WO2019189979A1 - 분지된 dna, 압타머를 포함하는 고효율 압타머 복합체 및 이의 용도 - Google Patents

분지된 dna, 압타머를 포함하는 고효율 압타머 복합체 및 이의 용도 Download PDF

Info

Publication number
WO2019189979A1
WO2019189979A1 PCT/KR2018/004326 KR2018004326W WO2019189979A1 WO 2019189979 A1 WO2019189979 A1 WO 2019189979A1 KR 2018004326 W KR2018004326 W KR 2018004326W WO 2019189979 A1 WO2019189979 A1 WO 2019189979A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
aptamer
dna
aptamer complex
complex
Prior art date
Application number
PCT/KR2018/004326
Other languages
English (en)
French (fr)
Inventor
김원종
이지현
Original Assignee
포항공과대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 포항공과대학교 산학협력단 filed Critical 포항공과대학교 산학협력단
Priority to US16/963,315 priority Critical patent/US11414667B2/en
Priority to CN201880091678.1A priority patent/CN111902538A/zh
Publication of WO2019189979A1 publication Critical patent/WO2019189979A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3519—Fusion with another nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/52—Physical structure branched
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/475—Assays involving growth factors

Definitions

  • the present invention relates to high efficiency aptamer complexes comprising branched DNA and aptamers and pharmaceutical uses thereof. More specifically, the aptamer complex of the present invention relates to a high-efficiency aptamer complex containing Y-type DNA as branched DNA and using vascular endothelial growth factor (VEGF) as a target molecule.
  • VEGF vascular endothelial growth factor
  • Ligand materials that can bind specifically to cancer cells with high affinity with cancer cell surface proteins are important for cancer diagnosis and therapeutic development. Such ligand materials can also be used as cancer biomarkers, and understanding of biomarkers can facilitate the development of new cancer therapeutics.
  • Aptamers are single-stranded DNA or RNA oligonucleotides that can be folded into specific three-dimensional structures to bind with high affinity and specificity for a target.
  • Targets for aptamers can be small molecule compounds, peptides, proteins, or the cells themselves (Dua, P. et al., Recent Pat. DNA Gene Seq., 2: 172, 2008). Such aptamers have advantages over antibodies, such as smaller size, better tissue penetration, ease of chemical manipulation, and no immune response.
  • aptamers have faster response and better signal-to-noise ratios than antibodies due to their small size.
  • Aptamers may also be attached to magnetic nanoparticle surfaces and used in magnetic resonance imaging (MRI) to improve image specificity.
  • MRI magnetic resonance imaging
  • aptamers can be used as "escort aptamers" that directly inhibit cancer growth signaling pathways by blocking cancer growth factors or growth factor receptors, or carry cytotoxic agents or therapeutic molecules such as siRNA to target cells. Accordingly, specific aptamers targeting cancer cell types or cancer cell surface proteins have been developed as novel cancer diagnostic and therapeutic agents. For example, Korean Patent No.
  • nucleic acid aptamer that can specifically bind to breast cancer cells or tissues
  • Korean Patent No. 10-1189790 discloses specific binding to pancreatic cancer cells or tissues.
  • Nucleic acid aptamers are disclosed.
  • the conventional aptamer cancer therapeutic agent is likely to cause toxicity due to a large amount of non-specific accumulation when injected along the blood vessel, and the effect of inhibiting the growth of cancer cells in the body is not as expected, so the practical application in the clinical practice is limited. It is a lot.
  • branched DNA is an artificial branch of the DNA helix structure, and Y-type DNA or X-type DNA is typical, and Y-type and four-type nucleic acid sequences are combined when three types of nucleic acid sequences are combined.
  • the case is called X-type (Jingjing Li et al., Anal. Chem., 2017, 89 (23), pp 12850-12856).
  • the present invention relates to a highly efficient aptamer complex comprising branched DNA and aptamer, and the aptamer complex of the present invention, and a pharmaceutical composition comprising the same as an active ingredient, have a higher binding efficiency with a target molecule than a conventional aptamer. Remarkably excellent, it is expected to be widely used in the medical field.
  • a high-efficiency aptamer complex comprising branched DNA and aptamer and a pharmaceutical composition for treating cancer comprising the same as an active ingredient.
  • an “aptamer” is a 15-40 single-stranded oligonucleotide that forms a specific three-dimensional formation, has a stem loop structure, and binds specifically to a specific molecule. There is this. Aptamers are compounds that are chemically easy to synthesize, easy to chemically modify, heat stable, and have very high specificity for the target. The sequence of aptamers can be discovered by a method called selective evolution of ligands by exponential enrichment (SELEX), and hundreds of aptamer sequences have already been disclosed. Aptamers are often compared to antibodies in that they specifically bind to targets, but have no immune response.
  • aptamers have been discovered that can bind to a variety of target molecules, including small molecule organics, peptides and membrane proteins. Aptamers are often compared to single antibodies because of their inherent high affinity (usually pM levels) and their specificity to bind to target molecules, especially as 'chemical antibodies'.
  • Antibodies are difficult to produce due to their large molecular structure ( ⁇ 150 kDa) and are difficult to modify, whereas aptamers are small molecular structures consisting of nucleic acids of about 20 to 60 mer in length and are easily modified. It has one advantage. Aptamers are very stable compared to antibodies. Protein or antibody pharmaceuticals are not stored or transported at room temperature, but aptamers are able to maintain their function even after sterilization, and if they are denatured, they can be regenerated in a short time, especially for long periods of time. It is very easy to use for diagnostic applications requiring repeated use.
  • nucleic acid constructs (aptamer candidate molecules) in the nucleic acid construct library, as the antibody binds to various antigens, have the ability to bind various targets and thus the desired Only the nucleic acid constructs that can bind are selected.
  • Nucleic acid constructs which are not bound by a method such as affinity chromatography can be removed and selectively obtained only by binding to the target molecule.
  • the nucleic acid construct is separated from the target molecule and the aptamer exhibits excellent binding and specificity by repeating these processes 5 to 15 more times using the nucleic acid construct obtained after amplifying the nucleic acid. Can be excavated.
  • the early aptamers obtained through SELEX also perform a post-SELEX (post-SELEX) process to improve to a more stable and powerful aptamer.
  • post-SELEX post-SELEX
  • ribose 2'-OH of an RNA aptamer is replaced with 2'-F, 2'-NH2, or 2'-O-methyl group.
  • aptamers may be conjugated with polymers such as polyethylene glycol (PEG), diacylglycerol or cholesterol, to reduce rapid disappearance in the blood.
  • PEG polyethylene glycol
  • aptamers combined with biotin at the 5 'end or 3' end can be made and attached to streptavidin support for use in biosensor / chip applications (Dausse E. et al., Aptamers: a new class of oligonucleotides in the drug discovery pipeline, Curr. Opin. Pharmacol, 2009).
  • DNA constructs developed using DNA are self-assembled by sequence specific interactions between complementary nucleic acids, and DNA constructs, which are self-assembled nanounit constructs, control nucleotide sequences, adjust pH, temperature, light, and the like. It induces dynamic movement by inducing structural transformation by change of surrounding environment.
  • DNA-conjugated nanoparticles there is a large amount of nonspecific accumulation when injected along blood vessels, which can cause toxicity. Therefore, research on a system for delivering drug agents targeting only cancer cells is required.
  • branched DNA means that artificial branching occurs in the DNA helix structure, where Y-type DNA or X-type DNA is representative and three kinds of nucleic acid sequences are combined.
  • Y-type DNA or X-type DNA is representative and three kinds of nucleic acid sequences are combined.
  • X-type Jingjing Li et al., Anal. Chem., 2017, 89 (23), pp 12850-12856.
  • Branched DNA is effective for reliable quantitative analysis of nucleic acid molecules or for high efficiency binding with target molecules.
  • vascular endothelial growth factor is an important survival factor of vascular endothelial cells.
  • VEGF is one of the most potent angiogenesis factors and an important regulator of vascular permeability.
  • VEGF is widely accepted as a major regulator of pathological angiogenesis-related diseases such as wet-type age-related macular degeneration (AMD) and angiogenesis.
  • AMD wet-type age-related macular degeneration
  • VEGF vascular endothelial growth factor
  • VEGF receptor VEGF receptor
  • sVEGFR soluble VEGF receptors
  • RNA aptamer for VEGF165 was first approved by the FDA as an anti-VEGF drug for the treatment of neovascular AMD.
  • This aptamer drug is safe, but compared to other alternative anti-VEGF drugs such as ranibizumab, an anti-VEGF monoclonal antibody, and alibercept, VEGF receptors 1 and 2 fused to the Fc portion of IgG.
  • ranibizumab an anti-VEGF monoclonal antibody
  • alibercept VEGF receptors 1 and 2 fused to the Fc portion of IgG.
  • binding affinity and stability in vivo to VEGF are major factors affecting the biological effects of anti-VEGF aptamers.
  • pegaptanib Although structurally modified to enhance resistance to nucleases, pegaptanib has a problem of relatively short in vivo half-life of 9.3 hours after intravenous injection and 12 hours after subcutaneous injection (Tucker, CE et al., Journal of chromatography.B, Biomedical sciences and applications 1999, 732, 203-212).
  • the term "aptamer complex” refers to an aptamer complex developed in the present invention and includes an aptamer complex including branched DNA, an aptamer corresponding to a target sequence, and terminal DNA.
  • the branched DNA is preferably Y-type DNA
  • the target sequence is preferably a sequence corresponding to a vascular endothelial growth factor (VEGF) protein
  • the terminal DNA is Blu_end. It is preferable.
  • Angiogenesis is very important for the growth and metastasis of solid tumors.
  • tumor angiogenesis and angiogenesis which are highly related to the VEGF signaling pathway, are important processes in the development of tumors.
  • anti-cancer treatment using anti-VEGF factors as 'anti-VEGF therapy' or 'anti-angiogenesis therapy'.
  • Our previous studies have disclosed polymer amplified VEGF aptamers, but complexes whose structures are highly entangled by the RCA process, such as AA, have shown significantly lower VEGF capture efficiency compared to the same amount of oligomeric aptamers.
  • aptamer complexes comprising branched DNA, aptamer corresponding to target sequence, and terminal DNA have high stability and capture efficiency as aptamer complex therapeutics for tumor growth inhibition in vivo, It is expected to be used greatly.
  • the target molecule is a group consisting of vascular endothelial growth factor (VEGF), bovine serum albumin (BSA), adenosine triphosphate (ATP), hepatitis C virus (HCV), and human immunodeficiency virus (HIV).
  • VEGF vascular endothelial growth factor
  • BSA bovine serum albumin
  • ATP adenosine triphosphate
  • HCV hepatitis C virus
  • HCV human immunodeficiency virus
  • VEGF vascular endothelial growth factor
  • BSA bovine serum albumin
  • ATP adenosine triphosphate
  • HCV hepatitis C virus
  • HCV human immunodeficiency virus
  • vascular endothelial growth factor in the preparation of a highly efficient aptamer complex comprising branched DNA for selective and efficient capture of specific target molecules, blood vessels commonly found around cancer as specific target proteins and known as causative agents of macular edema Endothelial growth factor may be set, and preferably, vascular endothelial growth factor may be selected and used, but is not limited thereto.
  • pharmaceutical composition means a composition to be administered for a specific purpose.
  • the pharmaceutical composition of the present invention is a composition for the purpose of being used for the treatment of cancer or macular edema, comprising a highly efficient aptamer complex comprising branched DNA and aptamer as an active ingredient, Proteins of interest and pharmaceutically acceptable carriers, excipients or diluents.
  • pharmaceutically acceptable carrier or excipient those approved by the government or listed in government or other generally approved pharmacopoeia for use in vertebrates, and more particularly in humans.
  • the pharmaceutical compositions of the invention may be in the form of suspensions, solutions or emulsions in oily or aqueous carriers, and may be prepared in the form of solids or semisolids.
  • the pharmaceutical compositions of the present invention may include formulating agents such as suspending, stabilizing, dissolving and / or dispersing agents and may be sterilized.
  • the pharmaceutical composition may be stable under the conditions of manufacture and storage, and may be preserved against the contaminating action of microorganisms such as bacteria or fungi.
  • the pharmaceutical compositions of the present invention may be in sterile powder form for reconstitution with a suitable carrier prior to use.
  • the pharmaceutical compositions may be in unit-dose form, in microneedle patches, in ampoules, or in other unit-dose containers, or in multi-dose containers.
  • the pharmaceutical composition may be stored in a freeze-dried (freeze-dried) state, which requires the addition of a sterile liquid carrier, eg, water for injection just before use.
  • a sterile liquid carrier eg, water for injection just before use.
  • Immediately injectable solutions and suspensions may be prepared as sterile powders, granules or tablets.
  • the pharmaceutical compositions of the present invention can be formulated or included in the form of microspheres in a liquid.
  • the pharmaceutical compositions of the present invention may comprise their pharmaceutically acceptable compounds and / or mixtures at concentrations between 0.001 and 100,000 U / kg.
  • the pharmaceutical compositions of the present invention may include suitable excipients, preservatives, suspending agents, additional stabilizers, dyes, buffers, antibacterial agents, antifungal agents, and isotonic agents, for example, sugars or sodium chloride.
  • suitable excipients such as used herein, the term "stabilizer” refers to a compound that is optionally used in the pharmaceutical compositions of the present invention to increase shelf life.
  • the stabilizer can be a sugar, an amino acid, or a polymer.
  • the pharmaceutical composition of the present invention may include one or more pharmaceutically acceptable carriers, and the carrier may be a solvent or a dispersion medium.
  • pharmaceutically acceptable carriers include water, saline, ethanol, polyols (eg glycerol, propylene glycol and liquid polyethylene glycols), oils, and suitable mixtures thereof.
  • sterilization techniques applied to the pharmaceutical compositions of the present invention include filtration through bacteria-inhibiting filters, terminal sterilization, incorporation of sterile preparations, irradiation, sterile gas irradiation, heating, vacuum drying and freeze drying. do.
  • administration means introducing the composition of the present invention to a patient in any suitable manner, and the route of administration of the composition of the present invention may be administered via any general route as long as it can reach the desired tissue.
  • the method of treatment of the present invention may comprise administering the pharmaceutical composition in a pharmaceutically effective amount.
  • the effective amount is defined as the type of disease, the severity of the disease, the type and amount of the active ingredient and other ingredients contained in the composition, the type and formulation of the patient and the age, body weight, general health condition, sex and diet, time of administration, route of administration And various factors, including the rate of secretion of the composition, the duration of treatment, and the drugs used concurrently.
  • an aptamer complex comprising a branched DNA, an aptamer corresponding to a target sequence, and a terminal DNA
  • the branched DNA provides an aptamer complex that is Y-type DNA
  • Y-type DNA provides any one or more aptamer complexes selected from the group consisting of SEQ ID NOs: 1-6
  • the protein corresponding to the target sequence is vascular endothelial growth factor (VEGF), bovine serum albumin (BSA), adenosine
  • VEGF vascular endothelial growth factor
  • BSA bovine serum albumin
  • An aptamer complex is provided which is at least one selected from the group consisting of triphosphate (ATP), hepatitis C virus (HCV), and human immunodeficiency virus (HIV), wherein the aptamer corresponding to the target sequence is SEQ ID NOs: 7-9 It provides any one or more aptamer complexes selected from the group consisting of, wherein the terminal DNA is prepared from any one
  • a drug delivery agent comprising the aptamer complex as an active ingredient.
  • the present invention provides a pharmaceutical composition for treating cancer comprising the aptamer complex as an active ingredient, wherein the cancer is melanoma, small cell lung cancer, non-small cell lung cancer, brain tumor, liver cancer, thyroid tumor, Stomach cancer, prostate cancer, breast cancer, ovarian cancer, bladder cancer, lung cancer, colon cancer, breast cancer, prostate cancer, glioblastoma, cervical cancer, endometrial cancer, kidney cancer, colon cancer, pancreatic cancer, esophageal carcinoma, head and neck tumor, mesothelioma, sarcoma, cholangiocarcinoma It provides a pharmaceutical composition for treating cancer which is at least one selected from the group consisting of small intestine adenocarcinoma, childhood malignant cancer, and epidermal cancer.
  • a cancer diagnostic kit comprising the aptamer complex as an active ingredient.
  • the present invention relates to high efficiency aptamer complexes comprising branched DNA and aptamers, and uses thereof, wherein the aptamer complexes of the present invention utilize branched DNA that is highly stable against nucleic acid amplification and nonspecific hybridization. Coupling efficiency is significantly better than conventional aptamers.
  • the pharmaceutical composition comprising the aptamer complex of the present invention as an active ingredient has no risk of toxicity in vivo, is stable in blood, and is excellent in the therapeutic effect of a target disease, and thus is expected to be widely used in the medical field. .
  • FIG. 1 is a view showing a manufacturing schematic of a CA designed in the present invention, according to an embodiment of the present invention.
  • FIG. 2 is a view showing the results of confirming the generation and size of the structure of the CA by electrophoresis according to an embodiment of the present invention.
  • FIG. 3 is a diagram illustrating dynamic scattered light analysis of CAs having various concentrations of Blu_ends according to an embodiment of the present invention.
  • FIG. 4 is a view showing the results of dynamic scattered light analysis of OA, AA, and CA according to an embodiment of the present invention.
  • FIG. 5 is a view showing a transmission electron microscope analysis of the CA, according to an embodiment of the present invention.
  • FIG. 6 is a view showing the results of atomic force microscopy analysis of CA, according to an embodiment of the present invention.
  • FIG. 7 is a diagram illustrating a synchrotron X-ray scattering measurement result of CA according to an embodiment of the present invention.
  • FIG. 7A shows representative X-ray scattering profiles of DNA complexes
  • FIG. 7B shows Guinea transformation values
  • FIG. 7C shows Kratky expression graphs.
  • FIG. 8 is a view showing the results of confirming the stability in the serum of OA, AA, and CA according to an embodiment of the present invention.
  • Figure 9 is a view showing the results of measuring the hVEGF capture capacity according to the degradation rate of OA, AA, and CA according to an embodiment of the present invention with a kit.
  • FIG. 10 is a view showing the results of measuring the ELVEGF hVEGF capture capacity of OA, AA, and CA according to an embodiment of the present invention.
  • FIG. 11 is a view showing the results of measuring the cytotoxicity of OA, AA, and CA by MTT according to an embodiment of the present invention.
  • FIG. 12 is a diagram showing the results of evaluating the degree of cellular uptake and internalization of CA according to an embodiment of the CA produced with FAM fluorescently labeled Blu_end according to an embodiment of the present invention.
  • Figure 13 is a diagram showing the results of tracking the short-term tumor size change after the administration of OA, AA, CA, or CSc to the cancer cell-administered mouse according to an embodiment of the present invention.
  • FIG. 14 is a diagram showing the results of tracking tumor size changes in organs after injection of OA, AA, CA, or CSc to cancer cell-administered mice according to an embodiment of the present invention.
  • 15 is a view showing the overall shape of the tumor tissue obtained on the 28th day after the injection of OA, AA, CA, or CSc to the cancer cell-administered mouse according to an embodiment of the present invention.
  • 16 is a diagram showing the results of tracking the change in the weight of the mouse after organ injection of OA, AA, CA, or CSc to the cancer cell-administered mouse according to an embodiment of the present invention.
  • FIG. 17 shows CD-31 tumor marker staining on day 28 after OA, AA, CA, or CSc injection was administered to cancer cell-administered mice according to one embodiment of the present invention.
  • FIG. 18 is a view showing the result of H & E staining on the 28th day after the injection of OA, AA, CA, or CSc to the cancer cell-administered mouse according to an embodiment of the present invention.
  • CA structured aptamer complex
  • Y-5, Y-3 the framework of the overall structure
  • Y_Vapt an aptamer capable of hybridizing with Y-shaped DNA protrusions
  • Blu_end is a type of terminal DNA that was used to block overhangs of Y-type DNA (single strands of unpaired nucleotides).
  • the hybridized oligomeric aptamers are used for specific interactions and capture with the target molecule.
  • FIG. 1 A schematic of the structured aptamer complex is shown in FIG. 1.
  • CA hVEGF DNA aptamer
  • Y_Vapt hVEGF DNA aptamer
  • Y_Vapt hVEGF DNA aptamer of hairpin structure.
  • six types of Y-type branched DNA Y01-5, Y02-5, Y03-5, Y01-3, Y02-3, Y03-3
  • Blu_end Y-Vapt
  • the generation of CA is determined by the ratio between Blu_end DNA and Y-type DNA.
  • CA_G # # of generation
  • hVEGF aptamers were prepared in the same manner as known techniques (J.
  • [Phos] indicated in the sequence is phosphorylated sequence
  • [FAM] is phosphor linked to the sequence.
  • Oligomeric aptamer complex (OA), oligomeric scrambled DNA (OSc), amplified aptamer complex (AA), amplified scrambled DNA (ASc) as a control for the CA of the present invention ), And structured scrambled DNA (CSc) were tested.
  • OA oligomeric hVEGF aptamer DNA was prepared by simple annealing.
  • Y_Vapt used to prepare CA was replaced with Y_Sc, which is a structured scrambled DNA without VEGF trapping ability and corresponds to a control group.
  • the concentrations of aptamers in OA, AA, and CA remained the same.
  • cyclic DNA was obtained using Phos_Vapt and Phos_Sc as templates. More specifically, phosphorylated modified DNA was mixed with ATP, MgCl 2, and ligase enzyme in buffer and reacted at 60 ° C. for 12 hours. After the enzyme inactivation process, the reaction was carried out for 30 minutes at 37 ° C. with 20U of nucleic acid Iase (Exonuclease I) and 100U of nucleic acid protease III (Exonuclease III), and the enzyme inactivation process was performed again. Synthesized cyclic DNA was confirmed by polyacrylamide gel electrophoresis after purification with DNA PrepMateTM-II, and the concentration was measured by UV absorption at 280 nm.
  • TM CircLigase
  • a 'rolling circle amplification (RCA)' process was performed to prepare amplified aptamer complex (AA) using the synthesized cyclic DNA, followed by F29 polymerase protocol. Specifically, a buffer containing dNTP, BSA, and F29 polymerase was added to the prepared cyclic Phos_Vapt and Pri_Vapt, and the solution was sufficiently reacted after mixing well. The solution was then slowly cooled after reaction at 80 ° C. for enzyme inactivation. Amplified aptamer complexes using Phos_Sc and Pri_Sc were also prepared in the same manner.
  • Samples were prepared by dissolving 1 nmole of OA, 10 pmole of primer AA amplified for 4 hours, or CA containing 1 nmole of aptamer in 50 mL of PBS.
  • the size of each aptamer in the solution was measured using Zetasizer Nano (Malvern Instruments, Malvern, UK). The measurement results are shown in FIGS. 3 and 4.
  • the average diameters of CA_G3, CA_G4, and CA_G5 were 112.6 nm, 132.0 nm, and 159.4 nm, respectively, and the CA without Blu_end was 123.5 nm.
  • the diameters of OA and AA were measured at 8.9 nm and 510.0 nm, respectively, and the diameter of AA was very large compared to CA.
  • Example 1-4 Image analysis of the prepared aptamer
  • Samples for transmission electron microscopy were prepared by depositing 10 mM of CA on a carbon grid coated with an ultra-thin carbon film (400 mesh, Ted Pella, Redding, Calif., USA). The grid was dried for one day prior to measurement, and TEM images were acquired with JEM-1011 (JEOL, Tokyo, Japan).
  • CA_G4 The images of measuring CA (CA_G4) by the TEM and AFM are shown in FIGS. 5 and 6. As a result, the spherical structure of CA was confirmed and the particle size was 105 ⁇ 9 nm.
  • the scattering intensity I (q) of the spherical particles in the solvent medium is calculated by a formula according to a known technique (Li, T et al., Chem. Rev. 2016, online publishing), and the radius of rotation of the DNA complex (Rg) is calculated. )
  • the X-ray scattering measurement results are shown in FIG. 7.
  • FIG. 7A Representative X-ray scattering profiles of DNA complexes are shown in FIG. 7A.
  • FIG. 7B the maximum qRg value for Guinea was 1.16 and the qRg limit value was 1.33.
  • OA oligomeric aptamer complexes
  • AA amplified aptamer complexes
  • CA structured aptamer complexes
  • the hVEGF capture capacity of OA and CA_G4 according to degradation rate is shown in FIG. 9.
  • the capture efficiency of CA_G4 was 100% immediately after preparation and incubated for 3 days.
  • the capture efficiency was 71.7%.
  • OA was found to capture little hVEGF independent of serum incubation time. This result indicates that CA_G4 has a fairly stable target molecule capture ability even in serum.
  • each prepared sample was mixed with hVEGF solution for 4 hours at room temperature, and the mixed solution was filtered through a PD-10 column (Sephadex G-25, GE Healthcare, Sweden). It was.
  • the amount of unpurified hVEGF was determined by hVEGF (ELISA kit, Komabiotech) enzyme-linked immunosorbent assay kit according to the manufacturer's guidelines (absorbance measurements at 490 nm by VICTOR3 VTM (Multilabel Counter, Perkin Elmer, Wellesley, Mass., USA)). Measured.
  • the hVEGF capture capacity of other samples such as OSc, ASc, and CSc was measured in the same way and the results are shown in FIG. 10.
  • CA_G4 aptamer at 50 pmole
  • Cytotoxicity of each aptamer complex was assessed using standard MTT assay.
  • A549 cells lung adenocarcinoma cells
  • DMEM serum-free medium
  • DMEM serum-free medium
  • the mixture was then replaced with fresh medium containing MTT solution (5 mg / mL) and reacted further for 4 hours.
  • CA prepared with FAM fluorescently labeled Blu_end was prepared and treated with A549 cells. More specifically, A549 cells were seeded on glass coverslips placed in 12-well plates at a density of 2 ⁇ 10 4 cells / well and incubated for 18 hours. The culture (DMEM) was then replaced with fresh serum-free DMEM containing FAM-labeled CA (containing 0.5 nmole of FAM) and incubated for an additional 5 hours. After incubation, cold DPBS addition blocked cell uptake, and cells were washed and finally fixed at 4 ° C. overnight with 10% neutral buffered formalin (NBF). Cells on the coverslip were observed with a confocal laser scanning microscope (Modified Zeiss Axio Observer, Z1 epi-fluorescence microscope) by DAPI staining, and the image results are shown in FIG. 12.
  • CSc has the same structure as CA in vivo, but the DNA sequence is a different aptamer complex.
  • the anticancer effect of the administered aptamers on A549 cells was analyzed by measuring tumor diameter with a caliper. The measured values were converted into tumor volumes using the formulas described in Table 3 below.
  • Tumor volume a X b 2 X 0.5 (a is short, b is long)
  • FIGS. 13 and 14 show changes in tumor size.
  • Experimental results showed that the aptamer untreated control (Control) increased OA, AA, and CSc by 8.9-fold, 9.5-fold, and 13.1-fold, respectively, compared to a 14.4-fold increase in tumor size on day 28.
  • the levels are reduced but not significant for anti-tumor therapy.
  • CA showed a 1.3-fold increase in tumors on day 28, indicating a significant tumor growth inhibitory effect.
  • the overall morphology of tumors obtained on day 28 is shown in FIG. 15.
  • mice The weight change of the mice is shown in FIG. 16. There was no significant change in body weight of mice by day 28 in all groups tested. This means that the designed OA, AA, and CA are not toxic in biological conditions.
  • mice were sacrificed four days after each aptamer complex (OA, AA, CA, or CSc) was administered to tumor cell-injected mice.
  • Tumors were excised and fixed for 24 hours at 10% NBF, embedded with paraffin, and cut to 4 mm thickness using Finesse ME microtome.
  • Tumor sections were stained with hematoxylin and eosin (H & E) to confirm histological changes of the tumor, and x10 magnification images were obtained with an optical microscope (Nikon eclipse 80i, USA).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Immunology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 분지된 DNA 및 압타머를 포함하는 고효율 압타머 복합체 및 이의 약학적 용도에 관한 것이다. 보다 구체적으로, 본 발명의 압타머 복합체는 분지된 DNA로서 Y형 DNA를 포함하고, 혈관내피세포 성장인자(vascular endothelial growth factor, VEGF)를 타겟 분자로 하는 고효율 압타머 복합체에 관한 것이다. 본 발명의 압타머 복합체, 및 이를 유효성분으로 포함하는 약학조성물은 타겟 분자와의 결합 효율이 종래의 압타머보다 현저하므로, 의학 분야에서의 크게 이용될 것으로 기대된다.

Description

분지된 DNA, 압타머를 포함하는 고효율 압타머 복합체 및 이의 용도
본 출원은 2018년 03월 28일자 한국 특허 출원 제10-2018-0035864호에 기초한 우선권의 이익을 주장하며, 해당 한국 특허 출원의 문헌에 개시된 모든 내용은 본 명세서의 일부로서 포함한다.
본 발명은 분지된 DNA 및 압타머를 포함하는 고효율 압타머 복합체 및 이의 약학적 용도에 관한 것이다. 보다 구체적으로, 본 발명의 압타머 복합체는 분지된 DNA로서 Y형 DNA를 포함하고, 혈관내피세포 성장인자(vascular endothelial growth factor, VEGF)를 타겟 분자로 하는 고효율 압타머 복합체에 관한 것이다.
암세포 표면 단백질과 높은 친화성을 가지고 특이적으로 암세포에 결합할 수 있는 리간드 물질은 암 진단 및 치료제 개발에 중요하다. 이러한 리간드 물질은 암 바이오마커로도 사용될 수 있고, 바이오마커에 대한 이해는 신규 암 치료제의 개발을 촉진할 수 있다. 압타머는 타겟에 대하여 높은 친화성과 특이성을 가지고 결합되도록 특이적인 3차원 구조로 접힐 수 있는 단일가닥 DNA, 또는 RNA 올리고뉴클레오티드이다. 압타머에 대한 타겟은 소분자 화합물, 펩타이드, 단백질이 될 수 있으며, 세포 자체가 될 수도 있다(Dua, P. et al., Recent Pat . DNA Gene Seq ., 2:172, 2008). 이러한 압타머는 항체에 비하여, 더 작은 사이즈, 더 우수한 조직 침투성, 화학적 조작의 용이성, 및 면역반응을 야기하지 않음 등의 장점을 가진다. 또한, in vivo 이미징 적용 시, 압타머는 그 작은 크기 덕분에 항체에 비하여 더 빠른 반응속도와 더 우수한 신호-노이즈 비를 가진다. 압타머는 또한, 이미지 특이성을 향상시키기 위하여, 자기나노입자 표면에 부착되어 자기공명영상(MRI)에 사용될 수 있다. 암 치료제로서, 압타머는 암 성장인자 또는 성장인자 수용체를 블로킹함으로써 암 성장 신호경로를 직접 억제하거나, 세포 독성제, 또는 siRNA와 같은 치료분자를 타겟세포로 운반하는 "escort aptamers"로서 사용될 수 있다. 따라서 신규 암 진단제 및 치료제로서 암세포 타입 또는 암세포 표면 단백질을 타겟팅하는 특이적인 압타머가 개발되어 왔다. 예를 들어, 대한민국 등록특허 제10-1759209에서는 유방암 세포 또는 조직에 특이적으로 결합할 수 있는 핵산 압타머를 개시하고 있고, 대한민국 등록특허 제10-1189790에서는 췌장암 세포 또는 조직에 특이적으로 결합할 수 있는 핵산 압타머를 개시하고 있다. 그러나 종래의 압타머 암 치료제는 혈관을 따라 주입했을 때 비특이적인 축적이 많아 독성을 유발할 가능성이 있고, 체내에서 암 세포의 성장을 억제하는 효과가 기대에 미치지 못하므로 실제 임상에서의 적용에 한계가 많은 실정이다.
한편, 분지된 DNA란 DNA 나선구조에 인위적인 분지를 발생시킨 것으로, Y형 DNA, 또는 X형 DNA가 대표적이며, 3종류의 핵산 서열이 결합된 경우를 Y형, 4종류의 핵산 서열이 결합된 경우를 X형이라 한다(Jingjing Li 등, Anal. Chem., 2017, 89 (23), pp 12850-12856).
본 발명은 분지된 DNA 및 압타머를 포함하는 고효율 압타머 복합체에 관한 것으로, 본 발명의 압타머 복합체, 및 이를 유효성분으로 포함하는 약학조성물은 타겟 분자와의 결합 효율이 종래의 압타머에 비해 현저하게 우수하므로, 의학 분야에서 크게 이용될 것으로 기대된다.
[선행기술문헌]
[특허문헌]
대한민국 등록특허 제 KR10-1759209호
대한민국 등록특허 제 KR10-1189790호
본 발명은 분지된 DNA 및 압타머를 포함하는 고효율 압타머 복합체 및 이를 유효성분으로 포함하는 암 치료용 약학조성물을 제공하는 것을 그 목적으로 한다. 그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
이하, 본원에 기재된 다양한 구체예가 도면을 참조로 기재된다. 하기 설명에서, 본 발명의 완전한 이해를 위해서, 다양한 특이적 상세사항, 예컨대, 특이적 형태, 조성물, 및 공정 등이 기재되어 있다. 그러나, 특정의 구체예는 이들 특이적 상세 사항 중 하나 이상 없이, 또는 다른 공지된 방법 및 형태와 함께 실행될 수 있다. 다른 예에서, 공지된 공정 및 제조 기술은 본 발명을 불필요하게 모호하게 하지 않게 하기 위해서, 특정의 상세사항으로 기재되지 않는다. "한 가지 구체예" 또는 "구체예"에 대한 본 명세서 전체를 통한 참조는 구체예와 결부되어 기재된 특별한 특징, 형태, 조성 또는 특성이 본 발명의 하나 이상의 구체예에 포함됨을 의미한다. 따라서, 본 명세서 전체에 걸친 다양한 위치에서 표현된 "한 가지 구체예에서" 또는 "구체예"의 상황은 반드시 본 발명의 동일한 구체예를 나타내지는 않는다. 추가로, 특별한 특징, 형태, 조성, 또는 특성은 하나 이상의 구체예에서 어떠한 적합한 방법으로 조합될 수 있다.
본 명세서에 있어서 “압타머(aptamer)”란, 특이적 3차원 형성을 형성하는 15-40개의 단일가닥 올리고뉴클레오티드로서, 스템 루프(stem loop) 구조를 가지며, 특정 분자에 특이적으로 결합하는 성질이 있다. 압타머는 화학적으로 합성이 용이하며, 화학적 변형이 쉽고 열에 안정적이면서 타겟에 대한 특이도가 매우 높은 화합물이다. 압타머의 서열은 SELEX(selective evolution of ligands by exponential enrichment)란 방법으로 발굴할 수 있으며, 이미 수백 종의 압타머 서열이 공개되어 있다. 압타머는 특이적으로 타겟과 결합한다는 점에서 흔히 항체와 비교되기도 하지만, 면역반응이 없다. 저분자 유기물, 펩타이드, 막 단백질까지 다양한 표적분자에 결합할 수 있는 많은 압타머들이 계속 해서 발굴되어 왔다. 압타머는 고유의 높은 친화성(보통 pM 수준)과 특이성으로 표적분자에 결합할 수 있다는 특성 때문에 자주 단일 항체와 비교가 되고, 특별히 'chemical antibody'라 불리는 만큼 대체항체로서의 가능성도 매우 높다.
항체는 분자 구조가 크기 때문에(~150kDa) 생산하는데 어려움이 있고 변형(modification) 또한 용이하지 못한 반면, 압타머는 약 20~60mer 정도 길이의 핵산으로 구성되어 있는 작은 분자 구조이고, 여러 필요한 변형이 용이한 장점을 가지고 있다. 압타머는 항체에 비해 안정성이 매우 높다. 단백질이나 항체 의약품의 경우 실온에서 보관이나 운반이 불가능하지만 압타머는 가능하고, 심지어 멸균 후에도 기능을 유지할 수 있으며, 만약 변성(denaturation)이 되더라도 다시 짧은 시간에 재생(regeneration)이 가능하기 때문에 특히 장시간 또 반복사용이 요구되는 진단용으로의 응용이 매우 용이하다.
새로운 압타머를 SELEX를 통해 발굴하는 과정을 살펴보면, 먼저 (i) DNA 합성 및 RNA인 경우에는 시험관내 전사(in vitro transcription) 방법을 이용하여 다양한 형태를 가지는 핵산 라이브러리를 만든다. (ii) 항체가 여러 종류의 항원과 결합하는 것처럼 핵산 구조체 라이브러리 안에 있는 다양한 핵산 구조체들 (압타머 후보 분자들)은 다양한 표적물질과 결합할 수 있는 능력을 가지고 있고 따라서 다음 과정으로 원하는 표적분자와 결합할 수 있는 핵산 구조체만을 선별하는 과정을 거치게 된다. (iii) 친화 크로마토그래피(affinity chromatography)와 같은 방법을 통해 결합하지 않은 핵산구조체는 제거되고 표적분자에 결합하는 것만을 선택적으로 얻을 수 있게 된다. (iv) 마지막으로 표적분자로부터 핵산 구조체를 분리(elution)하게 되고 그 핵산을 증폭시킨 후 얻은 핵산 구조체를 이용하여 다시 이 과정들을 5~15번 정도 더 반복함으로써 매우 우수한 결합력과 특이성을 보이는 압타머를 발굴할 수 있다. 상기와 같이 SELEX를 통해 얻어진 초기의 압타머들은 더 안정적이고 강력한 압타머로 개량하고자 하는 후-SELEX(post-SELEX) 과정을 수행하기도 한다. 대표적인 예로 RNA 압타머의 리보오스 2'-OH를 2'-F나 2'-NH2, 2'-O-메틸기로 치환하는 것이다. 이런 변화를 거치게 되면 핵산 분해효소에 대한 저항성이 우수하여 혈액 내에서 안정성이 10,000배 이상 증가된 압타머를 얻을 수 있게 된다. 이 외에도 압타머를 폴리에틸렌글리콜(polyethylene glycol, PEG)과 같은 고분자나 디아실글리세롤(diacylglycerol) 혹은 콜레스테롤(cholesterol)을 접합시켜 혈액 내에서 빠르게 소멸되는 것을 줄일 수 있다. 그리고 5'말단이나 3'말단에 비오틴(biotin)을 결합시킨 압타머를 만들어 스트렙타아비딘 지지체(streptavidin support)에 부착시켜 바이오 센서/칩 분야에서 사용될 수 있다(Dausse E. et al., Aptamers: a new class of oligonucleotides in the drug discovery pipeline, Curr. Opin. Pharmacol, 2009).
이러한 기술적 배경하에서, DNA을 이용해 개발된 DNA 구조체는 상보적인 핵산끼리 서열 특이적 상호작용을 함으로써 자기조립되며, 자기조립된 나노단위 구조체인 DNA 구조체는 염기 서열을 조절하고, pH와 온도, 빛 등 주변 환경 변화에 의해 구조변환을 유도함으로써 역동적인 움직임을 유발한다. DNA가 접합된 나노입자에 대해서는 많은 연구가 진행되고 있지만 혈관을 따라 주입했을 때 비특이적인 축적이 많아 독성을 유발할 수 있어 암세포만 표적으로 삼아 약물체를 전달하는 시스템에 대한 연구가 필요한 실정이다.
본 발명에 있어서 “분지된 DNA(branched DNA, bDNA)”란, DNA 나선구조에 인위적인 분지를 발생시킨 것으로, Y형 DNA, 또는 X형 DNA가 대표적이며, 3종류의 핵산 서열이 결합된 경우를 Y형, 4종류의 핵산 서열이 결합된 경우를 X형이라 한다(Jingjing Li 등, Anal. Chem., 2017, 89 (23), pp 12850-12856). 분지된 DNA는 핵산 분자의 신뢰할 수 있는 정량 분석, 또는 타겟 분자와의 고효율 결합에 효과적이다. 분지된 DNA는 PCR과 같은 핵산 증폭 및 비특이적 혼성화에 대해 매우 안정하므로, 종래의 핵산을 이용한 정량적 검출 한계를 50 분자 정도로 낮추는 것이 가능하다(Collins ML 등, Nucleic Acids Res. 1997 Aug 1;25(15):2979-84. 및 Kern D 등, J Clin Microbiol. 1996 Dec;34(12):3196-202).
본 명세서에 있어서 “혈관내피세포 성장인자(vascular endothelial growth factor, VEGF)”란, 혈관내피세포의 중요한 생존 인자이다. 생물학적 기능의 관점에서 VEGF는 가장 강력한 신생혈관유발인자 중 하나이며, 혈관 투과성의 중요한 조절자이다. VEGF는 습성 연령 관련 황반변성(wet-type age-related macular degeneration, AMD) 및 혈관 신생종양성장과 같은 병리학적 혈관신생 관련 질환의 주요한 조절자로 널리 허용되고 있다. 또한, 혈관 투과성의 강력한 증강제로서, 또한 당뇨병 황반 부종을 포함하여 병원성 혈관 누수와 관련된 질환에 깊이 관여한다.
항 VEGF의 치료는 습성 AMD, 당뇨병성 황반부종 및 암에 대한 가장 중요한 치료 방법으로 간주된다. (1) 항체(베바시주맙(bevacizumab), 라니비주맙(ranibizumab)) 또는 (2) VEGF 또는 VEGF 수용체(VEGFR)를 중화하기 위한 압타머(pegaptanib), (3) VEGF mRNA를 타겟팅하기 위한 siRNA (4) VEGF 수용체에 대한 소분자 티로신 키나제 저해제(lapatinib, sunitinib) 및 (5) VEGF와 VEGFR의 상호 작용을 저해하는 용해성 VEGF 수용체(sVEGFR)를 이용하여 VEGF 경로를 블록킹하는 다양한 기술들이 있다(Cardones, A. R. et al., Current pharmaceutical design 2006, 12, 387-394; Vasudev, N. S. et al., Angiogenesis 2014, 17, 471-494).
최근에는 많은 항-VEGF 약물이 VEGF-관련 질환의 치료에 사용된 예가 보고되었다. 그러나 생리학적 조건하에 체내에서의 이들 약물의 효율, 독성 및 안정성이 불확실한 문제가 있다(Kamba, T. et al., British Journal of Cancer 2007, 96, 1788-1795; Al-Husein, B. et al., Pharmacotherapy: The Journal of Human Pharmacology and Drug Therapy 2012, 32, 1095-1111)
VEGF165에 대한 RNA 압타머인 pegaptanib는 신생혈관 AMD의 치료를 위한 항-VEGF 약물로 FDA에 의하여 처음 승인되었다. 이 압타머 약물은 안전하나, 항 VEGF 단클론 항체인 라니비주맘(ranibizumab) 및 IgG의 Fc 부분에 융합된 VEGF 수용체 1 및 2인 애플리버셉트(aflibercept)과 같은 다른 대체 항-VEGF 약물과 비교하였을 때 그리 효율적이지 않아, 실제 임상에서는 거의 사용되지 않는다(Gragoudas, E. S. et al., The New England journal of medicine 2004, 351, 2805-2816; Schmidt-Erfurth, U. et al., The British journal of ophthalmology 2014, 98, 1144-1167). VEGF에 대한 결합 친화도 및 생체 내 안정성은 항-VEGF 압타머의 생물학적 효과를 영향을 미치는 주요한 인자이다. 뉴클레아제에 대한 내성을 향상시키기 위하여 구조적으로 변형시킬지라도 pegaptanib는 정맥주사 후에 9.3시간이고, 피하주사 후에 12시간으로 생체 내 반감기가 비교적 짧다는 문제점이 있다(Tucker, C. E. et al., Journal of chromatography. B, Biomedical sciences and applications 1999, 732, 203-212).
본 명세서에 있어서 “압타머 복합체(aptamer complex)”란, 본 발명에서 개발된 압타머 복합체로서, 분지된 DNA, 표적 서열에 대응하는 압타머, 및 말단 DNA를 포함하는 압타머 복합체를 의미한다. 이에 제한하는 것은 아니나, 상기의 분지된 DNA는 Y형 DNA인 것이 바람직하고, 상기의 표적 서열은 혈관내피세포 성장인자(VEGF) 단백질에 해당하는 서열인 것이 바람직하며, 상기의 말단 DNA는 Blu_end인 것이 바람직하다.
고형 종양의 성장 및 전이에는 혈관 형성이 매우 중요하다. 특히, VEGF 신호 전달 경로와 매우 관련이 깊은 종양 혈관 신생 및 혈관 형성은 종양의 발병에 중요한 과정이다. 지금까지 '항 -VEGF 요법'또는 '항 - 혈관 신생 요법'으로서 항 -VEGF 인자를 이용한 항암 치료에 대한 많은 보고가 있었다. 본 발명자들의 이전 연구는 폴리머 증폭 VEGF 압타머를 개시하였으나, AA와 같이 RCA공정에 의해 구조가 고도로 얽힌 복합체는 동일한 양의 올리고머 압타머에 비해 현저하게 낮은 VEGF 포획 효율을 보여주었다. 이러한 관점에서, 분지된 DNA, 표적 서열에 대응하는 압타머, 및 말단 DNA를 포함하는 압타머 복합체는 생체 내에서 종양 성장 억제를 위한 압타머 복합체 치료제로서 높은 안정성 및 포획 효율을 가지므로, 임상에서 크게 이용될 것으로 기대된다.
본 발명에 있어서, 상기 타겟분자는 혈관내피세포 성장인자(VEGF), 소 혈청 알부민(BSA), 아데노신 삼인산(ATP), C형 간염 바이러스(HCV), 및 인간 면역 결핍 바이러스(HIV)로 구성된 군으로부터 선택되는 어느 하나일 수 있으며, DNA 기반 압타머가 개발된 표적 물질이면 모두 사용 가능하다. 즉, VEGF 외의 물질도 압타머 서열만 대응되도록 설계하면 어느 물질이든 선택하여 포획될 수가 있다. 예를 들어 BSA에 대한 압타머를 특정해 분지된 DNA(Branched DNA)와 압타머 복합체를 형성시켜 BSA만을 포획할 수 있다.
본 발명에서는 특정 타겟분자를 선택적이고 효율적으로 포획하기 위하여 분지된 DNA를 포함하는 고효율 압타머 복합체를 제조하는 데에 있어서, 특정한 타겟 단백질로 암 주변에서 흔히 발견되고, 황반부종의 원인 물질로 알려진 혈관내피 세포 성장인자를 설정할 수 있어, 바람직하게는 혈관내피세포 성장인자를 선택하여 사용할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서 “약학조성물”이란, 특정한 목적을 위해 투여되는 조성물을 의미한다. 본 발명의 목적상, 본 발명의 약학조성물은 암 또는 황반부종의 치료를 위해 사용되는 것을 목적으로 하고, 분지된 DNA 및 압타머를 포함하는 고효율 압타머 복합체를 유효성분으로 포함하는 조성물이고, 이에 관여하는 단백질 및 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 포함할 수 있다.
상기의 "약학적 허용될 가능한" 담체 또는 부형제는 정부에 의해 승인된 것, 또는 척추 동물, 그리고 보다 특별하게는 인간에게 사용을 위한 정부 또는 기타 일반적으로 승인된 약전에서 리스트된 것을 의미한다.
비경구적인 투여를 위해 본 발명의 약학조성물은 유성 또는 수성 담체에 있는 현탁액, 용액 또는 에멀젼의 형태로 될 수 있고, 고체 또는 반고체의 형태로 제조될 수 있다. 또한, 본 발명의 약학조성물은 현탁제, 안정화제, 용해제 및/또는 분산제와 같은 제형화제를 포함할 수 있고, 멸균될 수 있다. 상기 약학조성물은 제조 및 저장의 조건 하에서 안정할 수 있고, 세균이나 곰팡이와 같은 미생물의 오염 작용에 대해 보존될 수 있다. 대안적으로, 본 발명의 약학조성물은 사용 전에 적절한 담체와 재구성을 위해 멸균 분말 형태일 수 있다. 약학조성물은 단위-복용량 형태로, 마이크로니들 패치에, 앰플에, 또는 기타 단위-복용량 용기에, 또는 다-복용량 용기에 존재할 수 있다. 대안적으로, 약학적 조성물은 단지 멸균 액체 담체, 예를 들어 사용 바로 전에 주사용 물의 부가함을 요하는 동결-건조된(냉동건조) 상태로 보관될 수 있다. 즉시 주사용액 및 현탁액은 멸균 분말, 그래뉼 또는 타블렛으로 제조될 수 있다.
몇몇 비 제한적인 실시형태에 있어서, 본 발명의 약학조성물은 제형화되어 질 수 있고, 또는 액체 속에 미립구의 형태로 포함될 수 있다. 어떤 비 제한적인 실시형태에 있어서, 본 발명의 약학조성물은 이들의 약학적으로 허용될 수 있는 화합물 및/또는 혼합물을 0.001 내지 100,000 U/kg 사이의 농도로 포함할 수 있다. 또한 어떤 비 제한적인 실시형태에 있어서, 본 발명의 약학조성물은 적절한 부형제는 보존제, 현탁제, 추가적인 안정화제, 염료, 완충제, 항균제, 항진균제, 및 등장화제, 예를 들어, 설탕 또는 염화나트륨을 포함할 수 있다. 여기서 사용된 것으로, 용어 "안정화제"는 보존 수명을 증가하기 위해 본 발명의 약학조성물에 선택적으로 사용된 화합물을 언급한다. 비-제한적인 실시에 있어서, 안정화제는 당, 아미노산, 또는 폴리머일 수 있다. 또한 본 발명의 약학조성물은 하나 또는 그 이상의 약학적으로 허용될 수 있는 담체를 포함할 수 있고, 상기 담체는 용매 또는 분산 배지일 수 있다. 약학적으로 허용될 수 있는 담체의 비-제한적인 예는 물, 식염수, 에탄올, 폴리올 (예, 글리세롤, 프로필렌 글리콜 및 액체 폴리에틸렌 글리콜), 오일, 및 이들의 적절한 혼합물을 포함한다. 본 발명의 약학조성물에 적용되는 멸균 기술의 비-제한적인 예는 세균-억제 필터를 통한 여과, 터미날 멸균화, 멸균 제제의 합체, 방사선 조사, 멸균 가스 조사, 가열, 진공 건조 및 동결 건조를 포함한다.
본 명세서에 있어서 “투여”란, 어떠한 적절한 방법으로 환자에게 본 발명의 조성물을 도입하는 것을 의미하며, 본 발명의 조성물의 투여경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 투여될 수 있다. 경구 투여, 복강 내 투여, 정맥 내 투여, 근육 내 투여, 피하 투여, 피내 투여, 비내 투여, 폐내 투여, 직장내 투여, 강내 투여, 복강 내 투여, 경막 내 투여가 이루어질 수 있으나, 본 발명의 목적상 주사의 형태로 투여되는 것이 바람직하며, 이에 제한되는 것은 아니다.
본 발명의 치료 방법은 상기 약학조성물을 약제학적 유효량으로 투여하는 것을 포함할 수 있다. 본 발명에서 유효량은 질환의 종류, 질환의 중증도, 조성물에 함유된 유효 성분 및 다른 성분의 종류 및 함량, 제형의 종류 및 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료 기간, 동시 사용되는 약물을 비롯한 다양한 인자에 따라 조절될 수 있다.
본 발명의 일 구체예에서, 분지된 DNA, 표적 서열에 대응하는 압타머, 및 말단 DNA를 포함하는 압타머 복합체를 제공하고, 상기 분지된 DNA는 Y형 DNA인 압타머 복합체를 제공하며, 상기 Y형 DNA는 서열번호 1 내지 6으로 구성된 군으로부터 선택되는 어느 하나 이상인 압타머 복합체를 제공하며, 상기 표적 서열에 대응하는 단백질은 혈관내피세포 성장인자(VEGF), 소 혈청 알부민(BSA), 아데노신 삼인산(ATP), C형 간염 바이러스(HCV), 및 인간 면역 결핍 바이러스(HIV)로 구성된 군으로부터 선택되는 어느 하나 이상인 압타머 복합체를 제공하며, 상기 표적 서열에 대응하는 압타머는 서열번호 7 내지 9로 구성된 군으로부터 선택되는 어느 하나 이상인 압타머 복합체를 제공하며, 상기 말단 DNA는 서열번호 13 내지 14로부터 선택되는 어느 하나 이상인 압타머 복합체를 제공한다.
본 발명의 다른 구체예에서, 상기의 압타머 복합체를 유효성분으로 포함하는 약물전달체를 제공한다.
본 발명의 또 다른 구체예에서, 상기의 압타머 복합체를 유효성분으로 포함하는 암 치료용 약학조성물을 제공하고, 상기 암은 흑색종, 소세포 폐암, 비-소세포 폐암, 뇌종양, 간암, 갑상선 종양, 위암, 전립선암, 유방암, 난소암, 방광암, 폐암, 대장암, 유방암, 전립선암, 교모세포종, 자궁경부암, 자궁내막암, 신장암, 결장암, 췌장암, 식도암종, 두경부 종양, 중피종, 육종, 담관암, 소장 선암, 소아 악성암, 및 표피암으로 구성된 군으로부터 선택되는 어느 하나 이상인 암 치료용 약학조성물을 제공한다.
본 발명의 또 다른 구체예에서, 상기의 압타머 복합체를 유효성분으로 포함하는 암 진단용 키트를 제공한다.
이하 상기 본 발명을 단계별로 상세히 설명한다.
본 발명은 분지된 DNA 및 압타머를 포함하는 고효율 압타머 복합체, 및 이의 용도에 관한 것으로, 본 발명의 압타머 복합체는 핵산 증폭 및 비특이적 혼성화에 대해 매우 안정한 분지된 DNA를 이용함으로서 타겟 분자와의 결합 효율이 종래의 압타머보다 현저히 우수하다. 또한 본 발명의 압타머 복합체를 유효성분으로 포함하는 약학조성물은 생체 내에서 독성의 위험이 없고, 혈액 내에서 안정하며, 타겟 질병의 치료 효과가 우수하므로, 의학 분야에서의 크게 이용될 것으로 기대된다.
도 1은 본 발명의 일 실시예에 따른, 본 발명에서 설계된 CA의 제조 개략도를 나타낸 도면이다.
도 2는 본 발명의 일 실시예에 따른, 전기영동으로 CA들의 구조체 생성 및 크기를 확인한 결과를 나타낸 도면이다.
도 3은 본 발명의 일 실시예에 따른, 다양한 농도의 Blu_end가 포함된 CA들의 동적 산란광 분석 결과를 나타낸 도면이다.
도 4는 본 발명의 일 실시예에 따른, OA, AA, 및 CA의 동적 산란광 분석 결과를 나타낸 도면이다.
도 5는 본 발명의 일 실시예에 따른, CA의 투과 전자 현미경 분석 결과를 나타낸 도면이다.
도 6은 본 발명의 일 실시예에 따른, CA의 원자력 현미경 분석 결과를 나타낸 도면이다.
도 7은 본 발명의 일 실시예에 따른, CA의 싱크로트론 X 선 산란 측정 결과를 나타낸 도이다. 보다 자세하게, 도 7A는 DNA 복합체의 대표적인 X 선 산란 프로파일, 도 7B는 기니에 변환값, 도 7C는 Kratky 표현 그래프를 나타낸다.
도 8은 본 발명의 일 실시예에 따른, OA, AA, 및 CA의 혈청 내 안정성을 확인한 결과를 나타낸 도면이다.
도 9는 본 발명의 일 실시예에 따른, OA, AA, 및 CA의 분해 속도에 따른 hVEGF 포획 능력을 키트로 측정한 결과를 나타낸 도면이다.
도 10은 본 발명의 일 실시예에 따른, OA, AA, 및 CA의 hVEGF 포획 능력을 ELISA로 측정한 결과를 나타낸 도면이다.
도 11은 본 발명의 일 실시예에 따른, OA, AA, 및 CA의 세포 독성을 MTT로 측정한 결과를 나타낸 도면이다.
도 12는 본 발명의 일 실시예에 따른, CA의 세포 흡수 및 내재화 정도를 FAM 형광 표지된 Blu_end로 제조한 CA로 평가한 결과를 나타낸 도면이다.
도 13은 본 발명의 일 실시예에 따른, 암세포 투여된 마우스에 OA, AA, CA, 또는 CSc를 주사 투여한 후, 단기의 종양 크기 변화를 추적한 결과를 나타낸 도이다.
도 14는 본 발명의 일 실시예에 따른, 암세포 투여된 마우스에 OA, AA, CA, 또는 CSc를 주사 투여한 후, 장기의 종양 크기 변화를 추적한 결과를 나타낸 도면이다.
도 15는 본 발명의 일 실시예에 따른, 암세포 투여된 마우스에 OA, AA, CA, 또는 CSc를 주사 투여한 후, 28일째에 수득한 종양 조직의 전체 형태를 나타낸 도이다.
도 16은 본 발명의 일 실시예에 따른, 암세포 투여된 마우스에 OA, AA, CA, 또는 CSc를 주사 투여한 후, 장기의 마우스 체중 변화를 추적한 결과를 나타낸 도면이다.
도 17은 본 발명의 일 실시예에 따른, 암세포 투여된 마우스에 OA, AA, CA, 또는 CSc를 주사 투여한 후, 28일째에 CD-31 종양 표지 염색한 결과를 나타낸 도면이다.
도 18은 본 발명의 일 실시예에 따른, 암세포 투여된 마우스에 OA, AA, CA, 또는 CSc를 주사 투여한 후, 28일째에 H & E 염색한 결과를 나타낸 도면이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1: 표적 분자 포착 구조체의 제조 및 물리학적 분석
실시예 1-1. 구조화 압타머 복합체(constructed aptamer, CA)의 제조
본 연구에서는 Y 형 DNA 구조를 기반으로 한 압타머 복합체인 '구조화 압타머 복합체(CA)'를 이용한 표적 분자 포획 플랫폼을 설계하였다. CA의 기본 구조는 (1) 전체 구조의 틀인 Y 자 모양의 DNA (Y-5, Y-3) 2 개, (2) Y 자 모양의 DNA 돌출부와 하이브리드 가능한 압타머인 Y_Vapt, 및 (3) 무딘 말단 형성을 위한 DNA로서의 Blu_end로 구성된다. Blu_end는 말단 DNA의 일종으로서, Y형 DNA의 오버행(overhang, 비쌍 뉴클레오타이드가 돌출된 단일 가닥)을 블럭킹하기 위해 사용하였다. 본 발명의 CA 플랫폼에서, 하이브리드된 올리고머 압타머는 표적 분자와의 특이적 상호 작용 및 포획을 위해 이용된다. 상기 구조화 압타머 복합체의 개략도를 도 1에 나타내었다.
본 실시예에서는 종양 부위에서 과발현된 인간 VEGF(hVEGF)를 포획하기 위해, CA는 헤어핀 구조의 hVEGF DNA 압타머(Y_Vapt)로 제조하였다. 구체적으로, Y형 분지 DNA 6종류(Y01-5, Y02-5, Y03-5, Y01-3, Y02-3, Y03-3), Blu_end, 및 Y-Vapt를 정확한 양으로 혼합하고, 표 1의 조건으로 어닐링하였다. CA의 경우, Blu_end DNA와 Y 형 DNA 사이의 비율에 따라 CA의 생성이 결정된다. CA를 제조하기 위해 다양한 양의 Blu_end가 사용되었을 때, CA_G#(# of generation)으로 명명하였다. hVEGF 압타머는 공지된 기술(Lee, J 등의 J. Chem. Mater. 2016, 28, 3961., 및 Potty, A 등의 Biopolymers 2009, 91, 145.)과 동일하게 제조하였다. 각 재료의 서열정보는 표 2에 기재하였고, 5' 말단에 변형이 있는 경우에는 대괄호로 표시하였다.
Order 1 2 3 4 5 6 7 8 9 10 11 12 13 14
Temperature [oC] 95 85 80 75 70 65 60 55 50 45 40 30 20 4
Time [min] 5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 5
서열번호 명명 서열 (5'-3') bp
서열번호 1 Y01-5 GCTCCTCGCCTGAAGCTCGATGAATAGCGGTCAGATCCGTACCTA 45
서열번호 2 Y02-5 GCTCCTCGCCTGAAGCTTCGTTCGCAATACGACCGCTATTCATCG 45
서열번호 3 Y03-5 GCTCCTCGCCTGAAGCTTAGGTACGGATCTGCGTATTGCGAACGA 45
서열번호 4 Y01-3 ATCCATGCCTAGACTGGCGATAAGTAGCTGTCCGCTCCTCG 41
서열번호 5 Y02-3 GCTACTTATCGCCAGCATAACGCTTGCTTGTCCGCTCCTCG 41
서열번호 6 Y03-3 AGCAAGCGTTATGCGTCTAGGCATGGATTGTCCGCTCCTCG 41
서열번호 7 Y_Vapt AGCTTCAGGCGAGGAGCCCACCCCGTCTTCCAGACAAGAGTGCAGGGGTGGCGAGGAGCGGACA 64
서열번호 8 Pri_Vapt CCCGTCTTCCAGACAAGAGTGCAGGG 26
서열번호 9 Phos_Vapt [Phos]TTTTTAAGCTTGTCCGCTCCTCGCCACCCCTGCACTCTTGTCTGGAAGACGGGGTGGGCTCCTCGCCTGAAGCTT 75
서열번호 10 Y_Sc AGCTTCAGGCGAGGAGCCCACTATTATGGAACCGAATTTTGTTTCATGTGGCGAGGAGCGGACA 64
서열번호 11 Pri_Sc TATTATGGAACCGAATTTTGTTTCAT 26
서열번호 12 Phos_Sc [Phos]TTTTTAAGCTTGTCCGCTCCTCGCCACATGAAACAAAATTCGGTTCCATAATAGTGGGCTCCTCGCCTGAAGCTT 75
서열번호 13 Blu_end TGTCCGCTCCTCG 13
서열번호 14 FAM_Blu_end [FAM]TGTCCGCTCCTCG 13
상기 표 2에서, 서열에 표기된 [Phos]는 서열이 인산화된 것이고, [FAM]은 서열에 형광체가 연결된 것이다.
준비된 CA는 사용하기까지 4℃에서 보관하였고, 폴리아크릴아마이드 젤 전기영동(PAGE 6 %, SYBR Gold®로 염색, 45 분간 100V)으로 구조체의 생성 및 크기를 확인하고, 그 결과를 도 2에 나타내었다. 도 2에서, 어닐링된 제품(라인 4)은 Y-5(라인 2), 및 Y-3(라인 3)보다 적게 이동하여, 분자량이 더 큰 것을 나타내었다.
본 발명의 CA에 대한 대조군으로서 올리고머 압타머 복합체(oligomeric aptamer, OA), 올리고머 스크램블 DNA(oligomeric scrambled DNA, OSc), 증폭 압타머 복합체(amplified aptamer, AA), 증폭 스크램블 DNA(amplified scrambled DNA, ASc), 및, 구조화된 스크램블 DNA(constructed scrambled DNA, CSc)를 시험하였다. OA의 경우, 올리고머 hVEGF 압타머 DNA를 단순 어닐링하여 제조하였다. CSc의 경우, CA의 제조에 사용된 Y_Vapt를 Y_Sc로 대체하여 제조하였으며, 이는 VEGF 포집능력이 없는 구조화된 스크램블 DNA로써 대조군에 해당한다. OA, AA, 및 CA에서 압타머의 농도는 동일하게 유지하였다.
실시예 1-2. 증폭 압타머 복합체(amplified aptamer, AA)의 제조
공지 기술인 CircLigaseTM 프로토콜에 따라, Phos_Vapt 및 Phos_Sc를 주형으로 하여 환형 DNA를 수득하였다. 보다 구체적으로, 인산화 변형된 DNA를 완충액 내에서 ATP, MgCl2, 및 리가아제 효소와 혼합하고, 60℃에서 12 시간 동안 반응시켰다. 효소 불활성화 과정을 거친 후 20U의 핵산말단분해효소 I(Exonuclease I)과 100U의 핵산말단분해효소 III(Exonuclease III)로 37℃에서 30분간 반응시키고, 효소 불활성화 과정을 재수행하였다. 합성된 환형 DNA는 DNA PrepMateTM-II로 정제한 후 폴리아크릴아마이드 젤 전기영동으로 확인하였고, 280nm에서 자외선 흡수로 농도를 측정하였다.
상기 합성된 환형 DNA를 이용하여 증폭 압타머 복합체(AA)를 제조하기 위해 'rolling circle amplification (RCA)'공정을 수행하였고, 이후 F29 중합 효소 프로토콜을 수행하였다. 구체적으로, 준비된 환형 Phos_Vapt 및 Pri_Vapt에 dNTP, BSA, 및 F29 폴리머라아제가 포함된 완충액을 첨가하고, 잘 혼합한 후에 용액을 30 ℃에서 충분히 반응시켰다. 이후 효소 불활성화를 위해 용액을 80 ℃에서 반응 후 서서히 냉각시켰다. Phos_Sc 및 Pri_Sc를 이용한 증폭 압타머 복합체도 동일한 방법으로 제조하였다.
실시예 1-3. 제조된 압타머들의 동적 산란광(DLS) 분석
시료는 50 mL의 PBS에 1 nmole의 OA, 4시간 동안 증폭시킨 10 pmole의 프라이머 AA, 또는 1 nmole 의 압타머를 포함하는 CA를 용해하는 방법으로 준비하였다. 용액안의 각 압타머의 크기는 Zetasizer Nano(Malvern Instruments, Malvern, UK)를 이용하여 측정하였다. 상기 측정 결과를 도 3과 도 4에 나타내었다. 실험 결과, CA_G3, CA_G4, 및 CA_G5의 평균 직경은 각각 112.6nm, 132.0nm, 및 159.4nm으로 나타났고, Blu_end가 포함되지 않은 CA는 123.5nm으로 나타났다. 반면, OA와 AA의 직경은 각각 8.9 nm과 510.0 nm로 측정되어, AA의 경우 CA에 비해 직경이 매우 큰 것을 알 수 있었다.
실시예 1-4. 제조된 압타머의 이미지 분석
투과 전자 현미경(TEM)을 위한 시료는 10 mM의 CA를 초박막 탄소막(400 메쉬, Ted Pella, Redding, CA, USA)으로 코팅된 탄소 그리드 상에 침착시키는 방법으로 준비하였다. 그리드는 측정 전에 하루 동안 건조하였고, TEM 이미지는 JEM-1011(JEOL, Tokyo, Japan)으로 획득하였다.
원자력 현미경(AFM)을 위한 시료는 새로 절단한 운모(Pelco Mica sheets, Ted Pella Corp.)를 NiCl2로 처리하고, 10분간 인큐베이션하였다. CA를 10 mM NiCl2를 포함하는 PBS에 용해시키고, 용해액을 세정된 운모 상에 침착시켰다. 30분 반응 후, 운모 표면을 탈이온수로 세척하고 건조시켰다. 건조된 시료를 VEECO Dimension 3100 / Nanoscope V (VECCO)를 이용하여 비접촉 모드로 스캔하였다.
상기 TEM 및 AFM으로 CA(CA_G4)를 측정한 이미지를 도 5와 도 6에 나타내었다. 실험 결과 CA의 구형 구조가 확인되었고, 입자 크기는 105 ± 9nm 였다.
실시예 1-5. 제조된 압타머들의 싱크로트론 X 선 산란 측정
시료는 50 μL의 PBS 용액으로 준비하였고, 싱크로트론 X 선 산란 측정은 4C 빔라인에서 수행하였다. 모든 시료는 25℃, 및 4m와 1m의 샘플 대 검출기 거리(sample-to-detector distances)에서 측정하였다. 산란 데이터는 60초의 노출 시간을 갖는 λ = 0.0756nm의 X선 방사원을 사용하는 2차원 전하 결합 검출기(Model Rayonix 2D Mar, U.S.A.)를 통해 수집하였고, 2D 산란 데이터는 빔 중심에 대해 원형으로 평균화되고 샘플 뒤쪽에 위치한 신틸레이션 카운터(scintilliation counter)를 통해 투과된 X선 빔의 강도를 모니터링하여 표준화하였다. 그 후, 산란 데이터로부터 용매 매질에서 구형 입자의 산란 강도 I (q)를 공지 기술(Li, T 등, Chem. Rev. 2016, online publishing)에 따른 식으로 계산하고, DNA 복합체의 회전 반경(Rg)을 추출하기 위한 기니에 방정식 처리하여 용매 산란 효과를 제거하였다(Guinier, A 등, Wiley: New York, 1955.). 상기 X 선 산란 측정 결과를 도 7에 나타내었다.
DNA 복합체의 대표적인 X 선 산란 프로파일은 도 7A에 나타내었다. 도 7B에서 기니에 qRg 최대값은 1.16, qRg 제한값은 1.33으로 나타났다. X 선 데이터의 일반화된 Kratky 표현은 도 7C에 도시하였는데, q = 0.34 nm-1 부근의 국부 최소값이 0에 도달하지 않는 것을 알 수 있었다. 이것은 곡선 표면을 갖는 구형 입자의 특성으로, 제조된 압타머 복합체가 표면이 고르지 않은 구형의 물체라는 것을 의미한다.
실시예 1-6. 제조된 압타머들의 혈청 내 안정성 확인
저중합체 압타머 복합체(oligomeric aptamer,OA), 증폭 압타머 복합체(amplified aptamer, AA), 및 구조화 압타머 복합체(constructed aptamer, CA)의 혈청 내에서의 DNA 핵산분해효소에 대한 안정성을 확인하기 위해 압타머 복합체들를 10% FBS(fetal bovine serum) 용액에 혼합하고, 37℃ 암소에서 3 일간 반응시켰다. 저중합체 압타머 복합체에 대한 안정성은 폴리아크릴아마이드 젤 전기영동으로 분석하였고, 증폭 압타머 복합체와 구조화 압타머 복합체에 대한 안정성은 아가로즈 젤 전기영동으로 분석하였다. 상기 결과를 도 8에 나타내었다. 실험 결과, OA는 12 시간 후에 완전히 열화된 것으로 관찰되었지만, AA는 3 일 동안 열화의 진행이 거의 없는 것으로 나타났다. 이것은 AA의 고도로 얽힌 구조는 DNA 핵산분해효소에 의해 분해되기 어렵지만, 짧은 DNA로서의 OA는 쉽게 분해된다는 것을 의미한다. CA_G4의 경우, DNA 핵산분해효소에 대한 내성은 AA와 비교하여 유사 하였지만, 분해 과정은 AA보다 빠른 것으로 나타났다. 이것으로, CA가 DNA 핵산분해효소에 적정한 수준의 저항성이 있다는 것을 알 수 있었다.
분해 속도에 따른 OA, 및 CA_G4의 hVEGF 포획 능력은 도 9에 나타내었다. 0시간(제조된 직후), 12시간, 1일, 2일, 또는 3일간 혈청 배양된 시료로 hVEGF 포획 실험을 진행한 결과, 제조 직후 CA_G4의 포획 효율은 100% 였고, 3일간 배양된 경우의 포획 효율은 71.7% 로 나타났다. 그러나 OA는 혈청 배양 시간에 비의존적으로 hVEGF를 거의 포획하지 못하는 것으로 나타났다. 이 결과는 CA_G4가 혈청 내에서도 표적 분자 포획 능력이 상당히 안정적인 것을 의미한다.
실시예 2: 표적 분자 포착 구조체의 생물학적 효과 분석
실시예 2-1. hVEGF 함유 용액에서 OA, AA, CA의 포획능 확인
OA, AA, 및 CA의 hVEGF 포획능을 확인하기 위해, 준비된 각 시료를 실온에서 4 시간 동안 hVEGF 용액과 혼합하고, 혼합 용액을 PD-10 컬럼(Sephadex G-25, GE Healthcare, Sweden)으로 여과하였다. 정제되지 않은 hVEGF의 양은 제조사의 가이드라인(VICTOR3 VTM(Multilabel Counter, Perkin Elmer, Wellesley, MA, USA)에 의해 490nm에서 흡광도 측정)에 따라, hVEGF(ELISA 키트, Komabiotech) 효소 결합 면역 흡착 분석 키트로 측정하였다. OSc, ASc, 및 CSc와 같은 다른 시료의 hVEGF 포획 능력을 동일한 방법으로 측정하고, 그 결과를 도 10에 나타내었다.
실험 결과, OA와 CA(CA_G4)는 현저한 포집 효율이 있으나, AA는 상대적으로 포집 효율이 낮은 것으로 나타났다. 이 결과는 DNA 구조의 반응부위 노출이 표적 분자를 효율적으로 포획하는데 매우 중요하다는 것을 의미한다. CA는 전반적인 구조가 OA와 비슷하다. 그러나 AA는 RCA 공정에 의해 고도로 얽힌 구조를 형성하여, 표적 압타머가 hVEGF에 노출되지 않으므로 표적 분자와의 상호작용이 낮다. CA의 hVEGF 포획 효율은 압타머 농도가 50 pmole에 도달할 때 포화되는 것으로 나타났다(CA_G4 = 50 pmole의 압타머).
실시예 2-2. 제조된 압타머 복합체들의 세포 독성 확인
각 압타머 복합체(OA, AA, 및 CA)의 세포 독성은 표준 MTT 분석을 이용하여 평가하였다. 먼저, A549 세포(lung adenocarcinoma cell)를 5 x 103 세포 / 웰의 밀도로 96-웰 플레이트에 파종하고, CO2 인큐베이터에서 24시간 동안 배양하였다. 세포에 다양한 농도(0, 250, 500, 1000, 1500, 또는 2500 nM)의 OA, AA, 또는 CA를 무혈청 배지 (DMEM)에서 6시간 동안 처리하였고, 상등액을 제거하고, 신선한 혈청 함유 배지(DMEM)에서 20시간 동안 배양하였다. 이후, 혼합물을 MTT 용액(5 mg / mL)을 포함하는 신선한 배지로 교체하고, 4시간 동안 추가로 반응시켰다. 상층액을 제거하고, 각 웰에 DMSO를 첨가하여 세포 내 보라색 포르마잔 결정을 용해시킨 후, 마이크로 플레이트 분광 형광 측정기(VICTOR3 V Multilabel Counter, Perkin Elmer, Wellesley, MA, USA)를 이용하여 570nm에서 흡광도를 측정하였다. 측정값은 배지만 첨가한 대조군 시료의 측정값을 기준으로 상대 백분율로 나타내었다. 상기 MTT 분석 결과를 도 11에 나타내었다.
실험 결과, 0 내지 250 pmole의 압타머 농도에서 세포 생존력이 크게 저하되지 않아, 시험된 압타머 복합체들이 모두 생체 적합성이 있는 것으로 나타났다.
실시예 2-3. 시험 관내 세포 흡수 및 내재화 정도 확인
CA의 세포 흡수 및 내재화 정도를 평가하기 위해, FAM 형광 표지된 Blu_end로 제조된 CA를 준비하여 A549 세포에 처리하였다. 보다 구체적으로, A549 세포를 2 x 104 세포 / 웰의 밀도로 12-웰 플레이트에 놓인 유리 커버슬립 상에 파종하고, 18시간 배양하였다. 이후 배양액(DMEM)을 FAM-표지 CA(0.5 nmole of FAM 함유)를 함유하는 신선한 무혈청 DMEM으로 교체하고, 추가로 5 시간 동안 배양 하였다. 인큐베이션 후, 차가운 DPBS 첨가로 세포 흡수를 차단, 및 세포를 세척하였으며, 최종적으로 4℃에서 밤새 10% 중성 완충 포르말린(NBF)으로 고정하였다. 커버슬립 상의 세포는 DAPI 염색하여 공초점 레이저 스캐닝 현미경(Modified Zeiss Axio Observer, Z1 epi-fluorescence microscope)로 관찰하고, 이미지 결과를 도 12에 나타내었다.
실험 결과, FAM-표지된 CA의 녹색 형광 신호가 DAPI 청색 형광과 오버랩되는 핵 영역에서 발현되는 것을 확인하여, CA의 세포 내재화가 원활한 것을 확인하였다.
실시예 2-4. 제조된 압타머 복합체들의 생체 내 암 치료 효과 확인
본 발명에서의 모든 동물 실험은 포스텍 생명 공학 센터 윤리위원회의 승인을 받아 수행하였다. 먼저, A549 세포(1x108)를 각 암컷 BALB / c-nu / nu 마우스의 옆구리에 피하 접종한 후, 마우스를 무작위로 5개 그룹으로 나누고(n = 3), 1일과 5일째에 OA, AA, CA, 또는 CSc를 주사 투여하였다. CSc는 생체 내에서 CA와 동일한 구조를 가지나, DNA 서열은 상이한 압타머 복합체이다.
투여된 압타머들의 A549 세포에 대한 항암 효과는 캘리퍼 (caliper)로 종양 직경을 측정함으로써 분석하였다. 측정된 값은 하기 표 3에 기재된 수식을 이용하여 종양 체적으로 변환하였다.
종양 체적 = a X b2 X 0.5(a는 짧은 치수, b는 긴 치수)
각 압타머를 투여한 후, 마우스에서의 종양 추적, 및 체중 변화는 28일째까지 모니터링하여, 그 결과를 도 13 내지 도 16에 나타내었다.
보다 구체적으로, 도 13과 도 14는 종양 크기의 변화를 나타낸다. 실험 결과, 압타머 비처리 대조군(Control)은 28일째에 종양 크기가 14.4배 증가된 것에 비하여, OA, AA, 및 CSc는 각 8.9배, 9.5배, 및 13.1배 증가된 것으로 나타났다. 압타머 비처리 대조군에 비해서는 감소된 수치이지만 항 종양 요법으로 유의한 수준은 아니다. 반면 CA의 경우, 28일째에 종양이 1.3배 증가된 것으로 나타나, 종양 성장 억제 효과가 현저한 것으로 나타났다. 28일째에 수득된 종양의 전체 형태를 도 15에 나타내었다.
마우스의 체중 변화는 도 16에 나타내었다. 시험된 모든 그룹에서 28일째까지 마우스의 체중은 유의한 변화가 없었다. 이는 설계된 OA, AA, 및 CA가 생물학적 조건에서 독성이 없음을 의미한다.
실시예 2-5. 종양 조직의 조직학적 및 화학적 변화 확인
면역 조직 화학 분석을 위해, 종양 세포 주입된 마우스에 각 압타머 복합체(OA, AA, CA, 또는 CSc)를 투여한 후 4일째에 생쥐를 희생시켰다. 종양을 절제하고 10% NBF에서 24시간 동안 고정시킨 후, 파라핀으로 포매하고, Finesse ME 마이크로톰을 이용하여 4mm두께로 박절하였다. 종양의 조직학적 변화를 확인하기 위해 종양 절편을 헤마톡실린과 에오신(H & E)으로 염색하였고, 광학현미경(Nikon eclipse 80i, USA)으로 x10 배율 이미지를 수득하였다.
CD-31 항체를 이용한 면역 조직 화학 염색의 경우, 비특이적 결합을 방지하기 위해 4mm 두께로 박절한 절편을 블럭킹 용액(5w / v % BSA 함유)으로 15분간 처리하고, PBS로 수 회 세척한 후, 1차 항체로 실온에서 1시간 동안 처리하였다. 이후 염소 항-토끼 lgG-FITC 표지된 2차 항체로 1시간 동안 처리하였다. 마지막으로 DAPI를 포함하는 봉입제로 커버슬립 봉입하고, 4℃의 암소에서 보관하였다. 형광 이미지는 x40 배율의 공초점 레이저 스캐닝 현미경(Modified Zeiss Axio Observer, Z1 epi-fluorescence microscope)으로 수득하였다.
상기 이미지 결과들을 도 17과 도 18에 나타내었다. 실험 결과, 압타머 비처리 대조군, OA, AA, 및 CSc는 종양 조직이 CD-31 염색되어 녹색 형광(FITC)이 발현되었으나, CA에서는 녹색 형광이 거의 발현되지 않았다. H & E 염색에서도 CA에서는 세포 자멸 및 괴사가 명확하게 관찰되었지만, 다른 모든 그룹에서는 유의하게 나타나지 않았다. 이러한 결과는 CA가 비교된 다른 압타머 복합체들에 비하여 hVEGF를 포획하고 종양 부위에서 혈관 신생을 억제하여 종양 세포를 사멸시키는 데 현저한 효과가 있음을 나타낸다.

Claims (10)

  1. 분지된 DNA, 표적 서열에 대응하는 압타머, 및 말단 DNA를 포함하는, 압타머 복합체.
  2. 제1항에 있어서,
    상기 분지된 DNA는 Y형 DNA인, 압타머 복합체.
  3. 제1항에 있어서,
    상기 Y형 DNA는 서열번호 1 내지 6으로 구성된 군으로부터 선택되는 어느 하나 이상인, 압타머 복합체.
  4. 제1항에 있어서,
    상기 표적 서열에 대응하는 단백질은 혈관내피세포 성장인자(VEGF), 소 혈청 알부민(BSA), 아데노신 삼인산(ATP), C형 간염 바이러스(HCV), 및 인간 면역 결핍 바이러스(HIV)로 구성된 군으로부터 선택되는 어느 하나 이상인, 압타머 복합체.
  5. 제1항에 있어서,
    상기 표적 서열에 대응하는 압타머는 서열번호 7 내지 9로 구성된 군으로부터 선택되는 어느 하나 이상인, 압타머 복합체.
  6. 제1항에 있어서,
    상기 말단 DNA는 서열번호 13 내지 14로 구성된 군으로부터 선택되는 어느 하나 이상인, 압타머 복합체.
  7. 제1항의 압타머 복합체를 유효성분으로 포함하는, 약물전달체.
  8. 제1항의 압타머 복합체를 유효성분으로 포함하는, 암 치료용 약학조성물.
  9. 제8항에 있어서,
    상기 암은 흑색종, 소세포 폐암, 비-소세포 폐암, 뇌종양, 간암, 갑상선 종양, 위암, 전립선암, 유방암, 난소암, 방광암, 폐암, 대장암, 유방암, 전립선암, 교모세포종, 자궁경부암, 자궁내막암, 신장암, 결장암, 췌장암, 식도암종, 두경부 종양, 중피종, 육종, 담관암, 소장 선암, 소아 악성암, 및 표피암으로 구성된 군으로부터 선택되는 어느 하나 이상인, 암 치료용 약학조성물.
  10. 제1항의 압타머 복합체를 유효성분으로 포함하는, 암 진단용 키트.
PCT/KR2018/004326 2018-03-28 2018-04-13 분지된 dna, 압타머를 포함하는 고효율 압타머 복합체 및 이의 용도 WO2019189979A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US16/963,315 US11414667B2 (en) 2018-03-28 2018-04-13 High efficiency aptamer complex comprising branched DNA and aptamer, and use thereof
CN201880091678.1A CN111902538A (zh) 2018-03-28 2018-04-13 包含分支dna和适体的高效适体复合物及其用途

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020180035864A KR102023839B1 (ko) 2018-03-28 2018-03-28 분지된 dna, 압타머를 포함하는 고효율 압타머 복합체 및 이의 용도
KR10-2018-0035864 2018-03-28

Publications (1)

Publication Number Publication Date
WO2019189979A1 true WO2019189979A1 (ko) 2019-10-03

Family

ID=68059111

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/004326 WO2019189979A1 (ko) 2018-03-28 2018-04-13 분지된 dna, 압타머를 포함하는 고효율 압타머 복합체 및 이의 용도

Country Status (4)

Country Link
US (1) US11414667B2 (ko)
KR (1) KR102023839B1 (ko)
CN (1) CN111902538A (ko)
WO (1) WO2019189979A1 (ko)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102510170B1 (ko) 2020-10-07 2023-03-14 포항공과대학교 산학협력단 활성산소종 감응성을 가지는, 고분자가 코팅된 금 나노입자-압타머 나노구조체의 개발 및 응용
CN114681619B (zh) * 2020-12-30 2023-08-29 上海交通大学医学院附属仁济医院 基于Biotin-SA的核酸适体复合物及其应用
CN114246951A (zh) * 2021-12-24 2022-03-29 中国石油大学(华东) 一种dna纳米载体复合物及其制备方法和应用
CN114606238B (zh) * 2022-03-15 2023-08-25 暨南大学 特异性识别血管内皮生长因子的核酸适配体及用途
CN114606239B (zh) * 2022-03-15 2023-08-25 暨南大学 特异性识别血管内皮生长因子的核酸适配体及用途

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140091750A (ko) * 2011-11-18 2014-07-22 탁시스 바이오 가부시키가이샤 표적 단백질에 결합하는 핵산 단편
KR20160101260A (ko) * 2015-02-16 2016-08-25 기초과학연구원 핵산 압타머로 수식된 고분자 시트 및 이의 제조방법

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6696252B2 (en) * 1990-06-11 2004-02-24 Gilead Sciences, Inc. High-affinity oligonucleotide ligands to vascular endothelial growth factor (VEGF)
US7153948B2 (en) * 1994-04-25 2006-12-26 Gilead Sciences, Inc. High-affinity oligonucleotide ligands to vascular endothelial growth factor (VEGF)
WO2010017264A2 (en) * 2008-08-05 2010-02-11 Cornell University Photo-crosslinked nucleic acid hydrogels
WO2010078516A2 (en) * 2009-01-01 2010-07-08 Cornell University Multifunctional nucleic acid nano-structures
JP5603933B2 (ja) 2009-06-01 2014-10-08 ソンギュングヮン ユニバーシティ ファウンデーション フォー コーポレート コラボレーション 膵臓癌細胞または組織に特異的に結合できる核酸アプタマー及びその用途
KR101759209B1 (ko) 2010-01-22 2017-07-19 성균관대학교산학협력단 Ｈｅｒ－２ 과발현 유방암 세포 또는 조직에 특이적으로 결합할 수 있는 핵산 압타머 및 그 용도
KR101726213B1 (ko) * 2016-04-20 2017-04-13 한양대학교 산학협력단 카나마이신 검출용 핵산 압타머
KR102019407B1 (ko) 2016-11-01 2019-09-11 기초과학연구원 타겟분자를 선택적으로 포획하는 덱스트란 고분자 기반의 증폭된 핵산 압타머 나노구조체의 제조방법
CN107462705B (zh) * 2017-07-26 2019-10-18 广东省生态环境技术研究所 一种灵敏度强、可分解的量子点纳米球探针及其制备方法
WO2020036654A2 (en) * 2018-04-27 2020-02-20 Arizona Board Of Regents On Behalf Of Arizona State University Highly knotted molecular topologies from single-stranded nucleic acids

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140091750A (ko) * 2011-11-18 2014-07-22 탁시스 바이오 가부시키가이샤 표적 단백질에 결합하는 핵산 단편
KR20160101260A (ko) * 2015-02-16 2016-08-25 기초과학연구원 핵산 압타머로 수식된 고분자 시트 및 이의 제조방법

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CANSIZ, SENA: "DNA aptamer based nanodrugs: molecular engineering for efficiency", CHEMISTRY - AN ASIAN JOURNAL, vol. 10, 2015, pages 2084 - 2094, XP055640525 *
MENG, HONG-MIN: "Aptamer-integrated DNA nanostructures for biosensing, bioimaging and cancer therapy", CHEMICAL SOCIETY REVIEWS, vol. 45, no. 9, 2016, pages 2583 - 2602, XP055640527 *
PARK, KYUNG SOO: "Predictive evaluation for the preparation of a synthetic Y-shaped DNA nanostructure", BIOTECHNOLOGY AND BIOPROCESS ENGINEERING, vol. 19, 2014, pages 262 - 268, XP055640529 *
WU, CUICHEN: "Building a multifunctional aptamer-based DNA nanoassembly for targeted cancer therapy", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, vol. 135, 2013, pages 18644 - 18650, XP055235740, doi:10.1021/ja4094617 *

Also Published As

Publication number Publication date
US11414667B2 (en) 2022-08-16
CN111902538A (zh) 2020-11-06
KR102023839B1 (ko) 2019-09-20
US20210371863A1 (en) 2021-12-02

Similar Documents

Publication Publication Date Title
WO2019189979A1 (ko) 분지된 dna, 압타머를 포함하는 고효율 압타머 복합체 및 이의 용도
Ektate et al. Chemo-immunotherapy of colon cancer with focused ultrasound and Salmonella-laden temperature sensitive liposomes (thermobots)
Zhang et al. E. coli Nissle 1917-derived minicells for targeted delivery of chemotherapeutic drug to hypoxic regions for cancer therapy
Liu et al. Multifunctional aptamer-based nanoparticles for targeted drug delivery to circumvent cancer resistance
Guo et al. Tunneling nanotubular expressways for ultrafast and accurate M1 macrophage delivery of anticancer drugs to metastatic ovarian carcinoma
Zhen et al. Targeted delivery of CRISPR/Cas9 to prostate cancer by modified gRNA using a flexible aptamer-cationic liposome
Zhang et al. A polyvalent aptamer system for targeted drug delivery
Kim et al. Design and clinical developments of aptamer-drug conjugates for targeted cancer therapy
KR101963885B1 (ko) 세포투과성이 향상된 펩티드 핵산 복합체 및 이를 포함하는 약학적 조성물
EP2589377B1 (en) Microvesicles derived from cell protoplast, and use thereof
Kim et al. Anti-apoptotic cardioprotective effects of SHP-1 gene silencing against ischemia–reperfusion injury: Use of deoxycholic acid-modified low molecular weight polyethyleneimine as a cardiac siRNA-carrier
Xia et al. Molecular engineering of aptamer self-assemblies increases in vivo stability and targeted recognition
KR20100063048A (ko) 신생물성 또는 감염성 장애의 면역예방 또는 면역치료를 위한 폴리펩티드-핵산 접합체
Huang et al. Lipid nanoparticle delivery system for mRNA encoding B7H3‐redirected bispecific antibody displays potent antitumor effects on malignant tumors
Dong et al. Adaptive design of mRNA-loaded extracellular vesicles for targeted immunotherapy of cancer
JP6346265B2 (ja) Ｄｎａインターカレーティング剤の細胞送達
Deci et al. Carrier-free CXCR4-targeted nanoplexes designed for polarizing macrophages to suppress tumor growth
KR101457348B1 (ko) 조직 특이적 펩티도미메틱 리간드를 사용하는 표적화된 전달
WO2014134179A1 (en) Methods for classifying a cancer as susceptible to tmepai-directed therapies and treating such cancers
Yeom et al. Aptamer-conjugated gold nanoparticles platform as the intracellular delivery of antibodies for cancer therapy
JP2023532032A (ja) 血液脳関門浸透アプタマー及びその利用
KR20140038288A (ko) 표적화된 리포솜
KR101757840B1 (ko) 암세포 선택적 약물 전달이 가능한 다중 일렬 헤어핀 dna 및 이의 약물전달체로서의 용도
US11236343B2 (en) Method for producing dextran polymer-based, amplified nucleic acid aptamer nanoconstruct selectively capturing target molecule
KR101484441B1 (ko) 유전자 전달을 위한 gmp 나노입자

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18912407

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18912407

Country of ref document: EP

Kind code of ref document: A1