WO2021194243A1 - 글루타메이트-시스테인 리가아제 변이체 및 이를 이용한 글루타치온 생산방법 - Google Patents

글루타메이트-시스테인 리가아제 변이체 및 이를 이용한 글루타치온 생산방법 Download PDF

Info

Publication number
WO2021194243A1
WO2021194243A1 PCT/KR2021/003617 KR2021003617W WO2021194243A1 WO 2021194243 A1 WO2021194243 A1 WO 2021194243A1 KR 2021003617 W KR2021003617 W KR 2021003617W WO 2021194243 A1 WO2021194243 A1 WO 2021194243A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
microorganism
variant
glutathione
glutamate
Prior art date
Application number
PCT/KR2021/003617
Other languages
English (en)
French (fr)
Inventor
양은빈
하철웅
김연수
임영은
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to CN202180022763.4A priority Critical patent/CN115768883A/zh
Priority to AU2021242116A priority patent/AU2021242116A1/en
Priority to JP2022555103A priority patent/JP2023517110A/ja
Priority to EP21774874.8A priority patent/EP4112725A4/en
Priority to CA3172465A priority patent/CA3172465A1/en
Priority to BR112022019055A priority patent/BR112022019055A8/pt
Priority to MX2022011597A priority patent/MX2022011597A/es
Publication of WO2021194243A1 publication Critical patent/WO2021194243A1/ko
Priority to ZA2022/10106A priority patent/ZA202210106B/en
Priority to JP2024063274A priority patent/JP2024084851A/ja

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/746—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y603/00—Ligases forming carbon-nitrogen bonds (6.3)
    • C12Y603/02—Acid—amino-acid ligases (peptide synthases)(6.3.2)
    • C12Y603/02002—Glutamate-cysteine ligase (6.3.2.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/85—Saccharomyces
    • C12R2001/865—Saccharomyces cerevisiae

Definitions

  • the present application relates to a novel glutamate-cysteine ligase variant and a glutathione production method using the same.
  • Glutathione is an organic sulfur compound most commonly present in cells, and is a tripeptide form in which three amino acids of glycine, glutamate, and cysteine are combined.
  • Glutathione exists in the body in two forms: reduced glutathione (GSH) and oxidized glutathione (GSSG).
  • GSH reduced glutathione
  • GSSG oxidized glutathione
  • Reduced glutathione (GSH) which is present in a relatively high proportion under normal circumstances, is mainly distributed in the liver and skin cells of the human body. It plays an important role, such as a whitening action that inhibits the production.
  • glutathione with various functions is spotlighted as a material in various fields such as pharmaceuticals, health functional foods, and cosmetics, and is also used in the manufacture of flavor materials, food and feed additives. It is known that glutathione has a great effect of increasing the taste of the raw material and maintaining rich taste, and can be used alone or in combination with other substances to be used as a kokumi flavor enhancer. In general, Kokumi material has a richer feeling than umami material such as nucleic acid and MSG, and is known to be produced by decomposition and aging of proteins.
  • the present inventors discovered a novel glutamate-cysteine ligase mutant and completed the present application by confirming that the glutathione-producing ability of the strain was greatly increased when introduced.
  • the present application provides a glutamate-cysteine ligase variant in which the amino acid corresponding to the 86th position from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.
  • the present application provides a polynucleotide encoding the variant, and a vector comprising the same.
  • the present application relates to the variant; a polynucleotide encoding the variant; And it provides a microorganism for producing glutathione, including any one or more of the vector containing the polynucleotide.
  • the present application provides a glutathione production method comprising the step of culturing the microorganism.
  • the novel glutamate-cysteine ligase variant of the present application greatly increases glutathione production, it can be usefully used for high glutathione production.
  • the produced glutathione has an antioxidant effect, a detoxification effect, and an immune enhancing effect, and thus can be usefully used in cosmetic compositions, food compositions, feed compositions, pharmaceutical compositions, and manufacturing thereof.
  • One aspect of the present application provides a glutamate-cysteine ligase variant in which the amino acid corresponding to the 86th position from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.
  • the variant comprises one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 1, wherein the substitution comprises an amino acid corresponding to the 86th position from the N-terminus of SEQ ID NO: 1 is substituted with another amino acid, glutamate-cysteine ligase It may be a glutamate-cysteine ligase variant.
  • the variant may be a protein variant in which amino acid 86 is substituted with another amino acid from the N-terminus in the amino acid sequence of SEQ ID NO: 1.
  • GCL Glutamate-cysteine ligase
  • Glutamate-cysteine ligase is an enzyme also called “glutamate-cysteine ligase” or “gamma-glutamylcysteine synthetase (GCS)” .
  • Glutamate-cysteine ligase is known to catalyze the following reactions:
  • the reaction catalyzed by the glutamate-cysteine ligase is known to be the first step in glutathione synthesis.
  • the glutamate-cysteine ligase is a yeast-derived sequence and may be a protein including the amino acid sequence of SEQ ID NO: 1, but is not limited thereto.
  • the amino acid sequence of SEQ ID NO: 1 is an amino acid sequence encoded by the gsh1 gene, and may be referred to as "GSH1 protein" or "glutamate-cysteine ligase".
  • the amino acid sequence constituting the glutamate-cysteine ligase of the present application can be obtained from a known database, GenBank of NCBI. For example, it may be derived from Saccharomyces cerevisiae, but is not limited thereto, and a sequence having the same activity as the amino acid sequence may be included without limitation.
  • glutamate-cysteine ligase is defined as a protein comprising the amino acid sequence of SEQ ID NO: 1, but a meaningless sequence before and after the amino acid sequence of SEQ ID NO: 1 or a naturally occurring mutation, or a latent mutation (silent) thereof mutation) is not excluded, and it is apparent to those skilled in the art that if it has the same or corresponding activity as the protein comprising the amino acid sequence of SEQ ID NO: 1, it corresponds to the glutamate-cysteine ligase of the present application.
  • the glutamate-cysteine ligase of the present application has the amino acid sequence of SEQ ID NO: 1 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology thereto, or It may be a protein comprising an amino acid sequence with identity.
  • a protein having an amino acid sequence in which some sequence is deleted, modified, substituted or added is also included within the scope of the protein subject to mutation of the present application. is self-evident
  • a 'polypeptide comprising the amino acid sequence of SEQ ID NO: 1' may belong to a 'polypeptide comprising the amino acid sequence of SEQ ID NO: 1' if it has the same or corresponding activity.
  • variant means that one or more amino acids differ from the recited sequence in conservative substitution and/or modification, but the function of the protein ( functions) or properties (properties) are maintained, and for the purpose of the present application, the amino acid corresponding to the 86th position from the N-terminus of SEQ ID NO: 1 among the glutamate-cysteine ligases described above is an amino acid other than cysteine It may be a variant substituted with a residue.
  • a variant differs from an identified sequence by several amino acid substitutions, deletions or additions. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the protein and evaluating the properties of the modified protein.
  • variants may include variants in which one or more portions, such as an N-terminal leader sequence or a transmembrane domain, are removed.
  • variants may include variants in which a portion is removed from the N- and/or C-terminus of the mature protein.
  • variant may include terms such as variant, modified, mutated protein, mutant polypeptide, mutant (in English, modified, modified protein, modified polypeptide, mutant, mutein, divergent, variant, etc.), If it is a term used in a mutated meaning, it is not limited thereto.
  • the mutant may have increased activity of the mutated protein compared to the natural wild-type or unmodified protein, but is not limited thereto.
  • conservative substitution means substituting one amino acid with another amino acid having similar structural and/or chemical properties. Such variants may have, for example, one or more conservative substitutions while still retaining one or more biological activities. Such amino acid substitutions may generally occur based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues.
  • variants may contain deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide.
  • the polypeptide may be conjugated with a signal (or leader) sequence at the N-terminus of the protein that is involved in the transfer of the protein either co-translationally or post-translationally.
  • the polypeptide may also be conjugated with other sequences or linkers to enable identification, purification, or synthesis of the polypeptide.
  • 'substitution with another amino acid' is not limited as long as it is an amino acid different from the amino acid before the substitution. That is, the substitution of cysteine, which is the 86th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1, with another amino acid can be expressed as "the 86th amino acid is substituted with an amino acid other than cysteine".
  • cysteine which is the 86th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1
  • cysteine which is the 86th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1
  • cysteine which is the 86th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1
  • cysteine which is the 86th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1
  • cysteine which is the 86th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1
  • cysteine which
  • the "glutamate-cysteine ligase variant” of the present application may be described as "a (mutant) polypeptide having glutamate-cysteine ligase activity", “GSH1 variant”, and a protein before mutation, a native wild-type polypeptide or an unmodified polypeptide It may be possible to increase glutathione production compared to, but is not limited thereto.
  • the variant may be one in which one or more amino acids in the amino acid sequence of SEQ ID NO: 1 are substituted with other amino acids.
  • the variant may include a mutation in which the amino acid corresponding to the 86th position in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid other than cysteine.
  • the other amino acids may be selected from glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, tyrosine, asparagine, glutamate, glutamine, aspartate, lysine, arginine and histidine. .
  • variant in which the 86th amino acid is substituted with another amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1 refers to the N or C terminus of the amino acid sequence of SEQ ID NO: 1, or an amino acid deletion / addition / insertion in the middle Even if it is described at a position other than position 86 by
  • glutamate-cysteine ligase variant in the present application a variant in which the 86th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid is described, but the glutamate-cysteine ligase variant of the present application is It is not limited to the variant of the amino acid sequence of SEQ ID NO: 1, and in any amino acid sequence having glutamate-cysteine ligase activity, "the amino acid corresponding to position 86 of the amino acid sequence of SEQ ID NO: 1" is substituted with another amino acid It is apparent that variants
  • amino acid corresponding to the 86th position of the amino acid sequence of SEQ ID NO: 1 in any amino acid sequence can be identified through various sequence alignment methods known in the art.
  • the glutamate-cysteine ligase variant is the amino acid sequence of SEQ ID NO: 1 or 80%, 85% thereof, It may be a protein containing an amino acid sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% homology or identity, wherein the amino acid corresponding to the 86th position of SEQ ID NO: 1 is substituted with another amino acid have.
  • Glutamate-cysteine ligase variant in which the 86th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1 of the present application is substituted with an amino acid other than cysteine, may include the amino acid sequence of any one of SEQ ID NOs: 3 to 21 . Specifically, it may consist essentially of the amino acid sequence of any one of SEQ ID NOs: 3 to 21, and more specifically, it may consist of the amino acid sequence of any one of SEQ ID NOs: 3 to 21, but is limited thereto doesn't happen
  • the variant comprises the amino acid sequence of any one of SEQ ID NOs: 3 to 21, or amino acid 86 in the amino acid sequence is fixed (ie, corresponding to position 86 of SEQ ID NOs: 3 to 21 in the amino acid sequence of the variant)
  • the amino acid is the same as the amino acid at position 86 of SEQ ID NOs: 3 to 21), and may include an amino acid sequence having 80% or more homology or identity therewith, but is not limited thereto.
  • the variant of the present application is at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of any one of SEQ ID NOs: 3 to 21 and SEQ ID NOs: 3 to 21 Polypeptides with homology or identity may be included. In addition, if it is an amino acid sequence having such homology or identity and exhibiting efficacy corresponding to the variant, proteins having an amino acid sequence in which some sequences are deleted, modified, substituted or added other than position 86 are also included in the scope of the present application. self-evident
  • the term 'homology' or 'identity' refers to a degree related to two given amino acid sequences or base sequences, and may be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably.
  • Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used.
  • Substantially, homologous or identical sequences generally have moderate or high stringency along at least about 50%, 60%, 70%, 80% or 90% of the entire or full-length sequence. It can hybridize under stringent conditions. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotides.
  • GAP program is defined as the total number of symbols in the shorter of two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
  • Default parameters for the GAP program are: (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.
  • Another aspect of the present application may provide a polynucleotide encoding the variant.
  • polynucleotide refers to a DNA or RNA strand of a certain length or longer as a polymer of nucleotides in which nucleotide monomers are linked in a long chain by covalent bonds, and more specifically, encoding the protein variant. It may be a polynucleotide fragment that
  • the polynucleotide encoding the protein variant of the present application may be included without limitation as long as it is a polynucleotide sequence encoding a glutamate-cysteine ligase variant that increases glutathione production ability.
  • the gene encoding the glutamate-cysteine ligase of the present application may be a gsh1 gene.
  • the gene may be derived from yeast. Specifically, it may be derived from Saccharomyces genus, more specifically Saccharomyces cerevisiae. Specifically, it may be a gene encoding the amino acid sequence of SEQ ID NO: 1, and more specifically, it may be a sequence including the nucleotide sequence of SEQ ID NO: 2, but is not limited thereto.
  • the polynucleotide encoding the protein variant of the present application is a coding region within a range that does not change the amino acid sequence of the polypeptide due to codon degeneracy or in consideration of codons preferred in an organism to express the polypeptide.
  • any polynucleotide sequence encoding a protein variant in which the amino acid corresponding to the 86th position in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid may be included without limitation.
  • the polynucleotide of the present application is a polynucleotide sequence encoding a protein variant of the present application, specifically, a protein comprising the amino acid sequence of any one of SEQ ID NOs: 3 to 21, or a polypeptide having homology or identity therewith may be, but is not limited thereto.
  • the homology or identity is as described above.
  • amino acid corresponding to the 86th position in the amino acid sequence of SEQ ID NO: 1 by hybridizing under stringent conditions with a probe that can be prepared from a known gene sequence for example, a sequence complementary to all or part of the polynucleotide sequence
  • a probe that can be prepared from a known gene sequence for example, a sequence complementary to all or part of the polynucleotide sequence
  • Any sequence encoding a protein variant substituted with another amino acid may be included without limitation.
  • stringent conditions means conditions that allow specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., supra). For example, genes having high homology between genes with 80% or more, specifically 90% or more, more specifically 95% or more, still more specifically 97% or more, particularly specifically 99% or more homology between genes Conditions that hybridize with each other and do not hybridize with genes with lower homology, or wash conditions of general Southern hybridization at 60° C., 1X SSC, 0.1% SDS, specifically 60° C., 0.1X SSC, 0.1% SDS, more specifically, at a salt concentration and temperature equivalent to 68° C., 0.1X SSC, 0.1% SDS, washing once, specifically 2 to 3 times, can be enumerated. However, the present invention is not limited thereto, and may be appropriately adjusted by those skilled in the art according to the purpose.
  • Hybridization requires that two polynucleotides have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the present application may also include substantially similar polynucleotide sequences as well as isolated polynucleotide fragments complementary to the overall sequence.
  • polynucleotides having homology can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the conditions described above.
  • the Tm value may be 60 °C, 63 °C or 65 °C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • the appropriate stringency for hybridizing polynucleotides depends on the length of the polynucleotides and the degree of complementarity, and the parameters are well known in the art.
  • Another aspect of the present application may provide a vector comprising a polynucleotide encoding the protein variant.
  • the term "vector” refers to a DNA preparation containing the nucleotide sequence of a polynucleotide encoding the target protein operably linked to a suitable regulatory sequence so that the target protein can be expressed in a suitable host.
  • suitable regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the vector After transformation into a suitable host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
  • the vector used in the present application is not particularly limited, and any vector known in the art may be used.
  • the yeast expression vector may be both an integrative yeast plasmid (YIp) and an extrachromosomal plasmid vector.
  • the extrachromosomal plasmid vector may include an episomal yeast plasmid (YEp), a replicative yeast plasmid (YRp), and a yeast centromer plasmid (YCp).
  • YACs artificial yeast chromosomes
  • available vectors include pESCHIS, pESC-LEU, pESC-TRP, pESC-URA, Gateway pYES-DEST52, pAO815, pGAPZ A, pGAPZ B, pGAPZ C, pGAPa A, pGAPa B, pGAPa C, pPIC3.5K , pPIC6 A, pPIC6 B, pPIC6 C, pPIC6 ⁇ A, pPIC6 ⁇ B, pPIC6 ⁇ C, pPIC9K, pYC2/CT, pYD1 Yeast Display Vector, pYES2, pYES2/CT, pYES2/NT A, pYES2/NT B, pYES2/NT C , pYES2/CT, pYES2.1, pYES-DEST52, pTEF1/Zeo, pFLD1, PichiaPinkTM, p4
  • a polynucleotide encoding a target protein in a chromosome may be replaced with a mutated polynucleotide through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted.
  • the selection marker is used to select cells transformed with the vector, that is, to determine whether a target nucleic acid molecule is inserted, and confer a selectable phenotype such as drug resistance, auxotrophicity, resistance to cytotoxic agents, or expression of surface proteins. markers may be used. In an environment treated with a selective agent, only the cells expressing the selectable marker survive or exhibit other expression traits, so that the transformed cells can be selected.
  • the term "transformation" refers to introducing a vector including a polynucleotide encoding a glutamate-cysteine ligase variant into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome, as long as they can be expressed in the host cell.
  • the polynucleotide may include DNA and RNA encoding a glutamate-cysteine ligase variant.
  • the polynucleotide may be introduced into a host cell and expressed in any form, as long as it can be expressed.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression.
  • the expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a target polypeptide of the present application and the gene sequence are functionally linked.
  • the method for transforming the vector of the present application includes any method of introducing a nucleic acid into a cell, and may be performed by selecting a suitable standard technique as known in the art depending on the host cell.
  • the present application relates to the variant; a polynucleotide encoding the variant; And it may include any one or more of vectors including the polynucleotide, to provide a microorganism producing glutathione.
  • the microorganism may be a microorganism expressing the mutant or a microorganism into which the mutant is introduced.
  • microorganism comprising a mutant refers to a microorganism having a naturally weak glutathione-producing ability or a glutathione-producing ability in a parent strain without glutathione-producing ability. It may be a given microorganism.
  • the microorganism is a microorganism expressing a glutamate-cysteine ligase variant comprising one or more amino acid mutations in the amino acid sequence of SEQ ID NO: 1, wherein the amino acid mutation is an amino acid corresponding to the 86th position from the N-terminus. It may contain a substituted mutation.
  • the microorganism may be a microorganism expressing a glutamate-cysteine ligase variant in which the amino acid corresponding to the 86th position in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.
  • the microorganism may be a Saccharomyces cerevisiae strain deposited with accession number KCCM12659, but is not limited thereto.
  • the glutamate-cysteine ligase and its variants are as described above.
  • the term, "to be expressed / being" a protein refers to a state in which a target protein is introduced into a microorganism or modified to be expressed in the microorganism.
  • the target protein is a protein present in a microorganism, it may mean a state in which its activity is enhanced compared to before intrinsic or modified.
  • the “protein of interest” may be the aforementioned glutamate-cysteine ligase variant.
  • introduction of protein may be one that exhibits the activity of a specific protein that the microorganism did not originally have, or exhibits improved activity compared to the intrinsic activity or activity before modification of the corresponding protein.
  • a polynucleotide encoding a specific protein may be introduced into a chromosome in a microorganism, or a vector including a polynucleotide encoding a specific protein may be introduced into the microorganism to exhibit its activity.
  • enhancement of activity may refer to improved activity compared to the intrinsic activity or activity prior to modification of a specific protein of a microorganism.
  • “Intrinsic activity” may refer to the activity of a specific protein originally possessed by the parent strain before transformation when the trait of a microorganism is changed due to genetic variation caused by natural or artificial factors.
  • the activity enhancement of the present application increases the intracellular copy number of the gene encoding the protein variant, introduces a mutation into the expression control sequence of the gene encoding the protein variant, and a gene expression control sequence encoding the protein variant.
  • Replacing a sequence with strong activity replacing a gene encoding a native protein on a chromosome with a gene encoding the protein variant, introducing a mutation in the gene encoding the protein to enhance the activity of the protein variant, and introducing a mutation into the microorganism It may be any one or more selected from the group consisting of introducing a protein variant, but is not limited thereto.
  • the copy number increase of the gene is not particularly limited, but may be performed in a form operably linked to a vector or inserted into a chromosome in a host cell.
  • a vector capable of replicating and functioning independently of a host to which a polynucleotide encoding the protein of the present application is operably linked may be introduced into a host cell.
  • a vector capable of inserting the polynucleotide into a chromosome in the host cell, to which the polynucleotide is operably linked may be introduced into the chromosome of the host cell. Insertion of the polynucleotide into a chromosome may be accomplished by any method known in the art, for example, by homologous recombination.
  • modifying the expression control sequence so as to increase the expression of the polynucleotide is not particularly limited thereto, but deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence to further enhance the activity of the expression control sequence, or their It can be carried out by inducing a mutation in the sequence in combination, or by replacing it with a nucleic acid sequence having a stronger activity.
  • the expression control sequence is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence for regulating the termination of transcription and translation, and the like.
  • a strong promoter may be linked to the upper portion of the polynucleotide expression unit instead of the original promoter, but is not limited thereto.
  • available promoters include TEF1 promoter, TEF2 promoter, GAL10 promoter, GAL1 promoter, ADH1 promoter, ADH2 promoter, PHO5 promoter, GAL1-10 promoter, TDH3 promoter (GPD promoter), TDH2 promoter, TDH1 promoter, PGK1 promoter, PYK2 promoter, ENO1 promoter, ENO2 promoter and TPI1 promoter.
  • the modification of the polynucleotide sequence on the chromosome is not particularly limited thereto, but a mutation in the expression control sequence by deletion, insertion, non-conservative or conservative substitution of a nucleic acid sequence or a combination thereof to further enhance the activity of the polynucleotide sequence. It can be carried out by inducing and replacing with a polynucleotide sequence improved to have stronger activity.
  • Incorporation and enhancement of such protein activity is generally performed such that the activity or concentration of the corresponding protein is at least 1%, 10%, 25%, 50%, based on the activity or concentration of the protein in the wild-type or unmodified microbial strain. It may be increased by 75%, 100%, 150%, 200%, 300%, 400% or 500%, up to 1000% or 2000%, but is not limited thereto.
  • the term "unmodified microorganism” does not exclude a strain containing a mutation that can occur naturally in a microorganism, it is a native strain itself, a microorganism that does not contain a variant of the protein, or a variant of the protein It may be a microorganism that has not been transformed with a vector containing the encoding polynucleotide.
  • the microorganism containing the glutamate-cysteine ligase variant or a polynucleotide encoding it may be, for example, a recombinant microorganism prepared by transformation with a vector containing the polynucleotide, but is limited thereto. doesn't happen
  • the recombinant microorganism may be yeast, for example, may be a microorganism of the genus Saccharomyces, specifically Saccharomyces cerevisiae, but is not limited thereto.
  • Glutathione is used interchangeably with “glutathione” and “GSH”, and refers to a tripeptide composed of three amino acids: glutamate, cysteine, and glycine. Glutathione may be used as a raw material for pharmaceuticals, health functional foods, flavoring materials, food, feed additives, cosmetics, etc., but is not limited thereto.
  • a microorganism producing glutathione includes all microorganisms in which genetic modification has occurred, either naturally or artificially, and a specific mechanism is weakened due to a cause such as insertion of an external gene or intensification or inactivation of an intrinsic gene.
  • the modified or enhanced microorganism it may be a microorganism having a genetic mutation or enhanced activity for the desired glutathione production.
  • the microorganism producing glutathione may refer to a microorganism capable of producing an excess of the desired glutathione compared to a wild-type or unmodified microorganism, including glutamate-cysteine ligase.
  • the “glutathione-producing microorganism” may be used interchangeably with terms such as “glutathione-producing microorganism”, “microorganism having glutathione-producing ability,” “glutathione-producing strain”, “strain having glutathione-producing ability”, and the like.
  • the glutathione-producing microorganism may be a recombinant microorganism.
  • the recombinant microorganism is as described above.
  • the glutathione-producing microorganism is not particularly limited in its type as long as it can produce glutathione, but may be a microorganism of the genus Saccharomyces, specifically Saccharomyces cerevisiae. However, it is not limited thereto.
  • the parent strain of the glutathione-producing microorganism including the mutant is not particularly limited as long as it is capable of producing glutathione.
  • the microorganism may further include mutations such as strengthening biosynthetic pathways for increasing glutathione production capacity, releasing feedback inhibition, degrading pathways or gene inactivation to weaken biosynthetic pathways, and such mutations do not exclude natural ones . However, it is not limited thereto.
  • Another aspect of the present application provides a glutathione production method comprising the step of culturing the microorganism.
  • the microorganism, glutathione is the same as described above. Through strain culture, glutathione can be accumulated in the cells.
  • the medium and other culture conditions used for culturing the strain of the present application may be used without any particular limitation as long as it is a medium used for culturing a microorganism of the genus Saccharomyces. It can be cultured under aerobic or anaerobic conditions in a normal medium containing a nitrogen source, phosphorus, inorganic compounds, amino acids and/or vitamins while controlling temperature, pH, etc.
  • the carbon source includes carbohydrates such as glucose, fructose, sucrose, maltose, and the like; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; Amino acids such as glutamate, methionine, lysine and the like may be included, but are not limited thereto.
  • natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugar cane offal and corn steep liquor can be used, including glucose and sterilized pre-treated molasses (i.e. molasses converted to reducing sugar).
  • Carbohydrates such as, etc. may be used, and other appropriate amounts of carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more thereof.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Organic nitrogen sources such as amino acids, peptones, NZ-amines, meat extracts, yeast extracts, malt extracts, corn steep liquor, casein hydrolysates, fish or degradation products thereof, defatted soybean cakes or degradation products thereof and the like can be used. These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Organic nitrogen sources such as amino acids, peptones, NZ-amines, meat extracts, yeast extracts, malt extracts, corn steep liquor, casein hydrolysates, fish or degradation products thereof, de
  • the phosphorus may include potassium first potassium phosphate, second potassium phosphate, or a sodium-containing salt corresponding thereto.
  • potassium first potassium phosphate potassium phosphate
  • second potassium phosphate or a sodium-containing salt corresponding thereto.
  • sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used.
  • the medium may contain amino acids, vitamins and/or appropriate precursors.
  • L-amino acid and the like may be added to the culture medium of the strain.
  • glycine, glutamate, and/or cysteine may be added, and if necessary, L-amino acids such as lysine may be further added, but not necessarily limited thereto. does not
  • the medium or precursor may be added to the culture in a batch or continuous manner, but is not limited thereto.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the culture in an appropriate manner during the culture of the strain to adjust the pH of the culture.
  • an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation.
  • oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen or carbon dioxide gas may be injected with or without gas to maintain anaerobic and microaerobic conditions.
  • the temperature of the culture may be 25° C. to 40° C., and more specifically, 28° C. to 37° C., but is not limited thereto.
  • the incubation period may be continued until a desired production amount of useful substances is obtained, and specifically, it may be 1 hour to 100 hours, but is not limited thereto.
  • the glutathione production method may further include an additional process after the culturing step.
  • the additional process may be appropriately selected depending on the use of glutathione.
  • the glutathione production method may include recovering glutathione from one or more substances selected from the strain, its dried product, extract, culture, and lysate after the culturing step.
  • the method may further include a step of lysing the strain before or simultaneously with the recovery step.
  • the lysis of the strain may be carried out by a method commonly used in the technical field to which the present application belongs, for example, a lysis buffer solution, a sonicator, heat treatment, and a French presser.
  • the lysis step may include an enzymatic reaction such as a cell wall degrading enzyme, a nucleic acid degrading enzyme, a nucleic acid transfer enzyme, a proteolytic enzyme, but is not limited thereto.
  • dry yeast containing a high content of glutathione through the glutathione manufacturing method yeast extract, yeast extract mix powder, pure purified glutathione (pure) glutathione), but is not limited thereto, and may be appropriately manufactured according to the desired product.
  • dry yeast may be used interchangeably with terms such as "dried strain”.
  • the dry yeast may be prepared by drying yeast cells accumulating glutathione, and specifically, may be included in a composition for feed, a composition for food, and the like, but is not limited thereto.
  • yeast extract may be used interchangeably with terms such as "strain extract".
  • the strain extract may mean a material remaining after separating the cell wall from the cells of the strain. Specifically, it may refer to the remaining components excluding the cell wall from the components obtained by lysing the cells.
  • the extract of the strain includes glutathione, and components other than glutathione may include at least one of protein, carbohydrate, nucleic acid, and fiber, but is not limited thereto.
  • glutathione a target material
  • glutathione a target material
  • the recovery step may include a purification process.
  • the purification process may be pure purification by separating only glutathione from the strain. Through the purification process, pure purified glutathione may be prepared.
  • the glutathione production method may further include a step of mixing a material selected from among the strains obtained after the culturing step, their dried products, extracts, cultures, and lysates, and glutathione recovered therefrom and an excipient.
  • yeast extract mix powder can be prepared.
  • the excipient may be appropriately selected and used according to the intended use or form, for example, starch, glucose, cellulose, lactose, glycogen, D-mannitol, sorbitol, lactitol, maltodextrin, calcium carbonate, synthetic aluminum silicate, Calcium monohydrogen phosphate, calcium sulfate, sodium chloride, sodium hydrogen carbonate, purified lanolin, dextrin, sodium alginate, methylcellulose, colloidal silica gel, hydroxypropyl starch, hydroxypropylmethylcellulose, propylene glycol, casein, calcium lactate , Primogel, and gum arabic, and specifically may be one or more components selected from starch, glucose, cellulose, lactose, dextrin, glycogen, D-mannitol, and maltodextrin, but is not limited thereto.
  • the excipient may include, for example, a preservative, a wetting agent, a dispersing agent, a suspending agent, a buffer, a stabilizing agent, or an isotonic agent, but is not limited thereto.
  • Another aspect of the present application provides the use of the glutamate-cysteine ligase variant for glutathione production. Another aspect of the present application provides a glutathione production use of the microorganism.
  • the glutamate cysteine ligase mutant and microorganism are as described above.
  • Example 1 Selection of glutathione-producing strains and confirmation of glutathione-producing ability
  • a strain having a glutathione-producing ability was selected by obtaining a strain from yeast containing various strains and improving it.
  • grain samples such as rice, barley, mung bean, and oats are collected from a total of 20 regions, including Yongin, Icheon, Pyeongtaek, and Hwaseong areas in Gyeonggi-do, Korea. After that, it was dried slowly to prepare yeast.
  • 25ml of YPD broth was dispensed in a 250ml Erlenmeyer flask, inoculated with the pure isolated strain, and cultured with shaking (30°C, 200 rpm) for 48 hours to check the glutathione production, and strain screening was performed.
  • a mutation (random mutation) was induced in the isolated strain. Specifically, a strain in which glutathione production was confirmed among the yeast isolated from the yeast was isolated and named CJ-37 strain. After culturing CJ-37 strain on a solid medium, the broth was inoculated to obtain a culture solution, and UV was irradiated to the cells using a UV lamp. Thereafter, only mutant strains that formed colonies were isolated and obtained by spreading the UV-irradiated culture medium on a plate medium, and their glutathione production was confirmed.
  • the strain showing the best glutathione production among the mutated strains was selected as the glutathione-producing strain and named CJ-5 strain. It was deposited on July 31 and was given the deposit number KCCM12568P.
  • strain CC02-2490 It was deposited with the (Korean Culture Center of Microorganisms, KCCM) on January 17, 2020 and was given an accession number KCCM12659P.
  • Saccharomyces cerevisiae (S. cerevisiae) CEN.PK2-1D and S. cerevisiae CJ-5 strains were produced to determine whether glutathione production was increased.
  • PCR was performed using the primers of SEQ ID NO: 22 and SEQ ID NO: 23 to secure a partial sequence of GSH1 N-terminal including the N-terminal BamHI flanking sequence, the initiation codon of the GSH1 ORF and the C86R variant coding sequence, and SEQ ID NO: 24 and the sequence
  • a partial sequence of GSH1 C-terminal including a C-terminal XhoI flanking sequence, a GSH1 ORF stop codon and a C86R mutation coding sequence was obtained using the primer of No. 25.
  • each PCR product was obtained S. cerevisiae CEN.PK2-1D and S. cerevisiae CJ-5 were transformed at the same molar ratio.
  • PCR was performed under the conditions of heat denaturation at 95°C for 5 minutes, binding at 53°C for 1 minute, and polymerization at 72°C for 1 minute per kb. , 1425), a modified lithium acetate method was used. Specifically, O.D. After washing yeast cells between 0.7 and 1.2 twice with lithium acetate/TE buffer, the PCR products and single stranded DNA (Sigma D-7656) are mixed together in lithium acetate/TE/40% PEG buffer for 30 minutes. After stationary culture at 42°C for 15 minutes, the cells were cultured on an SC (2% glucose) agar plate without Uracil until colonies were seen to obtain a strain in which the GSH1 C86R mutation coding sequence and KlURA3 gene were introduced. obtained.
  • SC 2% glucose
  • each strain was cultured in 2 ml of YPD overnight, diluted 1/100, spread on an SC (2% glucose) agar plate containing 0.1% 5-FOA, and the Uracil marker was removed.
  • cerevisiae CEN.PK2-1D GSH1 C86R mutant strain and S. cerevisiae CJ-5 GSH1 C86R mutant strain were prepared.
  • strains capable of expressing the GSH1 mutant protein substituted with the remaining 18 amino acids are also prepared using a primer pair in which the arginine coding sequence 86 on the primer sequences of SEQ ID NOs: 23 and 24 is substituted with a sequence encoding another amino acid. It was manufactured in the same way except for the points.
  • the glutathione-producing ability was confirmed by introducing a mutation into another Cys residue of the GSH1 protein, and the results are shown in Table 4.
  • cysteine residues other than cysteine 86 did not have an effect of increasing glutathione production, but rather showed a decrease in glutathione production.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

본 출원은 신규한 글루타메이트-시스테인 리가아제 변이체 및 이를 이용한 글루타치온 생산방법에 관한 것이다.

Description

글루타메이트-시스테인 리가아제 변이체 및 이를 이용한 글루타치온 생산방법
본 출원은 신규한 글루타메이트-시스테인 리가아제 변이체 및 이를 이용한 글루타치온 생산방법에 관한 것이다.
글루타치온(Glutathione, GSH)은 세포 내에서 가장 일반적으로 존재하는 유기 황화합물로 글리신(glycine), 글루타메이트(glutamate), 시스테인(cysteine)의 세 가지 아미노산들이 결합한 트리펩타이드(tripeptide) 형태이다.
글루타치온은 체내에서는 환원형 글루타치온(GSH)과 산화형 글루타치온(GSSG) 두 가지 형태로 존재한다. 일반적인 상황에서 상대적으로 높은 비율로 존재하는 환원형 글루타치온(GSH)은 인체의 간과 피부 세포에 주로 분포하며 활성산소를 분해·제거하는 항산화 기능, 독성물질과 같은 외인성 화합물의 제거 등 해독 작용, 멜라닌 색소 생성을 억제하는 미백작용 등 중요한 역할을 한다.
노화가 진행될수록 글루타치온 생성량은 점점 감소하기 때문에, 항산화, 해독작용에 중요한 역할을 하는 글루타치온 생성량의 감소는 노화의 주범인 활성산소의 축적을 촉진시키므로, 외부에서 글루타치온의 공급이 필요하다(Sipes IG et al, The role of glutathione in the toxicity of xenobiotic compounds: metabolic activation of 1,2-dibromoethane by glutathione, Adv Exp Med Biol. 1986;197:457-67.)..
이와 같이 다양한 기능을 지닌 글루타치온은 제약, 건강기능식품, 화장품 등 다양한 분야의 소재로 각광받고 있으며 맛소재, 식품 및 사료 첨가제 제조에 이용되기도 한다. 글루타치온은 원물의 맛 상승과 풍부한 맛 지속성 유지효과가 크며, 단독으로 사용하거나 다른 물질과 배합하여 고쿠미(kokumi) 향미증진제로 사용 할 수 있음이 알려져 있다. 보통 고쿠미 소재는 기존 핵산, MSG 등의 우마미(umami) 소재보다 농후감을 가지며, 단백질이 분해 숙성되어 생성되는 것으로 알려져 있다.
그러나 이와 같이 다양한 분야에 사용할 수 있는 글루타치온에 대한 수요가 증가되고 있음에도 불구하고, 높은 생산 단가로 인해 효소 합성 공정은 아직 상용화가 되어 있지 않으며, 미생물을 배양하여 균체로부터 추출하는 방법은 그 수율이 낮아, 글루타치온의 산업적 생산에 적지 않은 비용이 필요하기 때문에 시장이 크게 활성화되지 못하는 실정이다.
본 발명자들은 상기와 같은 문제점을 해결하기 위해 예의 노력한 결과, 신규한 글루타메이트-시스테인 리가아제 변이체를 발굴하였으며 이를 도입하는 경우 균주의 글루타치온 생산능이 크게 증가함을 확인하여 본 출원을 완성하였다.
본 출원은 서열번호 1의 아미노산 서열의 N-말단으로부터 86번째 위치에 상응하는 아미노산이 다른 아미노산으로 치환된 글루타메이트-시스테인 리가아제 변이체를 제공한다.
본 출원은 상기 변이체를 코딩하는 폴리뉴클레오티드, 및 이를 포함하는 벡터를 제공한다.
본 출원은 상기 변이체; 상기 변이체를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상을 포함하여 글루타치온을 생산하는 미생물을 제공한다.
본 출원은 상기 미생물을 배양하는 단계를 포함하는 글루타치온 생산 방법을 제공한다.
본 출원의 신규한 글루타메이트-시스테인 리가아제 변이체는 글루타치온 생산을 크게 증가시키므로 글루타치온의 고생산에 유용하게 이용될 수 있는바, 이와 같이 글루타치온을 고생산하는 효모, 이의 건조물, 추출물, 배양물, 파쇄물 및 생산된 글루타치온은, 항산화 효과, 해독 효과, 면역력 증강 효과를 가지는 것인바, 화장품용 조성물, 식품용 조성물, 사료용 조성물, 의약품 조성물 및 이의 제조에도 유용하게 사용될 수 있다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 출원의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 출원에 포함되는 것으로 의도된다.
본 출원의 하나의 양태는, 서열번호 1의 아미노산 서열의 N-말단으로부터 86번째 위치에 상응하는 아미노산이 다른 아미노산으로 치환된 글루타메이트-시스테인 리가아제 변이체를 제공한다.
상기 변이체는 서열번호 1의 아미노산 서열에서 하나 이상의 아미노산 치환을 포함하고, 상기 치환은 서열번호 1의 N-말단으로부터 86번째 위치에 상응하는 아미노산이 다른 아미노산으로 치환된 것을 포함하는, 글루타메이트-시스테인 리가아제(glutamate-cysteine ligase) 변이체 일 수 있다.
구체적으로, 상기 변이체는 서열번호 1의 아미노산 서열에서 N-말단으로부터 86번 아미노산이 다른 아미노산으로 치환된 단백질 변이체일 수 있다.
본 출원의 "글루타메이트-시스테인 리가아제(glutamate-cysteine ligase, GCL)"는 "글루타메이트-시스테인 연결효소" 또는 "감마-글루타밀시스테인 신테타아제(gamma-glutamylcysteine synthetase, GCS)" 라고도 칭해지는 효소이다. 글루타메이트-시스테인 리가아제는 다음의 반응을 촉매하는 것으로 알려져 있다:
L-glutamate + L-cysteine + ATP ↔ gamma-glutamyl cysteine + ADP + Pi
또한 상기 글루타메이트-시스테인 리가아제가 촉매하는 반응은 글루타치온 합성의 첫 번째 단계인 것으로 알려져 있다.
상기 글루타메이트-시스테인 리가아제는 효모 유래의 서열로, 서열번호 1의 아미노산 서열을 포함하는 단백질일 수 있으나, 이에 제한되지 않는다.
본 출원에서 상기 서열번호 1의 아미노산 서열은 gsh1 유전자에 의해 코딩되는 아미노산 서열로, "GSH1 단백질"또는 "글루타메이트-시스테인 리가아제"로 지칭할 수 있다. 본 출원의 글루타메이트-시스테인 리가아제를 구성하는 아미노산 서열은 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있다. 일 예로, 사카로마이세스 세레비지애(Saccharomyces cerevisiae) 유래일 수 있으나 이에 제한되지 않으며 상기 아미노산 서열과 동일한 활성을 갖는 서열은 제한 없이 포함될 수 있다.
또한, 본 출원에서 글루타메이트-시스테인 리가아제를 서열번호 1의 아미노산 서열을 포함하는 단백질이라고 정의하였으나, 서열번호 1의 아미노산 서열 앞뒤로의 무의미한 서열 또는 자연적으로 발생할 수 있는 돌연변이, 혹은 이의 잠재성 돌연변이(silent mutation)를 제외하는 것이 아니며, 서열번호 1의 아미노산 서열을 포함하는 단백질과 서로 동일 또는 상응하는 활성을 가지는 경우라면 본 출원의 글루타메이트-시스테인 리가아제에 해당됨은 당업자에게 자명하다.
구체적인 예를 들어, 본 출원의 글루타메이트-시스테인 리가아제는 서열번호 1의 아미노산 서열 또는 이와 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 갖는 아미노산 서열을 포함하는 단백질일 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 변이 대상이 되는 단백질의 범위 내에 포함됨은 자명하다.
즉, 본 출원에서 '특정 서열번호로 기재된 아미노산 서열을 갖는 단백질 또는 폴리펩티드', '특정 서열번호로 기재된 아미노산 서열을 포함하는 단백질 또는 폴리펩티드'라고 기재되어 있다 하더라도, 해당 서열번호의 아미노산 서열로 이루어진 폴리펩티드와 동일 혹은 상응하는 활성을 가지는 경우라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원에서 사용될 수 있음은 자명하다. 예를 들어, '서열번호 1의 아미노산 서열을 포함하는 폴리펩티드'는, 이와 동일 혹은 상응하는 활성을 가지는 경우라면 '서열번호 1의 아미노산 서열로 이루어진 폴리펩티드'에 속할 수 있음은 자명하다.
본 출원에서 용어, "변이체(variant)"는 하나 이상의 아미노산이 보존적 치환(conservative substitution) 및/또는 변형(modification)에 있어서 상기 열거된 서열 (the recited sequence)과 상이하나, 상기 단백질의 기능(functions) 또는 특성(properties)이 유지되는 단백질을 지칭하며, 본 출원의 목적 상 상기에서 설명한 글루타메이트-시스테인 리가아제 중, 서열번호 1의 N-말단으로부터 86번째 위치에 상응하는 아미노산이 시스테인 이외의 아미노산 잔기로 치환된 변이체일 수 있다. 변이체는 수 개의 아미노산 치환, 결실 또는 부가에 의해 식별되는 서열(identified sequence)과 상이하다. 이러한 변이체는 일반적으로 상기 단백질의 아미노산 서열 중 하나 이상의 아미노산을 변형하고, 상기 변형된 단백질의 특성을 평가하여 식별될 수 있다. 즉, 변이체의 능력은 본래 단백질(native protein)에 비하여 증가될 수 있다. 또한, 일부 변이체는 N-말단 리더 서열 또는 막전이 도메인(transmembrane domain)과 같은 하나 이상의 부분이 제거된 변이체를 포함할 수 있다. 다른 변이체는 성숙 단백질 (mature protein) 의 N- 및/또는 C-말단으로부터 일부분이 제거된 변이체를 포함할 수 있다. 상기 용어 "변이체"는 변이형, 변형, 변이된 단백질, 변이형 폴리펩티드, 변이 등의 용어(영문 표현으로는 modification, modified protein, modified polypeptide, mutant, mutein, divergent, variant 등)가 사용될 수 있으며, 변이된 의미로 사용되는 용어라면 이에 제한되지 않는다. 본 출원의 목적상, 상기 변이체는 천연의 야생형 또는 비변형 단백질 대비 변이된 단백질의 활성이 증가된 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 상기 변이체는 하나 이상의 생물학적 활성을 여전히 보유하면서, 예를 들어 하나 이상의 보존적 치환을 가질 수 있다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다.
또한, 변이체는 폴리펩티드의 특성과 2차 구조에 최소한의 영향을 갖는 아미노산들의 결실 또는 부가를 포함할 수 있다. 예를 들면 폴리펩티드는 번역-동시에(co-translationally) 또는 번역-후에(post-translationally) 단백질의 이전(transfer)에 관여하는 단백질 N-말단의 시그널(또는 리더) 서열과 컨쥬게이트 할 수 있다. 또한 상기 폴리펩티드는 폴리펩티드를 확인, 정제, 또는 합성할 수 있도록 다른 서열 또는 링커와 컨쥬게이트 될 수 있다.
본 출원에서, '다른 아미노산으로 치환'은 치환 전의 아미노산과 다른 아미노산이면 제한되지 않는다. 즉 서열번호 1의 아미노산 서열의 N-말단으로부터 86번째 아미노산인 시스테인이 다른 아미노산으로 치환되는 것은 "86번째 아미노산이 시스테인 이외의 아미노산으로 치환되는" 것으로 표현할 수 있다. 한편, 본 출원에서 '특정 아미노산이 치환되었다'고 표현하는 경우, 다른 아미노산으로 치환되었다고 별도로 표기하지 않더라도 치환 전의 아미노산과 다른 아미노산으로 치환되는 것임은 자명하다.
본 출원의 "글루타메이트-시스테인 리가아제 변이체" 는 "글루타메이트-시스테인 리가아제 활성을 갖는 (변이형) 폴리펩티드", "GSH1 변이체"로 기재될 수 있으며, 변이 전의 단백질, 천연의 야생형 폴리펩티드 또는 비변형 폴리펩티드에 비해 글루타치온 생산량을 증가시킬 수 있는 것일 수 있으나 이에 제한되지 않는다.
상기 변이체는 서열번호 1의 아미노산 서열에서 하나 이상의 아미노산이 다른 아미노산으로 치환된 것일 수 있다. 구체적으로, 상기 변이체는 서열번호 1의 아미노산 서열에서 86번째 위치에 상응하는 아미노산이 시스테인 외의 아미노산으로 치환된 변이를 포함할 수 있다. 상기 다른 아미노산은 글리신, 알라닌, 발린, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판, 프롤린, 세린, 쓰레오닌, 타이로신, 아스파라긴, 글루타메이트, 글루타민, 아스파테이트, 라이신, 아르기닌 및 히스티딘 중에서 선택되는 것일 수 있다.
본 출원에서 "서열번호 1의 아미노산 서열의 N-말단으로부터 86번째 아미노산이 다른 아미노산으로 치환된 변이체"는, 서열번호 1의 아미노산 서열의 N 또는 C 말단, 또는 중간의 아미노산 결실/부가/삽입 등에 의해 86번이 아닌 다른 위치로 기재되는 경우라고 하더라도, 서열번호 1의 아미노산 서열의 86번 위치에 상응하는 아미노산이 다른 아미노산으로 치환된 변이체를 포함하는 것은 자명하다. 또한, 본 출원에서 글루타메이트-시스테인 리가아제 변이체의 일 예로서 서열번호 1의 아미노산 서열의 N-말단으로부터 86번째 아미노산이 다른 아미노산으로 치환된 변이체를 기재하였으나, 본 출원의 글루타메이트-시스테인 리가아제 변이체는 서열번호 1의 아미노산 서열의 변이체에 제한되지 않고, 그 밖에 글루타메이트-시스테인 리가아제 활성을 가지는 임의의 아미노산 서열에서 "서열번호 1의 아미노산 서열의 86번 위치에 상응하는 아미노산"이 다른 아미노산으로 치환된 변이체 역시 본 출원의 글루타메이트-시스테인 리가아제 변이체의 범위에 포함되는 것은 자명하다.
임의의 아미노산 서열 내에서 "서열번호 1의 아미노산 서열의 86번째 위치에 상응하는 아미노산" 은, 당업계에 공지된 다양한 서열 얼라인먼트(alignment) 방법을 통해 확인할 수 있다.
본 출원의 서열번호 1의 아미노산 서열의 N-말단으로부터 86번째 위치에 상응하는 아미노산이 다른 아미노산으로 치환된, 글루타메이트-시스테인 리가아제 변이체는, 서열번호 1의 아미노산 서열 또는 이와 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 갖는 아미노산 서열을 포함하고 서열번호 1의 86번째 위치에 상응하는 아미노산이 다른 아미노산으로 치환된 단백질일 수 있다.
본 출원의 서열번호 1의 아미노산 서열의 N-말단으로부터 86번째 아미노산이 시스테인 외의 아미노산으로 치환된, 글루타메이트-시스테인 리가아제 변이체는, 서열번호 3 내지 21 중 어느 하나의 아미노산 서열을 포함하는 것일 수 있다. 구체적으로 서열번호 3 내지 21 중 어느 하나의 아미노산 서열로 필수적으로 구성되는 (consisting essentially of) 것일 수 있고, 보다 구체적으로는 서열번호 3 내지 21 중 어느 하나의 아미노산 서열로 구성되는 것일 수 있으나 이에 제한되지 않는다.
또한 상기 변이체는 서열번호 3 내지 21 중 어느 하나의 아미노산 서열을 포함하거나, 또는 상기 아미노산 서열에서 86번 아미노산은 고정되고(즉, 변이체의 아미노산 서열에서 상기 서열번호 3 내지 21의 86번 위치에 상응하는 아미노산은 상기 서열번호 3 내지 21의 86번 위치의 아미노산과 동일하고), 이와 80% 이상의 상동성 또는 동일성을 갖는 아미노산 서열을 포함할 수 있으나, 이에 제한되는 것은 아니다.
구체적으로 본 출원의 상기 변이체는 서열번호 3 내지 21 및 상기 서열번호 3 내지 21 중 어느 하나의 아미노산 서열과 적어도 80%, 90%, 95%, 96%, 97%, 98%, 또는 99% 상동성 또는 동일성을 가지는 폴리펩티드를 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 변이체에 상응하는 효능을 나타내는 아미노산 서열이라면, 86번 위치 이외에, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 범위에 포함됨은 자명하다.
본 출원에서 용어 '상동성(homology)' 또는 '동일성(identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열과 관련된 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된 (conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나 (homologous) 또는 동일한 (identical) 서열은 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90%를 따라 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려된다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 예를 들어, Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다. (GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol.48 : 443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의한다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL(NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
또한, 임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려진 방법(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York)으로 결정될 수 있다.
본 출원의 다른 하나의 양태는 상기 변이체를 코딩하는 폴리뉴클레오티드를 제공할 수 있다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 단백질 변이체를 코딩하는 폴리뉴클레오티드 단편일 수 있다.
본 출원의 단백질 변이체를 코딩하는 폴리뉴클레오티드는, 글루타치온 생산능을 증가시키는 글루타메이트-시스테인 리가아제 변이체를 코딩하는 폴리뉴클레오티드 서열이라면 제한 없이 포함될 수 있다.
본 출원의 글루타메이트-시스테인 리가아제를 코딩하는 유전자는 gsh1 유전자일 수 있다. 상기 유전자는 효모 유래 일 수 있다. 구체적으로는 사카로마이세스(Saccharomyces) 속, 보다 구체적으로는 사카로마이세스 세레비지애(Saccharomyces cerevisiae) 유래일 수 있다. 구체적으로는 서열번호 1의 아미노산 서열을 코딩하는 유전자일 수 있으며, 보다 구체적으로 서열번호 2의 염기서열을 포함하는 서열일 수 있으나 이에 제한되지 않는다.
본 출원의 단백질 변이체를 코딩하는 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 폴리펩티드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리펩티드의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 서열번호 1의 아미노산 서열에서 86번째 위치에 상응하는 아미노산이 다른 아미노산으로 치환된 단백질 변이체를 코딩하는 폴리뉴클레오티드 서열이라면 제한 없이 포함할 수 있다. 예를 들어, 본 출원의 폴리뉴클레오티드는 본 출원의 단백질 변이체, 구체적으로는 상기 서열번호 3 내지 21 중 어느 하나의 아미노산 서열을 포함하는 단백질 또는 이와 상동성 또는 동일성을 갖는 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열일 수 있으나, 이에 제한되지 않는다. 상기 상동성 또는 동일성에 대해서는 전술한 바와 같다.
또한, 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 폴리뉴클레오티드 서열 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이브리드화하여 서열번호 1의 아미노산 서열에서 86번째 위치에 상응하는 아미노산이 다른 아미노산으로 치환된 단백질 변이체를 코딩하는 서열이라면 제한 없이 포함할 수 있다.
상기 "엄격한 조건"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌 (예컨대, J. Sambrook et al., 상동)에 구체적으로 기재되어 있다. 예를 들어, 상동성이 높은 유전자끼리, 80% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화의 세척 조건인 60℃, 1X SSC, 0.1% SDS, 구체적으로는 60℃, 0.1X SSC, 0.1% SDS, 보다 구체적으로는 68℃, 0.1X SSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다. 그러나 이에 제한되는 것은 아니며, 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치 (mismatch)가 가능할지라도, 두 개의 폴리뉴클레오티드가 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 폴리뉴클레오티드 서열뿐만 아니라 전체 서열에 상보적인 단리된 폴리뉴클레오티드 단편을 포함할 수 있다.
구체적으로, 상동성을 가지는 폴리뉴클레오티드는 55 ℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65 ℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다.
본 출원의 다른 하나의 양태는 상기 단백질 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 제공할 수 있다.
본 출원에서 사용된 용어 "벡터"는 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 코딩하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 효모 발현 벡터는 조합 효모 플라스미드(YIp: integrative yeast plasmid) 및 염색체 외 플라스미드 벡터(extrachromosomal plasmid vector)가 모두 가능하다. 상기 염색체 외 플라스미드 벡터는 에피솜 효모 플라스미드(YEp: episomal yeast plasmid), 복제 효모 플라스미드(YRp: replicative yeast plasmid) 및 효모 중심체 플라스미드(YCp: yeast centromer plasmid)를 포함할 수 있다. 또한, 인위적 효모 염색체들(YACs: artificial yeast chromosomes)도 본 출원의 벡터로 이용이 가능하다. 구체적인 예로서, 이용 가능한 벡터는 pESCHIS, pESC-LEU, pESC-TRP, pESC-URA, Gateway pYES-DEST52, pAO815, pGAPZ A, pGAPZ B, pGAPZ C, pGAPα A, pGAPα B, pGAPα C, pPIC3.5K, pPIC6 A, pPIC6 B, pPIC6 C, pPIC6α A, pPIC6α B, pPIC6α C, pPIC9K, pYC2/CT, pYD1 Yeast Display Vector, pYES2, pYES2/CT, pYES2/NT A, pYES2/NT B, pYES2/NT C, pYES2/CT, pYES2.1, pYES-DEST52, pTEF1/Zeo, pFLD1, PichiaPinkTM, p427-TEF, p417-CYC, pGAL-MF, p427-TEF, p417-CYC, PTEF-MF, pBY011, pSGP47, pSGP46, pSGP36, pSGP40, ZM552, pAG303GAL-ccdB, pAG414GAL-ccdB, pAS404, pBridge, pGAD-GH, pGAD T7, pGBK T7, pHIS-2, pOBD2, pRS408, pRS410, pRS418, pRS420, pRS428, yeast micron A form, pRS403, pRS404, pRS405, pRS406, pYJ403, pYJ404, pYJ405 및 pYJ406를 포함하나, 이에 한정되는 것은 아니다.
일례로 세포 내 염색체 삽입용 벡터를 통해 염색체 내에 목적 단백질을 코딩하는 폴리뉴클레오티드를 변이된 폴리뉴클레오티드로 교체시킬 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 용어 "형질전환"은 글루타메이트-시스테인 리가아제 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것 일 수 있다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 글루타메이트-시스테인 리가아제 변이체를 코딩하는 DNA 및 RNA를 포함할 수 있다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트 (expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터 (promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 한정되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다. 본 출원의 벡터를 형질전환시키는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법 (electroporation), 인산칼슘 (CaPO4) 침전, 염화칼슘 (CaCl2) 침전, 미세주입법 (microinjection), 폴리에틸렌글리콜 (PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
본 출원은 상기 변이체; 상기 변이체를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상을 포함하여, 글루타치온을 생산하는 미생물을 제공할 수 있다.
상기 미생물은, 상기 변이체를 발현하는 미생물, 또는 상기 변이체가 도입된 미생물 일 수 있다.
본 출원에서 용어 "변이체를 포함하는 미생물", "변이체가 도입된 미생물" 또는"변이체를 발현하는 미생물"이란, 자연적으로 약한 글루타치온 생산능을 가지고 있는 미생물 또는 글루타치온 생산능이 없는 모균주에 글루타치온 생산능이 부여된 미생물일 수 있다. 구체적으로 상기 미생물은 서열번호 1의 아미노산 서열 내 하나 이상의 아미노산 변이를 포함하는 글루타메이트-시스테인 리가아제 변이체를 발현하는 미생물로서, 상기 아미노산 변이는 N-말단으로부터 86번째 위치에 상응하는 아미노산이 다른 아미노산으로 치환된 변이를 포함하는 것일 수 있다. 또한, 상기 미생물은 서열번호 1의 아미노산 서열에서 86번째 위치에 상응하는 아미노산이 다른 아미노산으로 치환된 글루타메이트-시스테인 리가아제 변이체를 발현하는 미생물일 수 있다. 예를 들어, 상기 미생물은 수탁번호 KCCM12659로 기탁된 사카로마이세스 세레비지애 균주일 수 있으나 이에 제한되지 않는다.
상기 글루타메이트-시스테인 리가아제 및 이의 변이체에 대해서는 전술한 바와 같다.
본 출원에서 용어, 단백질이 "발현되도록/되는"은 목적 단백질이 미생물 내에 도입되거나, 미생물 내에서 발현되도록 변형된 상태를 의미한다. 상기 목적 단백질이 미생물 내 존재하는 단백질인 경우 내재적 또는 변형 전에 비하여 그 활성이 강화된 상태를 의미할 수 있다. 본 출원의 목적상 "목적 단백질" 은 전술한 글루타메이트-시스테인 리가아제 변이체일 수 있다.
구체적으로, "단백질의 도입"은, 미생물이 본래 가지고 있지 않았던 특정 단백질의 활성을 나타나게 되는 것 또는 해당 단백질의 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타나게 되는 것일 수 있다. 예를 들어, 특정 단백질을 코딩하는 폴리뉴클레오티드가 미생물 내 염색체로 도입되거나, 특정 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터가 미생물 내로 도입되어 이의 활성이 나타나는 것일 수 있다. 또한, "활성의 강화"는 미생물이 가진 특정 단백질의 내재적 활성 또는 변형 전 활성에 비하여 활성이 향상된 것일 수 있다. "내재적 활성"은 자연적, 또는 인위적 요인에 의한 유전적 변이로 미생물의 형질이 변화하는 경우, 형질 변화 전 모균주가 본래 가지고 있던 특정 단백질의 활성을 의미하는 것일 수 있다.
구체적으로, 본 출원의 활성 강화는 상기 단백질 변이체를 코딩하는 유전자의 세포 내 카피수 증가, 상기 단백질 변이체를 암호화하는 유전자의 발현 조절 서열에 변이를 도입, 상기 단백질 변이체를 암호화하는 유전자 발현 조절 서열을 활성이 강력한 서열로 교체, 염색체 상의 자연형 단백질을 코딩하는 유전자를 상기 단백질 변이체를 암호화하는 유전자로 대체, 상기 단백질 변이체의 활성이 강화되도록 상기 단백질을 암호화하는 유전자에 변이를 추가적으로 도입, 및 미생물에 단백질 변이체를 도입으로 이루어진 군으로부터 선택되는 어느 하나 이상 일 수 있으나 이에 제한되지 않는다.
상기에서 유전자의 카피수 증가는, 특별히 이에 제한되지 않으나, 벡터에 작동 가능하게 연결된 형태로 수행되거나, 숙주세포 내의 염색체 내로 삽입됨으로써 수행될 수 있다. 구체적으로, 본 출원의 단백질을 코딩하는 폴리뉴클레오티드가 작동 가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터가 숙주세포 내에 도입되는 것일 수 있다. 또는, 상기 폴리뉴클레오티드가 작동 가능하게 연결된, 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포의 염색체 내에 도입되는 것일 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있다.
다음으로, 폴리뉴클레오티드의 발현이 증가하도록 발현 조절서열을 변형하는 것은, 특별히 이에 제한되지 않으나, 상기 발현 조절서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖는 핵산 서열로 교체함에 의하여 수행될 수 있다. 상기 발현 조절서열은, 특별히 이에 제한되지 않으나, 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다.
상기 폴리뉴클레오티드 발현 단위의 상부에는 본래의 프로모터 대신 강력한 프로모터가 연결될 수 있으며 이에 한정되는 것은 아니다. 예를 들어, 숙주 세포가 효모인 경우 이용가능한 프로모터는 TEF1 프로모터, TEF2 프로모터, GAL10 프로모터, GAL1 프로모터, ADH1 프로모터, ADH2 프로모터, PHO5 프로모터, GAL1-10 프로모터, TDH3 프로모터(GPD 프로모터), TDH2 프로모터, TDH1 프로모터, PGK1 프로모터, PYK2 프로모터, ENO1 프로모터, ENO2 프로모터 및 TPI1 프로모터를 포함하나, 이에 한정되는 것은 아니다. 아울러, 염색체상의 폴리뉴클레오티드 서열의 변형은, 특별히 이에 제한되지 않으나, 상기 폴리뉴클레오티드 서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현 조절서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함에 의하여 수행될 수 있다.
이와 같은 단백질 활성의 도입 및 강화는, 상응하는 단백질의 활성 또는 농도가 야생형이나 비변형 미생물 균주에서의 단백질의 활성 또는 농도를 기준으로 하여 일반적으로 최소 1%, 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% 또는 500%, 최대 1000% 또는 2000%까지 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어 "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 천연형 균주 자체이거나, 상기 단백질의 변이체를 포함하지 않는 미생물, 또는 상기 단백질의 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 벡터로 형질전환되지 않은 미생물일 수 있다.
본 출원에서 상기 글루타메이트-시스테인 리가아제 변이체를 포함하거나 이를 코딩하는 폴리뉴클레오티드를 포함하는 미생물은, 예를 들면, 상기 폴리뉴클레오티드를 포함하는 벡터로 형질전환에 의해 제조되는 재조합 미생물일 수 있으나, 이에 제한되지 않는다. 상기 재조합 미생물은 효모일 수 있으며, 그 예로, 사카로마이세스 속 미생물일 수 있고, 구체적으로 사카로마이세스 세레비지애(Saccharomyces cerevisiae)일 수 있으나, 이에 제한되지 않는다.
본 출원의 "글루타치온(glutathione)"은 "글루타티온", "GSH"와 상호 교환적으로 사용되며, 글루타메이트(glutamate), 시스테인(Cysteine), 글라이신(glycine) 의 세가지 아미노산으로 구성된 트리펩타이드를 의미한다. 글루타치온은 제약, 건강기능식품, 맛소재, 식품, 사료 첨가제, 화장품 등의 원료로 이용될 수 있으나, 이에 제한되지 않는다.
본 출원에서 "글루타치온을 생산하는 미생물"은 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 글루타치온 생산을 위한 유전적 변이가 일어나거나 활성을 강화시킨 미생물일 수 있다. 본 출원의 목적상 상기 글루타치온을 생산하는 미생물은, 글루타메이트-시스테인 리가아제를 포함하여, 야생형이나 비변형 미생물과 비교하여 목적하는 글루타치온을 과량으로 생산할 수 있는 미생물을 의미할 수 있다. 상기 "글루타치온을 생산하는 미생물" 은 "글루타치온 생산 미생물","글루타치온 생산능을 갖는 미생물, "글루타치온 생산 균주", "글루타치온 생산능을 갖는 균주" 등의 용어와 혼용되어 사용될 수 있다.
상기 글루타치온 생산 미생물은 재조합 미생물일 수 있다. 상기 재조합 미생물은 전술한 바와 같다.
상기 글루타치온 생산 미생물은 글루타치온 생산이 가능하다면 그 종류가 특별히 제한되지는 않으나, 사카로마이세스 속 (the genus Saccharomyces) 미생물일 수 있고, 구체적으로는 사카로마이세스 세레비지애(Saccharomyces cerevisiae) 일 수 있으나, 이에 제한되지 않는다.
상기 변이체를 포함하는 글루타치온 생산 미생물의 모균주는, 글루타치온 생산이 가능한 것이면 특별히 제한되지 않는다. 상기 미생물은 추가로 글루타치온 생산능 증가를 위한 생합성경로 강화, 피드백 저해 해제, 분해경로 혹은 생합성 경로를 약화시키는 유전자 불활성화 등의 변이를 포함하는 것일 수 있고, 이러한 변이는 자연적인 것을 배제하는 것은 아니다. 그러나, 이에 제한되지 않는다.
본 출원의 다른 하나의 양태는 상기 미생물을 배양하는 단계를 포함하는 글루타치온 제조방법을 제공한다. 상기 미생물, 글루타치온에 대해서는 전술한 바와 같다. 균주 배양을 통해 글루타치온이 균체 내에 축적될 수 있다.
본 출원의 균주의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 사카로마이세스속 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용될 수 있으며, 구체적으로는 본 출원의 균주를 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 또는 혐기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루타메이트, 메티오닌, 라이신 등과 같은 아미노산 등이 포함될 수 있으나, 이에 제한되지 않는다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있고, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으나, 이에 제한되지 않는다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있다.
그 외에 상기 배지에는 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 구체적으로, 상기 균주의 배양 배지에는 L-아미노산 등이 첨가될 수 있다. 구체적으로는 글리신(glycine), 글루타메이트(glutamate), 및/또는 시스테인(cysteine) 등이 첨가될 수 있고, 필요에 따라서는 라이신(lysine) 등의 L-아미노산 이 더 첨가될 수 있으나 반드시 이에 제한되지 않는다.
상기 배지 또는 전구체는 배양물에 회분식 또는 연속식으로 첨가될 수 있으며, 이에 제한되지 않는다.
본 출원에서, 균주의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배양물에 적절한 방식으로 첨가하여, 배양물의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배양물의 호기 상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있다.
배양물의 온도는 25℃ 내지 40℃일 수 있으며, 보다 구체적으로는 28℃ 내지 37℃일 수 있으나 이에 제한되지 않는다. 배양 기간은 원하는 유용 물질의 생성량이 수득될 때까지 계속될 수 있으며, 구체적으로는 1 시간 내지 100 시간일 수 있으나 이에 제한되지 않는다.
상기 글루타치온 제조방법은, 상기 배양 단계 이후, 추가적인 공정을 더 포함할 수 있다. 상기 추가 공정은 글루타치온 용도에 따라 적절히 선택될 수 있다.
구체적으로, 상기 글루타치온 제조방법은 상기 배양 단계 이후 상기 균주, 이의 건조물, 추출물, 배양물, 파쇄물 중에서 선택된 하나 이상의 물질로부터 글루타치온을 회수하는 단계를 포함할 수 있다.
상기 방법은 상기 회수 단계 이전, 혹은 동시에 균주를 용균시키는 단계를 추가로 포함할 수 있다. 균주의 용균은 본 출원이 속하는 기술 분야에서 통상적으로 사용되는 방법, 예를 들어, 용균용 완충용액, 소니케이터, 열 처리 및 후렌치 프레서 등에 의해 실시할 수 있다. 또한 상기 용균 단계는 세포벽 분해 효소, 핵산 분해 효소, 핵산 전이 효소, 단백질 분해 효소 등 효소반응을 포함할 수 있으나 이에 제한되지 않는다.
본 출원의 목적상, 상기 글루타치온 제조방법을 통해 글루타치온이 고함량으로 포함된 건조 효모(Dry yeast), 효모 추출물(yeast extract), 효모추출물 혼합 분말(yeast extract mix powder), 순수 정제된 글루타치온(pure glutathione)을 제조할 수 있으나 이에 제한되지 않으며, 목적하는 제품에 따라 적절하게 제조될 수 있다.
본 출원에서 건조 효모(dry yeast)는 "균주 건조물" 등의 용어와 교환적으로 사용될 수 있다. 상기 건조 효모는 글루타치온을 축적한 효모 균체를 건조시켜 제조할 수 있으며, 구체적으로 사료용 조성물, 식품용 조성물 등에 포함될 수 있으나, 이에 제한되지 않는다.
본 출원에서 효모 추출물(yeast extract)은 "균주 추출물" 등의 용어와 상호 교환적으로 사용될 수 있다. 상기 균주 추출물은, 상기 균주의 균체에서 세포벽을 분리하고 남은 물질을 의미할 수 있다. 구체적으로, 균체를 용균시켜 수득한 성분에서 세포벽을 제외한 나머지 성분을 의미할 수 있다. 상기 균주 추출물은 글루타치온을 포함하며, 글루타치온 외의 성분으로는 단백질, 탄수화물, 핵산, 섬유질 중 하나 이상의 성분이 포함되어 있을 수 있으나 이에 제한되지 않는다.
상기 회수 단계는 당해 기술 분야에 공지된 적합한 방법을 이용하여, 목적 물질인 글루타치온을 회수할 수 있다.
상기 회수 단계는 정제 공정을 포함할 수 있다. 상기 정제 공정은 균주로부터 글루타치온만을 분리하여 순수 정제하는 것일 수 있다. 상기 정제 공정을 통해, 순수 정제된 글루타치온(pure glutathione)이 제조될 수 있다.
필요에 따라, 상기 글루타치온 제조방법은, 상기 배양 단계 이후 수득된 균주, 이의 건조물, 추출물, 배양물, 파쇄물 및 이들로부터 회수된 글루타치온 중에서 선택된 물질과 부형제를 혼합하는 단계를 더 포함할 수 있다. 상기 혼합 단계를 통해 효모추출물 혼합 분말(yeast extract mix powder)이 제조될 수 있다.
상기 부형제는 목적하는 용도나 형태에 따라 적절히 선택하여 사용할 수 있으며, 예를 들어, 전분, 글루코오스, 셀룰로오스, 락토오스, 글리코겐, D-만니톨, 소르비톨, 락티톨, 말토덱스트린, 탄산칼슘, 합성규산알루미늄, 인산일수소칼슘, 황산칼슘, 염화나트륨, 탄산수소나트륨, 정제 라놀린, 덱스트린, 알긴산나트륨, 메틸셀룰로오스, 콜로이드성실리카겔, 하이드록시프로필스타치, 하이드록시프로필메틸셀루로오스, 프로필렌글리콜, 카제인, 젖산칼슘, 프리모젤, 아라비아 검 중에서 선택되는 것일 수 있으며, 구체적으로는 전분, 글루코오스, 셀룰로오스, 락토오스, 덱스트린, 글리코겐, D-만니톨, 말토덱스트린 중에서 선택되는 하나 이상의 성분일 수 있으나 이에 제한되지 않는다.
상기 부형제는, 예를 들어, 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등을 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 다른 하나의 양태는 상기 글루타메이트-시스테인 리가아제 변이체의 글루타치온 생산 용도를 제공한다. 본 출원의 다른 하나의 양태는 상기 미생물의 글루타치온 생산 용도를 제공한다. 상기 글루타메이트 시스테인 리가아제 변이체 및 미생물에 대해서는 전술한 바와 같다.
이하 본 출원을 실시예 및 실험예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예 및 실험예는 본 출원을 예시적으로 설명하기 위한 것으로 본 출원의 범위가 이들 실시예 및 실험예에 한정되는 것은 아니다.
실시예 1: 글루타치온 생산 균주 선별 및 글루타치온 생산능 확인
다양한 균주를 함유하고 있는 누룩으로부터 균주를 수득하고 이를 개량하여 글루타치온 생산능을 갖는 균주를 선별하였다.
구체적으로, 대한민국 경기도 용인 이천 평택 화성 지역 등 총 20개 지역에서 쌀, 보리, 녹두, 귀리 등 곡물시료를 채취하여 분쇄한 후 반죽하여 헝겊에 싸고 단단히 눌러 모양을 만든 다음, 짚으로 싸서 10일간 발효시킨 후, 서서히 건조시켜서 누룩을 제조하였다.
제조된 누룩으로부터 다양한 균주를 분리하고자 하기와 같이 실험을 수행하였다. 5g의 누룩에 45 ml의 식염수를 첨가하여 혼합기로 분쇄하였다. 효모 균주의 순수분리를 위해 serial dilution하여 YPD Agar(Yeast extract 10 g/L, Bacto peptone 20 g/L, Glucose 20 g/L, 증류수 1리터 기준)에 spreading하여 30℃에서 48시간 배양하였다. 그리고, colony 형태와 현미경 검증을 통해 효모의 colony를 YPD agar에 streaking 하였다. 250 ml 삼각플라스크에 YPD broth를 25ml 분주하고 순수 분리된 균주를 접종하여 48시간동안 진탕 배양(30℃, 200 rpm)하여 글루타치온 생산량을 확인하여 균주 스크리닝을 수행하였다.
1차적으로 분리된 균주들의 개량을 위해, 분리된 균주에 돌연변이(random mutation)를 유도하였다. 구체적으로 상기 누룩으로부터 분리한 효모중 글루타치온 생산이 확인된 균주를 분리하여 CJ-37 균주로 명명하였다. CJ-37 균주를 고체배지에 배양한 후 broth에 접종하여 배양액을 수득하였으며, UV 램프를 이용하여 균체에 UV를 조사하였다. 이후, UV 조사된 배양액을 평판배지에 도말하여 콜로니를 형성한 변이 균주만을 분리 수득하였으며, 이들의 글루타치온 생산량을 확인하였다.
그 결과, 변이 균주 중 가장 우수한 글루타치온 생산량을 나타내는 균주를 글루타치온 생산 균주로 선별하여 CJ-5 균주로 명명하였으며, 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(Korean Culture Center of Microorganisms, KCCM)에 2019년 7월 31일자로 기탁하여 기탁번호 KCCM12568P를 부여 받았다.
실시예 2: 글루타치온 생산능 증가를 위한 추가 개량 실험
CJ-5 균주의 글루타치온 생산능을 추가적으로 개선하기 위해 다음과 같은 방법으로 돌연변이를 유도하였다.
CJ-5 균주를 고체배지에 배양한 후 broth에 접종하여 배양액을 수득하였으며, UV 램프를 이용하여 균체에 UV를 조사하였다. 이후, UV 조사된 배양액을 평판배지에 도말하여 콜로니를 형성한 변이 균주만을 분리 수득하였으며, 글루타치온 생산능이 가장 많이 향상된 균주를 분리하여 CC02-2490 균주로 명명하고 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(Korean CultureCenter of Microorganisms, KCCM)에 2020년 1월 17일자로 기탁하여 수탁번호 KCCM12659P를 부여받았다. 상기 균주의 글루타치온 생산능 증가와 관련하여 글루타치온 생합성유전자 gsh1의 염기서열을 분석한 결과, gsh1 유전자가 코딩하는 GSH1 단백질의 86번째 아미노산인 시스테인이 아르기닌으로 치환된 것을 확인하였다.
실시예 3: GSH1 C86 잔기 변이 실험
상기 실시예 2의 결과로부터 GSH1 단백질의 86번 위치가 글루타치온 생산에 중요할 것이라고 판단하여 GSH1 단백질의 86번째 시스테인 아미노산이 다른 아미노산으로 치환된 변이 단백질을 발현하도록 사카로마이세스 세레비지애(S. cerevisiae) CEN.PK2-1D 및 사카로마이세스 세레비지애(S. cerevisiae) CJ-5 균주의 변이 균주를 제작하여 글루타치온 생산량 증가 여부를 확인하고자 하였다.
사카로마이세스 세레비지애의 GSH1 단백질의 86번 시스테인을 아르기닌으로 치환한 균주를 제작하기 위하여 Lee TH, et al.(J. Microbiol. Biotechnol. (2006), 16(6), 979-982) 논문에 개시된 내용을 참고로 하여 pWAL100 및 pWBR100 플라스미드를 이용하였다. 구체적으로 CJ-5 균주의 genomic DNA를 주형(template)으로 하여 다음과 같이 PCR을 수행하였다. 서열번호 22와 서열번호 23의 프라이머를 이용한 PCR을 수행하여 N-terminal BamHI flanking 서열, GSH1 ORF의 개시코돈 및 C86R 변이 암호화 서열을 포함하는 GSH1 N-terminal일부 서열을 확보하고, 서열번호 24와 서열번호 25의 프라이머를 이용하여 C-terminal XhoI flanking 서열, GSH1 ORF 종결코돈 및 C86R 변이 암호화 서열을 포함하는 GSH1 C-terminal 일부 서열을 확보하였다. 이후 이 두 서열을 주형(template)으로 하여 서열번호 22와 서열번호 25를 이용하여 overlap PCR을 수행한 결과 86번째 시스테인이 아르기닌으로 치환된 GSH1 변이 단백질 암호화 서열, N-terminal BamHI, C-terminal XhoI 제한효소 서열을 포함하는 GSH1 ORF 절편을 확보하였다. 상기 ORF 절편은 BamHI 및 XhoI처리 후 동일한 효소로 처리한 pWAL100 벡터에 클로닝하여 pWAL100-GSH1(C86R)벡터를 제조하였다.
또한, CJ-5 균주의 genomic DNA를 template으로 하여 서열번호 26과 서열번호 27의 프라이머를 이용한 PCR을 수행하여 N-terminal SpeI, C-terminal NcoI 제한효소 서열을 포함하는 GSH1 ORF 종결코돈 이후 500bp를 확보하고 SpeI, NcoI 제한효소를 처리하였다. 이후 동일한 제한효소를 처리한 pWBR100에 클로닝하여 pWBR100-GSH1벡터를 제조하였다.
최종적으로 효모에 도입할 DNA 절편을 제작하기 위해 앞서 제작한 pWAL100-GSH1(C86R) 벡터를 주형(template)으로 하여 서열번호 22와 서열번호 28의 프라이머를 이용하여 아르기닌 변이 암호화서열과 KlURA3 일부를 포함하는 PCR 산물을 획득하고 pWBR100-GSH1벡터를 주형(template)으로 하여 서열번호 29와 서열번호 27의 프라이머를 이용하여 KlURA3 일부와 GSH1 종결코돈 이후 500bp를 포함하는 PCR 산물을 획득한 후 각 PCR 산물을 동일한 몰비율로 S. cerevisiae CEN.PK2-1D 및 S. cerevisiae CJ-5 에 형질전환 하였다. PCR은 95℃에서 열변성 과정 5분, 53℃에서 결합과정 1분, 72℃에서 중합과정 1kb당 1분의 조건으로 수행하였으며 효모의 형질전환은 Geitz의 논문(Nucleic Acid Research, 20(6), 1425)을 변형한 리튬아세테이트 방법(Lithium acetate method)을 사용하였다. 구체적으로 O.D. 0.7 ~ 1.2 사이의 효모 세포를 리튬아세테이트/TE buffer로 2회 세척 한 후, 상기 PCR산물들과 single stranded DNA (Sigma D-7656)을 함께 섞어 리튬아세테이트/TE/40 % PEG buffer에서 30분간 30℃, 42℃에서 15분간 정치배양한 후 cell들을 우라실(Uracil)이 포함되지 않은 SC (2% glucose) agar plate에서 콜로니가 보일 때까지 배양하여 GSH1 C86R 변이 암호화 서열과 KlURA3 유전자가 도입된 균주를 획득하였다. 이후 KlURA3를 제거하기 위하여 각 균주를 2ml의 YPD에 overnight 배양 후 1/100 희석하여 0.1%의 5-FOA가 포함된 SC (2% glucose) agar plate에 도말하여 우라실(Uracil)마커가 제거된 S. cerevisiae CEN.PK2-1D GSH1 C86R 변이 균주 및 S. cerevisiae CJ-5 GSH1 C86R 변이 균주를 제작하였다. 아르기닌 외에 나머지 18종의 아미노산으로 치환된 GSH1 변이 단백질을 발현할 수 있는 균주도 서열번호 23 및 서열번호 24의 프라이머 서열상의 86번 아르기닌 코딩 서열을 다른 아미노산을 코딩하는 서열로 치환한 프라이머쌍을 이용한 점을 제외하고는 동일한 방식으로 제작하였다.
프라이머 5'→3' 서열
F_BamHI_GSH1
(서열번호 22)		 GGTAGGATCCATGGGACTCTTAGCTTTGGGCAC
R_GSH1_C86R
(서열번호 23)		 TTAGCCTCCCTAAGGGACGAATCCT
F_GSH1_C86R
(서열번호 24)		 CGTCCCTTAGGGAGGCTAACGATGT
R_XhoI_GSH1
(서열번호 25)		 ATGACTCGAGTTAACATTTGCTTTCTATTGAAGGC
F_SpeI_GSH1_DW
(서열번호 26)		 TAGAACTAGTACTCCTTTTATTTCGGTTGTGAA
R_NcoI_GSH1_DW
(서열번호 27)		 GCTGCCATGGGAATAGTGTGAACCGATAACTGTGT
R_AL killer
(서열번호 28)		 GAGCAATGAACCCAATAACGAAATCTT
F_BR killer
(서열번호 29)		 CTTGACGTTCGTTCGACTGATGAG
상기에서 제작된 각 균주를 26시간 배양하여 생산한 글루타치온(GSH)농도를 측정한 결과를 표 2 및 표 3에 표시하였다.
Figure PCTKR2021003617-appb-T000001
Figure PCTKR2021003617-appb-T000002
실험 결과 GSH1 단백질의 86번 시스테인을 다른 아미노산으로 치환하는 경우 야생형 GSH1 단백질을 포함하는 경우보다 최대 27% 이상 글루타치온 생산능이 증가하는 것을 확인할 수 있었다.
이를 통해 GSH1 단백질의 86번 시스테인을 다른 아미노산으로 치환한 GSH1 변이체가 글루타치온 생산능을 크게 증가시키는 것임을 알 수 있다.
실시예 4: 다른 Cys 잔기가 글루타치온 생산량에 미치는 영향 확인
비교예로서 GSH1 단백질의 다른 Cys 잔기에 변이를 도입하여 글루타치온 생산능을 확인하여 그 결과를 표 4에 나타내었다.
Figure PCTKR2021003617-appb-T000003
실험 결과 86번 시스테인 이외의 다른 시스테인 잔기는 글루타치온 생산량 증가 효과를 가지지 못하였으며, 오히려 글루타치온 생산량이 감소하는 양상을 나타내었다.
이를 통해 단백질 내 존재하는 시스테인 잔기가 모두 글루타치온 생산량 증가 효과를 나타내는 것은 아님을 알 수 있다. 또한, 본 출원에서 개발한 신규한 GSH1 변이체가 글루타치온 생산량 증가를 나타내는 것임을 확인할 수 있다.
글루타치온을 고생산하는 효모, 이의 건조물, 추출물, 배양물, 파쇄물 및 생산된 글루타치온은, 항산화 효과, 해독 효과, 면역력 증강 효과를 가지는 것인바, 화장품용 조성물, 식품용 조성물, 사료용 조성물, 의약품 조성물 및 이의 제조에도 유용하게 사용될 수 있다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2021003617-appb-I000001
Figure PCTKR2021003617-appb-I000002

Claims (12)

  1. 서열번호 1의 아미노산 서열의 N-말단으로부터 86번째 위치에 상응하는 아미노산이 다른 아미노산으로 치환된, 글루타메이트-시스테인 리가아제(glutamate-cysteine ligase) 변이체.
  2. 제1항에 있어서, 상기 86번째 위치에 상응하는 아미노산이 글리신, 알라닌, 발린, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판, 프롤린, 세린, 쓰레오닌, 타이로신, 아스파라긴, 글루타메이트, 글루타민, 아스파테이트, 라이신, 아르기닌 또는 히스티딘으로 치환된, 글루타메이트-시스테인 리가아제 변이체.
  3. 제1항에 있어서, 상기 변이체는 서열번호 1의 아미노산 서열과 80% 이상 및 100% 미만의 서열 상동성을 가지는 것인, 글루타메이트-시스테인 리가아제 변이체.
  4. 제1항에 있어서, 상기 변이체는 서열번호 3 내지 21 중에서 선택되는 어느 하나의 아미노산 서열로 구성되는 것인, 글루타메이트-시스테인 리가아제 변이체.
  5. 제1항 내지 제4항 중 어느 한 항의 글루타메이트-시스테인 리가아제 변이체를 코딩하는 폴리뉴클레오티드.
  6. 제5항의 폴리뉴클레오티드를 포함하는 벡터.
  7. 제1항 내지 제4항 중 어느 한 항의 글루타메이트-시스테인 리가아제 변이체; 상기 변이체를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상을 포함하는, 글루타치온을 생산하는 미생물.
  8. 제7항에 있어서, 상기 미생물은 사카로마이세스 속 미생물인, 글루타치온을 생산하는 미생물.
  9. 제7항에 있어서, 상기 미생물은 사카로마이세스 세레비지애(Saccharomyces cerevisiae)인, 글루타치온을 생산하는 미생물.
  10. 제7항에 있어서, 상기 미생물은 수탁번호 KCCM12659P로 기탁된 사카로마이세스 세레비지애 균주인, 글루타치온을 생산하는 미생물.
  11. 제1항 내지 제4항 중 어느 한 항의 글루타메이트-시스테인 리가아제 변이체; 상기 변이체를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상을 포함하는 미생물을 배지에서 배양하는 단계를 포함하는, 글루타치온 생산 방법.
  12. 제11항에 있어서, 상기 방법은 상기 배양된 미생물, 상기 미생물의 건조물, 상기 미생물의 추출물, 상기 미생물의 배양물, 및 상기 미생물의 파쇄물 중에서 선택된 하나 이상의 물질로부터 글루타치온을 회수하는 단계를 추가로 포함하는, 글루타치온 생산 방법.
PCT/KR2021/003617 2020-03-25 2021-03-24 글루타메이트-시스테인 리가아제 변이체 및 이를 이용한 글루타치온 생산방법 WO2021194243A1 (ko)

Priority Applications (9)

Application Number Priority Date Filing Date Title
CN202180022763.4A CN115768883A (zh) 2020-03-25 2021-03-24 谷氨酸-半胱氨酸连接酶变体和使用其生产谷胱甘肽的方法
AU2021242116A AU2021242116A1 (en) 2020-03-25 2021-03-24 Glutamate-Cysteine Ligase Variant And Method Of Producing Glutathione Using The Same
JP2022555103A JP2023517110A (ja) 2020-03-25 2021-03-24 グルタミン酸－システインリガーゼ変異体及びそれを用いたグルタチオン生産方法
EP21774874.8A EP4112725A4 (en) 2020-03-25 2021-03-24 GLUTAMATE-CYSTEIN LIGASE VARIANT AND METHOD FOR PRODUCING GLUTATHIONE THEREFROM
CA3172465A CA3172465A1 (en) 2020-03-25 2021-03-24 Glutamate-cysteine ligase variant and method of producing glutathione using the same
BR112022019055A BR112022019055A8 (pt) 2020-03-25 2021-03-24 Variante de glutamato-cisteína ligase e método de produção de glutationa usando a mesma
MX2022011597A MX2022011597A (es) 2020-03-25 2021-03-24 Variante de glutamato-cisteina ligasa y procedimiento de produccion de glutation mediante el uso de la misma.
ZA2022/10106A ZA202210106B (en) 2020-03-25 2022-09-12 Glutamate-cysteine ligase variant and method for producing glutathione using same
JP2024063274A JP2024084851A (ja) 2020-03-25 2024-04-10 グルタミン酸－システインリガーゼ変異体及びそれを用いたグルタチオン生産方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200036456A KR102282387B1 (ko) 2020-03-25 2020-03-25 글루타메이트-시스테인 리가아제 변이체 및 이를 이용한 글루타치온 생산방법
KR10-2020-0036456 2020-03-25

Publications (1)

Publication Number Publication Date
WO2021194243A1 true WO2021194243A1 (ko) 2021-09-30

Family

ID=77125544

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/003617 WO2021194243A1 (ko) 2020-03-25 2021-03-24 글루타메이트-시스테인 리가아제 변이체 및 이를 이용한 글루타치온 생산방법

Country Status (12)

Country Link
EP (1) EP4112725A4 (ko)
JP (2) JP2023517110A (ko)
KR (1) KR102282387B1 (ko)
CN (1) CN115768883A (ko)
AR (1) AR121652A1 (ko)
AU (1) AU2021242116A1 (ko)
BR (1) BR112022019055A8 (ko)
CA (1) CA3172465A1 (ko)
MX (1) MX2022011597A (ko)
TW (1) TWI786573B (ko)
WO (1) WO2021194243A1 (ko)
ZA (1) ZA202210106B (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100095829A (ko) * 2009-02-23 2010-09-01 대한민국(농촌진흥청장) 글루타치온을 고농도로 생산하는 사카로마이세스 세레비시애의 돌연변이체 및 이를 배양하여 글루타치온을 대량 생산하는 방법
KR20110118492A (ko) * 2010-04-23 2011-10-31 샘표식품 주식회사 글루타치온 함량이 증대된 신규 효모 변이주, 그 제조 방법 및 용도
EP3101130A1 (en) * 2014-01-31 2016-12-07 Ajinomoto Co., Inc. Mutant glutamate-cysteine ligase and method for manufacturing gamma-glutamyl-valyl-glycine

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2005073638A (ja) * 2003-09-02 2005-03-24 Ajinomoto Co Inc キャンディダ・ユティリスのグルタチオン合成酵素をコードする遺伝子
WO2013054447A1 (ja) * 2011-10-14 2013-04-18 味の素株式会社 γ‐Ｇｌｕ‐Ｘ‐Ｇｌｙまたはその塩の製造方法、および変異型グルタチオン合成酵素
KR102546738B1 (ko) * 2021-01-04 2023-06-22 씨제이제일제당 주식회사 글루타메이트-시스테인 리가아제 변이체 및 이를 이용한 글루타치온 생산방법

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100095829A (ko) * 2009-02-23 2010-09-01 대한민국(농촌진흥청장) 글루타치온을 고농도로 생산하는 사카로마이세스 세레비시애의 돌연변이체 및 이를 배양하여 글루타치온을 대량 생산하는 방법
KR20110118492A (ko) * 2010-04-23 2011-10-31 샘표식품 주식회사 글루타치온 함량이 증대된 신규 효모 변이주, 그 제조 방법 및 용도
EP3101130A1 (en) * 2014-01-31 2016-12-07 Ajinomoto Co., Inc. Mutant glutamate-cysteine ligase and method for manufacturing gamma-glutamyl-valyl-glycine

Non-Patent Citations (18)

* Cited by examiner, † Cited by third party
Title
"Atlas Of Protein Sequence And Structure", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
"Guide to Huge Computers", 1994, ACADEMIC PRESS
ATSCHUL, S. F. ET AL., J MOLEC BIOL, vol. 215, 1990, pages 403
CARILLO ET AL.: "SIAM J Applied Math", vol. 48, 1988, pages: 1073
DEVEREUX, J ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
GEITZ, NUCLEIC ACID RESEARCH, vol. 20, no. 6, pages 1425
GRIBSKOV ET AL., NUCL. ACIDS RES., vol. 14, 1986, pages 6745
J. SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
KANG, HYUN AH ET AL.: "Development Status of Cell Factory for Mass Production of Glutathione by Yeast and Synthetic Biological Research Prospects", RESEARCH TRENDS IN KAIST INTELLIGENT SYNTHETIC BIOLOGY CENTER, vol. 5069, 17 November 2017 (2017-11-17), KR, pages 1 - 13, XP009530976 *
LEE TH ET AL., J. MICROBIOL. BIOTECHNOL., vol. 16, no. 6, 2006, pages 979 - 982
NEEDLEMAN ET AL., J MOLBIOL, vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
RICE ET AL.: "Trends Genet", vol. 16, 2000, article "The European Molecular Biology Open Software Suite", pages: 276 - 277
See also references of EP4112725A4
SIPES IG ET AL.: "The role of glutathione in the toxicity of xenobiotic compounds: metabolic activation of 1,2-dibromoethane by glutathione", ADV EXP MED BIOL., vol. 197, 1986, pages 457 - 67
SMITHWATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482
XU WEN; JIA HAIYAN; ZHANG LONGMEI; WANG HAIYAN; TANG HUI; ZHANG LIPING: "Effects ofGSH1andGSH2Gene Mutation on Glutathione Synthetases Activity ofSaccharomyces cerevisiae", PROTEIN JOURNAL, KLUWER ACADEMIC/PLENUM PUBLISHERS, DORDRECHT, NL, vol. 36, no. 4, 1 August 2017 (2017-08-01), NL, pages 270 - 277, XP036279509, ISSN: 1572-3887, DOI: 10.1007/s10930-017-9731-0 *

Also Published As

Publication number Publication date
TWI786573B (zh) 2022-12-11
TW202202619A (zh) 2022-01-16
EP4112725A4 (en) 2023-09-27
MX2022011597A (es) 2022-10-18
CA3172465A1 (en) 2021-09-30
BR112022019055A8 (pt) 2022-11-16
EP4112725A1 (en) 2023-01-04
JP2023517110A (ja) 2023-04-21
JP2024084851A (ja) 2024-06-25
ZA202210106B (en) 2024-03-27
AU2021242116A1 (en) 2022-10-27
KR102282387B1 (ko) 2021-07-27
AR121652A1 (es) 2022-06-22
CN115768883A (zh) 2023-03-07
BR112022019055A2 (pt) 2022-11-08

Similar Documents

Publication Publication Date Title
WO2019160301A1 (ko) 시트레이트 신타아제의 활성이 약화된 변이형 폴리펩타이드 및 이를 이용한 l-아미노산 생산방법
WO2019164346A1 (ko) L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
WO2022145623A1 (ko) 글루타메이트-시스테인 리가아제 변이체 및 이를 이용한 글루타치온 생산방법
WO2020067618A1 (ko) 알파-글루코시다제의 활성이 강화된 l-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산 생산 방법
JP7467627B2 (ja) 新規なプロモーター及びそれを用いたグルタチオン生産方法
WO2021194243A1 (ko) 글루타메이트-시스테인 리가아제 변이체 및 이를 이용한 글루타치온 생산방법
WO2022260403A1 (ko) 슈퍼옥사이드 디스뮤테이즈 1 변이체 및 이를 이용한 글루타치온 또는 그 유도체의 생산방법
WO2022215800A1 (ko) 신규한 분지쇄아미노산 투과효소 변이체 및 이를 이용한 l-발린 생산 방법
RU2806289C1 (ru) Новый промотор и способ получения глутатиона с его использованием
US20240229006A1 (en) Glutamate-Cysteine Ligase Variant and Method of Producing Glutathione Using the Same
WO2023177254A1 (ko) 거짓쌀도둑거저리 유래 아스파테이트 1-디카복실라아제의 활성이 강화된 미생물, 및 이의 용도
WO2022215801A1 (ko) 신규한 글리세르알데히드-3-인산탈수소효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2022231342A1 (ko) 변이형 spot 단백질 및 이를 이용한 l-아미노산을 생산하는 방법
WO2024035140A1 (ko) 신규한 아세토하이드록시산 신타아제 소단위체 변이체 및 이를 이용한 l-발린 생산 방법.
WO2022245000A1 (ko) Agl 단백질의 활성이 강화된, 아미노산을 생산하는 미생물 및 이를 이용한 아미노산 생산 방법
WO2023177253A1 (ko) 거짓쌀도둑거저리 유래 아스파테이트 1-디카복실레이스의 변이체 및 이를 포함하는 미생물
WO2022215796A1 (ko) 신규한 전사 조절자 변이체 및 이를 이용한 l-발린 생산 방법
WO2022215799A1 (ko) 신규한 2-이소프로필말레이트합성효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2022215798A1 (ko) 신규한 디히드로리포일 아세틸기전이효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2022215802A1 (ko) 신규한 슈가 포터 계열 mfs 트랜스포터 변이체 및 이를 이용한 l-발린 생산 방법
WO2022215797A1 (ko) 신규한 WhiB 계열 전사 조절자 WhcA 변이체 및 이를 이용한 L-발린 생산 방법
WO2022005225A1 (ko) 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21774874

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022555103

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3172465

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2021774874

Country of ref document: EP

Effective date: 20220928

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022019055

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 2022123863

Country of ref document: RU

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021242116

Country of ref document: AU

Date of ref document: 20210324

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112022019055

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20220922