WO2021261816A1 - 스핑고지질 및 스핑고이드 염기의 생산성이 향상된 피키아 시페라이 변이 균주 및 이의 제조방법 - Google Patents

스핑고지질 및 스핑고이드 염기의 생산성이 향상된 피키아 시페라이 변이 균주 및 이의 제조방법 Download PDF

Info

Publication number
WO2021261816A1
WO2021261816A1 PCT/KR2021/007298 KR2021007298W WO2021261816A1 WO 2021261816 A1 WO2021261816 A1 WO 2021261816A1 KR 2021007298 W KR2021007298 W KR 2021007298W WO 2021261816 A1 WO2021261816 A1 WO 2021261816A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
pichia
mutant strain
ciferai
taps
Prior art date
Application number
PCT/KR2021/007298
Other languages
English (en)
French (fr)
Inventor
안정오
한창표
장민정
권희운
이태희
이주희
김혜진
Original Assignee
한국생명공학연구원
솔루스첨단소재 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원, 솔루스첨단소재 주식회사 filed Critical 한국생명공학연구원
Priority to CN202180057358.6A priority Critical patent/CN116157518A/zh
Priority to EP21828118.6A priority patent/EP4170038A4/en
Priority to US18/003,025 priority patent/US20230242951A1/en
Publication of WO2021261816A1 publication Critical patent/WO2021261816A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/02—Amides, e.g. chloramphenicol or polyamides; Imides or polyimides; Urethanes, i.e. compounds comprising N-C=O structural element or polyurethanes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/16—Yeasts; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436—Fatty acid esters
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/84—Pichia

Definitions

  • the present invention relates to a Pichia ciferai mutant strain having improved productivity of sphingolipids and sphingoid bases by regulating fatty acid metabolism and a method for preparing the same.
  • Sphingolipid refers to a group of lipids derived from sphingoid bases and is a generic term for ceramides or ceramide derivatives that have sphingosine, phytosphingosine, and sphinganine as their basic skeleton in the human body. to be. It is naturally present in large amounts in the cell membranes of animals, plants and microorganisms and is involved in various cell signaling such as cell differentiation, cell growth and apoptosis.
  • Ceramide has both hydrophilic and lipophilic groups, so it is known that it not only prevents the evaporation of moisture from the skin, but also acts as a defense material having the permeability of the stratum corneum of human skin and homeostasis to microorganisms. Recently, ceramides have been used as useful substances in cosmetics.
  • Tetra acetyl phytosphingosine which is valuable as a ceramide precursor, is a substance in which phytosphingosine among sphingoid bases is produced in a fully acetylated state by N, O-acetylation. It is easily converted to phytosphingosine.
  • the chemical structure of the converted phytosphingosine has the same D-erythro isomer structure as the ceramide structure of human skin, so it can be used as a raw material for producing ceramides friendly to human skin.
  • TAPS can be synthesized chemically (Current Organic Chemistry, 2010. 14(20) 2483-2521), but the process is complicated and the production cost is high. Therefore, production through a biological method is attracting attention as a method to replace it from an economic point of view. Among them, it was found that Pichia ciferai produces a large amount of sphingoid bases and sphingolipids including TAPS (Journal of bacteriology, 1960, 80(4) 484-491), and then genome sequencing (Eukaryotic cell, A brief process for the biosynthesis of TAPS is known through 2012, 11(12) 1582).
  • Wild-type Pichia ciferai is known to produce 233 mg/L of TAPS at a yield of 5 mg (TAPS)/g (glucose) in an experiment conducted for research purposes (Applied Microbiology, 1962, 10(5) 401).
  • the newly isolated Pichia ciferai DSCC 7-25 showed a TAPS production yield of 1,065 mg/L through the control of culture conditions and the separation and purification method of sphingolipids (Korean Patent No. 10-0221357, Korean Patent No. 10-0188857).
  • this is only an improvement in the production yield at the laboratory level, and it is not enough to achieve mass production for industrial use.
  • An object of the present invention is to provide a genetically engineered Pichia ciferai mutant strain having increased productivity of sphingolipids and sphingoid bases and a method for preparing the same.
  • an object of the present invention is to provide a method for producing TAPS, which is a ceramide precursor, using a genetically engineered Pichia ciferai mutant strain.
  • the present invention provides a genetically engineered Pichia ciferai mutant strain.
  • a Pichia ciferai mutant strain in which the expression of a gene related to beta-oxidation of palmitoyl-CoA is suppressed in order to increase the accumulation of palmitoyl-CoA in cells.
  • a Pichia ciferai mutant strain whose expression is suppressed by deletion of the PcPOX3 gene, which is a gene related to beta oxidation of palmitoyl-CoA.
  • a Pichia ciferai mutant strain in which the expression of the PcLCB4 gene, which is a gene involved in phosphorylation of sphingoid bases, is additionally suppressed in PcPOX3 gene-deleted Pichia ciferai cells.
  • a culture method and a method for producing TAPS for increasing the production of TAPS for increasing the production of TAPS (Tetraacetyl phytosphingosine), which is a precursor of ceramide in a cell.
  • TAPS which is a precursor of ceramide in the Pichia ciferai mutant strain.
  • the Pichia ciferai mutant strain provided by the present invention provides a genetically engineered Pichia ciferai strain with increased productivity of sphingolipids and sphingoid bases compared to the wild type.
  • the present invention provides an environmentally friendly production method capable of producing sphingolipids and sphingoid bases through biological methods.
  • FIG 1 shows the construction diagram of the auxotrophic PcURA3 gene deletion cassette vector.
  • FIG. 2 shows the construction of a fatty acid metabolism-related deletion cassette vector and the principle of continuous deletion.
  • 3 is a graph showing the TAPS production of each Pichia ciferai mutant strain.
  • FIG. 4 is a graph showing TAPS production in a medium containing C12 FAME in a PcPOX3 gene deleted Pichia ciferai mutant strain.
  • Pichia ciferai is the only yeast that has the ability to produce and secrete large amounts of fully acetylated sphingolipids, which cannot be seen in other yeasts (Journal of bacteriology, 1960, 80(4) 484-491). The exact origin of the evolution is not known, but it is presumed that it evolved through competition for securing a carbon energy source in a yeast or crab tree-positive strain that mass-produced amino acids (Science 2001, 292(5516) 504).
  • Pichia ciferai is a non-traditional yeast strain, previously named Hansenula ciferrii or Pichia ciferrii, but has now been reclassified into the genus Wickerhamomyces. However, in the present invention, in order to prevent confusion with the existing naming, it was designated as Pichia ciferrii as the existing name. As the main characteristic of Pichia ciferai, it is the only yeast with the ability to produce and mass secrete fully acetylated sphingoids that are not found in other yeasts. .
  • the first step in the sphingolipid biosynthesis process is a step in which serine palmitoyl translase (3-ketosphinganine synthase) condenses serine and palmitoyl-CoA to form 3-ketosphinganine having 18 carbon atoms, This step determines the rate of the sphingolipid biosynthesis process (Biochimica et Biophysica Acta (BBA) -Lipids and Lipid Metabolism, 1973. 306(2) 341-345).
  • Palmitoyl-CoA which is a raw material for TAPS biosynthesis together with serine (L-serine), is metabolized to acetyl-CoA (Acetyl-CoA) by beta-oxidation. Blocking this metabolic process can enhance the conversion of palmitic acid to palmitoyl-CoA, thereby inducing the accumulation of palmitoyl-CoA, thereby increasing TAPS production.
  • the gene related to the enzyme that catalyzes the reaction of converting palmitoyl-CoA to trans- ⁇ 2-Enoyl-CoA during beta oxidation is known to be the POX gene. Named and similar genes are known. By suppressing the expression of the genes, it is possible to increase the accumulation rate of palmitoyl-CoA.
  • sphinganine kinase LCB4 (PcLCB4) is an enzyme having kinase activity for phosphorylation of sphinganine and phytosphingosine. Yes (Korea Registered Patent No. 10-2056651).
  • the present invention relates to a Pichia ciferrii mutant strain in which the expression of the PcPOX3 gene (SEQ ID NO: 28) or PcPOX3 (SEQ ID NO: 28) and PcLCB4 (SEQ ID NO: 29) genes is suppressed, and a method for suppressing the expression of the genes
  • a method for suppressing the expression of the genes As a result of partial or all deletion of each gene, foreign DNA insertion, substitution of a part of a gene by a foreign gene, RNA interference, gene mutagenesis, or a combination thereof, specifically, due to partial or all deletion of each gene and, more specifically, by deletion of each gene as a whole.
  • the present invention it is possible to increase the accumulation rate of palmitoyl-CoA by constructing a deletion cassette targeting the corresponding genes, and in the present invention, a Pichia ciferai mutant strain in which the PcPOX3 gene is deleted, and a PcPOX3 and PcLCB4 gene in which the PcPOX3 and PcLCB4 genes are simultaneously deleted.
  • the increased production of TAPS was confirmed by producing a Chia ciperai mutant strain.
  • a "wild type" of a cell is, in the context of the present invention, preferably a factor affecting the activity of an enzyme encoded by a nucleic acid sequence specified in the cell according to the present invention (e.g. a specified enzyme encoding the corresponding enzyme). refers to a parent strain developed through modification of a gene comprising a nucleic acid sequence or a promoter present in a corresponding gene and functionally linked to a specified nucleic acid sequence.
  • the decrease in specific activity of the cells according to the present invention compared to their wild-type is possible by measuring the activity by using cells grown under the same conditions such as the same number/concentration of cells, for example, medium, gas treatment, and agitation. can be measured, but is not limited thereto.
  • the yeast mutant strain of the present invention is a mutant strain in which the sphingolipid metabolism pathway is redesigned using a Pichia ciferrii wild type strain as the parent strain, and preferably, Korea Patent Registration No. 10-0188857 If the Pichia ciferai DSCC 7-25 strain (Accession No. KFCC-10937) disclosed in the examples of the reference is used, or a strain having a sphingolipid metabolic pathway, it can be used as the parent strain without limitation in the strain.
  • the TAPS production (TAPS specific yield) in the mutant strain through the above method was about 1.7 times in the PcPOX3 gene deletion mutant strain, and 2 times or more in the mutant strain in which the PcPOX3 and PcLCB4 genes were simultaneously deleted. .
  • An embodiment of the present invention provides a method of increasing TAPS production by artificially accumulating intracellular fatty acids by adding fatty acid methyl esters to the culture medium of the mutant strain.
  • the TAPS specific yield increased to about 100% in the PcPOX3 gene deletion mutant strain.
  • nucleotide identity with respect to the above-mentioned sequences can be determined with the aid of known methods. Typically, special computer programs are used with algorithms that take special requirements into account.
  • Another object of the present invention is to provide a mutant strain according to the present invention that produces a sphingoid base and a sphingolipid.
  • sphingoid base in the context of the present invention includes phytosphingosine, sphingosine, sphingadeenine, 6-hydroxysphingosine and sphinganine (dihydrosphingosine), also in acetylated form, For example, tetraacetylphytosphingosine, triacetylphytosphingosine, diacetylphytosphingosine, O-acetylphytosphingosine, triacetylsphinganine, diacetylsphinganine, O-acetylsphingosine Nin, triacetylsphingosine, diacetylsphingosine, O-acetylsphingosine, tetraacetyl-6-hydroxysphingosine, triacetyl-6-hydroxysphingosine, diacetyl-6-hydroxysphingosine , means selected from among O-acet
  • sphingolipid in the context of the present invention is understood to mean a compound comprising a sphingoid base covalently bound to a fatty acid via an amide bond.
  • Fatty acids may be saturated or mono- or polyunsaturated.
  • Fatty acid side chains can vary in length.
  • the fatty acid side chain may also bear functional groups such as hydroxyl groups.
  • Sphingolipids include, for example, phytoceramide, ceramide and dihydroceramide, and the more complex glucosylceramide (cerebroside) and inositol phosphorylceramide, mannosylinositol phosphorylceramide and mannosyldiinositol phosphorylceramide. do.
  • sphingolipid is a sphingoid base bound to an acetyl radical via an amide bond, such as for example N-acetylphytosphingosine, N-acetylsphinganine, N-acetylsphingosine, N-acetyl-6-hydro
  • amide bond such as for example N-acetylphytosphingosine, N-acetylsphinganine, N-acetylsphingosine, N-acetyl-6-hydro
  • hydroxysphingosine are also known as short-chain ceramides.
  • Another object of the present invention is to provide a method for preparing the above-described mutant strain according to the present invention.
  • the manufacturing method is
  • the Pichia ciferai mutant strain according to the present invention can be used to prepare a sphingoid base and a sphingolipid, and is preferably suitable for improving the production yield of tetraacetylphytosphingosine (TAPS), but is not limited thereto. .
  • TAPS tetraacetylphytosphingosine
  • Carbon sources that can be used in the cell culture step include carbohydrates such as for example glucose, fructose, glycerol, sucrose, maltose, molasses, or other alcohols such as for example ethanol, and organic acids such as for example acetate to be.
  • Nitrogen sources that can be used are, for example, ammonia, ammonium sulfate, ammonium nitrate, ammonium chloride, organic nitrogen compounds (eg yeast extract, malt extract, peptone, corn steep liquor).
  • Inorganic compounds such as, for example, phosphates, magnesium salts, potassium salts, zinc salts, iron salts and the like can also be used.
  • Suitable culture conditions for the Pichia ciferai strain of the present invention are known to those skilled in the art from, for example, International Patent Publication No. 2007-131720 or Korean Patent No. 10-0221357.
  • the subsequent construction of the cassette was constructed by E. coli plasmid cloning. Gene deletion was performed by replacing DNA by classical homologous recombination and double cassette utilization (Yeast, 1996. 12(14): 1439-1457).
  • the present inventors first discovered and deleted the auxotrophic gene PcURA3 for efficient use of the marker gene, and then used it as a marker for the deletion of the PcPOX3 and PcLCB4 genes (Example 2).
  • a PcURA3 deletion cassette was constructed using the plasmid pGEM-T-easy (Promega) vector as a transfer vector.
  • the pGEM-T-easy vector was digested using restriction enzymes SpeI and SacI, and the resulting 2.97 kb DNA fragment was used as a backbone for subsequent cloning.
  • the 5' end (P-GAP1) of the PcGAPDH gene (SEQ ID NO: 1) was cut using restriction enzymes SpeI and NdeI, and two DNA fragments in which the PcNAT1 gene (SEQ ID NO: 2) was cut using SacI and NdeI were cut in advance.
  • the pGEM-T-easy vector fragment was linked with T4 DNA ligase (TAKARA) treatment.
  • the GAPDH terminus linked on the vector was digested using restriction enzymes SpeI and EcoRI, and the resulting 4.147 kb DNA fragment was used as a backbone for subsequent cloning.
  • the 150 bp sequence T-PcTEF of the 3' end of the PcTEF1 gene isolated from the Pichia ciferai wild-type cell genome was amplified (SEQ ID NO: 27).
  • T-PcTEF was digested using restriction enzymes SpeI and EcoRI, and the previously cut pGEM-T-easy vector GAPDH terminus was ligated with T4 DNA ligase (TAKARA) treatment.
  • GAPDH terminus (Fig. 1, P-GAP1) linked on the vector, PcNAT1 gene and PcTEF terminus (Fig. 1, T-PcTEF) DNA 1335 bp, 5' of the PcURA3 gene (SEQ ID NO: 3) isolated from the Pichia ciferai wild-type cell genome
  • the end 1171 bp and the 3' end 548 bp were PCR amplified.
  • the end of PcGAPDH and the 5' end of the PcURA3 gene, and the end of the PcTEF gene and the 3' end of the PcURA3 gene were overlapped by 22bp and 25bp.
  • Primer NAT1_MB (cacctgaatcaggatattcttctaatacctgg, SEQ ID NO: 9) located at 324 bp from the start codon of the PcNAT1 gene and PcURA3_5D1F located at 1171 bp at the 5' end of the PcURA3 gene (SEQ ID NO: 3) (tgagaaacgtggcaatggatcattg, SEQ ID NO: 10 using cassette 1) PCR amplified.
  • Cassette 2 of FIG. 1 was PCR amplified using primer NAT1_1F (atgggtaaggaaaagactcacgttt, SEQ ID NO: 11) located at the start codon of the PcNAT1 gene and primer PcURA3_3D2B (ttgtcactcttgaatggcatctactg, SEQ ID NO: 12) located at 548 bp at the 3' end of the PcURA3 gene.
  • primer NAT1_1F atgggtaaggaaaaagactcacgttt, SEQ ID NO: 11
  • primer PcURA3_3D2B ttgtcactcttgaatggcatctactg, SEQ ID NO: 12
  • the deletion cassette (SEQ ID NO: 4) prepared by the method of Example 1 was introduced into a Pichia ciferai strain by transformation to delete the PcURA3 gene (SEQ ID NO: 3), and the inserted cassette was confirmed through PCR and DNA sequencing analysis did (Fig. 1)
  • Example 2 Construction of a gene deletion cassette related to fatty acid and sphingolipid metabolism
  • the basic construction principle of the cassette vector is the same as that of the auxotrophic gene deletion cassette.
  • the target gene for constructing a deletion cassette is PcPOX3, PcLCB4, or simultaneous deletion of PcPOX3 and PcLCB4.
  • a deletion cassette was constructed using the plasmid pGEM-T-easy (Promega) as a transport vector.
  • the pGEM-T-easy (Promega) vector was digested using restriction enzymes NotI and SpeI, and the resulting 3.73 kb DNA fragment was used as a backbone for subsequent cloning.
  • PCR amplification was performed so that the 5' end of the PcURA3 gene ORF of 359 bp to the 3' end of 387 bp overlapped with the above-described pGEM-T-easy vector fragment SpeI cut section by 30 bp.
  • the 3' end of the PcURA3 gene is 387 bp
  • the 5' end overlaps with the pGEM-T-easy vector fragment NotI cut section described above by 30 bp
  • the 3' end is 359 bp from 329 bp to the 5' end of the URA3 gene.
  • PCR amplification was performed to overlap by 30 bp.
  • the two DNA fragments amplified by PCR and the excised pGEM-T-easy vector fragment were made to have repeat sequences at both ends of the PcURA3 gene through infusion cloning (TAKARA).
  • the 5' end region and the 3' end region (Table 1) of the target gene to be deleted were amplified by PCR, respectively, and at this time, the 5' end of the primer was extended to overlap the repeat sequence of the marker gene to be fused by 30-35 bp ( Table 1).
  • the previously constructed vector was linked to the DNA fragment cut with NotI restriction enzyme and the 5' end PCR amplified with primers N1 and N3 of the deletion target gene (FIG. 1) through infusion cloning (TAKARA).
  • the DNA fragment cut with SpeI restriction enzyme and the 3' end amplified by PCR with primers N4 and N5 of the deletion target gene were ligated to the previously constructed vector through infusion cloning (TAKARA).
  • Cassette 1 of Figure 2 was PCR amplified using the primer PcURA3R (GCTCTGTAACGTTCACCTTC, SEQ ID NO: 13) located 43 bp from the PcURA3 gene stop codon and the reverse primer (N2) at the end of the deletion target inserted at the 5' end of the marker gene.
  • PcURA3R GCTCTGTAACGTTCACCTTC, SEQ ID NO: 13
  • Cassette 2 of FIG. 2 was PCR amplified using the primer PcURA3F (ATTAGGTCCATATATCTGTCTTGTC, SEQ ID NO: 14) binding to the inside of the gene 150 bp from the start codon of the PcURA3 gene and the reverse primer (N6) of the deletion target end inserted at the 3' end of the marker gene. .
  • PcURA3F ATTAGGTCCATATATCTGTCTTGTC, SEQ ID NO: 14
  • the gene deletion cassette (SEQ ID NO: 5 to 8) prepared by the method of Example 2 was introduced into a Pichia ciferai strain by transformation to delete the target gene, and the inserted cassette was confirmed through PCR and DNA sequence analysis.
  • 5'-fluoroorotic acid 5'-fluoroorotic acid was used in Pichia ciferai cells in which the marker gene was culled through recombination of repeat sequences inserted at the 5' and 3' ends of the marker gene. ) and confirmed through PCR after construction by the addition of
  • the constructed cassette was subjected to heat shock for 15 minutes at a temperature of 37 ° C., and transformed into the parent strain DSCC 7-25, and a strain derived therefrom, and the expression of the target gene was confirmed by PCR amplification. A target transformant was selected.
  • PcURA3 gene deletion mutant strain in strain Pichia ciferai DSCC 7-25 (Accession No. KFCC-1093), PcLCB4 gene deletion mutant strain in the BD 02 strain (KD 02), PcPOX3 gene deletion mutation in BD 02 strain Strain (KD 04), and strain BD 02 with simultaneous deletion of PcLCB4 and PcPOX3 genes (KD 08) respectively (Table 2)
  • YGM optimal medium glycerol 100 g / l, yeast extract 2 g / l, KNO 3 3 g / l, (NH 4 ) 2 SO 4 0.5g/l, MgSO 4 7H 2 O 0.3g/l, NaCl 0.5g/l, CSL (corn steep liquor) 3g/l, LS-300 (anti-forming agent) 1g/ l
  • TAPS was analyzed by HPLC using UV 200 nm.
  • a solvent an 84.5:18.45:0.05 mixture of methanol, water, and TFA (trifluoroacetic acid) was used.
  • Characteristics of each mutant strain strain name Characteristic BD 02 PcURA3 gene deletion in Pichia ciferai DSCC 7-25 (Accession No. KFCC-10937) KD 02 Deletion of PcLCB4 gene in BD 02 strain KD 04 Deletion of PcPOX3 gene in BD 02 strain KD 08 Simultaneous deletion of PcPOX3 and PcLCB4 genes in BD 02 strain
  • BD 02 KD and 04 strains respectively transformed converts the YGM optimal medium and then inoculated on 50ml cultured for 3 days at 220 rpm 25 °C fatty acid was added culture medium (glycerol, 30g / l, Yeast Extract 2g / l, KNO 3 3g / l, (NH 4 ) 2 SO 4 0.5g/l, MgSO 4 7H 2 O 0.3g/l, NaCl 0.5g/l, CSL 3g/l, LS-300 1g/l, Lauric acid methyl ester 2.14 g/l, Tween 80 (0.5%) 50 ml was added and cultured at 220 rpm for 4 days at 25°C.
  • culture medium glycerol, 30g / l, Yeast Extract 2g / l, KNO 3 3g / l, (NH 4 ) 2 SO 4 0.5g/l, MgSO 4 7H 2 O 0.3g/l, NaCl 0.5g
  • TAPS was analyzed by HPLC using UV 200 nm.
  • a solvent an 84.5:18.45:0.05 (w/w) mixture of methanol, water and TFA was used.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Mycology (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Botany (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 신규한 세라마이드 전구물질 생산용 효모 변이 균주 및 이의 제조방법에 관한 것으로, 보다 구체적으로는 피키아 시페라이(Pichia ciferrii)에서 세라마이드 생산을 위한 대사경로의 재설계를 통해 제조된 스핑고리피드 대사산물을 과발현할 수 있도록 유전자 조작된 피키아 시페라이 변이 균주 또는 상기 변이 균주의 제조방법에 관한 것이다.

Description

스핑고지질 및 스핑고이드 염기의 생산성이 향상된 피키아 시페라이 변이 균주 및 이의 제조방법
본 출원은 2020년 6월 23일자 한국 특허 출원 제10-2020-0076795호에 기초한 우선권의 이익을 주장하며, 해당 한국 특허 출원의 문헌에 개시된 모든 내용은 본 명세서의 일부로서 포함된다.
본 발명은 지방산 대사를 조절함으로 스핑고지질 및 스핑고이드 염기의 생산성이 향상된 피키아 시페라이 변이균주 및 이의 제조방법에 관한 것이다.
스핑고지질(sphingolipid)은 스핑고이드 염기로부터 유도되는 지질군을 나타내며 인체 내에서 스핑고신(sphingosine), 파이토스핑고신(phytosphingosine), 스핑가닌(sphinganine)을 기본 골격으로 하고 있는 세라마이드 또는 세라마이드 유도체의 통칭이다. 자연적으로는 동물, 식물 및 미생물의 세포막에 다량으로 존재하며 세포분화, 세포성장 및 세포사멸 등의 다양한 세포 신호전달에 관여한다.
세라마이드는 친수성 및 친유성기를 함께 가지고 있어 피부의 수분이 증발하는 것을 막을 뿐 아니라, 사람 피부 각질층의 침투성, 미생물에 대한 항상성을 지니는 방어물질 역할을 하는 것으로 알려져 있다. 최근에 세라마이드(ceramides)는 화장품의 유용 물질로서 이용되고 있다.
세라마이드 전구체로 가치가 있는 테트라아세틸파이토스핑고신(Tetra acetyl phytosphingosine; TAPS)은 스핑고이드 염기 중 파이토스핑고신이 N, O-아세틸화에 의해 완전히 아세틸화된 상태로 생산되는 물질로서, 탈아세틸화 반응을 통해 다시 파이토스핑고신으로 전환이 용이하다. 전환된 파이토스핑고신의 화학적 구조가 인간 피부의 세라마이드 구조와 동일한 D-erythro 이성질체 구조를 지니고 있어, 인간 피부에 친화적인 세라마이드를 생산하는 원료로서 사용이 가능하다.
TAPS는 화학적으로 합성이 가능하나(Current Organic Chemistry, 2010. 14(20) 2483-2521) 그 과정이 복잡하고 생산 비용이 높다. 따라서, 경제적인 측면에서 이를 대체하기 위한 방법으로 생물학적인 방법을 통한 생산이 주목받고 있다. 그 중 피키아 시페라이가 TAPS를 포함하는 다량의 스핑고이드 염기 및 스핑고지질을 생산한다는 것이 발견되었고(Journal of bacteriology, 1960, 80(4) 484-491), 이후 게놈 시퀀싱(Eukaryotic cell, 2012, 11(12) 1582)을 통하여 TAPS의 생합성에 대한 간략한 과정이 알려져 있다.
야생형의 피키아 시페라이는 연구목적으로 진행된 실험에서 5 mg(TAPS)/g(glucose) 수율로 233 mg/L의 TAPS를 생산하는 것으로 알려져 있다(Applied Microbiology, 1962, 10(5) 401). 또한, 새로 분리된 피키아 시페라이 DSCC 7-25는 배양조건 조절 및 스핑고지질 분리정제 방법을 통해 1,065 mg/L의 TAPS 생산수율을 나타냈다(대한민국 등록특허 제10-0221357호, 대한민국 등록특허 제10-0188857호). 하지만, 이는 실험실 수준의 생산수율 향상에 지나지 않으며, 산업적 활용을 위한 대량생산에는 미치지 못하는 수준이다.
따라서, 본 발명에서는 산업적 활용이 가능하도록 TAPS의 생산 수율이 증가된 피키아 시페라이 변이 균주 및 이의 제조방법을 제공하고자 한다.
[선행기술문헌]
특허문헌
대한민국 등록특허 제10-0221357호
대한민국 등록특허 제10-0188857호
대한민국 등록특허 제10-2056651호
비특허문헌
Current Organic Chemistry, 2010. 14(20) 2483-2521
Journal of bacteriology, 1960, 80(4) 484-491
Eukaryotic cell, 2012, 11(12) 1582
Applied Microbiology, 1962, 10(5) 401
Science 2001, 292(5516) 504
Biochimica et Biophysica Acta(BBA) -Lipids and Lipid Metabolism, 1973. 306(2) 341-345
본 발명의 목적은 스핑고지질 및 스핑고이드 염기의 생산성이 증가된 유전자 조작된 피키아 시페라이 변이 균주 및 그의 제조방법을 제공하는데 있다.
추가적으로, 본 발명의 목적은 유전자 조작된 피키아 시페라이 변이 균주를 이용하여 세라마이드 전구체인 TAPS를 생산하는 방법을 제공하는데 있다.
상기 목적을 달성하기 위해 본 발명은 유전자 조작된 피키아 시페라이 변이 균주를 제공한다.
본 발명의 일 구현예에 따라, 세포 내에서 팔미토일-CoA의 축적을 높이기 위해 팔미토일-CoA의 베타 산화(β-oxidation)에 관련된 유전자의 발현이 억제된 피키아 시페라이 변이 균주를 제공한다.
본 발명의 일 구현예에 따라, 팔미토일-CoA의 베타 산화에 관련된 유전자인 PcPOX3 유전자가 결실되어 발현이 억제된 피키아 시페라이 변이 균주를 제공한다.
본 발명의 일 구현예에 따라, PcPOX3 유전자가 결실된 피키아 시페라이 세포에 스핑고이드 염기의 인산화에 관여하는 유전자인 PcLCB4 유전자의 발현이 추가적으로 억제된 피키아 시페라이 변이 균주를 제공한다.
본 발명의 일 구현예에 따라, 세포 내에서 세라마이드의 전구체인 TAPS(Tetraacetyl phytosphingosine) 생산을 높이기 위한 배양 방법 및 TAPS 제조방법을 제공한다.
본 발명의 일 구현예에 따라 상기 피키아 시페라이 변이 균주에서 세라마이드의 전구체인 TAPS 제조방법을 제공한다.
본 발명에 의해 제공되는 피키아 시페라이 변이 균주는 야생형에 비해 스핑고지질 및 스핑고이드 염기의 생산성이 증가된 유전자 조작된 피키아 시페라이 균주를 제공한다. 또한, 본 발명은 생물학적 방법을 통해 스핑고지질 및 스핑고이드 염기를 생산할 수 있는 환경친화적인 생산방법을 제공한다.
도 1은 영양요구성 PcURA3 유전자 결실 카세트 벡터의 구축 도면을 나타낸 것이다.
도 2는 지방산 대사 관련 결실 카세트 벡터의 구축 및 연속 결실의 원리를 나타낸 것이다.
도 3은 각각의 피키아 시페라이 변이 균주의 TAPS 생산량을 나타낸 그래프이다.
도 4는 PcPOX3 유전자 결실된 피키아 시페라이 변이 균주에 C12의 FAME이 함유된 배지에서의 TAPS 생산량을 나타낸 그래프이다.
이하, 본 발명에 대한 이해를 돕기 위하여 본 발명을 더욱 상세하게 설명한다.
피키아 시페라이는 다른 효모들에서는 볼 수 없는 완전히 아세틸화된 스핑고지질의 생산 및 대량 분비능력을 갖춘 유일한 효모이며(Journal of bacteriology, 1960, 80(4) 484-491), 아직까지 이러한 표현형으로 진화하게 된 정확한 기원은 밝혀지지 않았으나, 다만 아미노산 대량 생산 효모나 혹은 크랩트리 양성 균주에서 탄소 에너지원 확보를 위한 경쟁을 통해 진화했을 것으로 짐작되고 있다(Science 2001, 292(5516) 504).
피키아 시페라이는 비 전통 효모 균주로서 이전에는 한세눌라 시페라이(Hansenula ciferrii) 또는 피키아 시페라이(Pichia ciferrii)로 명명되었으나, 현재에는 위커하모마이세스(Wickerhamomyces) 속으로 재분류 되었다. 하지만, 본 발명에서는 기존의 명명과 혼돈을 방지하기 위하여 기존의 명명대로 피키아 시페라이(Pichia ciferrii)로 명시하였다. 피키아 시페라이의 주요 특징으로 다른 효모들에서는 볼 수 없는 완전히 아세틸화 된 스핑고이드의 생산 및 대량 분비능력을 갖춘 유일한 효모로 앞서 서술한 화장품 세라마이드 전구체로 가치 있는 TAPS를 생산하여 분비할 수 있다.
스핑고지질 생합성 과정의 첫 단계는 세린 팔미토일 트랜스라제(3-ketosphinganine synthase)가 세린과 팔미토일-CoA를 응축하여 탄소수 18의 3-케토스핑가닌(3-ketosphinganine)을 형성하는 단계이며, 이 단계가 스핑고지질 생합성 과정의 속도를 결정하는 단계이다(Biochimica et Biophysica Acta(BBA) -Lipids and Lipid Metabolism, 1973. 306(2) 341-345).
세린(L-serine)과 함께 TAPS 생합성의 원료가 되는 팔미토일-CoA는 베타-산화(ß-Oxidation)과정에 의하여 아세틸-CoA (Acetyl-CoA)로 분해되는 대사과정이 존재한다. 이 대사과정을 차단하면 팔미트산(Palmitic acid)에서 팔미토일-CoA로의 전환을 강화할 수 있으며 그로 인해, 팔미토일-CoA의 축적을 유도해 TAPS 생산량을 증가시킬 수 있다.
베타 산화(ß-Oxidation)과정에서 팔미토일-CoA를 trans-Δ2-Enoyl-CoA로 전환하는 반응을 촉매하는 효소와 관련된 유전자는 POX 유전자인 것으로 알려져 있으며, 피키아 시페라이에서 역시 PcPOX3 및 PcPOX4로 명명된 이와 유사한 유전자가 알려져 있다. 해당 유전자들의 발현을 억제함으로써 팔미토일-CoA의 축적률을 증가시킬 수 있다.
또한, 지방산 대사에서 PcLCB4(sphinganine kinase LCB4)는 스핑가닌 및 파이토스핑고신의 인산화시키는 키나제(kinase) 활성을 지니는 효소로서 PcLCB4 유전자를 결실시키면 스핑고신 쪽으로의 대사를 억제함으써 TAPS 생산량이 늘어난다는 것이 알려져 있다(대한민국 등록특허 제10-2056651호).
본 발명은 PcPOX3 유전자(서열번호 28) 또는 PcPOX3(서열번호 28) 및 PcLCB4(서열번호 29) 유전자의 발현이 억제된 피키아 시페라이(Pichia ciferrii) 변이 균주에 관한 것으로서, 상기 유전자들의 발현 억제 방법으로는 각 유전자의 일부 또는 전체 결실, 외래 DNA 삽입, 유전자 일부의 외래 유전자에 의한 치환, RNA 간섭, 유전자의 돌연변이 유도 또는 이들의 조합에 의한 것이고, 구체적으로는 각 유전자의 일부 또는 전체 결실에 의한 것이고, 보다 구체적으로는 각 유전자 전체 결실에 의한 것이다.
본 발명에서는 해당 유전자들을 타겟으로 결실 카세트를 구축해 팔미토일-CoA의 축적률을 증가시킬 수 있고, 본 발명에서는 PcPOX3 유전자를 결실시킨 피키아 시페라이 변이 균주, 및 PcPOX3 및 PcLCB4 유전자를 동시에 결실시킨 피키아 시페라이 변이 균주를 제작하여 증가된 TAPS 생산량을 확인하였다.
상기 효소 활성 감소는 야생형 피키아 시페라이 균주와 비교되는 것으로 이해된다.
세포의 "야생형"이란 본 발명과 관련하여 바람직하게는, 본 발명에 따른 세포가 특정된 핵산 서열에 의하여 코딩된 효소의 활성에 영향을 미치는 요소(예를 들어, 상응하는 효소를 코딩하는 특정된 핵산 서열을 포함하는 유전자 또는 상응하는 유전자에 존재하고 특정된 핵산 서열에 기능적으로 연결된 프로모터)의 변형을 통해 발달되는 모 균주를 의미한다.
야생형과 비교하여 “효소 활성 감소” 란 바람직하게는, 야생형 활성을 기준으로 적어도 50%만큼, 특히 바람직하게는 적어도 90%만큼, 추가로 바람직하게는 적어도 99.9%만큼, 추가로 한층 더 바람직하게는 적어도 99.99%만큼, 가장 바람직하게는 적어도 99.999%만큼 감소한 활성을 의미한다.
본 발명에 따른 세포의 그의 야생형과 비교한 특정 활성의 감소는 가능하면 동등한 세포수/농도, 예를 들어 배지, 가스처리, 교반과 같은 동일한 조건하에서 증식시킨 세포를 사용함으로써 활성을 측정하는 방법으로 측정할 수 있으나 이에 한정하는 것은 아니다.
본 발명의 효모 변이 균주는 피키아 시페리이(Pichia ciferrii) 야생형(wild type)의 균주를 모균주로 하여 스핑고지질 대사 경로를 재설계한 변이 균주이며, 바람직하게는 한국등록특허 제10-0188857호의 실시예에 개시된 피키아 시페라이 DSCC 7-25 균주(기탁번호 KFCC-10937)를 이용하거나, 스핑고지질 대사 경로를 갖는 균주라면 스트레인에 제한 없이 모균주로 이용이 가능하다.
본 발명의 일실시예에서는 상기 방법을 통한 변이 균주에서의 TAPS 생산(TAPS 특이수율)은, PcPOX3 유전자 결실 변이 균주에서는 약 1.7배, PcPOX3 및 PcLCB4 유전자를 동시에 결실시킨 변이 균주에서는 2배 이상을 보였다.
본 발명의 일실시예에서는 상기 변이균주 배양 배지에 지방산 메틸에스터를 추가하여 인위적으로 세포 내 지방산을 축적시킴으로써 TAPS 생산을 늘리는 방법을 제공한다. 그 결과 PcPOX3 유전자 결실 변이 균주에서는 약 100%로 TAPS 특이수율이 증가했다.
위 언급한 서열에 관하여 "뉴클레오티드 동일성"은 공지 방법의 도움을 빌려 측정될 수 있다. 일반적으로, 특별한 필요조건을 고려에 넣는 알고리즘을 갖춘 특수 컴퓨터 프로그램이 사용된다.
본 발명의 또다른 목적은 스핑고이드 염기 및 스핑고지질을 생성하는 본 발명에 따른 변이균주를 제공하는데 있다.
본 발명과 관련하여 용어 "스핑고이드 염기"는 피토스핑고신, 스핑고신, 스핑가디에닌, 6-히드록시스핑고신 및 스핑가닌(디히드로스핑고신), 또한 아세틸화 형태로, 예컨대 예를 들어 테트라아세틸피토스핑고신, 트리아세틸피토스핑고신, 디아세틸피토스핑고신, O-아세틸피토스핑고신, 트리아세틸스핑가닌, 디아세틸스핑가닌, O-아세틸스핑가닌, 트리아세틸스핑고신, 디아세틸스핑고신, O-아세틸스핑고신, 테트라아세틸-6-히드록시스핑고신, 트리아세틸-6-히드록시스핑고신, 디아세틸-6-히드록시스핑고신, O-아세틸-6-히드록시스핑고신, 트리아세틸스핑가디에닌, 디아세틸스핑가디에닌, O-아세틸스핑가디에닌 중에서 선택되는 것을 의미한다.
본 발명과 관련하여 용어 "스핑고지질"은 아미드 결합을 통해 지방산에 공유결합한 스핑고이드 염기를 포함하는 화합물을 의미하는 것으로 이해된다. 지방산은 포화되거나 또는 단일불포화- 또는 다불포화될 수 있다. 지방산 측쇄는 길이가 다양할 수 있다. 지방산 측쇄는 히드록시기와 같은 관능기를 또한 보유할 수 있다. 스핑고지질로는 예를 들어, 피토세라미드, 세라미드 및 디히드로세라미드, 및 좀더 복잡한 글루코실세라미드(세레브로시드) 및 이노시톨 포스포릴세라미드, 만노실이노시톨 포스포릴세라미드 및 만노실디이노시톨 포스포릴세라미드가 포함된다. 여기서 스핑고지질은 아미드 결합을 통해 아세틸 라디칼에 결합한 스핑고이드 염기, 예컨대 예를 들어 N-아세틸피토스핑고신, N-아세틸스핑가닌, N-아세틸스핑고신, N-아세틸-6-히드록시스핑고신을 또한 포함한다. 이들 화합물은 단쇄형 세라미드라는 용어로도 알려져 있다.
피토스핑고신, 스핑고신, 스핑가디에닌, 6-히드록시스핑고신, 스핑가닌(디히드로스핑고신), 테트라아세틸피토스핑고신(TAPS), 트리아세틸피토스핑고신, 디아세틸피토스핑고신, O-아세틸피토스핑고신, N-아세틸피토스핑고신, 트리아세틸스핑가닌(TriASa), 디아세틸스핑가닌, O-아세틸스핑가닌, N-아세틸스핑가닌, 트리아세틸스핑고신(TriASo), 디아세틸스핑고신, O-아세틸스핑고신, N-아세틸스핑고신, 테트라아세틸-6-히드록시스핑고신, 트리아세틸-6-히드록시스핑고신, 디아세틸-6-히드록시스핑고신, O-아세틸-6-히드록시스핑고신, N-아세틸-6-히드록시스핑고신, 트리아세틸스핑가디에닌, 디아세틸스핑가디에닌, 및 O-아세틸스핑가디에닌으로 이루어진 군으로부터 선택된 스핑고이드 염기 및 스핑고지질을 제조하기 위한 본 발명에 따른 변이 균주의 이용이 유리하다. 테트라아세틸피토스핑고신(TAPS)을 제조하기 위한 본 발명에 따른 변이 균주의 이용이 바람직하다.
본 발명의 또다른 목적은 본 발명에 따른 앞서 기재한 변이 균주를 제조하는 방법을 제공하는데 있다. 상기 제조방법은
a) 피키아 시페라이 균주를 제공하는 단계, 및
b) β 산화에 관련된 적어도 1종의 유전자를, 그 유전자 내로의 외래 DNA 또는 선택 마커 유전자를 코딩하는 DNA의 삽입, 유전자의 적어도 일부 결실, 유전자 서열에서의 점 돌연변이, RNA 간섭의 영향에의 유전자 노출, 및 외래 DNA 또는 프로모터 영역의 외래 DNA에 의한 유전자의 일부 치환에 의하여 변형시키는 단계를 포함한다.
본 발명에 따른 피키아 시페라이 변이 균주는 스핑고이드 염기 및 스핑고지질을 제조하는데 사용될 수 있고, 바람직하게는 테트라아세틸피토스핑고신(TAPS)의 생산 수율을 향상시키는데 적합하나 이에 한정되지 않는다.
이하에서 본 발명에 따른 피키아 시페라이 변이 균주를 사용하여 스핑고이드 염기 및 스핑고지질을 제조하는 방법을 구체적으로 설명한다.
a) 일실시예 따라 유전자 변형된 변이 균주를, 탄소원을 포함하는 배지와 접촉시키는 단계;
b) 균주가 상기 탄소원으로부터 스핑고이드 염기 및 스핑고지질을 생성할 수 있게 해주는 조건하에서 균주를 배양하는 단계; 및
c) 임의로, 생성된 스핑고이드 염기 및 스핑고지질을 단리하는 단계를 포함한다.
이하에서 본 발명에 따른 피키아 시페라이 변이 균주를 사용하여 스핑고이드 염기 및 스핑고지질을 제조하는 추가적인 방법을 구체적으로 설명한다.
a) 일실시예 따라 유전자가 변형된 변이균주를, 탄소원 및 지방산 메틸 에스터(FAME)를 포함하는 배지와 접촉시키는 단계;
b) 변이 균주가 상기 탄소원으로부터 스핑고이드 염기 및 스핑고지질을 생성할 수 있게 해주는 조건하에서 변이 균주를 배양하는 단계; 및
c) 임의로, 생성된 스핑고이드 염기 및 스핑고지질을 단리하는 단계를 포함한다.
상기 세포 배양 단계에서 사용될 수 있는 탄소원은 탄수화물, 예컨대 예를 들어 글루코스, 프룩토스, 글리세롤, 수크로스, 말토스, 당밀, 또는 그 밖의 알콜, 예컨대 예를 들어 에탄올, 및 유기산, 예컨대 예를 들어 아세테이트이다. 사용될 수 있는 질소원은 예를 들어 암모니아, 황산암모늄, 질산암모늄, 염화암모늄, 유기 질소 화합물(예컨대, 효모 추출물, 맥아 추출물, 펩톤, 옥수수침지액)이다. 무기 화합물, 예컨대 예를 들어 인산염, 마그네슘염, 칼륨염, 아연염, 철염 등이 또한 사용될 수 있다.
본 발명의 피키아 시페라이 균주에 대한 적합한 배양 조건은 예를 들어 국제공개특허 제2007-131720호 또는 한국등록특허 제10-0221357호로부터 당업자에게 공지되어 있다.
이하, 본 발명을 실시예에 의해 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다. 발명의 용도 범위는 전체의 상세한 설명과 특허청구범위에 따른다.
<실시예>
<실시예 1> 영양요구성 유전자 결실 카세트 구축
별도의 명시가 없는 한 이후의 카세트의 구축은 대장균 플라스미드 클로닝에 의해 구축되었다. 유전자의 결실은 고전적인 상동성 재조합과 이중 카세트 활용에 의해 DNA를 치환하여 실행하였다(Yeast, 1996. 12(14): 1439-1457).
본 발명자들은 효율적인 마커 유전자의 활용을 위해 영양요구성 유전자 PcURA3를 먼저 발굴하여 결실하였으며, 이후 PcPOX3, PcLCB4 유전자의 결실(실시예2)에 대한 마커로 활용하였다.
구체적으로, 플라스미드 pGEM-T-easy(Promega) 벡터를 운반 벡터로 사용하여 PcURA3 결실 카세트를 구축했다. pGEM-T-easy 벡터를 제한효소 SpeI과 SacI을 사용해 절단했으며 그에 따라 생성된 2.97 kb의 DNA 절편을 후속 클로닝을 위한 골격으로 사용하였다.
PCR 증폭에 의하여 피키아 시페라이 야생형 세포 게놈에서 분리한 GAPDH 유전자(서열번호 1) 5' 말단의 600bp서열과 DNA 합성한 항생제 nourseothricin 저항성 유전자 PcNAT1(서열번호 2)를 증폭했다.
제한효소 SpeI과 NdeI을 사용해 PcGAPDH 유전자(서열번호 1)의 5' 말단(P-GAP1)을 절단하고, SacI과 NdeI을 사용해 PcNAT1 유전자(서열번호 2)를 절단한 두 DNA 절편을 사전에 절단한 pGEM-T-easy 벡터 절편과 T4 DNA 접합효소(TAKARA) 처리를 통해 연결했다.
벡터상에서 연결된 GAPDH 말단을 제한효소 SpeI과 EcoRI을 사용해 절단했으며 그에 따라 생성된 4.147 kb의 DNA 절편을 후속 클로닝을 위한 골격으로 사용하였다.
PCR 증폭에 의하여 피키아 시페라이 야생형 세포 게놈에서 분리한 PcTEF1 유전자 3' 말단의 150bp서열 T-PcTEF를 증폭했다(서열번호 27).
제한효소 SpeI과 EcoRI을 사용해 T-PcTEF를 절단하고, 사전에 절단한 pGEM-T-easy 벡터 GAPDH 말단과 T4 DNA 접합효소(TAKARA) 처리를 통해 연결했다.
벡터상에서 연결된 GAPDH 말단(도 1, P-GAP1), PcNAT1 유전자와 PcTEF 말단(도1, T-PcTEF) DNA 1335bp, 피키아 시페라이 야생형 세포 게놈에서 분리한 PcURA3 유전자(서열번호 3)의 5' 말단 1171 bp, 3' 말단 548 bp를 PCR 증폭했다. 이 때 PcGAPDH 말단과 PcURA3 유전자의 5' 말단, PcTEF 유전자 말단과 PcURA3 유전자 3' 말단이 22bp, 25bp 중첩되도록 했다.
PcNAT1 유전자의 개시코돈으로부터 324bp에 위치하는 프라이머 NAT1_MB(cacctgaatcaggatattcttctaatacctgg, 서열번호 9)와 PcURA3 유전자(서열번호 3) 5' 말단 1171bp에 위치하는 PcURA3_5D1F(tgagaaacgtggcaatggatcattg, 서열번호 10)를 사용해 도 1의 카세트 1을 PCR 증폭했다.
PcNAT1 유전자의 개시코돈에 위치하는 프라이머 NAT1_1F(atgggtaaggaaaagactcacgttt, 서열번호 11)와 PcURA3 유전자 3' 말단 548bp에 위치하는 프라이머 PcURA3_3D2B(ttgtcactcttgaatggcatctactg, 서열 12)를 사용해 도 1의 카세트 2를 PCR 증폭했다.
서술된 모든 프라이머는 5'에서 3' 방향으로 표기되었다.
실시예 1의 방법으로 제조된 결실 카세트(서열번호 4)를 피키아 시페라이 균주에 형질전환으로 도입해 PcURA3 유전자(서열번호 3)를 결실하였으며, 삽입된 카세트는 PCR과 DNA서열 분석을 통해 확인했다(도 1)
<실시예 2> 지방산 및 스핑고지질 대사 관련 유전자 결실 카세트의 구축
기본적인 카세트 벡터의 구축 원리는 영양요구성 유전자 결실 카세트의 구축과 동일하다.
본 실시예에서 결실 카세트를 구축하고자 하는 타겟 유전자는 PcPOX3, PcLCB4, 또는 PcPOX3 및 PcLCB4 동시 결실이다. 플라스미드 pGEM-T-easy(Promega)을 운반벡터로 사용하여 결실 카세트를 구축했다. pGEM-T-easy(Promega) 벡터를 제한효소 NotI과 SpeI을 사용해 절단했으며 그에 따라 생성된 3.73 kb의 DNA 절편을 후속 클로닝을 위한 골격으로 사용하였다.
피키아 시페라이 야생형 게놈을 주형으로 PcURA3 유전자 ORF의 5' 말단 359bp에서부터 3' 말단 387bp를 앞서 서술한 pGEM-T-easy 벡터 절편 SpeI 절단 단면과 30bp 중첩되도록 PCR 증폭했다.
피키아 시페라이 야생형 게놈을 주형으로 PcURA3 유전자 3' 말단 387bp를 5' 말단은 앞서 서술한 pGEM-T-easy 벡터 절편 NotI 절단 단면과 30bp 중첩되고 3' 말단은 URA3 유전자의 5' 말단 329bp에서부터 359bp까지 30bp 중첩되도록 PCR 증폭했다.
앞서 PCR 증폭한 두 DNA 절편과 절단한 pGEM-T-easy 벡터 절편을 infusion cloning(TAKARA)를 통해 PcURA3 유전자 양 말단에 반복서열이 존재하도록 만들었다.
결실하고자 하는 타겟 유전자의 5' 말단 부위와 3' 말단 부위(표 1)를 각각 PCR 증폭하고, 이 때 융합하고자 하는 마커 유전자의 반복서열과 30-35bp 중첩하도록 프라이머 5' 말단을 연장해 사용했다(표 1).
결실 유전자의 해당 프라이머 서열 리스트
유전자명 결실 타겟 유전자 해당 프라이머 서열
N1 N2 N3 N4 N5 N6
PcPOX3 gatgcatgctcgagcAGTATCAAATCAATTACTTATACACTTATGACTTTTATG
(서열번호 15)		 AGTATCAAATCAATTACTTATACACTTATGACTTTTATG
(서열번호 16)		 TATATTGTTGACCgcATAACCAGCTAATTTCACAATTTTTTTGAAAGCT
(서열번호 17)
cactggcggccgttaTTTCCATTACATCAGAAAACATTTCACAAT
(서열번호 18)		 ccgagctcggatccaATATTTCCTTAATATCCTTCTAACTTCTTCTTCA
(서열번호 19)		 ATATTTCCTTAATATCCTTCTAACTTCTTCTTCA
(서열번호 20)
PcLCB4 gatgcatgctcgagcAAACTTATTCTCTTGTTTGGAACAC
(서열번호 21)		 AAACTTATTCTCTTGTTTGGAACAC
(서열번호 22)		 TATATTGTTGACCgcTTCAAATCTTGAAGGACCTAACC
(서열번호 23)
cactggcggccgttaCGTATGGCACCAACTTTATTATC
(서열번호 24) 		ccgagctcggatccaGCAATTCTTGTTAAAGCAGCTC
(서열번호 25)		 GCAATTCTTGTTAAAGCAGCTC
(서열번호 26)
앞서 구축한 벡터를 NotI 제한효소 절단한 DNA 절편과 결실 타겟 유전자(도 1)의 프라이머 N1과 N3로 PCR 증폭한 5' 말단과 infusion cloning(TAKARA)을 통해 연결했다.
앞서 구축한 벡터에 SpeI 제한효소 절단한 DNA 절편과 결실 타겟 유전자의 프라이머 N4과 N5로 PCR 증폭한 3' 말단을 infusion cloning(TAKARA)을 통해 연결했다.
PcURA3 유전자 종결코돈으로부터 43bp 내부에 위치하는 프라이머 PcURA3R(GCTCTGTAACGTTCACCTTC, 서열 13)와 마커유전자 5' 말단에 삽입된 결실 타겟 말단 부위의 역방향 프라이머(N2)를 사용해 도 2의 카세트 1을 PCR 증폭했다
PcURA3 유전자의 개시코돈으로부터 150bp 유전자 내부에 결합하는 프라이머 PcURA3F(ATTAGGTCCATATATCTGTCTTGTC, 서열 14)와 마커 유전자 3' 말단에 삽입된 결실 타겟 말단 부위의 역방향 프라이머(N6)를 사용해 도 2의 카세트 2를 PCR 증폭했다.
서술된 모든 프라이머는 5'에서 3' 방향으로 표기되었다.
이 방법을 통해 PcPOX3 서열(서열번호 5, 서열번호 6), PcLCB4 서열(서열번호 7, 서열번호 8)을 갖는 특정 유전자 결실 카세트를 구축하였다.
실시예 2의 방법으로 제조된 유전자 결실 카세트(서열번호 5 내지 8)를 피키아 시페라이 균주에 형질전환으로 도입해 타겟 유전자를 결실하였으며, 삽입된 카세트는 PCR과 DNA 서열 분석을 통해 확인했다.
연속적인 유전자의 결실을 위하여 마커 유전자의 5' 및 3'의 말단에 삽입된 반복 서열의 재조합을 통해 마커 유전자가 도태된 피키아 시페라이 세포를 5'-플루오로오로틱산(5'-fluoroorotic acid)의 첨가에 의해 구축 후 PCR을 통해 확인했다.
<실시예 3> 형질전환체 선발
구축한 카세트를 온도 37℃ 조건에서 15분 열 충격(heat shock)을 가하여, 모균주인 DSCC 7-25, 및 이에서 유래한 균주에 형질전환하여, 타겟 유전자의 발현 여부를 PCR 증폭으로 확인하여 목적하는 형질전환체를 선발하였다.
<실시예 4> 형질전환체의 TAPS 생산
균주 피키아 시페라이 DSCC 7-25(기탁번호 KFCC-1093)에서 PcURA3 유전자 결실 변이 균주(BD 02), 상기 BD 02 균주에서 PcLCB4 유전자 결실 변이 균주(KD 02), BD 02 균주에서 PcPOX3 유전자 결실 변이 균주(KD 04), 및 BD 02 균주에서 PcLCB4 및 PcPOX3 유전자 동시 결실 변이 균주(KD 08)를 각각(표 2) YGM　최적배지(글리세롤　100g/ℓ,　효모 추출물　2g/ℓ, KNO3 3g/ℓ, (NH4)2SO4 0.5g/ℓ, MgSO4·7H2O 0.3g/ℓ, NaCl 0.5g/ℓ, CSL(corn steep liquor) 3g/ℓ, LS-300(anti-forming agent) 1g/ℓ) 50㎖에 접종하여 25℃에서 5일간 220rpm으로 배양한 후 메탄올을 4 부피로 첨가하여 상온에서 1시간 반응한 다음, 원심분리한 상등액의 TAPS를 분석하였다.
TAPS는 UV 200 ㎚를 이용하여 HPLC로 분석하였다. 용매로 메탄올과 물 및 TFA (trifluoroacetic acid)의 84.5:18.45:0.05 혼합액을 사용하였다.
각 변이균주의 특징
균주 명칭 특징
BD 02 피키아 시페라이 DSCC 7-25(기탁번호 KFCC-10937)에서 PcURA3 유전자 결실
KD 02 BD 02 균주에서 PcLCB4 유전자 결실
KD 04 BD 02 균주에서 PcPOX3 유전자 결실
KD 08 BD 02 균주에서 PcPOX3 및 PcLCB4 유전자 동시 결실
아래 표 3 및 도 3에 나타난 바와 같이 YGM 최적 배지를 사용한 경우, BD 02에 대한 PcLCB4 유전자 결실 변이균주(KD 02) 및 PcPOX3 유전자 결실 변이균주 (KD 04)에서의 TAPS 특이수율은 각각 1.9배, 1.7배 증가했다.
또한, BD 02에 대한 PcLCB4 및 PcPOX3 유전자 동시 결실 변이균주(KD 08)의 경우 2.3배의 높은 TAPS 특이수율을 보였다.
각 균주 별 TAPS 생산량 분석 결과
　 BD 02 KD 02 KD 04 KD 08
TAPS (mg/L) 2460 3750 2800 3500
TAPS 특이수율 (mg/DCW) 10.9 20.85 18.53 24.72
상대적인 TAPS 특이수율(BD 02 기준) 1 1.9 1.7 2.3
<실시예 5> 지방산 메틸에스터 첨가 및 형질전환균주에서의 TAPS 생산
BD 02 및 KD 04 형질변환 균주 각각을 YGM　최적배지 50㎖에 접종하여 25℃에서 3일간 220 rpm으로 배양한 후 지방산 첨가배지 (글리세롤　30g/ℓ,　효모 추출물　2g/ℓ, KNO3 3g/ℓ, (NH4)2SO4 0.5g/ℓ, MgSO4·7H2O 0.3g/ℓ, NaCl 0.5g/ℓ, CSL 3g/ℓ, LS-300 1g/ℓ, Lauric acid methyl ester 2.14 g/l, Tween 80 0.5%) 50㎖를 첨가해 25℃에서 4일간 220 rpm으로 배양했다.
메탄올을 4 부피로 첨가하여 상온에서 1시간동안 반응한 다음, 원심분리한 상등액의 TAPS를 분석하였다.
TAPS는 UV 200㎚를 이용하여 HPLC로 분석하였다. 용매로 메탄올과 물 및 TFA의 84.5:18.45:0.05 (w/w) 혼합액을 사용하였다.
표 4의 결과로부터 비교할 수 있는 바와 같이 지방산 메틸에스터를 첨가한 최적배지를 사용한 경우 BD 02에 대한 PcPOX3 결실변이균주 KD 04의 TAPS 생산량이 약 70% 증가했으며 특이수율은 100% 이상 증가했다.
각 균주별 TAPS 생산량 분석 결과
BD 02 KD 04
TAPS (mg/L) 2240 3774
TAPS 특이수율(mg/DCW) 14.1 29
상대적인 TAPS 특이수욜(BD 02 기준) 1 2.1

Claims (13)

  1. 야생형 피키아 시페라이(Pichia ciferrii) 균주에서 팔미토일-CoA(palmitoyl Co-A)의 베타 산화(β-oxidation)의 차단 기전에 의해 세포 내 팔미토일-CoA 축적에 의해 스핑고리피드 대사산물을 과발현할 수 있도록 유전자 조작된 피키아 시페라이 (Pichia ciferrii) 변이 균주.
  2. 제1항에 있어서,
    상기 조작된 유전자는 PcPOX3 유전자(서열번호 28)인 피키아 시페라이 변이 균주.
  3. 제2항에 있어서,
    상기 유전자는 발현이 억제된 것인 피키아 시페라이 변이 균주.
  4. 제3항에 있어서,
    상기 유전자의 발현 억제 방법은 각 유전자의 일부 또는 전체 결실, 외래 DNA 삽입, 유전자 일부의 외래 유전자에 의한 치환, RNA 간섭, 유전자의 돌연변이 유도 또는 이들의 조합에 의한 것인 피키아 시페라이 변이 균주.
  5. 제4항에 있어서,
    상기 유전자의 발현 억제 방법은 각 유전자의 일부 또는 전체 결실에 의한 것인, 피키아 시페라이 변이 균주.
  6. 제5항에 있어서,
    추가적으로 PcLCB4 유전자(서열번호 29)의 발현이 억제된, 피키아 시페라이 변이 균주.
  7. 제1항 내지 제6항 중 어느 한 항에 있어서,
    상기 피키아 시페라이 세포의 야생형은 피키아 시페라이 DSCC 7-25(기탁번호 KFCC-10937) 균주인 피키아 시페라이변이 균주.
  8. 제1항 내지 제6항 중 어느 한 항의 피키아 시페라이 변이 균주를,
    (a) 탄소원을 포함하는 배지에 배양하는 단계; 및
    (b) 배양된 균주 내에 축적된 TAPS를 수득하는 단계; 를 포함하는,
    TAPS 생산방법.
  9. 제1항 내지 제6항 중 어느 한 항의 피키아 시페라이 변이 균주를,
    (a) FAME(Fatty acid methyl ester)을 포함하는 배지에 배양하는 단계; 및
    (b) 배양된 균주 내에 축적된 TAPS를 수득하는 단계; 를 포함하는,
    TAPS 생산방법.
  10. 제9항에 있어서,
    상기 FAME은 C12:0인 메틸 라우레이트(Methyl laurate)인, TAPS 생산방법.
  11. 제7항의 피키아 시페라이 변이 균주를,
    (a) 탄소원을 포함하는 배지에 배양하는 단계;
    (b) 배양된 세포 내에 축적된 TAPS를 수득하는 단계; 를 포함하는,
    TAPS 생산방법.
  12. 제7항의 피키아 시페라이 변이 균주를,
    (a) FAME(Fatty acid methyl ester)을 포함하는 배지에 배양하는 단계;
    (b) 배양된 세포 내에 축적된 TAPS를 수득하는 단계를 포함하는,
    TAPS 생산방법.
  13. 제12항에 있어서,
    상기 FAME은 C12:0인 메틸 라우레이트(Methyl laurate)인, TAPS 생산방법.
PCT/KR2021/007298 2020-06-23 2021-06-10 스핑고지질 및 스핑고이드 염기의 생산성이 향상된 피키아 시페라이 변이 균주 및 이의 제조방법 WO2021261816A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN202180057358.6A CN116157518A (zh) 2020-06-23 2021-06-10 具有改善的鞘脂及鞘氨醇类碱生产力的雪氏毕赤酵母突变株及其制备方法
EP21828118.6A EP4170038A4 (en) 2020-06-23 2021-06-10 MUTANT STRAIN OF PICHIA CIFERRII HAVING IMPROVED PRODUCTIVITY OF SPHINGOLIPID AND SPHINGOID BASE AND PREPARATION METHOD THEREFOR
US18/003,025 US20230242951A1 (en) 2020-06-23 2021-06-10 Pichia ciferrii mutant strain having improved sphingolipid and sphingoid base productivity, and preparation method therefor

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200076795A KR102343479B1 (ko) 2020-06-23 2020-06-23 스핑고지질 및 스핑고이드 염기의 생산성이 향상된 피키아 시페라이 변이 균주 및 이의 제조방법
KR10-2020-0076795 2020-06-23

Publications (1)

Publication Number Publication Date
WO2021261816A1 true WO2021261816A1 (ko) 2021-12-30

Family

ID=79176967

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/007298 WO2021261816A1 (ko) 2020-06-23 2021-06-10 스핑고지질 및 스핑고이드 염기의 생산성이 향상된 피키아 시페라이 변이 균주 및 이의 제조방법

Country Status (5)

Country Link
US (1) US20230242951A1 (ko)
EP (1) EP4170038A4 (ko)
KR (1) KR102343479B1 (ko)
CN (1) CN116157518A (ko)
WO (1) WO2021261816A1 (ko)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240032256A (ko) * 2022-09-01 2024-03-12 고려대학교 산학협력단 TAPS 생산능이 증진된 위커해모아이시스 시페라이(Wickerhammyces ciferrii) 돌연변이 균주 및 이를 이용한 TAPS 생산방법
KR102540378B1 (ko) * 2022-12-30 2023-06-08 솔루스바이오텍 주식회사 Taps 생산능이 향상된 위커하모마이세스 시페라이 균주, 및 그를 이용한 목적 물질을 생산하는 방법
CN117947119A (zh) * 2024-01-29 2024-04-30 重庆智合生物医药有限公司 一种四乙酰植物鞘氨醇和三乙酰二氢鞘氨醇混合物的发酵方法

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100188857B1 (ko) 1996-12-19 1999-06-01 백운화 스핑고리피드의 발효생산성이 우수한 신규한 효모균주 피키아 시페라이 dscc 7-25의 분리 방법
KR100221357B1 (ko) 1996-12-19 1999-10-01 유병택 신규 효모균주 피키아 시페라이 dscc 7-25의 발효 최적화를 통한 고효율 스핑고리피드의 제조방법
WO2007131720A1 (en) 2006-05-11 2007-11-22 Cosmoferm B.V. Improved production of sphingoid bases using genetically engineered microbial strains
US20150353966A1 (en) * 2012-12-19 2015-12-10 Verdezyne, Inc. Biological methods for preparing a fatty dicarboxylic acid
JP2018519843A (ja) * 2015-07-22 2018-07-26 イー・アイ・デュポン・ドウ・ヌムール・アンド・カンパニーＥ．Ｉ．Ｄｕ Ｐｏｎｔ Ｄｅ Ｎｅｍｏｕｒｓ Ａｎｄ Ｃｏｍｐａｎｙ 生物を用いる長鎖ジカルボン酸の高レベルの生産
KR102056651B1 (ko) 2011-08-18 2019-12-17 에보니크 오퍼레이션즈 게엠베하 피키아 시페리이 세포 및 그의 용도
KR20200076795A (ko) 2018-12-19 2020-06-30 주식회사 포스코 버링성이 우수한 고강도 냉연강판 및 합금화 용융아연도금강판

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100188857B1 (ko) 1996-12-19 1999-06-01 백운화 스핑고리피드의 발효생산성이 우수한 신규한 효모균주 피키아 시페라이 dscc 7-25의 분리 방법
KR100221357B1 (ko) 1996-12-19 1999-10-01 유병택 신규 효모균주 피키아 시페라이 dscc 7-25의 발효 최적화를 통한 고효율 스핑고리피드의 제조방법
WO2007131720A1 (en) 2006-05-11 2007-11-22 Cosmoferm B.V. Improved production of sphingoid bases using genetically engineered microbial strains
KR102056651B1 (ko) 2011-08-18 2019-12-17 에보니크 오퍼레이션즈 게엠베하 피키아 시페리이 세포 및 그의 용도
US20150353966A1 (en) * 2012-12-19 2015-12-10 Verdezyne, Inc. Biological methods for preparing a fatty dicarboxylic acid
JP2018519843A (ja) * 2015-07-22 2018-07-26 イー・アイ・デュポン・ドウ・ヌムール・アンド・カンパニーＥ．Ｉ．Ｄｕ Ｐｏｎｔ Ｄｅ Ｎｅｍｏｕｒｓ Ａｎｄ Ｃｏｍｐａｎｙ 生物を用いる長鎖ジカルボン酸の高レベルの生産
KR20200076795A (ko) 2018-12-19 2020-06-30 주식회사 포스코 버링성이 우수한 고강도 냉연강판 및 합금화 용융아연도금강판

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
APPLIED MICROBIOLOGY, vol. 10, no. 5, 1962, pages 401
BIOCHIMICA ET BIOPHYSICA ACTA (BBA) -LIPIDS AND LIPID METABOLISM, vol. 306, no. 2, 1973, pages 341 - 345
BIOCHIMICA ET BIOPHYSICA ACTA(BBA) -LIPIDS AND LIPID METABOLISM, vol. 306, no. 2, 1973, pages 341 - 345
CHRISTOPH SCHORSCH, TIM KÖHLER, HEIKO ANDREA, ECKHARD BOLES: "High-level production of tetraacetyl phytosphingosine (TAPS) by combined genetic engineering of sphingoid base biosynthesis and L-serine availability in the non-conventional yeast Pichia ciferrii", METABOLIC ENGINEERING, vol. 14, no. 2, 1 March 2012 (2012-03-01), pages 172 - 184, XP055038100, ISSN: 10967176, DOI: 10.1016/j.ymben.2011.12.002 *
CURRENT ORGANIC CHEMISTRY, vol. 14, no. 20, 2010, pages 2483 - 2521
EUKARYOTIC CELL, vol. 11, no. 12, 2012, pages 1582
JOURNAL OF BACTERIOLOGY, vol. 80, no. 4, 1960, pages 484 - 491
KLUG LISA, DAUM GÜNTHER: "Yeast lipid metabolism at a glance", FEMS YEAST RESEARCH, vol. 14, no. 3, 1 May 2014 (2014-05-01), GB, NL , pages 369 - 388, XP055882732, ISSN: 1567-1356, DOI: 10.1111/1567-1364.12141 *
LEE HEESEOK, HAN CHANGPYO, LEE HYEOK-WON, PARK GYUYEON, JEON WOOYOUNG, AHN JUNGOH, LEE HONGWEON: "Development of a promising microbial platform for the production of dicarboxylic acids from biorenewable resources", BIOTECHNOLOGY FOR BIOFUELS, vol. 11, no. 1, 1 December 2018 (2018-12-01), pages 1 - 14, XP055800830, DOI: 10.1186/s13068-018-1310-x *
SCIENCE, vol. 292, no. 5516, 2001, pages 504
See also references of EP4170038A4
YEAST, vol. 12, no. 14, 1996, pages 1439 - 1457

Also Published As

Publication number Publication date
CN116157518A (zh) 2023-05-23
US20230242951A1 (en) 2023-08-03
EP4170038A4 (en) 2024-06-26
KR102343479B1 (ko) 2021-12-27
EP4170038A1 (en) 2023-04-26

Similar Documents

Publication Publication Date Title
WO2021261816A1 (ko) 스핑고지질 및 스핑고이드 염기의 생산성이 향상된 피키아 시페라이 변이 균주 및 이의 제조방법
WO2018043856A1 (ko) 신규 프로모터 및 이의 용도
EP0931833B1 (en) Method of producing L-serine by fermentation
EP0943687B1 (en) Method of producing L-serine by fermentation
EP1792975B1 (en) Microorganism of the genus Corynebacterium having enhanced L-lysine productivity and method of producing L-lysine using said microorganism
Dubnau et al. Mycobacterium bovis BCG genes involved in the biosynthesis of cyclopropyl keto‐and hydroxy‐mycolic acids
WO2014142463A1 (ko) L-발린 생산능이 향상된 균주 및 이를 이용한 l-발린 생산방법
WO2016024771A1 (ko) O-포스포세린 생산 미생물 및 이를 이용한 o-포스포세린 또는 l-시스테인 생산 방법
WO2019190193A1 (ko) 글라이신 생산능이 증가된 미생물 및 이를 이용한 발효 조성물 생산 방법
WO2012077994A2 (ko) 오르니틴 생산능이 향상된 미생물 및 이를 이용하여 오르니틴을 생산하는 방법
WO2022240071A1 (ko) 카르노신, 히스티딘, 베타알라닌 생산용 재조합 미생물 및 이를 이용한 카르노신, 히스티딘, 베타알라닌의 생산방법
WO2015064917A1 (ko) Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 ｌ-라이신 생산방법
KR20070091134A (ko) 스핑고이드 염기 또는 그 유도체를 생산하는 미생물 균주
WO2024144132A1 (en) Wickerhamomyces ciferrii strain having enhanced taps productivity and method of producing desired substance using same
EP3119875B1 (en) Microorganisms producing l-amino acids and process for producing l-amino acids using the same
WO2022005225A1 (ko) 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도
EP1368480B1 (de) Verfahren zur veränderung des genoms von gram-positiven bakterien mit einem neuen konditional negativ dominanten markergen
WO2022004953A1 (ko) 아세토인 생산능을 갖는 유전적으로 조작된 효모 및 이를 이용한 아세토인 생산방법
WO2021125494A1 (ko) 다중약물 유출펌프 변이체, 상기 변이체를 코딩하는 폴리뉴클레오티드, 상기 변이체를 포함하는 미생물, 및 이를 이용하여 비올라세인 또는 디옥시비올라세인을 제조하는 방법
KR102303662B1 (ko) 화합물을 생산하는 미생물 및 이를 이용한 화합물의 생산 방법
WO2019124932A2 (ko) L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법
KR100267668B1 (ko) 피치아 시페리 유래의 세린 팔미토일 트랜스퍼라제를 코딩하는유전자 및 이를 이용한 taps 생산방법
WO2017065457A1 (ko) L-쓰레오닌 생산능을 가지는 미생물 및 그를 이용하여 l-쓰레오닌을 생산하는 방법
WO2022191358A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
KR100287483B1 (ko) 피치아 시페리 유래의 글리세르알데히드-3-인산 탈수소효소 프로모터 유전자 및 이를 이용한 taps 생산방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21828118

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021828118

Country of ref document: EP

Effective date: 20230123