WO2021251656A1 - 엑소좀 유래 miRNA를 이용한 스트레스 진단기술 - Google Patents

엑소좀 유래 miRNA를 이용한 스트레스 진단기술 Download PDF

Info

Publication number
WO2021251656A1
WO2021251656A1 PCT/KR2021/006555 KR2021006555W WO2021251656A1 WO 2021251656 A1 WO2021251656 A1 WO 2021251656A1 KR 2021006555 W KR2021006555 W KR 2021006555W WO 2021251656 A1 WO2021251656 A1 WO 2021251656A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
mir
stress
exosome
derived
Prior art date
Application number
PCT/KR2021/006555
Other languages
English (en)
French (fr)
Inventor
우정민
성민경
서민수
강경구
성수은
최주희
이시준
김길수
Original Assignee
재단법인 대구경북첨단의료산업진흥재단
경북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 재단법인 대구경북첨단의료산업진흥재단, 경북대학교 산학협력단 filed Critical 재단법인 대구경북첨단의료산업진흥재단
Publication of WO2021251656A1 publication Critical patent/WO2021251656A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to a composition for diagnosing stress using the fact that the expression pattern of exosome-derived miRNA changes under stress.
  • stress refers to a non-specific biological response occurring in the body to various injuries or stimuli applied to the living body.
  • Response to external temporary stress may be a natural phenomenon, but if the response to stress persists for a long time, mental or physical damage may occur.
  • stress is not always perceptible to the subject to which the stress is applied, and in the case of animals, it is sometimes difficult to recognize that they are in a state of stress.
  • exosomes are small extracellular vesicles with a diameter of about 200 nm or less that are formed inside the cell and secreted out of the cell through multivesicles. Exosomes, which contain protein and genetic information of parental cells, have recently been suggested to be useful as biomarkers for various diseases.
  • It is an object of the present invention to provide a composition for diagnosing stress comprising an agent for measuring the expression level of a specific miRNA derived from an exosome.
  • Another object of the present invention is to provide a kit for diagnosing stress comprising the composition.
  • Another object of the present invention is to provide an information providing method for diagnosing stress, comprising comparing the expression level of a specific miRNA derived from an axosome of an individual with the expression level of the corresponding miRNA derived from an exosome of a control group.
  • the present invention provides let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c- 5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p, miR-98-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c-5p, miR- It provides a composition for diagnosing stress, comprising an agent for measuring the expression level of one or more exosome-derived miRNAs selected from the group consisting of 425-5p and miR-93-5p.
  • the exosome may be a nerve-derived exo.
  • the agent may include a primer or probe that specifically binds to the one or more exosome-derived miRNAs.
  • the present invention provides a kit for diagnosing stress comprising the composition.
  • the present invention comprises the steps of (a) isolating the exosomes from the biological sample of the individual; and
  • the biological sample may be blood.
  • the exosome may be a nerve-derived exo.
  • let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p let from the group consisting of -7c-5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p and miR-98-3p
  • the method may further include determining that the subject is in a stress state when the expression level of the selected one or more miRNAs is higher than that of the control group.
  • let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p of the subject in step (b) when the expression level of one or more miRNAs selected from the group consisting of miR-19b-3p, miR-24-3p, miR-30c-5p, miR-425-5p and miR-93-5p is low compared to the control group
  • the method may further include determining that the subject is in a state of stress.
  • the present invention confirmed miRNAs whose expression levels specifically change under stress conditions.
  • These miRNAs are stress disease-related biomarkers. It is expected that not only can it be used as a tool, but it will also be usefully used for product development related to stress diagnosis.
  • FIG. 1 schematically shows the contents of the experimental design for constructing an acute high-intensity stress animal model.
  • 2a and 2b show the secretion pattern of stress-related specific hormones (cortisol, corticosterone) in mice treated with stress over time.
  • Figure 3a is the result of confirming the expression patterns of GFAP, BDNF, Cox2 and TNF-alpha in the hippocampus of the brain on the 1st, 3rd and 7th day after acute high intensity stress induction by immunostaining technique.
  • Figure 3b confirms the change of specific protein expression in the hippocampus of acute high-intensity stress compared to the normal group.
  • Figure 4a confirms the specific surface antigen expression of the serum-derived exosomes by FACS.
  • Figure 4b confirms the specific surface antigen expression of the serum-derived exosomes by Western blot.
  • Figure 4c is an electron microscope observation results for the morphological confirmation of the serum-derived exosomes.
  • Figure 4d shows the DLS measurement results for confirming the size of the exosomes.
  • Figure 5a schematically shows a method of extracting the nerve-derived exosomes from the serum-derived exosomes.
  • Figure 5b is a result of confirming the expression of the nerve-specific markers CD171, TUJ1 and NSE in western to prove the neuron-derived exosome.
  • FIG. 6 shows the results of comparative analysis of miRNA expression patterns of nerve-derived exosomes in the acute high-intensity stress-induced group compared to the normal group through NGS.
  • the present invention is let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p, let-7d-3p, let -7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p, miR-98-3p, let-7d-5p, let-7g-5p, let-7i -5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c-5p, miR-425-5p and miR-93-5p
  • It provides a composition for diagnosing stress, comprising an agent for measuring the expression level of one or more exosome-derived miRNAs selected from the group consisting of.
  • miRNA refers to an approximately 22 nt untranslated RNA that acts as a post-transcriptional repressor through base binding with the 3' untranslated region (UTR) region of mRNA.
  • exosome miRNAs can be carried out by extracting exosomes from a sample and detecting exosome miRNAs in the extract. Detection of these exosomes miRNAs can be measured by hybridization and amplification reactions, but is not limited thereto and can be easily carried out using various techniques known in the art.
  • the base sequence of miRNA mentioned in the present invention is as follows.
  • miRNAs Base sequence (5' ⁇ 3') SEQ ID NO: let-7a-1-3p CUAUACAAUCUACUGUCUUUCC One let-7a-5p UGAGUAGUAGGUUGUAUAGUU 2 let-7b-3p CAUUACAACCUACUGCCUUCCC 3 let-7b-5p UGAGGUAGGUUGUGUGGUU 4 let-7c-2-3p CUAUACAAUCUACUGUCUUUCC 5 let-7c-5p UGAGUAGUAGGUUGUAUGGUU 6 let-7d-3p CUAUACGACCUGCUGCCUUUCU 7 let-7f-1-3p CUAUACAAUCUAUUGCCUUCC 8 let-7f-5p UGAGGUAGAUUGUAUAGUU 9 miR-126a-5p CAUUAUUACUUUUGGUACGCG 10 miR-3473 UCUAGGGCUGGAGAGAUGGCUA 11 miR-466b-3p AUACAUACACACAUACAC 12 miR-98-3p CUAUACAACUUACUA
  • the exosome may be a neuron-derived exosome.
  • the agent for measuring the expression level of exosomal miRNA of the present invention is exosomal miRNA and expression level, which is a marker whose expression level is reduced in a specimen of a biological sample under a stress state. It refers to a molecule that can be used for detection of the marker by checking the expression level of the exosome miRNA, which is a marker that is increased.
  • the agent may include a primer or probe that specifically binds to the one or more exosome-derived miRNAs.
  • the detection of a nucleic acid may be performed by an amplification reaction using one or more oligonucleotide primers hybridized to a nucleic acid molecule or a complement of the nucleic acid molecule.
  • detection of exosome miRNAs using primers can be performed by amplifying the gene sequence using an amplification method such as PCR and then confirming whether the gene is amplified by a method known in the art.
  • a primer is a nucleic acid sequence having a short free 3' hydroxyl group.
  • a short nucleic acid sequence capable of forming a base pair with a complementary template and serving as a starting point for template strand copying.
  • Primers can initiate DNA synthesis in the presence of reagents for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at appropriate buffers and temperatures.
  • the presence or absence of stress can be diagnosed by performing PCR amplification using the sense and antisense primers specifically binding to the one or more miRNAs to check the expression level.
  • the length of the sense and antisense primers can be modified based on what is known in the art.
  • the probe refers to a nucleic acid fragment, such as RNA or DNA, corresponding to several bases to several tens of bases as long and is labeled.
  • the probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like.
  • stress can be diagnosed by performing hybridization using one or more of the above miRNAs and complementary probes and checking the expression level. Selection of appropriate probes and hybridization conditions can be modified based on those known in the art.
  • primers or probes can be appropriately designed by those skilled in the art based on known sequences.
  • primers or probes can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods.
  • Such nucleic acid sequences may also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, encapsulation, substitution with one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoros. amidates, carbamates, etc.) or charged linkages (eg phosphorothioates, phosphorodithioates, etc.).
  • the expression level of miRNA can be measured according to a method commonly used in the art, for example, reverse transcriptase polymerase reaction (RT-PCR), competitive reverse transcriptase polymerase reaction (Competitive RT-PCR), real-time reverse transcriptase polymerase reaction (Real-time RT-PCR), RNase protection assay (RPA; RNase protection assay), Northern blotting (Northern blotting), or gene chip, and the like are included, but are not limited thereto.
  • RT-PCR reverse transcriptase polymerase reaction
  • Competitive RT-PCR competitive reverse transcriptase polymerase reaction
  • Real-time RT-PCR real-time reverse transcriptase polymerase reaction
  • RNase protection assay RNase protection assay
  • Northern blotting Northern blotting
  • gene chip and the like are included, but are not limited thereto.
  • the present invention provides a kit for diagnosing stress comprising the composition.
  • the kit may include not only an agent for measuring the expression level of the exosome miRNA, but also tools, reagents, etc. commonly used in the art that are used to be suitable for use as a stress diagnosis kit.
  • the tool or reagent examples include, but are not limited to, a suitable carrier, a labeling material capable of generating a detectable signal, chromophores, solubilizers, detergents, buffers, stabilizers, and the like.
  • the labeling material is an enzyme, it may include a substrate capable of measuring enzyme activity and a reaction terminator.
  • the carrier includes a soluble carrier and an insoluble carrier
  • an example of the soluble carrier is a physiologically acceptable buffer known in the art, for example, PBS
  • an example of the insoluble carrier is polystyrene, polyethylene, polypropylene, polyester, poly It may be acrylonitrile, fluororesin, crosslinked dextran, polysaccharide, polymer such as magnetic fine particles plated with metal in latex, other paper, glass, metal, agarose, and combinations thereof.
  • kit of the present invention includes the above-described composition as a component, redundant descriptions are omitted in order to avoid excessive complexity of the present specification.
  • the present invention comprises the steps of (a) isolating the exosomes from the biological sample of the individual; and
  • the “comparison with the expression level of the miRNA derived from the exosome of the control sample” refers to comparing the expression level of the same type of control miRNA with the specific miRNA derived from the exosome of the subject to be diagnosed.
  • the method may further include determining that the subject is in a stress state.
  • let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b of the subject in step (b) When the expression level of one or more miRNAs selected from the group consisting of -3p, miR-24-3p, miR-30c-5p, miR-425-5p, and miR-93-5p is low compared to the control group, the subject is stressed It may further include the step of determining the state.
  • the term "low expression” used while referring to the expression level of the exosome miRNA is a biomarker (exosome-derived miRNA in the present invention) indicating an abnormal process, disease, or other condition in an individual or a symptom thereof.
  • a biomarker exosome-derived miRNA in the present invention
  • high expression used while referring to the expression level of the exosomal miRNA in the present specification is when the biomarker indicates or is a symptom of an abnormal process, disease, or other condition within the subject, from a healthy or normal subject or a subject for comparison Refers to a value or level of a biomarker in a biological sample that is higher than a value or level range of a biomarker detected in the obtained biological sample.
  • biological sample refers to any sample obtained from an individual in which the expression of miRNA of the present invention can be detected.
  • the biological sample is any one selected from the group consisting of blood, saliva, biopsy, skin tissue, liquid culture, feces and urine, but is not particularly limited thereto.
  • it is blood, and it can be prepared by processing by a method commonly used in the art.
  • the exosome may be a nerve-derived exosome.
  • Example 1-1 laboratory animal
  • Example 1-2 Acute High Intensity Stress Model Protocol
  • Electromagnetic shock was used to induce acute high intensity stress.
  • the stress group was exposed to the paw shock test for 20 min (8 sec duration; 5 min interval, 4 total times), and animals were sacrificed on days 1, 3, and 7 from stress induction (Fig. 1). At this time, the animal was anesthetized with 3% isoflurane to minimize pain and blood was collected from the abdominal vein.
  • Brain samples were fixed in 10% neutral buffered formalin. After fixation, the tissue was dehydrated, removed and embedded in paraffin. Sections were cut from brain paraffin blocks to a thickness of 4 ⁇ m. And hematoxylin and eosin (H&E) staining was performed using a DAKO CoverStainer (Agilent, Santa Clara, California, USA).
  • IHC immunohistochemistry
  • Exosomes were isolated from serum using the exo-quick solution by modifying the manufacturer's instructions. After centrifugation to remove cell debris, 2 ml serum and 500 ⁇ l solution were mixed. After centrifugation of the mixture, the pellet was resuspended in 200 ⁇ l PBS.
  • Samples were then pelleted by mixing for 10 s and vortexing for 30 s, followed by centrifugation at 4500 x g for 10 min at 4 °C. The supernatant was transferred to a new tube and 15 ⁇ l Tris-HCl was added. Then 25 ⁇ l PBS was added.
  • Example 1-6 flow cytometry
  • exosomes isolated from serum were incubated with 10 ⁇ l of aldehyde/sulfate latex beads at room temperature for 15 minutes.
  • 500 ⁇ l PBS supplemented with 3% BSA was added, and then samples were incubated on a rotary mixer overnight.
  • Bead-bound exosomes were pelleted by centrifugation at 3000 x g for 10 min and washed with 500 ⁇ l PBS. The sample was then pelleted by centrifugation at 3000 x g for 10 min.
  • the supernatant was removed from the sample, and the pellet was resuspended in 50 ⁇ l of PBS containing anti-CD9, CD63 antibody (BioLegend, San Diego, CA, USA) for 1 h at room temperature. Then, the sample was pelleted by centrifugation at 3000 x g for 10 minutes, and the pellet was resuspended in 200 ⁇ l of PBS. Detection of exosome markers was performed using a flow cytometer Galios.
  • Exosomes isolated from serum were resuspended in cold distilled water.
  • the exosome suspension was loaded onto a Formbar carbon coated grid and fixed in 2% para-formaldehyde for 10 min, then the solution was removed and the sample dried.
  • the grid was observed by bioTEM.
  • the size of the isolated exosomes was measured using a Zeta Sizer Nano S.
  • the membrane was then blocked with TBS-T supplemented with 5% skim milk for 1.5 h at room temperature.
  • the membrane was then anti-CD9 (1:1000; NovusBio, USA), CD81 (1:1000; NovusBio, USA), TSG101 (1:1000; NovusBio, USA), CD171 (1:1000; Santa Cruz Biotechnology, Santa Cruz, CA, USA), TUJ1 (1:1000; Abcam, Cambridge, UK), and NSE (1:1000; Abcam, Cambridge, UK) were incubated with primary antibodies overnight at 4 °C.
  • the membrane was washed with TBS-T and incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (1:2000 dilution) at room temperature for 1 hour. After the reaction, the membrane was washed with TBS-T. Bands were identified with EzWestLumi plus using Image QuantTM LAS 4000 (GE Healthcare, UK).
  • 900 ⁇ l of sample was prepared by pooling neuronal-derived exosomes isolated from serum. Concentrations were determined using the PierceTM BCA Protein Assay Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. The concentrations of each sample were 2.25 mg/ml (control), 1.66 mg/ml (severe), as determined by BCA analysis.
  • Exosome mRNA isolation and library preparation were performed by Macrogen using the SMARTer smRNA-Seq kit according to the manufacturer's instructions. Then, miRNA sequencing was performed according to the HiSeq 2500 system instruction manual.
  • cortisol and corticosterone levels were measured in serum using ELISA. Blood was collected at 0 hr, 2 hr, 4 hr, 6 hr, 9 hr, 18 hr, 20 hr, 1 day (24 hr), 3 hr, 7 hr from induction to stress.
  • H&E staining and IHC were performed to analyze the change in the expression level of neuroinflammatory marker protein due to acute high-intensity stress.
  • H&E staining there was no significant difference in the hippocampus when comparing the control group and the group treated with high intensity stress on days 1, 3, and 7 of the stress treatment (FIG. 3a).
  • exosomes were confirmed using a transmission electron microscope (TEM). TEM images showed that exosomes isolated from serum were spherical bilayer membranes and ranged in diameter from 30-150 nm (Fig. 4c).
  • TEM images showed that exosomes isolated from serum were spherical bilayer membranes and ranged in diameter from 30-150 nm (Fig. 4c).
  • isolation of neuronal-derived exosomes was performed using an anti-L1 cell adhesion molecule (L1CAM, CD171) biotinylated antibody for immunoprecipitation. Then, the characteristics of the nerve-derived exosomes were analyzed by Western blotting (FIG. 5a).
  • L1CAM anti-L1 cell adhesion molecule
  • neural markers such as TUJ1 and NSE present in the neuronal exosomes were found in the neuronal exosomes (nEV) isolated from the serum, but were hardly identified in the total exosomes (tEV) (Fig. 5b).
  • NGS Next-generation sequencing
  • miRNAs are stress disease-related biomarkers. Not only can it be used as a tool, but it can also be usefully used for product development related to stress diagnosis.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 스트레스 하에서 엑소좀 유래 miRNA의 발현 양상이 변화한다는 점을 이용한 스트레스 진단용 조성물 등에 관한 것으로, 본 발명은 정상 동물 및 고강도 스트레스 처리 동물 모델의 신경 유래 엑소좀의 miRNA의 발현을 비교 평가한 결과 스트레스 상태에서 특이적으로 발현정도가 변화하는 miRNA를 확인하였는 바, 이러한 miRNA는 스트레스 질환 관련 바이오마커로 활용될 수 있을 뿐만 아니라 스트레스 진단에 관한 제품개발에도 유용하게 이용될 것으로 기대된다.

Description

엑소좀 유래 miRNA를 이용한 스트레스 진단기술
본 발명은 스트레스 하에서 엑소좀 유래 miRNA의 발현 양상이 변화한다는 점을 이용한 스트레스 진단용 조성물 등에 관한 것이다.
일반적으로 스트레스(Stress)란, 생체에 가해지는 여러 상해 또는 자극에 대하여 체내에서 일어나는 비특이적인 생물반응을 의미한다. 외부의 일시적인 스트레스에 대한 반응은 자연스런 현상일 수 있지만, 스트레스에 대한 반응이 오랫동안 지속될 경우에는 정신적 또는 신체적으로 손상을 입게 될 수 있다. 특히, 스트레스는 스트레스가 가해지는 대상이 언제나 자각할 수 있는 것은 아니고 동물의 경우 스트레스 상태에 있는 것을 인지하기 어려운 경우도 있으므로 스트레스 상태인지 객관적으로 진단할 수 있는 방법이 필요하다.
한편, 엑소좀은 세포 내부에서 형성되어 다중소낭체를 통해 세포 외부로 분비되는 직경 약 200 nm 이하의 작은 세포외소포체이다. 모세포의 단백질과 유전정보를 포함하고 있는 엑소좀은 최근 다양한 질환의 바이오마커로 활용 가능성이 제시되고 있다.
다만 엑소좀을 이용하여 스트레스를 진단하는 방법에 대한 기술은 아직 연구된 바 없어 이에 대한 심도 깊은 연구가 요구되고 있다.
본 발명의 목적은 엑소좀 유래 특정 miRNA의 발현 수준을 측정하는 제제를 포함하는 스트레스 진단용 조성물을 제공하는 것이다.
본 발명의 다른 목적은 상기 조성물을 포함하는 스트레스 진단용 키트를 제공하는 것이다.
본 발명의 또 다른 목적은 개체의 액소좀 유래 특정 miRNA의 발현 수준을 대조군의 엑소좀 유래 해당 miRNA의 발현 수준과 비교하는 단계를 포함하는, 스트레스 진단을 위한 정보제공 방법을 제공하는 것이다.
상기 본 발명의 목적을 달성하기 위해 본 발명은 let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p, miR-98-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c-5p, miR-425-5p 및 miR-93-5p로 이루어지는 군으로부터 선택된 1종 이상의 엑소좀 유래 miRNA의 발현 수준을 측정하는 제제를 포함하는, 스트레스 진단용 조성물을 제공한다.
본 발명의 일 구현예로 상기 엑소좀은 신경 유래 엑소좀 일 수 있다.
본 발명의 일 구현예로 상기 제제는 상기 하나 이상의 엑소좀 유래 miRNA에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 것일 수 있다.
또한, 본 발명은 상기 조성물을 포함하는 스트레스 진단용 키트를 제공한다.
또한, 본 발명은 (a) 개체의 생물학적 시료로부터 엑소좀을 분리하는 단계; 및
(b) 상기 (a)단계에서 분리된 엑소좀에서 유래한 let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p, miR-98-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c-5p, miR-425-5p 및 miR-93-5p로 이루어지는 군으로부터 선택된 1종 이상의 miRNA의 발현 수준을 대조군 시료의 해당 엑소좀 유래 miRNA의 발현 수준과 비교하는 단계를 포함하는, 스트레스 진단을 위한 정보제공 방법을 제공한다.
본 발명의 일 구현예로 상기 생물학적 시료는 혈액일 수 있다.
본 발명의 일 구현예로 상기 엑소좀은 신경 유래 엑소좀 일 수 있다.
본 발명의 일 구현예로 상기 (b)단계에서 개체의 let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p 및 miR-98-3p로 이루어지는 군으로부터 선택된 1종 이상의 miRNA의 발현 수준이 대조군에 비해 고발현인 경우 상기 개체는 스트레스 상태인 것으로 판정하는 단계를 더 포함할 수 있다.
본 발명의 일 구현예로 상기 (b)단계에서 개체의 let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c-5p, miR-425-5p 및 miR-93-5p로 이루어지는 군으로부터 선택된 1종 이상의 miRNA의 발현 수준이 대조군에 비해 저발현인 경우 상기 개체는 스트레스 상태인 것으로 판정하는 단계를 더 포함할 수 있다.
본 발명은 정상 동물 및 고강도 스트레스 처리 동물 모델의 신경 유래 엑소좀의 miRNA의 발현을 비교 평가한 결과 스트레스 상태에서 특이적으로 발현정도가 변화하는 miRNA를 확인하였는 바, 이러한 miRNA는 스트레스 질환 관련 바이오마커로 활용될 수 있을 뿐만 아니라 스트레스 진단에 관한 제품개발에도 유용하게 이용될 것으로 기대된다.
도 1은 급성 고강도 스트레스 동물 모델을 구축하기 위한 실험설계 내용을 개략적으로 나타낸 것이다.
도 2a 및 2b는 스트레스 처리한 마우스에서 스트레스 관련 특이 호르몬(코티솔, 코르티코스테론)의 분비 양상을 시간별로 나타낸 것이다.
도 3a는 급성 고강도 스트레스 유발 이후 1일, 3일 및 7일째에 뇌의 해마(hippocampus) 부위에 GFAP, BDNF, Cox2 및 TNF-alpha의 발현 양상을 면역염색기법으로 확인한 결과이다.
도 3b는 정상군 대비 급성 고강도 스트레스의 해마에서 특정 단백질 발현의 변화를 확인한 것이다.
도 4a는 혈청 유래 엑소좀의 특이적 표면항원 발현을 FACS 로 확인한 것이다.
도 4b는 혈청 유래 엑소좀의 특이적 표면항원 발현을 웨스턴 블롯으로 확인한 것이다.
도 4c는 혈청 유래 엑소좀의 형태학적 확인을 위한 전자현미경 관찰 결과이다.
도 4d는 엑소좀의 크기 확인을 위한 DLS 측정 결과를 나타낸 것이다.
도 5a는 혈청 유래 엑소좀에서 신경유래 엑소좀을 추출하는 방법을 개략적으로 나타낸 것이다.
도 5b는 신경 유래 엑소좀의 증명을 위하여 신경 특이마커인 CD171, TUJ1 및 NSE의 발현을 western으로 확인한 결과이다.
도 6은 정상군 대비 급성 고강도 스트레스 유발군에서 신경 유래 엑소좀의 miRNA 발현 양상을 NGS를 통하여 비교 분석한 결과를 나타낸 것이다.
본 발명은 let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p, miR-98-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c-5p, miR-425-5p 및 miR-93-5p로 이루어지는 군으로부터 선택된 1종 이상의 엑소좀 유래 miRNA의 발현 수준을 측정하는 제제를 포함하는, 스트레스 진단용 조성물을 제공한다.
본 발명에서 "miRNA(microRNA)"는, mRNA의 3' 비번역 영역(UTR) 부위와의 염기결합을 통해 전사후 억제자 역할을 하는 대략 22 nt의 비번역 RNA를 의미한다.
엑소좀 miRNAs의 검출은 통상적으로는 시료부터 엑소좀을 추출하여, 추출물 중의 엑소좀 miRNAs을 검출함으로써 실시할 수 있다. 이러한 엑소좀 miRNAs의 검출은 하이브리드화 반응 및 증폭반응에 의해 측정될 수 있으나, 이에 제한되지 않고 당업계에 공지된 다양한 기술을 이용하여 용이하게 실시될 수 있다.
한편 본 발명에서 언급되는 miRNA의 염기서열을 아래와 같다.
miRNAs 염기서열(5'→3') 서열번호
let-7a-1-3p CUAUACAAUCUACUGUCUUUCC 1
let-7a-5p UGAGGUAGUAGGUUGUAUAGUU 2
let-7b-3p CUAUACAACCUACUGCCUUCCC 3
let-7b-5p UGAGGUAGUAGGUUGUGUGGUU 4
let-7c-2-3p CUAUACAAUCUACUGUCUUUCC 5
let-7c-5p UGAGGUAGUAGGUUGUAUGGUU 6
let-7d-3p CUAUACGACCUGCUGCCUUUCU 7
let-7f-1-3p CUAUACAAUCUAUUGCCUUCC 8
let-7f-5p UGAGGUAGUAGAUUGUAUAGUU 9
miR-126a-5p CAUUAUUACUUUUGGUACGCG 10
miR-3473 UCUAGGGCUGGAGAGAUGGCUA 11
miR-466b-3p AUACAUACACACACACAUACAC 12
miR-98-3p CUAUACAACUUACUACUUUCC 13
let-7d-5p AGAGGUAGUAGGUUGCAUAGUU 14
let-7g-5p UGAGGUAGUAGUUUGUACAGUU 15
let-7i-5p UGAGGUAGUAGUUUGUGCUGUU 16
miR-140-3p UACCACAGGGUAGAACCACGG 17
miR-17-5p CAAAGUGCUUACAGUGCAGGUAG 18
miR-191a-5p CAACGGAAUCCCAAAAGCAGCUG 19
miR-19b-3p UGUGCAAAUCCAUGCAAAACUGA 20
miR-24-3p UGGCUCAGUUCAGCAGGAACAG 21
miR-30c-5p UGUAAACAUCCUACACUCUCAGC 22
miR-425-5p AAUGACACGAUCACUCCCGUUGA 23
miR-93-5p CAAAGUGCUGUUCGUGCAGGUAG 24
본 발명에서 상기 엑소좀은 신경 유래 엑소좀 일 수 있다.본 발명의 엑소좀 miRNA의 발현 수준을 측정하는 제제는 스트레스 상태에서 생물학적 시료의 검체에서 발현 수준이 감소되는 마커인 엑소좀 miRNA 및 발현 수준이 증가되는 마커인 엑소좀 miRNA의 발현 수준을 확인함으로써 마커의 검출에 사용될 수 있는 분자를 의미한다.
본 발명에서 상기 제제는 상기 하나 이상의 엑소좀 유래 miRNA에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 것일 수 있다.
즉, 핵산의 검출은 핵산 분자 또는 상기 핵산 분자의 상보물에 하이브리드화되는 하나 이상의 올리고뉴클레오타이드 프라이머를 사용하는 증폭반응에 의해 수행될 수 있다. 예컨대, 프라이머를 이용한 엑소좀 miRNAs의 검출은 PCR과 같은 증폭 방법을 사용하여 유전자 서열을 증폭한 다음 당 분야에 공지된 방법으로 유전자의 증폭 여부를 확인함으로써 수행될 수 있다.
프라이머는 짧은 자유 3말단 수산화기(free 3' hydroxyl group)를 갖는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍(base pair)을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 폴리머레이즈 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성이 개시될 수 있다. 본 발명에서는 상기 하나 이상의 miRNA에 특이적으로 결합하는 센스 및 안티센스 프라이머를 이용하여 PCR 증폭을 실시하여 발현 수준을 확인함으로써 스트레스 여부를 진단할 수 있다. PCR 조건, 센스 및 안티센스 프라이머의 길이는 당업계에 공지된 것을 기초로 변형할 수 있다.
프로브는 짧게는 수 염기 내지 길게는 수십 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하며 라벨링되어 있다. 프로브는 올리고뉴클로타이드(oligonucleotide) 프로브, 단쇄 DNA(single stranded DNA) 프로브, 이중쇄 DNA(double stranded DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있다. 본 발명에서는 위 하나 이상의 miRNA와 상보적인 프로브를 이용하여 혼성화를 실시하여 발현 수준을 확인함으로써 스트레스 여부를 진단할 수 있다. 적당한 프로브의 선택 및 혼성화 조건은 당업계에 공지된 것을 기초로 변형할 수 있다.
이러한 프라이머 또는 프로브는 공지된 서열을 바탕으로 당업자가 적절히 디자인할 수 있다.
예컨대, 프라이머 또는 프로브는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비-제한적인 예로는 메틸화, 캡화, 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다.
miRNA의 발현 수준은 당해 분야에서 통상 사용되는 방법에 따라 측정될 수 있는데, 예컨대 역전사효소 중합효소반응(RT-PCR), 경쟁적 역전사효소 중합효소반응(Competitive RT-PCR), 실시간 역전사효소 중합효소반응 (Real-time RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting) 또는 유전자 칩 등이 포함되며 이들로 제한되는 것은 아니다.
본 발명의 다른 양태로서 본 발명은 상기 조성물을 포함하는 스트레스 진단용 키트를 제공한다.
상기 키트에는 상기 엑소좀 miRNA의 발현 수준을 측정하는 제제뿐만 아니라, 스트레스 진단 키트로 사용되기에 적합하도록 사용되는 당 분야에서 일반적으로 사용되는 도구, 시약 등이 포함될 수 있다.
상기 도구 또는 시약의 일 예로, 적합한 담체, 검출 가능한 신호를 생성할 수 있는 표지 물질, 발색단(chromophores), 용해제, 세정제, 완충제, 안정화제 등이 포함되나 이에 제한되지 않는다. 표지물질이 효소인 경우에는 효소 활성을 측정할 수 있는 기질 및 반응 정지제를 포함할 수 있다. 담체는 가용성 담체, 불용성 담체가 있고, 가용성 담체의 일 예로 당 분야에서 공지된 생리학적으로 허용되는 완충액, 예를 들어 PBS가 있고, 불용성 담체의 일 예로 폴리스틸렌, 폴리에틸렌, 폴리프로필렌, 폴리에스테르, 폴리아크릴로니트릴, 불소 수지, 가교 덱스트란, 폴리사카라이드, 라텍스에 금속을 도금한 자성 미립자와 같은 고분자, 기타 종이, 유리, 금속, 아가로오스 및 이들의 조합일 수 있다.
본 발명의 키트는 상술한 조성물을 구성으로 포함하므로, 중복된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 (a) 개체의 생물학적 시료로부터 엑소좀을 분리하는 단계; 및
(b) 상기 (a)단계에서 분리된 엑소좀에서 유래한 let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p, miR-98-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c-5p, miR-425-5p 및 miR-93-5p로 이루어지는 군으로부터 선택된 1종 이상의 miRNA의 발현 수준을 대조군 시료의 해당 엑소좀 유래 miRNA의 발현 수준과 비교하는 단계를 포함하는, 스트레스 진단을 위한 정보제공 방법을 제공한다.
상기 “대조군 시료의 해당 엑소좀 유래 miRNA 발현 수준과 비교” 한다는 것은 진단의 대상인 개체의 엑소좀에서 유래한 특정 miRNA와 동일한 종류의 대조군 miRNA의 발현 정도를 비교한다는 것이다.
본 발명의 상기 (b)단계에서 개체의 let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p 및 miR-98-3p로 이루어지는 군으로부터 선택된 1종 이상의 miRNA의 발현 수준이 대조군에 비해 고발현인 경우 상기 개체는 스트레스 상태인 것으로 판정하는 단계를 더 포함할 수 있다.
본 발명의 상기 (b)단계에서 개체의 let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c-5p, miR-425-5p, miR-93-5p로 이루어지는 군으로부터 선택된 1종 이상의 miRNA의 발현 수준이 대조군에 비해 저발현인 경우 상기 개체는 스트레스 상태인 것으로 판정하는 단계를 더 포함할 수 있다.
본 발명에서 상기 엑소좀 miRNA의 발현 수준을 언급하면서 사용되는 용어 "저발현"은 바이오 마커(본 발명에서는 엑소좀 유래 miRNA)가 비정상 프로세스, 질환 혹은 개체 내 기타 병태를 나타내거나 이의 징후인 경우, 건강하거나 정상인 개체 또는 비교 대상인 개체로부터 획득된 생물학적 시료에서 검출되는 바이오 마커의 값 혹은 수준 범위 보다 낮은 생물학적 시료 내의 바이오 마커의 값 혹은 수준을 지칭한다.
본 명세서에서 상기 엑소좀 miRNA의 발현 수준을 언급하면서 사용되는 용어 "고발현"은 바이오 마커가 비정상 프로세스, 질환 혹은 개체 내 기타 병태를 나타내거나 이의 징후인 경우, 건강하거나 정상인 개체 또는 비교 대상인 개체로부터 획득된 생물학적 시료에서 검출되는 바이오 마커의 값 혹은 수준 범위 보다 높은 생물학적 시료 내의 바이오 마커의 값 혹은 수준을 지칭한다.
본 명세서에서 사용되는 용어 "생물학적 시료"란 본 발명의 miRNA 발현이 검출될 수 있는 개체로부터 얻어지는 모든 시료를 의미한다.
본 발명의 바람직한 구현예에 따르면, 상기 생물학적 시료는 혈액, 타액(saliva), 생검(biopsy), 피부 조직, 액체 배양물, 분변 및 소변으로 이루어진 군에서 선택된 어느 하나이며, 특별히 이에 제한되지 않으나 바람직하게는 혈액이며, 본 발명의 기술분야에서 통상적으로 사용되는 방법으로 처리하여 준비될 수 있다.
본 발명에서 상기 엑소좀은 신경 유래 엑소좀 일 수 있다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
<실시예: 1 재료 및 준비>
실시예 1-1. 실험동물
8 주령 수컷 Sprague-Dawley 래트에 온도, 습도 및 빛을 조절 하였다 (24 ± 2 °C, 50 ± 20 % 상대 습도, 12시간 명주기 / 12시간 암주기 (07:00에 불이 켜짐)). 동물들은 음식과 물에 자유롭게 접근할 수 있도록 하였으며, 모든 동물 실험 프로토콜은 한국 경기도 (KPC)의 기관 동물 관리 및 사용위원회 (KPC-IACUC; 승인 번호 P181112)에 의해 검토되고 승인되었으며, 지침에 따랐다.
실시예 1-2. 급성 고강도 스트레스 모델 프로토콜
전자 발충격을 사용하여 급성 고강도 스트레스를 유발시켰다. 스트레스 그룹을 20 분 동안 발충격 테스트에 노출시켰으며(8 초 지속; 5 분 간격, 총 4 회), 스트레스 유발로 부터 1 일, 3 일, 7 일에 동물을 희생시켰다(도 1). 이때, 동물을 3 % 이소플루란으로 마취하여 통증을 최소화하고 혈액을 복부 정맥에서 채취하였다.
실시예 1-3. ELISA 분석
혈액은 스트레스 유도로부터 0 시간, 2 시간, 4 시간, 6 시간, 9 시간, 18 시간, 20 시간, 1 일(24 시간), 3 일, 7 일에 수집되었다. 혈액으로부터 분리된 혈청은 ELISA를 이용하여 스트레스 관련 호르몬 수준을 측정하는데 사용되었다. 코티솔 및 코르티코스테론은 제조사의 지시에 따라 코티콜 ELISA 키트 및 코르티 코스테론 ELISA 키트 (Enzo Life Sciences, Ann Arbor, USA)를 사용하여 측정되었다.
실시예 1-4. 조직병리학
뇌 샘플을 10 % 중성 완충 포르말린에 고정시켰다. 고정 후, 조직을 탈수시키고, 제거하고, 파라핀에 포매시켰다. 뇌 파라핀 블록으로부터 섹션을 4 ㎛의 두께로 절단하였다. 그리고 헤마톡실린 및 에오신(H&E) 염색은 DAKO CoverStainer (Agilent, 미국 캘리포니아 산타 클라라 소재)를 사용하여 수행하였다.
신경 염증 마커 단백질의 발현을 확인하기 위해, 면역 조직 화학 (immunohistochemistry, IHC)을 수행하였다. 뇌 절편을 항-BDNF (Abcam, Cambridge, UK), COX-2 (Abcam, Cambridge, UK), GFAP (Abcam, Cambridge, UK), TNF-α (Abcam, Cambridge, UK) 1차 항체로 염색하고 제조자의 지시에 따라 라벨링된 중합체 DAKO EnVisionTM + System-HRP를 사용하였다. 염색 후, 뇌절편을 Pannoramic SCAN II로 스캔 하였다. 해마에서 신경염증 마커를 Imaged J 소프트웨어를 사용하여 정량화 하였다.
실시예 1-5. 엑소좀 및 신경 유래 엑소좀의 분리
엑소좀은 제조사의 지침을 수정하여 엑소-퀵솔루션을 사용하여 혈청으로부터 분리되었다. 세포 파편 제거를 위해 원심 분리한 후, 2 ml 혈청 및 500 μl 용액을 혼합하였다. 혼합물을 원심 분리한 후, 펠렛을 200 ㎕ PBS로 재현탁 시켰다.
신경 유래 엑소좀의 분리는 종래 언급된 방법(Mustapic, Maja, and et al)에 수정을 가하여 수행하였다. 혈청 200 ㎕로부터 분리된 엑소좀을 회전 혼합기에서 4 ℃에서 1시간 동안 anti-CD171 2㎕와 함께 인큐베이션 하였다. 15 μl PierceTM streptavidin plus UltralinkTM 수지 및 28μl PBS를 첨가한 후, 샘플을 회전 믹서에서 4 ℃로 1 시간 동안 배양하였다. 샘플을 4 ℃에서 10 분 동안 200 x g에서 원심 분리하여 펠렛화한 다음, 상청액을 샘플로부터 제거하고 상기 펠렛을 200 μl 0.1M 글리신-HCl에 재현탁 시켰다. 그 다음, 10초 동안 혼합하고 30초 동안 볼텍싱 한 후, 4 ℃에서 10 분 동안 4500 x g에서 원심 분리하여 샘플을 펠렛화 하였다. 상청액을 새로운 튜브로 옮기고 15 μl Tris-HCl을 첨가하였다. 이어서, 25 μl PBS를 첨가하였다.
실시예 1-6. 유세포 분석
혈청으로부터 분리된 50 ㎕ 엑소좀을 10 ㎕의 알데히드 / 설페이트 라텍스 비드와 함께 실온에서 15 분 동안 배양하였다. 3 % BSA 보충된 500 ㎕ PBS를 첨가한 다음, 샘플을 회전 혼합기에서 밤새 인큐베이션 하였다. 비드 결합 엑소좀을 3000 x g에서 10분 동안 원심 분리하여 펠렛화하고, 500 μl PBS로 세척하였다. 이어서, 3000 x g에서 10분 동안 원심 분리하여 샘플을 펠릿화 하였다. 상청액을 샘플로부터 제거하고, 펠렛을 anti-CD9, CD63 항체 (BioLegend, San Diego, CA, USA)를 함유하는 50 μl의 PBS로 1 시간 동안 실온에서 재현탁시켰다. 그 다음 3000 x g에서 10분 동안 원심 분리하여 샘플을 펠렛화 하였으며, 펠렛을 200 μl의 PBS로 재현탁 시켰다. 엑소좀 마커의 검출은 유세포 분석기 Galios를 사용하여 수행되었다.
실시예 1-7. 투과 전자 현미경 관찰
혈청으로부터 분리된 엑소좀을 차가운 증류수에 재현탁 시켰다. 엑소좀 현탁액을 포름바 탄소 코팅 그리드에 로딩하고 2% 파라 포름알데히드에 10분 동안 고정시킨 다음, 용액을 제거하고 샘플을 건조시켰다. 그리드는 bioTEM에 의해 관찰되었다.
실시예 1-8. 동적 광산란 관찰
Zeta Sizer Nano S를 사용하여 분리된 엑소좀의 크기를 측정하였다.
실시예 1-9. 웨스턴 블롯
웨스턴 블롯을 사용하여 엑소좀 마커 (CD9, CD81 및 TSG101), 신경 유래 엑소좀 마커 (CD171) 및 신경 마커 (TUJ1, NSE)를 확인하였다. M-PER 및 HaltTM 프로테아제 및 포스파타제 인히비터 칵테일 (Thermo Scientific)을 용해를 위해 혈청으로부터 분리된 각각의 총 엑소좀 (tEV) 및 신경 유래 엑소좀 (nEV)에 첨가하였다. 샘플 농도는 제조사의 지시에 따라 PierceTM BCA 단백질 분석 키트를 사용하여 측정하였다. 20 μg의 엑소좀 용해물을 BoltTM 4-12 % Bis-Tris Plus 겔에 로딩하고 polyvinylidene fluoride(PVDF) 막으로 옮겼다. 이어서, 막을 실온에서 1.5 시간 동안 5 % skim milk로 보충된 TBS-T로 차단하였다. 그 다음, 상기 막을 anti-CD9 (1:1000; NovusBio, USA), CD81 (1:1000; NovusBio, USA), TSG101 (1:1000; NovusBio, USA), CD171(1:1000; Santa Cruz Biotechnology, Santa Cruz, CA, USA), TUJ1 (1:1000; Abcam, Cambridge, UK), NSE (1:1000; Abcam, Cambridge, UK) 일차 항체와 함께 4 ℃에서 밤새 인큐베이션 하였다. 그 다음, 막을 TBS-T로 세척한 후, horseradish peroxidase (HRP)-접합된 이차 항체 (1 : 2000 희석)와 함께 실온에서 1 시간 동안 배양하였다. 반응 후, 막을 TBS-T로 세척하였다. 밴드는 Image QuantTM LAS 4000 (GE Healthcare, UK)을 사용하여 EzWestLumi plus로 확인하였다.
실시예 1-10. 엑소좀의 miRNA 분석을 위한 차세대 시퀀싱(Next generation sequencing (NGS))
혈청으로부터 분리된 신경 유래 엑소좀을 풀링하여 샘플 900 ㎕를 제조하였다. 제조업체의 지침에 따라 PierceTM BCA 단백질 분석 키트 (Thermo Fisher Scientific)를 사용하여 농도를 측정하였다. BCA 분석에 의해 측정된 바와 같이, 각 샘플의 농도는 2.25 mg / ml (control), 1.66 mg / ml (severe)이다.
엑소좀 mRNA 분리 및 라이브러리 준비는 제조사의 지시에 따라 SMARTer smRNA-Seq 키트를 사용하였으며 마크로젠에 의해 수행되었다. 그 다음 HiSeq 2500 시스템 사용 설명서에 따라 miRNA 시퀀싱을 수행하였다.
실시예 1-11. 통계 분석
모든 통계 분석은 Student 's t test를 사용하여 수행되었다. 통계적 유의성 값은 p <0.05로 설정되었다.
<실시예 2: 급성 고강도 스트레스 그룹에서 스트레스 호르몬 수치 확인>
급성 고강도 스트레스 유발 여부를 확인하기 위해 ELISA를 사용하여 혈청에서 코티솔 및 코르티코스테론 수준을 측정하였다. 혈액은 스트레스로 유도로부터 0 시간, 2 시간, 4 시간, 6 시간, 9 시간, 18 시간, 20 시간, 1 일 (24 시간), 3 일, 7 일에 수집되었다.
그 결과, 대조군과 비교하여 급성 고강도 스트레스 군에서, 코티솔 수준이 상당한 증가하였음을 확인하였다(표 2 및 도 2a).
시간 실험군 대조군 P 값
0 h 13.45±4.91 4.21±0.41 p=0.00099
2 h 8.82±2.45 4.36±0.85 p=0.0018
4 h 9.77±2.69 4.56±0.92 p=0.0012
6 h 7.36±1.83 4.99±0.85 p=0.016
9 h 9.67±2.25 5.4±1.33 p=0.0025
18 h 6.37±2.66 2.51±0.57 p=0.0060
20 h 11.24±4.39 4.71±1.29 p=0.0058
Day 1 10.08±4.42 3.37±0.65 p=0.0043
Day 3 5.91±1.45 3.9±1.27 p=0.029
Day 7 5.58±1.3 3.35±0.81 p=0.0051
코르티코스테론의 경우, 스트레스 노출로부터 0 시간 및 1 일째에 상당한 증가가 관찰되었고, 스트레스 유도로부터 6 시간에 현저한 감소가 확인되었다(표 3 및 도 2b).
시간 실험군 대조군 P 값
0 h 224.31±93.41 82.88±62.32 p=0.012
2 h 45.66±31.58 75.28±38.15 p=0.174
4 h 106.94±45.64 94.71±68.77 p=0.726
6 h 34.24±17.22 105.91±68.10 p=0.031
9 h 100.79±72.11 94.66±60.06 p=0.876
18 h 36.08±32.38 20.84±19.65 p=0.348
20 h 134.43±75.67 87.40±76.77 p=0.310
Day 1 119.58±80.09 19.73±13.38 p=0.013
Day 3 22.51±22.17 68.79±73.10 p=0.169
Day 7 85.69±76.35 65.22±35.14 p=0.564
상기 결과는 급성 고강도 스트레스 처리에 의해 마우스에 스트레스가 유발되었음을 의미한다.
<실시예 3: 급성 고강도 스트레스 그룹 해마에서 신경 염증 마커 수준의 병리학적 분석>
급성 고강도 스트레스에 의한 신경 염증 마커 단백질 발현 수준 변화를 분석하기 위해, H&E 염색 및 IHC를 수행하였다. H&E 염색 결과, 스트레스 처리 1일, 3일 및 7일에 대조군과 고강도 스트레스를 처리한 그룹 비교시 해마에서 유의미한 차이는 없었다(도 3a).
BDNF, COX-2, GFAP 및 TNF-α와 같은 신경 관련 염증 마커의 발현 수준을 확인하기 위해, IHC 염색을 수행한 후 정량화 하였다(도 3b). 그 결과 해마에서 BDNF 발현의 현저한 변화는 관찰되지 않았다(대조군 = 10.92 ± 2.21 %, 제 1 일 = 13.54 ± 4.59 %, p = 0.212; 제 3 일 = 6.60 ± 4.87 %, p = 0.117; 제 7 일 = 12.46 ± 1.43 %, p = 0.185). COX-2 발현 관련 유의미한 결과는 3 일 또는 7 일에 관찰되었다 (대조군 = 7.62 ± 0.71 %, 1 일 = 8.33 ± 1.34 %, p = 0.232; 3 일 = 10.75 ± 1.59 %, p = 0.018; 7 일 = 11.34 ± 1.51 %, p = 0.009). GFAP 발현 수준은 스트레스 노출로부터 1 일, 3 일, 7 일차에 크게 변화되었다 (대조군 = 14.66 ± 4.2 %, 1 일 = 22.43 ± 1.18 %, p = 0.018; 3 일 = 24.77 ± 1.82 %, p = 0.009; 7 일 = 26.36 ± 1.06 %, p = 0.005). 마지막으로, TNF-α 발현 수준은 7 일에 유의미하게 변화하였다 (대조군 = 0 %, 1 일 = 0 %; 3 일 = 0 %; 7 일 = 0.60 ± 0.47 %, p = 0.0003).
상기 결과는 고강도 스트레스가 해마에 손상을 유발할 수 있음을 의미한다.
<실시예 4: 혈청에서 분리한 엑소좀의 특성 확인>
신경 유래 엑소좀이 분리되기 전에 혈청으로부터 분리된 총 엑소좀의 특성을 확인하였다. 먼저, 엑소좀 마커인 CD9, CD63 및 TSG101의 존재를 확인하기 위해 형광 활성화 세포 분류 (fluorescence-activated cell sorting, FACS) 및 웨스턴 블로팅을 수행하였다. FACS 결과 CD9, CD63과 같은 테트라스파닌이 엑소좀에 존재함을 보여주었다(도 4a). 또한, 웨스턴 블롯팅 결과 테트라스파닌 뿐만 아니라 TSG101의 존재를 확인하였다(도 4b).
또한, 투과형 전자 현미경(transmission electron microscope, TEM)을 사용하여 엑소좀의 모양과 크기를 확인했다. TEM 이미지는 혈청으로부터 분리된 엑소좀이 구형 이중층 막이고 직경이 30-150nm 범위임을 보여주었다 (도 4c).
마지막으로, 엑소좀의 크기를 확인하기 위해 동적 광산란 (dynamic light scattering, DLS)을 수행한 결과 엑소좀의 크기가 30-150 nm 범위에 있음을 확인하였다(도 4d).
<실시예 5: 신경 세포 유래 엑소좀의 특성 확인>
총 엑소좀의 분리 후, 면역 침전을 위해 anti-L1 세포 부착 분자 (L1CAM, CD171) 비오티닐화된 항체(biotinylated antibody)를 사용하여 신경 유래 엑소좀의 분리를 수행하였다. 그 다음 웨스턴 블롯팅을 통해 신경 유래 엑소좀의 특성을 분석하였다(도 5a).
웨스턴 블롯 결과 신경 유래 엑소좀에 존재하는 TUJ1, NSE 같은 신경 마커는 혈청으로부터 분리된 신경 유래 엑소좀 (nEV)에 있고 총 엑소좀 (tEV)에서는 거의 확인되지 않았다(도 5b).
<실시예 6: 스트레스에 의해 유도된 엑소좀 내 miRNA 발현 변화>
스트레스에 의해 변화된 miRNA 발현 패턴을 확인하기 위해 차세대 시퀀싱 (NGS)을 수행하였다. 그 결과, 대조군과 비교해 13 개의 상향 조절된 miRNA 및 11 개의 하향 조절된 miRNA를 확인하였다(도 6, 표 4 및 표 5).
Figure PCTKR2021006555-appb-T000001
Figure PCTKR2021006555-appb-T000002
상기 결과는, 급성 고강도 스트레스하에 발현된 신경 유래 엑소좀으로부터 유래된 특정 miRNA의 엑소좀은 스트레스 관련 바이오 마커로서 사용될 수 있음을 의미한다.
본 발명은 정상 동물 및 고강도 스트레스 처리 동물 모델의 신경 유래 엑소좀의 miRNA의 발현을 비교 평가한 결과 스트레스 상태에서 특이적으로 발현정도가 변화하는 miRNA를 확인하였는 바, 이러한 miRNA는 스트레스 질환 관련 바이오마커로 활용될 수 있을 뿐만 아니라 스트레스 진단에 관한 제품개발에도 유용하게 이용될 수 있다.
<110> Daegu-Gyeongbuk Medical Innovation Foundation and Kyungpook National University Industry-Academic Cooperation Foundation
<120> Stress diagnosis technology using exosome-derived miRNA
<130> PP210402
<160> 24
<170> KoPatentIn 3.0
<210> 1
<211> 22
<212> RNA
<213> let-7a-1-3p
<400> 1
cuauacaauc uacugucuuu cc 22
<210> 2
<211> 22
<212> RNA
<213> let-7a-5p
<400> 2
ugagguagua gguuguauag uu 22
<210> 3
<211> 22
<212> RNA
<213> let-7b-3p
<400> 3
cuauacaacc uacugccuuc cc 22
<210> 4
<211> 22
<212> RNA
<213> let-7b-5p
<400> 4
ugagguagua gguugugugg uu 22
<210> 5
<211> 22
<212> RNA
<213> let-7c-2-3p
<400> 5
cuauacaauc uacugucuuu cc 22
<210> 6
<211> 22
<212> RNA
<213> let-7c-5p
<400> 6
ugagguagua gguuguaugg uu 22
<210> 7
<211> 22
<212> RNA
<213> let-7d-3p
<400> 7
cuauacgacc ugcugccuuu cu 22
<210> 8
<211> 21
<212> RNA
<213> let-7f-1-3p
<400> 8
cuauacaauc uauugccuuc c 21
<210> 9
<211> 22
<212> RNA
<213> let-7f-5p
<400> 9
ugagguagua gauuguauag uu 22
<210> 10
<211> 21
<212> RNA
<213> miR-126a-5p
<400> 10
cauuauuacu uuugguacgc g 21
<210> 11
<211> 22
<212> RNA
<213> miR-3473
<400> 11
ucuagggcug gagagauggc ua 22
<210> 12
<211> 22
<212> RNA
<213> miR-466b-3p
<400> 12
auacauacac acacacauac ac 22
<210> 13
<211> 21
<212> RNA
<213> miR-98-3p
<400> 13
cuauacaacu uacuacuuuc c 21
<210> 14
<211> 22
<212> RNA
<213> let-7d-5p
<400> 14
agagguagua gguugcauag uu 22
<210> 15
<211> 22
<212> RNA
<213> let-7g-5p
<400> 15
ugagguagua guuuguacag uu 22
<210> 16
<211> 22
<212> RNA
<213> let-7i-5p
<400> 16
ugagguagua guuugugcug uu 22
<210> 17
<211> 21
<212> RNA
<213> miR-140-3p
<400> 17
uaccacaggg uagaaccacg g 21
<210> 18
<211> 23
<212> RNA
<213> miR-17-5p
<400> 18
caaagugcuu acagugcagg uag 23
<210> 19
<211> 23
<212> RNA
<213> miR-191a-5p
<400> 19
caacggaauc ccaaaagcag cug 23
<210> 20
<211> 23
<212> RNA
<213> miR-19b-3p
<400> 20
ugugcaaauc caugcaaaac uga 23
<210> 21
<211> 22
<212> RNA
<213> miR-24-3p
<400> 21
uggcucaguu cagcaggaac ag 22
<210> 22
<211> 23
<212> RNA
<213> miR-30c-5p
<400> 22
uguaaacauc cuacacucuc agc 23
<210> 23
<211> 23
<212> RNA
<213> miR-425-5p
<400> 23
aaugacacga ucacucccgu uga 23
<210> 24
<211> 22
<212> RNA
<213> miR-93-5p
<400> 24
ugagguagua gguugugugg uu 22

Claims (9)

  1. let-7a-1-3p(서열번호 1), let-7a-5p(서열번호 2), let-7b-3p(서열번호 3), let-7b-5p(서열번호 4), let-7c-2-3p(서열번호 5), let-7c-5p(서열번호 6), let-7d-3p(서열번호 7), let-7f-1-3p(서열번호 8), let-7f-5p(서열번호 9), miR-126a-5p(서열번호 10), miR-3473(서열번호 11), miR-466b-3p(서열번호 12), miR-98-3p(서열번호 13), let-7d-5p(서열번호 14), let-7g-5p(서열번호 15), let-7i-5p(서열번호 16), miR-140-3p(서열번호 17), miR-17-5p(서열번호 18), miR-191a-5p(서열번호 19), miR-19b-3p(서열번호 20), miR-24-3p(서열번호 21), miR-30c-5p(서열번호 22), miR-425-5p(서열번호 23) 및 miR-93-5p(서열번호 24)로 이루어지는 군으로부터 선택된 1종 이상의 엑소좀 유래 miRNA의 발현 수준을 측정하는 제제를 포함하는, 스트레스 진단용 조성물.
  2. 제1항에 있어서, 상기 엑소좀은 신경 유래 엑소좀인 것인, 스트레스 진단용 조성물.
  3. 제1항에 있어서, 상기 제제는 상기 하나 이상의 엑소좀 유래 miRNA에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 것인, 스트레스 진단용 조성물.
  4. 제1항 내지 제3항 중 어느 한 항의 조성물을 포함하는 스트레스 진단용 키트.
  5. (a) 개체의 생물학적 시료로부터 엑소좀을 분리하는 단계; 및
    (b) 상기 (a)단계에서 분리된 엑소좀에서 유래한 let-7a-1-3p(서열번호 1), let-7a-5p(서열번호 2), let-7b-3p(서열번호 3), let-7b-5p(서열번호 4), let-7c-2-3p(서열번호 5), let-7c-5p(서열번호 6), let-7d-3p(서열번호 7), let-7f-1-3p(서열번호 8), let-7f-5p(서열번호 9), miR-126a-5p(서열번호 10), miR-3473(서열번호 11), miR-466b-3p(서열번호 12), miR-98-3p(서열번호 13), let-7d-5p(서열번호 14), let-7g-5p(서열번호 15), let-7i-5p(서열번호 16), miR-140-3p(서열번호 17), miR-17-5p(서열번호 18), miR-191a-5p(서열번호 19), miR-19b-3p(서열번호 20), miR-24-3p(서열번호 21), miR-30c-5p(서열번호 22), miR-425-5p(서열번호 23) 및 miR-93-5p(서열번호 24)로 이루어지는 군으로부터 선택된 1종 이상의 miRNA의 발현 수준을 대조군 시료의 해당 엑소좀 유래 miRNA의 발현 수준과 비교하는 단계를 포함하는, 스트레스 진단을 위한 정보제공 방법.
  6. 제5항에 있어서, 상기 생물학적 시료는 혈액인 것인, 스트레스 진단을 위한 정보제공 방법.
  7. 제5항에 있어서, 상기 엑소좀은 신경 유래 엑소좀인 것인, 스트레스 진단을 위한 정보제공 방법.
  8. 제5항에 있어서, 상기 (b)단계에서 개체의 let-7a-1-3p(서열번호 1), let-7a-5p(서열번호 2), let-7b-3p(서열번호 3), let-7b-5p(서열번호 4), let-7c-2-3p(서열번호 5), let-7c-5p(서열번호 6), let-7d-3p(서열번호 7), let-7f-1-3p(서열번호 8), let-7f-5p(서열번호 9), miR-126a-5p(서열번호 10), miR-3473(서열번호 11), miR-466b-3p(서열번호 12) 및 miR-98-3p(서열번호 13)로 이루어지는 군으로부터 선택된 1종 이상의 miRNA의 발현 수준이 대조군에 비해 고발현인 경우 상기 개체는 스트레스 상태인 것으로 판정하는 단계를 더 포함하는, 스트레스 진단을 위한 정보제공 방법.
  9. 제5항에 있어서, 상기 (b)단계에서 개체의 let-7d-5p(서열번호 14), let-7g-5p(서열번호 15), let-7i-5p(서열번호 16), miR-140-3p(서열번호 17), miR-17-5p(서열번호 18), miR-191a-5p(서열번호 19), miR-19b-3p(서열번호 20), miR-24-3p(서열번호 21), miR-30c-5p(서열번호 22), miR-425-5p(서열번호 23) 및 miR-93-5p(서열번호 24)로 이루어지는 군으로부터 선택된 1종 이상의 miRNA의 발현 수준이 대조군에 비해 저발현인 경우 상기 개체는 스트레스 상태인 것으로 판정하는 단계를 더 포함하는, 스트레스 진단을 위한 정보제공 방법.
PCT/KR2021/006555 2020-06-11 2021-05-26 엑소좀 유래 miRNA를 이용한 스트레스 진단기술 WO2021251656A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200070904A KR102348806B1 (ko) 2020-06-11 2020-06-11 엑소좀 유래 miRNA를 이용한 스트레스 진단기술
KR10-2020-0070904 2020-06-11

Publications (1)

Publication Number Publication Date
WO2021251656A1 true WO2021251656A1 (ko) 2021-12-16

Family

ID=78846302

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/006555 WO2021251656A1 (ko) 2020-06-11 2021-05-26 엑소좀 유래 miRNA를 이용한 스트레스 진단기술

Country Status (2)

Country Link
KR (3) KR102348806B1 (ko)
WO (1) WO2021251656A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP7406059B1 (ja) 2022-10-20 2023-12-27 防衛装備庁長官 急性ストレス評価用データの生成方法

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2016513095A (ja) * 2013-02-12 2016-05-12 リニューロン・リミテッドＲｅＮｅｕｒｏｎ Ｌｉｍｉｔｅｄ 幹細胞微粒子及びｍｉＲＮＡ
US20170044613A1 (en) * 2014-04-22 2017-02-16 The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. Methods, Processes, Devices and Kits for the Measurement of Post Traumatic Stress Disorder MicroRNA Markers

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101643353B1 (ko) 2014-10-10 2016-07-27 서울대학교산학협력단 운동 스트레스 진단용 조성물 및 이의 용도
CN104975093B (zh) 2015-07-10 2017-12-12 浙江省农业科学院 血清ssc‑miR‑215作为检测仔猪肠道应激损伤分子标记物的应用
EP3464639A4 (en) 2016-05-31 2020-01-01 Goetzl, Edward, J. DIAGNOSTIC METHOD AND METHOD FOR TESTING THE EFFECTIVENESS OF A MEDICINAL PRODUCT FOR DEMENTIA USING ASTROCYTE-DERIVED EXOSOMES

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2016513095A (ja) * 2013-02-12 2016-05-12 リニューロン・リミテッドＲｅＮｅｕｒｏｎ Ｌｉｍｉｔｅｄ 幹細胞微粒子及びｍｉＲＮＡ
US20170044613A1 (en) * 2014-04-22 2017-02-16 The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. Methods, Processes, Devices and Kits for the Measurement of Post Traumatic Stress Disorder MicroRNA Markers

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BENINSON LIDA A., BROWN PETER N., LOUGHRIDGE ALICE B., SALUDES JONEL P., MASLANIK THOMAS, HILLS ABIGAIL K., WOODWORTH TYLER, CRAIG: "Acute Stressor Exposure Modifies Plasma Exosome-Associated Heat Shock Protein 72 (Hsp72) and microRNA (miR-142-5p and miR-203)", PLOS ONE, vol. 9, no. 9, 26 September 2014 (2014-09-26), pages e108748, XP055879336, DOI: 10.1371/journal.pone.0108748 *
FANG KE; XU JING-XIAN; CHEN XING-XING; GAO XIN-RAN; HUANG LING-LING; DU AN-QI; JIANG CHUAN; GE JIN-FANG: "Differential serum exosome microRNA profile in a stress-induced depression rat model", JOURNAL OF AFFECTIVE DISORDERS., ELSEVIER BIOCHEMICAL PRESS, AMSTERDAM., NL, vol. 274, 24 May 2020 (2020-05-24), NL , pages 144 - 158, XP086208253, ISSN: 0165-0327, DOI: 10.1016/j.jad.2020.05.017 *
SNIJDERS CLARA, KRAUSKOPF JULIAN, PISHVA EHSAN, EIJSSEN LARS, MACHIELS BARBIE, KLEINJANS JOS, KENIS GUNTER, VAN DEN HOVE DANIEL, K: "Circulating Serum MicroRNAs as Potential Diagnostic Biomarkers of Posttraumatic Stress Disorder: A Pilot Study", FRONTIERS IN GENETICS, vol. 10, 1 January 2019 (2019-01-01), pages 1042, XP055879337, DOI: 10.3389/fgene.2019.01042 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP7406059B1 (ja) 2022-10-20 2023-12-27 防衛装備庁長官 急性ストレス評価用データの生成方法

Also Published As

Publication number Publication date
KR20210153942A (ko) 2021-12-20
KR102389340B1 (ko) 2022-04-21
KR102348806B1 (ko) 2022-01-07
KR20220049503A (ko) 2022-04-21
KR20220008929A (ko) 2022-01-21

Similar Documents

Publication Publication Date Title
WO2019182371A1 (ko) 퇴행성 신경질환 진단용 조성물
WO2012081898A2 (ko) 위암의 예후 예측용 마커 및 이를 이용하는 위암의 예후 예측 방법
WO2021251656A1 (ko) 엑소좀 유래 miRNA를 이용한 스트레스 진단기술
WO2018038352A2 (ko) 치매진단용 자가항체 바이오마커 및 이를 이용한 치매진단 방법
WO2016144136A1 (ko) Ffpe 조직에서 핵산의 분리 방법
WO2019225923A1 (ko) 질환의 진단용 조성물
WO2018084594A1 (ko) 차세대서열결정법을 이용한 표적 단백질의 집단적 정량 방법과 그 용도
WO2017018735A1 (ko) 노화 판별용, 비만 판별용, 암 진단용 바이오마커 및 이를 이용한 진단키트
WO2022114920A1 (ko) 혈액 유래 엑소좀에서 발굴한 신규의 알츠하이머 진단용 바이오마커 및 이를 이용한 알츠하이머 진단방법
WO2018004254A1 (ko) 미세먼지 노출 여부 확인용 바이오마커 및 이를 이용하는 확인방법
WO2023234659A1 (ko) 퇴행성 턱관절염의 진단 또는 예후 예측용 유전자 마커 및 이의 용도
WO2021002735A1 (ko) T 세포의 세포 표면 항원 및 이의 다양한 용도
WO2017176067A1 (ko) 줄기세포의 세포노화 검출용 키트
WO2017007241A1 (ko) Parp 및 탄키라제 동시 저해제에 대한 감수성 결정 방법
WO2013100273A1 (ko) 방사선 피폭 진단용 마커 ｉｇｆｂｐ-5, 그 마커의 발현수준을 측정하는 방사선 피폭 진단용 조성물, 그 조성물을 포함하는 방사선 피폭 진단용 키트, 및 그 마커를 이용한 방사선 피폭을 진단하는 방법
WO2022102885A1 (ko) 엑소좀 유래 miRNA를 이용한 아토피성 피부염 상관 스트레스 진단기술
WO2020130467A2 (ko) Cd8+ 메모리 t 세포 매개성 질환의 예방 또는 치료용 약학 조성물
WO2013133472A1 (ko) 독성 예측 및 치료 타겟으로서의 ａctivating transcription factor 3(atf 3)
WO2018088826A2 (ko) 대장암 전이 진단 또는 예후 예측용 조성물 및 이의 용도
WO2023090901A1 (ko) 기계 학습을 이용한 세포 노화의 마커를 선별하는 방법, 세포 노화 바이오 마커, 및 이를 이용한 세놀리틱 제제를 스크리닝 하는 방법
WO2020004904A1 (ko) Rna 은 제자리 혼성화 방법을 통한 aimp2-dx2 신호 자동화 검출 방법
WO2020096339A1 (ko) 중간엽줄기세포의 증식 및 이동 능력 예측용 바이오마커 및 이의 용도
WO2019088709A2 (ko) Nc886 유전자를 이용한 난소암 예후 예측을 위한 정보제공방법
WO2018012889A1 (ko) Itac의 억제제를 포함하는 조성물
WO2023167544A1 (ko) Fam167a를 포함하는 bcr-abl 비의존성 타이로신 키나아제 억제제 내성을 진단하기 위한 바이오마커 및 fam167a를 타겟으로 하는 만성 골수성 백혈병 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21821641

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21821641

Country of ref document: EP

Kind code of ref document: A1