus formation and vasoconstriction. Specifically, overexpression of thrombin can be observed in blood clotting-related diseases.
- the aptamer binding to the gold nanoparticles is a fusion of an aptamer for TNF- ⁇ and an aptamer for ATP (SEQ ID NO: 1: ACCTGGGGGAGTATTGCGGAGGAAGGTTTTTTTTGGTGGATGGCGCAGTCGGCGACAATTTTTTT).
- SEQ ID NO: 1 ACCTGGGGGAGTATTGCGGAGGAAGGTTTTTTTTGGTGGATGGCGCAGTCGGCGACAATTTTTTTTT
- a fused form of an aptamer for VEGF and an aptamer for ATP SEQ ID NO: 2: ACCTGGGGGAGTATTGCGGAGGAAGGTTTTTTTCCCGTCTTCCAGACAAGAGTGCAGGGTTTTTTTTT-Thiol
- the 3' end of the aptamer is modified with a Thiol (-SH) group for bonding with gold nanoparticles.
- the gold nanoparticle-aptamer of the present invention combines polymerized phenylboronic acid [poly(methylvinyl ether-maleic anhydride)], which is a maleic anhydride polymer to which phenylboronic acid is bonded, and finally polymerized phenyl by means of ATP.
- a gold nanoparticle-aptamer nanostructure coated with boronic acid is produced.
- the polymerized phenylboronic acid may be used without limitation as long as it is a water-soluble polymer containing a plurality of phenylboronic acid.
- the ratio of phenylboronic acid in the polymerized phenylboronic acid can be appropriately controlled by controlling the amount of 3-aminophenylboronic acid, which is a phenylboronic acid monomer.
- the content of phenylboronic acid in the polymerized phenylboronic acid [poly(methylvinyl ether-maleic anhydride)] prepared in the present invention is 28%.
- Phenylboronic acid can be easily combined with the diol of ATP, and the phenylboron ester bond, which is formed at this time, has a property of being sensitively separated from reactive oxygen species, so the nanostructure of the present invention is sensitive to reactive oxygen species and It may have the ability to trap reactive oxygen species.
- the polymerized phenylboronic acid coated on gold nanoparticles via ATP in the form of a cage blocks the aptamer for disease-related factors.
- concentration of is high, phenylboronic acid traps reactive oxygen species, thereby exposing the aptamer to the disease-related factor, and the aptamer traps the target disease-related factor.
- the nanostructure of the present invention is targeted to a lesion site with a high concentration of reactive oxygen species in the body, and after capturing reactive oxygen species, depending on the type of aptamer, it is possible to capture cytokines overexpressed in the lesion, etc. have
- Active oxygen species are oxygen free radicals produced due to the chemical properties of oxygen and oxygen compounds derived therefrom.
- the nanostructure according to an embodiment of the present invention can be manufactured without a complicated synthesis process, and it has been confirmed that it has reactive oxygen species sensitivity and reactive oxygen species trapping ability, and TNF- ⁇ trapping ability, as well as cell and blood toxicity It was confirmed that it exhibits a high therapeutic effect in the inflammatory model of cells and mice without showing . Therefore, the nanostructure of the present invention can be utilized as an anti-inflammatory therapeutic agent.
- the inflammatory disease is pancreatitis, chronic hepatitis, esophagitis, gastritis, colitis, pneumonia, bronchitis, sore throat, peritonitis, myocardial infarction, heart failure, Alzheimer's disease, arthritis, renal failure, psoriasis, anemia, diabetes and fiber It may be any one or more selected from the group consisting of hwajeung, but is not limited thereto.
- the arthritis is composed of osteoarthritis, degenerative arthritis, inflammatory arthritis, rheumatoid arthritis, dissociative osteochondritis, joint ligament damage, meniscus damage, joint misalignment, avascular necrosis and juvenile idiopathic arthritis. It may be any one or more selected from the group, but is not limited thereto.
- the nanostructure according to an embodiment of the present invention has VEGF trapping ability, diseases related to VEGF overexpression, specifically various cancer diseases, rheumatoid arthritis, diabetic retinopathy, ischemic retinopathy, psoriasis, proliferative diabetic retinopathy, It can be used as a therapeutic agent for diseases such as macular degeneration.
- the efficacy of the nanostructure was verified through an inflammation model, but considering the anti-inflammatory principle of the nanostructure, it can be expected to show efficacy in various diseases related to inflammation, and disease that is a changeable component By altering the aptamer for the relevant factor, it is possible to show efficacy for the target disease.
- therapeutic agent means a composition administered for a specific purpose.
- the therapeutic agent of the present invention aims to be used for the treatment of cancer, inflammation, or macular degeneration, and is a composition comprising gold nanoparticles-aptamer nanostructures as an active ingredient, and a protein involved therein and pharmaceutically acceptable carriers, excipients or diluents.
- pharmaceutically acceptable carrier or excipient means one approved by a governmental regulatory department or listed in a governmental or other generally approved pharmacopeia for use in vertebrates, and more particularly in humans. do.
- the pharmaceutical composition of the present invention may be in the form of a suspension, solution or emulsion in an oily or aqueous carrier, and may be prepared in solid or semi-solid form.
- the pharmaceutical composition of the present invention may include formulation agents such as suspending agents, stabilizing agents, solubilizing agents and/or dispersing agents, and may be sterilized.
- the pharmaceutical composition may be stable under the conditions of manufacture and storage, and may be preserved against the contaminating action of microorganisms such as bacteria or fungi.
- the pharmaceutical composition of the present invention may be in sterile powder form for reconstitution with an appropriate carrier prior to use.
- the pharmaceutical compositions may be presented in unit-dose form, in microneedle patches, in ampoules, or in other unit-dose containers, or in multi-dose containers.
- the pharmaceutical composition may be stored in a freeze-dried (lyophilized) state requiring only the addition of a sterile liquid carrier, eg, water for injection immediately prior to use.
- a sterile liquid carrier eg, water for injection immediately prior to use.
- Immediate injection solutions and suspensions may be prepared as sterile powders, granules or tablets.
- the pharmaceutical composition of the present invention may be formulated or contained in a liquid in the form of microspheres.
- the pharmaceutical composition of the present invention may contain a pharmaceutically acceptable compound and/or mixture thereof at a concentration between 0.001 and 100,000 U/kg.
- the pharmaceutical compositions of the present invention may include suitable excipients, preservatives, suspending agents, additional stabilizing agents, dyes, buffers, antibacterial agents, antifungal agents, and isotonic agents, for example, sugar or sodium chloride.
- stabilizer refers to a compound optionally used in the pharmaceutical composition of the present invention to increase shelf life.
- the stabilizing agent may be a sugar, an amino acid, or a polymer.
- the pharmaceutical composition of the present invention may include one or more pharmaceutically acceptable carriers, and the carrier may be a solvent or a dispersion medium.
- pharmaceutically acceptable carriers include water, saline, ethanol, polyols (eg, glycerol, propylene glycol and liquid polyethylene glycol), oils, and suitable mixtures thereof.
- sterilization techniques applied to the pharmaceutical composition of the present invention include filtration through a bacteriostatic filter, incorporation of a sterile agent, irradiation, irradiation with sterile gas, heating, vacuum drying and freeze drying.
- administration means introducing the composition of the present invention to a patient by any suitable method, and the administration route of the composition of the present invention may be administered through any general route as long as it can reach the target tissue.
- Oral administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intranasal administration, rectal administration, intrathecal administration may be made, and for the purpose of the present invention, administration in the form of injection is preferred, It is not limited.
- the treatment method of the present invention may include administering the pharmaceutical composition in a pharmaceutically effective amount.
- the effective amount includes the type of disease, the severity of the disease, the type and content of excipients, the type of formulation and the patient's age, weight, general health, sex and diet, administration time, administration route, treatment period, concomitant drugs, etc. It can be adjusted according to various factors.
- Example 1-1 Preparation of polymer-coated gold nanoparticles-aptamer nanostructures
- Gold nanoparticles are synthesized by preparing 1.47 mM gold chloride hydrate in distilled water at 20 ml at 100°C, adding 400 ⁇ l of 0.34 M sodium citrate, and reacting for 15 minutes. Gold nanoparticles having a size of about 15 nm were confirmed by transmission electron microscopy (FIG. 2).
- aptamers for modifying gold nanoparticles by binding to gold nanoparticles, and specific sequences are described in Table 1 below (SEQ ID NO: 1 and SEQ ID NO: 3). Each aptamer is modified with a Thiol (-SH) group at the 3'-end to bind to the gold nanoparticles.
- -SH Thiol
- the Apt sequence is a sequence including an aptamer for ATP and an aptamer for TNF- ⁇ , and the Ctrl sequence includes only an aptamer for ATP and does not include an aptamer for TNF- ⁇ , but the Apt sequence and length is a non-specific sequence for the same TNF- ⁇ .
- each aptamer sequence (25 nmol) was activated by reducing it with 250 nmol tris(2-carboxyethyl)phosphine hydrochloride (TCEP ⁇ HCl), and then, 15 nM gold prepared above
- TCEP ⁇ HCl tris(2-carboxyethyl)phosphine hydrochloride
- 15 nM gold prepared above The nanoparticles were added to 5 ml and mixed for 52 hours. During mixing, 5 M NaCl was added at an interval of 4 hours a total of 3 times from the 16th hour to increase the NaCl concentration in the solution by 0.1 M, and finally to 0.3 M. After synthesis, unreacted substances were removed by centrifugation 3 times at 4,000 rpm for 5 minutes using a 100 kDa Amicon tube.
- the thiol group of the aptamer binds to the gold nanoparticles to modify the gold nanoparticles, and the modified gold nanoparticles are Au-Apt (which binds to TNF) according to the aptamer sequence.
- Aptamer + Aptamer binding to ATP), Au-Ctrl (aptamer binding to TNF + non-specific aptamer) was named.
- the polymer-coated gold nanoparticles-aptamer nanostructures were named Au-Apt-ATP-pPBA and Au-Ctrl-ATP-pPBA according to the aptamer sequence (see FIG. 6(a)).
- 50 nM of Au-Apt or Au-Ctrl and 250 nM Cy5.5-pPBA were added in PBS (pH 8.2) containing 5 mM Mg 2+ without ATP or 250 Mix in the presence of ⁇ M ATP.
- centrifugation was performed at 13,200 rpm for 30 minutes to observe the Cy5.5-pPBA fluorescence of the supernatant. (b), FIG. 6(c)).
- Example 1-2 Confirmation of sensitivity to reactive oxygen species of polymer-coated gold nanoparticles-aptamer nanostructures
- the boron signal of pPBA is detected in the nanostructure when there is no reactive oxygen species, but when it reacts with reactive oxygen species, the boron signal of pPBA is not detected, confirming that pPBA is removed by reactive oxygen species.
- the sizes of Au-Apt-ATP-pPBA and Au-Ctrl-ATP-pPBA, which were larger than Au-Apt and Au-Ctrl, returned to their original state after reaction with reactive oxygen species. It was confirmed that the nanostructure of the pPBA was removed in response to reactive oxygen species (FIG. 8).
- the H 2 O 2 group was mixed with 100 ⁇ M H 2 O 2 when each component was mixed.
- Au-Apt-ATP-pPBA was coated with an aptamer for TNF- ⁇ by pPBA (blocking), so it showed a significantly reduced TNF- ⁇ trapping ability compared to Au-Apt to which the aptamer was exposed. , It shows the TNF- ⁇ trapping ability restored upon H 2 O 2 treatment. This is because pPBA blocking the aptamer was removed as a reactive oxygen species of H 2 O 2 (FIG. 10(a)).
- Au-Apt-ATP-pPBA can be converted from inactive to active in TNF- ⁇ trapping according to reactive oxygen species response.
- Example 2-1 Confirmation of toxicity of polymer-coated gold nanoparticles-aptamer nanostructures
- Cytotoxicity was determined by dispensing RAW 264.7 cells into a 96-well culture plate at 10,000 cells/well and culturing for 24 hours.
- ATP-pPBA was treated with various concentrations (1.25, 2.5, 5, 10, 20, 40 nM) based on gold nanoparticles, and viability was confirmed after 24 hours. As a result, no significant cytotoxicity was observed in all samples used in the experiment (FIG. 11).
- red blood cells were isolated after collecting mouse whole blood, and then diluted 10 times in PBS to obtain a red blood cell solution.
- Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, and Au-Ctrl-ATP-pPBA of 20 nM based on gold nanoparticles were mixed for 6 hours, respectively, and centrifuged at 13,200 rpm for 30 minutes to obtain the supernatant.
- the dissolved hemoglobin was quantified by absorbance at 542 nm.
- the red blood cell solution treated with PBS was set as 0% hemolysis, and the final concentration of 0.1% Triton X-100 was set as 100% hemolysis. 12).
- Example 2-2 Confirmation of intracellular anti-inflammatory effect of polymer-coated gold nanoparticles-aptamer nanostructures
- RAW 264.7 cells were treated with phorbol 12-myristate 13-acetate. After activation (induction of inflammation) with (PMA) or H 2 O 2 , the experiment was conducted.
- TNF- ⁇ , IL-6 which are secreted by an inflammatory response and known as inflammatory factors, are regulated by the treatment of the polymer-coated gold nanoparticles-aptamer nanostructures of the present invention.
- RAW The 264.7 cells were seeded in a 12-well culture plate at 200,000 cells/well, and the medium was changed after 24 hours of incubation, and 20 nM Au-Apt, Au-Ctrl, Au-Apt- based on gold nanoparticles with 200 ng/mL PMA. ATP-pPBA and Au-Ctrl-ATP-pPBA were treated. After 24 hours, the medium was centrifuged at 13200 rpm for 30 minutes, and the concentration of reactive oxygen species, TNF- ⁇ , and IL-6 in the supernatant was confirmed by Amplex red assay and enzyme immunoassay.
- the H 2 O 2 treatment concentration was first determined to be 100 ⁇ M (Fig. 17(a)).
- Raw 264.7 cells were seeded at 10,000 cells/well in a 96-well culture plate, and the medium was replaced after 24 hours.
- Au-Apt, Au-Ctrl, Au-Apt- at 20 nM based on 100 ⁇ M H 2 O 2 and gold nanoparticles.
- ATP-pPBA and Au-Ctrl-ATP-pPBA were treated together.
- As a result of checking the cell viability after 24 hours using the cytotoxicity and viability test method it was confirmed that the cell viability increased similarly to the anti-inflammatory effect shown for each sample (FIG. 17(b)).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Epidemiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Nanotechnology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Inorganic Chemistry (AREA)
- Ophthalmology & Optometry (AREA)
- Ceramic Engineering (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Optics & Photonics (AREA)
- Pain & Pain Management (AREA)
- Rheumatology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
본 발명은 활성산소종 감응성을 가지고, 활성산소종 포집 및 TNF-α 포집을 통해 염증성 질환을 치료할 수 있는, 고분자가 코팅된 금 나노입자-압타머 나노구조체에 관한 것이다.
Description
본 출원은 2020년 10월 7일자 한국 특허 출원 제10-2020-0129318호에 기초한 우선권의 이익을 주장하며, 해당 한국 특허 출원의 문헌에 개시된 모든 내용은 본 명세서의 일부로서 포함된다.
본 발명은 활성산소종 감응성을 가지는, 고분자가 코팅된 금 나노입자-압타머 나노구조체의 개발 및 응용에 관한 것으로, 보다 상세하게는 금 나노입자에 개질화된 압타머를 통해 질환의 진행과 관련된 사이토카인 등의 질병관련인자의 포집이 가능하고 염증성 질환에서 발생이 증가한다고 알려진 활성산소종에 의해 조절 가능한 고분자 코팅을 통해 염증성 질환 등 다양한 질환에 활용할 수 있는 나노구조체에 관한 것이다.
압타머는 특정 타겟에 대해 항체와 마찬가지로 높은 친화성과 특이성을 가지고 결합할 수 있는 특이적인 3차원적 구조를 가지는 단일가닥 DNA 또는 RNA 올리고뉴클레오티드이다. 압타머에 대한 타겟은 소분자 화합물, 펩타이드, 단백질 등 다양하게 존재한다. 이러한 압타머는 항체에 비하여, 더 작은 사이즈, 더 우수한 조직 침투성, 화학적 변형의 용이성 및 체내에서 면역반응을 야기하지 않는다는 등의 장점을 가진다.
그러나 압타머를 체내에서 활용하고자 할 경우 체내에서의 안정성이 떨어지는 문제점을 가지고 있어 PEG(polyethylene glycol)과 결합시키는 등 하이브리드 물질을 개발하여 활용하는 것이 일반적이다. 특히, 금 나노입자-압타머 하이브리드 물질은 합성 및 응용이 용이하고 높은 안정성으로 인해 진단 및 치료 목적으로 활발하게 연구되고 있다.
그러나 기존의 금 나노입자-압타머 하이브리드 물질들은 압타머의 기능성을 충분히 활용하고 있지 않으며, 압타머의 타겟 물질 포획 능력을 활용해 나노구조체를 형성한 사례는 크게 알려진 바가 없다.
활성산소종(Reactive Oxygen Species; ROS)과 TNF-α는 대표적인 염증인자로서, 염증성 질환 등에서 과다하게 발현되어 질환을 악화시키는 것으로 알려져 있고, 활성산소종 및 VEGF는 암, 황반변성 등의 신생혈관 관련 질환에서 과다하게 발현되어 질환을 악화시키는 것으로 알려져 있다. 따라서, 이러한 질환들은 TNF-α 또는 VEGF를 억제함으로써 치료 효과를 얻을 수 있고 실제 TNF-α 저해제 또는 VEGF 저해제를 치료에 사용하고 있다.
본 발명에서는 압타머의 기능성을 확장시켜 타겟 물질 포획을 통한 치료 및 타겟 물질 포획을 통한 나노구조체 형성을 모두 달성하고자 하였으며, 기존에 존재하지 않던 특이한 나노구조체를 고안하였다.
본 발명의 고분자가 코팅된 금 나노입자-압타머 나노구조체는 활성산소종을 포집할 수 있는 고분자 코팅을 통해 활성산소종을 억제하고, 압타머를 통해 TNF-α 또는 VEGF를 억제하여 해당 질환을 치료할 수 있다.
[선행기술문헌]
특허문헌 1. 한국 공개특허 제 10-2018-0064585호 (항균용 나노 구조체 및 이의 용도)
특허문헌 2. 한국 등록특허 제 10-2023839호 (분지된 DNA, 압타머를 포함하는 고효율 압타머 복합체 및 이의 용도)
본 발명은 단순한 과정으로 고분자가 코팅된 금 나노입자-압타머 나노구조체를 제조하며, 상기 고분자 코팅은 활성산소종 존재 시에만 활성산소종을 포집하여 제거되고, 상기 압타머는 고분자 코팅이 제거된 후에 질병 관련 인자를 포집하는 지능적인 나노구조체를 구현하는 것을 그 목적으로 한다.
상기 목적 달성을 위해, 본 발명은 금 나노입자, 상기 금 나노입자의 표면에 결합되는 압타머, 및 상기 압타머에 ATP를 중심으로 결합되는 고분자로 이루어진 나노구조체의 제조 및 활용을 제공한다.
상기 금 나노입자는 구형으로 10~200 nm의 크기를 가질 수 있다.
상기 압타머는 두 종류의 압타머가 단일 가닥에 함께 존재하며, 그 중 한 압타머는 타겟이 되는 질병관련인자와 결합하는 압타머로 타겟을 포획할 수 있으며, 다른 압타머는 ATP에 결합하는 압타머로 ATP와 상호작용하여 나노구조체 형성을 돕는다.
상기 타겟은 특정 질환에서 과발현되는 사이토카인일 수 있고, VEGF, TNF-α일 수 있다.
상기 고분자는 고분자화된 페닐보론산으로, 말레산 무수물 중합체에 페닐보론산이 결합된 공중합체일 수 있고, ATP와 결합하여 고분자가 코팅된 나노구조체를 형성한다.
상기 고분자는 활성산소종을 포집하여 압타머와 타겟의 결합을 조절할 수 있다.
본 발명은 금 나노입자, 상기 금 나노입자의 표면에 결합하는 압타머, 및 상기 압타머에 ATP를 중심으로 결합하는 고분자를 포함하는 나노구조체의 제조 및 응용에 관한 것으로, 상기 나노 구조체는 단순한 방법으로 합성될 수 있으며, 활성산소종을 효과적으로 제거하면서 고분자화된 페닐보론산으로 코팅(블로킹)된 타겟 물질 포획 압타머가 노출될 수 있고, 이에 노출된 압타머가 TNF-α, VEGF와 같은 타겟 물질을 포획할 수 있으므로 활성산소종과 TNF-α, VEGF 등이 과발현되는 염증성 질환, 암, 황반변성 질환 등의 질환에 대한 치료용도로 활용될 수 있다.
도 1은 본 발명의 일 실시예에 따른 고분자가 코팅된 금 나노입자-압타머 나노구조체의 형성 및 염증 질환에서의 항염증 작용을 모사한 도면이다.
도 2는 본 발명의 일 실시예에 따른 금 나노입자의 합성 방법 및 투과 전자 현미경(Transmission Electron Microscope: TEM) 분석 결과를 나타낸 도면이다.
도 3은 본 발명의 일 실시예에 따른 압타머가 개질화된 금 나노입자의 합성 방법 및 동적 산란광(Dynamic Light Scattering: DLS) 분석 결과, 금 나노입자에 개질화된 압타머의 수를 나타낸 도면이다.
도 4는 Au-Apt 와 Au-Ctrl의 투과 전자 현미경 분석 결과 및 전자 에너지 손실 분광법(Electron Energy Loss Spectrometry) 분석 결과를 나타낸 도면이다.
도 5는 본 발명의 일 실시예에 따른 고분자화된 페닐보론산의 합성 방법 및 1H 핵자기공명(Nuclear Magnetic Resonance) 분석 결과를 나타낸 도면이다.
도 6은 본 발명의 일 실시예에 따른 고분자가 코팅된 금 나노입자-압타머 나노구조체의 합성 방법 및 ATP 유무에 따른 압타머가 개질화된 금 나노입자-고분자 간 상호작용 분석 결과를 나타낸 도면이다.
도 7은 본 발명의 일 실시예에 따른 Au-Apt-ATP-pPBA와 Au-Ctrl-ATP-pPBA의 활성산소종 유무에 따른 투과 전자 현미경 분석 결과 및 전자 에너지 손실 분광법 분석 결과를 나타낸 도면이다.
도 8은 본 발명의 일 실시예에 따른 Au-Apt-ATP-pPBA와 Au-Ctrl-ATP-pPBA의 활성산소종 유무에 따른 동적 산란광 분석 결과를 나타낸 도면이다.
도 9는 본 발명의 일 실시예에 따른 Au-Apt-ATP-pPBA를 포함한 다양한 시료의 활성산소종 포집 능력 평가 결과를 나타낸 도면이다.
도 10은 본 발명의 일 실시예에 따른 Au-Apt-ATP-pPBA를 포함한 다양한 시료의 TNF-α 포집 능력 평가 결과를 나타낸 도면이다.
도 11은 본 발명의 일 실시예에 따른 Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA의 세포 독성 평가 결과를 나타낸 도면이다.
도 12는 본 발명의 일 실시예에 따른 Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA의 용혈도 시험 결과를 나타낸 도면이다.
도 13은 본 발명의 일 실시예에 따른 PMA에 의해 활성화된 세포에 대한 Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA의 항염증 효과를 세포 내 활성산소종 형광 이미지로 확인한 결과를 나타낸 도면이다.
도 14는 본 발명의 일 실시예에 따른 PMA에 의해 활성화된 세포에 대한 Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA의 항염증 효과를 세포 외 활성산소종 농도, TNF-α 농도, IL-6 농도로 확인한 결과를 나타낸 도면이다.
도 15는 본 발명의 일 실시예에 따른 hydrogen peroxide(H2O2)에 의해 활성화된 세포에 대한 Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA의 항염증 효과를 세포 내 활성산소종 형광 이미지로 확인한 결과를 나타낸 도면이다.
도 16은 본 발명의 일 실시예에 따른 H2O2에 의해 활성화된 세포에 대한 Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA의 항염증 효과를 세포 외 활성산소종 농도, TNF-α 농도, IL-6 농도로 확인한 결과를 나타낸 도면이다.
도 17은 본 발명의 일 실시예에 따른 H2O2의 농도에 따른 세포 독성과, Au-Apt-ATP-pPBA를 포함한 시료를 H2O2와 함께 처리하였을 때의 세포 독성 평가 결과를 나타낸 도면이다.
도 18은 본 발명의 일 실시예에 따른 마우스 복막염 모델에 대한 Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA의 항염증 효과를 복막액 내 TNF-α 및 IL-6 농도로 평가한 결과를 나타낸 도면이다.
도 19는 본 발명의 일 실시예에 따른 마우스 복막염 모델에 대한 Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA의 항염증 효과를 혈액 내 TNF-α 및 IL-6 농도로 평가한 결과를 나타낸 도면이다.
이하에서 본 발명에 대하여 구체적으로 설명한다. 본 발명에 대한 설명 및 도면에서는 발명의 요지를 흐릴 수 있는 공지의 내용은 기재를 생략할 수 있고, 본 발명을 이해를 돕기 위해 도면 구성의 일부는 과장 또는 생략될 수 있으며, 본 명세서에서 따로 정의하지 않는 용어에 대하여는 본 발명이 속하는 분야에서 통상의 지식을 가진 자가 일반적으로 이해할 수 있는 의미로 해석되어야 할 것이다.
본 명세서에 있어서 “압타머(aptamer)”란, 특이적인 3차원적 구조를 형성하는 15-40개의 단일가닥 올리고뉴클레오티드로서, 스템 루프(stem loop) 구조를 가지며, 상기 3차원적 구조를 기반으로 특정 물질에 특이적으로 결합하는 성질이 있다. 압타머는 화학적으로 합성이 용이하며, 화학적 변형이 쉽고 열에 안정적이면서 타겟에 대한 특이도가 매우 높은 화합물이다. 압타머의 서열은 SELEX(selective evolution of ligands by exponential enrichment)법으로 발굴할 수 있으며, 이미 수백 종의 압타머 서열이 공개되어 있다. 압타머는 높은 친화성으로 표적 분자와 결합한다는 점에서 흔히 항체와 비교되기도 하지만, 생체 내 면역반응이 없다는 장점이 있다.
항체는 단백질 분자로 크기가 비교적 크기 때문에(~150kDa) 생산하는데 비용이 많이 들고, 변형(modification) 또한 용이하지 못한 반면, 압타머는 약 20~60mer 정도 길이의 핵산으로 구성되어 있는 작은 분자 구조이고, 변형이 용이한 장점을 가지고 있다. 압타머는 핵산으로 이루어져 있기 때문에, 항체에 비해 안정성이 매우 높다. 단백질이나 항체 의약품의 경우 실온에서 보관이나 운반이 불가능하지만 압타머는 가능하고, 심지어 멸균 후에도 기능을 유지할 수 있으며, 만약 변성(denaturation)이 되더라도 다시 짧은 시간에 재생(regeneration)이 가능하기 때문에 특히 장시간 또 반복사용이 요구되는 진단용으로의 응용이 매우 용이하다.
다만, 압타머는 사이즈가 작고, 혈청 내 다양한 종류의 핵산 분해효소가 존재하여 체내 안정성이 낮다는 단점이 존재하지만, 압타머를 폴리에틸렌글리콜(polyethylene glycol, PEG)과 같은 고분자나 디아실글리세롤(diacylglycerol) 혹은 콜레스테롤(cholesterol)을 접합시켜 혈액 내에서 빠르게 소멸되는 것을 줄일 수 있다. 그리고 압타머의 5'말단이나 3'말단에 비오틴(biotin)을 결합시켜 스트렙타아비딘 지지체(streptavidin support)에 부착시켜 바이오 센서/칩 분야에서 사용할 있다(Dausse E. et al., Aptamers: a new class of oligonucleotides in the drug discovery pipeline?, Curr. Opin. Pharmacol, 2009).
본 발명은 염증 질환 등 다양한 분야에 활용될 수 있는 고분자가 코팅된 금 나노입자-압타머 나노구조체를 제조하고 응용하는 것에 관한 것이다.
상기 금 나노입자는 구형으로 10~100 nm, 10~50 nm 또는 10~20 nm의 크기를 가질 수 있으나, 금 나노입자는 그 합성 방법에 따른 크기 조절이 잘 알려져 있어 사용 목적에 맞추어 크기를 변화시킬 수 있으므로, 나노입자의 크기는 제한되지 않는다. 상기 크기는 금 나노입자의 직경 또는 지름을 의미한다. 금 나노입자의 크기는 투과 전자현미경 또는 동적산란광 분석 등의 방법으로 분석할 수 있다.
금 나노입자에는 압타머가 결합되는데, 상기 압타머는 포집하고자 하는 질병관련인자에 대한 압타머 및 ATP와의 결합을 위한 ATP에 대한 DNA 압타머를 포함한다. 따라서, 상기 압타머는 두가지 종류의 압타머의 융합(fusion)에 의해 생성된다. 즉 상기 압타머는 두 가지 종류의 압타머를 동시에 보유하여 두 가지 종류의 타겟 분자와 결합할 수 있는 단일가닥 DNA 서열이다.
ATP는 페닐보론산과 결합할 수 있는 특징을 가지고 있으므로, 도 1에 도시된 바와 같이 금 나노입자는 ATP를 매개로 금 나노입자에 부착된 ATP에 대한 압타머와 고분자화된 페닐보론산과 결합하여, 압타머가 결합된 금 나노입자의 바깥으로 고분자화된 페닐보론산 케이지가 코팅된 금 나노입자-압타머 나노구조체가 형성될 수 있다. 따라서, 본 발명의 금 나노입자-압타머 나노구조체 제조에 있어, ATP에 대한 압타머는 ATP와의 결합을 위해 필수적이나, 질병관련인자에 대한 압타머는 본 발명에서 예시로 보여준 TNF-α, 또는 VEGF에 대한 압타머 뿐 아니라, 특정 타겟 물질을 포집할 수 있는 압타머라면 용도에 따라 제한되지 않고 변경될 수 있다.
질병관련인자는 질환에 따라 발현이 증가된다고 알려진 바이오마커일 수 있다. 구체적으로는 염증 반응에 의해 발현이 증가된다고 알려져 있는 사이토카인인 IL-6, TNF-α, IL-1β, MCP-1, MIP-1α에서 선택되는 하나일 수 있으나, 이에 제한되지 않는다
또한, 질병관련인자는 VEGF일 수 있다. VEGF는 혈관형성인자로서, VEGF의 발현이 높아지면 비정상적인 혈관생성이 늘어난다. 구체적으로는 암, 황반변성 등의 질환에서 VEGF의 과발현을 관찰할 수 있다.
또한, 질병관련인자는 트롬빈(thrombin)일 수 있다. 트롬빈은 혈액응고에 직접적으로 관여하는 인자로서, 혈전 생성 및 혈관 수축에 관여한다. 구체적으로는 혈액 응고 관련 질환에서 트롬빈의 과발현을 관찰할 수 있다.
본 발명의 일 실시예에서는 금 나노입자와 결합하는 압타머는 TNF-α에 대한 압타머 및 ATP에 대한 압타머가 융합된 형태(서열번호 1: ACCTGGGGGAGTATTGCGGAGGAAGGTTTTTTTTGGTGGATGGCGCAGTCGGCGACAATTTTTTT)이다. 또한, 본 발명의 일 실시예에서는 VEGF에 대한 압타머 및 ATP에 대한 압타머가 융합된 형태(서열번호 2: ACCTGGGGGAGTATTGCGGAGGAAGGTTTTTTTCCCGTCTTCCAGACAAGAGTGCAGGGTTTTTTT-Thiol)가 사용될 수 있다. 상기 압타머의 3' 말단은 금 나노입자와의 결합을 위해 Thiol(-SH)기로 수식되어 있다.
본 발명의 금 나노입자-압타머는 페닐보론산이 결합된 말레산 무수물 중합체인 고분자화된 페닐보론산 [폴리(메틸비닐에테르-말레산 무수물)]과 ATP를 매개로 결합하여 최종적으로 고분자화된 페닐보론산이 코팅된 금 나노입자-압타머 나노구조체가 생성된다. 상기 고분자화된 페닐보론산은 페닐보론산을 다수 포함하고 있는 수용성 고분자라면 제한되지 않고 사용될 수 있다.
고분자화된 페닐보론산에서 페닐보론산의 비율은 페닐보론산 단량체인 3-아미노페닐보론산의 양을 조절함으로써 적절하게 조절할 수 있다. 본 발명에서 제조한 고분자화된 페닐보론산 [폴리(메틸비닐에테르-말레산 무수물)]에서의 페닐보론산의 함량은 28%이다.
페닐보론산은 ATP의 다이올(diol)과 쉽게 결합할 수 있으며, 이때 형성되는 결합인 페닐보론에스테르 결합은 활성산소종에 민감하게 분리되는 성질이 있으므로, 본 발명의 나노구조체는 활성산소종 감응성 및 활성산소종 포집 능력을 가질 수 있다.
즉, ATP를 매개로 금 나노입자에 케이지 형태로 코팅된 고분자화된 페닐보론산은 질병관련인자에 대한 압타머를 블로킹하고 있으므로, 일반적인 상태에서는 질병관련인자는 압타머에 결합하지 못하지만, 활성산소종의 농도가 높은 경우, 페닐보론산은 활성산소종를 포집함으로써, 질병관련인자에 대한 압타머가 노출되면서, 압타머는 목적하는 질병관련인자를 포집하게 된다.
따라서, 본 발명의 나노구조체는 체내에서 활성산소종의 농도가 높은 병변 부위에 타겟팅되어, 활성산소종을 포집한 후 압타머의 종류에 따라 병변에서 과발현하는 사이토카인 등을 포집할 수 있다는 이중 기능을 가진다.
활성산소종은 산소가 지닌 화학적 특성으로 인해 생산되는 산소 유리기 (oxygen free radical) 및 이들로부터 유래된 산소화합물로 superoxide anion (O2-·), 과산화수소 (Hydogenperoxide: H2O2), 수산기 (OH·), alkoxyl기 (RO·), peroxyl기 (ROO·) 등을 총칭한다.
이러한 활성산소종은 화학적으로 매우 불안하고 반응성이 크기 때문에 생체 내에서 효소 촉매 반응, 전사인자의 활성화 및 생체 분자, 세포, 조직 등에 광범위한 산화적 손상을 줌으로써 주위에 염증을 유발하고 조직섬유화의 주요인자로 관여한다. 이러한 산화적 손상은 인체 전 조직에서 각종 질병을 유발하게 된다. 구체적으로는 피부, 신장 등 다양한 조직에서의 암 발생 및 발생된 암의 진행에 관여한다는 것이 알려져 있을 뿐 아니라, 심혈관 질환, 염증, 섬유화 질환, 당뇨병 등 거의 모든 질병에서 중요하게 작용하는 것으로 알려지고 있다.
본 발명의 일실시예에 따른 나노구조체는 복잡한 합성 과정 없이 제조가 가능하며, 활성산소종 감응성 및 활성산소종 포집 능력, 그리고 TNF-α 포집 능력을 보유한다는 것을 확인했을 뿐 아니라, 세포 및 혈액 독성을 나타내지 않고 세포 및 마우스의 염증 모델에서 높은 치료 효과를 나타냄을 확인하였다. 따라서, 본 발명의 나노구조체는 항염증 치료제로 활용될 수 있다.
본 발명의 일실시예에 따르면, 상기 염증성 질환은 췌장염, 만성간염, 식도염, 위염, 대장염, 폐렴, 기관지염, 인후염, 복막염, 심근경색, 심부전, 알츠하이머, 관절염, 신부전, 건선, 빈혈, 당뇨 및 섬유화증으로 이루어 진 군에서 선택되는 어느 하나 이상인 것일 수 있지만, 이에 제한되지 않는다.
본 발명의 일실시예에 따르면, 상기 관절염은 골관절염, 퇴행성 관절염, 염증성 관절염, 류마티스 관절염, 박리성 골연골염, 관절 인대손상, 반월상 연골판 손상, 관절의 부정정렬, 무혈성 괴사증 및 소아 특발성 관절염으로 이루어진 군으로부터 선택되는 어느 하나 이상인 것일 수 있지만, 이에 제한되지 않는다.
또한, 본 발명의 일실시예에 따른 나노구조체는 VEGF 포집 능력이 있으므로, VEGF 과발현과 관련된 질환, 구체적으로는 각종 암 질환, 류마티스 관절염, 당뇨병성 망막증, 허혈성 망막병증, 건선, 증식성 당뇨 망막증, 황반 변성 등의 질환에 대한 치료제로 사용될 수 있다.
본 발명의 일 실시예에서는 염증 모델을 통해 상기 나노구조체의 효능을 검증하였으나, 상기 나노구조체의 항염증 원리를 고려하면 염증과 관련된 다양한 질환에서도 효능을 나타낼 것으로 기대할 수 있으며, 변경가능한 구성성분인 질병관련 인자에 대한 압타머를 변경함으로써 대상 질병에 대한 효능을 나타낼 수 있다.
본 발명에 있어서 “치료제”란, 특정한 목적을 위해 투여되는 조성물을 의미한다. 본 발명의 목적상, 본 발명의 치료제는 암, 염증, 또는 황반변성의 치료를 위해 사용되는 것을 목적으로 하고, 금 나노입자-압타머 나노 구조체를 유효성분으로 포함하는 조성물이고, 이에 관여하는 단백질 및 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 포함할 수 있다.
상기의 "약학적 허용될 가능한" 담체 또는 부형제는 정부의 규제부에 의해 승인된 것이나, 또는 척추 동물, 그리고 보다 특별하게는 인간에게 사용을 위한 정부 또는 기타 일반적으로 승인된 약전에서 리스트된 것을 의미한다.
비경구적인 투여를 위해 본 발명의 약학조성물은 유성 또는 수성 담체에 있는 현탁액, 용액 또는 에멀젼의 형태로 될 수 있고, 고체 또는 반고체의 형태로 제조될 수 있다. 또한, 본 발명의 약학조성물은 현탁제, 안정화제, 용해제 및/또는 분산제와 같은 제형화제를 포함할 수 있고, 멸균될 수 있다. 상기 약학조성물은 제조 및 저장의 조건 하에서 안정할 수 있고, 세균이나 곰팡이와 같은 미생물의 오염 작용에 대해 보존될 수 있다. 대안적으로, 본 발명의 약학조성물은 사용 전에 적절한 담체와 재구성을 위해 멸균 분말 형태일 수 있다. 약학조성물은 단위-복용량 형태로, 마이크로니들 패치에, 앰플에, 또는 기타 단위-복용량 용기에, 또는 다-복용량 용기에 존재할 수 있다. 대안적으로, 약학적 조성물은 단지 멸균 액체 담체, 예를 들어 사용 바로 전에 주사용 물의 부가함을 요하는 동결-건조된(냉동건조) 상태로 보관될 수 있다. 즉시 주사용액 및 현탁액은 멸균 분말, 그래뉼 또는 타블렛으로 제조될 수 있다.
몇몇 비 제한적인 실시형태에 있어서, 본 발명의 약학조성물은 제형화되어 질 수 있고, 또는 액체 속에 미립구의 형태로 포함될 수 있다. 어떤 비 제한적인 실시형태에 있어서, 본 발명의 약학조성물은 이들의 약학적으로 허용될 수 있는 화합물 및/또는 혼합물을 0.001 내지 100,000 U/kg 사이의 농도로 포함할 수 있다. 또한 어떤 비 제한적인 실시형태에 있어서, 본 발명의 약학조성물은 적절한 부형제는 보존제, 현탁제, 추가적인 안정화제, 염료, 완충제, 항균제, 항진균제, 및 등장화제, 예를 들어, 설탕 또는 염화나트륨을 포함할 수 있다. 여기서 사용된 것으로, 용어 "안정화제"는 보존 수명을 증가하기 위해 본 발명의 약학조성물에 선택적으로 사용된 화합물을 언급한다. 비-제한적인 실시에 있어서, 안정화제는 당, 아미노산, 또는 폴리머일 수 있다. 또한 본 발명의 약학조성물은 하나 또는 그 이상의 약학적으로 허용될 수 있는 담체를 포함할 수 있고, 상기 담체는 용매 또는 분산 배지일 수 있다. 약학적으로 허용될 수 있는 담체의 비-제한적인 예는 물, 식염수, 에탄올, 폴리올 (예, 글리세롤, 프로필렌 글리콜 및 액체 폴리에틸렌 글리콜), 오일, 및 이들의 적절한 혼합물을 포함한다. 본 발명의 약학조성물에 적용되는 멸균 기술의 비-제한적인 예는 세균-억제 필터를 통한 여과, 멸균 제제의 합체, 방사선 조사, 멸균 가스 조사, 가열, 진공 건조 및 동결 건조를 포함한다.
본 명세서에 있어서 “투여”란, 어떠한 적절한 방법으로 환자에게 본 발명의 조성물을 도입하는 것을 의미하며, 본 발명의 조성물의 투여경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 투여될 수 있다. 경구 투여, 복강 내 투여, 정맥 내 투여, 근육 내 투여, 피하 투여, 비강 내 투여, 직장 내 투여, 경막 내 투여가 이루어질 수 있고, 본 발명의 목적상 주사의 형태로 투여되는 것이 바람직하며, 이에 제한되는 것은 아니다.
본 발명의 치료 방법은 상기 약학조성물을 약제학적 유효량으로 투여하는 것을 포함할 수 있다. 본 발명에서 유효량은 질환의 종류, 질환의 중증도, 부형제의 종류 및 함량, 제형의 종류 및 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로, 치료 기간, 병용 약물을 비롯한 다양한 인자에 따라 조절될 수 있다.
이하에서 본 발명을 실시하기 위한 실시예에 대하여 상세히 설명하며, 하기의 실시예는 본 발명을 실시하기 위한 바람직한 예시에 해당하는 것으로 본 발명이 실시예에 의하여 한정되는 것은 아니다.
실시예 1. 고분자가 코팅된 금 나노입자-압타머 나노구조체의 제조 및 물리화학적 분석
실시예 1-1. 고분자가 코팅된 금 나노입자-압타머 나노구조체의 제조
금 나노입자는 증류수에 녹인 1.47 mM gold chloride hydrate를 20 ㎖ 100℃ 로 준비하고, 여기에 0.34 M sodium citrate 400 ㎕를 넣어 15분간 반응시켜 합성한다. 투과 전자 현미경으로 15 nm 정도의 크기를 가지는 금 나노입자가 확인되었다 (도 2).
금 나노입자에 결합하여 금 나노입자를 개질하는 압타머는 두 가지로, 아래 표 1에 구체적인 서열이 기재되어 있다(서열번호 1 및 서열번호 3). 각각의 압타머는 금 나노입자에 결합하기 위해 3'-말단이 Thiol(-SH) 기로 수식(modification)되어 있다.
| 명칭 및 서열번호 |
본 발명에 사용된 압타머의 염기서열 (5'-3') |
| Apt(서열번호 1) | ACCTGGGGGAGTATTGCGGAGGAAGGTTTTTTTTGGTGGATGGCGCAGTCGGCGACAATTTTTTT-Thiol |
| Ctrl(서열번호 3) | ACCTGGGGGAGTATTGCGGAGGAAGGTTTTTTTTGACTTGGTGCAGACGATGGCAGGGTTTTTTT-Thiol |
Apt 염기서열은 ATP에 대한 압타머와 TNF-α에 대한 압타머를 포함하는 서열이며, Ctrl 염기서열은 ATP에 대한 압타머만 포함하고 TNF-α에 대한 압타머는 포함하지 않지만, Apt 서열과 길이가 같은 TNF-α에 비 특이적인 서열이다.
압타머를 금 나노입자에 개질화하기 위해서는 각각의 압타머 서열 (25 nmol)를 250 nmol tris(2-carboxyethyl)phosphine hydrochloride (TCEP·HCl)로 환원시켜 활성화시킨 후, 앞서 제조된 15 nM의 금 나노입자 5 ㎖에 넣고 52시간 동안 혼합하였다. 혼합하는 동안 16시간째부터 총 3번 4시간 간격으로 5 M NaCl를 넣어주어 용액 내의 NaCl 농도를 0.1 M씩, 최종적으로 0.3 M가 되도록 높여주었다. 합성 후 100 kDa Amicon tube를 이용하여 4,000 rpm에서 5분간 3번 원심분리하여 반응하지 않은 물질들을 제거하였다.
도 3(a)의 모식도에 나타난 바와 같이 압타머의 Thiol기가 금 나노입자에 결합하여 금 나노입자를 개질화하고, 개질화된 금 나노입자는 압타머 서열에 따라 Au-Apt (TNF에 결합하는 압타머+ATP에 결합하는 압타머), Au-Ctrl (TNF에 결합하는 압타머+비특이적인 압타머)로 명명하였다.
Au-Apt 와 Au-Ctrl 각각을 동적 산란광으로 분석한 결과 크기가 약 20 nm 정도임을 확인하였다 (도 3(b)). 또한, 금 나노입자 당 개질화된 압타머의 수를 계산하고자 1 nM의 Au-Apt 및 Au-Ctrl 각각을 50 mM potassium cyanide를 사용하여 금 나노입자만 녹인 후, SYBR Gold 형광염색으로 DNA의 양을 정량한 결과 Au-Apt 및 Au-Ctrl 각각에 대해 금 나노입자 1개당 53개와 44개의 압타머로 개질화되었음을 확인하였다 (도 3(c), 도 3(d)). 또한, 투과 전자 현미경 분석 및 전자 에너지 손실 분광법 분석을 통해 금 나노입자의 형태와 구성 원소(Au, P)의 존재여부 확인하였다 (도 4).
고분자화된 페닐보론산(poly(phenyl boronic acid); pPBA)을 합성하기 위해 DMSO에 분자량 80 kDa인 폴리(메틸비닐에테르-말레산 무수물)[Poly(methyl vinyl ether-alt-maleic anhydride; PMVEMA)을 녹이고, 말레산: 페닐보론산(PBA)의 몰 비율이 30%가 되도록 3-아미노페닐보론산(3-aminophenyl boronic acid)을 넣어 실온에서 24시간 반응을 진행하였다(도 5(a)). 잔여 무수산을 분해하기 위해 1 N NaOH를 이용하여 가수분해한 후 10 kDa dialysis membrane을 이용하여 투석 및 동결 건조를 통해 페닐보론산이 결합된 말레산 무수물 중합체인 최종 생성물(고분자화된 페닐보론산(poly(phenyl boronic acid); pPBA)을 얻었다. 최종 생성물인 pPBA 내 PBA의 양을 정량하기 위해 1H 핵자기공명 분석을 이용하여 분석한 결과 28% PBA 당량을 확인하였다 (도 5). 압타머가 개질화된 금 나노입자와의 상호작용 분석을 위해 Cy5.5-amine를 말레산 무수물 대비 1% 당량을 추가한 pPBA (Cy5.5-pPBA) 또한 제조하였으며, 합성 과정은 상기와 동일하다.
pPBA 고분자가 코팅된 금 나노입자-압타머 나노구조체를 합성하기 위해 400 nM의 Au-Apt 또는 Au-Ctrl과 2 mM의 ATP를 5 mM Mg2+가 함유된 PBS (pH 8.2)에서 혼합한 후, 13,200 rpm에서 30분간 원심분리 하여 수득하였다. 수득한 물질을 다시 5 mM Mg2+ 가 함유된 PBS (pH 8.2)에 녹이고 2 μM pPBA를 혼합한 후 13,200 rpm에서 30분간 원심분리하여 수득하였다. 고분자가 코팅된 금 나노입자-압타머 나노구조체는 압타머 서열에 따라 Au-Apt-ATP-pPBA와 Au-Ctrl-ATP-pPBA 로 명명되었다 (도 6(a) 참조). 상기 나노구조체의 형성에 ATP가 미치는 영향을 확인하고자 50 nM의 Au-Apt 또는 Au-Ctrl과 250 nM Cy5.5-pPBA를 5 mM Mg2+가 함유된 PBS (pH 8.2)에서 ATP 없이 또는 250 μM의 ATP 존재 하에 혼합하였다. 다음 단계로 13,200 rpm에서 30분간 원심분리 하여 상층액의 Cy5.5-pPBA 형광을 관찰하였으며, 그 결과 ATP가 존재할 때만 형광이 감소하여 나노구조체 형성에 ATP가 크게 관여함을 확인할 수 있었다 (도 6(b), 도 6(c)).
실시예 1-2. 고분자가 코팅된 금 나노입자-압타머 나노구조체의 활성산소종 감응성 확인
고분자가 코팅된 금 나노입자-압타머 나노구조체 (Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA)의 활성산소종 감응성을 확인하기 위해, 40 nM의 Au-Apt-ATP-pPBA 또는 Au-Ctrl-ATP-pPBA에 100 μM hydrogen peroxide (H2O2)를 5 mM Mg2+ 가 함유된 PBS (pH 8.2)에서 혼합하고 상온에서 2시간 동안 방치한 후, 투과 전자 현미경 분석 및 전자 에너지 손실 분광법 분석 (도 7), 동적 산란광 분석 (도 8)을 진행하였다.
그 결과 전자 에너지 손실 분광법 분석에서 활성산소종이 없을 때는 나노구조체에서 pPBA의 붕소 신호가 검출되지만, 활성산소종과 감응하면 pPBA의 붕소 신호가 검출되지 않는 것을 통해 활성산소종에 의해 pPBA가 제거됨을 확인할 수 있었다. 또한, 동적 산란광 분석에서 Au-Apt와 Au-Ctrl에 비해 크기가 커졌던 Au-Apt-ATP-pPBA와 Au-Ctrl-ATP-pPBA의 크기가 활성산소종 감응 후 다시 원상복귀되는 것을 통해 본 발명의 나노구조체는 활성산소종에 감응하여 pPBA가 제거됨을 확인할 수 있었다(도 8).
실시예 1-3. 고분자가 코팅된 금 나노입자-압타머 나노구조체의 활성산소종 포집 능력 확인
고분자가 코팅된 금 나노입자-압타머 나노구조체(Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA)의 활성산소종 포집 능력을 확인하기 위해 금 나노입자 기준으로 20 nM의 Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA, Au-Apt+pPBA, Au-Ctrl+pPBA, 20 nM pPBA, 1.15 μM ATP를 각각 5 mM Mg2+가 함유된 PBS (pH 8.2)에서 100 μM의 H2O2와 상온에서 2시간 동안 혼합한 후, 13,200 rpm 30분의 원심분리를 한 후, 상층액의 활성산소종 농도를 Amplex Red assay를 통해 확인하였다.
그 결과 pPBA나 ATP는 활성산소종 포집 능력을 가지고 있지 않았고, 단순히 Au-Apt나 Au-Ctrl에 ATP 없이 pPBA를 혼합해주는 것만으로는 활성산소종 포집 능력이 생기지 않았고, 고분자가 코팅된 금 나노입자-압타머 나노구조체 형태인 Au-Apt-ATP-pPBA와 Au-Ctrl-ATP-pPBA만이 유의미하게 높은 활성산소종 포집 능력을 가지고 있음을 확인할 수 있었다 (도 9). 즉 Au-Apt-ATP-pPBA와 Au-Ctrl-ATP-pPBA는 활성산소종에 감응한다는 것을 다시 한번 확인할 수 있었다.
실시예 1-4. 고분자가 코팅된 금 나노입자-압타머 나노구조체의 TNF-α 포집 능력 확인
고분자가 코팅된 금 나노입자-압타머 나노구조체(Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA)의 TNF-α 포집 능력을 확인하기 위해 Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA, Au-Apt+pPBA, Au-Ctrl+pPBA 와 250 pg/mL TNF-α가 압타머:TNF-α 몰비 10000:1로 5 mM Mg2+가 함유된 PBS (pH 8.2)에서 37°C 에서 4시간 동안 혼합하고 13,200 rpm에서 30분간 원심분리한 후 상층액의 TNF-α 농도를 효소면역분석법으로 확인하였다. H2O2를 처리군은 각 성분 혼합 시 100 μM H2O2를 같이 혼합하였다. 그 결과 Au-Apt-ATP-pPBA는 pPBA에 의해 TNF-α에 대한 압타머가 코팅(블로킹: blocking)되어 있으므로, 상기 압타머가 노출된 Au-Apt에 비해 현저히 감소된 TNF-α 포집 능력을 보여주었으며, 이는 H2O2 처리 시에 회복된 TNF-α 포집능력을 보인다. 이는 압타머를 블로킹하던 pPBA가 H2O2의 활성산소종으로 제거되었기 때문이다(도 10(a)). 하지만, Au-Apt와 Au-Apt+pPBA는 TNF-α에 대한 압타머가 pPBA로 블로킹되어 있지 않으므로, TNF-α를 포집 능력이 감소하지 않았고, TNF-α 압타머가 존재하지 않는 Au-Ctrl, Au-Ctrl-ATP-pPBA 등의 시료는 H2O2 처리와 관계없이 TNF-α를 전혀 포집하지 못함을 확인할 수 있었다 (도 10(a) 및 (b)).
이를 통해 Au-Apt-ATP-pPBA는 활성산소종 감응에 따라 TNF-α 포집 비활성에서 활성으로 전환이 가능함을 확인할 수 있다.
실시예 2. 고분자가 코팅된 금 나노입자-압타머 나노구조체의 항염증 효과 확인
실시예 2-1. 고분자가 코팅된 금 나노입자-압타머 나노구조체의 독성 확인
본 발명의 고분자가 코팅된 나노입자-압타머 나노구조체의 항염증 효과 확인에 앞서 나노구조체 자체 독성을 확인하고자, 세포 독성 및 용혈도를 분석하였다.
세포 독성은 RAW 264.7 세포를 96-well 배양 플레이트에 10,000 cells/well로 분주하고 24시간 배양한 후, 배지를 교체하고 Au-Apt, Au-Apt-ATP-pPBA, Au-Ctrl, Au-Ctrl-ATP-pPBA를 금 나노입자 기준의 다양한 농도(1.25, 2.5, 5, 10, 20, 40 nM)로 처리하고 24시간 후의 생존율을 확인하였다. 그 결과 실험에 사용한 모든 시료에서 유의미한 세포독성이 관찰되지 않았다 (도 11).
동물 모델에 적용하기 전 용혈도 확인을 위해서는 마우스 전혈을 채취한 후 적혈구를 분리하고 이를 다시 PBS에 10배 희석해 적혈구 용액을 확보하였다. 여기에 금 나노입자 기준 20 nM인 Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA를 각각 6시간 동안 혼합한 후 13,200 rpm에서 30분 원심분리하여 상층액에 용해된 헤모글로빈을 542 nm 흡광으로 정량하였다. 기준으로 상기 적혈구 용액에 PBS를 처리한 것이 0% 용혈, 최종농도 0.1% Triton X-100를 처리한 것을 100% 용혈로 설정하였으며 결과적으로 실험에 사용한 모든 나노구조체에서 유의미한 용혈이 관찰되지 않았다 (도 12).
실시예 2-2. 고분자가 코팅된 금 나노입자-압타머 나노구조체의 세포 내 항염증 효과 확인
고분자가 코팅된 금 나노입자-압타머 나노구조체(Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA)의 세포 내 항염증 효과를 확인하기 위해 RAW 264.7 세포를 phorbol 12-myristate 13-acetate (PMA) 또는 H2O2로 활성화(염증 유도)시킨 후 실험을 진행하였다.
먼저 PMA에 의해 활성화된 세포의 경우 세포 내 활성산소종 형광을 확인하고자 다음과 같은 실험이 수행되었다. RAW 264.7 세포를 12-well 배양 플레이트에 150,000 cells/well로 분주하고 24시간 배양한 후, 배지를 교체하고 200 ng/mL PMA와 함께 금 나노입자 기준 20 nM의 Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA을 처리해주었다. 6시간 후 배지를 제거하고 세포를 세척해준 후 20 μM 2',7'-dichlorofluoresin diacetate를 처리한 후 45분 후에 형광현미경으로 세포 내 활성산소종 형광이 관찰되었다. 그 결과 활성산소종 포집 능력이 있는 Au-Ctrl-ATP-pPBA에서 유의미한 활성산소종 감소가 관찰되었고, TNF-α 포집 능력이 있는 Au-Apt에서도 활성산소종-TNF-α 간 상호작용을 통한 활성산소종 감소가 관찰되었다. 하지만 활성산소종 포집 능력과 TNF-α 포집 능력을 모두 가진 Au-Apt-ATP-pPBA에서 두 경우에 비해 유의미하게 높은 활성산소종 감소가 관찰되었다 (도 13).
추가적으로 염증반응에 의해 분비되어 염증성 인자라고 알려져 있는 활성산소종, TNF-α, IL-6가 본 발명의 고분자가 코팅된 금 나노입자-압타머 나노구조체 처리에 의해 조절되는지를 확인하기 위해, RAW 264.7 세포를 12-well 배양 플레이트에 200,000 cells/well로 분주하고 24시간 배양 후에 배지를 교체하고 200 ng/mL PMA와 함께 금 나노입자 기준 20 nM의 Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA을 처리해주었다. 24시간 후 배지를 13200 rpm에서 30분간 원심분리한 후 상층액의 활성산소종, TNF-α, IL-6 농도를 Amplex red assay와 효소면역분석법을 통해 확인하였다.
그 결과 Au-Ctrl-ATP-pPBA와 Au-Apt가 각각 활성산소종 포집 능력과 TNF-α 포집 능력으로 인해 염증을 감소시키며, 두 가지 능력을 모두 가진 Au-Apt-ATP-pPBA가 유의미하게 뛰어난 항염증 효과를 가진다는 것을 확인하였다 (도 14).
H2O2로 활성화시킨 세포에 대한 실험의 경우 상기 PMA로 활성화시킨 세포의 실험 방법에서 200 ng/㎖ PMA만 100 μM H2O2로 변경하여 진행되었으며, 결과에서는 유사한 경향성을 확인하였다 (도 15, 도 16).
추가적으로 H2O2에 의한 세포 독성이 항염증효과에 의해 감소하는지 확인하기 위해 먼저 H2O2 처리농도를 100 μM로 결정하였다(도 17(a)).
RAW 264.7 세포를 96-well 배양 플레이트에 10,000 cells/well로 분주하고 24시간 후 배지를 교체하고 100 μM H2O2와 금 나노입자 기준 20 nM의 Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA을 함께 처리하였다. 24시간 후 세포의 생존율을 세포독성 및 생존률 시험방법으로 확인해본 결과 시료별로 보여주었던 항염증 효과와 유사하게 세포의 생존율이 증가함을 확인할 수 있었다 (도 17(b)).
실시예 2-3. 고분자가 코팅된 금 나노입자-압타머 나노구조체의 마우스 내 항염증 효과 확인
고분자가 코팅된 금 나노입자-압타머 나노구조체(Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA)의 마우스 내 항염증 효과를 확인하기 위해 마우스의 복강에 1 ㎎/㎖ zymosan 800 ㎕를 주입해 복막염을 만들었다. 1시간 후 금 나노입자 기준 100 nM의 Au-Apt, Au-Ctrl, Au-Apt-ATP-pPBA, Au-Ctrl-ATP-pPBA 200 ㎕를 복강 주사하고, 추가적으로 5시간이 지난 후 마우스에 복막 세척을 수행하여 복막액을 채취하고, 심장 채혈을 통해 전혈을 채취하였다. 복막액과 전혈 내의 TNF-α 농도와 IL-6 농도를 효소면역분석법을 통해 확인하였다. 그 결과 세포에서의 결과와 비슷한 경향성으로, Au-Ctrl-ATP-pPBA와 Au-Apt가 각각 활성산소종 포집 능력과 TNF-α 포집 능력으로 인해 염증을 감소시키며, 두 가지 능력을 모두 가진 Au-Apt-ATP-pPBA가 유의미하게 뛰어난 항염증 효과를 가진다는 것을 확인하였다 (도 18, 도 19).
Claims (14)
- 금 나노입자,상기 금 나노입자의 표면에 개질화된 압타머, 및상기 압타머에 ATP를 매개체로 코팅되는 고분자화된 페닐보론산으로 이루어지는 나노 구조체.
- 제1항에 있어서,상기 금 나노입자는 10~200 nm의 크기를 가지는 것을 특징으로 하는 나노 구조체.
- 제1항에 있어서,상기 압타머는 질병관련인자에 대한 압타머와 ATP에 대한 압타머를 동시에 보유하는 단일 가닥 DNA 서열인, 나노 구조체.
- 제3항에 있어서,상기 질병관련인자는 TNF-α, VEGF, IL-6, IL-1, MCP-1, 트롬빈(thrombin)에서 선택되는 하나인 것인, 나노 구조체.
- 제4항에 있어서,상기 질병관련인자는 TNF-α, VEGF에서 선택되는 하나인 것인, 나노 구조체.
- 제5항에 있어서,상기 질병관련인자는 TNF-α인, 나노 구조체.
- 제5항에 있어서,상기 질병관련인자는 VEGF인, 나노 구조체.
- 제1항에 있어서,상기 압타머는 서열번호 1 또는 2의 서열을 가지는, 나노 구조체.
- 제8항에 있어서,상기 압타머는 서열번호 1의 서열을 가지는, 나노 구조체.
- 제8항에 있어서,상기 압타머는 서열번호 2의 서열을 가지는, 나노 구조체.
- 제1항에 있어서,상기 고분자화된 페닐보론산은 친수성이면서 페닐보론산을 포함하는 고분자인, 나노 구조체.
- 제1항 내지 제11항 중 어느 한 항의 나노 구조체를 유효성분으로 포함하는, 항염증 치료제.
- 제1항 내지 제11항 중 어느 한 항의 나노 구조체를 유효성분으로 포함하는, 항암 치료제.
- 제1항 내지 제11항 중 어느 한 항의 나노 구조체를 유효성분으로 포함하는, 황반변성 치료제.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US18/020,145 US20240301431A1 (en) | 2020-10-07 | 2021-10-05 | Development and application of polymer-coated gold nanoparticle-aptamer nanoconstruct having sensitivity to reactive oxygen species |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2020-0129318 | 2020-10-07 | ||
| KR1020200129318A KR102510170B1 (ko) | 2020-10-07 | 2020-10-07 | 활성산소종 감응성을 가지는, 고분자가 코팅된 금 나노입자-압타머 나노구조체의 개발 및 응용 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022075693A1 true WO2022075693A1 (ko) | 2022-04-14 |
Family
ID=81126657
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2021/013605 Ceased WO2022075693A1 (ko) | 2020-10-07 | 2021-10-05 | 활성산소종 감응성을 가지는, 고분자가 코팅된 금 나노입자-압타머 나노구조체의 개발 및 응용 |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US20240301431A1 (ko) |
| KR (1) | KR102510170B1 (ko) |
| WO (1) | WO2022075693A1 (ko) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20170129463A (ko) * | 2016-05-17 | 2017-11-27 | 기초과학연구원 | 페닐보론산이 결합된 고분자를 포함하는 약물 전달체 |
| KR20180047734A (ko) * | 2016-11-01 | 2018-05-10 | 기초과학연구원 | 타겟분자를 선택적으로 포획하는 덱스트란 고분자 기반의 증폭된 핵산 압타머 나노구조체의 제조방법 |
| CN109001165A (zh) * | 2017-06-07 | 2018-12-14 | 天津师范大学 | 一种免标记磷光探针定量检测三磷酸腺苷的方法 |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2176277B1 (en) * | 2007-07-19 | 2016-02-24 | Georgia State University Research Foundation, Inc. | Nucleotides and aptamers containing boronic acid groups having biased binding to glycosylated proteins, and uses thereof |
| BR112014011831A2 (pt) * | 2011-11-17 | 2017-05-09 | Nat Univ Corp Tokyo Medical & Dental Univ | copolímero em bloco tendo grupo ácido fenilborônico nele introduzido e o uso deste |
| US9468681B2 (en) * | 2013-03-01 | 2016-10-18 | California Institute Of Technology | Targeted nanoparticles |
| WO2015171930A1 (en) * | 2014-05-07 | 2015-11-12 | Arizona Board Of Regents Acting For And On Behalf Of Arizona State University | Linker molecule for multiplex recognition by atomic force microscopy (afm) |
| KR101966505B1 (ko) | 2016-12-05 | 2019-04-05 | 중앙대학교 산학협력단 | 항균용 나노 구조체 및 이의 용도 |
| KR102023839B1 (ko) | 2018-03-28 | 2019-09-20 | 포항공과대학교 산학협력단 | 분지된 dna, 압타머를 포함하는 고효율 압타머 복합체 및 이의 용도 |
| US20210355496A1 (en) * | 2018-10-24 | 2021-11-18 | Chan Zuckerberg Biohub, Inc. | Compositions and methods involving aptamer switch polynucleotides |
-
2020
- 2020-10-07 KR KR1020200129318A patent/KR102510170B1/ko active Active
-
2021
- 2021-10-05 US US18/020,145 patent/US20240301431A1/en active Pending
- 2021-10-05 WO PCT/KR2021/013605 patent/WO2022075693A1/ko not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20170129463A (ko) * | 2016-05-17 | 2017-11-27 | 기초과학연구원 | 페닐보론산이 결합된 고분자를 포함하는 약물 전달체 |
| KR20180047734A (ko) * | 2016-11-01 | 2018-05-10 | 기초과학연구원 | 타겟분자를 선택적으로 포획하는 덱스트란 고분자 기반의 증폭된 핵산 압타머 나노구조체의 제조방법 |
| CN109001165A (zh) * | 2017-06-07 | 2018-12-14 | 天津师范大学 | 一种免标记磷光探针定量检测三磷酸腺苷的方法 |
Non-Patent Citations (3)
| Title |
|---|
| FADWA ODEH, HAMDI NSAIRAT, WALHAN ALSHAER, MOHAMMAD A. ISMAIL, EZALDEEN ESAWI, BARAA QAQISH, ABEER AL BAWAB, SAID I. ISMAIL: "Aptamers Chemistry: Chemical Modifications and Conjugation Strategies", MOLECULES, vol. 25, no. 1, pages 3, XP055718990, DOI: 10.3390/molecules25010003 * |
| KIM JINSEONG, PARK HYEONGMOK, SARAVANAKUMAR GURUSAMY, KIM WON JONG: "Polymer/Aptamer-Integrated Gold Nanoconstruct Suppresses the Inflammatory Process by Scavenging ROS and Capturing Pro-inflammatory Cytokine TNF-α", APPLIED MATERIALS & INTERFACES, AMERICAN CHEMICAL SOCIETY, US, vol. 13, no. 8, 3 March 2021 (2021-03-03), US , pages 9390 - 9401, XP055919660, ISSN: 1944-8244, DOI: 10.1021/acsami.0c15727 * |
| YEO JIWON, LEE JUNSEOK, YOON SEONYEONG, KIM WON JONG: "Tannic acid-based nanogel as an efficient anti-inflammatory agent", BIOMATERIALS SCIENCE, R S C PUBLICATIONS, GB, vol. 8, no. 4, 19 February 2020 (2020-02-19), GB , pages 1148 - 1159, XP055919657, ISSN: 2047-4830, DOI: 10.1039/C9BM01384A * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR102510170B1 (ko) | 2023-03-14 |
| US20240301431A1 (en) | 2024-09-12 |
| KR20220046187A (ko) | 2022-04-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2589391B1 (en) | Bacterial cell-derived microvesicles for use in a method of treating cancer | |
| Gou et al. | Non‐pore dependent and MMP‐9 responsive gelatin/silk fibroin composite microparticles as universal delivery platform for inhaled treatment of lung cancer | |
| US9795688B2 (en) | Cell-specific targeting using nanostructured delivery systems | |
| WO2019189979A1 (ko) | 분지된 dna, 압타머를 포함하는 고효율 압타머 복합체 및 이의 용도 | |
| CN115845075B (zh) | 基于牛奶外泌体的功能化载药外泌体及其制备方法和应用 | |
| CN113004372A (zh) | 一种免疫多肽及其应用 | |
| US20260102500A1 (en) | Pkc inhibitors for the treatment of septic cholestasis with polymethine dye targeting | |
| CN111001006A (zh) | 葫芦素b和氧化响应抗肿瘤前药共载仿生纳米粒 | |
| Chen et al. | Theranostic nanosystem mediating cascade catalytic reactions for effective immunotherapy of highly immunosuppressive and poorly penetrable pancreatic tumor | |
| Wu et al. | Enhanced drug delivery to hepatocellular carcinoma with a galactosylated core–shell polyphosphoester nanogel | |
| CN116262138A (zh) | 一种具有核壳结构的pH响应型外泌体载体及其制备方法与应用 | |
| CN114426554A (zh) | 有机荧光小分子化合物、有机荧光纳米载体及其制备方法和应用 | |
| US20180016582A1 (en) | Dna aptamer binding to non-small cell lung cancer cells (h1975) | |
| CN119925694A (zh) | 一种生物素-亲和素驱动外泌体控释的COFs基纳米植入材料及其制备方法 | |
| CN103977434B (zh) | 一种对羟基苯甲酸介导的脑靶向聚合物胶束递药系统 | |
| Lu et al. | Inflammation-targeting and self-limited neutrophilic membrane-encapsulated teicoplanin for the treatment of infectious pneumonia | |
| CN118986918A (zh) | 解纤维化与抑制胰腺癌转移协同的纳米药物及其制备方法 | |
| KR102510170B1 (ko) | 활성산소종 감응성을 가지는, 고분자가 코팅된 금 나노입자-압타머 나노구조체의 개발 및 응용 | |
| CN112843244B (zh) | 一种尺寸可变的智能化载药纳米簇系统及其制备方法和应用 | |
| JP5250229B2 (ja) | カーボンナノホーン | |
| CN120131953B (zh) | 一种具有声动力活性的靶向纳米药物及其制备方法和应用 | |
| Wang et al. | pH-Responsive carrier-free nanoparticles based on teicoplanin and borneol for enhanced MRSA infectious wound healing | |
| Hardie | Chemical manipulation of macrophages: nanomaterial and molecular approaches | |
| WO2026095245A1 (ko) | 생물 의약품의 장기 보관용 전달체 및 이의 제조 방법 | |
| CN120459058A (zh) | 一种工程化细胞膜纳米颗粒及其制备方法和应用 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21877944 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 21877944 Country of ref document: EP Kind code of ref document: A1 |