WO2016144136A1 - Ffpe 조직에서 핵산의 분리 방법 - Google Patents

Ffpe 조직에서 핵산의 분리 방법 Download PDF

Info

Publication number
WO2016144136A1
WO2016144136A1 PCT/KR2016/002461 KR2016002461W WO2016144136A1 WO 2016144136 A1 WO2016144136 A1 WO 2016144136A1 KR 2016002461 W KR2016002461 W KR 2016002461W WO 2016144136 A1 WO2016144136 A1 WO 2016144136A1
Authority
WO
WIPO (PCT)
Prior art keywords
peg
seq
kit
ffpe
dna
Prior art date
Application number
PCT/KR2016/002461
Other languages
English (en)
French (fr)
Inventor
장세진
천성민
김태임
이정신
최은경
Original Assignee
재단법인 아산사회복지재단
울산대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 재단법인 아산사회복지재단, 울산대학교 산학협력단 filed Critical 재단법인 아산사회복지재단
Priority to CN201680026192.0A priority Critical patent/CN107922940B/zh
Priority to EP16762023.6A priority patent/EP3269813B1/en
Priority to US15/557,551 priority patent/US20180112208A1/en
Publication of WO2016144136A1 publication Critical patent/WO2016144136A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
    • C12N15/1013—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers by using magnetic beads
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay

Definitions

  • the present invention relates to a method for separating nucleic acids from a sample prepared by dissolving formalin-fixed, paraffin-embedded (FFPE) tissue sections, a nucleic acid separation kit, and a lysis buffer for nucleic acid separation.
  • FFPE formalin-fixed, paraffin-embedded
  • kits and methods for separating nucleic acids from FFPE tissue using a column are known (QIAamp FFPE tissue kit).
  • QIAamp FFPE tissue kit As a method for separating nucleic acids from FFPE tissue, kits and methods for separating nucleic acids from FFPE tissue using a column are known (QIAamp FFPE tissue kit).
  • QIAamp FFPE tissue kit As a method for separating nucleic acids from FFPE tissue, kits and methods for separating nucleic acids from FFPE tissue using a column are known (QIAamp FFPE tissue kit).
  • QIAamp FFPE tissue kit As a method for separating nucleic acids from FFPE tissue, kits and methods for separating nucleic acids from FFPE tissue using a column are known (QIAamp FFPE tissue kit).
  • QIAamp FFPE tissue kit As a method for separating nucleic acids from FFPE tissue, kits and methods for separating nucleic acids from FFPE
  • the present inventors have made diligent efforts to develop a kit and a method for obtaining nucleic acids from FFPE tissues effectively.
  • FFPE tissue sections are dissolved to prepare a sample, and a solution containing a salt and PEG and magnetic beads are added thereto.
  • a nucleic acid from the magnetic beads to which the nucleic acid is bound. It was confirmed that the nucleic acid can be effectively separated from the sample prepared by dissolving FFPE tissue fragments using the method developed above, and completed the present invention.
  • One object of the present invention is to provide a method for separating nucleic acids from samples prepared by dissolving formalin-fixed, paraffin-embedded (FFPE) tissue sections.
  • FFPE formalin-fixed, paraffin-embedded
  • Another object of the invention is a lysis buffer; A solution comprising a salt and PEG; And it provides a kit for separating nucleic acids from FFPE tissue, including magnetic beads.
  • Another object of the present invention is to provide a lysis buffer for nucleic acid separation from FFPE tissue, including a chelating agent, an ionic surfactant and Tris-Cl.
  • Kits and methods for separating nucleic acids from FFPE tissues of the present invention have the effect of obtaining high yields of nucleic acids in a short time from samples prepared by dissolving FFPE tissue fragments.
  • Figure 1 shows the yield of DNA from the old FFPE tissue specimens (2000 to 2004) by the bead method, specifically, the amount of DNA was measured by PicoGreen (PG) and NanoDrop (ND) method.
  • the upper graph shows the amount of DNA in ⁇ g
  • the middle graph shows the ratio of DNA amount of ND to PG.
  • the graph below shows the amount of DNA ( ⁇ g) measured using PicoGreen after separating DNA from each sample using the bead method or the column method (Qiagen kit).
  • Figure 2 is a comparison of the DNA separation from the old FFPE tissue specimens (2013) by using the column method and the bead method, respectively measured by PicoGreen (PG) and Nanodrop (ND).
  • the graph at the top shows the amount of DNA isolated by PG (unit: ⁇ g), and the graph at the bottom shows the ratio of ND DNA to PG.
  • FIG. 3 shows 24 SNPs sites using nine gDNAs isolated from FFPE tissue samples in column (QIAGEN) or bead (100 ⁇ l lysis buffer, 100 ⁇ l lysis buffer + PEG, or 50 ⁇ l lysis buffer). When genotyping was performed for the qualitative analysis of the clear peak pattern.
  • FIG. 4 shows 100 g of gDNA isolated from five different FFPE tissues using a QIAamp DNA FFPE Tissue kit, a QiAamp DNA FFPE Tissue kit, a QIAquick PCR Purification kit, or an ASAN-Method of the present invention. It is shown by comparing the recovery ratio (Recovery ratio) when extracted.
  • Figure 5 shows the yield when DNA was separated by the bead method of the present invention by varying the amount of tissue sections of liver cancer FFPE tissue samples (# 4864 and # 19401) (6 to 6 ⁇ m thickness).
  • the size of the tissue contained in the liver cancer FFPE block is 1 to 1.5 cm in both the length and width, and 100 ⁇ l of the elution solvent was used.
  • the Y axis in the graph represents the total amount of DNA obtained (ng).
  • Figure 6 is a photograph of the electrophoresis performed to confirm the DNA yield when the DNA is separated by the MN kit and the bead method of the present invention for five tissue samples.
  • the left five columns (lanes 2 to 6) are DNA separated by the bead method of the present invention
  • the right five columns (lanes: 8 to 12) are DNA separated using an MN kit. 50 ⁇ l of the total elution solvent was used, 5 ⁇ l of which was loaded onto the gel.
  • researchers from other institutions were asked to conduct the experiment.
  • Figure 7 shows the DNA yield when DNA was isolated by MN kit and the bead method of the present invention for five tissue samples.
  • On the left is a graph measuring the amount of DNA (unit: ⁇ g) with NanoDrop (ND) and PicoGreen (PG) in the middle, and the graph showing the ND / PG ratio on the right.
  • ND NanoDrop
  • PG PicoGreen
  • FFPE formalin-fixed, paraffin-embedded
  • tissue is separated from the animal specimens by incision or biopsy.
  • the tissue is then cut to prepare a section, which is fixed to prevent it from decay or degradation and to clearly examine it under a microscope for histological, pathological or cytological studies.
  • Immobilization is the process of immobilizing, lethaling, and preserving tissue for the purpose of staining and viewing the tissue under a microscope.
  • Post-processing allows tissues to penetrate staining reagents and cross-link macromolecules, causing them to stabilize and trap in place. Many fixatives are used for this purpose, such as, for example, Bowine solutions, formalin or liquid nitrogen.
  • the immobilized tissue is then embedded in wax so that it can be cut into thin sections and stained with hematoxylin and eosin stains.
  • microtoming is performed by cutting the fine sections to study staining with antibodies under a microscope.
  • the conventional method has a problem in that the yield is reduced due to DNA microfragmentation, entanglement with proteins, and the like, and there has been a demand for the development of a method for obtaining the same in high yield.
  • the sample containing the FFPE tissue sections are magnetic beads; And a method for reacting with a solution comprising a salt and PEG, and separating the nucleic acid bound to the magnetic beads.
  • the magnetic beads can capture the nucleic acid more effectively, thereby obtaining nucleic acid in high yield. It was confirmed that it can be done. In particular, it was confirmed that the nucleic acid samples of the FFPE tissue fragments of more than 10 years since the preparation can be effectively recovered.
  • the present invention has developed a technique for efficiently separating nucleic acids from FFPE tissue by reproducibly optimizing the composition of the lysis buffer in the above method.
  • step (a) is a step of adding a solution containing salt and PEG, and magnetic beads to a separated sample prepared by dissolving FFPE tissue sections to allow nucleic acid to bind to magnetic beads.
  • the FFPE tissue fragment is an FFPE tissue having a size suitable for nucleic acid separation, and may be in a thinly cut form of FFPE tissue to have a size suitable for nucleic acid separation. In addition, it is not limited thereto, but may be a thickness of 2 to 10 ⁇ m.
  • the FFPE tissue for use in the method for separating nucleic acid from the FFPE tissue of the present invention is applicable not only to recently prepared but also to FFPE tissue stored for a long time for more than 10 years.
  • nucleic acids can be separated without adding ethanol, particularly between the dissolution step and the step of adding the beads. There is an advantage. However, it is not limited thereto.
  • the isolated sample prepared by dissolving the FFPE tissue fragments may be prepared by dissolving the FFPE tissue fragments in a lysis buffer.
  • the method of the present invention comprises the steps of adding a lysis buffer to the FFPE tissue sections; Adding a magnetic beads and a solution containing a salt and PEG to the sample dissolved in the first step; And a third step of obtaining the magnetic beads from the sample to which the magnetic beads are added and separating the nucleic acid therefrom, but is not particularly limited thereto.
  • the lysis buffer used for dissolving FFPE tissue sections may specifically include, but is not limited to, a chelating agent, an ionic surfactant, and Tris-Cl.
  • the separation of the magnetic beads is easier and / or the yield is higher than when using the other buffer.
  • the chelating agent is Mg 2+ and Ca can be used to isolate the divalent cation, such as + 2, and therefore can protect the DNA from the enzyme to decompose it, but is not limited thereto.
  • chelating agent may be selected from the group consisting of diethylenetriaminepentaacetic acid (DTPA), ethylenediaminetetraacetic acid (EDTA), ethylene glycol tetraacetic acid (EGTA), and NTA (N, N-bis (carboxymethyl) glycine), but is not limited thereto. It doesn't work.
  • EDTA was used as a chelating agent.
  • the EDTA may represent an EDTA portion of an EDTA compound (eg, K 2 EDTA, K 5 EDTA, or Na 2 EDTA), but is not limited thereto.
  • an EDTA compound eg, K 2 EDTA, K 5 EDTA, or Na 2 EDTA
  • an ionic surfactant is a material having both hydrophilic and hydrophobic moieties in a molecule and exhibits ionic properties upon dissociation.
  • SDS sodium dodecyl sulfate
  • ammonium lauryl sulfate ammonium lauryl sulfate
  • sodium lauryl ether sulfate SLES
  • sodium myreth sulfate sodium myreth sulfate
  • Dioctyl sodium sulfosuccinate perfluorooctanesulfonate (PFOS), perfluorobutanesulfonate, linear alkylbenzene sulfonates (LABs), sodium lauroyl sarcosinate, PFOA perfluorononanoate and perfluorooctanoate (PFO), but are not limited thereto.
  • the lysis buffer comprises 10 to 100 mM chelating agent; 0.1 to 5% (w / v) ionic surfactant; Or / and 10 to 100 mM Tris-Cl, but is not limited thereto.
  • the pH of the lysis buffer may be 7.0 to 8.5.
  • the lysis buffer may include, but is not limited to, EDTA, SDS, and Tris-Cl.
  • protease may be added together.
  • protease may be used a variety of protease commonly used for nucleic acid separation, for example, can be used protease K (proteinase K).
  • the addition of the solution containing the magnetic beads, salt and PEG to the sample may be performed sequentially or simultaneously, but is not limited thereto.
  • a solution containing PEG and salts added with the magnetic beads is not particularly limited, but may help capture small nucleic acid fragments of 100 bp or less than 100 nt.
  • the salt in the solution containing the salt and polyethylene glycol (PEG) is not particularly limited in kind, but may be, for example, sodium chloride.
  • PEG of the solution may be PEG having an average molecular weight of 6,000 to 10,000 Da, but is not limited thereto.
  • the solution containing the salt and PEG may be one containing 1 to 4 M of salt and 10 to 40% (w / v) of PEG, but is not limited thereto.
  • magnetic beads refer to particles or beads that react to a magnetic field.
  • magnetic beads do not have a magnetic field, but are materials that form a magnetic dipole exposed to the magnetic field.
  • it refers to a substance that can be magnetized in a magnetic field, but does not have magnetism in the absence of a magnetic field.
  • the magnetism used in the present invention includes, but is not limited to, both paramagnetic and superparamagnetic materials.
  • the magnetic beads are preferably beads having a property of binding to a nucleic acid.
  • the magnetic beads may be in a form having a functional group that binds to a nucleic acid, for example, a -COOH group, but is not limited thereto.
  • the method of separating nucleic acids from FFPE tissue of the present invention may include, but is not limited to, deparaffinizing FFPE tissue.
  • the FFPE tissue is immobilized immobilized tissue in wax, and since most of the embedding media are hydrophobic, removal of an inert material may be necessary before histological, cellular or molecular biological analysis using hydrophilic reagents.
  • the term "deparafinization” or “dewaxing” is used broadly in the present invention to denote the removal of some or all types of embedding media from a biological sample.
  • paraffin embedded tissue sections can be deparaffinized by treatment with organic solvents such as toluene, xylene, limonene or other suitable solvent.
  • deparaffinization was carried out by adding xylene and washing with ethanol several times.
  • step (b) is a step of obtaining magnetic beads from the sample to which the magnetic beads are added, and separating nucleic acids therefrom.
  • step (b) is a step of separating the nucleic acid attached to the magnetic beads added in the step (a) from the magnetic beads.
  • the method may include washing the magnetic beads before obtaining the magnetic beads from the sample to which the magnetic beads have been added.
  • the washing of the magnetic beads may be performed using 50 to 95% (v / v) ethanol solution, specifically 80 to 90% (v / v) ethanol solution.
  • This washing process can be carried out by placing the magnetic beads under a magnetic stand, collecting the magnetic beads, removing the supernatant, and adding the wash buffer thereto to wash. In addition, this washing step may be performed one or more times.
  • the nucleic acid can be separated from the magnetic beads by separating the magnetic beads and adding an elution buffer to the separated magnetic beads.
  • lysis buffers A solution comprising a salt and PEG; and a kit for separating nucleic acid from FFPE tissue comprising magnetic beads.
  • Lysis buffers solutions comprising salts and PEG, and magnetic beads are as described above.
  • kit may further include other instruments, solutions, and the like, which are generally used for nucleic acid separation, and may include instructions for separating nucleic acids from FFPE tissue, but are not limited thereto.
  • kit may further include, but is not limited to, magnetic bead wash buffer, and magnetic bead separation mechanisms (eg, magnetic stands).
  • Another specific embodiment of the present invention is a lysis buffer for nucleic acid separation from FFPE tissue comprising a chelating agent, an ionic surfactant and Tris-Cl.
  • Lysis buffers for nucleic acid separation from chelating agents, ionic surfactants, and FFPE tissues are as described above.
  • the FFPE blocks were cut to 6 ⁇ m thick and then one or two FFPE tissue sections were placed in a 1.5 ml tube. Then, 1 ml xylene (xylene) was added and mixed, centrifuged at 12,000 x g for 3 minutes at room temperature, and the supernatant was removed. Then, 0.8 ml xylene and 0.4 ml EtOH were added and mixed, followed by centrifugation at 12,000 x g for 3 minutes at room temperature, and the supernatant was removed. Then, 1 ml EtOH was added and mixed, followed by centrifugation at 12,000 x g for 3 minutes at room temperature, and the supernatant was removed. The remaining EtOH was then incubated at room temperature for 0.5-1 hour to completely evaporate.
  • xylene xylene
  • lysis buffer (10 mM Tris-Cl, pH 8.0, 100 mM EDTA, pH 8.0, 0.5% SDS) and 10 ⁇ l of proteinase K were added and mixed. , Incubated overnight at 56 ° C.
  • wash buffer 85% EtOH
  • the beads were then dried, the reaction tube was removed from the magnetic stand and 60 ⁇ l of elution buffer (10 mM Tris-Cl, pH 8.5 or tertiary distilled water) was added. The reaction tube was then placed on a magnetic stand, and the eluate was separated to obtain a genomic DNA sample.
  • elution buffer (10 mM Tris-Cl, pH 8.5 or tertiary distilled water
  • the FFPE blocks were cut to 6 ⁇ m thick and then one or two FFPE tissue sections were placed in a 1.5 ml tube.
  • lysis buffer (10 mM Tris-Cl, pH 8.0, 100 mM EDTA, pH 8.0, 0.5% SDS
  • mineral oil 200 ⁇ l of mineral oil
  • proteinase K 10 ⁇ l
  • wash buffer 85% EtOH
  • the beads were then dried, the reaction tube was removed from the magnetic stand and 60 ⁇ l of elution buffer (10 mM Tris-Cl, pH 8.5 or tertiary distilled water) was added. The reaction tube was then placed on a magnetic stand, and the eluate was separated to obtain a genomic DNA sample.
  • elution buffer (10 mM Tris-Cl, pH 8.5 or tertiary distilled water
  • the PicoGreen reagent was diluted to 1/200 using IX TE buffer, then wrapped in aluminum foil and kept at room temperature to prevent light.
  • the standard concentration DNA (100 ng / ⁇ l) included in the kit was serially diluted twice with 1 ⁇ TE buffer to prepare 50, 25, 12.5, 6.3, 3.2, 1.6, 0.8 ng / ⁇ l. Then, 3 ⁇ l of the above standard concentration DNA prepared at 50 to 0.8 ng / ⁇ l was mixed well with 150 ⁇ l of 1 ⁇ TE buffer, respectively, and stored.
  • a DNA concentration calculation formula was prepared according to the 535 nm measured value. It was checked whether the p-value (relative to the DNA concentration and the linearity of the measured value of the 535 nm wavelength band) of the calculation formula was 0.99 or more, and if less than that, the measurement was remeasured to prepare a standard concentration calculation formula.
  • genomic DNA In order to evaluate the quality of the obtained genomic DNA, clear genotyping was performed. Specifically, 24 SNPs sites using 9 genomic DNAs isolated from FFPE tissue samples by column method (QIAGEN) or bead method (100 ⁇ l lysis buffer, 100 ⁇ l lysis buffer + PEG or 50 ⁇ l lysis buffer). When genotyping was performed for the clear peak pattern was qualitatively analyzed.
  • 100 ⁇ l lysis buffer + PEG condition means that 100 ⁇ l of lysis buffer is used during the dissolution process, and then 100 ⁇ l of solution A, which is a mixture of PEG and NaCl, is added, and the remaining 100 ⁇ l lysis buffer and 50 ⁇ l lysis buffer are used.
  • the conditions mean that only lysis buffer was used without adding solution A.
  • this assay is a SNP analysis of Germline mutations, it can be analyzed only with homo (100%) homozygous base or hetero (50%) heterozygous base, but homo or hetero recognition is performed depending on the quality of genomic DNA used as a template. It is difficult to determine the pattern of heterozygotes (ie, 80 ⁇ 90% or homozygous or 10 ⁇ 20% or 80 ⁇ 90%). You can judge the quality.
  • genotypes of 24 SNPs of genomic DNA obtained by each method were the most accurately analyzed for homo (100%) and hetero (50%). It was confirmed how was obtained. Since 24 SNP analyzes were performed on 9 genomic DNAs, we counted the most specific genotype results from a total of 216 genotypes and analyzed which method yielded the largest number of clear genotype results. .
  • the specific experimental procedure is as follows.
  • PCR primers and UEP primers were designed for each of 24 SNP sites using the Assay designer module of Sequenom's Typer program. At this time, the size of the amplicons amplified is about 100bp, SNP position was designed to be located in the middle of each amplification product. Designed primers (SEQ ID NO: 1 to SEQ ID NO: 120) are shown in Tables 1 and 2 below.
  • the QIAamp MinElute column was then transferred to a new 2 ml collection tube, 500 ⁇ l of AW1 solution was added and centrifuged at 8,000 rpm for 1 minute.
  • the QIAamp MinElute column was transferred to a new 2 ml collection tube, 500 ⁇ l of AW2 solution was added, and centrifuged at 8,000 rpm for 1 minute.
  • the QIAamp MinElute column was then transferred to a new 2 ml collection tube and centrifuged for 3 min at 14,000 rpm.
  • the QIAquick spin column was then transferred to a new 2 ml collection tube, 750 ⁇ l of PE solution was added and centrifuged at 8,000 rpm for 1 minute.
  • the QIAquick spin column was then transferred to a new 2 ml collection tube and centrifuged for 1 minute at 14,000 rpm.
  • the QIAquick spin column was transferred to a new 1.5 mL tube, and 30 ⁇ l of EB solution was dispensed at the center of the column, placed at room temperature for 1 minute, and centrifuged at 14,000 rpm for 1 minute.
  • the QIAquick spin column was then removed and DNA extracted in a 1.5 ml tube was obtained.
  • the concentration was then quantified with PicoGreen and multiplied by the eluent volume of 30 to calculate the final recovery rate (final yield / 100 ng).
  • the bead pellet was transferred to a new 1.5 ml tube, taking care not to touch, to obtain extracted DNA.
  • the concentration was then quantified with PicoGreen and multiplied by the eluent volume of 30 to calculate the final recovery rate (final yield / 100 ng).
  • DNA extracted by each method was compared with respect to the same sample using electrophoresis. Specifically, 2 ⁇ l of the final DNA extract was loaded on a 1.5% agarose gel, electrophoresed at 100 V for 25 minutes, and analyzed by electrophoresis using Biorad's GelDoc equipment. At this time, to confirm the DNA size, the 100bp DNA ladder was electrophoresed together.
  • the yield of the DNA extracted with the beads is 2-3 times higher (Fig. 7 left and center).
  • the difference in quantitative value of PicoGreen was greater than the difference in quantitative value of NanoDrop. It can be inferred.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)

Abstract

본 발명은 FFPE(formalin-fixed, paraffin-embedded) 조직 절편을 포함하는 시료로부터 핵산을 분리하는 방법, 핵산 분리 키트 및 핵산 분리를 위한 용해 완충액에 관한 것이다.

Description

FFPE 조직에서 핵산의 분리 방법
본 발명은 FFPE(formalin-fixed, paraffin-embedded) 조직 절편을 용해하여 제조된 시료로부터 핵산을 분리하는 방법, 핵산 분리 키트 및 핵산 분리를 위한 용해 완충액에 관한 것이다.
최근, 의료 분야에서는 분자생물학적 기술이 다양하게 이용되고 있다. 특히, 분자 병리학적 측면에서 이러한 기술들은 형태학적 수준에서부터 유전자 수준까지 병리학적 진단을 가능하게 하며, 또한 상기 형태학적 수준 및 유전자 수준으로부터 특정 질병의 유전적 특징을 밝힐 수 있다(DeMarzo et al., Lancet, (2003) 361, 955-64). 이러한 진단 과정을 위해 병원에서는 FFPE(formalin-fixed, paraffin-embedded) 형태로 조직을 수거하게 되는데, 상기 FFPE 조직을 통해 다양한 임상적 상태와 관련된 유전적 정보를 분석 및 진단할 수 있다(Roukos DH et al., Pharmacogenomics, (2010) 11, 283-7). 하지만, FFPE 표본에서 핵산이 작은 절편으로 분해되고 단백질과 엉키기 때문에 분자적으로 임상적인 적용을 위해 FFPE 조직으로부터 DNA를 분리하는 것에 제한이 따른다(Feldman MY et al., Prog Nucleic Acid Res Mol Biol, (1973) 13, 1-49). 따라서, 최적의 농도 및 순도를 가지는 양질의 DNA를 분리하는 방법의 필요성이 강조되고 있다.
FFPE 조직으로부터 핵산을 분리하는 방법으로, 컬럼을 이용하여 FFPE 조직으로부터 핵산을 분리하는 키트 및 방법 등이 알려져 있다(QIAamp FFPE tissue kit). 그러나, 기존에 알려진 방법에 비하여 개선된 FFPE 조직으로부터 핵산을 분리하는 키트 및 방법의 개발이 여전히 요구되고 있다.
본 발명자들은 FFPE 조직으로부터 핵산을 효과적으로 수득할 수 있는 키트 및 수득 방법의 개발을 위하여 예의 노력한 결과, FFPE 조직 절편을 용해하여 시료를 제조하고, 여기에 염 및 PEG를 포함하는 용액과 자성 비드를 첨가하여 핵산이 결합된 자성 비드로부터 핵산을 획득하는 방법을 개발하였다. 상기 개발된 방법을 사용하여 FFPE 조직 절편을 용해하여 제조된 시료에서 핵산을 효과적으로 분리할 수 있음을 확인하였고, 본 발명을 완성하였다.
본 발명의 하나의 목적은 FFPE(formalin-fixed, paraffin-embedded) 조직 절편을 용해하여 제조된 시료로부터 핵산을 분리하는 방법을 제공하는 것이다.
본 발명의 다른 목적은 용해 완충액(lysis buffer); 염 및 PEG를 포함하는 용액; 및 자성 비드를 포함하는, FFPE 조직으로부터 핵산을 분리하기 위한 키트를 제공하는 것이다.
본 발명의 또 다른 목적은 킬레이트제(chelating agent), 이온성 계면활성제(ionic surfactant) 및 Tris-Cl을 포함하는, FFPE 조직으로부터 핵산 분리를 위한 용해 완충액을 제공하는 것이다.
본 발명의 FFPE 조직으로부터 핵산을 분리하기 위한 키트 및 방법에 따르면 FFPE 조직 절편을 용해하여 제조된 시료에서 핵산을 단기간 내에 고수율로 수득할 수 있는 효과를 가진다.
도 1은 비드 방식으로 오래된 FFPE 조직 표본(2000년 내지 2004년)에서 DNA를 분리한 수율을 나타낸 것으로, 구체적으로 PicoGreen(PG) 및 NanoDrop(ND) 방식으로 DNA 양을 측정하였다. 상단의 그래프는 DNA의 양(단위: μg)을 나타내며, 중간 그래프는 PG에 대한 ND의 DNA 양의 비율을 나타낸다. 그리고 하단의 그래프는 각각의 표본에서 비드 방식 또는 컬럼 방식(Qiagen kit)을 이용하여 DNA를 분리한 뒤 PicoGreen을 이용하여 측정한 DNA의 양(단위: μg)을 나타낸 것이다.
도 2는 오래되지 않은 FFPE 조직 표본(2013년)에서 각각 컬럼 방식과 비드 방식을 이용하여 DNA를 분리한 것을 PicoGreen(PG) 및 Nanodrop(ND)으로 측정하여 비교한 것이다. 상단의 그래프는 분리한 DNA의 양을 PG로 측정하여 나타내낸 것이며(단위: μg), 하단의 그래프는 PG에 대한 ND의 DNA 양을 비율로 나타낸 것이다.
도 3은 컬럼 방식(QIAGEN), 또는 비드 방식(100㎕ lysis buffer, 100㎕ lysis buffer + PEG, 또는 50㎕ lysis buffer)으로 FFPE 조직 표본으로부터 분리한 9개의 gDNA를 이용하여, 24곳의 SNPs site에 대한 유전형질 분석(genotyping)을 수행하였을 때 clear peak pattern을 정성 분석한 것이다.
도 4는 QIAamp DNA FFPE Tissue kit를 이용하여 5개의 서로 다른 FFPE tissues에서 분리한 gDNA 100ng을, QiAamp DNA FFPE Tissue kit, QIAquick PCR Purification kit, 또는 본 발명의 비드 방식(ASAN-Method)을 이용하여 재 추출하였을 때의 회복률(Recovery ratio)을 비교하여 나타낸 것이다.
도 5는 간암 FFPE 조직 표본(#4864 및 #19401)의 조직 절편의 양을 달리하여(6 μm 두께로 1장 내지 5장) 본 발명의 비드 방식으로 DNA를 분리하였을 때 수율을 나타낸 것이다. 간암 FFPE block에 포함된 조직의 크기는 가로, 세로 모두 1 내지 1.5cm이며,용출 용매는 100㎕를 사용하였다. 그래프에서 Y축은 수득한 DNA 총량(ng)을 나타낸다.
도 6은 다섯 개의 조직 표본에 대하여 MN 키트와 본 발명의 비드 방식으로 DNA를 분리하였을 때의 DNA 수율을 확인하기 위하여 전기영동을 수행한 사진이다. 사진에서 좌측 다섯 개의 열(lane: 2 ~ 6)은 본 발명의 비드 방식으로 분리한 DNA이고, 우측 다섯 개의 열(lane: 8 ~ 12)은 MN kit를 이용하여 DNA를 분리한 것이다. 전체 용출 용매는 50㎕를 사용하고, 이 중 5㎕를 겔에 로딩하였다. 실험의 객관성을 확인하기 위해 타 기관 소속의 연구원이 실험을 수행하도록 하였다.
도 7은 다섯 개의 조직 표본에 대하여 MN 키트와 본 발명의 비드 방식으로 DNA를 분리하였을 때의 DNA 수율을 나타낸 것이다. 좌측은 NanoDrop(ND), 가운데는 PicoGreen(PG)으로 DNA 양(단위: μg)을 측정한 그래프이며, 우측은 ND/PG ratio를 나타낸 그래프이다.
상기의 과제를 해결하기 위한 본 발명의 구체적인 하나의 양태는
(a) FFPE(formalin-fixed, paraffin-embedded) 조직 절편을 용해하여 제조된, 분리된 시료에 염 및 PEG(polyethylene glycol)를 포함하는 용액 및 자성 비드를 첨가하는 단계; 및
(b) 상기 자성 비드가 첨가된 시료에서 자성 비드를 획득하고, 이로부터 핵산을 분리하는 단계를 포함하는, FFPE 조직으로부터 핵산을 분리하는 방법이다.
본 발명에서 용어, "FFPE(formalin-fixed, paraffin-embedded)"는 동물로부터 분리된 조직을 보관 또는 저장하기 위한 하나의 방법으로, 조직을 고정하고 고정된 조직을 왁스에 포매시킨 것을 의미한다. 이에 제한되는 것은 아니나 FFPE 조직을 제조하기 위한 구체적인 과정은 다음과 같을 수 있다.
먼저, 절개 또는 생검에 의해 동물 시편으로부터 조직을 분리한다. 그 다음, 상기 조직을 잘라 절편을 제조하고, 이를 부패 또는 분해로부터 방지하고 조직학적, 병리학적 또는 세포학적 연구를 위해 현미경하에서 이것을 명확하게 검사하기 위해 고정한다. 고정은 조직을 현미경하에서 염색 및 조망하기 위한 목적으로 부동화시키고, 치사시키고, 보존시키는 공정이다. 공정 후 가공은 조직이 염색 시약을 투과하도록 만들고 거대분자를 가교시켜, 이들이 위치에 안정화되고 갇히게 한다. 예를 들어, 보우인(Bouine) 용액, 포르말린 또는 액체 질소와 같은, 많은 고정액이 본 목적을 위해 사용된다. 그 다음 상기 고정된 조직을 왁스에 포매시켜, 얇은 섹션으로 절단하고 헤마톡실린 및 에오신 염색으로 염색될 수 있게 한다. 이 후, 마이크로톰(microtoming)은 현미경하에서 항체로의 염색을 연구하기 위해 미세한 섹션을 절단함으로써 실시된다.
상기 FFPE 조직으로부터 핵산을 분리하는 방법에 있어서 종래 방법은 DNA 미세 단편화, 단백질과의 엉킴 등으로 수율이 감소하는 문제가 있어 이를 높은 수율로 획득하는 방법의 개발이 요구되어 왔다.
본 발명에서는, FFPE 조직 절편을 포함하는 시료를 자성 비드; 및 염 및 PEG를 포함하는 용액과 반응시키고, 자성 비드에 결합된 핵산을 분리하는 방법을 개발하였다. 자성 비드와 FFPE 조직으로부터 분리된 핵산을 반응시킴에 있어서, 염 및 PEG를 포함하는 용액을 모두 포함하는 용액을 사용하는 경우, 자성 비드가 핵산을 보다 효과적으로 포획할 수 있어, 고수율로 핵산을 수득할 수 있음을 확인하였다. 특히, 제조된 지 10년 이상의 FFPE 조직 절편의 핵산 시료를 효과적으로 회수할 수 있음을 확인하였다. 나아가, 본 발명에서는 상기 방법에 있어 용해 완충액의 조성 역시 최적화하여 재현성 있게 FFPE 조직으로부터 핵산을 효과적으로 분리할 수 있는 기술을 개발하였다.
이하 본 발명의 단계 및 각 구성을 보다 상세히 설명한다.
본 발명의 방법에서 (a) 단계는 FFPE 조직 절편을 용해하여 제조된, 분리된 시료에 염 및 PEG를 포함하는 용액, 및 자성 비드를 첨가하여 핵산이 자성 비드에 결합하도록 하는 단계이다.
본 발명에서, 상기 조직은 핵산의 분석 또는 수득이 필요한 개체로부터 분리된 조직이라면 어떠한 동물로부터 분리된 것이라도 그 종류는 특별히 제한되지 않는다. 상기 FFPE 조직 절편은 핵산 분리에 적절한 크기를 가지는 FFPE 조직으로, 핵산 분리에 적합한 크기를 가지도록 FFPE 조직을 얇게 자른 형태일 수 있다. 또한 이에 제한되는 것은 아니나, 2 내지 10 ㎛의 두께일 수 있다. 본 발명의 FFPE 조직으로부터 핵산을 분리하는 방법에 이용되기 위한 FFPE 조직은 최근에 제조된 것뿐만 아니라 10년 이상 장기간 보관된 FFPE 조직 역시 적용 가능하다. 나아가, 종래 비드를 이용하는 핵산 분리 방법에서는 일반적으로 용해 단계 이후 에탄올을 첨가한 뒤 비드를 첨가하지만, 본 발명에서는 특히 용해 단계와 비드를 첨가하는 단계 사이에 에탄올을 첨가하지 않고 핵산을 분리할 수 있는 이점이 있다. 다만, 이에 제한되는 것은 아니다.
상기 FFPE 조직 절편을 용해하여 제조된, 분리된 시료는 FFPE 조직 절편을 용해 완충액(lysis buffer)으로 용해시켜 제조한 것일 수 있다.
이에 따라 본 발명의 방법은 FFPE 조직 절편에 용해 완충액을 첨가하는 제1 단계; 상기 제1 단계에서 용해된, 상기 시료에 염 및 PEG를 포함하는 용액 및 자성 비드를 첨가하는 제2 단계; 및 상기 자성 비드가 첨가된 시료에서 자성 비드를 획득하고, 이로부터 핵산을 분리하는 제3 단계를 포함할 수 있으나, 특별히 이에 제한되지 않는다.
본 발명자들은 다양한 조성의 용해 완충액을 비교하여, FFPE 시료에서 고순도 및 고수율로 핵산을 분리하기 위한 최적화된 용해 완충액 조성을 확립하였다.
FFPE 조직 절편의 용해를 위해 사용되는 상기 용해 완충액은 구체적으로, 킬레이트제(chelating agent), 계면활성제(ionic surfactant) 및 Tris-Cl을 포함하는 것일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 실시양태에 따르면, 상기 조성을 가진 용해 완충액을 사용하는 경우, 다른 완충액을 사용한 경우에 비하여, 자성 비드의 분리가 용이하거나/하며 수율이 높음을 확인하였다.
본 발명에서, 킬레이트 제는 Mg2 + 및 Ca2 +와 같은 이가 양이온을 격리시키기 위하여 사용될 수 있으며, 이에 따라 DNA를 이를 분해하는 효소들로부터 보호할 수 있으나, 이에 제한되지 않는다.
상기 킬레이트 제의 예로는 DTPA(diethylenetriaminepentaacetic acid), EDTA(ethylenediaminetetraacetic acid), EGTA(ethylene glycol tetraacetic acid), 및 NTA(N,N-bis(carboxymethyl)glycine)로 이루어진 군으로부터 선택된 것일 수 있으나, 이에 제한되지 않는다. 본 발명의 일 실시예에서는 EDTA를 킬레이트제로 사용하였다.
상기 EDTA는 EDTA 화합물(예, K2EDTA, K5EDTA, 또는 Na2EDTA) 중 EDTA 부분을 나타내는 것일 수 있으나, 이에 제한되지 않는다.
본 발명에서, 이온성 계면활성제(ionic surfactant)는 한 분자 내에 친수성과 소수성 부분을 함께 가지고 있는 물질로서, 해리 시 이온성인 특성을 나타내는 물질이다.
본 발명에서 사용될 수 있는 상기 이온성 계면활성제의 예로는, SDS(sodium dodecyl sulfate), 암모니움 라우릴 설페이트(ammonium lauryl sulfate), SLES(sodium lauryl ether sulfate), 소디움 미레쓰 설페이트(sodium myreth sulfate), 디옥틸 소디움 설포석시네이트(dioctyl sodium sulfosuccinate), PFOS(perfluorooctanesulfonate), 페르플루오로부탄설포네이트(perfluorobutanesulfonate), LABs(linear alkylbenzene sulfonates), 소디움 라우로일 사르코시네이트(sodium lauroyl sarcosinate), PFOA(perfluorononanoate) 및 PFO(perfluorooctanoate)를 들 수 있으나, 이에 제한되지 않는다.
상기 용해 완충액은 10 내지 100 mM 킬레이트제; 0.1 내지 5 % (w/v) 이온성 계면활성제; 또는/및 10 내지 100 mM Tris-Cl을 포함하는 것일 수 있으나, 이에 제한되지 않는다.
여기서, 상기 용해 완충액의 pH는 7.0 내지 8.5일 수 있다.
보다 구체적으로, 상기 용해 완충액은 EDTA, SDS 및 Tris-Cl을 포함하는 것일 수 있으나, 이에 제한되지 않는다.
또한, 상기 용해 완충액으로 FFPE 조직 시료를 용해시킬 때, 단백질 분해효소를 함께 첨가할 수 있다.
상기 단백질분해효소는 핵산 분리에 통상적으로 사용되는 다양한 단백질분해효소가 사용될 수 있으나, 그 예로 단백질분해효소 K(proteinase K)를 사용할 수 있다.
본 발명에서, 상기 자성 비드와 염 및 PEG를 포함하는 용액을 상기 시료에 첨가하는 것은 순차적으로, 또는 동시에 수행될 수 있으나, 이에 제한되지 않는다.
순차적으로 수행하는 경우, 자성 비드의 첨가 후 상기 용액을 첨가하거나, 상기 용액을 첨가한 다음, 자성 비드를 첨가하는 방식 모두 수행될 수 있다.
본 발명에서, 상기 자성 비드와 함께 첨가되는 염 및 PEG를 포함하는 용액은 특별히 이에 제한되지는 않으나, 100bp 혹은 100nt 이하의 작은 핵산 단편을 포획하는 것에 도움을 줄 수 있다.
상기 염 및 PEG(polyethylene glycol)를 포함하는 용액에서 상기 염은 그 종류가 특별히 제한되지 않으나, 그 예로 염화나트륨일 수 있다.
상기 용액의 PEG는 평균 분자량이 6,000 내지 10,000 Da인 PEG일 수 있으나, 이에 제한되지 않는다.
보다 구체적으로, 상기 염 및 PEG를 포함하는 용액은 1 내지 4 M의 염 및 10 내지 40 %(w/v)의 PEG를 포함하는 것일 수 있으나, 이에 제한되지 않는다.
본 발명에서 자성 비드는, 자기장에 반응하는 입자 또는 비드를 말한다. 일반적으로, 자성 비드는 자기장을 가지지 않으나, 자기장에 노출되는 자기쌍극자를 형성하는 물질을 말한다. 예컨대, 자기장 하에서 자화될 수 있으나, 자기장의 부재 하에서는 스스로는 자성을 가지지 않는 물질을 말한다. 본 발명에서 사용되는 자성은 상자성(paramagnetic) 또는 초상자성(superparamagnetic) 물질을 모두 포함하나, 이에 제한되지 않는다.
본 발명의 목적상 상기 자성 비드는 핵산에 결합하는 성질을 가지는 비드임이 바람직하고, 그 예로 핵산에 결합하는 관능기, 예컨대 -COOH기를 가지는 형태일 수 있으나, 이에 제한되지 않는다.
본 발명의 FFPE 조직으로부터 핵산을 분리하는 방법에는 이에 제한되는 것은 아니나, FFPE 조직을 탈파라핀화하는 단계가 포함될 수 있다.
상기 FFPE 조직은 고정된 조직을 왁스에 포매시킨 것이고, 대부분의 포매 매질은 소수성이므로, 친수성 시약을 주로 이용하는 조직학적, 세포학적 또는 분자생물학적 분석 전에 불활성 물질의 제거가 필요할 수 있다. 용어 "탈파라핀화(deparafinization)" 또는 "탈랍(dewaxing)"은 생물학적 샘플로부터 임의 유형의 포매 매질을 일부 또는 전체 제거하는 것을 나타내는 것으로 본 발명에서 광범위하게 사용된다. 예를 들어 이에 제한되는 것은 아니나, 파라핀 포매된 조직 절편은 유기 용매, 예컨대 톨루엔, 자일렌, 리모넨 또는 기타 적합한 용매를 통한 처리에 의해 탈파라핀화될 수 있다.
본 발명의 일 실시양태에 따르면 자일렌을 첨가하고 에탄올로 세척하는 과정을 수 회 거쳐 탈파라핀화를 수행하였다.
본 발명에서 상기 (b) 단계는 상기 자성 비드가 첨가된 시료에서 자성 비드를 획득하고, 이로부터 핵산을 분리하는 단계이다.
구체적으로, 상기 (b) 단계는 상기 (a) 단계에서 첨가된 자성 비드에 부착되어 있는 핵산을 자성 비드로부터 분리하는 단계이다.
상기 자성 비드가 첨가된 시료에서 자성 비드를 획득하기 전, 자성 비드를 세척하는 단계를 포함할 수 있다.
이때, 상기 자성 비드의 세척은 50 내지 95 %(v/v) 에탄올 용액, 구체적으로는 80 내지 90 %(v/v) 에탄올 용액을 사용하여 수행되는 것일 수 있다.
이와 같은 세척 과정은 자성 비드를 자성 스탠드 하에 두어, 자성 비드를 모은 다음, 상층액을 제거하고, 여기에 세척 완충액을 첨가하여 세척하는 방식으로 수행할 수 있다. 또한, 이러한 세척 단계는 1회 이상 수행할 수 있다.
이와 같은 세척 과정을 선택적으로 수행한 다음, 자성 비드를 분리하고, 분리된 자성 비드에 용출 완충액(elution buffer)을 첨가하는 등의 방식으로 자성 비드로부터 핵산을 분리할 수 있다.
본 발명의 구체적인 다른 양태는, 용해 완충액; 염 및 PEG를 포함하는 용액; 및 자성 비드를 포함하는 FFPE 조직으로부터 핵산을 분리하기 위한 키트이다.
용해 완충액, 염 및 PEG를 포함하는 용액, 및 자성 비드에 대해서는 앞서 설명한 바와 같다.
또한, 상기 키트는 핵산 분리에 일반적으로 사용되는 다른 기구, 용액 등을 추가로 포함할 수 있으며, FFPE 조직으로부터 핵산 분리를 위한 지시서 등을 포함할 수 있으나, 이에 제한되지 않는다.
또한, 상기 키트는 추가로 자성 비드 세척 완충액, 및 자성 비드 분리 기구(예, 자성 스탠드(magnetic stand))를 추가로 포함할 수 있으나, 이에 제한되지 않는다.
본 발명의 구체적인 다른 양태는, 킬레이트제, 이온성 계면활성제 및 Tris-Cl을 포함하는 FFPE 조직으로부터 핵산 분리를 위한 용해 완충액이다.
킬레이트제, 이온성 계면활성제, FFPE 조직으로부터 핵산 분리를 위한 용해 완충액에 대해서는 앞서 설명한 바와 같다.
이하 본 발명을 하기 예에 의해 상세히 설명한다. 다만, 하기 예는 본 발명을 예시하기 위한 것일 뿐, 하기 예에 의해 본 발명의 범위가 제한되지는 않는다.
실시예 1: FFPE 조직 표본으로부터 게놈 DNA의 분리(파라핀 제거 과정 포함)
(1) FFPE 블록 절편화 및 파라핀 제거
FFPE 블록을 6 ㎛ 두께로 자른 후 FFPE 조직 절편 1 또는 2개를 1.5㎖ 튜브에 담았다. 그 다음, 1㎖ 자일렌(xylene)을 첨가하고 혼합한 뒤 상온에서 12,000 x g로 3분간 원심분리하고, 상층액을 제거하였다. 그 다음, 0.8 ㎖ 자일렌 및 0.4 ㎖ EtOH를 첨가하고 혼합한 뒤 상온에서 12,000 x g로 3분간 원심분리하고, 상층액을 제거하였다. 그 다음, 1 ㎖ EtOH를 첨가하고 혼합한 뒤 상온에서 12,000 x g로 3분간 원심분리하고, 상층액을 제거하였다. 그 다음 잔존 EtOH를 완전히 증발시키기 위해 상온에서 0.5 내지 1시간 동안 인큐베이션하였다.
(2) 용해 및 게놈 DNA 분리
파라핀을 제거한 FFPE 조직 절편이 담긴 튜브에 용해 완충액(10mM Tris-Cl, pH 8.0, 100mM EDTA, pH 8.0, 0.5% SDS) 90 ㎕ 및 단백질 분해효소 K(proteinase K) 10 ㎕를 첨가하고 이를 혼합하여, 56℃에 밤새 인큐베이션하였다.
그 다음, 상기 튜브에 자성 비드(AMPure XP) 100㎕ 및 용액 A(2.5M NaCl, 20% PEG-8000) 100㎕를 각 튜브에 첨가하고 이를 혼합한 뒤, 상온에 3분간 인큐베이션하였다. 그 다음, 자성 스탠드(magnetic stand)에서 상기 튜브를 5분간 인큐베이션하고, 상기 튜브의 상층액을 제거하였다.
그 다음, 세척 완충액(85% EtOH) 500㎕를 첨가하고 반응시킨 후, 자성 스탠드 위에서 에탄올 상층액을 제거하였고, 상기 세척 과정을 수회 반복하였다.
그 다음, 비드를 건조시켰고, 자성 스탠드에서 반응 튜브를 빼어낸 다음, 용출 완충액(10 mM Tris-Cl, pH 8.5 또는 3차 증류수) 60㎕를 첨가하였다. 그 다음, 자성 스탠드 위에 반응 튜브를 둔 다음, 용출액을 분리하여, 게놈 DNA 시료를 수득하였다.
실시예 2: FFPE 조직 표본으로부터 게놈 DNA의 분리(파라핀 제거 과정 불포함)
(1) FFPE 블록 절편화
FFPE 블록을 6 ㎛ 두께로 자른 후 FFPE 조직 절편 1 또는 2개를 1.5㎖ 튜브에 담았다.
(2) 용해 및 게놈 DNA 분리
FFPE 조직 절편이 담긴 튜브에 용해 완충액(10mM Tris-Cl, pH 8.0, 100mM EDTA, pH 8.0, 0.5% SDS) 200 ㎕, 미네랄 오일 200 ㎕ 및 단백질 분해효소 K(proteinase K) 10㎕를 첨가하고 이를 혼합하여, 56℃에 밤새 인큐베이션하였다.
그 다음, 하부 층(lower phase)을 분리하여 새로운 튜브에 옮기고, 상기 튜브에 자성 비드(AMPure XP) 100 ㎕ 및 용액 A(2.5M NaCl, 20% PEG-8000) 100 ㎕를 각 튜브에 첨가하고 이를 혼합한 뒤, 상온에 3분간 인큐베이션하였다. 그 다음, 자성 스탠드(magnetic stand)에서 상기 튜브를 5분간 인큐베이션하고, 상기 튜브의 상층액을 제거하였다.
그 다음, 세척 완충액(85% EtOH) 500 ㎕를 첨가하고 반응시킨 후, 자성 스탠드 위에서 에탄올 상층액을 제거하였고, 상기 세척 과정을 수회 반복하였다.
그 다음, 비드를 건조시켰고, 자성 스탠드에서 반응 튜브를 빼어낸 다음, 용출 완충액(10 mM Tris-Cl, pH 8.5 또는 3차 증류수) 60 ㎕를 첨가하였다. 그 다음, 자성 스탠드 위에 반응 튜브를 둔 다음, 용출액을 분리하여, 게놈 DNA 시료를 수득하였다.
상기 실시예 1의 파라핀 제거 과정을 포함하는 방법과 상기 실시예 2의 파라핀 제거 과정을 불포함하는 방법을 통해 추출된 게놈 DNA를 비교하였을 때, DNA의 질적 특성은 비슷한 수준이었으나, 파라핀 제거 과정을 불포함한 경우에는 상기 과정을 포함한 경우의 80 내지 90% 정도의 수율을 보였다. 다만, 탈파라핀화를 별도로 수행하지 않는 경우 실험의 편의를 도모할 수 있으므로, 다 수의 시료에서 게놈 DNA를 추출하는 경우에 매우 유용하게 이용될 수 있다. 이후의 실험 과정은 실시예 1의 파라핀 제거 과정을 포함하는 방법으로 수행되었다.
실시예 3: DNA 정량 분석
(1) NanoDrop(ND)을 이용한 정량
Thermo Scientific 사의 NanoDrop 2000 장비를 이용하여 dsDNA 농도 측정 모드로 사용하였다. DNA 추출 용출액을 reference로 이용하여 blank 값을 보정한 후, 추출한 DNA 1 ㎕를 이용하여 OD260에서의 흡광도를 구하고, 다음의 식, dsDNA 농도 = 흡광도(OD260) * 50 ng/㎕을 이용하여 농도를 구한 후, 추출용매 총 부피인 100 ㎕를 곱해서 최종 수득률을 계산하였다.
(2) PicoGreen(PG)을 이용한 정량
Invitrogen사의 Quant-Ti Picogreen dsDNA assay kit를 구매하여 dsDNA 농도를 측정하는데 사용하였다.
가. PicoGreen 시약 준비
농도 측정 30분전에, 1X TE 완충액을 이용하여 PicoGreen 시약을 1/200로 희석한 후, 빛이 닿지 않도록 알루미늄 호일로 감싸서 실온에 보관하였다.
나. 표준 농도 DNA (Lambda DNA) 준비
키트에 포함되어 있는 표준 농도 DNA(100 ng/㎕)를 1X TE 완충액을 이용하여 2배씩 순차적으로 희석하여, 50, 25, 12.5, 6.3, 3.2, 1.6, 0.8 ng/㎕가 되도록 준비하였다. 그 다음 50 내지 0.8 ng/㎕로 준비된 상기 표준 농도 DNA 3㎕를 각각 1X TE 완충액 150 ㎕와 잘 섞은 후 보관하였다.
다. 추출된 FFPE DNA 준비
농도 측정 30분전에, 추출 FFPE DNA 3 ㎕를 1X TE 완충액 150 ㎕와 잘 섞은 후 보관하였다.
라. 농도측정 및 최종 수득률 계산
빛이 투과하지 않는 96 well assay plate의 각 well에 상기 가. 과정에서 준비한 PicoGreen 시약 50 ㎕와 각각의 DNA 50 ㎕(나. 및 다. 과정에서 준비된, 순차 희석된 표준 농도 DNA 및 추출 FFPE DNA 시료)를 넣고 잘 섞은 후, 상온에서 3분간 보관하였다.
그 다음, 2000g에서 1분간 원심분리한 후, 485nm 파장대에서 excitation 시키고 535nm 파장대에서의 값을 측정하였다. 이 때, 측정값의 정확도를 높이기 위해, 모든 DNA에 대해 3번씩 반복실험을 수행하며, DNA가 포함되지 않는 1X TE를 이용한 음성 대조군 값도 측정하였다. 다음으로 535nm 파장대에 대한, 모든 DNA 측정값에서 negative control 측정값을 뺀 보정수치를 계산하였다.
그 다음, 순차 희석된 표준 농도 DNA의 농도와 535nm 파장대의 보정수치를 이용하여, 535nm 측정값에 따른 DNA 농도 산출식을 작성하였다. 해당 산출식의 p-value(DNA 농도와 535nm 파장대 측정값의 linearity 에 대한)값이 0.99 이상인지를 확인하고, 그 이하인 경우는, 표준 농도 산출식 작성을 위해, 재측정하였다.
마지막으로, 상기 보정수치를 상기 표준 농도 산출식에 대입하여, 각각의 DNA 농도를 계산하고, 각 DNA의 농도에 추출용매 총 부피인 100 ㎕를 곱해서 최종 수득률을 계산하였다.
실시예 4: 10년 이상의 오래된 FFPE 조직을 이용한 PREP
오래된 FFPE blcok의 경우 gDNA의 절편화가 많이 진행되므로, 일반적인 크기의 게놈 DNA를 순수 분리하는 용도로 제작된 키트의 경우, DNA 수득률이 낮아질 수 있다. 본 연구에서는 DNA 추출과정에, PEG와 NaCl로 이루어진 용액을 최적화된 농도로 첨가하여, 작은 크기로 절편화된 DNA까지 획득할 수 있도록 하였으며, 이로 인해 오래된 FFPE DNA 수득률을 월등히 높일 수 있었다.
도 1의 상단과 중앙 그래프에 나타난 바와 같이, ND과 PG 정량값 간에 큰 차이가 나타나는 이유는, 본 발명의 DNA 분리 방법이 DNA 절편화로 인한 작은 크기의 게놈 DNA까지 수득한 것이기 때문이다. 가장 하단 그래프에 나타난 바와 같이, 오래된 FFPE block에서 작은 크기로 절편화된 DNA를 추출할 경우, 본 연구에서 개발한 비드 방법을 이용하였을 때, QIAGEN kit 대비 10배 이상의 수득률을 얻을 수 있음을 확인하였다.
실시예 5: 오래되지 않은 FFPE 조직을 이용한 PREP
최근에 제작된 FFPE block의 경우, DNA 절편화가 많이 진행되지 않아 비교적 큰 크기의 gDNA를 얻을 수 있다. 따라서, DNA 수득률과 PG 정량값 대비 ND 정량값의 비율에에 있어서, 비드 방법과 QIAGEN kit를 사용한 경우에 유사한 수준을 보이는 것을 확인할 수 있엇다(도 2).
실시예 6: 실시예 1의 게놈 DNA PREP 방법으로 수득한 시료의 clear genotyping
수득한 게놈 DNA의 질을 평가하기 위해, clear genotyping을 수행하였다. 구체적으로, 컬럼 방식(QIAGEN), 또는 비드 방식(100 ㎕ lysis buffer, 100 ㎕ lysis buffer + PEG 또는 50 ㎕ lysis buffer)으로 FFPE 조직 표본으로부터 분리한 9개의 게놈 DNA를 이용하여, 24곳의 SNPs site에 대한 유전형질 분석(genotyping)을 수행하였을 때 clear peak pattern을 정성 분석하였다. 상기 비드 방식 중 100 ㎕ lysis buffer + PEG 조건은 용해 과정에서 용해 완충액 100 ㎕ 사용하고, 이 후 PEG와 NaCl 혼합물인 용액 A를 100 ㎕ 첨가한 것을 의미하며, 나머지 100 ㎕ lysis buffer 및 50 ㎕ lysis buffer 조건은 용액 A를 첨가하지 않고 용해 완충액만 사용한 것을 의미한다.
상기 분석은 Germline mutation인 SNP 분석이기 때문에, 동형염기인 homo (100%) 또는 이형염기인 hetero (50%)로만 분석될 수 있음에도 불구하고, 주형으로 이용되는 게놈 DNA의 질에 따라 homo또는 hetero 인지를 판단하기 어려운 패턴(즉, 동형염기임에도 80~90%이거나, 이형염기임에도 10~20% 또는 80~90%로 나타나는 경우)의 이형염기가 나오는 경우가 있어, 상기 분석을 통해 추출된 DNA의 질을 판단할 수 있다.
Sanger sequencing 방법으로 확인된 genotype을 gold-standard로 삼아, 각 방법으로 얻은 게놈 DNA의 24곳의 SNPs에 대한 genotype 분석 시, homo (100%)와 hetero (50%)에 대해 가장 정확하게 분석이 이루어진 DNA가 어떤 방법으로 얻은 것인지를 확인하였다. 9개의 게놈 DNA에 대해 24곳의 SNP 분석이 이루어졌으므로, 총 216개의 genotypes 중 가장 명확한 genotype 결과의 수를 세어, 어떤 방법을 사용하였을 때 가장 많은 수의 명확한 genotype 결과를 얻을 수 있었는지를 분석하였다. 구체적인 실험과정은 다음과 같다.
(1) 24 SNP site에 대한 프라이머 (primer) 설계
Sequenom사의 Typer 프로그램의 Assay designer 모듈을 이용하여, 24곳의 SNP site 각각에 대해 PCR 프라이머와 UEP 프라이머를 설계하였다. 이 때, 증폭된 amplicons의 크기는 대략 100bp 정도이며, SNP 위치는 각 증폭산물의 중간에 위치하도록 설계하였다. 설계된 프라이머(서열번호 1 내지 서열번호 120)를 하기 표 1 및 표 2에 나타내었다.
PCR 프라이머 정보
SNP_ID 2nd-PCRP 1st-PCRP AMP_LEN
rs248205 ACGTTGGATGGGCTCATGGGAAGAATCATC(서열번호 1) ACGTTGGATGGGGCAACATACCACTATTG(서열번호 2) 102
rs2051068 ACGTTGGATGACCCTGGAAACCATTTCAGA(서열번호 3) ACGTTGGATGCTGAAGGTAAAGATTCAAG(서열번호 4) 101
rs1950501 ACGTTGGATGAATGACTCACCACTGACCAC(서열번호 5) ACGTTGGATGTGTTGTCTGGGAACTCAGGG(서열번호 6) 104
rs1952966 ACGTTGGATGGGCTCTGGTTACAACAGCTT(서열번호 7) ACGTTGGATGAGAAGTTTGCTTGGCTGAAG(서열번호 8) 120
AMG_mid100 ACGTTGGATGGGCTTGAGGCCAACCATCAG(서열번호 9) ACGTTGGATGCCTCATCCTGGGCACCCTGG(서열번호 10) 99
rs1385306 ACGTTGGATGGTCTGTCAGCTGTTCTGATG(서열번호 11) ACGTTGGATGGGCTCTGTATAGAGCTTTGG(서열번호 12) 99
rs1365740 ACGTTGGATGGTACTTACCTCCTGAGGTAG(서열번호 13) ACGTTGGATGACTTCCTATGTTGCCAGCAC(서열번호 14) 102
rs2016207 ACGTTGGATGCTGATGCAAAAATCTATGGC(서열번호 15) ACGTTGGATGGCTCTAGTAGATTGCTAGCC(서열번호 16) 107
rs1571256 ACGTTGGATGATACCGCAGAAGTTTGGCAC(서열번호 17) ACGTTGGATGGCATTCTAAACATGCCTCTC(서열번호 18) 99
rs1350836 ACGTTGGATGATTTCAGACTGTTGTGCTGG(서열번호 19) ACGTTGGATGCCTGTGGCCTTTTCATGGAG(서열번호 20) 102
rs120434 ACGTTGGATGATGCCTTGTTCCATGTGCTG(서열번호 21) ACGTTGGATGACACAAGTGGAAGCTTGCAG(서열번호 22) 101
rs2347790 ACGTTGGATGATGCTCCACCCACACAGTTC(서열번호 23) ACGTTGGATGACCTATGCAACAGCTGGAAG(서열번호 24) 93
rs298898 ACGTTGGATGCCATATATACAGGGTGTATAG(서열번호 25) ACGTTGGATGATAGTGTAGTGAGTGCTATG(서열번호 26) 103
rs2380657 ACGTTGGATGGCTAGGGTTGAAAACCAATG(서열번호 27) ACGTTGGATGGAATATGAGCACAACACACG(서열번호 28) 110
rs2180770 ACGTTGGATGCACTTGTCACAAACTCTAGG(서열번호 29) ACGTTGGATGAACCACAGTGAGCATGGAAG(서열번호 30) 113
rs58616 ACGTTGGATGTAGGCAGAAAAGGGCTGAAG(서열번호 31) ACGTTGGATGCCCTTCTGCTTTAACACTATC(서열번호 32) 114
rs265005 ACGTTGGATGATCAGGCACAATCTCTACCC(서열번호 33) ACGTTGGATGACACAAAGCTACCACTGCAC(서열번호 34) 101
rs1259859 ACGTTGGATGGCCAATTTTATAGAAACTC(서열번호 35) ACGTTGGATGTAGTATCAAGGTTTTCTGGC(서열번호 36) 104
rs1549944 ACGTTGGATGTGTCACATATGCTGGCCTTG(서열번호 37) ACGTTGGATGCTCTCTTGAAGAAGGTGCAG(서열번호 38) 100
rs1028330 ACGTTGGATGTTTTCGGGCAGTGAAGAGAC(서열번호 39) ACGTTGGATGCTCTACATCTGTGGGTCTAG(서열번호 40) 105
rs1390272 ACGTTGGATGCCTTTGATATTTGTTCCAC(서열번호 41) ACGTTGGATGCAGGATAGTCTACTATGTGC(서열번호 42) 97
rs1434199 ACGTTGGATGGGCATAGGGAGCTGAATCAA(서열번호 43) ACGTTGGATGCACCTCTGCCCCCTAATTTC(서열번호 44) 111
rs464221 ACGTTGGATGTGAGGACTTGGGATTAGGAC(서열번호 45) ACGTTGGATGAGGCAGCAGCAGAAGTTTAG(서열번호 46) 87
rs1522307 ACGTTGGATGTAGGGTCCAGAAATGTGTTG(서열번호 47) ACGTTGGATGGGAGAAGCAAGCCATAGATG(서열번호 48) 95
UEP 프라이머 정보
SNP_ID UEP_MASS UEP_SEQ EXT1_CALL EXT1_MASS EXT1_SEQ EXT2_CALL EXT2_MASS EXT2_SEQ
rs248205 4803 AAAGCTCCAACACACT(서열번호49 ) C 5050 AAAGCTCCAACACACTC(서열번호50) G 5090 AAAGCTCCAACACACTG(서열번호 51)
rs2051068 4955 GAGCGCACAGGTATAG(서열번호 52) T 5226 GAGCGCACAGGTATAGA(서열번호 53) C 5243 GAGCGCACAGGTATAGG(서열번호 54)
rs1950501 5284 GTGGGTACAAAGGTCAA(서열번호 55) G 5531 GTGGGTACAAAGGTCAAC(서열번호 56) C 5571 GTGGGTACAAAGGTCAAG(서열번호 57)
rs1952966 5194 CTTGGCTGAAGCAATAC(서열번호 58) A 5466 CTTGGCTGAAGCAATACA(서열번호 59) G 5482 CTTGGCTGAAGCAATACG(서열번호 60)
AMG_mid100 5203 tGGACCACTTGAGAAAC(서열번호 61) G 5451 tGGACCACTTGAGAAACC(서열번호 62) T 5475 tGGACCACTTGAGAAACA(서열번호 63)
rs1385306 5423 TTTGGCTCATCTGTTCTC(서열번호 64) G 5670 TTTGGCTCATCTGTTCTCC(서열번호 65) C 5710 TTTGGCTCATCTGTTCTCG(서열번호 66)
rs1365740 5631 CACCTTTTTCCTCTTCATT(서열번호 67) G 5918 CACCTTTTTCCTCTTCATTG(서열번호 68) T 5958 CACCTTTTTCCTCTTCATTT(서열번호 69)
rs2016207 5805 AGCACAGAATCCTTTAGAA(서열번호 70) C 6052 AGCACAGAATCCTTTAGAAC(서열번호 71) T 6132 AGCACAGAATCCTTTAGAAT(서열번호 72)
rs1571256 6019 TGCCTCTCAGTACTCTAGTC(서열번호 73) T 6290 TGCCTCTCAGTACTCTAGTCA(서열번호 74) C 6306 TGCCTCTCAGTACTCTAGTCG(서열번호 75)
rs1350836 6094 CCACCTCAAAGGGATATTAA(서열번호 76) C 6341 CCACCTCAAAGGGATATTAAC(서열번호 77) T 6421 CCACCTCAAAGGGATATTAAT(서열번호 78)
rs120434 6237 ggGTTGGCAACATGGTTAAG(서열번호 79) C 6484 ggGTTGGCAACATGGTTAAGC(서열번호 80) G 6524 ggGTTGGCAACATGGTTAAGG(서열번호 81)
rs2347790 6373 ccccGATGTGCGTATGCCTTA(서열번호 82) A 6644 ccccGATGTGCGTATGCCTTAA(서열번호 83) G 6660 ccccGATGTGCGTATGCCTTAG(서열번호 84)
rs298898 6451 GTGAGTGCTATGATCATTATC(서열번호 85) C 6698 GTGAGTGCTATGATCATTATCC(서열번호 86) T 6778 GTGAGTGCTATGATCATTATCT(서열번호 87)
rs2380657 6733 tggaACAACACACGTTTTTAGT(서열번호 88) C 6981 tggaACAACACACGTTTTTAGTC(서열번호 89) T 7061 tggaACAACACACGTTTTTAGTT(서열번호 90)
rs2180770 6943 ccAAATATAACCTTGATCCTCTG(서열번호 91) T 7214 ccAAATATAACCTTGATCCTCTGA(서열번호 92) C 7230 ccAAATATAACCTTGATCCTCTGG(서열번호 93)
rs58616 7014 TCTGCTTTAACACTATCAGGGTA(서열번호 94) G 7261 TCTGCTTTAACACTATCAGGGTAC(서열번호 95) A 7341 TCTGCTTTAACACTATCAGGGTAT(서열번호 96)
rs265005 7022 tttaTGCTCAACTGGACTATAAA(서열번호 97) T 7293 tttaTGCTCAACTGGACTATAAAA(서열번호 98) C 7309 tttaTGCTCAACTGGACTATAAAG(서열번호 99)
rs1259859 7110 gatgGGAGGTGATCCTTCTTATA(서열번호 100) C 7397 gatgGGAGGTGATCCTTCTTATAG(서열번호 101) A 7437 gatgGGAGGTGATCCTTCTTATAT(서열번호 102)
rs1549944 7469 ggggAGGAAAGAAACACTGATCCA(서열번호 103) A 7740 ggggAGGAAAGAAACACTGATCCAA(서열번호 104) G 7756 ggggAGGAAAGAAACACTGATCCAG(서열번호 105)
rs1028330 7561 ccacTGACATGTATCCACCATTATG(서열번호 106) T 7832 ccacTGACATGTATCCACCATTATGA(서열번호 107) C 7848 ccacTGACATGTATCCACCATTATGG(서열번호 108)
rs1390272 7613 gCTTGGTTTTTCTTAACAAGTTCAC(서열번호 109) T 7884 gCTTGGTTTTTCTTAACAAGTTCACA(서열번호 110) C 7900 gCTTGGTTTTTCTTAACAAGTTCACG(서열번호 111)
rs1434199 7686 gATTTGAAGGTCTAGAACTTTCATT(서열번호 112) G 7933 gATTTGAAGGTCTAGAACTTTCATTC(서열번호 113) C 7973 gATTTGAAGGTCTAGAACTTTCATTG(서열번호 114)
rs464221 8027 gtCAGCAGCAGAAGTTTAGACAATTA(서열번호 115) G 8274 gtCAGCAGCAGAAGTTTAGACAATTAC(서열번호 116) A 8354 gtCAGCAGCAGAAGTTTAGACAATTAT(서열번호 117)
rs1522307 8069 tagaAAGCCATAGATGAAAATACGGA(서열번호 118) C 8317 tagaAAGCCATAGATGAAAATACGGAC(서열번호 119) T 8396 tagaAAGCCATAGATGAAAATACGGAT(서열번호 120)
(2) iPLEX 반응 수행 ( Sequenom사의 iPLEX kit 사용)
가. Multiplex PCR 반응수행
각각의 방법으로 추출한 DNA 5 ng, 상기 표 1의 프라이머 혼합물(각 0.5 μM) 1.2 ㎕, dNTP mix (25 mM) 0.1 ㎕, Qiagen사의 HotStarTaq DNA polymerase (5U/㎕) 0.12 ㎕, 10x PCR buffer 0.65 ㎕, 25 mM MgCl2 0.35 ㎕를 섞고, 최종 부피가 5 ㎕가 되도록 3차 증류수를 첨가한 다음, 94 ℃에서 15분 반응시켜 HotStarTaq polymerase를 활성화한 후, [94 ℃ (20초)/56 ℃ (30초)/72 ℃ (60초)] 반응을 45회 반복한 후, 72 ℃에서 3분간 반응시켰다.
나. SAP(Shrimp Alkaline Phosphatase) 처리
Multiplex PCR 과정 중 각각의 증폭 산물 생성에 사용되지 않고 남아있는 dNTP를 비활성화시키기 위해, 상기 가. 과정에서 수행한 multiplex PCR 증폭반응물에, SAP buffer 0.2 ㎕, SAP 0.3 ㎕ 및 3차 증류수 1.5 ㎕를 첨가하고 37 ℃에서 40분, 그 다음 85 ℃에서 10분간 반응을 수행하였다.
다. Single Base Extension 반응 수행
상기 나. 반응의 결과물에, 10x Plus iPLEX buffer 0.2 ㎕, iPLEX termination mix 0.1 ㎕, UEP mix (각 분자량에 따라 7 또는 14 μM) 1.2 ㎕, Sequenase 0.02 ㎕, 3차 증류수 0.48 ㎕를 첨가한 다음, 94 ℃에서 30초 반응 후, [94 ℃ (5초)/ 52 ℃ (5초)/ 80 ℃ (5초)/ 52 ℃ (5초)/ 80 ℃ (5초)/ 52 ℃ (5초)/ 80 ℃ (5초)/ 52 ℃ (5초)/ 80 ℃ (5초)/ 52 ℃ (5초)/ 80 ℃ (5초)] 반응을 40회 반복한 후, 72 ℃에서 3분 인큐베이션하여 반응을 종료하였다.
(3) Genotyping 분석
상기 반응물 각각을 Sequenom사의 SpectroChip II의 각 spot에 분주한 후, Sequenom사의 MALDI-ToF 장비를 이용하여 데이터를 얻고, 이를 Sequenom사의 Typer Analyzer 프로그램으로 분석하여 24 SNP 각각에 대한 UEP 분자량의 변화를 확인함으로써, 각 SNP에 대한 genotype을 확인할 수 있었다.
그 결과, 도 3에 나타난 바와 같이, 100 ㎕ lysis buffer + PEG 방법으로 분리한 DNA를 주형으로 이용할 경우, 총 216개의 genotype 중 150개의 genotype이 clear peak pattern으로 나타나는 것을 확인하였다. 따라서 본 발명의 비드 방식의 DNA 추출 방법은 다른 DNA 추출 방법(QIAGEN, 100 ㎕ lysis buffer 또는 50 ㎕ lysis buffer)에 비해 가장 명확한 SNP genotyping이 가능하도록 양질의 DNA를 추출할 수 있는 방법임을 알 수 있다.
실시예 7: 실시예 1의 게놈 DNA PREP 방법으로 수득한 시료의 회복률(Recovery ratio) 분석
QIAamp DNA FFPE Tissue kit 를 이용하여 5개의 서로 다른 FFPE tissues에서 분리한 게놈 DNA 100 ng (PicoGreen 정량값 기준)을, QIAamp DNA FFPE Tissue kit, QIAquick PCR Purification kit, 또는 본 발명의 비드 방식(ASAN-Method)을 이용하여 재추출하였을 때의 회복률(Recovery ratio)을 비교하였다. 구체적인 실험 방법은 다음과 같다.
(1) QIAamp DNA FFPE Tissue kit
ATL 용액 200 ㎕에 순수 분리되어 있는 DNA 100 ng을 섞은 후, AL 용액과 100% 에탄올을 각각 200 ㎕씩 첨가한 후 잘 혼합하였다. 그 다음 2 ㎖ collection tube에 장착된 QIAamp MinElute column으로 옮긴 후, 8,000 rpm에서 1분간 원심분리하였다.
그 다음 QIAamp MinElute column을 새로운 2 ㎖ collection tube로 옮긴 후, 500 ㎕의 AW1 용액을 넣고 8,000 rpm에서 1분간 원심분리하였다.
그 다음 QIAamp MinElute column을 새로운 2 ㎖ collection tube로 옮긴 후, 500 ㎕의 AW2 용액을 넣고 8,000 rpm에서 1분간 원심분리하였다.
그 다음 QIAamp MinElute column을 새로운 2 ㎖ collection tube로 옮긴 후, 14,000 rpm에서 3분간 원심분리하였다.
그 다음 QIAamp MinElute column을 새로운 1.5 ㎖ 튜브로 옮긴 다음, 30 ㎕의 ATE 용액을 컬럼의 중앙에 분주하고 상온에서 1분간 둔 후, 14,000 rpm에서 1분간 원심분리하였다.
그 다음 QIAamp MinElute column을 제거하고, 1.5ml 튜브에 추출된 DNA 획득하였다. 그 다음 PicoGreen으로 농도를 측정하고, 용출액 부피인 30을 곱하여, 최종 회복률(최종 수득량/100 ng)을 계산하였다.
(2) QIAquick PCR Purification kit
순수 분리되어 있는 DNA 100 ng (10 ㎕)에 5배 부피(50 ㎕)의 PB1용액을 넣고 잘 혼합하였다. 그 다음 2 ㎖ collection tube에 장착된 QIAquick spin column으로 옮긴 후, 8,000 rpm에서 1분간 원심분리하였다.
그 다음 QIAquick spin column을 새로운 2 ㎖ collection tube로 옮긴 후, 750 ㎕의 PE 용액을 넣고 8,000 rpm에서 1분간 원심분리하였다.
그 다음 QIAquick spin column을 새로운 2 ml collection tube로 옮긴 후, 14,000 rpm에서 1분간 원심분리하였다.
그 다음 QIAquick spin column을 새로운 1.5 ㎖ 튜브로 옮긴 뒤 30 ㎕의 EB 용액을 column의 중앙에 분주하고 상온에서 1분간 둔 후, 14,000 rpm에서 1분간 원심분리하였다.
그 다음 QIAquick spin column을 제거하고, 1.5 ㎖ 튜브에 추출된 DNA를 획득하였다. 그 다음 PicoGreen으로 농도를 정량하고 용출액 부피인 30을 곱하여, 최종 회복률(최종 수득량/100ng)을 계산하였다.
(3) 본 발명의 비드 방식
깨끗한 1.5 ㎖ 튜브에 용해 완충액 100 ㎕에 순수 분리되어 있는 DNA 100 ng을 섞은 후, 자성 비드(AMPure XP)와 용액 A(2.5M NaCl, 20% PEG-8000)를 각각 100 ㎕씩 첨가한 후 잘 혼합하였다.
그 다음 상온에서 3분 반응시키고 자성 스탠드(magnetic stand)로 옮겨 5분간 둔 다음, 가라앉은 비드에 닿지 않도록 주의하면서 나머지 용액을 조심스럽게 제거하였다.
그 다음 85%의 에탄올 500 ㎕를 첨가한 후 30초 후 제거하는 과정을 2회 반복 후, 5분간 실온에 두어 잔여 에탄올을 증발시켰다.
그 다음 자성 스탠드에서 다른 곳으로 옮긴 뒤 30 ㎕의 용출용액을 첨가하고 완전히 섞은 후 실온에서 5분간 반응시켰다.
그 다음 다시 자성 스탠드로 옮겨 비드를 가라앉힌 후, 비드 펠렛은 건드리지 않도록 주의하면서, 새로운 1.5 ㎖ 튜브로 용액만 옮겨 추출된 DNA를 획득하였다. 그 다음 PicoGreen으로 농도를 정량하고 용출액 부피인 30을 곱하여, 최종 회복률(최종 수득량/100ng)을 계산하였다.
그 결과 도 4에 나타난 바와 같이, 비드를 이용한 방법(ASAN-Method)을 사용하였을 때, 가장 높은 회복률을 얻을 수 있었다. Qiagen 사의 두 제품간에서도 차이가 나타났는데, FFPE tissue kit 보다 PCR purification kit에서 보다 높은 회복률을 얻을 수 있었다. 이는, PCR 증폭산물과 같은 작은 크기의 DNA를 추출하는 용도로 제작된 키트이기 때문에, 작은 조각으로 절편화된 FFPE DNA를 보다 효율적으로 획득할 수 있었을 것으로 여겨진다. 하지만, 본 발명의 비드 방법의 경우, 이러한 PCR purification kit 보다도 월등히 높은 FFPE DNA 회복률을 보여주는 것으로 보아, 절편화된 FFPE DNA 획득에 우수하다는 사실을 알 수 있다.
실시예 8: 실시예 1의 게놈 DNA PREP 방법으로 수득한 시료의 수율 분석
본 연구에서 개발한 비드 방식으로 DNA를 추출할 경우, 획득 가능한 수득량을 확인하기 위해, 6 ㎛ 두께로 자른 동일 FFPE block 절편을 1 내지 5장까지 사용하여, DNA 수득률을 확인하였다(도 5). 그 결과 본 발명의 용해 완충액 100 ㎕, 비드 100 ㎕ 및 용액 A 100 ㎕ 조건을 사용할 경우, 획득 가능한 수득률은 PicoGreen 정량 기준으로 대략 5㎍ 정도 인 것으로 확인되었다.
실시예 9: 실시예 1의 게놈 DNA PREP 방법의 재현가능성 확인
총 5개의 서로 다른 FFPE 시료를 이용하여, 6 ㎛ 두께로 자른 FFPE 절편 4장을 이용하여, 타 기관의 연구원이 본 발명의 비드 방법과, MN사의 컬럼 방식의 키트를 이용하여, DNA를 추출하고 ND 및 PG 정량값을 구하여, 각 방법간의 DNA 수득률 및 추출 DNA의 질을 확인하였다.
먼저 전기영동을 이용하여 동일한 시료에 대하여 각각의 방법으로 추출한 DNA를 비교하였다. 구체적으로 최종 DNA 추출액 2 ㎕를 1.5 % 아가로스 겔에 로딩하고, 100 V에서 25분간 전기영동하고, Biorad사의 GelDoc 장비를 이용하여 전기영동 사진을 찍어 분석하였다. 이 때, DNA 크기를 확인하기 위해, 100bp DNA ladder를 함께 전기영동하였다.
그 결과 비드 방법으로 추출한 DNA가 MN kit 방법으로 추출한 DNA 보다 훨씬 더 진한 밴드 강도를 보임을 확인하였다(도 6).
또한, 비드로 추출한 DNA의 수득률이 2 내지 3배 가량 더 높음을 알 수 있다(도 7 좌측 및 중앙). 특히, 비드 방법으로 추출한 DNA와 MN kit로 추출한 DNA간의 수득률 비교에 있어, PicoGreen 정량값 차이가 NanoDrop 정량값 차이보다 더 큰 것으로 미루어 보아, 비드 방법으로 추출한 DNA에 intact form인 dsDNA가 더 많이 포함되어 있음을 유추해 볼 수 있다.
나아가, DNA의 질을 확인해 볼 수 있는 ND/PG 비율 분석에서도, 비드 방법으로 추출한 DNA가 MN kit로 추출한 DNA보다 상대적으로 더 낮은 ND/PG 비율을 나타내고 있음을 확인하였다(도 7 우측).
결론적으로, 본 발명의 자성 비드를 이용하여 FFPE 조직으로부터 핵산을 분리하는 방법은, 최근에 제작된 FFPE 조직 뿐만 아니라, 제작된지 10년 이상의 오래된 FFPE 조직에서도 다른 방식의 DNA 추출 방법에 비해 양질의 DNA를 높은 수율로 추출할 수 있다.
이상의 설명으로부터, 본 발명이 속하는 기술 분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (32)

  1. (a) FFPE(formalin-fixed, paraffin-embedded) 조직 절편을 용해하여 제조된, 분리된 시료에 염 및 PEG(polyethylene glycol)를 포함하는 용액 및 자성 비드를 첨가하는 단계; 및
    (b) 상기 자성 비드가 첨가된 시료에서 자성 비드를 획득하고, 이로부터 핵산을 분리하는 단계를 포함하는, FFPE 조직으로부터 핵산을 분리하는 방법.
  2. 제1항에 있어서,
    상기 분리된 시료는 킬레이트제(chelating agent), 이온성 계면활성제(ionic surfactant) 및 Tris-Cl을 포함하는 용해 완충액으로 FFPE 조직 절편을 용해시켜 제조한 것인, 방법.
  3. 제2항에 있어서,
    상기 용해 완충액은 10 내지 100 mM 킬레이트제; 0.1 내지 5 % (w/v) 이온성 계면활성제; 및 10 내지 100 mM Tris-Cl을 포함하는 것인, 방법.
  4. 제2항 또는 제3항에 있어서, 상기 용해 완충액의 pH는 7.0 내지 8.5인 것인, 방법.
  5. 제2항에 있어서,
    상기 킬레이트제(chelating agent)는 DTPA(diethylenetriaminepentaacetic acid), EDTA(ethylenediaminetetraacetic acid), EGTA(ethylene glycol tetraacetic acid), 및 NTA(N,N-bis(carboxymethyl)glycine)로 이루어진 군으로부터 선택된 것인, 방법.
  6. 제2항에 있어서, 상기 이온성 계면활성제는 SDS(sodium dodecyl sulfate), 암모니움 라우릴 설페이트(ammonium lauryl sulfate), SLES(sodium lauryl ether sulfate), 소디움 미레쓰 설페이트(sodium myreth sulfate), 디옥틸 소디움 설포석시네이트(dioctyl sodium sulfosuccinate), PFOS(perfluorooctanesulfonate), 페르플루오로부탄설포네이트(perfluorobutanesulfonate), LABs(linear alkylbenzene sulfonates), 소디움 라우로일 사르코시네이트(sodium lauroyl sarcosinate), PFOA(perfluorononanoate) 및 PFO(perfluorooctanoate)로 이루어진 군으로부터 선택된 것인, 방법.
  7. 제2항에 있어서, 상기 용해 완충액은 EDTA, SDS 및 Tris-Cl을 포함하는 것인, 방법.
  8. 제1항에 있어서, 상기 염 및 PEG를 포함하는 용액은 염화나트륨 및 PEG를 포함하는 것인, 방법.
  9. 제1항 또는 제8항에 있어서, 상기 PEG(polyethylene glycol)는 평균 분자량이 6,000 내지 10,000 Da인 PEG인 것인, 방법.
  10. 제1항에 있어서, 상기 염 및 PEG를 포함하는 용액은 1 내지 4 M의 염 및 10 내지 40 %(w/v)의 PEG를 포함하는 것인, 방법.
  11. 제2항에 있어서, 용해 완충액과 함께 단백질 분해효소를 FFPE 조직 절편에 첨가하는 것을 포함하는 것인, 방법.
  12. 제1항에 있어서, 상기 (b) 단계는 자성 비드가 첨가된 시료에서 자성 비드를 세척한 후, 자성 비드를 획득하고, 이로부터 핵산을 분리하는 것인, 방법.
  13. 제12항에 있어서, 상기 세척은 50 내지 95 %(v/v) 에탄올 용액을 사용하여 수행되는 것인, 방법.
  14. 제1항에 있어서, 상기 핵산은 게놈 DNA(genomic DNA)인, 방법.
  15. 제1항에 있어서, 상기 FFPE 조직 절편은 4 내지 8㎛ 두께인 것인, 방법.
  16. 제1항에 있어서, 상기 FFPE 조직은 제조된지 10년 이상인 것인, 방법.
  17. 제1항에 있어서, 상기 FFPE 조직 절편은 용해 전에 탈파라핀 된 것인, 방법.
  18. 용해 완충액(lysis buffer); 염 및 PEG(polyethylene glycol)를 포함하는 용액; 및 자성 비드를 포함하는, FFPE(formalin-fixed, paraffin-embedded) 조직으로부터 핵산을 분리하기 위한 키트.
  19. 제18항에 있어서,
    상기 용해 완충액은 킬레이트제(chelating agent), 이온성 계면활성제(ionic surfactant) 및 Tris-Cl을 포함하는 것인, 키트.
  20. 제18항에 있어서,
    상기 용해 완충액은 10 내지 100 mM 킬레이트제; 0.1 내지 5 % (w/v) 이온성 계면활성제; 및 10 내지 100 mM Tris-Cl을 포함하는 것인, 키트.
  21. 제18항 내지 제20항 중 어느 한 항에 있어서, 상기 용해 완충액의 pH는 7.0 내지 8.5인 것인, 키트.
  22. 제19항에 있어서,
    상기 킬레이트제(chelating agent)는 DTPA(diethylenetriaminepentaacetic acid), EGTA(ethylene glycol tetraacetic acid), 및 NTA(N,N-bis(carboxymethyl)glycine)로 이루어진 군으로부터 선택된 것인, 키트.
  23. 제19항에 있어서, 상기 이온성 계면활성제는 SDS(sodium dodecyl sulfate), 암모니움 라우릴 설페이트(ammonium lauryl sulfate), SLES(sodium lauryl ether sulfate), 소디움 미레쓰 설페이트(sodium myreth sulfate), 디옥틸 소디움 설포석시네이트(dioctyl sodium sulfosuccinate), PFOS(perfluorooctanesulfonate), 페르플루오로부탄설포네이트(perfluorobutanesulfonate), LABs(linear alkylbenzene sulfonates), 소디움 라우로일 사르코시네이트(sodium lauroyl sarcosinate), PFOA(perfluorononanoate) 및 PFO(perfluorooctanoate)로 이루어진 군으로부터 선택된 것인, 키트.
  24. 제18항에 있어서, 상기 용해 완충액은 EDTA, SDS 및 Tris-Cl을 포함하는 것인, 키트.
  25. 제18항에 있어서, 상기 염 및 PEG(polyethylene glycol)를 포함하는 용액은 염화나트륨 및 PEG를 포함하는 것인, 키트.
  26. 제18항 또는 제25항에 있어서, 상기 PEG(polyethylene glycol)는 평균 분자량이 6,000 내지 10,000 Da인 PEG인 것인, 키트.
  27. 제18항 또는 제25항에 있어서, 상기 염 및 PEG를 포함하는 용액은 1 내지 4 M의 염 및 10 내지 40 %(w/v)의 PEG를 포함하는 것인, 키트.
  28. 제18항에 있어서, 상기 키트는 추가로 자성 비드 세척 완충액, 자성 비드 분리 기구, 또는 둘 다를 추가로 포함하는 것인, 키트.
  29. 제28항에 있어서, 상기 자성 비드 세척 완충액은 50 내지 95 %(v/v) 에탄올 용액인 것인, 키트.
  30. 제28항에 있어서, 상기 자성 비드 분리 기구는 자성 스탠드(magnetic stand)인 것인, 키트.
  31. 제18항에 있어서, 상기 핵산은 게놈 DNA(genomic DNA)인, 키트.
  32. 킬레이트제(chelating agent), 이온성 계면활성제(ionic surfactant) 및 Tris-Cl을 포함하는, FFPE 조직으로부터 핵산 분리를 위한 용해 완충액.
PCT/KR2016/002461 2015-03-12 2016-03-11 Ffpe 조직에서 핵산의 분리 방법 WO2016144136A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN201680026192.0A CN107922940B (zh) 2015-03-12 2016-03-11 从ffpe组织中分离核酸的方法
EP16762023.6A EP3269813B1 (en) 2015-03-12 2016-03-11 A method for isolating a nucleic acid from an ffpe tissue
US15/557,551 US20180112208A1 (en) 2015-03-12 2016-03-11 A method for isolating a nucleic acid from an ffpe tissue

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020150034697A KR101728096B1 (ko) 2015-03-12 2015-03-12 Ffpe 조직에서 핵산의 분리 방법
KR10-2015-0034697 2015-03-12

Publications (1)

Publication Number Publication Date
WO2016144136A1 true WO2016144136A1 (ko) 2016-09-15

Family

ID=56879519

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/002461 WO2016144136A1 (ko) 2015-03-12 2016-03-11 Ffpe 조직에서 핵산의 분리 방법

Country Status (5)

Country Link
US (1) US20180112208A1 (ko)
EP (1) EP3269813B1 (ko)
KR (1) KR101728096B1 (ko)
CN (1) CN107922940B (ko)
WO (1) WO2016144136A1 (ko)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110093342A (zh) * 2019-03-28 2019-08-06 凡知医疗科技(江苏)有限公司 一种从石蜡包埋组织切片提取核酸的方法
CN110835628B (zh) * 2019-11-25 2021-07-27 宁波艾捷康宁生物科技有限公司 一种石蜡切片基因组dna提取的除蜡裂解液及提取试剂盒和提取方法
CN110938624A (zh) * 2019-12-27 2020-03-31 深圳市海普洛斯生物科技有限公司 一种用于基因组dna提取的试剂盒及其应用
CN111593047B (zh) * 2020-06-24 2021-08-20 申翌生物科技(杭州)有限公司 适用于组织样本的磁珠法核酸提取试剂盒及提取方法
CN113088515A (zh) * 2021-05-07 2021-07-09 杭州康代思锐生物科技有限公司 用于ffpe组织样本dna提取的试剂盒、方法及其应用
CN114317524B (zh) * 2021-12-28 2024-08-20 国家粮食和物资储备局科学研究院 用于粮食籽粒附着真菌dna提取的试剂、试剂盒及提取方法

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060078923A1 (en) * 2003-04-02 2006-04-13 Mckernan Kevin Method for isolating nucleic acids
US20060141450A1 (en) * 2002-12-09 2006-06-29 Xu Zhang Magnetism based rapid cell separation
WO2007068764A1 (de) * 2005-12-16 2007-06-21 Qiagen Gmbh Verfahren zur extraktion von biomolekülen aus fixierten geweben
US20130053254A1 (en) * 2010-02-26 2013-02-28 Qiagen Gmbh Process for parallel isolation and/or purification of rna and dna
US20140364597A1 (en) * 2013-06-06 2014-12-11 Rbc Bioscience Corp. Method for isolating nucleic acids from formalin-fixed paraffin embedded tissue samples

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101268189A (zh) * 2003-04-02 2008-09-17 亚钧阔特生命科学公司 分离核酸的方法
US8426126B2 (en) * 2004-03-18 2013-04-23 Applied Biosystems, Llc Modified surfaces as solid supports for nucleic acid purification
EP2193831A1 (de) * 2008-12-05 2010-06-09 Qiagen GmbH Parallel-Extraktion von unterschiedlichen Biomolekülen aus Formalin-fixiertem Gewebe
DE202009018981U1 (de) * 2009-07-01 2015-03-11 Axagarius Gmbh & Co. Kg Verwendung eines Kits für die Isolierung von Biomolekülen aus biologischen Proben sowie Kit dafür
CN101787364B (zh) * 2009-11-16 2011-09-28 浙江大学 一种从陈旧福尔马林固定组织提取dna的方法
EP3828270A1 (en) * 2012-09-28 2021-06-02 Cepheid Compositions for dna and rna extraction from fixed paraffin-embedded tissue samples
CN104328108A (zh) * 2014-08-06 2015-02-04 河南科技大学 一种快速提取和纯化福尔马林固定组织中dna的方法

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060141450A1 (en) * 2002-12-09 2006-06-29 Xu Zhang Magnetism based rapid cell separation
US20060078923A1 (en) * 2003-04-02 2006-04-13 Mckernan Kevin Method for isolating nucleic acids
WO2007068764A1 (de) * 2005-12-16 2007-06-21 Qiagen Gmbh Verfahren zur extraktion von biomolekülen aus fixierten geweben
US20130053254A1 (en) * 2010-02-26 2013-02-28 Qiagen Gmbh Process for parallel isolation and/or purification of rna and dna
US20140364597A1 (en) * 2013-06-06 2014-12-11 Rbc Bioscience Corp. Method for isolating nucleic acids from formalin-fixed paraffin embedded tissue samples

Also Published As

Publication number Publication date
KR101728096B1 (ko) 2017-04-20
EP3269813A1 (en) 2018-01-17
US20180112208A1 (en) 2018-04-26
CN107922940B (zh) 2022-02-08
CN107922940A (zh) 2018-04-17
EP3269813B1 (en) 2023-05-24
KR20160110806A (ko) 2016-09-22
EP3269813A4 (en) 2018-08-01

Similar Documents

Publication Publication Date Title
WO2016144136A1 (ko) Ffpe 조직에서 핵산의 분리 방법
WO2015183025A1 (ko) 표적 특이적 뉴클레아제를 이용한 표적 dna의 민감한 검출 방법
Datta et al. Laser capture microdissection: Big data from small samples
Yan et al. Identification of Gasz, an evolutionarily conserved gene expressed exclusively in germ cells and encoding a protein with four ankyrin repeats, a sterile-α motif, and a basic leucine zipper
WO2016144137A1 (ko) 순환 유리 핵산의 분리 방법
WO2016036172A1 (ko) 단백질 키나제 억제제에 대한 감수성 예측용 바이오 마커 및 이의 용도
WO2018169145A1 (ko) 진행성 위암 환자의 수술 후 예후 또는 항암제 적합성 예측 시스템
WO2024080731A1 (ko) 췌장암 진단을 위한 메틸화 마커 유전자 및 이의 용도
WO2019177345A1 (ko) 초고감도 바이오마커 다중 검출 방법
CA2689537C (en) Epigenetic methods
Wei et al. The transcription factor Sox30 is involved in Nile tilapia spermatogenesis
WO2024043743A1 (ko) Flt3 유전자 증폭용 조성물 및 이의 용도
WO2013105801A1 (ko) 만성 골수성 백혈병 융합 유전자형 타이핑용 프로브, 프라이머 및 이의 이용방법
WO2020184905A2 (ko) 유방암 샘플에서 질량분석법 의한 허2 정량 방법 및 이를 이용한 허2 상태 스코어링
WO2019013530A2 (ko) 진단 키트, 진단 방법 및 진단 장치
WO2015034178A1 (ko) 파라핀블록 제조용 혈중 세포 응집제 및 이를 이용한 파라핀블록 제조방법
WO2021107713A1 (ko) Lats1 유전자 변이 마커 기반의 근위축성 측삭경화증의 진단방법
WO2021251656A1 (ko) 엑소좀 유래 miRNA를 이용한 스트레스 진단기술
WO2022108407A1 (ko) 핵산 길이 비를 이용한 암 진단 및 예후예측 방법
WO2018194280A1 (ko) SDC2(Syndecan 2) 유전자의 메틸화 검출방법
WO2020159069A1 (ko) 압타머를 이용한 다중 multiplex pcr 방법
WO2016076524A1 (ko) Sing-pcrseq 방법을 적용한 핵산의 표준화 정량 분석 방법
WO2019194640A1 (ko) 분자 인덱스된 바이설파이트 시퀀싱
WO2024096467A1 (ko) 종양주변 정상조직을 이용한 대장암 예후 예측용 마커
WO2023090901A1 (ko) 기계 학습을 이용한 세포 노화의 마커를 선별하는 방법, 세포 노화 바이오 마커, 및 이를 이용한 세놀리틱 제제를 스크리닝 하는 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16762023

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2016762023

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 15557551

Country of ref document: US