WO2014182050A1 - Amd3100을 포함하는 골질환 예방 또는 치료용 조성물 - Google Patents

Amd3100을 포함하는 골질환 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2014182050A1
WO2014182050A1 PCT/KR2014/004024 KR2014004024W WO2014182050A1 WO 2014182050 A1 WO2014182050 A1 WO 2014182050A1 KR 2014004024 W KR2014004024 W KR 2014004024W WO 2014182050 A1 WO2014182050 A1 WO 2014182050A1
Authority
WO
WIPO (PCT)
Prior art keywords
bone
amd3100
preventing
composition
mice
Prior art date
Application number
PCT/KR2014/004024
Other languages
English (en)
French (fr)
Inventor
배재성
진희경
Original Assignee
경북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경북대학교 산학협력단 filed Critical 경북대학교 산학협력단
Priority to US14/889,337 priority Critical patent/US20160081980A1/en
Publication of WO2014182050A1 publication Critical patent/WO2014182050A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs

Definitions

  • the present invention relates to a composition for preventing or treating bone diseases, including AMD3100.
  • Bones are active tissues that change continuously throughout life. Bone is visually divided into external cortical bone (dense bone) and internal small bone (sponge bone, sponge bone). Cortical bone has strong physical strength to protect and support the body, and soju bone absorbs shock or calcium Mainly to keep the change constant. This phenomenon is called bone remodeling, in which old bones are destroyed (bone uptake) even after the growth of bone has stopped, and the life-long fixation (bone formation) that fills in where the new bones are missing is repeated. The balance between osteoblasts and osteoclasts is balanced so that bone absorption and bone formation must be balanced to maintain bone homeostasis and to maintain a constant calcium level in the blood. The absorption is increased to release the calcium of the bone into the blood, and if the bone absorption continues, the bone is weakened, a disease such as osteoporosis occurs.
  • Osteoporosis is postmenopausal osteoporosis, which is indicated by increased bone resorption due to the activation of osteoclasts due to rapid hormonal changes following menopause, and senile osteoporosis, in which osteoblasts decrease due to aging and osteoblasts decrease. Can be classified as Since osteoporosis fractures lead to severe activity limitations and are associated with a high mortality rate of about 15-35% in hip fractures, the diagnosis and treatment of osteoporosis is important before osteoporotic fractures occur (osteoporosis diagnosis). And Treatment Guidelines 2007, 2008).
  • Known therapeutic agents for osteoporosis include bisphosphonate-based drugs, which are deposited on the mineral component of bone and form an ATP analog that does not hydrolyze when osteoclasts phage on the bone where the bisphosphonates are deposited.
  • bisphosphonate-based drugs which are deposited on the mineral component of bone and form an ATP analog that does not hydrolyze when osteoclasts phage on the bone where the bisphosphonates are deposited.
  • it is known to be toxic to cells or to cause osteoclast activity and apoptosis in osteoclasts in various ways, thereby reducing bone resorption and thereby increasing bone density.
  • These drugs are known to be relatively safe, but in recent years, their long-term use affects bone remodeling or bone regeneration after bone fracture due to normal bone resorption and bone formation. Concerns have been raised that this could have an undesired effect, and in fact it has been reported that this causes fatigue fractures in many patients.
  • One aspect of the present invention to provide a composition for preventing or treating bone diseases.
  • One aspect of the present invention provides a composition for preventing or treating bone diseases, including AMD3100 or a pharmaceutically acceptable salt thereof represented by the following formula (1).
  • the composition comprises a pharmaceutical composition or a food composition.
  • the bone disease of one aspect may be osteoporosis, osteomalacia, rickets, fibrous osteoarthritis, aplastic bone disease or metabolic bone disease, preferably osteoporosis.
  • the AMD3100 may release hematopoietic stem cells into the bloodstream and reduce osteoclasts in the bone marrow.
  • the AM3100 of the present invention increases the level of SDF-1 in the blood, induces the mobilization of HSPC (hematopoietic stem / progenitor cells) from bone marrow to blood, and deposits of osteoclasts in bone marrow ( By reducing deposition, effective prevention or treatment of bone disease is possible.
  • HSPC hematopoietic stem / progenitor cells
  • FIG. 2 shows the fold change of plateau homeostasis of SDF-1 in mouse bone marrow supernatant after administration of PBS or AMD3100.
  • FIG. 6 shows flow cytometry results for Lin ⁇ Sca-1 + c-kit + cells in bone marrow of PBS-treated OVX and AMD3100-treated OVX mice.
  • FIG. 8 is a view showing micro-CT images of the distal femur of each group.
  • BMD bone mineral density
  • BMC bone mineral content
  • BVF bone volume fraction
  • TMD tissue mineral density
  • Tb.N tissue mineral density
  • cortical bone and trabecular bone trabecular number
  • Tb. Sp. trabecular separation
  • cortical bone mineral density Cr. BMD
  • cortical bone mineral content Cr. BMC
  • Fig. 11 shows osteoclasts in the spongy area of OVX mice.
  • a decrease in multi-nucleated TRAP + osteoclasts was identified in the bone marrow, arrowheads represent active TRAP + osteoclasts stained in red (initial magnification, x 200).
  • FIG. 13 is a histogram showing the number of osteoblasts per bone surface [N.Ob / BS (/ mm)].
  • One aspect of the present invention provides a composition for preventing or treating bone diseases, including AMD3100 or a pharmaceutically acceptable salt thereof represented by the following formula (1).
  • the composition comprises a pharmaceutical composition or a food composition.
  • AMD3100 is the first new molecular entity new drug approved as a hematopoietic stem cell mobilizer, also called Plerixafor.
  • the chemical name of this substance is 1,1 '-[1,4-phenylenebis (methylene)] bis [1,4,8,11-tetraazacyclotetradicaine] (1,1'-[1,4- Phenylenebis (methylene)] bis [1,4,8,11-tetraazacyclotetradecane]).
  • the molecular formula is C 28 H 54 N 8 , with a molecular weight of 502.79 g / mol.
  • the AMD3100 can be used in the form of a pharmaceutically acceptable salt, and as the salt, an addition salt formed by a pharmaceutically acceptable base is useful.
  • a pharmaceutically acceptable salt an addition salt formed by a pharmaceutically acceptable base is useful.
  • an inorganic base containing an alkali metal or the like may be used, or an organic base such as an amine having a strong basicity may be used.
  • Salts in which inorganic bases are used may be added salts such as sodium salts, potassium salts, calcium salts and magnesium salts, and salts in which organic bases are used may be ethanolamine salts, propanolamine salts, ammonium salts, or general tetraalkyl salts. Addition salts such as amine salts are useful.
  • AMD3100 increases the level of SDF-1 in blood in OVX experimental animal model, induces mobilization of HSPC (hematopoietic stem / progenitor cell) from bone marrow to blood, By reducing the deposition of osteoclasts, the effective prevention or treatment of bone diseases is possible.
  • HSPC hematopoietic stem / progenitor cell
  • the bone disease of one aspect may be osteoporosis, osteomalacia, rickets, fibrous osteoarthritis, aplastic bone disease or metabolic bone disease, preferably osteoporosis.
  • the composition may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers included in the composition are conventionally used in the preparation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, fine Crystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like.
  • the pharmaceutical composition may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, and the like, in addition to the above components.
  • the pharmaceutical composition may be administered orally or parenterally.
  • parenteral administration it can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, endothelial administration, topical administration, intranasal administration, pulmonary administration and rectal administration.
  • oral administration because proteins or peptides are digested, oral compositions should be formulated to coat the active agent or to protect it from degradation in the stomach.
  • the composition may be administered by any device in which the active substance may migrate to the target cell.
  • Appropriate dosages of the pharmaceutical compositions can be prescribed in various ways, such as by the method of formulation, mode of administration, age, weight, sex, morbidity, patient's age, food, time of administration, route of administration, rate of excretion and response to reaction. have. Preferred dosages of the compositions are in the range of 0.001-100 mg / kg on an adult basis.
  • pharmaceutically effective amount means an amount sufficient to prevent or treat bone disease, preferably to prevent or treat osteoporosis.
  • the composition may be prepared in unit dose form or formulated into a multi-dose container by formulating with a pharmaceutically acceptable carrier and / or excipient, according to methods readily available to those skilled in the art.
  • the formulation may be in the form of solutions, suspensions, syrups or emulsions in oils or aqueous media, or in the form of extracts, powders, powders, granules, tablets or capsules, and may further comprise dispersants or stabilizers.
  • the composition may be administered as a separate therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents.
  • AMD3100 of the present invention may be added to food or beverage for the purpose of preventing or improving bone diseases.
  • the amount of the compound in the food or beverage may be added at 0.01 to 15% by weight of the total food weight
  • the health beverage composition may be added in a ratio of 0.02 to 5 g, preferably 0.3 to 1g based on 100 ml.
  • this can be easily determined by those skilled in the art to suit the product.
  • the food composition may further include a food additive acceptable in addition to the AMD 3100, it may be prepared in the form of tablets, capsules, pills, liquids and the like.
  • the food composition of the present invention is not particularly limited to other ingredients except for containing the AMD3100 as an essential ingredient, and may contain various flavors or natural carbohydrates, etc. as additional ingredients, such as ordinary drinks.
  • natural carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose and the like; And conventional sugars such as polysaccharides such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • natural flavoring agents such as, tauumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.
  • the proportion of said natural carbohydrates is generally about 1-20 g, preferably about 5-12 g per 100 ml of the composition of the present invention.
  • the food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic and natural flavors, coloring and neutralizing agents (such as cheese, chocolate), pectic acid and salts thereof, alginic acid and Salts, organic acids, protective colloid thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks, and the like.
  • the food composition of the present invention may contain a fruit flesh for producing natural fruit juice and fruit juice beverage and vegetable beverage. These components can be used independently or in combination. The proportion of such additives is generally selected in the range of 0 to about 20 parts by weight per 100 parts by weight of the compound of the present invention.
  • mice were purchased from the Jackson Laboratory (Bar Harbor, ME). Mice were raised at a temperature of 22 ⁇ 2 ° C and a humidity of 45-65% with a 12-hour light / dark cycle in an air-conditioned room, providing free access to food and tap water. Mice received sham surgery or ovariectomize (OVX) at 12 weeks of age and were killed at 16 weeks of age.
  • OVX ovariectomize
  • One week after surgery, gastric surgery or ovarian isolated mice were intraperitoneally injected with AMD3100 (Sigma-Aldrich # A5602, St.
  • mice were sacrificed and blood samples collected through cardiac puncture for colony-forming unit (CFU) assays.
  • CFU colony-forming unit
  • RNA samples were extracted from cultured cells from total bone marrow (BM) cells of each of the four animals in each group. It was determined using a Nanodrop ND-1000 spectrophotometer. A total of 5 mg of each RNA was converted to cDNA using sprint RT complete-oligo (dT) 18 (Clontech, MountainView, CA, www.clontech.com) following the manufacturer's instructions. The cDNA was quantified using QuantiTect SYBR Green PCR Kit (Qiagen).
  • Osteocalcin forward 5'- GGGCAATAAGGTAGTGAACAG -3 ', reverse 5'-GCAGCACAGGTCCTA AATAGT -3'
  • Runt-related transcription factor 2 (RUNX2) (forward 5'-ATACTGGGATGAGGAATGCG-3 ', reverse 5'-CCAAGAAGGCACAGACAGAA-3'),
  • PTHR1 Parathyroid receptor-1 (PTHR1) (forward: 5'-GGATGATCCACTTCTTGTGC-3 ', reverse 5'-GATTCTGGTGGAGGGACTGT-3').
  • Atp6v0d2 forward 5'-CGGAAAAGAACTCGTGAAGA-3 'reverse 5'-CTGGAAGCCCAGTAAACAGA-3'
  • NFATc-1 forward 5'-AGGTGACACTAGGGGACACA-3 ', reverse 5'-AGTCCCTTCCAAGTTTCCAC-3'
  • TRAP forward 5'-ACTTCCCCAGCCCTTACTAC-3 '
  • reverse 5'-TCAGCACATAGCCCACACCG-3' reverse 5'-TCAGCACATAGCCCACACCG-3'
  • Plasma mice were collected by cardiac puncture using a tube (1 ml syringe containing 50 ⁇ l of 100 mM EDTA), and bone marrow was washed with PBS. After centrifugation, plasma and bone marrow supernatants were collected and used for SDF-1 protein detection using ELISA (R & D Systems, Minneapolis, MN, USA).
  • PB peripheral blood
  • MethoCult GF M3434 StemCell Technologies
  • Bone marrow cells from the femur and tibia were collected by rinsing with 20 ml PBS through a 25-gauge needle. After centrifugation at 1300 rpm for 5 minutes, the supernatant was removed and the cells were washed with ammonium chloride lysis. Cells were first lined with a Lineage Cell Depletion Kit magnetic labeling system using a biotinylated lineage antibody cocktail (CD5, CD45R [B220], CD11b, Gr-1 [Ly-6G / C], and Ter-119). Incubated for 10 minutes at 4 ° C. and incubated with anti-biotin MicroBeads (Milt-enyi Biotec) for 20 minutes at 4 ° C.
  • mice For microcomputed tomography ( ⁇ CT) in vivo imaging, each group of mice was scanned at 8 ⁇ m size resolution using an eXplore Locus scanner (GE Healthcare). In the femur, the scan area was confined to the distal metaphysis and extended about 1.7 mm from the proximal tip of the primary spongiosa.
  • BMD bone mineral content
  • BVF bone volume fraction
  • TMD tissue mineral density
  • Tb.N. trabecular number
  • Tb. Sp. trabecular separation
  • Cr.BMD cortical BMD
  • Cr.BMC cortical BMC
  • Bone marrow cells were obtained from the femur and tibia of 7 week old mice. Bone marrow suspension was added to the plate with macrophage colony stimulating factor (30 ng / ml). After 24 hours of incubation, non-adherent cells were collected and resuspended in ⁇ -MEM containing 10% FBS. For the experiment of osteoclastogenesis, the BM-derived macrophages were treated with ⁇ -containing FB, RANKL (receptor activator for nuclear factor ⁇ B ligand; 100 ng / ml), and M-CSF (30 ng / ml). MEM was placed in a 6-well plate at a density of 2 ⁇ 10 6 cells / well for 3 days under conditions with or without AMD3100 (25 mg / ml).
  • TRAP staining the femur was fixed in 4% paraformaldehyde for 24 hours, tissue decalcify in 10% EDTA for 1 week, dehydrated in ethanol and inserted into paraffin. . Cut into 4- ⁇ m thick and stained with H & E (hematoxylin and eosin). For TRAP staining, sections were 225 ⁇ M Naphthol AS-MX phosphate (Sigma-Aldrich, St.
  • AMD3100 was injected into OVX mice.
  • HSPC hematopoietic stem / progenitor cells
  • FIG. 2 shows the fold change of plateau homeostasis of SDF-1 in mouse bone marrow supernatant after administration of PBS or AMD3100.
  • 3 is a diagram showing the fold change of ballast homeostasis of SDF-1 in mouse plasma supernatant after administration of PBS or AMD3100.
  • functional SDF-1 levels in the AMD3100 treated group decreased in bone marrow and increased in plasma.
  • FIG. 5 shows the effect of AMD3100 on HSPC fluidization using CFU assay in blood.
  • FIG. 5 shows the effect of AMD3100 on HSPC fluidization using CFU assay in blood.
  • FIG. 5 shows the effect of AMD3100 on HSPC fluidization using CFU assay in blood.
  • FIG. 5 shows the effect of AMD3100 on HSPC fluidization using CFU assay in blood.
  • FIG. 5 shows the effect of AMD3100 on HSPC fluidization using CFU assay in blood.
  • FIG. 5 shows the effect of AMD3100 on HSPC fluidization using CFU assay in blood.
  • BMD bone mineral density
  • BMC bone mineral content
  • BVF bone volume fraction
  • TMD tissue mineral density
  • Tb.N. trabecular number
  • Tb. Sp. micro-CT analyzes were performed for the evaluation of trabecular separation, cortical bone mineral density (C.BMD) and cortical bone mineral content (Cr. BMC).
  • FIG. 8 is a view showing micro-CT images of the distal femur of each group. As shown in FIG. 8, increased bone density was observed in AMD3100-treated OVX mice over PBS-treated OVX mice.
  • FIG. 9 shows BMD, BVF, BMC, TMD, Tb.N., Tb.Sp., Cr.BMD and Cr.BMC in cortical bone and trabecular bone, respectively.
  • an increase in BMD was observed in AMD3100-treated OVX mice over PBS-treated OVX mice, whereas BVF, BMC, TMD, Tb.N., Tb.Sp., Cr.BMD and Cr.BMC There was no difference between groups.
  • Osteoporosis results from the deposition of osteoclasts rather than the defects of osteoblasts. Therefore, in order to confirm that mobilization of AMD3100 affects the differentiation of osteoclasts, it was first checked whether HSPCs differentiate into mature functional osteoclasts when AMD3100 was treated.
  • TRAP staining was performed to detect osteoclasts in the trabecular region of OVX mice.
  • Fig. 11 shows osteoclasts in the spongy area of OVX mice.
  • the number and size of TRAP + active osteoclasts black arrows
  • FIG. 12 is a histogram showing the number of osteoclasts per bone surface [N.Oc / BS (/ mm)]. As shown in FIG. 12, a reduced number of osteoclasts were found in AMD3100-treated OVX mice than PBS-treated OVX mice. In addition, in order to confirm the effect on the osteoblast number of AMD3100, H & E staining was performed.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Rheumatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 AMD3100 또는 이의 약학적으로 허용가능한 염을 포함하는 골질환의 예방 또는 치료용 조성물에 관한 것이다. 본 발명의 AM3100은 혈액 내 SDF-1 수준을 증가시키고, 골수로부터 혈액으로의 HSPC (조혈줄기전구세포)의 유동화 (mobilization)를 유도하며, 골수에의 파골세포의 침착 (deposition)을 감소시킴으로써, 효과적인 골질환의 치료 또는 예방이 가능하다.

Description

AMD3100을 포함하는 골질환 예방 또는 치료용 조성물
본 발명은 AMD3100을 포함하는 골질환의 예방 또는 치료용 조성물에 관한 것이다.
뼈는 일생동안 지속적으로 변화하는 활동적인 조직이다. 뼈는 육안으로 외부의 피질골(치밀골)과 내부의 소주골(해면골, 스폰지뼈)로 구분하는데, 피질골은 물리적인 강도가 강하여 신체를 보호하고 지지하는 역할을 하고, 소주골은 충격을 흡수하거나 칼슘의 변화를 일정하게 유지하는 역할을 주로 한다. 뼈의 성장이 중단된 후에도 오래된 뼈는 파괴되어 없어지고(골 흡수), 새로운 뼈가 없어진 곳을 메우는 고정(골 형성)이 일생동안 반복되는, 이러한 현상을 뼈의 재형성(remodeling)이라 한다. 조골세포와 파골세포 사이의 상호작용이 균형을 이루어 골 흡수와 골 형성이 균형을 이루어야 뼈의 항상성이 유지되고 혈액 속의 칼슘 농도가 일정하게 유지되는데, 혈액에 칼슘이 부족하게 되면 이를 보충하기 위하여 골 흡수가 증가되어 뼈의 칼슘을 혈액으로 방출하게 되며, 골 흡수가 지속되면 뼈가 약해져 골다공증과 같은 질환이 발생한다.
골다공증은 폐경에 따른 급격한 호르몬의 변화에 의한 파골세포(osteoclast)의 활성화에 따른 골흡수 증가로 나타나는 폐경 후 골다공증과, 노화가 되면서 조골세포(osteoblast)의 기능이 감소하여 골형성이 감소하는 노인성 골다공증으로 분류할 수 있다. 이러한 골다공증으로 인한 골절은 심각한 활동 제한에 이르게 되고, 고관절 골절의 경우 약 15-35%의 높은 사망률과 관련되어 있기 때문에, 골다공증성 골절이 발생하기 이전에 골다공증의 진단과 치료가 중요하다(골다공증 진단 및 치료 지침 2007, 2008).
국내의 골다공증 유병률은 2008년 기준 최근 5년간 약 3배 증가되었고, 골다공증 골절에 의한 연간 사회경제적 손실이 약 1조 500억원에 달할 정도로 심각한 수준에 이르고 있다고 보고된다(골다공증 진단 및 치료 지침 2007, 2008). 또한, 최신의 2009년도 국민건강통계에 따르면, 50세 이상 및 65세 이상 한국인 전체의 골다공증 유병률은 23.1%와 42.0%로 만성질환 중에서도 유병률이 매우 높게 나타나 국민건강에 커다란 문제로 떠오르고 있다 (2009년 국민건강통계-국민건강영양조사).
기존에 알려진 골다공증 치료제로는 비스포스포네이트(bisphosphonate)계열의 약물이 있는데, 비스포스포네이트는 골의 무기질 성분에 침착되며, 비스포스포네이트가 침착된 골을 파골세포가 탐식할 경우 가수분해되지 않는 ATP 유사체(analogue)를 형성하여 세포에 독성을 나타내거나 파골세포 내에서 다양한 방식으로 파골세포의 활성 감소 및 아폽토시스(apoptosis)를 초래해 골 흡수를 줄이고 이를 통해 골밀도를 증가시키는 것으로 알려져 있다. 이러한 약물들은 비교적 안전한 것으로 알려져 있으나, 최근 장기간 사용시 정상적인 골 흡수 및 골 형성에 의한 골의 재형성(remodeling)이나 골절 이후 골 재생(healing)과정에 영향을 주어 골의 탄성이 떨어져 오히려 골 강도에 좋지 않은 영향을 줄 수 있다는 우려들이 제기되고 있으며, 실제로 이로 인해 많은 환자에서 피로 골절을 일으킨다는 보고가 있다.
따라서 골질환 발병과 관련된 새로운 골대사 기전의 발견 및 골질환의 예방 또는 치료제 개발의 필요성이 절실하게 요구되고 있는 실정이다.
본 발명의 일 양상은 골질환 예방 또는 치료용 조성물을 제공하는 것이다.
본 발명의 일 양상은 하기 화학식 1로 표시되는 AMD3100 또는 이의 약학적으로 허용가능한 염을 포함하는 골질환의 예방 또는 치료용 조성물을 제공한다.
[화학식 1]
Figure PCTKR2014004024-appb-I000001
상기 조성물은 약학적 조성물 또는 식품 조성물을 포함한다.
상기 일 양상의 골질환은 골다공증(osteoporosis), 골연화증(osteomalacia), 구루병, 섬유성 골염, 무형성 골질환 또는 대사성 골질환일 수 있으며, 바람직하게는 골다공증일 수 있다.
상기 AMD3100는 조혈줄기세포를 혈류로 방출시키고, 골수 내 파골세포를 감소시킬 수 있다.
본 발명의 AM3100은 혈액 내 SDF-1 수준을 증가시키고, 골수로부터 혈액으로의 HSPC(조혈줄기전구세포, hematopoietic stem/progenitor cell)의 유동화(mobilization)를 유도하며, 골수에의 파골세포의 침착(deposition)을 감소시킴으로써, 효과적인 골질환의 예방 또는 치료가 가능하다.
도 1은 본 발명에서의 설계된 실험의 타임라인을 나타낸 도면이다. 12 주령 C57BL/6 마우스(n = 40)를 4개의 그룹으로 나누었다 (Sham/PBS group [n = 10]; Sham/AMD3100 group [n = 10]; OVX/PBS group [n = 10]; OVX/AMD3100 group [n = 10]).
도 2는 PBS 또는 AMD3100의 투여 후 마우스 골수 상청액에서의 SDF-1의 안정기 항상성의 변화(fold change)를 나타내는 도면이다.
도 3은 PBS 또는 AMD3100의 투여 후 마우스 혈장 상청액에서의 SDF-1의 안정기 항상성의 변화(fold change)를 나타내는 도면이다. 데이터는 평균SEM으로 나타내었다 (ANOVA; Tukeys HSD test. 그룹 당 n= 4 - 5). PBS-처리 Sham 마우스와 AMD3100-처리 Sham 마우스 또는 PBS-처리 OVX와 AMD3100-처리 OVX 마우스를 비교하는 경우 * p < 0.05.
도 4는 OVX 및 위 대조군 마우스의 골수로부터의 Osteocalcin, PTHR1, Osterix, 및 Runx2의 발현을 실시간 PCR로 분석한 결과이다. 데이터는 평균 SEM으로 나타내었다 (ANOVA; Tukeys HSD test. 그룹당 n = 4 - 5). 대조군 또는 AMD3100 처리 마우스와 비교하는 경우 * p < 0.05.
도 5는 혈액 중 CFU 어세이를 이용하여 HSPC 유동화에 대한 AMD3100의 효과를 나타낸 도면이다. 데이터는 평균SEM으로 나타내었다 (ANOVA; Tukeys HSD test. 그룹 당 n= 4 - 5). PBS-처리 OVX와 AMD3100-처리 OVX 마우스를 비교하는 경우 * p < 0.05
도 6은 PBS-처리 OVX 및 AMD3100-처리 OVX 마우스의 골수에서의 Lin-Sca-1+c-kit+세포에 대한 유세포분석 결과를 나타낸 도면이다.
도 7은 PBS-처리 OVX 및 AMD3100-처리 OVX 마우스의 골수에서의 Lin-Sca-1+c-kit+세포에 대한 유세포분석 결과를 그래프로 나타낸 도이다. 데이터는 평균SEM으로 나타내었다 (ANOVA; Tukeys HSD test. 그룹 당 n= 4 - 5). PBS-처리 OVX와 AMD3100-처리 OVX 마우스를 비교하는 경우 * p < 0.05
도 8은 각 그룹의 원위 대퇴골(distal femur)의 micro-CT의 영상을 나타낸 도면이다.
도 9는 피질골(cortical bone)l 및 해면질골(trabecular bone)에서의 BMD (bone mineral density), BMC (bone mineral content), BVF (bone volume fraction), TMD (tissue mineral density), Tb.N. (trabecular number), Tb.Sp. (trabecular separation), Cr.BMD (cortical bone mineral density) 및 Cr.BMC (cortical bone mineral content)를 각각 나타낸 도면이다.
도 10은 양적 실시간 PCR을 통하여 AMD3100이 파골세포 분화와 관련된 유전자의 발현에 미치는 영향을 확인한 도이다. 3일간 AMD3100 (25 g/ml)의 존재 또는 비존재 하에서, RANKL를 처리 또는 비처리한 BM 배양액으로부터 총 RNA를 추출하였다. 데이터는 평균 SEM (Anova, Tukeys HSD test. n = 3 per group)으로 나타내었다. AMD3100 처리배지 또는 해당 대조군 (matched control)과 비교하여 *P < 0.05.
도 11은 OVX 마우스의 해면질 부위에서의 파골세포를 나타내는 도면이다. 다핵의 (multi-nucleated) TRAP+파골 세포의 감소가 골수에서 확인되었다, 화살촉은 적색으로 염색된 활성 TRAP+파골 세포를 나타낸다 (최초 배율, x 200).
도 12는 골 표면당 파골 세포의 수[N.Oc/BS (/mm)]를 나타내는 히스토그램이다.
도 13은 골 표면당 조골 세포의 수 [N.Ob/BS (/mm)]를 나타내는 히스토그램이다.
데이터는 평균 SEM으로 나타내었다 (Students t-test. n= 4 - 5 per group).
PBS-처리 OVX 마우스와 비교하여 * p < 0.05.
본 발명의 일 양상은 하기 화학식 1로 표시되는 AMD3100 또는 이의 약학적으로 허용가능한 염을 포함하는 골질환의 예방 또는 치료용 조성물을 제공한다.
[화학식 1]
Figure PCTKR2014004024-appb-I000002
상기 조성물은 약학적 조성물 또는 식품 조성물을 포함한다.
이하, 본 발명에 대해 상세히 설명한다.
본 발명에 있어서 AMD3100은 Plerixafor으로도 불리는 조혈줄기세포 동원제로 허가된 최초의 저분자량 신물질(new molecular entity) 신약이다. 이 물질의 화학명은 1,1′-[1,4-페닐렌비스(메틸렌)]비스[1,4,8,11-테트라아자사이클로테트라디케인] (1,1′-[1,4-Phenylenebis(methylene)]bis[1,4,8,11-tetraazacyclotetradecane])이다. 분자식은 C28H54N8이며, 분자량은 502.79 g/mol이다.
상기 AMD3100는 약학적으로 허용가능한 염의 형태로 사용할 수 있으며, 염으로는 약학적으로 허용 가능한 염기에 의해 형성된 부가염이 유용하다. 상기 염기로는, 알칼리 금속 등이 포함된 무기 염기를 사용하거나 또는 염기성이 강한 아민 등과 같은 유기 염기를 사용할 수 있다. 무기 염기가 사용되는 염으로는 나트륨 염, 칼륨 염, 칼슘 염, 마그네슘 염 등의 부가염이 가능하고, 유기 염기가 사용되는 염으로는 에탄올아민 염, 프로판올아민 염, 암모늄 염, 또는 일반적인 테트라알킬아민 염 등의 부가염이 유용하다.
본 발명에 있어서 AMD3100는 OVX 실험 동물 모델에서 혈액 내 SDF-1 수준을 증가시키고, 골수로부터 혈액으로의 HSPC (조혈줄기전구세포, hematopoietic stem/progenitor cell)의 유동화 (mobilization)를 유도하며, 골수에의 파골세포의 침착을 감소시킴으로써, 효과적인 골질환의 예방 또는 치료가 가능하다.
상기 일 양상의 골질환은 골다공증(osteoporosis), 골연화증(osteomalacia), 구루병, 섬유성 골염, 무형성 골질환 또는 대사성 골질환일 수 있으며, 바람직하게는 골다공증일 수 있다.
상기 조성물이 골질환의 예방 또는 치료용 약학적 조성물로 제조되는 경우, 상기 조성물은 약학적으로 허용되는 담체를 포함할 수 있다. 상기 조성물에 포함되는 약학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토오스, 덱스트로오스, 수크로오스, 소르비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로오스, 폴리비닐피롤리돈, 셀룰로오스, 물, 시럽, 메틸 셀룰로오스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 상기 약학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다.
상기 약학적 조성물은 경구 또는 비경구로 투여할 수 있다. 비경구 투여인 경우에는 정맥내 주입, 피하 주입, 근육 주입, 복강 주입, 내피 투여, 국소 투여, 비내 투여, 폐내 투여 및 직장내 투여 등으로 투여할 수 있다. 경구 투여시, 단백질 또는 펩타이드는 소화가 되기 때문에 경구용 조성물은 활성 약제를 코팅하거나 위에서의 분해로부터 보호되도록 제형화 되어야 한다. 또한, 상기 조성물은 활성 물질이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다.
상기 약학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 상기 조성물의 바람직한 투여량은 성인 기준으로 0.001-100 ㎎/kg 범위 내이다. 용어 "약학적 유효량"은 골질환을 예방 또는 치료하는데, 바람직하게는 골다공증을 예방 또는 치료하는데 충분한 양을 의미한다.
상기 조성물은 당해 당업자가 용이하게 실시할 수 있는 방법에 따라, 약학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액, 시럽제 또는 유화액 형태이거나 엑스제, 산제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다. 또한, 상기 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고, 종래의 치료제와는 순차적 또는 동시에 투여될 수 있다.
본 발명의 AMD3100은 골질환의 예방 또는 개선 효과를 목적으로 식품 또는 음료에 첨가될 수 있다. 이 때, 식품 또는 음료 중의 상기 화합물의 양은 전체 식품 중량의 0.01 내지 15 중량 %로 가할 수 있으며, 건강 음료 조성물은 100 ㎖를 기준으로 0.02 내지 5 g, 바람직하게는 0.3 내지 1g의 비율로 가할 수 있으나, 이는 당업자에 의해 제품에 맞게 용이하게 결정될 수 있다.
상기 식품 조성물은 상기 AMD3100외에도 식품학적으로 허용 가능한 식품보조 첨가제를 더 포함할 수 있으며, 정제, 캡슐제, 환제, 액제 등의 형태로 제조될 수 있다.
보다 구체적으로, 본 발명의 식품조성물은 필수 성분으로서 상기 AMD3100을 함유하는 외에는 다른 성분에는 특별한 제한이 없으며 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 상술한 것 이외의 향미제로서 천연 향미 제(타우마틴, 스테비아 추출물 (예를 들어 레바우디오시드 A, 글리시르히진 등) 및 합성 향미제(사카린, 아스파르탐 등)를 유리하게 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100㎖당 일반적으로 약 1 내지 20 g, 바람직하게는 약 5 내지 12 g이다.
상기 외에 본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 광물 (전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 그밖에 본 발명의 식품 조성물은 천연 과일 쥬스 및 과일 쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 본 발명의 화합물 100 중량부 당 0 내지 약 20 중량부의 범위에서 선택되는 것이 일반적이다.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1: 실험 동물 및 처리
마우스 실험은 경북국립대학교 동물실험윤리위원회(Institutional Animal Care and Use Committee, IACUC)에 승인받았다. 12 주령의 암컷 C57BL/6마우스를 Jackson Laboratory (Bar Harbor, ME)로부터 구매하였다. 마우스는 공기가 조절되는 방에서 12 시간의 명/암 사이클로 22±2 °C의 온도 및 45?65 %의 습도에서 길러졌으며, 음식과 수돗물에 자유로운 접근이 가능하도록 하였다. 마우스는 위 수술(sham surgery) 또는 난소 적출(ovariectomize, OVX)를 12 주령시에 받았으며, 16주령시에 살생되었다. 수술 후 1 주일 후, 위 수술 또는 난소적출된 마우스에게 21일동안 AMD3100 (Sigma-Aldrich #A5602, St. Louis, MO, sigma Aldrich.com) (5 mg/kg/day) 또는 PBS를 복강내 주입하였다. 처리 후, 마우스는 희생되었으며, 혈액 샘플은 콜로니형성단위(colony-forming unit, CFU) 어세이를 위하여 심장천자를 통하여 수집되었다. 대퇴골을 분리하고 4 %의 파라포름알데히드를 이용하여 인산염-완충된(phosphate-buffered) 생리 식염수(pH 7.4)에 16시간동안 이를 고정시켰으며, 골밀도 측정을 위하여 80 %의 에탄올에서 4 °C에서 보관하였다.
실시예 2: 양적-실시간 PCR의 수행
각 그룹마다 4 마리의 동물 각각의 전체 골수(bone marrow, BM) 세포로부터 RNeasy Mini kit (Qiagen, Hilden, Germany, www1.qiagen.com) RNA 샘플을 추출 및 배양된 세포로부터 분리하였으며, 농도를 a Nanodrop ND-1000 분광 광도계를 이용하여 결정하였다. 각 RNA의 총 5 mg을 제조사의 안내에 따라 sprint RT complete-oligo(dT)18 (Clontech, MountainView, CA, www.clontech.com)를 이용하여 cDNA로 전환시켰다. 그 cDNA를 QuantiTect SYBR Green PCR Kit (Qiagen)를 이용하여 정량하였다. 각각의 전사체 (transcript)에 하기의 반응 물질을 규정된 최종 농도(end-concentration)까지 첨가하였다: 정방향 프라이머(5 pM), 역방향 프라이머(5 pM), 및 QuantiTect SYBR Green PCR Master 믹스. 10 ㎕ 마스터-믹스를 0.1 ml 튜브에 첨가하고, 역전사된 총 RNA 100 ng을 포함하는 5 ㎕를 PCR 주형으로서 첨가하였다. 튜브를 봉하고, 원심분리하며, Corbett research RG-6000 real-time PCR machine(Corbett LifeScience, Sydney, Australia, www.corbettlifescience.com)내에 위치시켰다. 하기의 프라이머가 사용되었다:
오스테오칼신 (Osteocalcin) (정방향 5’- GGGCAATAAGGTAGTGAACAG -3’, 역방향 5’-GCAGCACAGGTCCTA AATAGT -3’),
오스테릭스 (Osterix) (정방향 5’- GCGTATGGCTTCTTTGTGCCT-3’, 역방향 5’-AGCTCACTATGGCTCCAGTCC-3’ ),
런트-연관 전사 인자 (Runt-related transcription factor 2 (RUNX2) (정방향 5’-ATACTGGGATGAGGAATGCG-3’ , 역방향 5’-CCAAGAAGGCACAGACAGAA-3’ ),
부갑상선 수용체-1 (parathyroid receptor-1, PTHR1) (정방향: 5’-GGATGATCCACTTCTTGTGC-3’ , 역방향 5’-GATTCTGGTGGAGGGACTGT-3’).
Atp6v0d2 (정방향 5’-CGGAAAAGAACTCGTGAAGA-3’ 역방향 5’-CTGGAAGCCCAGTAAACAGA-3’),
NFATc-1 (정방향 5’-AGGTGACACTAGGGGACACA-3’ , 역방향 5’-AGTCCCTTCCAAGTTTCCAC-3’),
TRAP (정방향 5’-ACTTCCCCAGCCCTTACTAC-3’), 역방향5’-TCAGCACATAGCCCACACCG-3’).
실시예 3: ELISA (Enzyme-Linked Immunosorbent) 어세이의 수행
튜브 (100 mM EDTA를 50 ㎕ 포함하는 1 ml 실린지)를 이용하여 심장 천자(cardiac puncture)하여 마우스의 혈장을 수집하였고, 골수는 PBS로 씻어내었다. 원심 분리 후, 혈장 및 골수 상청액을 수집하였고, ELISA (R&D Systems, Minneapolis, MN, USA)를 이용한 SDF-1 단백질 검출을 위하여 사용하였다.
실시예 4: 조혈 콜로니형성 세포 (Hematopoietic Colony-Forming cell, CFU) 어세이의 수행
염화암모늄 용혈 후 PB (peripheral blood)의 단일-세포 현탁액을 MethoCult GF M3434 (StemCell Technologies)를 포함하는 35 mm 디쉬에 도말하였다 (3 × 105 세포/플레이트). 조혈 콜로니를 37 °C, 5 % CO2에서의 12 ~14 일간의 배양 후, 제조사의 지시에 따라 계수 및 기록하였다.
실시예 5: 유세포분석 (Flow cytometry)의 수행
대퇴골 및 경골로부터 골수 세포를 25-게이지 바늘를 통과한 20 ml의 PBS로 씻어내어 수집하였다. 5분간 1300 rpm에서 원심 분리 후, 상청액을 제거하고 세포를 ammonium chloride lysis를 이용하여 세척하였다. 세포를 우선 비오틴화된 계통 항체 칵테일(biotinylated lineage antibody cocktail (CD5, CD45R [B220], CD11b, Gr-1 [Ly-6G/C], and Ter-119)를 이용한 Lineage Cell Depletion Kit magnetic labeling system으로 10분간 4 ℃에서 배양하고, 항-비오틴 MicroBeads (Milt-enyi Biotec)로 20분간 4 ℃에서 배양하였다. 양성 면역 선발(Positive immunoselection)을 PE/Cy7-접합 항-Sca-1 (BD Pharmingen), APC-접항 항-마우스 CD117 (c-Kit) (BD Pharmingen) 및 a FACS Aria (BD Biosciences)를 이용하여 유세포분석기 상에서 수행하였다.
실시예 6: 미세 전산화 단층 촬영 (Microcomputed tomography)
미세 전산화 단층 촬영(microcomputed tomography, μCT) in vivo 영상화를 위하여, eXplore Locus scanner (GE Healthcare)를 이용하여 8 μm 크기 해상도에서 각 그룹의 마우스를 스캔하였다. 대퇴골에서, 스캔 부분을 골간단 말단 (distal metaphysis)부분으로 한정하고 일차 해면질 (primary spongiosa)의 근위촉 (proximal tip)으로부터 약 1.7mm으로 확장하였다. 골밀도(BMD), 골무기질량(bone mineral content, BMC), 골부피분율(bone volume fraction, BVF), 조직무기밀도(tissue mineral density, TMD) Tb.N. (trabecular number), Tb.Sp. (trabecular separation), Cr.BMD (cortical BMD) 및 Cr.BMC (cortical BMC)를 2.0+ ABA Microview of the micro-CT system에서 제공되는 소프트웨어를 이용하여 정량하였다.
실시예 7: 파골세포의 분화
7주령 마우스의 대퇴골 및 경골로부터 골수 세포를 수득하였다. 골수 현탁액을 M-CSF (macrophage colony stimulating factor, 30 ng/ml)와 함께 플레이트에 첨가하였다. 24시간 배양 후, 비부착 세포 (non-adherent cell)를 수집하였으며, 10 % FBS를 포함하는 α-MEM에 재현탁시켰다. 파고세포형성 (osteoclastogenesis) 실험을 위하여, BM-유래 대식세포를 10 % FBS, RANKL (receptor activator for nuclear factor κB ligand; 100 ng/ml), M-CSF (30 ng/ml)를 포함하는 α-MEM에 AMD3100가 존재 (25 mg/ml) 또는 비존재하는 조건하에서 3일 간, 2x106 cells/well의 밀도로 6-well 플레이트에 위치시켰다.
실시예 8: 조직학적 분석의 수행
TRAP 염색을 위하여, 대퇴골을 24시간동안 4 % 파라포름알데이드 내에 고정하고, 1 주일동안 조직을 10 % EDTA 내에서 석회질을 제거(decalcify)하며, 에탄올 내에서 수분을 제거하고, 파라핀 속에 삽입하였다. 4-㎛ 두깨로 절단하고 H&E (hematoxylin 및 eosin)으로 염색하였다. TRAP 염색을 위하여, 절편을 225 μM Naphthol AS-MX 인산염 (Sigma-Aldrich, St. Louis, MO, USA), 0.84 % N, N-디메틸포름아미드 (dimethylformamide) (Sigma-Aldrich), 및 50 mM 타르타르산 나트륨을 포함하는 50 mM 아세트산 나트륨 (pH 5.0) 중 1.33 mM Fast Red Violet LB Salt (Sigma-Aldrich)으로 염색하고, 30분간 배양하였다. 배양 후, 절편을 증류수로 세척하고 1 % 메틸 그린 (methyl green)으로 대비염색하였다. 조직계측학적 분석 (histomorphometric analysis)을 Bioquant OSTEOII 프로그램 (BIOQUANT Image Analysis Corporation, Nashville, TN, USA)을 이용하여 수행하였다.
실시예 9: 통계학적 분석
두 그룹의 비교를 위하여 학생의 T-test를 수행하는 반면, 다수의 그룹의 비교를 위해서는 SAS 통계학적 패키지 (release 9.1; SAS Institute Inc., Cary, NC)에 따라서 Tukey’s HSD 테스트 및 분산 테스트의 반복측정분석을 수행하였다. p < 0.05를 유의적인 것으로 간주하였다.
실시예 10: AMD3100에 의한 OVX 마우스 혈액 내 SDF-1 level 증가의 확인
OVX 마우스에 대하여 AMD3100가 효과를 나타내는지 여부를 확인하기 위하여, OVX 마우스에 AMD3100를 주입하였다. 주입 프로토콜은 도 1에서 나타낸다. 12 주령 C57BL/6 마우스 (n = 40)를 4개의 그룹으로 나누었다 (Sham/PBS group [n = 10]; Sham/AMD3100 group [n = 10]; OVX/PBS group [n = 10]; OVX/AMD3100 group [n = 10]). 이에 따라, AMD3100의 처리가 SDF-1의 방출을 유도하는지 및 이것이 HSPC(조혈 줄기/전구 세포, hematopoietic stem/progenitor cell) 의 리크루팅(recruiting)과 관련이 있는지 여부를 확인하기 위한 실험을 실시하였다. 케모카인 SDF-1(stromal cell-derived factor-1)은 CXCL12로도 불리며 인간 및 설치류 HSPC에 대한 가장 강력한 화학주성인자 (chemoattractant)이다. 도 2는 PBS 또는 AMD3100의 투여 후 마우스 골수 상청액에서의 SDF-1의 안정기 항상성의 변화(fold change)를 나타내는 도면이다. 도 3은 PBS 또는 AMD3100의 투여 후 마우스 혈장 상청액에서의 SDF-1의 안정기 항상성의 변화(fold change)를 나타내는 도면이다. 도 2 및 도 3에서 나타난 바와 같이, AMD3100 처리군의 기능성 SDF-1 수준이 골수에서는 감소하고 혈장에서는 증가하였다. 이러한 결과는 AMD3100의 처리가 혈액내의 SDF-1의 증가를 유발하며, 골수로부터 혈액으로의 HSPCs의 유동화에 영향을 미친다는 것을 나타낸다. 뒤이어, AMD3100가 조골세포 활성에 영향을 주는지 여부를 결정하기 위하여, Osteocalcin, PTHR1, Osterix, 및 Runx2를 포함하는 조골세포계(osteoblast lineage)-특이적 유전자에 대한 검사를 수행하였다. 그러나 각 그룹간에 조골세포계-특이적 유전자 수준에 대한 유의적인 차이는 나타나지 않았다 (도 4). 상기 결과에 의해 AMD3100가 혈액 내 SDF-1 증가를 유도하고, OVX 마우스의 조골세포를 변화시키지는 않는다는 것을 확인할 수 있었다.
실시예 11: AMD3100에 의한 OVX 마우스에서의 HSPC의 유동화 유도의 확인
OVX 마우스에서 AMD3100 가 골수로부터 HSPC를 유동화시키는지 여부를 결정하기 위하여, OVX 마우스에 21일 동안 AMD3100 또는 PBS를 적용하였다. 도 5는 혈액 중 CFU 어세이를 이용하여 HSPC 유동화에 대한 AMD3100의 효과를 나타낸 도면이다. 도 5에서 나타난 바와 같이, CFU 세포의 수에 있어서, PBS-처리 OVX 마우스보다 AMD3100-처리 OVX 마우스에서 현저한 증가가 나타났다. 유세포 분석을 골수 내의 HSPC의 퍼센트를 평가하기 위하여 수행하였다. PBS-처리 OVX 마우스보다 AMD3100-처리 OVX 마우스에서, 골수 중 Lin- Sca-1+ c-Kit+ (LSK) 세포 퍼센트의 감소가 나타났으나, 통계학적으로 유의적이지는 않았다 (도 6 및 7). 이러한 데이터는 AMD3100가 OVX-유도 골다공증 모델에서 골수로부터 혈액으로의 HSPC의 유동화를 유도한다는 것을 나타낸다.
실시예 12: 골 표면으로의 파골세포의 침착 (deposition)의 감소를 통한 AMD3100의 OVX-유도 골손실의 완화 확인
여러 골 파라미터에 대한 AMD3100의 효과를 확인하기 위하여, BMD (bone mineral density), BMC (bone mineral content), BVF (bone volume fraction), TMD (tissue mineral density), Tb.N. (trabecular number), Tb.Sp. (trabecular separation), Cr.BMD (cortical bone mineral density) 및 Cr.BMC (cortical bone mineral content) 평가를 위한 micro-CT 분석을 수행하였다.
도 8은 각 그룹의 원위 대퇴골(distal femur)의 micro-CT의 영상을 나타낸 도면이다. 도 8에서 나타난 바와 같이, PBS-처리 OVX 마우스보다 AMD3100-처리 OVX 마우스에서 증가된 골밀도를 관찰하였다.
도 9는 피질골(cortical bone)l 및 해면질골(trabecular bone)에서의 BMD, BVF, BMC, TMD, Tb.N., Tb.Sp., Cr.BMD 및 Cr.BMC를 각각 나타낸 도면이다. 도 9에서 나타난 바와 같이, PBS-처리 OVX 마우스보다 AMD3100-처리 OVX 마우스에서 BMD의 증가가 관찰된 반면, BVF, BMC, TMD, Tb.N., Tb.Sp., Cr.BMD 및 Cr.BMC는 그룹간에 차이가 없었다.
골다공증은 조골세포의 결함보다는 파골세포의 침착에 따라 발생한다. 따라서, AMD3100의 유동화 (mobilization)가 파골세포의 분화에 영향을 비치는지 확인하기 위하여, 우선 AMD3100를 처리하였을 때 HSPCs가 성숙한 기능성 파골세포로 분화하는지 여부를 확인하였다.
그 결과를 도 10에 나타내었다. 도 10에 나타난 바와 같이, AMD3100는 파골세포 분화에 영향을 나타내지 않았다.
또한, OVX 마우스의 해면질 부위(trabecular region)에서 파골 세포를 검출하기 위하여 TRAP 염색을 수행하였다. 도 11은 OVX 마우스의 해면질 부위에서의 파골세포를 나타내는 도면이다. 도 11에서 나타난 바와 같이 TRAP+ 활성 파골세포의 수 및 크기 (검은 화살표)는 AMD3100-처리 OVX 마우스의 해면질 부위에서 감소를 나타내었다.
파골세포의 수를 결정하기 위하여 조직계측학적 분석을 수행하였다. 도 12은 골 표면당 파골 세포의 수[N.Oc/BS (/mm)]를 나타내는 히스토그램이다. 도 12에서 나타난 바와 같이 PBS-처리 OVX 마우스보다 AMD3100-처리 OVX 마우스에서 감소된 수의 파골세포를 확인할 수 있었다. 또한, AMD3100의 조골세포 수에 대한 영향을 확인하기 위하여, H&E 염색을 수행하였다.
도 13은 그 결과를 나타낸다. 도 13에 나타난 바와 같이, AMD3100 처리군 간에 조골세포 수의 유의적인 변화는 관찰되지 않았다.
이를 종합하여 볼 때, 상기 데이터는 AMD3100가 골수-유래 HSPC의 혈액으로의 유동화를 유도하고, 골표면에 부착된 파골세포의 수를 감소시킴으로써, OVX-유도 골다공증 모델에서의 골손실을 개선한다는 것을 나타낸다.

Claims (5)

  1. 하기 화학식 1로 표시되는 AMD3100 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 골질환의 예방 또는 치료용 약학적 조성물.
    [화학식 1]
    Figure PCTKR2014004024-appb-I000003
  2. 청구항 1에 있어서, 상기 골질환은 골다공증(osteoporosis), 골연화증(osteomalacia), 구루병, 섬유성 골염, 무형성 골질환 및 대사성 골질환으로 구성된 군으로부터 선택된 어느 하나인 것을 특징으로 하는, 골 질환의 예방 또는 치료용 약학적 조성물.
  3. 청구항 1에 있어서, 상기 AMD3100은 조혈줄기세포를 혈류로 방출시키고, 골수 내 파골세포를 감소시키는 것을 특징으로 하는, 골 질환의 예방 또는 치료용 약학적 조성물.
  4. 청구항 1에 있어서, 상기 골질환은 골다공증인 것을 특징으로 하는 골 질환의 예방 또는 치료용 약학적 조성물.
  5. 하기 화학식 1로 표시되는 AMD3100을 유효성분으로 포함하는 골질환 예방 또는 개선용 식품 조성물.
    [화학식 1]
    Figure PCTKR2014004024-appb-I000004
PCT/KR2014/004024 2013-05-07 2014-05-07 Amd3100을 포함하는 골질환 예방 또는 치료용 조성물 WO2014182050A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/889,337 US20160081980A1 (en) 2013-05-07 2014-05-07 Composition Comprising AMD3100 For Preventing or Treating Bone Diseases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2013-0051433 2013-05-07
KR20130051433A KR101489861B1 (ko) 2013-05-07 2013-05-07 Amd3100을 포함하는 골질환 예방 또는 치료용 조성물

Publications (1)

Publication Number Publication Date
WO2014182050A1 true WO2014182050A1 (ko) 2014-11-13

Family

ID=51867465

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/004024 WO2014182050A1 (ko) 2013-05-07 2014-05-07 Amd3100을 포함하는 골질환 예방 또는 치료용 조성물

Country Status (3)

Country Link
US (1) US20160081980A1 (ko)
KR (1) KR101489861B1 (ko)
WO (1) WO2014182050A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10504270B2 (en) * 2016-12-22 2019-12-10 Apple Inc. Resource synchronization for graphics processing
KR102098289B1 (ko) * 2018-04-11 2020-04-07 경북대학교 산학협력단 발네물린을 유효성분으로 함유하는 골 질환 예방 또는 치료용 조성물

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110070244A1 (en) * 2005-04-25 2011-03-24 The Cbr Institute For Biomedical Research, Inc. Methods for the treatment of multiple myeloma
KR20110114197A (ko) * 2010-04-13 2011-10-19 경북대학교 산학협력단 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물
US20120003189A1 (en) * 2008-11-06 2012-01-05 Pelus Louis M Materials and Methods to Enhance Hematopoietic Stem Cells Engraftment Procedures

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5424331A (en) * 1994-06-10 1995-06-13 Bio-Virus Research Incorporated Pharmaceutical compositions and dietary soybean food products for the prevention of osteoporosis
KR20070085288A (ko) * 2004-09-24 2007-08-27 안지오블라스트 시스템스 인코퍼레이티드 간엽 전구세포의 증식 및/또는 생존성 증강 방법
US9682078B2 (en) * 2011-03-18 2017-06-20 University Of Virginia Patent Foundation Compositions and methods for tissue engineering and cell based therapies

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110070244A1 (en) * 2005-04-25 2011-03-24 The Cbr Institute For Biomedical Research, Inc. Methods for the treatment of multiple myeloma
US20120003189A1 (en) * 2008-11-06 2012-01-05 Pelus Louis M Materials and Methods to Enhance Hematopoietic Stem Cells Engraftment Procedures
KR20110114197A (ko) * 2010-04-13 2011-10-19 경북대학교 산학협력단 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
XIAO XIA WANG ET AL.: "Progenitor cell mobilization enhances bone healing by means of improved neovascuiarization and osteogenesis", PLASTIC AND RECONSTRUCTIVE SURGERY, vol. J28, no. 2, 2011, pages 395 - 405 *

Also Published As

Publication number Publication date
US20160081980A1 (en) 2016-03-24
KR101489861B1 (ko) 2015-02-05
KR20140132205A (ko) 2014-11-17

Similar Documents

Publication Publication Date Title
EP3138570A1 (en) Muscle atrophy inhibitor containing quercetin glycoside
JP7125353B2 (ja) Ｈｔｌｖ－１関連脊髄症を治療することに用いるための医薬組成物
US20160136194A1 (en) Pharmaceutical composition comprising a proton pump inhibitor and a prebiotic for the treatment of ulcerous lesions of the stomach and duodenum
WO2017042337A1 (en) Short-chain fatty acids for use in the treatment of cardiovascular disease
WO2014182050A1 (ko) Amd3100을 포함하는 골질환 예방 또는 치료용 조성물
CN112694463B (zh) 一种异戊烯基色原酮类化合物在制备抗冠状病毒药物中的用途
US20220135935A1 (en) Composition comprising lactobacillus sakei cvl-001 or culture liquid thereof for alleviating, preventing, or treating bone diseases or metabolic diseases
TW201026317A (en) Use of cycloartane compounds for treating arthritis
RU2501549C1 (ru) Фармацевтическая композиция для лечения гастроэзофагеальной рефлюксной болезни
CN113288892A (zh) 聚adp核糖聚合酶抑制剂在抗冠状病毒中的应用
WO2014084669A1 (ko) 프래럽토린 a 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 골다공증 예방 또는 치료용 약학적 조성물
WO2021060933A1 (ko) Mmagnu2 화합물을 유효성분으로 함유하는 결핵균, 비결핵 항산균 또는 그람 양성균 감염 질환 예방 또는 치료용 조성물
CN112245424B (zh) 一种没药烷倍半萜结构类似物在制备抗冠状病毒药物中的用途
WO2018080276A1 (ko) 담즙산을 포함하는 허혈성 재관류 손상의 예방 또는 치료용 약학적 조성물
WO2021045595A1 (ko) 치아 주변조직 유래 다분화능 줄기세포를 포함하는 비만 또는 비알코올성 지방간의 예방 또는 치료용 약학적 조성물
CN112675172B (zh) 一种二酮哌嗪类化合物在制备抗冠状病毒药物中的用途
WO2021261855A1 (ko) 아연 트랜스포터 액티베이터 조성물
CN104114165A (zh) 用于治疗憩室病的方法和组合物
JP2016164138A (ja) 筋分化促進組成物
US20220305092A1 (en) Medicament and food for preventing or treating novel coronavirus pneumonia covid-19 and use thereof
WO2022173123A1 (ko) 시클로엘페닐알라닐엘프롤린 디펩타이드를 포함하는 근섬유 형성의 촉진 또는 파골세포의 분화억제 기전을 통한 근감소증 또는 골다공증 치료용 조성물
WO2022045673A1 (ko) 신규한 화합물을 유효성분으로 포함하는 심근경색 후 심부전 예방 또는 치료용 조성물 및 이의 용도
WO2022169230A1 (ko) 6-메톡시니코틴아미드를 유효성분으로 포함하는 근감소증의 예방 또는 치료용 조성물
WO2022169226A1 (ko) 로나파르닙을 유효성분으로 포함하는 근감소증의 예방 또는 치료용 조성물
US9724394B2 (en) Pharmaceutical composition for preventing or treating osteoporosis which comprises neuropeptide Y as active ingredient

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14794964

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 14889337

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14794964

Country of ref document: EP

Kind code of ref document: A1