WO2022231342A1 - 변이형 spot 단백질 및 이를 이용한 l-아미노산을 생산하는 방법 - Google Patents

변이형 spot 단백질 및 이를 이용한 l-아미노산을 생산하는 방법 Download PDF

Info

Publication number
WO2022231342A1
WO2022231342A1 PCT/KR2022/006097 KR2022006097W WO2022231342A1 WO 2022231342 A1 WO2022231342 A1 WO 2022231342A1 KR 2022006097 W KR2022006097 W KR 2022006097W WO 2022231342 A1 WO2022231342 A1 WO 2022231342A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
spot
present application
protein
microorganism
Prior art date
Application number
PCT/KR2022/006097
Other languages
English (en)
French (fr)
Inventor
김희정
정무영
김혜미
김현아
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to CA3215115A priority Critical patent/CA3215115A1/en
Priority to JP2023561411A priority patent/JP2024513452A/ja
Priority to CN202280031422.8A priority patent/CN117222658A/zh
Priority to EP22796174.5A priority patent/EP4306536A1/en
Priority to BR112023022402A priority patent/BR112023022402A2/pt
Publication of WO2022231342A1 publication Critical patent/WO2022231342A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
    • C12P13/227—Tryptophan
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli

Definitions

  • the present application relates to a mutant SpoT protein and a method for producing L-amino acids using the same.
  • Microorganisms used for L-amino acid production were initially selected from strains showing analog resistance through chemical or physical mutation. Recombinant strains using
  • the stringent response was first discovered as a phenomenon in which protein synthesis is inhibited in a situation of amino acid depletion as a response of bacteria to various stressful situations. It is known to adapt to various stressful environments through -340.).
  • the key reaction of the austerity response is initiated by guanosine pentaphosphate (pppGpp) and guanosine tetraphosphate (ppGpp). Since these two molecules are not functionally different, they are usually denoted as (p)ppGpp.
  • pppGpp is produced by a pppGpp synthetase named RelA.
  • the RelA protein monitors the state of protein translation in the ribosome. When there is insufficient protein in the cell, the concentration of tRNA without amino acids increases. When this tRNA binds to the ribosome, RelA is activated. RelA produces pppGpp by reacting guanosine triphosphate (GTP) with adenosine triphosphate (ATP). When the balance is restored by increasing the concentration of amino acids in the cell, (p)ppGpp is hydrolyzed by the SpoT protein.
  • the SpoT protein has not only the degradation activity of (p)ppGpp, but also the synthesis activity (Nat Rev Microbiol. (2012) 10(3): 203-12). However, the relationship between SpoT protein and amino acid production is still unknown.
  • the present application provides a mutant SpoT protein and a method for producing L-amino acids using the same.
  • One object of the present application is to provide a variant SpoT protein comprising the substitution of an amino acid corresponding to position 262 in the sequence of SEQ ID NO: 1 with another amino acid.
  • Another object of the present application is a polynucleotide encoding the variant SpoT protein; and to provide a vector including the same.
  • the mutant SpoT protein a polynucleotide encoding the variant SpoT protein; And to provide a microorganism of the genus Escherichia comprising at least one of the vectors comprising the polynucleotide.
  • Another object of the present application is to provide a method for producing L- amino acids, comprising culturing the microorganism in a medium.
  • Another object of the present application is to provide a method for increasing the L-amino acid production capacity of a microorganism, comprising modifying the microorganism to express the mutant SpoT protein.
  • L-amino acids can be effectively produced using the mutant protein of the present application.
  • variant SpoT protein comprising the substitution of an amino acid corresponding to position 262 in the sequence of SEQ ID NO: 1 with another amino acid.
  • the mutant SpoT protein is a mutant protein comprising a substitution of an amino acid corresponding to the 262th position from the N-terminus of the amino acid sequence of SEQ ID NO: 1 with another amino acid in a polypeptide or SpoT protein having SpoT protein activity it means.
  • the other amino acids are glycine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, glutamine, aspartic acid, glutamic acid, lysine, arginine and histidine. It may be an amino acid of choice.
  • the other amino acid may be selected from among polar amino acids.
  • the other amino acid may be selected from serine, threonine, cysteine, tyrosine, asparagine and glutamine.
  • variant protein according to any one of the above embodiments, wherein the variant SpoT protein has, comprises, or consists essentially of any one of the amino acid sequences set forth in SEQ ID NOs: 19 to 24. may consist of).
  • variant protein according to any one of the above embodiments, wherein the variant SpoT protein comprises a substitution of an amino acid corresponding to position 262 with another amino acid based on the amino acid sequence of SEQ ID NO: 1, contains an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more and less than 100% homology or identity to the amino acid sequence described as can do.
  • mutant protein having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted or added is also provided in the present application. It is obvious that it is included within the scope of
  • amino acid sequence N-terminus, C-terminal and/or sequence addition or deletion that does not alter the function of the variant protein of the present application, naturally occurring mutations, silent mutations or a case with conservative substitutions.
  • conservative substitution means substituting an amino acid for another amino acid having similar structural and/or chemical properties. Such amino acid substitutions may generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the protein or polypeptide.
  • variant protein of the present application may also be described as "protein variant”.
  • variant means that one or more amino acids are conservatively substituted and/or modified so that they differ from the amino acid sequence before the mutation of the variant, but have functions or properties. refers to a polypeptide that is maintained. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation. In addition, some variants may include variants in which one or more portions, such as an N-terminal leader sequence or a transmembrane domain, have been removed.
  • variants may include variants in which a portion is removed from the N- and/or C-terminus of the mature protein.
  • variant may be used interchangeably with terms such as mutant, modified, mutant polypeptide, mutated protein, mutant and mutant (in English, modified, modified polypeptide, modified protein, mutant, mutein, divergent, etc.) and, as long as it is a term used in a mutated sense, it is not limited thereto.
  • the variant may be a polypeptide comprising an amino acid sequence in which the amino acid corresponding to position 262 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.
  • variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide.
  • a signal (or leader) sequence involved in protein translocation may be conjugated to the N-terminus of the mutant, either co-translationally or post-translationally.
  • the variants may also be conjugated with other sequences or linkers for identification, purification, or synthesis.
  • the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or nucleotide sequences and may be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably.
  • Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of a sequence under moderate or high stringent conditions. It is apparent that hybridization also includes hybridization with polynucleotides containing common codons or codons taking codon degeneracy into account in the polynucleotide.
  • a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
  • Default parameters for the GAP program are: (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.
  • the mutant SpoT protein of the present application may have the activity of the SpoT protein.
  • the mutant SpoT protein of the present application may have an activity to increase the ability to produce L-amino acids compared to a wild-type polypeptide having the activity of the SpoT protein.
  • the term "SpoT protein” refers to a polypeptide having degradation and/or synthesis activity of (p)ppGpp.
  • the SpoT protein of the present application may be used in combination as a bifunctional (p)ppGpp synthase and a bifunctional (p)ppGpp hydrolase.
  • the sequence of the SpoT protein can be obtained from GenBank of NCBI, which is a known database. Specifically, it may be a polypeptide encoded by a spoT gene, but is not limited thereto.
  • the SpoT protein of the present application may be derived from Escherichia sp. In one embodiment, the SpoT protein of the present application may be the amino acid sequence of SEQ ID NO: 1. In one embodiment, the SpoT protein of the present application is 70% or more, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more of the amino acid sequence of SEQ ID NO: 1 amino acid sequences having homology or identity. However, it is not limited thereto.
  • corresponding to refers to an amino acid residue at a listed position in a polypeptide, or to an amino acid residue that is similar, identical or homologous to a listed residue in a polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that refers to a specific sequence.
  • corresponding region generally refers to a similar or corresponding position in a related protein or reference protein.
  • any amino acid sequence is aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered with reference to the numerical position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 1.
  • a sequence alignment algorithm such as that described in this application can identify the position of an amino acid, or a position at which modifications, such as substitutions, insertions, or deletions, occur compared to a query sequence (also referred to as a "reference sequence").
  • Such alignments include, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al. , 2000), Trends Genet. 16: 276-277), etc., but is not limited thereto, and a sequence alignment program known in the art, a pairwise sequence comparison algorithm, etc. may be appropriately used.
  • Another aspect of the present application is to provide a polynucleotide encoding the variant SpoT protein of the present application.
  • polynucleotide refers to a DNA or RNA strand of a certain length or longer as a polymer of nucleotides in which nucleotide monomers are connected in a long chain form by covalent bonds, and more specifically, the mutant SpoT protein It refers to a polynucleotide fragment encoding
  • the polynucleotide encoding the variant SpoT protein of the present application may include a nucleotide sequence encoding an amino acid sequence comprising a substitution of an amino acid corresponding to position 262 in the sequence of SEQ ID NO: 1 with another amino acid.
  • the polynucleotide of the present application may include, consist of, or consist essentially of a nucleotide sequence encoding the amino acid sequence of SEQ ID NOs: 19 to 24.
  • the polynucleotide of the present application is codon degeneracy (degeneracy) or codon preferred in the organism to express the variant protein of the present application, within the range that does not change the amino acid sequence of the variant protein of the present application Various modifications may be made to the coding region.
  • the polynucleotide of the present application has 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more homology or identity to the sequence of SEQ ID NO: 2 Having or including a nucleotide sequence that is more than, 98% or more, and less than 100%, or homology or identity with the sequence of SEQ ID NO: 2 is 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% of the nucleotide sequence may consist or consist essentially of, but is not limited thereto.
  • the codon encoding the amino acid corresponding to position 262 of SEQ ID NO: 1 is an amino acid other than alanine, specifically, glycine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan , proline, serine, threonine, cysteine, tyrosine, asparagine, glutamine, aspartic acid, glutamic acid, lysine, arginine and histidine.
  • polynucleotide of the present application may be included without limitation as long as it can hybridize under stringent conditions with a probe that can be prepared from a known gene sequence, for example, a sequence complementary to all or part of the polynucleotide sequence of the present application.
  • stringent condition means a condition that enables specific hybridization between polynucleotides. These conditions are specifically described in the literature (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
  • polynucleotides with high homology or identity 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or a condition in which polynucleotides having 99% or more homology or identity hybridize with each other and polynucleotides with lower homology or identity do not hybridize, or a washing condition of conventional Southern hybridization at 60°C, 1XSSC, 0.1% SDS, specifically 60°C, 0.1XSSC, 0.1% SDS, more specifically 68°C, 0.1XSSC, 0.1% SDS at a salt concentration and temperature equivalent to one wash, specifically two to three washes conditions can be enumerated.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization.
  • the term "complementary" is used to describe the relationship between nucleotide bases capable of hybridizing to each other.
  • adenosine is complementary to thymine
  • cytosine is complementary to guanine.
  • the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments complementary to the overall sequence.
  • a polynucleotide having homology or identity to the polynucleotide of the present application can be detected using the hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions.
  • the Tm value may be 60 °C, 63 °C, or 65 °C, but is not limited thereto and may be appropriately adjusted by those skilled in the art depending on the purpose.
  • the appropriate stringency for hybridizing the polynucleotides depends on the length of the polynucleotides and the degree of complementarity, and the parameters are well known in the art (eg, J. Sambrook et al., supra).
  • Another aspect of the present application is to provide a vector comprising the polynucleotide of the present application.
  • the vector may be an expression vector for expressing the polynucleotide in a host cell, but is not limited thereto.
  • the "vector" of the present application refers to a DNA preparation comprising the nucleotide sequence of a polynucleotide encoding the target polypeptide operably linked to a suitable expression control region (or expression control sequence) so that the target polypeptide can be expressed in a suitable host.
  • a suitable expression control region or expression control sequence
  • the expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the vector After transformation into an appropriate host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
  • the vector used in the present application is not particularly limited, and any vector known in the art may be used.
  • Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in a natural or recombinant state.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors may be used.
  • pBluescript II-based pGEM-based, pTZ-based, pCL-based, pET-based and the like
  • pDZ pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like
  • pC1BAC vectors and the like can be used.
  • a polynucleotide encoding a target polypeptide may be inserted into a chromosome through a vector for intracellular chromosome insertion.
  • the insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted.
  • the selection marker is used to select cells transformed with the vector, that is, to determine whether a target nucleic acid molecule is inserted, and selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface polypeptide expression. Markers to be given can be used. In an environment treated with a selective agent, only the cells expressing the selectable marker survive or exhibit other expression traits, so that the transformed cells can be selected.
  • the term "transformation” refers to introducing a vector including a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome, as long as they can be expressed in the host cell.
  • the polynucleotide includes DNA and/or RNA encoding a target polypeptide.
  • the polynucleotide may be introduced in any form as long as it can be introduced and expressed into a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression.
  • the expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding the target variant of the present application and the polynucleotide sequence are functionally linked.
  • mutant SpoT protein of the present application is the mutant SpoT protein of the present application; a polynucleotide encoding the variant SpoT protein; And it is to provide a microorganism comprising one or more of the vector containing the polynucleotide, Escherichia sp. (Escherichia sp.).
  • the microorganism of the present application may include the mutant SpoT protein of the present application, a polynucleotide encoding the mutant protein, or a vector including the polynucleotide of the present application.
  • the microorganism of the present application expresses the mutant SpoT protein of the present application, including a vector comprising a polynucleotide encoding the mutant protein, or the polynucleotide of the present application, the mutant SpoT protein of the present application can do.
  • strain or microorganism
  • strain includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially.
  • a specific mechanism is weakened or enhanced as a microorganism, and may be a microorganism including genetic modification for the production of a desired polypeptide, protein or product.
  • the strain of the present application includes a strain comprising any one or more of the vector including the variant protein of the present application, the polynucleotide of the present application, and the polynucleotide of the present application; a strain modified to express the variant protein of the present application or the polynucleotide of the present application; a strain expressing the variant protein of the present application, or the polynucleotide of the present application (eg, a recombinant strain); Or it may be a strain having the mutant protein activity of the present application (eg, a recombinant strain), but is not limited thereto.
  • the strain of the present application may be a strain having the ability to produce L- amino acids.
  • the L-amino acid may be L-tryptophan.
  • the strain of the present application is a microorganism having the ability to naturally produce SpoT protein or L-amino acid, or the mutant SpoT protein of the present application or a polynucleotide encoding the same in a microorganism having no SpoT protein or L-amino acid production ability (or the polynucleotide A vector including nucleotides) may be introduced and/or a microorganism to which L-amino acid production ability is imparted, but is not limited thereto.
  • the strain of the present application is a cell or microorganism that is transformed with a vector containing the polynucleotide of the present application or a polynucleotide encoding the mutant protein of the present application, and expresses the mutant protein of the present application, of the strain may include all microorganisms capable of producing L-amino acids, including the variant protein of the present application.
  • the strain of the present application is a recombinant strain in which the SpoT variant is expressed by introducing the polynucleotide encoding the variant of the present application into a natural wild-type microorganism or a microorganism producing L-amino acids, thereby increasing the ability to produce L-amino acids.
  • the recombinant strain having an increased L-amino acid production ability may be a microorganism having an increased L-amino acid production ability compared to a natural wild-type microorganism or a non-SpoT microorganism (ie, a microorganism expressing a wild-type SpoT protein), but is limited thereto not.
  • the SpoT protein unmodified microorganism which is the target strain for comparing the increase in the L-amino acid production ability, may be CA04-4303 and KCCM11166P strain, but is not limited thereto.
  • the recombinant strain with increased L-amino acid production capacity may have increased by about 5% or more, 6% or more, or 8% or more compared to the L-amino acid production capacity of the parent strain or unmodified microorganism before mutation, but the parent strain before mutation Or, as long as it has an increased amount of + value compared to the production capacity of the unmodified microorganism, it is not limited thereto.
  • the term "about” is a range including all of ⁇ 0.5, ⁇ 0.4, ⁇ 0.3, ⁇ 0.2, ⁇ 0.1, etc., including all numerical values in a range equal to or similar to the numerical value following the term about, but not limited
  • the term "unmodified microorganism” does not exclude a strain containing a mutation that can occur naturally in a microorganism, it is a wild-type strain or a natural-type strain itself, or a genetic variation caused by natural or artificial factors. It may mean the strain before being changed.
  • the unmodified microorganism may refer to a strain in which the mutant SpoT protein described herein is not introduced or before it is introduced.
  • the "unmodified microorganism” may be used interchangeably with "strain before modification", “microbe before modification”, “unmodified strain”, “unmodified strain”, “unmodified microorganism” or "reference microorganism”.
  • the microorganism of the present application may be a microorganism of the genus Escherichia. Specifically, it may be Escherichia coli , but is not limited thereto.
  • the variant SpoT protein, polynucleotide, L-amino acid, and the like are as described in the other aspects above.
  • Another aspect of the present application provides a method for producing L- amino acids, comprising the step of culturing the microorganism of the genus Escherichia of the present application in a medium.
  • the L-amino acid production method of the present application may include culturing an Escherichia spp. strain comprising the mutant SpoT protein of the present application or the polynucleotide of the present application or the vector of the present application in a medium.
  • the L-amino acid may be L-tryptophan.
  • the term "culturing” means growing the Escherichia spp. strain of the present application under moderately controlled environmental conditions.
  • the culture process of the present application may be performed according to a suitable medium and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art according to the selected strain.
  • the culture may be a batch, continuous and/or fed-batch, but is not limited thereto.
  • the term "medium” refers to a material in which nutrients required for culturing the Escherichia sp. strain of the present application are mixed as a main component, and nutrients and growth factors, including water, which are essential for survival and growth supply, etc.
  • any medium and other culture conditions used for culturing the Escherichia sp. strain of the present application may be used without any particular limitation as long as it is a medium used for culturing conventional microorganisms, but the Escherichia sp. strain of the present application It can be cultured under aerobic conditions while controlling temperature, pH, etc. in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid, and/or vitamin.
  • the carbon source includes carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, and the like; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; amino acids such as glutamic acid, methionine, lysine, and the like may be included.
  • natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugar cane offal and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e., converted to reducing sugar). molasses) may be used, and other appropriate amounts of carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more, but is not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine
  • organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract
  • the phosphorus may include potassium first potassium phosphate, second potassium phosphate, or a sodium-containing salt corresponding thereto.
  • potassium first potassium phosphate potassium phosphate
  • second potassium phosphate or a sodium-containing salt corresponding thereto.
  • sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and in addition, amino acids, vitamins and/or suitable precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, the present invention is not limited thereto.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium.
  • an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation.
  • oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without or without gas to maintain anaerobic and microaerobic conditions, it is not
  • the culture temperature may be maintained at 20 to 45° C., specifically, 25 to 40° C., and may be cultured for about 10 to 160 hours, but is not limited thereto.
  • the L-amino acid produced by the culture of the present application may be secreted into the medium or may remain in the cell.
  • the L-amino acid production method of the present application includes the steps of preparing the Escherichia sp. strain of the present application, preparing a medium for culturing the strain, or a combination thereof (regardless of the order, in any order), For example, before the culturing step, it may be further included.
  • the method for producing L-amino acids of the present application may further include recovering L-amino acids from the culture medium (the culture medium) or the Escherichia sp. strain of the present application.
  • the recovering step may be further included after the culturing step.
  • the recovery may be to collect the desired L-amino acid using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method, etc. .
  • a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method, etc. .
  • chromatography such as island chromatography, HPLC, or a combination thereof may be used, and a desired L-amino acid may be recovered from a medium or a microorganism using a suitable method known in the art.
  • the L-amino acid production method of the present application may include an additional purification step.
  • the purification may be performed using a suitable method known in the art.
  • the recovery step and the purification step are performed simultaneously (or sequentially) regardless of the order, or simultaneously or in one step may be integrated and performed, but is not limited thereto.
  • the variant SpoT protein, polynucleotide, vector, strain, etc. are as described in the other aspects above.
  • Another aspect of the present application provides a composition for producing L-amino acids, including the variant SpoT protein of the present application.
  • the composition comprises a mutant SpoT protein of the present application, a polynucleotide encoding the mutant SpoT protein, a vector containing the polynucleotide, or an Escherichia spp. strain containing the polynucleotide of the present application; a culture thereof; Or it may include a combination of two or more of them.
  • composition of the present application may further include any suitable excipients commonly used in compositions for the production of amino acids, and these excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents, etc.
  • excipients commonly used in compositions for the production of amino acids
  • these excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents, etc.
  • the present invention is not limited thereto.
  • the variant SpoT protein, polynucleotide, vector, strain, medium and L-amino acid are the same as those described in the other aspects above.
  • Another aspect of the present application provides a method for increasing the L-amino acid production capacity of a microorganism, comprising modifying the microorganism to express the mutant SpoT protein of the present application.
  • Another aspect of the present application provides use of the mutant SpoT protein of the present application for producing L-amino acids.
  • the variant SpoT protein, microorganism, and L-amino acid are the same as those described in other embodiments.
  • the chromosomal DNA (gDNA) of E. coli wild strain W3110 was extracted using the Genomic-tip system of Qiagen (Co.), and the gDNA PCR (polymerase chain reaction) was performed using a PCR HL premix kit (manufactured by BIONEER, the same hereinafter) as a template.
  • the amplified mutant spoT gene fragment, and the EcoR V restriction enzyme-cleaved vector pSKH vector (US 8569066 B2) for chromosomal transformation were prepared by Gibson assembly (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, Recombinant plasmids were obtained by cloning using the NEBuilder HiFi DNA Assembly Master Mix) method, and depending on the substituted mutations, pSKH- spoT (A262S), pSKH- spoT (A262T), pSKH- spoT (A262C), pSKH- spoT (A262Y) ), pSKH -spoT (A262N), and pSKH- spoT (A262Q). Cloning was performed by mixing the Gibson assembly reagent and each gene fragment with the calculated number of moles, and then storing at 50° C. for 1 hour.
  • Example 2 Development of a mutant strain in which the SpoT 262 amino acid coding sequence is substituted with a polar amino acid coding sequence
  • the coding sequence of alanine, the 262th amino acid of SpoT on the chromosome is a polar amino acid through a secondary crossover process.
  • a strain substituted with the coding sequence of phosphorus serine, threonine, cysteine, tyrosine, asparagine, and glutamine (SEQ ID NOs: 19-24) was obtained.
  • the genetic manipulation was confirmed by PCR and genome sequencing using the primers of SEQ ID NO: 3 and SEQ ID NO: 4 that can amplify the external regions of the upstream region and the downstream region of the homologous recombination into which the gene is inserted, respectively.
  • CA04-4303 (US 2020-0063219 A1), which is another L-tryptophan-producing strain, whether the introduction of the SpoT 262 mutation exhibits the same effect in other L-tryptophan-producing strains of the genus Escherichia.
  • CA04-4303 is a strain in which trpR, mtr, and tnaA are deleted in the wild-type W3110 strain, and the 21st amino acid of trpE is substituted from proline to serine.
  • the L-tryptophan-producing strain KCCM11166P-based SpoT 262 amino acid substituted with a polar amino acid prepared in Example 2 was cultured in the tryptophan titer medium prepared according to the composition shown in Table 2 below to confirm the L-tryptophan-producing ability.
  • Tryptophan titer medium composition composition Concentration (per liter) Glucose 60 g K2HPO4 1 g (NH4)2SO4 10 g NaCl 1 g MgSO4 ⁇ 7H2O 1 g sodium citrate 5 g yeast extract 2 g calcium carbonate 40 g phenylalanine 0.15 g Tyrosine 0.1 g pH 6.8
  • E. coli KCCM11166P cultured overnight on LB solid medium in an incubator at 37 ° C.
  • the consumed sugar of the control KCCM11166P strain observed at 22 hours of culture was 25.0 g/L, but the same time consumption of the mutant strains in which amino acid 262 of the SpoT protein amino acid sequence was substituted with a polar amino acid.
  • the sugar was 27-31 g/L. This is a value that the productivity is improved by 8.8% to 25.8%, and in particular, it was confirmed that the productivity of KCCM11166P::spoT(A262T) was improved the most.
  • the L-amino acid productivity is increased in the microorganism of the genus Escherichia into which the mutant SpoT is introduced in which the amino acid 262 of the amino acid sequence of the present application is substituted with a polar amino acid, resulting in an increase in L-amino acid than in the unmodified strain. This suggests an increase in productivity.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 출원은 변이형 SpoT 단백질 및 이를 이용하여 L-아미노산을 생산하는 방법에 관한 것이다.

Description

변이형 SPOT 단백질 및 이를 이용한 L-아미노산을 생산하는 방법
본 출원은 변이형 SpoT 단백질 및 이를 이용하여 L-아미노산을 생산하는 방법에 관한 것이다.
L-아미노산 생산에 사용되는 미생물들은 초기에 화학적 또는 물리적 돌연변이를 통한 유사체 내성을 나타내는 선별 균주들이 주로 사용되어 왔으나, 1990년대 유전자 재조합 기술의 급격한 발전과 분자수준의 조절 기작들이 규명됨에 따라 유전자 조작 기법을 이용한 재조합 균주들이 주로 사용되고 있다.
긴축감응(stringent response)은 다양한 스트레스 상황에 대한 박테리아의 반응으로 아미노산의 고갈 상황에서 단백질의 합성이 억제되는 현상으로 처음 발견되었으며, 현재는 세포 분열의 정지나 DNA 복제의 저해 등 다양한 생리 활동의 변화를 통해 다양한 스트레스 환경에 적응하기 위한 것으로 알려져 있다(F.C. Neidhart, ed. (Washington, D.C.: ASM Press), (1996) pp. 1458-1496, J. Mol. Microbiol. Biotechnol.(2002) 4: 331-340.). 긴축감응의 핵심 반응은 구아노신 5 인산(pppGpp)과 구아노신 4 인산(ppGpp)에 의해 시작된다. 이 두개의 분자는 기능적으로 큰 차이가 없기 때문에 일반적으로 (p)ppGpp와 같이 표기한다.
대장균의 경우 pppGpp는 RelA 라는 이름을 가진 pppGpp 합성효소에 의해 생성된다. RelA 단백질은 리보솜에서 단백질이 번역되는 상태를 감시한다. 세포 내에 단백질이 부족한 경우 아미노산을 가지지 않은 tRNA의 농도가 높아지는데 이 tRNA가 리보솜에 결합하면 RelA가 활성화 된다. RelA는 구아노신 3인산(GTP)과 아데노신 3인산(ATP)를 반응시켜 pppGpp를 생산한다. 세포 내의 아미노산 농도가 증가하여 균형이 회복되면 SpoT 단백질에 의해 (p)ppGpp가 가수분해된다. SpoT 단백질은 (p)ppGpp의 분해 활성뿐만 아니라 합성 활성도 가지고 있다(Nat Rev Microbiol. (2012) 10(3) : 203-12). 다만 SpoT 단백질과 아미노산 생산간의 관련성은 아직까지 알려져 있지 않다.
본 출원은 변이형 SpoT 단백질 및 이를 이용하여 L-아미노산을 생산하는 방법을 제공한다.
본 출원의 하나의 목적은, 서열번호 1의 서열에서 262번째 위치에 상응하는 아미노산의 다른 아미노산으로의 치환을 포함하는, 변이형 SpoT 단백질을 제공하는 것이다.
본 출원의 다른 목적은 상기 변이형 SpoT 단백질을 코딩하는 폴리뉴클레오티드; 및 이를 포함하는 벡터를 제공하는 것이다.
본 출원의 하나의 목적은, 상기 변이형 SpoT 단백질; 상기 변이형 SpoT 단백질을 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 에스케리키아 속 미생물을 제공하는 것이다.
본 출원의 다른 목적은 상기 미생물을 배지에서 배양하는 것을 포함하는, L-아미노산 생산 방법을 제공하는 것이다.
본 출원의 다른 목적은, 상기 변이형 SpoT 단백질을 발현하도록 미생물을 변형하는 단계를 포함하는, 미생물의 L-아미노산 생산능을 증가시키는 방법 방법을 제공하는 것이다.
본 출원의 변이형 단백질을 이용하여 L-아미노산을 효과적으로 생산할 수 있다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다. 또한, 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 출원의 하나의 양태는 서열번호 1의 서열에서 262번째 위치에 상응하는 아미노산의 다른 아미노산으로의 치환을 포함하는, 변이형 SpoT 단백질을 제공한다.
상기 변이형 SpoT 단백질은, SpoT 단백질의 활성을 갖는 폴리펩티드 또는 SpoT 단백질에서, 서열번호 1의 아미노산 서열의 N-말단으로부터 262번째 위치에 상응하는 아미노산의 다른 아미노산으로의 치환을 포함하는 변이형 단백질을 의미한다.
일 구현예로, 상기 다른 아미노산은 글리신, 발린, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판, 프롤린, 세린, 쓰레오닌, 시스테인, 타이로신, 아스파라긴, 글루타민, 아스파르트산, 글루탐산, 라이신, 아르기닌 및 히스티딘 중 선택되는 아미노산일 수 있다.
전술한 구현예 중 어느 하나에 따른 변이형 단백질로서, 상기 다른 아미노산은 극성 아미노산 중에서 선택되는 것일 수 있다.
전술한 구현예 중 어느 하나에 따른 변이형 단백질로서, 상기 다른 아미노산은 세린, 쓰레오닌, 시스테인, 타이로신, 아스파라긴 및 글루타민 중 선택되는 것일 수 있다.
전술한 구현예 중 어느 하나에 따른 변이형 단백질로서, 상기 변이형 SpoT 단백질은 서열번호 19 내지 24로 기재된 아미노산 서열 중 어느 하나의 서열을 가지거나, 포함하거나, 상기 아미노산 서열로 필수적으로 이루어질(essentially consisting of) 수 있다.
전술한 구현예 중 어느 하나에 따른 변이형 단백질로서, 상기 변이형 SpoT 단백질은 서열번호 1의 아미노산 서열을 기준으로 262번 위치에 상응하는 아미노산의 다른 아미노산으로의 치환을 포함하고, 상기 서열번호 1로 기재된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% 이상 100% 미만의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다.
또한, 이러한 상동성 또는 동일성을 가지며 본 출원의 변이형 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 변이형 단백질도 본 출원의 범위 내에 포함됨은 자명하다.
예를 들어, 상기 아미노산 서열 N-말단, C-말단 그리고/또는 내부에 본 출원의 변이형 단백질의 기능을 변경하지 않는 서열 추가 또는 결실, 자연적으로 발생할 수 있는 돌연변이, 잠재성 돌연변이 (silent mutation) 또는 보존적 치환을 가지는 경우이다.
상기 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 통상적으로, 보존적 치환은 단백질 또는 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않을 수 있다.
본 출원의 변이형 단백질은 "단백질 변이체" 로도 기재될 수 있다.
본 출원에서 용어, "변이체(variant)"는 하나 이상의 아미노산이 보존적 치환(conservative substitution) 및/또는 변형(modification)되어 상기 변이체의 변이 전 아미노산 서열과 상이하나 기능(functions) 또는 특성(properties)이 유지되는 폴리펩티드를 지칭한다. 이러한 변이체는 일반적으로 상기 폴리펩티드의 아미노산 서열 중 하나 이상의 아미노산을 변형하고, 상기 변형된 폴리펩티드의 특성을 평가하여 동정(identify)될 수 있다. 즉, 변이체의 능력은 변이 전 폴리펩티드에 비하여 증가되거나, 변하지 않거나, 또는 감소될 수 있다. 또한, 일부 변이체는 N-말단 리더 서열 또는 막전이 도메인(transmembrane domain)과 같은 하나 이상의 부분이 제거된 변이체를 포함할 수 있다. 다른 변이체는 성숙 단백질(mature protein)의 N- 및/또는 C-말단으로부터 일부분이 제거된 변이체를 포함할 수 있다. 상기 용어 "변이체"는 변이형, 변형, 변이형 폴리펩티드, 변이된 단백질, 변이 및 변이체 등의 용어(영문 표현으로는 modification, modified polypeptide, modified protein, mutant, mutein, divergent 등)가 혼용되어 사용될 수 있으며, 변이된 의미로 사용되는 용어라면 이에 제한되지 않는다. 본 출원의 목적상, 상기 변이체는 서열번호 1의 아미노산 서열의 262번째 위치에 상응하는 아미노산이 다른 아미노산으로 치환된 아미노산 서열을 포함하는 폴리펩티드일 수 있다.
또한, 변이체는 폴리펩티드의 특성과 2차 구조에 최소한의 영향을 갖는 아미노산들의 결실 또는 부가를 포함할 수 있다. 예를 들면 변이체의 N-말단에는 번역-동시에(co-translationally) 또는 번역-후에(post-translationally) 단백질의 이동(translocation)에 관여하는 시그널(또는 리더) 서열이 컨쥬게이트 될 수 있다. 또한 상기 변이체는 확인, 정제, 또는 합성할 수 있도록 다른 서열 또는 링커와 컨쥬게이트 될 수 있다.
본 출원에서 용어, '상동성 (homology)' 또는 '동일성 (identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열 상호간 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
본 출원의 일 예로, 본 출원의 변이형 SpoT 단백질은 SpoT 단백질의 활성을 가질 수 있다. 또한, 본 출원의 변이형 SpoT 단백질은, SpoT 단백질의 활성을 갖는 야생형 폴리펩티드에 비해 L-아미노산 생산능이 증가하도록 하는 활성을 가질 수 있다.
본 출원에서 용어, "SpoT 단백질"은 (p)ppGpp의 분해 및/또는 합성 활성을 가지는 폴리펩티드이다. 구체적으로, 본 출원의 SpoT 단백질은 Bifunctional (p)ppGpp synthase, bifunctional (p)ppGpp hydrolase 로 혼용하여 사용될 수 있다. 본 출원에서 상기 SpoT 단백질은 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있다. 구체적으로 spoT 유전자에 의해 코딩되는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
일 구현예로, 본 출원의 SpoT 단백질은 에스케리키아 속 (Escherichia sp.) 유래일 수 있다. 일 구현예로, 본 출원의 SpoT 단백질은 서열번호 1의 아미노산 서열일 수 있다. 일 구현예로, 본 출원의 SpoT 단백질은 서열번호 1의 아미노산 서열과 70% 이상, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다. 그러나 이에 제한되지 않는다.
본 출원에서, 용어 "상응하는(corresponding to)"은, 폴리펩티드에서 열거되는 위치의 아미노산 잔기이거나, 또는 폴리펩티드에서 열거되는 잔기와 유사하거나 동일하거나 상동한 아미노산 잔기를 지칭한다. 상응하는 위치의 아미노산을 확인하는 것은 특정 서열을 참조하는 서열의 특정 아미노산을 결정하는 것일 수 있다. 본 출원에 사용된 "상응 영역"은 일반적으로 관련 단백질 또는 참조 (reference) 단백질에서의 유사하거나 대응되는 위치를 지칭한다.
예를 들어, 임의의 아미노산 서열을 서열번호 1과 정렬(align)하고, 이를 토대로 상기 아미노산 서열의 각 아미노산 잔기는 서열번호 1의 아미노산 잔기와 상응하는 아미노산 잔기의 숫자 위치를 참조하여 넘버링 할 수 있다. 예를 들어, 본 출원에 기재된 것과 같은 서열 정렬 알고리즘은, 쿼리 시퀀스("참조 서열"이라고도 함)와 비교하여 아미노산의 위치, 또는 치환, 삽입 또는 결실 등의 변형이 발생하는 위치를 확인할 수 있다.
이러한 정렬에는 예를 들어 Needleman-Wunsch 알고리즘 (Needleman 및 Wunsch, 1970, J. Mol. Biol. 48: 443-453), EMBOSS 패키지의 Needle 프로그램 (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) 등을 이용할 수 있으나, 이에 제한되지 않고 당업계에 알려진 서열 정렬 프로그램, 쌍 서열(pairwise sequence) 비교 알고리즘 등을 적절히 사용할 수 있다.
본 출원의 다른 하나의 양태는 본 출원의 변이형 SpoT 단백질을 코딩하는 폴리뉴클레오티드를 제공하는 것이다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 변이형 SpoT 단백질을 코딩하는 폴리뉴클레오티드 단편을 의미한다.
본 출원의 변이형 SpoT 단백질을 코딩하는 폴리뉴클레오티드는, 서열번호 1의 서열에서 262번째 위치에 상응하는 아미노산의 다른 아미노산으로의 치환을 포함하는 아미노산 서열을 코딩하는 염기서열을 포함할 수 있다. 일 구현예로, 본 출원의 폴리뉴클레오티드는 서열번호 19 내지 24의 아미노산 서열을 코딩하는 염기서열을 포함하거나, 이루어지거나, 필수적으로 구성될 수 있다.
본 출원의 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy) 또는 본 출원의 변이형 단백질을 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 본 출원의 변이형 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 본 출원의 폴리뉴클레오티드는 서열번호 2의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열을 가지거나 포함하거나, 또는 서열번호 2의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열로 이루어지거나 필수적으로 이루어질 수 있으나, 이에 제한되지 않는다. 이때, 상기 상동성 또는 동일성을 갖는 서열에서, 서열번호 1의 262번째 위치에 상응하는 아미노산을 코딩하는 코돈은, 알라닌을 제외한 아미노산, 구체적으로, 글리신, 발린, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판, 프롤린, 세린, 쓰레오닌, 시스테인, 타이로신, 아스파라긴, 글루타민, 아스파르트산, 글루탐산, 라이신, 아르기닌 및 히스티딘 중 선택되는 아미노산을 코딩하는 코돈 중 하나 일 수 있다.
또한, 본 출원의 폴리뉴클레오티드는 공지의 유전자 서열로부터 제조될 수 있는 프로브, 예를 들면, 본 출원의 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이브리드화할 수 있는 서열이라면 제한없이 포함될 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(Sambrook et al., supra, 9.50-9.51, 11.7-11.8 참조)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 폴리뉴클레오티드끼리, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 폴리뉴클레오티드끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1XSSC, 0.1% SDS, 구체적으로 60℃, 0.1XSSC, 0.1% SDS, 보다 구체적으로 68℃, 0.1XSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원의 폴리뉴클레오티드는 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 본 출원의 폴리뉴클레오티드와 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
상기 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(예컨대, J. Sambrook et al., 상동).
본 출원의 또 다른 하나의 양태는 본 출원의 폴리뉴클레오티드를 포함하는 벡터를 제공하는 것이다. 상기 벡터는 상기 폴리뉴클레오티드를 숙주세포에서 발현시키기 위한 발현 벡터일 수 있으나, 이에 제한되지 않는다.
본 출원의 "벡터"는 적합한 숙주 내에서 목적 폴리펩티드를 발현시킬 수 있도록 적합한 발현조절영역(또는 발현조절서열)에 작동 가능하게 연결된 상기 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 염기서열을 포함하는 DNA 제조물을 포함할 수 있다. 상기 발현조절영역은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pDZ계, pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 염색체 내로 삽입할 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 폴리펩티드의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 용어 "형질전환"은 표적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 혹은 미생물 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 폴리펩티드가 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 목적 폴리펩티드를 코딩하는 DNA 및/또는 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로도 도입될 수 있다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 변이체를 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원의 또 다른 하나의 양태는 본 출원의 변이형 SpoT 단백질; 상기 변이형 SpoT 단백질을 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는, 에스케리키아 속(Escherichia sp.) 미생물을 제공하는 것이다.
본 출원의 미생물은 본 출원의 변이형 SpoT 단백질, 상기 변이형 단백질을 코딩하는 폴리뉴클레오티드, 또는 본 출원의 폴리뉴클레오티드를 포함하는 벡터를 포함할 수 있다.
일 구현예로, 본 출원의 미생물은 본 출원의 변이형 SpoT 단백질 상기 변이형 단백질을 코딩하는 폴리뉴클레오티드, 또는 본 출원의 폴리뉴클레오티드를 포함하는 벡터를 포함하여, 본 출원의 변이형 SpoT 단백질을 발현할 수 있다.
본 출원에서 용어, "균주(또는, 미생물)"는 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 폴리펩티드, 단백질 또는 산물의 생산을 위하여 유전적 변형(modification)을 포함하는 미생물일 수 있다.
본 출원의 균주는 본 출원의 변이형 단백질, 본 출원의 폴리뉴클레오티드 및 본 출원의 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상을 포함하는 균주; 본 출원의 변이형 단백질 또는 본 출원의 폴리뉴클레오티드를 발현하도록 변형된 균주; 본 출원의 변이형 단백질, 또는 본 출원의 폴리뉴클레오티드를 발현하는 균주 (예컨대, 재조합 균주); 또는 본 출원의 변이형 단백질 활성을 갖는 균주 (예컨대, 재조합 균주)일 수 있으나, 이에 제한되지 않는다.
본 출원의 균주는 L-아미노산 생산능을 가진 균주일 수 있다.
일 구현예로, 상기 L-아미노산은 L-트립토판 일 수 있다.
본 출원의 균주는 자연적으로 SpoT 단백질 또는 L-아미노산 생산능을 가지고 있는 미생물, 또는 SpoT 단백질 또는 L-아미노산 생산능이 없는 모균주에 본 출원의 변이형 SpoT 단백질 또는 이를 코딩하는 폴리뉴클레오티드 (또는 상기 폴리뉴클레오티드를 포함하는 벡터)가 도입되거나 및/또는 L-아미노산 생산능이 부여된 미생물일 수 있으나 이에 제한되지 않는다.
일 예로, 본 출원의 균주는 본 출원의 폴리뉴클레오티드 또는 본 출원의 변이형 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터로 형질전환되어, 본 출원의 변이형 단백질을 발현하는 세포 또는 미생물로서, 본 출원의 균주는 본 출원의 변이형 단백질을 포함하여 L-아미노산을 생산할 수 있는 미생물을 모두 포함할 수 있다. 예를 들어, 본 출원의 균주는 천연의 야생형 미생물 또는 L-아미노산을 생산하는 미생물에 본 출원의 변이체를 코딩하는 폴리뉴클레오티드가 도입됨으로써 SpoT 변이체가 발현되어, L-아미노산 생산능이 증가된 재조합 균주일 수 있다. 상기 L-아미노산 생산능이 증가된 재조합 균주는, 천연의 야생형 미생물 또는 SpoT 비변형 미생물 (즉, 야생형 SpoT 단백질을 발현하는 미생물)에 비하여 L-아미노산 생산능이 증가된 미생물일 수 있으나, 이에 제한되는 것은 아니다. 그 예로, 상기 L-아미노산 생산능의 증가 여부를 비교하는 대상 균주인, SpoT 단백질 비변형 미생물은 CA04-4303, KCCM11166P 균주 일 수 있으나, 이에 제한되지 않는다.
일 예로, 상기 L-아미노산 생산능이 증가된 재조합 균주는 변이 전 모균주 또는 비변형 미생물의 L-아미노산 생산능에 비하여 약 5% 이상, 6% 이상, 8% 이상 증가한 것일 수 있으나, 변이 전 모균주 또는 비변형 미생물의 생산능에 비해 +값의 증가량을 갖는 한, 이에 제한되지 않는다. 상기 용어 "약(about)"은 ±0.5, ±0.4, ±0.3, ±0.2, ±0.1 등을 모두 포함하는 범위로, 약 이란 용어 뒤에 나오는 수치와 동등하거나 유사한 범위의 수치를 모두 포함하나, 이에 제한되지 않는다.
본 출원에서 용어, "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 야생형 균주 또는 천연형 균주 자체이거나, 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미할 수 있다. 예를 들어, 상기 비변형 미생물은 본 명세서에 기재된 변이형 SpoT 단백질이 도입되지 않거나 도입되기 전의 균주를 의미할 수 있다. 상기 "비변형 미생물"은 "변형 전 균주", "변형 전 미생물", "비변이 균주", "비변형 균주", "비변이 미생물" 또는 "기준 미생물"과 혼용될 수 있다.
본 출원의 또 다른 일 예로, 본 출원의 미생물은 에스케리키아 속 미생물일 수 있다. 구체적으로, 대장균(Escherichia coli) 일 수 있으나, 이에 제한되지 않는다.
본 출원의 미생물에서, 변이형 SpoT 단백질, 폴리뉴클레오티드 및 L-아미노산 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 본 출원의 에스케리키아 속 미생물을 배지에서 배양하는 단계를 포함하는, L-아미노산 생산방법을 제공한다.
본 출원의 L-아미노산 생산방법은 본 출원의 변이형 SpoT 단백질 또는 본 출원의 폴리뉴클레오티드 또는 본 출원의 벡터를 포함하는 에스케리키아 속 균주를 배지에서 배양하는 단계를 포함할 수 있다.
일 구현예로, 상기 L-아미노산은 L-트립토판 일 수 있다.
본 출원에서, 용어 "배양"은 본 출원의 에스케리키아 속 균주를 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및/또는 유가식일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "배지"는 본 출원의 에스케리키아 속 균주를 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 에스케리키아 속 균주의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 에스케리키아 속 균주를 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 사카로오스, 락토오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
또한, 본 출원의 에스케리키아 속 균주의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배지의 호기 상태를 유지하기 위하여, 배지 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으며, 이에 한정되는 것은 아니다.
본 출원의 배양에서 배양온도는 20 내지 45℃, 구체적으로는 25 내지 40℃를 유지할 수 있고, 약 10 내지 160 시간 동안 배양할 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 배양에 의하여 생산된 L-아미노산은 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
본 출원의 L-아미노산 생산방법은, 본 출원의 에스케리키아 속 균주를 준비하는 단계, 상기 균주를 배양하기 위한 배지를 준비하는 단계, 또는 이들의 조합(순서에 무관, in any order)을, 예를 들어, 상기 배양하는 단계 이전에, 추가로 포함할 수 있다.
본 출원의 L-아미노산 생산방법은, 상기 배양에 따른 배지(배양이 수행된 배지) 또는 본 출원의 에스케리키아 속 균주로부터 L-아미노산을 회수하는 단계를 추가로 포함할 수 있다. 상기 회수하는 단계는 상기 배양하는 단계 이후에 추가로 포함될 수 있다.
상기 회수는 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 목적하는 L-아미노산을 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 또는 이들의 방법을 조합하여 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 L-아미노산을 회수할 수 있다.
또한, 본 출원의 L-아미노산 생산방법은, 추가적으로 정제 단계를 포함할 수 있다. 상기 정제는 당해 기술분야에 공지된 적합한 방법을 이용하여, 수행할 수 있다. 일 예에서, 본 출원의 L-아미노산 생산방법이 회수 단계와 정제 단계를 모두 포함하는 경우, 상기 회수 단계와 정제 단계는 순서에 상관없이 이시적(또는 연속적)으로 수행되거나, 동시에 또는 하나의 단계로 통합되어 수행될 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 방법에서, 변이형 SpoT 단백질, 폴리뉴클레오티드, 벡터 및 균주 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 본 출원의 변이형 SpoT 단백질을 포함하는, L-아미노산 생산용 조성물을 제공한다.
일 구현예로, 상기 조성물은 본 출원의 변이형 SpoT 단백질, 상기 변이형 SpoT 단백질을 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 벡터 또는 본 출원의 폴리뉴클레오티드를 포함하는 에스케리키아 속 균주; 이를 배양한 배양물; 또는 이들 중 2 이상의 조합을 포함하는 것일 수 있다.
본 출원의 조성물은 아미노산 생산용 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 이러한 부형제는, 예를 들어 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 조성물에서, 변이형 SpoT 단백질, 폴리뉴클레오티드, 벡터, 균주, 배지 및 L-아미노산 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 본 출원의 변이형 SpoT 단백질을 발현하도록 미생물을 변형하는 단계를 포함하는, 미생물의 L-아미노산 생산능을 증가시키는 방법을 제공한다.
본 출원의 또 다른 하나의 양태는 본 출원의 변이형 SpoT 단백질의 L-아미노산 생산 용도를 제공한다.
변이형 SpoT 단백질, 미생물 및 L-아미노산 등에 대해서는 다른 양태에서 기재한 바와 같다.
한편, 본원 명세서에서 문맥상 달리 요구하지 않는 한, "포함한다", "포함하는", "함유하는", 등의 표현은 명시된 정수(integer) 또는 정수 그룹의 포함을 의미하지만, 다른 정수 또는 정수의 집합을 배제하는 것이 아니라고 이해되어야 한다.
이하 본 출원을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로 본 출원의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1. 재조합 벡터 pSKH-spoT의 제작
유전자 spoT(서열번호 2)의 변이 부위를 포함하는 DNA 단편 약 1.63 kb 를 얻기 위해, Qiagen(사)의 Genomic-tip 시스템을 이용하여 대장균 야생주인 W3110의 염색체 DNA (gDNA)를 추출하고, 상기 gDNA를 주형으로 PCR HL premix kit(BIONEER사 제품, 이하 동일함)를 사용하여 PCR (polymerase chain reaction)을 수행하였다. SpoT 아미노산 서열(서열번호 1)의 262번 아미노산 알라닌을 다른 극성 아미노산인 세린(S), 쓰레오닌(T), 시스테인(C), 타이로신(Y), 아스파라진(N), 글루타민(Q)으로 치환한 유전자 단편 부위를 증폭시키기 위하여 표 1의 프라이머를 세트를 사용하여 95℃에서 30초의 변성(denaturation), 56℃에서 30초의 어닐링(annealing), 및 68℃에서 1분의 신장(elongation)으로 이루어진 사이클을 27회 반복 수행하여 PCR을 하였다.
그 결과 치환 변이에 대해 각각 0.82kb, 0.88kb 크기의 유전자 단편을 수득하였다.
에스케리키아 속 도입을 위한 SpoT 아미노산 서열의 262번째 아미노산의 변이형 플라스미드 제작을 위한 mutagenic primer 세트
서열번호 염기서열
A262S-1 5 CAGGAATTCGATGTCGCCCTTGTATCTGTTTGAAAGCCT
7 CATTGACGATCACGCGGAA AGA GTAGATGTCCATGA
A262S-2 8 TCGATCATGGACATCTAC TCT TTCCGCGTGATCGTCA
6 GCTAGGTCGACTAGCGTGATCCCCATGTTGCAGATTTT
A262T-1 5 CAGGAATTCGATGTCGCCCTTGTATCTGTTTGAAAGCCT
9 CATTGACGATCACGCGGAA AGT GTAGATGTCCATGA
A262T-2 10 TCGATCATGGACATCTAC ACT TTCCGCGTGATCGTCA
6 GCTAGGTCGACTAGCGTGATCCCCATGTTGCAGATTTT
A262C-1 5 CAGGAATTCGATGTCGCCCTTGTATCTGTTTGAAAGCCT
11 CATTGACGATCACGCGGAA ACA GTAGATGTCCATGA
A262C-2 12 TCGATCATGGACATCTAC TGT TTCCGCGTGATCGTCA
6 GCTAGGTCGACTAGCGTGATCCCCATGTTGCAGATTTT
A262Y-1 5 CAGGAATTCGATGTCGCCCTTGTATCTGTTTGAAAGCCT
13 CATTGACGATCACGCGGAA ATA GTAGATGTCCATGA
A262Y-2 14 TCGATCATGGACATCTAC TAT TTCCGCGTGATCGTCA
6 GCTAGGTCGACTAGCGTGATCCCCATGTTGCAGATTTT
A262N-1 5 CAGGAATTCGATGTCGCCCTTGTATCTGTTTGAAAGCCT
15 CATTGACGATCACGCGGAA ATT GTAGATGTCCATGA
A262N-2 16 TCGATCATGGACATCTAC AAT TTCCGCGTGATCGTCA
6 GCTAGGTCGACTAGCGTGATCCCCATGTTGCAGATTTT
A262Q-1 5 CAGGAATTCGATGTCGCCCTTGTATCTGTTTGAAAGCCT
17 CATTGACGATCACGCGGAA TTG GTAGATGTCCATGA
A262Q-2 18 TCGATCATGGACATCTAC CAA TTCCGCGTGATCGTCA
6 GCTAGGTCGACTAGCGTGATCCCCATGTTGCAGATTTT
증폭된 변이체 spoT 유전자 단편, 그리고 EcoR Ⅴ 제한효소로 절단된 염색체 형질전환용 벡터 pSKH vector(US 8569066 B2)를 깁슨 어셈블리 (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, 치환된 변이에 따라 pSKH-spoT(A262S), pSKH-spoT(A262T), pSKH-spoT(A262C), pSKH-spoT(A262Y), pSKH-spoT(A262N), pSKH-spoT(A262Q)로 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50℃에 1시간 보존함으로써 수행하였다.
실시예 2. SpoT 262 번 아미노산 코딩 서열이 극성 아미노산 코딩 서열로 치환된 돌연변이 균주 개발
실시예 1에서 수득된 pSKH-spoT(A262S), pSKH-spoT(A262T), pSKH-spoT(A262C), pSKH-spoT(A262Y), pSKH-spoT(A262N), pSKH-spoT(A262Q)를 L-트립토판을 생산하는 균주 KCCM11166P (US 8835154 B2)의 electro-competent cell에 전기천공법을 이용하여 형질전환(transformation) 후, 2차 교차 과정을 거쳐 염색체 상에서 SpoT 262 번째 아미노산인 알라닌의 코딩 서열이 극성 아미노산인 세린, 쓰레오닌, 시스테인, 타이로신, 아스파라긴, 글루타민(서열번호 19-24) 코딩 서열로 치환된 균주를 얻었다. 해당 유전자가 삽입된 상동재조합 업스트림 지역과 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 3과 서열번호 4의 프라이머를 이용한 PCR 법과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였다.
서열번호 3 (spoT-confirm forward)
CCAGGAACAGCAAGAGCA
서열번호 4 (spoT-confirm reverse)
ACGGATATTACGGCAGGA
이렇게 수득된 균주를 대장균 KCCM11166P::spoT(A262S), KCCM11166P::spoT(A262T), KCCM11166P::spoT(A262C), KCCM11166P::spoT(A262Y), KCCM11166P::spoT(A262N), KCCM11166P::spoT(A262Q)로 명명하였다.
또한 상기 SpoT 262번 변이의 도입이 다른 에스케리키아 속 L-트립토판 생산 균주에서도 동일한 효과를 나타내는지 또 다른 L-트립토판 생산균주인 CA04-4303 (US 2020-0063219 A1)에서 확인하였다. CA04-4303 은 야생형 W3110 균주에서 trpR, mtr, tnaA가 결손되고, trpE의 21번째 아미노산이 프롤린에서 세린으로 치환된 균주이다. CA04-4303 균주 염색체상의 SpoT 262 번 아미노산인 알라닌 코딩 서열이 극성 아미노산인 세린, 쓰레오닌, 시스테인, 타이로신, 아스파라긴, 글루타민 코딩 서열로 치환된 균주들이 제작되었으며, 제작 과정은 상기에서 기술한 KCCM11166P 도입 과정과 같다.
이렇게 수득된 균주를 CA04-4303::spoT(A262S), CA04-4303::spoT(A262T), CA04-4303::spoT(A262C), CA04-4303::spoT(A262Y), CA04-4303::spoT(A262N), CA04-4303::spoT(A262Q)로 명명하였다.
실시예 3. SpoT 262번 아미노산이 극성 아미노산으로 치환된 돌연변이 균주의 L-트립토판 생산능 비교
실시예 2에서 제작된 L-트립토판 생산 균주 KCCM11166P 기반 SpoT 262번 아미노산이 극성 아미노산으로 치환된 균주들은 하기 표 2의 조성대로 제조된 트립토판 역가 배지에서 배양하여 L-트립토판 생산능을 확인하였다.
트립토판 역가 배지 조성
조성물 농도 (리터당)
Glucose 60 g
K2HPO4 1 g
(NH4)2SO4 10 g
NaCl 1 g
MgSO4·7H2O 1 g
구연산나트륨 5 g
효모액기스 2 g
탄산칼슘 40 g
페닐알라닌 0.15 g
타이로신 0.1 g
pH 6.8
구체적으로, 37℃ 배양기(incubator)에서 LB 고체 배지상에 밤새 배양한 대장균 KCCM11166P 및 대장균 KCCM11166P::spoT(A262S), KCCM11166P::spoT(A262T), KCCM11166P::spoT(A262C), KCCM11166P::spoT(A262Y), KCCM11166P::spoT(A262N), KCCM11166P::spoT(A262Q)를 각각 상기 표 2의 25 mL 역가 배지에 한 백금이씩 접종한 다음, 이를 37℃, 200 rpm의 배양기에서 48시간 동안 배양하여 당 소모속도 및 L-트립토판 농도를 비교하였다.
그 결과, 하기 표 3에 기재된 바와 같이, 배양 22시간에 관찰된 대조군 KCCM11166P 균주의 소모당은 25.0 g/L이지만, SpoT 단백질 아미노산 서열의 262번 아미노산을 극성 아미노산으로 치환한 돌연변이 균주들의 동일 시간 소모당은 27~31 g/L이었다. 이는, 생산성이 8.8%~25.8% 향상된 수치이며, 특히 KCCM11166P::spoT(A262T)의 생산성이 가장 크게 향상됨을 확인할 수 있었다.
이러한 결과를 통해 SpoT 단백질의 262 번 아미노산 위치가 해당 단백질의 활성을 변화시키기 위한 주요 지역임을 확인시켜주며, 262번 아미노산의 극성 아미노산으로의 치환을 통해 L-트립토판 발효에 있어 생산성을 크게 향상 시킬 수 있음을 의미한다.
SpoT 변이형이 포함된 트립토판 균주 역가 비교
균주 소모당
(g/L)*		 트립토판
(g/L)*		 생산성*
(g/L/h)		 트립토판
(g/L)**
KCCM11166P 25.0 3.5 0.159 8.1
KCCM11166P::spoT(A262S) 29.5 4.2 0.191 8.3
KCCM11166P::spoT(A262T) 31.0 4.4 0.200 8.2
KCCM11166P::spoT(A262C) 27.0 3.8 0.173 8.1
KCCM11166P::spoT(A262Y) 29.2 4.1 0.186 8.3
KCCM11166P::spoT(A262N) 39.6 4.2 0.191 8.1
KCCM11166P::spoT(A262Q) 27.8 3.9 0.177 8.2
*22시간 측정치, ** 48시간 측정치
SpoT 262번 아미노산의 극성 아미노산으로의 치환에 따른 L-트립토판 생산능의 변화는 실시예 2에서 수득한 CA04-4303 균주에서 다시 확인되었다. L-트립토판 생산능 비교를 위한 배양 방법 및 배지 조성은 상기 KCCM11166P 기반 배양과 동일하다.
하기 결과에서 알 수 있듯이, L-트립토판 생산 균주 CA04-4303 균주 기반 SpoT 262번 아미노산의 치환에서도 본 출원에서 선별한 변이가 L-트립토판 생산성을 크게 향상시킴을 보였다.
하기 표 4에 기재된 바와 같이, 배양 22시간에 관찰된 대조군 CA04-4303 균주의 소모당은 30.0 g/L이지만, SpoT 단백질 아미노산 서열의 262번 아미노산을 극성 아미노산으로 치환한 돌연변이 균주들의 동일 시간 소모당은 31.8~33.0 g/L이었다. 이는, 생산성이 13.0%~30.4% 향상된 수치이며, 특히 CA04-4303::spoT(A262Y)의 생산성이 가장 크게 향상됨을 확인할 수 있었다.
야생형 유래 균체 성장 및 트립토판 생성능 평가 결과
균주 소모당
(g/L)*		 트립토판
(g/L)*		 생산성*
(g/L/h)		 트립토판
(g/L)**
CA04-4303 30.0 0.50 0.023 1.3
CA04-4303(spoT A262S) 33.1 0.60 0.027 1.5
CA04-4303(spoT A262T) 33.0 0.64 0.029 1.4
CA04-4303(spoT A262C) 31.8 0.58 0.026 1.3
CA04-4303(spoT A262Y) 32.0 0.67 0.030 1.4
CA04-4303(spoT A262N) 32.9 0.62 0.028 1.5
CA04-4303(spoT A262Q) 32.5 0.59 0.027 1.4
*22시간 측정치, ** 48시간 측정치
상기와 같은 결과들은, 본 출원의 아미노산 서열의 262번 아미노산을 극성 아미노산으로 치환한 변이형 SpoT가 도입된 에스케리키아속 미생물에서 L-아미노산 생산성이 증가되어 결과적으로 비변형 균주보다 L-아미노산의 생산성이 증가되는 것을 시사하는 것이다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (13)

  1. 서열번호 1의 서열에서 262번째 위치에 상응하는 아미노산의 다른 아미노산으로의 치환을 포함하는, 변이형 SpoT 단백질.
  2. 제1항에 있어서, 상기 다른 아미노산은 극성 아미노산 중에서 선택되는 것인, 변이형 SpoT 단백질.
  3. 제1항에 있어서, 상기 다른 아미노산은 세린, 쓰레오닌, 시스테인, 타이로신, 아스파라긴 및 글루타민 중 선택되는 것인, 변이형 SpoT 단백질.
  4. 제1항 내지 제3항 중 어느 한 항의 변이형 SpoT 단백질을 코딩하는 폴리뉴클레오티드.
  5. 제1항 내지 제3항 중 어느 한 항의 변이형 SpoT 단백질 및 상기 변이형 SpoT 단백질을 코딩하는 폴리뉴클레오티드 중 1 이상을 포함하는, 에스케리키아 속(Escherichia sp.) 미생물.
  6. 제5항에 있어서, 상기 에스케리키아 속 미생물은 대장균인, 에스케리키아 속 미생물.
  7. 제5항에 있어서, 상기 에스케리키아 속 미생물은 L-아미노산을 생산하는 것인, 에스케리키아 속 미생물.
  8. 제7항에 있어서, 상기 L-아미노산은 L-트립토판인 것인, 에스케리키아 속 미생물.
  9. 제5항의 에스케리키아 속 미생물을 배지에서 배양하는 단계를 포함하는, L-아미노산을 생산하는 방법.
  10. 제9항에 있어서, 상기 L-아미노산은 L-트립토판인 것인, L-아미노산을 생산하는 방법.
  11. 제9항에 있어서, 상기 방법은 상기 미생물 또는 배지로부터 L-아미노산을 회수하는 단계를 포함하는, L-아미노산을 생산하는 방법.
  12. 제1항 내지 제3항 중 어느 한 항의 변이형 SpoT 단백질, 상기 변이형 SpoT 단백질을 발현하는 에스케리키아 속 미생물 또는 상기 미생물의 배양물을 포함하는 L-아미노산 생산용 조성물.
  13. 제1항 내지 제3항 중 어느 한 항의 변이형 SpoT 단백질을 발현하도록 미생물을 변형하는 단계를 포함하는, 미생물의 L-아미노산 생산능을 증가시키는 방법.
PCT/KR2022/006097 2021-04-28 2022-04-28 변이형 spot 단백질 및 이를 이용한 l-아미노산을 생산하는 방법 WO2022231342A1 (ko)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CA3215115A CA3215115A1 (en) 2021-04-28 2022-04-28 Mutant spot protein and method for producing l-amino acids using same
JP2023561411A JP2024513452A (ja) 2021-04-28 2022-04-28 変異型ＳｐｏＴタンパク質及びそれを用いたＬ－アミノ酸を生産する方法
CN202280031422.8A CN117222658A (zh) 2021-04-28 2022-04-28 突变SpoT蛋白和利用其生产L-氨基酸的方法
EP22796174.5A EP4306536A1 (en) 2021-04-28 2022-04-28 Mutant spot protein and method for producing l-amino acids using same
BR112023022402A BR112023022402A2 (pt) 2021-04-28 2022-04-28 Proteína spot variante, polinucleotídeo, micro-organismo do gênero escherichia, método e composição para produzir um l-aminoácido, método para aumentar a capacidade de produção de l-aminoácido de um micro-organismo e uso de uma proteína spot variante para produzir um l-aminoácido

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210055169A KR20220147981A (ko) 2021-04-28 2021-04-28 변이형 SpoT 단백질 및 이를 이용한 L-아미노산을 생산하는 방법
KR10-2021-0055169 2021-04-28

Publications (1)

Publication Number Publication Date
WO2022231342A1 true WO2022231342A1 (ko) 2022-11-03

Family

ID=83847069

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/006097 WO2022231342A1 (ko) 2021-04-28 2022-04-28 변이형 spot 단백질 및 이를 이용한 l-아미노산을 생산하는 방법

Country Status (7)

Country Link
EP (1) EP4306536A1 (ko)
JP (1) JP2024513452A (ko)
KR (1) KR20220147981A (ko)
CN (1) CN117222658A (ko)
BR (1) BR112023022402A2 (ko)
CA (1) CA3215115A1 (ko)
WO (1) WO2022231342A1 (ko)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010187552A (ja) * 2009-02-16 2010-09-02 Ajinomoto Co Inc Ｌ−アミノ酸生産菌及びｌ−アミノ酸の製造法
KR20120083795A (ko) * 2011-01-18 2012-07-26 씨제이제일제당 (주) Ｌ-아미노산의 생산능이 향상된 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법
US8569066B2 (en) 2006-12-29 2013-10-29 Cj Cheiljedang Corporation Genetically engineered recombinant Escherichia coli producing L-tryptophan having originally L-phenylalanine productivity, and method for producing L-tryptophan using the microorganism
CN107267568A (zh) * 2017-07-21 2017-10-20 徐州工程学院 利用spoT基因缺失菌株通过发酵生产L‑氨基酸的方法
CN110592109A (zh) * 2019-08-28 2019-12-20 黑龙江伊品生物科技有限公司 一种spoT基因改造的重组菌株及其构建方法与应用
US20200063219A1 (en) 2018-02-23 2020-02-27 Cj Cheiljedang Corporation Novel l-tryptophan exporter and method of producing l-tryptophan using the same

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8569066B2 (en) 2006-12-29 2013-10-29 Cj Cheiljedang Corporation Genetically engineered recombinant Escherichia coli producing L-tryptophan having originally L-phenylalanine productivity, and method for producing L-tryptophan using the microorganism
JP2010187552A (ja) * 2009-02-16 2010-09-02 Ajinomoto Co Inc Ｌ−アミノ酸生産菌及びｌ−アミノ酸の製造法
KR20120083795A (ko) * 2011-01-18 2012-07-26 씨제이제일제당 (주) Ｌ-아미노산의 생산능이 향상된 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법
US8835154B2 (en) 2011-01-18 2014-09-16 Cj Cheiljedang Corporation Microorganism having enhanced L-amino acids productivity and process for producing L-amino acids using the same
CN107267568A (zh) * 2017-07-21 2017-10-20 徐州工程学院 利用spoT基因缺失菌株通过发酵生产L‑氨基酸的方法
US20200063219A1 (en) 2018-02-23 2020-02-27 Cj Cheiljedang Corporation Novel l-tryptophan exporter and method of producing l-tryptophan using the same
CN110592109A (zh) * 2019-08-28 2019-12-20 黑龙江伊品生物科技有限公司 一种spoT基因改造的重组菌株及其构建方法与应用

Non-Patent Citations (14)

* Cited by examiner, † Cited by third party
Title
"Atlas Of Protein Sequence And Structure", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
"Guide to Huge Computers", 1994, ACADEMIC PRESS
"J. Mol. Microbiol. Biotechnol", vol. 4, 1996, ASM PRESS, pages: 1458 - 1496
ATSCHUL, S. F ET AL., J MOLEC BIOL, vol. 215, 1990, pages 403
CARILLO ET AL., SIAM J APPLIED MATH, vol. 48, 1988, pages 1073
DATABASE PROTEIN 13 October 2021 (2021-10-13), ANONYMOUS : "bifunctional GTP diphosphokinase/guanosine-3',5'-bispyrophosphate 3'-pyrophosphohydrolase [Enterobacteriaceae]", XP055980470, retrieved from NCBI Database accession no. WP_000280488.1 *
DEVEREUX, J ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
DG GIBSON ET AL., NATURE METHODS, vol. 6, 5 May 2009 (2009-05-05)
GRIBSKOV, NUCL. ACIDS RES, vol. 14, 1986, pages 6745
NAT REV MICROBIOL., vol. 10, no. 3, 2012, pages 203 - 12
NEEDLEMAN ET AL., J MOL BIOL., vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
RICE ET AL.: "Trends Genet", vol. 16, 2000, article "EMBOSS: The European Molecular Biology Open Software Suite", pages: 276 - 277

Also Published As

Publication number Publication date
JP2024513452A (ja) 2024-03-25
BR112023022402A2 (pt) 2024-01-23
CN117222658A (zh) 2023-12-12
KR20220147981A (ko) 2022-11-04
CA3215115A1 (en) 2022-11-03
EP4306536A1 (en) 2024-01-17

Similar Documents

Publication Publication Date Title
WO2021162459A1 (ko) 변이형 LysE를 포함하는 미생물, 및 이를 이용한 L-아미노산 생산 방법
WO2019027267A2 (ko) Atp 포스포리보실 전이효소 변이체 및 이를 이용한 l-히스티딘 생산방법
WO2022231368A1 (ko) 신규한 글루타메이트 합성 효소 서브 유니트 알파 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022225322A1 (ko) 신규한 f0f1 atp 합성효소 서브유닛 알파 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022231058A1 (ko) 신규한 수용성 피리딘 뉴클레오티드 트랜스수소효소 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022225319A1 (ko) 신규한 l-세린 암모니아 분해 효소 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022225320A1 (ko) 신규한 포스포글리세린산 디하이드로게나제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022225321A1 (ko) 신규한 f0f1 atp 합성효소 서브유닛 감마 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154190A1 (ko) 신규한 포스포노아세테이트 하이드롤라제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022231369A1 (ko) 신규한 포르메이트 의존성 포스포리보실글리신아미드 포밀 전이효소 변이체 및 이를 이용한 imp 생산 방법
WO2022231370A1 (ko) 신규한 2중기능성 포스포리보실아미노이미다졸카르복사미드 포밀트랜스퍼라아제/imp 사이클로하이드롤라아제 변이체 및 이를 이용한 imp 생산 방법
WO2022225100A1 (ko) 신규한 이중기능성 메틸렌테트라히드로폴레이트 탈수소효소/메테닐테트라하이드로폴레이트 사이클로하이드롤라아제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022158646A1 (ko) 신규한 쿠퍼익스포팅 p-type 에이티피에이즈 a 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022231057A1 (ko) 신규한 아이소시트르산 디하이드로게네이즈 키나아제/포스파타제 효소 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022231342A1 (ko) 변이형 spot 단백질 및 이를 이용한 l-아미노산을 생산하는 방법
WO2022215800A1 (ko) 신규한 분지쇄아미노산 투과효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2022158645A1 (ko) 신규한 데옥시구아노신트리포스페이트 트리포스포하이드로레이즈 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022158650A1 (ko) 신규한 페로체라테이즈 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022158652A1 (ko) 신규한 사이토신 퍼미에이즈 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022163930A1 (ko) 신규한 2-숙시닐-5-엔도피루빌-6-하이드록시-3-사이클로헥센-1-카복실레이트 신타아제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163929A1 (ko) 신규한 펩티딜-디펩티다제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163932A1 (ko) 신규한 알데하이드 디하이드로게나제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154188A1 (ko) 신규한 폴리케타이드 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154192A1 (ko) 신규한 알데하이드 디하이드로게나제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022245000A1 (ko) Agl 단백질의 활성이 강화된, 아미노산을 생산하는 미생물 및 이를 이용한 아미노산 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22796174

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2023561411

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 3215115

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2022796174

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: MX/A/2023/012307

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2022796174

Country of ref document: EP

Effective date: 20231012

WWE Wipo information: entry into national phase

Ref document number: 18557282

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 202280031422.8

Country of ref document: CN

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023022402

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 2023125543

Country of ref document: RU

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 112023022402

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20231026