WO2022045673A1 - 신규한 화합물을 유효성분으로 포함하는 심근경색 후 심부전 예방 또는 치료용 조성물 및 이의 용도 - Google Patents

신규한 화합물을 유효성분으로 포함하는 심근경색 후 심부전 예방 또는 치료용 조성물 및 이의 용도 Download PDF

Info

Publication number
WO2022045673A1
WO2022045673A1 PCT/KR2021/011049 KR2021011049W WO2022045673A1 WO 2022045673 A1 WO2022045673 A1 WO 2022045673A1 KR 2021011049 W KR2021011049 W KR 2021011049W WO 2022045673 A1 WO2022045673 A1 WO 2022045673A1
Authority
WO
WIPO (PCT)
Prior art keywords
myocardial infarction
present
composition
compound
active ingredient
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2021/011049
Other languages
English (en)
French (fr)
Inventor
장기육
임성민
김찬우
김은민
박은혜
황병희
성은화
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Academic Cooperation Foundation of Catholic University of Korea
Original Assignee
Industry Academic Cooperation Foundation of Catholic University of Korea
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Industry Academic Cooperation Foundation of Catholic University of Korea filed Critical Industry Academic Cooperation Foundation of Catholic University of Korea
Publication of WO2022045673A1 publication Critical patent/WO2022045673A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425Thiazoles
    • A61K31/427Thiazoles not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/04Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • A23V2200/326Foods, ingredients or supplements having a functional effect on health having effect on cardiovascular health
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00Food ingredients
    • A23V2250/30Other Organic compounds

Definitions

  • the present invention relates to a composition for preventing or treating heart failure after myocardial infarction, comprising a novel compound as an active ingredient, and uses thereof.
  • Myocardial infarction is a fatal disease that accounts for the number one cause of sudden death in adults in their 40s and 50s, and it is increasing day by day.
  • ischemic heart diseases the pathophysiology and clinical prognosis are different from that of stable angina.
  • the disease In the case of stable angina, the disease can be predicted, diagnosed, and treated with repetitive and characteristic chest pain or with a conventional exercise test. When clinical symptoms appear. Therefore, myocardial infarction cannot be predicted using conventional diagnostic methods or changes in serum lipids or biomarkers known to date.
  • Currently, only invasive methods such as intravascular echocardiography can be used to detect these fragile plaques. Therefore, it can be said that early diagnosis is very difficult because there are no biomarkers that can predict these changes before onset.
  • Myocardial infarction is the accumulation and growth of atherosclerotic plaque, which is a necrotic mass of cholesterol and lymphocytes, in the coronary artery lumen of the heart, and is derived from coronary artery disease (angina, etc.) Because the fibrous cap is very unstable, rupture of the lesion occurs easily, and the formation of a blood clot occurs due to a phenomenon in which the lumen of the blood vessel is completely blocked (thrombosis). Once myocardial infarction occurs, the muscles in the lower branch of the blood vessel are not supplied with oxygen and nutrients, resulting in necrosis of the heart muscle.
  • myocardial infarction starts as atherosclerosis and progresses for a long time, but unlike angina pectoris, in which the lesion is stably formed and the fibrous membrane is not easily ruptured, fragile arteriosclerosis, in which the formation and rupture of the lesion proceed very easily It differs from angina in the formation of vulnerable plaques.
  • Aspirin, beta-blockers, ACE inhibitors, antithrombotic agents, and the like are known as drugs for preventing recurrence of myocardial infarction.
  • Aspirin, beta-blockers, ACE inhibitors, antithrombotic agents, and the like are known as drugs for preventing recurrence of myocardial infarction.
  • problems such as allergy and tolerance, and in the case of antithrombotic drugs, there is a problem in that the risk of appearance increases.
  • An object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of heart failure after myocardial infarction, comprising the compound represented by Formula 1 or a pharmaceutical salt thereof as an active ingredient.
  • Another object of the present invention is to provide a health functional food for the prevention or improvement of heart failure after myocardial infarction, comprising the compound represented by Formula 1 or a pharmaceutical salt thereof as an active ingredient.
  • Another object of the present invention is to provide a method for treating heart failure after myocardial infarction, comprising administering to a subject a pharmaceutically effective amount of the pharmaceutical composition.
  • the present invention provides a pharmaceutical composition for preventing or treating heart failure after myocardial infarction, comprising the compound represented by Formula 1 or a pharmaceutical salt thereof as an active ingredient.
  • the present invention provides a health functional food for the prevention or improvement of heart failure after myocardial infarction, comprising the compound represented by Formula 1 or a pharmaceutical salt thereof as an active ingredient.
  • the present invention provides a method for treating heart failure after myocardial infarction, comprising administering to a subject a pharmaceutically effective amount of the pharmaceutical composition.
  • infarct area of myocardial infarction was reduced by treating the compound represented by Formula 1 of the present invention in a mouse model induced after myocardial infarction.
  • the effective substance of the present invention regulates the expression of cytokines, TNF- ⁇ , IL-1 ⁇ , TGF- ⁇ 1 and IL-10, which are related to the improvement of cardiac function and myocardial infarction.
  • Treg which is an immune cell, is regulated, it is confirmed that it is effective in heart failure after myocardial infarction, and it can be usefully used in related industries.
  • 1 is a schematic diagram of the animal test plan of the present invention in detail.
  • Figure 2a is a diagram visually confirming the size of the infarcted region when the compound of the present invention is treated.
  • Figure 2b shows the quantification of the size of the infarct when the compound of the present invention is treated.
  • FIG 3 is a view confirming that the thickness of the heart section is restored when the compound of the present invention is treated.
  • FIG. 4 is a view of ultrasound observation of changes in the thickness of the mouse heart tissue when the compound of the present invention is treated.
  • Figure 5a is a graph showing the Ejection fraction (EF), which is a change in the ECG of the mouse when the compound of the present invention is treated.
  • Figure 5b is a diagram showing the fractional shortening (fractional shortening, FS), which is a change in the ECG of the mouse when treated with the compound of the present invention as a graph.
  • FIG. 5c is a diagram showing a graph of the systolic volume (ESV), which is an electrocardiogram change in a mouse when the compound of the present invention is treated.
  • ESV systolic volume
  • FIG. 6 is a diagram illustrating changes in the heart tissue of a mouse when treated with the compound of the present invention by ultrasound.
  • Figure 7a is a diagram confirming the changes in CD68 and iNOS expressed by immunofluorescence staining when the compound of the present invention is treated.
  • Figure 7b is a diagram showing the quantification of the immunofluorescence of CD68 and iNOS that are expressed when the compound of the present invention is treated.
  • Figure 8a is a diagram confirming the changes in CD206 and iNOS expressed by immunofluorescence staining when the compound of the present invention is treated.
  • Figure 8b is a diagram showing the quantification of the immunofluorescence of CD206 and iNOS that are expressed when the compound of the present invention is treated.
  • Figure 9a is a diagram confirming the changes in CD4 and Foxp3 expressed by immunofluorescence staining when the compound of the present invention is treated.
  • Figure 9b is a diagram showing the quantification of the immunofluorescence of CD4 and Foxp3 expressed when the compound of the present invention is treated.
  • Figure 10a is a diagram showing a change in the cytokine (TNF- ⁇ ) expressed in a graph when the compound of the present invention is treated.
  • Figure 10b is a diagram showing a change in the cytokine (IL-1 ⁇ ) expressed in a graph when the compound of the present invention is treated.
  • Figure 10c is a diagram showing a change in the cytokine (TGF ⁇ 1) expressed in a graph when the compound of the present invention is treated.
  • Figure 10d is a diagram showing a change in the cytokine (IL-10) expressed in a graph when the compound of the present invention is treated.
  • 11a is a diagram confirming the difference in expression of IL-10, a cytokine that is expressed when the compound of the present invention is treated.
  • 11b is a diagram confirming the difference in expression of IL-17, a cytokine that is expressed when the compound of the present invention is treated.
  • Figure 12a is a view confirming the cell population changed in the spleen (spleen) when treated with the compound of the present invention by flow cytometry.
  • 12B is a diagram illustrating quantification of the cell population changed in the spleen when the compound of the present invention is treated.
  • Figure 12c is a view confirming the cell group changed in the mediastinal lymph node (mediastinal lymph node) when treated with the compound of the present invention by flow cytometry.
  • 12D is a diagram illustrating quantification of the cell group changed in the mediastinal lymph node when the compound of the present invention is treated.
  • the present invention provides a pharmaceutical composition for preventing or treating heart failure after myocardial infarction, comprising the compound represented by Formula 1 or a pharmaceutical salt thereof as an active ingredient.
  • the pharmaceutical composition of the present invention may further include an adjuvant in addition to the active ingredient.
  • the adjuvant may be used without limitation as long as it is known in the art, for example, Freund's complete adjuvant or incomplete adjuvant may be further included to increase the effect.
  • the pharmaceutical composition according to the present invention may be prepared in a form in which the active ingredient is incorporated into a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier includes carriers, excipients and diluents commonly used in the pharmaceutical field.
  • Pharmaceutically acceptable carriers that can be used in the pharmaceutical composition of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • the pharmaceutical composition of the present invention may be formulated in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injection solutions according to conventional methods, respectively. .
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in the active ingredient, for example, starch, calcium carbonate, sucrose, lactose, gelatin. It can be prepared by mixing and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.
  • Liquid formulations for oral administration include suspensions, solutions, emulsions, syrups, etc.
  • compositions for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations and suppositories.
  • non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used.
  • base of the suppository witepsol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.
  • composition according to the present invention may be administered to an individual by various routes. Any mode of administration can be envisaged, for example, by oral, intravenous, intramuscular, subcutaneous, intraperitoneal injection.
  • the dosage of the pharmaceutical composition according to the present invention is selected in consideration of the individual's age, weight, sex, physical condition, and the like. It is self-evident that the concentration of the active ingredient included in the pharmaceutical composition can be variously selected depending on the subject, and is preferably included in the pharmaceutical composition at a concentration of 0.01 to 5,000 ⁇ g/ml. If the concentration is less than 0.01 ⁇ g/ml, pharmaceutical activity may not appear, and if it exceeds 5,000 ⁇ g/ml, it may be toxic to the human body.
  • the heart failure after myocardial infarction may be heart failure that occurs after myocardial infarction.
  • Heart failure' of the present invention refers to a state in which the intrinsic function of the heart is weakened due to various heart diseases and insufficient blood flow to the body is transmitted. , refers to a condition accompanied by systemic edema due to decreased right heart function, and is caused by coronary artery disease, weakening (thinning) of the heart wall due to damage to the heart muscle, dysfunction of heart valves, high blood pressure, and irregular heartbeat. It is a disease that causes
  • the compound represented by Formula 1 or a pharmaceutical salt thereof may inhibit the production of CD68, TNF- ⁇ and IL-1 ⁇ .
  • the compound represented by Formula 1 or a pharmaceutical salt thereof may increase the expression of CD206, TGF- ⁇ 1 and IL-10.
  • the compound represented by Formula 1 or a pharmaceutical salt thereof may modulate Foxp3+Treg and Treg.
  • pharmaceutically acceptable salt is, within the scope of sound medical judgment, used for contact with tissues of humans and lower animals without undue toxicity, irritation, allergic reaction and the like, and has a reasonable advantage/disadvantage ratio. These salts are meant to be proportional. For example, S. M. Berge et al., in J. Pharmaceutical Sciences, 1977, 66, 1-19, describe in detail pharmaceutically acceptable salts, which is incorporated herein by reference. Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases.
  • Examples of pharmaceutically acceptable, non-toxic acid addition salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid, or organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid, or salts of amino groups formed using other methods used in the art, such as ion exchange.
  • Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepro.
  • Salts derived from suitable bases include alkali metal, alkaline earth metal, ammonium and N + (C 1-4 alkyl) 4 salts.
  • Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like.
  • pharmaceutically acceptable salts when appropriate, contain non-toxic ammonium, quaternary ammonium, and counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkyl sulfonates and aryl sulfonates.
  • the present invention provides a health functional food for the prevention or improvement of heart failure after myocardial infarction, comprising the compound represented by Formula 1 or a pharmaceutical salt thereof as an active ingredient.
  • the food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients like a conventional food composition.
  • Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • the above-mentioned flavoring agents can advantageously use natural flavoring agents (Taumatine), stevia extract (eg rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.).
  • the food composition of the present invention may be formulated in the same manner as the pharmaceutical composition and used as a functional food or added to various foods.
  • Foods to which the composition of the present invention can be added include, for example, beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gums, candy, ice cream, alcoholic beverages, vitamin complexes and health supplements. There is this.
  • the food composition contains, in addition to active ingredients, various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavoring agents, colorants and thickeners (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.
  • the food composition of the present invention may contain natural fruit juice and pulp for the production of fruit juice beverages and vegetable beverages.
  • the functional food composition of the present invention may be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. for the purpose of preventing or improving heart failure after myocardial infarction.
  • the term 'health functional food composition' refers to food manufactured and processed using raw materials or ingredients useful for the human body according to Act No. 6727 of the Health Functional Food Act, and It refers to ingestion for the purpose of obtaining useful effects for health purposes such as regulating nutrients or physiological effects.
  • the health functional food of the present invention may contain normal food additives, and unless otherwise specified, whether it is suitable as a food additive is related to the item according to the general rules and general test method of food additives approved by the Food and Drug Administration.
  • the items listed in the 'Food Additives Code' include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; natural additives such as persimmon pigment, licorice extract, crystalline cellulose, high pigment, and guar gum; Mixed preparations, such as a sodium L-glutamate preparation, a noodle-added alkali agent, a preservative preparation, and a tar color preparation, etc. are mentioned.
  • a health functional food in tablet form is granulated by a conventional method by mixing a mixture of the active ingredient of the present invention with an excipient, binder, disintegrant and other additives, followed by compression molding by putting a lubricant, etc., or The mixture may be compression molded directly.
  • the health functional food in the form of tablets may contain a corrosive agent and the like, if necessary.
  • hard capsules can be prepared by filling a mixture of the active ingredient of the present invention with additives such as excipients in a conventional hard capsule. It can be prepared by filling the mixture mixed with the capsule base such as gelatin.
  • the soft capsules may contain a plasticizer such as glycerin or sorbitol, a colorant, a preservative, and the like, if necessary.
  • a health functional food in the form of a ring can be prepared by molding a mixture of the active ingredient of the present invention with an excipient, a binder, a disintegrant, etc. by a known method, Alternatively, the surface may be coated with a material such as starch or talc.
  • the health functional food in the form of granules can be prepared in granular form by a conventionally known method by mixing a mixture of the active ingredient excipients, binders, disintegrants, etc. of the present invention, and may contain flavoring agents, flavoring agents, etc. as needed can
  • the present invention comprises the steps of administering a compound represented by the following formula (1) or a pharmaceutical salt thereof;
  • a method for reducing a myocardial infarction site and regulating a factor related to heart failure after myocardial infarction after administration of a compound represented by Formula 1 or a pharmaceutical salt thereof is provided.
  • the myocardial infarction-related factor may be CD68, CD206, TNF- ⁇ , IL-1 ⁇ , TGF- ⁇ 1, or IL-10.
  • to regulate the myocardial infarction-related factors may be to inhibit the expression of CD68, TNF- ⁇ and IL-1 ⁇ .
  • to regulate the myocardial infarction-related factors may be to increase the expression of CD206, TGF- ⁇ 1 and IL-10.
  • controlling the myocardial infarction-related factor may further include controlling Foxp3+Treg and Treg.
  • the present invention provides a method for treating heart failure after myocardial infarction, comprising administering to a subject a pharmaceutically effective amount of the pharmaceutical composition.
  • the treatment method of the present invention comprises administering the pharmaceutical composition to a subject in a therapeutically effective amount.
  • a specific therapeutically effective amount for a particular subject will depend on the type and extent of the response to be achieved, the specific composition, including whether other agents are used, if necessary, the subject's age, weight, general health, sex and diet, time of administration; It is preferable to apply differently depending on various factors including the route of administration and secretion rate of the composition, the duration of treatment, the drug used together with or concurrently with the specific composition, and similar factors well known in the pharmaceutical field.
  • the daily dosage is 0.0001 to 100 mg/kg, preferably 0.01 to 100 mg/kg, based on the amount of the pharmaceutical composition of the present invention, and may be administered 1 to 6 times a day.
  • each active ingredient should be such that the side effects do not occur by including the content of each active ingredient too high. Therefore, it is preferable to determine the effective amount of the composition suitable for the purpose of the present invention in consideration of the foregoing.
  • the subject is applicable to any mammal, and the mammal includes not only humans and primates, but also domestic animals such as cattle, pigs, sheep, horses, dogs and cats.
  • the pharmaceutical composition of the present invention may be administered to mammals such as rats, mice, livestock, and humans by various routes. Any mode of administration can be envisaged, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebroventricular injection.
  • myocardial infarction was induced in 20 to 22 g male C57BL mice aged 7 to 8 weeks. Specifically, the mouse was anesthetized, intubated, equipped with a mechanical animal blower (Harvard Apparatus, USA), and then ligated to the proximal portion of the left anterior descending artery using 8-0 silk to induce myocardial infarction.
  • a mechanical animal blower Harvard Apparatus, USA
  • mice induced myocardial infarction the compound of Formula 1 (Chem 1) (Sigma-Aldrich, St Louis, MO, USA) was dissolved in DMSO at a concentration of 100 mM to prepare a stock, and further diluted in PBS before administration was used. On the 1st day after myocardial infarction was induced, the stock was intraperitoneally administered, and vehicle was administered as a control group, and intraperitoneal injections were randomized for 7 days. Mice were humanely sacrificed on day 5 or 28 after myocardial infarction induction surgery (FIG. 1). Animal experiments were conducted after approval by the Institutional Animal Care and Use Committee of the clergyman.
  • Example 1 The heart of the mouse sacrificed in Example 1 was excised, fixed with 4% formaldehyde, and embedded in paraffin.
  • the embedded cardiac tissue was sectioned to a thickness of 5 ⁇ m using a microtome (Thermo Fisher Scientific, Waltham, MA, USA).
  • Serial sections were stained with Masson's trichrome for quantitative analysis of infarct size.
  • the infarct size was calculated as the total infarct circumference divided by the total LV circumference time (100).
  • mice treated with the compound of Formula 1 had a smaller myocardial infarction area compared to the control group.
  • Electrocardiography was measured with an Affinity 50 imaging system (Philips, Amsterdam, The Netherlands) on day 28 after myocardial infarction was induced.
  • mice were anesthetized with isoflurane (2.5%), and at the level of the papillary muscle, Ejection fraction (EF), through tracking on M-mode on short axis view. , fractional shortening (FS), and systolic volume (ESV) were measured.
  • EF Ejection fraction
  • FS fractional shortening
  • ESV systolic volume
  • Example 2 the paraffin-embedded cardiac tissue was removed from paraffin and rehydrated. The rehydrated sections were unmasked at 95°C for 10 minutes using antigen retrieval buffer (Abcam, Cambridge, UK; catalog number: ab93684). Then, the cardiac tissue was stained with CD4, Foxp 3, CD68, CD206 and iNOS or mannose receptor antibody, and reacted at 4° C. for 18 hours. After the reaction, it was reacted with the secondary antibody at RT for 1 hour. Nuclei were stained with DAPI solution, and the stained slides were fluorescently labeled with DAKO fluorescence mounting medium. After fluorescence labeling, fluorescence was visualized using a fluorescence microscope (LSM 510 Meta; Zeiss, Oberkochen, Germany) and imaged using ZEN 2012 software (Zeiss).
  • LSM 510 Meta Fluorescence microscope
  • RT-qPCR Quantitative real-time reverse transcription PCR
  • Cyp1a1 F TAACCATGACCGGGAACTGTG R: CTCCGATGCACTTTCGCTTG TNF- ⁇ F: CACAGAAAGCATGATCCGCGACGT R: TGAGAGGGAGGCCATTTGGGA’ IL-1 ⁇ F: GAGTGTGGATCCCAAGCAAT R: ACGGATTCCATGGTGAAGTC IL-10 F: GCTCTTACTGACTGGCATGAG R: CGCAGCTCTAGGAGCATGTG TGF- ⁇ 1 F: TGACGTCACTGGAGTTGTACG R: GGTTCATGTCATGGATGGTGC Gapdh F: AGAACATCATCCCTGCATCC R: CACATTGGGGGTAGGAACAC
  • FIGS. 10A to 10D compared with the control group, when the compound of Formula 1 (Chem 1) was treated in mice induced by myocardial infarction, TNF- ⁇ ( FIG. 10A ) and IL-1 ⁇ ( FIG. 10B ) ) was suppressed, and it was confirmed that the expression of TGF- ⁇ 1 (FIG. 10c) and IL-10 (FIG. 10d) was increased.
  • cytokine production single cell suspensions isolated from the spleen were cultured in RPMI1640 supplemented with 10% FBS and 1% antibiotics at a concentration of 1 x 10 6 cells/ml, and PMA (Sigma (Sigma) at a concentration of 50 ng/ml. ) and 1 ⁇ M of ionomycin were added to incubate and stimulate at 5% CO 2 , 37° C. for 24 hours. After 24 hours, the supernatant of the spleen cell culture medium was collected, and the amount of IL-10 and IL-17 cytokines was measured using an ELISA kit (R&D systems, Minneapolis, MN, USA) according to the manufacturer's protocol.
  • FIGS. 11a and 11b compared to the control group, the expression of IL-10 was increased in the group treated with Compound 1 (Chem 1) ( FIG. 11a ), but the expression of IL-17 was decreased ( 11b) was confirmed.
  • mice induced by myocardial infarction were obtained, and tissues were cut with a 70 ⁇ m cell strainer for the preparation of single cells.
  • Cell surface markers were stained with PerCp-CY5.5 anti-CD4 and APC-anti-CD25 for Treg cytometry according to BioLegend’s protocol.
  • cells were fixed and permeabilized with FOXP3 fixation/perm buffer set (Biolegend) according to the manufacturer's protocol, and then incubated with PE-conjugated antibody (Invitrogen). Cultured antibodies were flow cytometrically analyzed on a FACSCanto II (BD Biosciences, USA) using FolwJo software (TreeStar, Inc, San Carlos, China).
  • FIGS. 12A to 12D in the spleen ( FIGS. 12A and 12B ) and mediastinal lymph nodes ( FIGS. 12C and 12D ) of mice treated with the compound of Formula 1 (Chem 1), Foxp3+Treg and Treg It was confirmed that the number of was significantly increased.
  • the infarct area of the myocardial infarction was reduced by treating the compound represented by Formula 1 of the present invention in a mouse model induced after myocardial infarction.
  • the effective substance of the present invention regulates the expression of cytokines, TNF- ⁇ , IL-1 ⁇ , TGF- ⁇ 1 and IL-10, which are related to the improvement of cardiac function and myocardial infarction.
  • the immune cell Treg is regulated, it was confirmed that the effect on heart failure after myocardial infarction.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Cardiology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Vascular Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Hospice & Palliative Care (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은, 신규한 화합물을 유효성분으로 포함하는 심근경색 후 심부전의 예방 또는 치료용 조성물에 관한 것으로서, 본 발명의 화학식 1로 표시되는 화합물을 심근경색 후 심부전이 유도된 마우스 모델에 처리하여, 심근경색의 경색부위가 축소되는 것을 확인하였다. 또한, 본 발명의 유효물질은 심기능 개선 및 심근경색과 관련된 사이토카인인, TNF-α, IL-1β, TGF-β1 및 IL-10의 발현을 조절함을 확인하였다. 또한, 면역세포인 Treg가 조절되는 것을 확인하였는 바, 심근경색 후 심부전에 효과가 있는 것을 확인하였다.

Description

신규한 화합물을 유효성분으로 포함하는 심근경색 후 심부전 예방 또는 치료용 조성물 및 이의 용도
본 발명은, 신규한 화합물을 유효성분으로 포함하는 심근경색 후 심부전 예방 또는 치료용 조성물 및 이의 용도에 관한 것이다.
심근경색(myocardial infarction)은 4, 50대 성인 돌연사의 원인 1위를 차지하는 치명적인 질환으로서 날로 증가하는 추세이다. 허혈성 심장질환 중에서도 안정성 협심증과는 병태생리가 다르고 임상적 예후도 다르다. 안정성 협심증의 경우 반복적이며 특징적인 흉통으로 또는 통상적인 운동부하검사로 병을 예측 진단하고 치료할 수 있으나, 심근경색의 경우에는 소위 취약성 경화반(vulnerable plaque)이 갑자기 파열되어 관상동맥의 혈전성 폐색으로 임상 증상이 발현되는 경우이다. 따라서 심근경색은 통상적인 진단방법이나 혈청지질이나 현재까지 알려진 바이오마커 변화로는 예측이 불가능하다. 이러한 취약성 경화반을 찾을 수 있는 방법은 현재로서는 혈관 내 심초음파 방법을 이용하는 등 침습적 방법뿐이다. 따라서, 발병 전에 이러한 변화를 예측할 수 있는 바이오마커가 없기 때문에 조기 진단이 매우 어려운 질환이라고 할 수 있다.
심근경색은 심장의 관상동맥 혈관내강이 콜레스테롤과 임파구의 괴사덩어리인 동맥경화반의 축적과 성장으로, 병변이 성장하면서 혈관내강이 좁아져 생기는 관상동맥질환(협심증 등)으로부터 유래되나, 병변의 섬유성막(fibrous cap)이 매우 불안정하여 쉽게 병변의 파열(rupture)이 일어나고 혈전의 형성이 일어나 혈관의 내강이 완전히 막히는 현상(thrombosis)으로 인하여 생긴다. 일단 심근경색이 발생하면 그 혈관의 하위지점에 있는 근육들은 산소와 영양이 공급되지 않아 심장근육의 괴사가 일어난다. 따라서, 심근경색은 죽상경화로 시작되어 장기적으로 진행 발병하나, 병변이 안정적으로 형성되어 섬유성막이 쉽게 파열되지 않는 협심증(angina pectoris)과 달리, 병변의 형성과 파열이 매우 쉽게 진행되는 취약성 동맥경화반(vulnerable plaque)의 형성이라는 점에서 협심증과 차이가 있다.
심근 경색 후의 사망은 경색 발생 수 시간 이내에 가장 많이 일어나는데, 1시간 이내에 약 50%의 환자가 사망하고, 24시간 이내에 약 80%의 환자가 사망하는 것으로 알려져 있다. 그러므로 심근경색의 치료가 빨리 시작될수록 심근 경색에 의한 환자의 사망률을 줄일 수 있다.
또한, 심근경색증 발생 후 재발을 예방함으로써 심근경색증 후 장기 사망률과 이환율을 줄일 수 있다. 심근경색의 재발을 예방하는 약물로는 아스피린, 베타차단제, ACE 저해제, 항혈전제 등이 알려져 있다. 그러나 아스피린의 경우 알러지, 내성 등의 문제점이 있으며, 항혈전제의 경우에는 출현 위험성이 증가하는 문제점이 있다.
본 발명의 목적은 화학식 1로 표시되는 화합물 또는 이의 약제학적 염을 유효성분으로 포함하는 심근경색 후 심부전의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 화학식 1로 표시되는 화합물 또는 이의 약제학적 염을 유효성분으로 포함하는 심근경색 후 심부전의 예방 또는 개선용 건강기능식품을 제공하는 것이다.
본 발명의 또 다른 목적은 약학적으로 유효한 양의 상기의 약학적 조성물을 개체에 투여하는 단계를 포함하는, 심근경색 후 심부전의 치료 방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 화학식 1로 표시되는 화합물 또는 이의 약제학적 염을 유효성분으로 포함하는 심근경색 후 심부전의 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 화학식 1로 표시되는 화합물 또는 이의 약제학적 염을 유효성분으로 포함하는 심근경색 후 심부전의 예방 또는 개선용 건강기능식품을 제공한다.
또한, 본 발명은 약학적으로 유효한 양의 상기의 약학적 조성물을 개체에 투여하는 단계를 포함하는, 심근경색 후 심부전의 치료 방법을 제공한다.
본 발명의 화학식 1로 표시되는 화합물을 심근경색 후 심부전이 유도된 마우스 모델에 처리하여, 심근경색의 경색부위가 축소되는 것을 확인하였다. 또한, 본 발명의 유효물질은 심기능 개선 및 심근경색과 관련된 사이토카인인, TNF-α, IL-1β, TGF-β1 및 IL-10의 발현을 조절함을 확인하였다. 또한, 면역세포인 Treg가 조절되는 것을 확인하였는 바, 심근경색 후 심부전에 효과가 있는 것을 확인하여, 관련 산업에 유용하게 사용할 수 있다.
도 1은 본 발명의 동물실험 계획을 구체적으로 모식화한 것이다.
도 2a는 본 발명의 화합물을 처리하였을 때, 경색부위의 크기를 육안으로 확인한 도이다.
도 2b는 본 발명의 화합물을 처리하였을 때, 경색부위의 크기를 정량화한 것이다.
도 3은 본 발명의 화합물을 처리하였을 때, 심장 절편의 두께가 회복된 것을 확인한 도이다.
도 4는 본 발명의 화합물을 처리하였을 때, 마우스의 심장조직의 두께 변화를 초음파로 관찰한 도이다.
도 5a는 본 발명의 화합물을 처리하였을 때, 마우스의 심전도 변화인 방출분율(Ejection fraction, EF)을 그래프로 나타낸 도이다.
도 5b는 본 발명의 화합물을 처리하였을 때, 마우스의 심전도 변화인 분획단축(fractional shortening, FS)을 그래프로 나타낸 도이다.
도 5c는 본 발명의 화합물을 처리하였을 때, 마우스의 심전도 변화인 수축기 부피(systolic volume, ESV)를 그래프로 나타낸 도이다.
도 6은 본 발명의 화합물을 처리하였을 때, 마우스의 심장조직의 변화를 초음파로 관찰한 도이다.
도 7a은 본 발명의 화합물을 처리하였을 때, 발현되는 CD68 및 iNOS의 변화를 면역형광염색으로 확인한 도이다.
도 7b은 본 발명의 화합물을 처리하였을 때, 발현되는 CD68 및 iNOS의 면역형광을 수치화하여 나타낸 도이다.
도 8a은 본 발명의 화합물을 처리하였을 때, 발현되는 CD206 및 iNOS의 변화를 면역형광염색으로 확인한 도이다.
도 8b은 본 발명의 화합물을 처리하였을 때, 발현되는 CD206 및 iNOS의 면역형광을 수치화하여 나타낸 도이다.
도 9a는 본 발명의 화합물을 처리하였을 때, 발현되는 CD4 및 Foxp3의 변화를 면역형광염색으로 확인한 도이다.
도 9b는 본 발명의 화합물을 처리하였을 때, 발현되는 CD4 및 Foxp3의 면역형광을 수치화하여 나타낸 도이다.
도 10a는 본 발명의 화합물을 처리하였을 때, 발현되는 사이토카인(TNF-α)의 변화를 그래프로 나타낸 도이다.
도 10b는 본 발명의 화합물을 처리하였을 때, 발현되는 사이토카인(IL-1β)의 변화를 그래프로 나타낸 도이다.
도 10c는 본 발명의 화합물을 처리하였을 때, 발현되는 사이토카인(TGFβ1)의 변화를 그래프로 나타낸 도이다.
도 10d는 본 발명의 화합물을 처리하였을 때, 발현되는 사이토카인(IL-10)의 변화를 그래프로 나타낸 도이다.
도 11a는 본 발명의 화합물을 처리하였을 때, 발현되는 사이토카인인 IL-10의 발현차이를 확인한 도이다.
도 11b는 본 발명의 화합물을 처리하였을 때, 발현되는 사이토카인인 IL-17의 발현차이를 확인한 도이다.
도 12a는 본 발명의 화합물을 처리하였을 때 비장(spleen)에서 변화되는 세포군을 유세포분석으로 확인한 도이다.
도 12b는 본 발명의 화합물을 처리하였을 때 비장(spleen)에서 변화되는 세포군을 정량화한 도이다.
도 12c는 본 발명의 화합물을 처리하였을 때 종격림프절(mediastinal lymph node)에서 변화되는 세포군을 유세포분석으로 확인한 도이다.
도 12d는 본 발명의 화합물을 처리하였을 때 종격림프절(mediastinal lymph node)에서 변화되는 세포군을 정량화한 도이다.
본 발명은 화학식 1로 표시되는 화합물 또는 이의 약제학적 염을 유효성분으로 포함하는 심근경색 후 심부전의 예방 또는 치료용 약학적 조성물을 제공한다.
[화학식 1]
Figure PCTKR2021011049-appb-img-000001
본 발명의 약학 조성물에는 유효성분 이외에 보조제(adjuvant)를 추가로 포함할 수 있다. 상기 보조제는 당해 기술분야에 알려진 것이라면 어느 것이나 제한 없이 사용할 수 있으나, 예를 들어 프로인트(Freund)의 완전 보조제 또는 불완전 보조제를 더 포함하여 그 효과를 증가시킬 수 있다.
본 발명에 따른 약학 조성물은 유효성분을 약학적으로 허용된 담체에 혼입시킨 형태로 제조될 수 있다. 여기서, 약학적으로 허용된 담체는 제약 분야에서 통상 사용되는 담체, 부형제 및 희석제를 포함한다. 본 발명의 약학 조성물에 이용할 수 있는 약학적으로 허용된 담체는 이들로 제한되는 것은 아니지만, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로스, 메틸 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
본 발명의 약학 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀전, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 또는 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.
제제화할 경우에는 통상 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 그러한 고형 제제는 유효성분에 적어도 하나 이상의 부형제, 예를 들면 전분, 칼슘 카르보네이트, 수크로스, 락토오스, 젤라틴 등을 섞어 조제될 수 있다. 또한, 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용될 수 있다. 경구투여를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데, 일반적으로 사용되는 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수용성용제, 현탁제, 유제, 동결건조 제제 및 좌제가 포함된다. 비수용성용제, 현탁제로는 프로필렌 글리콜, 폴리에틸렌 글리콜, 올리브유와 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 트윈(tween) 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다.
본 발명에 따른 약학 조성물은 개체에 다양한 경로로 투여될 수 있다. 투여의 모든 방식이 예상될 수 있는데, 예를 들면 경구, 정맥, 근육, 피하, 복강내 주사에 의해 투여될 수 있다.
본 발명에 따른 약학 조성물의 투여량은 개체의 연령, 체중, 성별, 신체 상태 등을 고려하여 선택된다. 상기 약학 조성물 중 포함되는 유효성분의 농도는 대상에 따라 다양하게 선택할 수 있음은 자명하며, 바람직하게는 약학 조성물에0.01 ~ 5,000 ㎍/ml의 농도로 포함되는 것이다. 그 농도가 0.01 ㎍/ml 미만일 경우에는 약학 활성이 나타나지 않을 수 있고, 5,000 ㎍/ml를 초과할 경우에는 인체에 독성을 나타낼 수 있다.
본 발명의 일실시예에 따르면, 상기 심근경색 후 심부전은 심근경색 후에 발병하는 심부전일 수 있다.
본 발명의 ‘심부전’은 각종 심장질환으로 인해 심장의 고유 기능이 약화되어 전신에 충분한 혈류를 보내지 못하는 상태를 말하여, 좌심장의 기능 감소에 의해 체순환이 감소하면서, 피로감, 쇠약감 및 호흡곤란이나, 우심장의 기능 감소에 의한 전신 부종 등이 동반되는 상태를 뜻하고, 관상 동맥 질환, 심장근육의 손상으로 심벽약화(얇아짐), 심장 판막의 기능이상, 고혈압 및 불규칙 적인 심장 박동이 원인으로서 발병하게 되는 질환이다.
본 발명의 일실시예에 따르면, 상기 화학식 1로 표시되는 화합물 또는 이의 약제학적 염은, CD68, TNF-α 및 IL-1β의 생성을 억제하는 것일 수 있다.
본 발명의 일실시예에 따르면, 상기 화학식 1로 표시되는 화합물 또는 이의 약제학적 염은, CD206, TGF-β1 및 IL-10의 발현을 증가시키는 것일 수 있다.
본 발명의 일실시예에 따르면, 상기 화학식 1로 표시되는 화합물 또는 이의 약제학적 염은, Foxp3+Treg 및 Treg를 조절하는 것일 수 있다.
상기 용어 "약제학적으로 허용가능한 염" 은, 건전한 의학적 판단의 범위 내에서, 과도한 독성, 자극, 알레르기 반응 및 이와 유사한 것 없이 인간 및 하급 동물의 조직과 접촉에 사용되는 것이며 합리적인 장점/단점 비에 비례하는 이들 염을 의미한다. 예를 들어, S. M. Berge et al.는, J. Pharmaceutical Sciences, 1977, 66, 1-19에 상세하게 약제학적으로 허용가능한 염을 설명하고 있으며, 참조로서 여기 통합되어 있다. 본 발명의 화합물의 약제학적으로 허용가능한 염은, 적당한 무기 및 유기산 및 염기로부터 유도된 것들을 포함한다. 약제학적으로 허용가능한, 무독성 산부가염의 예들은, 염산, 브롬화수소산, 인산, 황산 및 과염소산과 같은 무기산, 또는 아세트산, 옥살산, 말레산, 타르타르산, 시트르산, 숙신산 또는 말론산과 같은 유기산으로 형성되거나, 또는 이온 교환과 같은 당해 기술분야에서 사용된 다른 방법을 사용하여 형성된 아미노기의 염이다. 다른 약제학적으로 허용가능한 염은, 아디페이트, 알지네이트, 아스코르베이트, 아스파르테이트, 벤젠술포네이트, 벤조에이트, 비설페이트, 보레이트, 부티레이트, 캄포레이트, 캄포르술포네이트, 시트레이트, 시클로 펜탄프로피오네이트, 디글루코네이트, 도데실설페이트, 에탄술포네이트, 포르메이트, 푸마레이트, 글루코헵토네이트, 글리세로포스페이트, 글루코네이트, 헤미설페이트, 헵타노에이트, 헥사노에이트, 히드로요오다이드, 2-히드록시-에탄술포네이트, 락토비오네이트, 락테이트, 라우레이트, 라우릴 설페이트, 말레이트, 말리에이트, 말로네이트, 메탄술포네이트, 2-나프탈렌술포네이트, 니코티네이트, 니트레이트, 올리에이트, 옥살레이트, 팔미테이트, 파모에이트, 펙티네이트, 퍼설페이트, 3-페닐프로피오네이트, 포스페이트, 피발레이트, 프로피오네이트, 스테아레이트, 숙시네이트, 설페이트, 타르트레이트, 티오시아네이트, p-톨루엔술포네이트, 운데카노에이트, 발레르에이트 염, 및 이와 유사한 것을 포함한다.
적당한 염기로부터 유도된 염은, 알칼리 금속, 알칼리 토금속, 암모늄 및 N+(C1-4알킬)4 염을 포함한다. 대표적 알칼리 또는 알칼리 토금속 염은 소듐, 리튬, 포타슘, 칼슘, 마그네슘, 및 이와 유사한 것을 포함한다. 게다가 약제학적으로 허용가능한 염은, 적당할 때, 무독성 암모늄, 4기 암모늄, 및 할라이드, 히드록시드, 카복실레이트, 설페이트, 포스페이트, 니트레이트, 저급알킬 술포네이트 및 아릴 술포네이트와 같은 상대이온을 사용하여 형성된 아민 양이온을 포함한다.
또한, 본 발명은 화학식 1로 표시되는 화합물 또는 이의 약제학적 염을 유효성분으로 포함하는 심근경색 후 심부전의 예방 또는 개선용 건강기능식품을 제공한다.
본 발명의 식품 조성물은 본 발명의 유효성분을 함유하는 것 외에 통상의 식품 조성물과 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다.
상술한 천연 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 상술한 향미제는 천연 향미제 (타우마틴), 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진 등) 및 합성 향미제 (사카린, 아스파르탐 등)를 유리하게 사용할 수 있다. 본 발명의 식품 조성물은 상기 약학적 조성물과 동일한 방식으로 제제화되어 기능성 식품으로 이용하거나, 각종 식품에 첨가할 수 있다. 본 발명의 조성물을 첨가할 수 있는 식품으로는 예를 들어, 음료류, 육류, 초코렛, 식품류, 과자류, 피자, 라면, 기타 면류, 껌류, 사탕류, 아이스크림류, 알코올 음료류, 비타민 복합제 및 건강보조식품류 등이 있다.
또한 상기 식품 조성물은 유효성분 외에 여러 가지 영양제, 비타민, 광물 (전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제 (치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 본 발명의 식품 조성물은 천연 과일 쥬스 및 과일 쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다.
본 발명의 기능성 식품 조성물은 심근경색 후 심부전의 예방 또는 개선 목적으로, 정제, 캅셀, 분말, 과립, 액상, 환 등의 형태로 제조 및 가공될 수 있다. 본 발명에서 '건강기능성 식품 조성물'이라 함은 건강기능식품에 관한 법률 제6727호에 따른 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 제조 및 가공한 식품을 말하며, 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건용도에 유용한 효과를 얻을 목적으로 섭취하는 것을 의미한다. 본 발명의 건강기능식품은 통상의 식품 첨가물을 포함할 수 있으며, 식품 첨가물로서의 적합 여부는 다른 규정이 없는 한, 식품의약품안전청에 승인된 식품 첨가물 공전의 총칙 및 일반시험법 등에 따라 해당 품목에 관한 규격 및 기준에 의하여 판정한다. 상기 '식품 첨가물 공전'에 수재된 품목으로는 예를 들어, 케톤류, 글리신, 구연산칼슘, 니코틴산, 계피산 등의 화학적 합성물; 감색소, 감초추출물, 결정셀룰로오스, 고량색소, 구아검 등의 천연첨가물; L-글루타민산나트륨 제제, 면류첨가알칼리제, 보존료 제제, 타르색소제제 등의 혼합제제류 등을 들 수 있다. 예를 들어, 정제 형태의 건강기능식품은 본 발명의 유효성분을 부형제, 결합제, 붕해제 및 다른 첨가제와 혼합한 혼합물을 통상의 방법으로 과립화한 다음, 활택제 등을 넣어 압축성형하거나, 상기 혼합물을 직접 압축 성형할 수 있다. 또한 상기 정제 형태의 건강기능식품은 필요에 따라 교미제 등을 함유할 수도 있다. 캅셀 형태의 건강기능식품 중 경질 캅셀제는 통상의 경질 캅셀에 본 발명의 유효성분을 부형제 등의 첨가제와 혼합한 혼합물을 충진하여 제조할 수 있으며, 연질 캅셀제는 본 발명의 유효성분을 부형제 등의 첨가제와 혼합한 혼합물을 젤라틴과 같은 캅셀기제에 충진하여 제조할 수 있다. 상기 연질 캅셀제는 필요에 따라 글리세린 또는 소르비톨 등의 가소제, 착색제, 보존제 등을 함유할 수 있다. 환 형태의 건강기능식품은 본 발명의 유효성분과 부형제, 결합제, 붕해제 등을 혼합한 혼합물을 기존에 공지된 방법으로 성형하여 조제할 수 있으며, 필요에 따라 백당이나 다른 제피제로 제피할 수 있으며, 또는 전분, 탈크와 같은 물질로 표면을 코팅할 수도 있다. 과립 형태의 건강기능식품은 본 발명의 유효성분의 부형제, 결합제, 붕해제 등을 혼합한 혼합물을 기존에 공지된 방법으로 입상으로 제조할 수 있으며, 필요에 따라 착향제, 교미제 등을 함유할 수 있다.
또한, 본 발명은 하기 화학식 1로 표시되는 화합물 또는 이의 약제학적 염을 투여하는 단계; 및
하기 화학식 1로 표시되는 화합물 또는 이의 약제학적 염을 투여한 후 심근경색 부위의 축소 및 심근경색 후 심부전 관련 인자를 조절하는 방법을 제공한다.
본 발명의 일실시예에 따르면, 상기 심근경색 관련 인자는, CD68, CD206, TNF-α, IL-1β, TGF-β1, IL-10인 것일 수 있다.
본 발명의 일실시예에 따르면, 상기 심근경색 관련 인자를 조절하는 것은, CD68, TNF-α 및 IL-1β의 발현을 억제하는 것일 수 있다.
본 발명의 일실시예에 따르면, 상기 심근경색 관련 인자를 조절하는 것은, CD206, TGF-β1 및 IL-10의 발현을 증가시키는 것일 수 있다.
본 발명의 일실시예에 따르면, 상기 심근경색 관련 인자를 조절하는 것은, Foxp3+Treg 및 Treg를 조절하는 것을 더 포함하는 것일 수 있다.
또한, 본 발명은 약학적으로 유효한 양의 상기의 약학적 조성물을 개체에 투여하는 단계를 포함하는, 심근경색 후 심부전의 치료 방법을 제공한다.
본 발명의 치료 방법은 상기 약학적 조성물을 치료적 유효량으로 개체에 투여하는 것을 포함한다. 특정 개체에 대한 구체적인 치료적 유효량은 달성하고자 하는 반응의 종류와 정도, 경우에 따라 다른 제제가 사용되는지의 여부를 비롯한 구체적 조성물, 개체의 연령, 체중, 일반건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간, 구체적 조성물과 함께 사용되거나 동시 사용되는 약물을 비롯한 다양한 인자와 의약 분야에 잘 알려진 유사 인자에 따라 다르게 적용하는 것이 바람직하다. 일일 투여량은 본 발명의 약학조성물의 양을 기준으로 0.0001 내지 100 ㎎/㎏이고, 바람직하게는 0.01 내지 100 ㎎/㎏이며, 하루 1 ~ 6 회 투여될 수 있다. 다만, 각 유효성분의 복용량 또는 투여량이 각 유효성분의 함량을 지나치게 높게 포함하여 부작용을 초래하지 않을 정도이어야 함은 당업자에게 자명하다. 따라서 본 발명의 목적에 적합한 조성물의 유효량은 전술한 사항을 고려하여 결정하는 것이 바람직하다.
상기 개체는 임의의 포유동물에 적용가능하며, 상기 포유동물은 인간 및 영장류뿐만 아니라, 소, 돼지, 양, 말, 개 및 고양이 등의 가축을 포함한다.
본 발명의 약학적 조성물은, 쥐, 생쥐, 가축, 인간 등의 포유동물에 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구, 직장 또는 정맥, 근육, 피하, 자궁내 경막 또는 뇌혈관내(intracerebroventricular) 주사에 의해 투여될 수 있다.
이하, 본 발명을 실시예에 의하여 더욱 상세하게 설명한다. 이들 실시예는 단지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 국한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
<실시예 1> 심근경색모델 및 약물의 처리
본 발명의 심근경색에 대한 화학식 1(Chem 1)의 화합물의 효과를 확인하기 위하여, 7 내지 8주령의 20 내지 22 g의 수컷 C57BL 마우스에 심근경색을 유도하였다. 구체적으로, 마우스를 마취시키고, 삽관하여 기계식 동물 송풍기(Harvard Apparatus, USA)를 장착한 후, 8-0 실크를 사용하여 좌측 전방 하강 동맥의 근위 부분에 결찰하여, 심근경색을 유도하였다. 심근경색이 유도된 마우스에, 화학식 1(Chem 1)의 화합물(Sigma-Aldrich, St Louis, MO, 미국)을 100mM의 농도로 DMSO에 용해시켜 스톡을 제조하였으며, 투여 전 추가로 PBS에 희석하여 사용하였다. 심근경색이 유도된 후 1일 째에, 상기의 스톡을 복강 투여하고, 대조군으로 비히클을 투여하였으며, 7일간 무작위로 복강내 주사하였다. 심근경색 유도 수술 후 5일 또는 28일에 마우스를 인도적으로 희생하였다(도 1). 동물 실험은 가톨릭 대학교의 기관 동물 관리 및 사용위원회의 승인 후 시행하였다.
<실시예 2> 조직학적 검사
상기 실시예 1에서 희생된 마우스의 심장을 절제하여, 4% 포름알데히드로 고정시키고 파라핀에 포매시켰다. 포매된 심장 조직은 마이크로톰(Thermo Fisher Scientific, Waltham, MA, 미국)을 이용하여 5 μm의 두께로 섹션하였다. 경색 크기의 정량 분석을 위해 Masson trichrome으로 연속 절편을 염색하였다. 경색의 크기는 총 경색의 둘레를 충 LV의 둘레 시간(100)으로 나눈 것으로 계산하였다. 전체 경색 영역을 시각화하기 위하여, 절제된 심장 조직을 4 구역으로 섹션하였으며, 섹션된 심장조직을 2,3,5-트리페닐테트라졸륨 클로라이드와 함께 37℃에서 20분 동안 배양하였다.
그 결과, 도 2a 및 도 2b에 나타낸 바와 같이, 화학식 1(Chem 1)의 화합물을 처리한 마우스는 대조군과 비교하여, 심근경색 부위가 작아진 것을 확인하였다.
또한, 심근경색 후 심부전이 유도된 마우스에서는 심장 조직의 심벽이 얇아졌으나, 화학식 1(Chem 1)의 화합물을 처리한 마우스에서는, 심장조직의 심벽이 대조군과 비교하여 유의적으로 두꺼워 진 것을 확인하였다(도 3).
<실시예 3> 심전도 검사 및 초음파 검사
심전도 검사는 심근경색이 유도된 후 28일째에 Affinity 50 이미징 시스템(Philips, Amsterdam, 네덜란드)으로 측정되었다. O2:NO2 (3:7) 혼합물에서, 이소플루란(2.5%)로 마우스를 마취시키고, 유두근의 수준에서, 단축뷰 상의 M-mode 상의 추적을 통하여, 방출분율(Ejection fraction, EF), 분획단축(fractional shortening, FS), 수축기 부피(systolic volume, ESV)를 측정하였다.
그 결과 도 4, 도 5a, 도 5b, 도 5c 및 도 6에 나타낸 바와 같이, 화학식 1(Chem 1)을 처리한 마우스에서, 대조군과 비교하여 EF 및 FS가 증가한 것을 확인하여, 심장의 수축기 기능이 개선된 것을 확인하였다.
<실시예 4> 면역형광 염색
상기 실시예 2에서 파라핀에 포매된 심장 조직을, 파라핀을 재거하고 재수화 시켰다. 재수화된 절편은 항원 회수 버퍼(Abcam, Cambridge, UK; catalogue number: ab93684)를 이용하여 95℃에서 10분간 언마스킹 하였다. 그 후 심장조직을 CD4, Foxp 3, CD68, CD206 및 iNOS 또는 만노스 수용체 항체와 함께 염색하여, 4℃에서 18 시간동안 반응시켰다. 반응 이후 RT에서 1시간 동안 2차항체와 반응시켰다. 핵은 DAPI 용약으로 염색하였으며, 염색된 슬라이드를 DAKO 형광 장착 매체로 형광을 표지하였다. 형광 표지 후 형광 현미경(LSM 510 Meta; Zeiss, Oberkochen, 독일)을 사용하여 형광을 가시화하고 ZEN 2012 소프트웨어(Zeiss)를 사용하여 이미지화 하였다.
그 결과 도 7a, 도 7b, 도 8a 및 도 8b에 나타낸 바와 같이, 화학식 1(Chem 1)의 화합물을 처리한 마우스에서는 CD68 및 iNOS의 형광은 대조군과 비교하여 유의적으로 감소하였으며, CD206 및 iNOS의 형광은 대조군과 비교하여 유의적으로 증가한 것을 확인하였고, 만노스 수용체의 형광 발현은 증가한 것을 확인하였다.
또한, Foxp3+Treg+CD4의 형광 발현이 대조군과 비교하여 증가한 것을 확인하였다(도 9a 및 도 9b).
<실시예 5> 정량적 실시간 역전사 PCR
RNA는 Trizol 시약을 이용하여 제조사의 프로토콜에 따라 추출하였다. 총 RNA 농도 및 순도는 Thermo Nanodrop 2000 (Thermo Fisher)을 이용하여 측정하였다. 총 RNA는 500 ng의 총 RNA에서, cDNA 합성 키트(Roche, Basel, Switzerland)를 사용하여 역전사 하였다. 정량적 실시간 역전사 PCR(RT-qPCR)은 CFX96 Real-Time PCR 검출 시스템(Bio-Rad Laboratories)을 사용하여 STBR Green(Bio-Rad Laboratories, Inc., Hercules, CA, USA)으로 수행하였으며, Gapdh의 발현으로, 발현을 정규화 하였다.
뮤린 조직에 대하여 하기 표 1의 프라이머 서열을 사용하였으며, 2-ddCt 방법을 사용하여 정규화 하였다.
타겟 프라이머(5’-3’)
Cyp1a1 F: TAACCATGACCGGGAACTGTG
R: CTCCGATGCACTTTCGCTTG
TNF-α F: CACAGAAAGCATGATCCGCGACGT
R: TGAGAGGGAGGCCATTTGGGA’
IL-1β F: GAGTGTGGATCCCAAGCAAT
R: ACGGATTCCATGGTGAAGTC
IL-10 F: GCTCTTACTGACTGGCATGAG
R: CGCAGCTCTAGGAGCATGTG
TGF-β1 F: TGACGTCACTGGAGTTGTACG
R: GGTTCATGTCATGGATGGTGC
Gapdh F: AGAACATCATCCCTGCATCC
R: CACATTGGGGGTAGGAACAC
그 결과 도 10a 내지 도 10d에 나타낸 바와 같이, 대조군과 비교하여, 심근경색이 유도된 마우스에서 화학식 1(Chem 1)의 화합물을 처리하였을 때 TNF-α(도 10a) 및 IL-1β(도 10b)의 생성이 억제되고, TGF-β1(도 10c) 및 IL-10(도 10d)의 발현은 증가한 것을 확인하였다.
<실시예 6> 사이토카인 정량
사이토카인 생성을 측정하기 위하여, 비장으로부터 분리된 단일 세포 현탁액을 10% FBS 및 1% 항생제가 보충된 RPMI1640에서 1 x 106 세포/ml의 농도로 배양하고, 50 ng/ml 농도의 PMA(Sigma) 및 1 μM의 이오노마이신을 첨가하여 24시간 동안 5%의 CO2, 37℃에서 배양 및 자극하였다. 24시간 후 비장 세포 배양액의 상층액을 수집하고, IL-10 및 IL-17은 ELISA 키트(R&D systems, Minneapolis, MN, 미국)를 이용하여 제조사의 프로토콜에 따라 사이토카인의 양을 측정하였다.
그 결과 도 11a 및 도 11b에 나타낸 바와 같이, 대조군과 비교하여, 화합물 1(Chem 1)을 처리한 군에서는 IL-10의 발현은 증가하였지만(도 11a), IL-17의 발현은 감소한 것(도 11b)을 확인하였다.
<실시예 7> 유세포분석
심근경색이 유도된 마우스의 비장 및 종격동 림프절을 수득하고, 단일세포의 제조를 위해 70 μm 세포스트레이너로 조직을 절단하였다. 세포 표면 마커를 BioLegend’s의 프로토콜에 따라서, Treg 세포분석을 위해 PerCp-CY5.5 anti-CD4 및 APC-anti-CD25로 염색하였다. 세포 내 염색을 위해, 제조사의 프로토콜에 따라 세포를 FOXP3으로 고정/펌 버퍼 세트(Biolegend)로 고정 및 투과시킨 후, PE-접합된 항체(Invitrogen)와 함께 배양 하였다. 배양된 항체는 FolwJo 소프트웨어(TreeStar, Inc, San Carlos, 중국)를 사용하여 FACSCanto II(BD Biosciences, 미국)에서 유세포 분석 하였다.
그 결과 도 12a 내지 도 12d에 나타낸 바와 같이, 화학식 1(Chem 1)의 화합물을 처리한 마우스의 비장(도 12a 및 도 12b) 및 종격동 림프절(도 12c 및 도 12d)에서는, Foxp3+Treg 및 Treg의 수를 유의미하게 증가시키는 것을 확인하였다.
<실시예 8> 통계학적 분석
모든 데이터는 SD로서, ± 로 편차와 함께 기재하였으며, 그룹간의 비교는 unpaired Student’s t test를 이용하여 분석하였다. GraphPad Prism 7 소프트웨어를 사용하여, 통계분석을 하였으며, 0.05 미만의 P값을 가지면 유의한 것으로 간주하였다.
따라서 본 발명의 화학식 1로 표시되는 화합물을 심근경색 후 심부전이 유도된 마우스 모델에 처리하여, 심근경색의 경색부위가 축소되는 것을 확인하였다. 또한, 본 발명의 유효물질은 심기능 개선 및 심근경색과 관련된 사이토카인인, TNF-α, IL-1β, TGF-β1 및 IL-10의 발현을 조절함을 확인하였다. 또한, 면역세포인 Treg가 조절되는 것을 확인하였는 바, 심근경색 후 심부전에 효과가 있는 것을 확인하였다.

Claims (7)

  1. 하기 화학식 1로 표시되는 화합물 또는 이의 약제학적 염을 유효성분으로 포함하는 심근경색 후 심부전의 예방 또는 치료용 조성물
    [화학식 1]
    Figure PCTKR2021011049-appb-img-000002
    .
  2. 제 1항에 있어서,
    상기 심근경색 후 심부전은, 심근경색 후에 발병하는 심부전인 것을 특징으로 하는 조성물.
  3. 제 1항에 있어서,
    상기 화학식 1로 표시되는 화합물 또는 이의 약제학적 염은, CD68, TNF-α 및 IL-1β의 생성을 억제하는 것을 특징으로 하는 심근경색 후 심부전의 예방 또는 치료용 조성물.
  4. 제 1항에 있어서,
    상기 화학식 1로 표시되는 화합물 또는 이의 약제학적 염은, CD206, TGF-β1 및 IL-10의 발현을 증가시키는 것을 특징으로 하는 심근경색 후 심부전의 예방 또는 치료용 조성물.
  5. 제 1항에 있어서,
    상기 화학식 1로 이루어진 화합물 또는 이의 약제학적 염은, Foxp3+Treg 및 Treg를 조절하는 것을 특징으로 하는 심근경색 후 심부전의 예방 또는 치료용 조성물.
  6. 하기 화학식 1로 표시되는 화합물 또는 이의 약제학적 염을 유효성분으로 포함하는 심근경색 후 심부전의 예방 또는 개선용 건강기능식품
    [화학식 1]
    Figure PCTKR2021011049-appb-img-000003
    .
  7. 약학적으로 유효한 양의 제 1항의 약학적 조성물을 개체에 투여하는 단계를 포함하는, 심근경색 후 심부전의 치료 방법.
PCT/KR2021/011049 2020-08-24 2021-08-19 신규한 화합물을 유효성분으로 포함하는 심근경색 후 심부전 예방 또는 치료용 조성물 및 이의 용도 Ceased WO2022045673A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0106068 2020-08-24
KR1020200106068A KR20220025976A (ko) 2020-08-24 2020-08-24 신규한 화합물을 유효성분으로 포함하는 심근경색 후 심부전 예방 또는 치료용 조성물 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2022045673A1 true WO2022045673A1 (ko) 2022-03-03

Family

ID=80353588

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/011049 Ceased WO2022045673A1 (ko) 2020-08-24 2021-08-19 신규한 화합물을 유효성분으로 포함하는 심근경색 후 심부전 예방 또는 치료용 조성물 및 이의 용도

Country Status (2)

Country Link
KR (1) KR20220025976A (ko)
WO (1) WO2022045673A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150250835A1 (en) * 2014-03-07 2015-09-10 Genmont Biotech Inc. Composition and method of lactobacillus reuteri gmnl-89 in treating type 2 diabetes
WO2019115576A1 (en) * 2017-12-13 2019-06-20 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods of treating heart failure
CN111067895A (zh) * 2020-01-14 2020-04-28 广东医科大学 Ite在制备预防和/或治疗心肺循环系统疾病的药物中的应用

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150250835A1 (en) * 2014-03-07 2015-09-10 Genmont Biotech Inc. Composition and method of lactobacillus reuteri gmnl-89 in treating type 2 diabetes
WO2019115576A1 (en) * 2017-12-13 2019-06-20 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods of treating heart failure
CN111067895A (zh) * 2020-01-14 2020-04-28 广东医科大学 Ite在制备预防和/或治疗心肺循环系统疾病的药物中的应用

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
MARIA VOLKOVA, MONICA PALMERI, KERRY S. RUSSELL, RAYMOND R. RUSSELL: "Activation of the aryl hydrocarbon receptor by doxorubicin mediates cytoprotective effects in the heart", CARDIOVASCULAR RESEARCH, OXFORD UNIVERSITY PRESS, GB, vol. 90, no. 2, 1 May 2011 (2011-05-01), GB , pages 305 - 314, XP055461865, ISSN: 0008-6363, DOI: 10.1093/cvr/cvr007 *
SEONG EUNHWA, LEE JUN‐HO, LIM SUNGMIN, PARK EUN‐HYE, KIM EUNMIN, KIM CHAN WOO, LEE EUNMI, OH GYU‐CHUL, CHOO EUN HO, HWANG BYUNG‐HE: "Activation of Aryl Hydrocarbon Receptor by ITE Improves Cardiac Function in Mice After Myocardial Infarction", JOURNAL OF THE AMERICAN HEART ASSOCIATION, vol. 10, no. 13, 6 July 2021 (2021-07-06), pages 20502, XP055902879, DOI: 10.1161/JAHA.120.020502 *
WEIRATHER JOHANNES, HOFMANN ULRICH D.W., BEYERSDORF NIKLAS, RAMOS GUSTAVO C., VOGEL BENJAMIN, FREY ANNA, ERTL GEORG, KERKAU THOMAS: "Foxp3 + CD4 + T Cells Improve Healing After Myocardial Infarction by Modulating Monocyte/Macrophage Differentiation", CIRCULATION RESEARCH, GRUNE AND STRATTON, BALTIMORE GRUNDE AND STRATTON , BALTIMORE, US, vol. 115, no. 1, 20 June 2014 (2014-06-20), US , pages 55 - 67, XP055902876, ISSN: 0009-7330, DOI: 10.1161/CIRCRESAHA.115.303895 *

Also Published As

Publication number Publication date
KR20220025976A (ko) 2022-03-04

Similar Documents

Publication Publication Date Title
MX2008003882A (es) Formulacion de capsula de pirfenidona y excipientes farmaceuticamente aceptables.
KR101855423B1 (ko) 인디루빈 유도체를 유효성분으로 포함하는 약학 조성물
JP7597554B2 (ja) オキシトシン受容体作動性組成物
WO2015026123A1 (ko) 모노아세틸디아실글리세롤 화합물을 유효성분으로 함유하는 만성폐쇄성 폐질환의 예방 또는 치료용 조성물
JPWO2013129220A1 (ja) ペプチドを含む医薬または食品
US20230026277A1 (en) Composition for prevention, alleviation, or treatment of respiratory disease
KR101702897B1 (ko) 바이오틴이 결합된 카페인산 화합물을 유효성분으로 함유하는 통풍 예방 또는 치료용 조성물
KR101659785B1 (ko) Il-6 활성 억제 작용을 갖는 화합물 또는 이의 약학적으로 허용되는 염을 유효성분으로 포함하는 il-6로 매개되는 질환의 예방 또는 치료용 조성물
WO2015034247A1 (ko) 모노아세틸디아실글리세롤 화합물을 유효성분으로 함유하는 아토피 피부염의 예방 또는 치료용 조성물
EP4640224A1 (en) Pharmaceutical composition containing sodium-glucose transporter-2 inhibitor and angiotensin ii receptor blocker for prevention or treatment of non-alcoholic fatty liver disease
JP5575927B2 (ja) ペントキシフィリンの便秘の予防または治療における応用
JPH06135830A (ja) フラボノイド誘導体を含有する抗高血圧薬組成物
KR20220025976A (ko) 신규한 화합물을 유효성분으로 포함하는 심근경색 후 심부전 예방 또는 치료용 조성물 및 이의 용도
CN113423404B (zh) 一种黄嘌呤衍生物药物组合物及其制备方法
WO2018080276A1 (ko) 담즙산을 포함하는 허혈성 재관류 손상의 예방 또는 치료용 약학적 조성물
KR20120012157A (ko) 실로스타졸 또는 이의 약리학적 허용가능한 염을 유효성분으로 함유하는 패혈증 또는 패혈증성 쇼크 치료 및 예방용 약학조성물
WO2022173123A1 (ko) 시클로엘페닐알라닐엘프롤린 디펩타이드를 포함하는 근섬유 형성의 촉진 또는 파골세포의 분화억제 기전을 통한 근감소증 또는 골다공증 치료용 조성물
WO2021158059A1 (ko) 릴메니딘 화합물을 유효성분으로 포함하는 취약 x 증후군 또는 관련 발달 장애 치료용 조성물
WO2022025709A1 (ko) 2,3,5-치환된 싸이오펜 화합물의 위장관기질종양 예방, 개선 또는 치료 용도
CN113197907B (zh) 栀子花乙酸及其衍生物在制备用于治疗糖尿病的药物中的应用
WO2021132897A1 (ko) 피페린을 함유하는 암성 악액질 예방, 개선 또는 치료용 조성물
WO2015167246A1 (ko) Ampk 억제기능에 기반한 뇌졸중 치료용 약학적 조성물 및 방법
KR101693069B1 (ko) 신증후군의 예방 또는 치료 활성을 갖는 항산화제의 용도
WO2014182050A1 (ko) Amd3100을 포함하는 골질환 예방 또는 치료용 조성물
KR20210021846A (ko) 사삼 추출물을 유효성분으로 포함하는 쇼그렌 증후군의 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21861970

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21861970

Country of ref document: EP

Kind code of ref document: A1