WO2021150959A1 - Animal-free dietary collagen - Google Patents
Animal-free dietary collagen Download PDFInfo
- Publication number
- WO2021150959A1 WO2021150959A1 PCT/US2021/014714 US2021014714W WO2021150959A1 WO 2021150959 A1 WO2021150959 A1 WO 2021150959A1 US 2021014714 W US2021014714 W US 2021014714W WO 2021150959 A1 WO2021150959 A1 WO 2021150959A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- naturally occurring
- occurring polypeptide
- terminal truncation
- seq
- amino acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L2/00—Non-alcoholic beverages; Dry compositions or concentrates therefor; Preparation or treatment thereof
- A23L2/52—Adding ingredients
- A23L2/66—Proteins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A21—BAKING; EDIBLE DOUGHS
- A21D—TREATMENT OF FLOUR OR DOUGH FOR BAKING, e.g. BY ADDITION OF MATERIALS; BAKING; BAKERY PRODUCTS
- A21D2/00—Treatment of flour or dough by adding materials thereto before or during baking
- A21D2/08—Treatment of flour or dough by adding materials thereto before or during baking by adding organic substances
- A21D2/24—Organic nitrogen compounds
- A21D2/26—Proteins
- A21D2/261—Animal proteins
-
- A—HUMAN NECESSITIES
- A21—BAKING; EDIBLE DOUGHS
- A21D—TREATMENT OF FLOUR OR DOUGH FOR BAKING, e.g. BY ADDITION OF MATERIALS; BAKING; BAKERY PRODUCTS
- A21D2/00—Treatment of flour or dough by adding materials thereto before or during baking
- A21D2/08—Treatment of flour or dough by adding materials thereto before or during baking by adding organic substances
- A21D2/24—Organic nitrogen compounds
- A21D2/26—Proteins
- A21D2/264—Vegetable proteins
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L2/00—Non-alcoholic beverages; Dry compositions or concentrates therefor; Preparation or treatment thereof
- A23L2/385—Concentrates of non-alcoholic beverages
- A23L2/39—Dry compositions
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
- A23L33/17—Amino acids, peptides or proteins
- A23L33/18—Peptides; Protein hydrolysates
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/40—Complete food formulations for specific consumer groups or specific purposes, e.g. infant formula
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/16—Emollients or protectives, e.g. against radiation
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/08—Anti-ageing preparations
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q5/00—Preparations for care of the hair
- A61Q5/002—Preparations for repairing the hair, e.g. hair cure
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q5/00—Preparations for care of the hair
- A61Q5/008—Preparations for oily hair
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/78—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin or cold insoluble globulin [CIG]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- A—HUMAN NECESSITIES
- A21—BAKING; EDIBLE DOUGHS
- A21D—TREATMENT OF FLOUR OR DOUGH FOR BAKING, e.g. BY ADDITION OF MATERIALS; BAKING; BAKERY PRODUCTS
- A21D13/00—Finished or partly finished bakery products
- A21D13/80—Pastry not otherwise provided for elsewhere, e.g. cakes, biscuits or cookies
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23G—COCOA; COCOA PRODUCTS, e.g. CHOCOLATE; SUBSTITUTES FOR COCOA OR COCOA PRODUCTS; CONFECTIONERY; CHEWING GUM; ICE-CREAM; PREPARATION THEREOF
- A23G3/00—Sweetmeats; Confectionery; Marzipan; Coated or filled products
- A23G3/34—Sweetmeats, confectionery or marzipan; Processes for the preparation thereof
- A23G3/36—Sweetmeats, confectionery or marzipan; Processes for the preparation thereof characterised by the composition containing organic or inorganic compounds
- A23G3/44—Sweetmeats, confectionery or marzipan; Processes for the preparation thereof characterised by the composition containing organic or inorganic compounds containing peptides or proteins
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
- A23L33/17—Amino acids, peptides or proteins
- A23L33/195—Proteins from microorganisms
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
- A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/02—Preparations for care of the skin for chemically bleaching or whitening the skin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q3/00—Manicure or pedicure preparations
Definitions
- Collagen is one of the most abundant proteins found in various connective tissues in the body including tendons, ligaments, skin, and hair.
- Collagens or collagen supplements are popular in medical, cosmetic, and/or health purposes (e.g., stimulating skin growth, promoting wound healing, strengthening nails or joints, etc.).
- Collagens for most collagen supplements are derived from animals as a byproduct of the animal processing industry. Yet, such animal-derived collagens may increase the risk of illness transmission as well as allergies.
- certain consumers are generally interested in animal-free products for a variety of other reasons. Thus, there remains a need for improved compositions and methods of collagens derived from non animal sources.
- a non-naturally occurring polypeptide comprising an amino acid sequence having: (i) at least 80% sequence identity to SEQ ID NO: 31 with an N-terminal truncation, a C-terminal truncation, or both; or (ii) at least 80% sequence identity to SEQ ID NO: 32 with an N-terminal truncation, a C-terminal truncation, or both.
- the non- naturally occurring polypeptide comprises an amino acid sequence having: (i) at least 85% sequence identity to SEQ ID NO: 31 with an N-terminal truncation, a C-terminal truncation, or both; or (ii) at least 85% sequence identity to SEQ ID NO: 32 with an N-terminal truncation, a C- terminal truncation, or both.
- the non-naturally occurring polypeptide comprises an amino acid sequence having: (i) at least 90% sequence identity to SEQ ID NO: 31 with an N- terminal truncation, a C-terminal truncation, or both; or (ii) at least 90% sequence identity to SEQ ID NO: 32 with an N-terminal truncation, a C-terminal truncation, or both.
- the non-naturally occurring polypeptide comprises an amino acid sequence having: (i) at least 95% sequence identity to SEQ ID NO: 31 with an N-terminal truncation, a C-terminal truncation, or both; or (ii) at least 95% sequence identity to SEQ ID NO: 32 with an N-terminal truncation, a C- terminal truncation, or both.
- the non-naturally occurring polypeptide comprises an amino acid sequence having: (i) at least 98% sequence identity to SEQ ID NO: 31 with an N- tenninal truncation, a C-terminal truncation, or both; or (ii) at least 98% sequence identity to SEQ ID NO: 32 with an N-terminal truncation, a C-terminal truncation, or both.
- the non-naturally occurring polypeptide comprises: (i) the amino acid sequence of SEQ ID NO: 31 with an N-terminal truncation, a C-terminal truncation, or both; or (ii) the amino acid sequence of SEQ ID NO: 32 with an N-terminal truncation, a C-terminal truncation, or both.
- the non-naturally occurring polypeptide comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 31 with an N-terminal truncation.
- the N-terminal truncation is an N-terminal truncation of 50 amino acids to 600 amino acids.
- the non-naturally occurring polypeptide comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 31 with a C-terminal truncation.
- the C-terminal truncation is a C-terminal truncation of 50 amino acids to 250 amino acids.
- the non-naturally occurring polypeptide comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 31 with both an N-terminal truncation and a C-terminal truncation.
- the N-terminal truncation is an N-terminal truncation of 50 amino acids to 600 amino acids
- the C-terminal truncation is a C-terminal truncation of 50 amino acids to 250 amino acids.
- the non-naturally occurring polypeptide comprises the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 6.
- the non-naturally occurring polypeptide consists of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 6.
- the non-naturally occurring polypeptide comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 32 with an N-terminal truncation.
- the N- terminal truncation is an N-terminal truncation of 50 amino acids to 750 amino acids.
- the non-naturally occurring polypeptide comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 32 with a C-terminal truncation.
- the C- terminal truncation is a C-terminal truncation of 50 amino acids to 250 amino acids.
- the non-naturally occurring polypeptide comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 32 with both an N-terminal truncation and a C-terminal truncation.
- the N-terminal truncation is an N-terminal truncation of 50 amino acids to 750 amino acids
- the C-terminal truncation is a C-terminal truncation of 50 amino acids to 250 amino acids.
- the non-naturally occurring polypeptide comprises the amino acid sequence of SEQ ID NO: 8.
- the non-naturally occurring polypeptide consists of the amino acid sequence of SEQ ID NO: 8.
- the non-naturally occurring polypeptide has a total truncation of 50 amino acids to 900 amino acids.
- the non- naturally occurring polypeptide is 50 amino acids to 250 amino acids in length.
- the non-naturally occurring polypeptide does not comprise one or more of: a laminin G domain, a Von Willebrand factor type A (vWA) domain, and a fibrillar collagen C-terminal domain.
- the non-naturally occurring polypeptide comprises one or more collagen triple helix repeats.
- the non-naturally occurring polypeptide is monomeric.
- the non-naturally occurring polypeptide does not form a stable triple helix structure of a naturally occurring collagen.
- the non-naturally occurring polypeptide is substantially free of other collagen chains.
- the non-naturally occurring polypeptide has a non- naturally occurring level of hydroxylation relative to a naturally-occurring collagen.
- fewer than 10% of prolines present in the non-naturally occurring polypeptide are hydroxylated. In some cases, the non-naturally occurring polypeptide is non-hydroxylated. In some cases, the non-naturally occurring polypeptide has a non-naturally occurring level of glycosylation relative to a naturally-occurring collagen. In some cases, the non-naturally occurring polypeptide protein comprises less than 5 wt. % glycosylation.
- a composition comprising between 0.001% and 30% w/w of the non-naturally occurring polypeptide of any one of the preceding.
- the composition is formulated for consumption by an individual.
- the composition is a nutraceutical.
- the individual is a human.
- a method of improving the appearance of the skin, the hair, and/or the nails of a subject, and/or improving bone, muscle, and/or joint health in the subject comprising: administering to the subject a composition of any one of the preceding compositions. In some cases, the administering comprises orally administering to the subject.
- a recombinant cell is provided containing therein at least one copy of a heterologous nucleic acid sequence encoding a non-naturally occurring polypeptide of any one of the preceding. In some cases, the recombinant cell is a microbial cell. In some cases, the microbial cell is a bacterial cell.
- the bacterial cell is of the species Escherichia coli.
- the recombinant cell lacks an enzyme that hydroxylates one or more amino acids of the non-naturally occurring polypeptide.
- the recombinant cell lacks prolyl 4-hydroxylase and/or prolyl 3 -hydroxylase.
- the heterologous nucleic acid sequence comprises a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, and 25-30.
- the heterologous nucleic acid sequence comprises a nucleic acid sequence having at least 85% sequence identity to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, and 25-30.
- the heterologous nucleic acid sequence comprises a nucleic acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, and 25-30. In some cases, the heterologous nucleic acid sequence comprises a nucleic acid sequence having at least 95% sequence identity to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, and 25-30. In some cases, the heterologous nucleic acid sequence comprises a nucleic acid sequence having at least 98% sequence identity to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, and 25-30. In some cases, the non-naturally occurring polypeptide further comprises a secretion signal.
- the recombinant cell secretes the non-naturally occurring polypeptide into the periplasm, into a culture media, or extracellularly.
- the heterologous nucleic acid sequence is codon-optimized for expression in the recombinant cell.
- the heterologous nucleic acid sequence is operably linked to an inducible promoter or a constitutive promoter.
- the heterologous nucleic acid is or is contained in a plasmid.
- the heterologous nucleic acid sequence is stably integrated into a chromosome of the recombinant cell.
- a culture medium comprising a recombinant cell of any one of the preceding.
- the culture medium further comprises the non-naturally occurring polypeptide of any one of the preceding secreted from the recombinant cell.
- the present disclosure further provides a recombinant cell containing therein at least one copy of a heterologous nucleic acid sequence encoding collagen selected from the group consisting of: Gallus gallus collagen or Acipenser schrenckii (Japanese sturgeon) collagen.
- the recombinant cell is a microbial cell.
- the microbial cell is a bacterial cell.
- the bacterial cell is of the species Escherichia coli.
- the heterologous nucleic acid sequence comprises any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, and 25-30.
- the collagen is a Gallus gallus Type 21 collagen. In some embodiments, the collagen is a Acipenser schrenckii Type 2 alpha 1 collagen. In some embodiments, the collagen is a non-naturally occurring collagen. In some embodiments, the collagen is a truncated collagen. In some embodiments, the collagen comprises an amino acid sequence according to any one of SEQ ID NOs: 2, 4, 6, and 8.
- the collagen further comprises a secretion signal sequence.
- the secretion signal sequence comprises an amino acid sequence according to any one of SEQ ID NOs: 10, 12, 14, 16, 18, 20, 22, and 24.
- the recombinant cell secretes the collagen into a culture media.
- the recombinant cell secretes to the periplasm.
- the recombinant cell secrets the collagen to the extracellular space.
- the heterologous nucleic acid sequence is codon-optimized for expression in the recombinant cell. In some embodiments, the heterologous nucleic acid sequence is operably linked to an inducible promoter or a constitutive promoter. In some embodiments, the heterologous nucleic acid is or is contained within a plasmid. In some embodiments, the heterologous nucleic acid sequence is stably integrated into the chromosome of the recombinant cell. [0012] The present disclosure also provides a culture medium comprising a recombinant cell described herein. In some embodiments, the culture medium further comprises a recombinant collagen secreted from the recombinant cell.
- the present disclosure also provides a recombinant protein comprising a sequence that has at least 90% sequence identity to a fragment of a collagen selected from the group consisting of: Gallus gallus collagen, and Acipenser schrenckii collagen.
- the collagen is a Gallus gallus Type 21 collagen.
- the collagen is a Acipenser schrenckii Type 2 alpha 1 collagen.
- the collagen is a non-naturally occurring collagen or fragment thereof.
- the protein has a non-naturally occurring level of glycosylation (e.g relative to a corresponding natural collagen).
- the protein comprises less than 5 wt. % glycosylation (e.g., less than 3 wt. %, less than 1 wt. %, less than 0.5 wt. %, or less than 0.1 wt. %).
- the protein is a truncated collagen.
- the protein comprises an amino acid sequence according to any one of SEQ ID NOs: 2, 4, 6, and 8 (or having a sequence identity of at least 90% thereof, at least 95% thereof, at least 98% thereof, or the like).
- the collagen further comprises a secretion signal sequence.
- the secretion signal sequence comprises an amino acid sequence according to SEQ ID NO: 10, 12, 14, 16, 18, 20, 22, and 24.
- the present disclosure also provides a composition comprising a recombinant protein as disclosed herein.
- the composition further comprises a culture media. Additionally and/or alternatively, the composition further comprises a recombinant cell as disclosed herein.
- the recombinant cell is a microbial cell.
- the microbial cell is a bacterial cell.
- the bacterial cell is of the species Escherichia coli.
- the recombinant cell comprises an integrated heterologous nucleic acid sequence encoding a collagen, a truncated collagen, or fragment thereof.
- the heterologous nucleic acid sequence comprises any one of SEQ ID NOs: 1, 3, 5, 7, and 25-30.
- the present disclosure also provides a process for purifying a recombinant collagen, the process comprises incubating a recombinant cell described herein in a culture media wherein the recombinant cell secretes the recombinant collagen into the culture media, collecting the culture media comprising the recombinant collagen secreted thereto, and purifying the recombinant collagen from the culture media.
- the present disclosure also provides a recombinant collagen purified from the culture medium disclosed in the process herein.
- the recombinant collagen has a purity of at least 80%, at least 85%, at least 90%, at least 95%, or at least 99%.
- the present disclosure also provides an expression vector comprising a nucleic acid sequence encoding a non-naturally occurring truncated collagen operably linked to a promoter, wherein the non-naturally occurring truncated collagen is selected from the group consisting of: Gallus gallus collagen and Acipenser schrenckii collagen.
- the nucleic acid sequence comprises any one of SEQ ID NOs: 1, 3, 5, 7, and 25-30.
- the Gallus gallus collagen is Type 21 collagen.
- the Acipenser schrenckii collagen is Type 2 alpha 1 collagen.
- the expression vector further comprises a nucleic acid sequence encoding a secretion signal sequence.
- the nucleic acid sequence encoding the secretion signal sequence comprises any one of SEQ ID NOs: 11, 13, 15, 17, 19, 21, and 23.
- the nucleic acid sequence is codon optimized for expression in a cell.
- the present disclosure also provides a composition comprising a recombinant collagen disclosed herein, formulated for consumption by an individual.
- the composition is a nutraceutical.
- the individual is a human.
- the composition comprises from 0.1% to 10% recombinant collagen.
- the composition comprises at least 50% of recombinant collagen. In some embodiments, the composition comprises from 70% to 99% of recombinant collagen. In some embodiments, the composition further comprises at least one of a carrier and a preservative. [0022]
- the present disclosure also provides a method of improving the appearance of the skin, the hair, and/or the nails of a subject by administering to a subject the composition disclosed herein. In some embodiments, the step of administering comprises orally administering to the subject.
- FIG. 1 shows an image of two SDS-PAGE gels showing bands of collagen proteins in supernatant samples from microbial cell cultures. The identities of each protein are indicated above each band.
- FIGS.2A-2C depict images of SDS-PAGE gels showing bands of non-naturally occurring polypeptides of the disclosure before and after pH 3.0 treatment.
- FIG. 3 depicts increased cell viability of human dermal fibroblasts when treated with a non-naturally occurring polypeptide of the disclosure (comprising an amino acid sequence according to SEQ ID NO: 2).
- FIG. 4 depicts increased collagen type I production in human dermal fibroblasts when treated with a non-naturally occurring polypeptide of the disclosure (comprising an amino acid sequence according to SEQ ID NO: 2).
- FIG. 5 depicts increased collagen type I production in tenocytes when treated with a non- naturally occurring polypeptide of the disclosure (comprising an amino acid sequence according to SEQ ID NO: 2).
- FIG. 6 depicts alignments of non-naturally occurring polypeptides of the disclosure with corresponding naturally occurring collagens.
- FIG. 6 discloses SEQ ID NOS: 33 and 34, respectively, in order of appearance.
- FIG. 7A depicts the effect of pH on viscosity of a solution of an exemplary non-naturally occurring polypeptide of the disclosure.
- FIG. 7B depicts a comparison of the viscosity of a solution of an exemplary non-naturally occurring polypeptide of the disclosure versus a benchmark.
- FIG. 8 depicts viscosity of various blends of an exemplary non-naturally occurring polypeptide of the disclosure and xanthan.
- FIG. 9 depicts gel hardness of a solution of an exemplary non-naturally occurring polypeptide of the disclosure.
- FIG. 10A and FIG. 10B depict gel hardness of solutions of various lots of an exemplary non-naturally occurring polypeptide of the disclosure.
- FIG. 11 depicts the effect of compaction and lecithin agglomeration on an exemplary non- naturally occurring polypeptide of the disclosure.
- FIG. 12 depicts the effect of pH and oil type on gel hardness of gels containing an exemplary non-naturally occurring polypeptide of the disclosure.
- the terms “individual”, “patient”, or “subject” are used interchangeably herein. None of the terms require or are limited to a situation characterized by the supervision (e.g., constant or intermittent) of a health care worker (e.g., a doctor, a registered nurse, a nurse practitioner, a physician’s assistant, an orderly, or a hospice worker).
- a health care worker e.g., a doctor, a registered nurse, a nurse practitioner, a physician’s assistant, an orderly, or a hospice worker.
- the term “comprise” or variations thereof such as “comprises” or “comprising” are to be read to indicate the inclusion of any recited feature but not the exclusion of any other features.
- the term “comprising” is inclusive and does not exclude additional, unrecited features.
- “comprising” may be replaced with “consisting essentially of’ or “consisting of’.
- the phrase “consisting essentially of’ is used herein to require the specified feature(s) as well as those which do not materially affect the character or function of the claimed disclosure.
- the term “consisting” is used to indicate the presence of the recited feature alone.
- treatment of refers to an approach for obtaining beneficial or desired results including but not limited to therapeutic benefit and/or a prophylactic benefit.
- therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated.
- a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the patient, notwithstanding that the patient is still afflicted with the underlying disorder.
- the compositions are, in some embodiments, administered to a patient at risk of developing a particular disease or condition, or to a patient reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease has not been made.
- a “subject” can be a biological entity containing expressed genetic materials.
- the biological entity can be a plant, animal, or microorganism, including, for example, bacteria, viruses, fungi, and protozoa.
- the subject can be tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro.
- the subject can be a mammal.
- the mammal can be a human.
- the subject may be diagnosed or suspected of being at high risk for a disease. In some cases, the subject is not necessarily diagnosed or suspected of being at high risk for the disease.
- truncated collagen as used herein generally refers to a polypeptide that is smaller than a full-length (e.g., natural) collagen wherein one or more portions of the full-length (e.g., natural) collagen is not present.
- the non-naturally polypeptides provided herein may be truncated at the C-terminal end, the N-terminal end, truncated by removal of internal portion(s) of the full-length collagen sequence (e.g., an internal truncation), truncated at both the C- terminal end and the N-terminal end, or may have one or both of a C-terminal truncation and an N-terminal truncation as well as an internal truncation.
- a truncated collagen may comprise an amino acid sequence according to SEQ ID NO: 2, or a homolog thereof.
- a truncated collagen may comprise an amino acid sequence according to SEQ ID NO: 8, or a homolog thereof.
- a “truncation” is inclusive of said amino acid position.
- an N-terminal truncation at amino acid position 100 of a full- length protein means a truncation of 100 amino acids from the N-terminus of the full-length protein (i.e., the truncated protein is missing amino acid positions 1 through 100 of the full- length protein).
- a C-terminal truncation at amino acid position 901 of a full-length protein means a truncation of 100 amino acids from the C-terminus (i.e., the truncated protein is missing amino acid positions 901 through 1000 of the full-length protein).
- an internal truncation at amino acid positions 101 and 200 means an internal truncation of 100 amino acids of the full-length protein (i.e., the truncated protein is missing amino acid positions 101 to 200 of the full-length protein).
- compositions, methods, and systems for manufacturing non-naturally occurring polypeptides such as, e.g., animal-free collagen polypeptides or collagen-like polypeptides, as well as collagen fragments, and/or truncated collagens, such as that are expressed in and/or by genetically engineered microorganisms.
- non-naturally occurring polypeptides include collagen or collagen-like polypeptides, recombinant collagens, collagen fragments, or truncated collagens.
- the non-naturally occurring polypeptides described herein are derived from any suitable source, such as from mammalian or non-mammalian sources.
- the non-naturally occurring polypeptides described herein are derived from (e.g., modified, truncated, fragments of, or the like) collagens of a bird or an avian animal (e.g., Gallus gallus collagen), a freshwater- or saltwater-fish (e.g., Acipenser schrenckii collagen), or any combination thereof.
- a bird or an avian animal e.g., Gallus gallus collagen
- a freshwater- or saltwater-fish e.g., Acipenser schrenckii collagen
- the non-naturally occurring polypeptides provided herein are not normally found in nature. Generally, the non-naturally occurring polypeptides described herein exhibit one or more differences from naturally occurring collagens. In certain aspects, the non-naturally occurring polypeptides provided herein may have a different amino acid sequence from naturally occurring polypeptides (e.g., a truncated collagen). In some cases, the non-naturally occurring polypeptides may have a different structure from a naturally occurring collagen. The quaternary structure of natural collagen is a triple helix, typically composed of three polypeptides. In some aspects, the non-naturally occurring polypeptides described herein may not have or may not form a quaternary structure of natural collagen.
- the non-naturally occurring polypeptides described herein may not form the stable triple helical structure of naturally occurring collagen.
- two are usually identical and are designated as the alpha chain.
- the third polypeptide is designated as the beta chain.
- a typical natural collagen can be designated as AAB, wherein the collagen is composed of two alpha (“A”) strands and one beta (“B”) strand.
- the non-naturally occurring polypeptides described herein do not have the AAB structure of natural collagen.
- the non-naturally occurring polypeptides described herein are free from or substantially free from different collagen chains (e.g., a non-naturally occurring polypeptide described herein may comprise an alpha chain collagen and may be free or substantially free from a beta chain collagen).
- the non-naturally occurring polypeptides described herein are monomeric (e.g., do not form multimeric structures).
- the non-naturally occurring polypeptides described herein may, in some instances, form multimeric structures with identical monomers (e.g., homodimers, homotrimers, etc.).
- the non-naturally occurring polypeptides are recombinant polypeptides (e.g., prepared recombinantly in a host cell).
- the non-naturally occurring collagen is, in one embodiment, a truncated collagen.
- Other non-naturally occurring collagen polypeptides include chimeric collagens.
- a chimeric collagen is a polypeptide wherein one portion of a collagen polypeptide is contiguous with a portion of a second collagen polypeptide.
- a collagen molecule comprising a portion of a collagen from one species contiguous with a portion of a collagen from another species is a chimeric collagen.
- the non-naturally occurring collagen comprises a fusion polypeptide that includes additional amino acids such as a secretion tag, histidine tag, green fluorescent protein, protease cleavage site,
- GEK repeats GDK repeats, and/or beta-lactamase.
- the non-naturally occurring polypeptides e.g., recombinant polypeptides
- the non-naturally occurring polypeptide comprises less than 10 wt. %, less than 9 wt. %, less than 8 wt. %, less than 7 wt. %, less than 6 wt. %, less than 5 wt. %, less than 4 wt. %, less than 3 wt. %, less than 2 wt.
- wt. % less than 1 wt. %, less than 0.9 wt. %, less than 0.8 wt. %, less than 0.7 wt. %, less than 0.6 wt. %, less than 0.5 wt. %, less than 0.4 wt. %, less than 0.3 wt. %, less than 0.2 wt. %, or less than 0.1 wt. % glycosylation.
- the non-naturally occurring polypeptide comprises less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5% of total glycosylation of the corresponding natural collagen or naturally present collagen.
- the non-naturally occurring polypeptide comprises less than 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 glycosylations.
- those lower levels of glycosylation can be specific to one or more types of glycosylation (e.g., O-glycosylation or N-glycosylation, etc.) and/or the glycosylation residues (e.g., galactosylhydroxylysine (Gal-Hyl), glucosyl galactosylhydroxylsine (GlcGal-Hyl), etc.).
- Non-naturally occurring polypeptides produced recombinantly e.g., in a recombinant host cell
- a non-naturally occurring polypeptide provided herein has a non- naturally occurring amount of hydroxyprolines. In some cases, a non-naturally occurring polypeptide provided herein lacks hydroxyprolines. In some cases, a non-naturally occurring polypeptide provided herein comprises fewer hydroxyprolines than a naturally-occurring collagen. Hydroxyprolines include, without limitation, 3-hydroxyproline, 4-hydroxyproline, and 5-hydroxyproline.
- less than about 50% (e.g., less than about 45%, less than about 40%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, or less) of the prolines present in the amino acid sequence of a non-naturally occurring polypeptide provided herein are hydroxyprolines.
- a non-naturally occurring polypeptide produced recombinantly e.g., in a recombinant host cell
- a recombinant polypeptide as provided herein is recombinantly expressed in a recombinant host cell (e.g., bacterial cell) that lacks an enzyme that hydroxylates one or more amino acids (e.g., proline) of the recombinant polypeptide.
- a recombinant polypeptide as provided herein is recombinantly expressed in a host cell (e.g., bacterial cell) that lacks prolyl 4-hydroxylase and/or prolyl 3 -hydroxylase.
- the non-naturally occurring polypeptides provided herein lack or substantially lack lysyl oxidation.
- Lysyl oxidation involves the conversion of lysine residues into highly reactive aldehydes that can form cross-links with other proteins.
- Naturally occurring collagens may have some level of lysyl oxidation.
- the non-naturally occurring polypeptides may be different from natural collagens in that they lack or substantially lack lysyl oxidation.
- the non-naturally occurring polypeptides provided herein may have a function and/or provide a benefit (e.g., as provided herein) similar or substantially similar to that of a natural or a full-length collagen.
- the non- naturally occurring polypeptides provided herein may have improved or increased function and/or benefit (e.g., as provided herein) as compared to a natural or a full- length collagen.
- the non-naturally occurring polypeptides disclosed herein often have advantageous properties related to their monomeric structure and/or lack of amino acids capable of cross- linking with other collagen strands, e.g., the lack of hydroxy proline residues.
- collagen hydrolysates of the non-naturally occurring polypeptides disclosed herein are also produced with increased solubility as compared to full-length or natural collagens.
- monomeric structures, as opposed to natural triple helix collagens are more readily digestible and bioavailable, or broken down by digestive proteases.
- Other advantageous properties include improved physical properties in liquid compositions and in purification processes, since full- length or natural collagens or collagen strands interact to form stronger structures that can precipitate due to the presence of hydroxyproline residues.
- the non-naturally occurring polypeptides provided herein comprise an amino acid sequence that has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to at least a portion of the naturally existing mammalian or non-mammalian collagens from which those are derived from.
- the non-naturally occurring polypeptide has an amino acid sequence that has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a Gallus gallus Type 21 alpha 1 collagen or fragment thereof.
- the non-naturally occurring polypeptide has an amino acid sequence that has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a Acipenser schrenckii Type 2 alpha 1 collagen fragment.
- the recombinant protein is a truncated collagen.
- a truncated collagen is a polypeptide that is smaller than a full-length (e.g., natural) collagen wherein one or more portions (e.g., internal and/or terminal portion(s)) of the full-length (e.g., natural) collagen is not present.
- the non-naturally occurring polypeptides provided herein are truncated at the C-terminal end, the N-terminal end, truncated by removal of internal portion(s) of the full-length collagen polypeptide (e.g., internal truncation), truncated at both the C-terminal end and the N-terminal end, or comprise one or both of a C-terminal truncation and an N-terminal truncation as well as an internal truncation.
- the non-naturally occurring polypeptides provided herein are truncated at the C-terminal end, the N-terminal end, truncated by removal of internal portion(s) of the full-length collagen polypeptide (e.g., internal truncation), truncated at both the C-terminal end and the N-terminal end, or comprise one or both of a C-terminal truncation and an N-terminal truncation as well as an internal
- the non-naturally occurring polypeptide is a fragment of a naturally occurring collagen that retains at least 50%, at least 60%, at least 70%, at least 80%, at least 90% of a function (e.g., of interest) of natural or naturally-present corresponding collagens.
- the term truncated collagen is interchangeably used with the term collagen fragment.
- the truncated collagen includes any contiguous collagen fragments that are at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% of full-length natural or naturally-present corresponding collagens.
- the truncation is an internal truncation, a truncation at the N-terminal portion of the collagen, a truncation at the C-terminal portion of the collagen, a truncation of an internal portion, or a truncation at both the C-terminal end and the N-terminal end.
- a truncated collagen provided herein may be truncated by from 50 amino acids to 1000 amino acids, from 50 amino acids to 950 amino acids, from 50 amino acids to 900 amino acids, from 50 amino acids to 850 amino acids, from 50 amino acids to 800 amino acids, from 50 amino acids to 750 amino acids, from 50 amino acids to 700 amino acids, from 50 amino acids to 650 amino acids, from 50 amino acids to 600 amino acids, from 50 amino acids to 550 amino acids, from 50 amino acids to 500 amino acids, from 50 amino acids to 450 amino acids, from 50 amino acids to 400 amino acids, from 50 amino acids to 350 amino acids, from 50 amino acids to 300 amino acids, from 50 amino acids to 250 amino acids, from 50 amino acids to 200 amino acids, from 50 amino acids to 150 amino acids, or from 50 amino acids to 100 amino acids.
- a truncated collagen is truncated by 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220
- a non-naturally occurring polypeptide (e.g., truncated collagen) disclosed herein may comprise a truncation relative to a full-length (e.g., natural) collagen.
- a truncated collagen disclosed herein may comprise a truncation relative to a full-length (e.g., natural) chicken ( Gallus gallus ) type 21 alpha 1 collagen (e.g., SEQ ID NO: 31).
- a truncated collagen disclosed herein may comprise the amino acid sequence of SEQ ID NO: 31 with an N-terminal truncation, a C-terminal truncation, an internal truncation, or a combination thereof.
- a truncated collagen disclosed herein may comprise a truncation relative to a full-length (e.g., natural) Japanese sturgeon ( Acipenser schrenckii ) type 2 alpha 1 collagen (e.g., SEQ ID NO: 32).
- a truncated collagen disclosed herein may comprise the amino acid sequence of SEQ ID NO: 32 with an N- terminal truncation, a C-terminal truncation, an internal truncation, or a combination thereof.
- full-length (e.g., natural) collagens are provided in Table 1 below.
- polypeptides may be truncated collagen polypeptides comparable to fish collagens, including from other species of sturgeon, or from other species producing roe suitable for caviar, including salmon, steelhead, trout, lumpfish, whitefish, or carp, as well as other fish such as tilapia and sharks.
- Suitable comparable sequences from Acipenser schrenckii include NCBI accession numbers BA058965.1, BA058966.1,
- Suitable sequences from Acipenser ruthenus include NCBI accession numbers A0A444UGW0, A0A444TZM6, A0A444UC45, A0A444UC53, A0A662YTX1, A0A662Z270, A0A662YZ39, A0A444U1F5, A0A444UJK3, A0A444UNU0, X5HZZ7, X5IHC1, A0A444UPK8, A0A444UBS1, A0A444UYQ7, A0A444TWQ3, A0A444ULY4, A0A444TZ23, A0A662YS48, A0A444U4C8, A0A444UD64, A0A662YX10,
- polypeptides may be truncated collagen polypeptides comparable to chicken collagens, or other poultry collagens, such as from domestic fowls, including chickens, turkeys, geese, and ducks.
- Suitable comparable sequences from Gallus gallus (chicken) include NCBI accession numbers V9GZR2, Q9PSS5, A0A3Q2UDI3, Q90802, A0A1D5PNH7, Q4TZW6, Q90803, Q91014, A0A1D5PPI0, A0A1D5P1A5, A0A3Q2U6K2, A0A3Q2U8F9, Q90689, A0A3Q2U3U6, P13731, A0A1D5PFE0, A0A3Q2TXZ7, Q5FY72, A0A1D5PR16, A0A1D5PKR6, F1NDF5, Q90589, P08125, F1NRH2, P3
- a non-naturally occurring polypeptide as described herein may comprise the amino acid sequence of SEQ ID NO: 31 (or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%) sequence identity thereto) with an N-terminal truncation at any amino acid position (e.g., relative to SEQ ID NO: 31) from amino acid positions 1 to 537; from amino acid positions 1 to 542; from amino acid positions 1 to 547; from amino acid positions 1 to 552; from amino acid positions 1 to 557; from amino acid positions 1 to 562; from amino acid positions 1 to 567; from amino acid positions 1 to 572; or from amino acid positions 1 to 577.
- amino acid position e.g., relative to SEQ ID NO: 31
- a non- naturally occurring polypeptide as described herein may comprise the amino acid sequence of SEQ ID NO: 31 (or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%) sequence identity thereto) with a C-terminal truncation at any amino acid position (relative to SEQ ID NO: 31) from amino acid positions 726 to 957; from amino acid positions 731 to 957; from amino acid positions 736 to 957; from amino acid positions 741 to 957; from amino acid positions 746 to 957; from amino acid positions 751 to 957; from amino acid positions 756 to 957; from amino acid positions 761 to 957; from amino acid positions 766 to 957; from amino acid positions 769 to 957; from amino acid positions 774 to 957; from amino acid positions 779 to 957; or from amino acid positions 784 to 957.
- a non-naturally occurring from amino acid positions 726 to 957; from amino acid positions 731 to 9
- a non-naturally occurring polypeptide as described herein may comprise the amino acid sequence of SEQ ID NO: 31 (or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%) sequence identity thereto) with an N-terminal truncation at any amino acid position (e.g., relative to SEQ ID NO: 31) from amino acid positions 1 to 537; from amino acid positions 1 to 542; from amino acid positions 1 to 547; from amino acid positions 1 to 552; from amino acid positions 1 to 557; from amino acid positions 1 to 562; from amino acid positions 1 to 567; from amino acid positions 1 to 572; or from amino acid positions 1 to 577; and with a C-terminal truncation at any amino acid position (relative to SEQ ID NO: 31) from amino acid positions 726 to 957; from amino acid positions 731 to 957; from amino acid positions 736 to 9
- a non-naturally occurring polypeptide e.g., truncated collagen
- a non-naturally occurring polypeptide may comprise the amino acid sequence of SEQ ID NO: 31 (or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%) sequence identity thereto) with an N- terminal truncation at amino acid position 557 (relative to SEQ ID NO: 31); and with a C- terminal truncation at amino acid position 746 (relative to SEQ ID NO: 31).
- a non-naturally occurring polypeptide e.g., truncated collagen
- a non-naturally occurring polypeptide may comprise the amino acid sequence of SEQ ID NO: 31 (or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%) sequence identity thereto) with an N-terminal truncation at amino acid position 557 (relative to SEQ ID NO: 31); and with a C-terminal truncation at amino acid position 769 (relative to SEQ ID NO: 31).
- a non-naturally occurring polypeptide as described herein may comprise the amino acid sequence of SEQ ID NO: 32 (or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%) sequence identity thereto) with an N-terminal truncation at any amino acid position (e.g., relative to SEQ ID NO: 32) from amino acid positions 1 to 660; from amino acid positions 1 to 665; from amino acid positions 1 to 670; from amino acid positions 1 to 675; from amino acid positions 1 to 680; from amino acid positions 1 to 685; from amino acid positions 1 to 690; from amino acid positions 1 to 695; or from amino acid positions 1 to 700.
- SEQ ID NO: 32 or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%) sequence identity thereto) with an N-terminal truncation at any amino acid position (e.g., relative to SEQ
- a non-naturally occurring polypeptide as described herein may comprise the amino acid sequence of SEQ ID NO: 32 (or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%) sequence identity thereto) with a C-terminal truncation at any amino acid position (relative to SEQ ID NO: 32) from amino acid positions 855 to 1420; from amino acid positions 860 to 1420; from amino acid positions 865 to 1420; from amino acid positions 870 to 1420; from amino acid positions 875 to 1420; from amino acid positions 880 to 1420; from amino acid positions 885 to 1420; from amino acid positions 890 to 1420; from amino acid positions 895 to 1420; or from amino acid positions 900 to 1420.
- SEQ ID NO: 32 or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%) sequence identity thereto) with a C-terminal
- a non-naturally occurring polypeptide as described herein may comprise both an N-terminal truncation and a C-terminal truncation.
- a non-naturally occurring polypeptide e.g., truncated collagen
- a non-naturally occurring polypeptide e.g., truncated collagen
- a non-naturally occurring polypeptide may comprise the amino acid sequence of SEQ ID NO: 32 (or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%) sequence identity thereto) with an N-terminal truncation at amino acid position 680 (relative to SEQ ID NO: 32); and with a C-terminal truncation at amino acid position 880 (relative to SEQ ID NO: 32).
- a non-naturally occurring polypeptide may comprise any amino acid sequence provided herein.
- a non-naturally occurring polypeptide e.g., truncated collagen
- a non-naturally occurring polypeptide may consist essentially of any amino acid sequence provided herein.
- the non- naturally occurring polypeptide has or comprises an amino acid sequence of any one of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8.
- a non-naturally occurring polypeptide comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or at least 98% sequence identity to any one of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8.
- the non-naturally occurring polypeptide consists of or consists essentially of an amino acid sequence of any one of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8.
- the non-naturally occurring polypeptide may include any chimeric collagen that includes at least one non-continuous collagen fragment.
- the non- naturally occurring polypeptide can be a chimeric collagen in which a portion of N-terminus collagen is contiguous with a portion of C-terminus collagen where the portion of N-terminus collagen and the portion of C-terminus collagen are not contiguous in the natural or naturally- present corresponding collagens.
- the non-naturally occurring polypeptide can be a chimeric collagen in which a portion of C-terminus collagen is contiguous with a portion of N-terminus collagen (e.g., in a flipped or reverse order - C terminus collagen is located in the N- terminus of the portion of N-terminus collagen) where the portion of C-terminus collagen and the portion of N-terminus collagen are contiguous or non-contiguous in the natural or naturally- present corresponding collagens.
- the non-naturally occurring polypeptide can be a chimeric collagen in which one portion of a collagen polypeptide is contiguous with a portion of a second collagen polypeptide (e.g., a collagen molecule comprising a portion of a collagen from a first species contiguous with a portion of a collagen from a second species is a chimeric collagen, etc.).
- a collagen polypeptide e.g., a collagen molecule comprising a portion of a collagen from a first species contiguous with a portion of a collagen from a second species is a chimeric collagen, etc.
- SEQ ID NO: 1 A nucleotide sequence encoding a truncated collagen type 21 alpha 1 polypeptide from Gallus gallus (chicken) GATACCGGTTTTCCGGGTATGCCTGGTCGTAGCGGTGATCCGGGTCGTAGCGGTAAAGATGGTC
- SEQ ID NO: 2 Amino acid sequence of a truncated collagen type 21 alpha 1 polypeptide from Gallus gallus (chicken)
- SEQ ID NO: 3 A nucleotide sequence encoding a truncated collagen type 21 alpha 1 polypeptide from Gallus gallus (chicken)
- SEQ ID NO: 4 Amino acid sequence of a truncated collagen type 21 alpha 1 polypeptide from Gallus gallus (chicken)
- SEQ ID NO: 5 The nucleotide sequence encoding a truncated collagen type 21 alpha 1 polypeptide from Gallus gallus (chicken) [0071] GATACTGGTTTCCCGGGGATGCCTGGGCGCTCAGGTGATCCGGGGCGTAGTGGAAAAGA
- SEQ ID NO: 6 Amino acid sequence of a truncated collagen type 21 alpha 1 polypeptide from Gallus gallus (chicken)
- SEQ ID NO: 7 The nucleotide sequence encoding a truncated collagen type 2 alpha 1 polypeptide from Acipenser schrenckii (Japanese sturgeon)
- SEQ ID NO: 8 Amino acid sequence of a truncated collagen type 2 alpha 1 polypeptide from Acipenser schrenckii (Japanese sturgeon)
- SEQ ID NO: 10 Amino acid sequence of a Secretion Signal Sequence 1
- SEQ ID NO: 11 The nucleotide sequence encoding a secretion signal sequence named Secretion Signal Sequence 2
- SEQ ID NO: 13 The nucleotide sequence encoding a secretion signal sequence named Secretion Signal Sequence 3
- SEQ ID NO: 14 Amino acid sequence of a Secretion Signal Sequence 3
- SEQ ID NO: 15 The nucleotide sequence encoding a secretion signal sequence named Secretion Signal Sequence 4
- SEQ ID NO: 16 Amino acid sequence of a Secretion Signal Sequence 4
- SEQ ID NO: 17 The nucleotide sequence encoding a secretion signal sequence named Secretion Signal Sequence 5
- SEQ ID NO: 18 Amino acid sequence of a Secretion Signal Sequence 5
- SEQ ID NO: 19 The nucleotide sequence encoding a secretion signal sequence named Secretion Signal Sequence 6
- SEQ ID NO: 20 Amino acid sequence of a Secretion Signal Sequence 6
- SEQ ID NO: 21 The nucleotide sequence encoding a secretion signal sequence named Secretion Signal Sequence 7 ATGCTGAACCCGAAAGTTGCTTACATGGTTTGGATGACCTGCCTGGGTCTGACCCTGCCGTCTC
- SEQ ID NO: 23 The nucleotide sequence encoding a secretion signal sequence named Secretion Signal Sequence 8
- SEQ ID NO: 24 Amino acid sequence of a Secretion Signal Sequence 8
- SEQ ID NO: 25 A codon-optimized nucleotide sequence encoding a truncated collagen type 2 alpha 1 polypeptide from Acipenser schrenckii (Japanese sturgeon)
- SEQ ID NO: 26 A codon-optimized nucleotide sequence encoding a truncated collagen type 2 alpha 1 polypeptide from Acipenser schrenckii (Japanese sturgeon)
- SEQ ID NO: 27 A codon-optimized nucleotide sequence encoding a truncated collagen type 2 alpha 1 polypeptide from Acipenser schrenckii (Japanese sturgeon) GGTTTGCAAGGTATGCCAGGGGAACGGGGTGCGTCCGGGATAGCCGGGGCAAAAGGTGATCGAG
- SEQ ID NO: 28 A codon-optimized nucleotide sequence encoding a truncated collagen type 2 alpha 1 polypeptide from Acipenser schrenckii (Japanese sturgeon)
- SEQ ID NO: 29 A codon-optimized nucleotide sequence encoding a truncated collagen type 2 alpha 1 polypeptide from Acipenser schrenckii (Japanese sturgeon)
- SEQ ID NO: 30 A codon-optimized nucleotide sequence encoding a truncated collagen type 21 polypeptide from Gallus gallus
- the non-naturally occurring polypeptide comprises an amino acid sequence of any one of SEQ ID NOs: 2, 4, 6, and 8. In some embodiments, the non-naturally occurring polypeptide comprises an amino acid sequence having a sequence identity of at least
- the non-naturally occurring polypeptide is encoded by a nucleic acid sequence of any one of SEQ ID NOs: 2, 4, 6, and 8.
- the non-naturally occurring polypeptide is encoded by a nucleic acid sequence of any one of SEQ ID NOs: 2, 4, 6, and 8.
- the non-naturally occurring polypeptide is encoded by a nucleic acid having sequence identity of at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% thereof, or the like, to the nucleic acid sequence of any one of SEQ ID NOs: 1, 3, 5, 7, and 25-30.
- the non-naturally occurring polypeptides provided herein may or may not contain one or more domains from natural collagen.
- FIG. 6 depicts an alignment of exemplary non-naturally occurring polypeptides (e.g., truncated collagens) of the disclosure with the corresponding naturally occurring collagen.
- the top panel depicts an alignment of a non-naturally occurring polypeptide of SEQ ID NO: 2 and SEQ ID NO: 6 with Gallus gallus type 21 alpha 1 collagen (e.g., SEQ ID NO: 31).
- the bottom panel depicts an alignment of a non-naturally occurring polypeptide of SEQ ID NO: 8 with Acipenser schrenckii type 2 alpha 1 collagen.
- FIG. 1 depicts an alignment of exemplary non-naturally occurring polypeptides (e.g., truncated collagens) of the disclosure with the corresponding naturally occurring collagen.
- the top panel depicts an alignment of a non-naturally occurring polypeptide of SEQ ID NO: 2 and SEQ ID NO
- non-naturally occurring polypeptides may have one or more domains found in natural collagen (e.g., collagen triple helix repeat domains).
- FIG. 6 further demonstrates that non-naturally occurring polypeptides may lack one or more domains found in natural collagen (e.g., Von Willebrand factor type A (vWA) domain, laminin G domain, fibrillar collagen C- terminal domain).
- vWA Von Willebrand factor type A
- a non-naturally occurring polypeptide provided herein may contain one or more collagen triple helix repeat domains.
- a non-naturally occurring polypeptide provided herein may lack one or more of a Von Willebrand factor type A (vWA) domain, a laminin G domain, and a fibrillar collagen C-terminal domain).
- the non-naturally occurring polypeptide includes a secretion signal sequence.
- Any suitable secretion signal sequence e.g., hydrophobic signaling peptides, Sec signal peptides, Tat signal peptides, etc.
- exemplary secretion signal sequences includes a peptide having an amino acid sequence of any one of SEQ ID NOs: 10, 12, 14, 16, 18, 20, 22, and 24.
- the secretion signal sequence includes a peptide encoded by a nucleic acid sequence of any one of SEQ ID NOs: 9, 11, 13, 15, 17, 19, 21, and 23.
- the secretion signal sequence is preferably located in the N-terminus of the non-naturally occurring polypeptide (e.g., recombinant polypeptide). Yet, it is contemplated that the secretion signal sequence can be located at other than N-terminus where the secretion signal sequence remains functional.
- the non-naturally occurring polypeptide (e.g., recombinant polypeptide) as described herein can be expressed or generated via a nucleic acid sequence encoding the non-naturally occurring polypeptide (e.g., recombinant polypeptide).
- another aspect of the disclosure includes an expression vector comprising a nucleic acid sequence encoding the non-naturally occurring polypeptide (e.g., recombinant polypeptide).
- the expression vector is a bacterial expression vector.
- the expression vector is a yeast expression vector.
- the expression vector is an insect expression vector.
- Any suitable expression vector that can induce the protein expression from the inserted nucleic acid encoding the non-naturally occurring polypeptide e.g., recombinant polypeptide.
- exemplary bacterial expression vectors may include pGEX vectors where glutathione S- transferase is used as a fusion partner and gene expression is under the control of the tac promoter, or pET vectors (e.g., pET28 vector, etc.) which uses a T7 promoter.
- Exemplary yeast expression vectors may include pPIC vectors, which uses the AOX1 promoter inducible with methanol.
- the expression vector is in a plasmid form (e.g., including bacterial artificial chromosome form, etc.) that are independently present in the host cell (e.g., cells expressing the recombinant polypeptide).
- the expression vector is stably integrated into the chromosome of the host cell via random or targeted integration.
- the nucleic acid sequence encoding the non-naturally occurring polypeptide is codon-optimized to be expressed in non-animal cells, preferably in bacterial cells.
- “codon-optimized” means that the codon composition is improved for expression in the heterologous cells (e.g., microbial cells, bacterial cells, etc.) without altering the encoded amino acid sequences.
- Non-limiting examples of codon- optimized nucleic acid sequences include SEQ ID NOs: 25-30.
- the expression vector may include one or more selection agent.
- the selection agents include certain sugars including galactose containing sugars or antibiotics including ampicillin, hygromycin, G418 and others. Enzymes that are used to confer resistance to the selection agent include b-galactosidase or a b-lactamase.
- the expression vector includes an inducible promoter or a constitutive promoter (e.g., CMV promoter, etc.) such that the nucleic acid encoding the recombinant protein is operatively linked to the inducible promoter or the constitutive promoter.
- the expression vector may include tetracycline-inducible promoter pTET, araC-ParaBAD inducible promoter, or IPTG inducible lac promoter.
- operatively linked promoter and nucleic acid means that the expression of the nucleic acid (e.g., transcription, translation, etc.) is at least under partial control of the promoter.
- the nucleic acid encoding the non-naturally occurring polypeptide e.g., recombinant polypeptide
- the expression vector may have an overlap of from 20 to 50 bp long, from 20 to 40 bp long, from 20 to 30 bp long, or from 30 to 40 bp long.
- Such overlap can be added using PCR with aDNA polymerase (e.g., PRIMESTAR ® GXL polymerase (www.takarabio.com/products/pcr/gc- rich-pcr/primestar-gxl-dna-polymerase)).
- aDNA polymerase e.g., PRIMESTAR ® GXL polymerase (www.takarabio.com/products/pcr/gc- rich-pcr/primestar-gxl-dna-polymerase)
- Opened expression vector and the insert nucleic acid encoding the non-naturally occurring polypeptide can be assembled together into the final plasmid using any suitable cloning system (e.g., IN-FUSION ® Cloning (www.takarabio.com/products/cloning/in-fusion-cloning) or SGI Gibson assembly (us.vwr.com/store/product/17613857/gibson-assembly-hifi-l-step-kit-synthetic-genomics-inc)).
- IN-FUSION ® Cloning www.takarabio.com/products/cloning/in-fusion-cloning
- SGI Gibson assembly us.vwr.com/store/product/17613857/gibson-assembly-hifi-l-step-kit-synthetic-genomics-inc
- Such prepared expression vector can be used to generate genetically engineered or modified organisms, or a recombinant cell to produce the non-naturally occurring polypeptides described herein (e.g., collagens, truncated collagens, or collagen fragments).
- the recombinant cells contain at least one copy of a plasmid or a stably integrated heterologous nucleic acid sequence encoding the non-naturally occurring polypeptide (e.g., collagens, truncated collagens, or collagen fragments, preferably collagens, truncated collagens, or collagen fragments of, or derived from, Gallus gallus collagen and/or Acipenser schrenckii collagen).
- the recombinant cell is a microbial cell.
- the expression vector can be inserted into (e.g., via any suitable transformation method) the bacterial cells for protein expression (e.g., Escherichia coli including BL-21 cells, etc.) to be independently present in the cytoplasm of the bacteria (e.g., as a plasmid form) or to be at least temporarily and/or stably integrated into the bacterial chromosome.
- the transformed cells can be cultivated in a suitable media.
- the suitable media includes a minimal media and the cells are frozen in 1.5 aliquots with vegetable glycerin at a ratio of 50:50 of cells of cells to glycerin.
- one vial of the frozen cultured cells can be cultured in a suitable amount of bacteria culture media (e.g., minimal media, 50ml, 100ml, etc.) for at least 6 hours, at least 8 hours, at least 10 hours, at least 12 hours, at least overnight at at least 36 °C, preferably at about 37 °C by continuously shaking the culture (e.g., at least 100 rpm, at least 200 rpm, at least 250 rpm, etc.).
- Table 2 and Table 3 show the exemplary formulation of the minimal media that can be used for cell cultivation and culture.
- transformed cells can then be transferred to a larger volume of growth media (e.g., minimal media) and grown for at least 4 hours, at least 5 hours, at least 6 hours, at least 7 hours, at least 8 hours, from 5 to 10 hours, from 5 to 9 hours, from 6 to 9 hours, and/or alternatively until the cell density in the media reaches optical density (OD) of 600.
- growth media e.g., minimal media
- fermentation process can be performed at various temperature ranging from 22 °C to 33 °C, from 29 °C to 33 °C, from 30 °C to 32 °C, from 23 °C to 29 °C, or from 25 °C to 28 °C.
- the temperature of the fermentation can be maintained at a constant temperature and immediately upon completion of fermentation the non-naturally occurring polypeptide can be purified.
- the temperature of the fermentations can be maintained for a desired period of time and when cell densities of OD600 of 10-20 are reached, then the temperature can be reduced to induce protein production. In such embodiments, typically, the temperature is reduced from 28° C to 25° C.
- protein expression in the bacteria can be induced by adding induction reagent.
- the expression vector contains lac promoter and the nucleic acid encoding the non-naturally occurring polypeptide (e.g., truncated collagen, collagen fragments, or collagen) is under the control of the lac promoter
- the expression of the nucleic acid can be induced by adding isopropyl b-d-l-thiogalactopyranoside (IPTG) at a concentration ranging from 0.1 - 1.5 mM, from 0.1 - 1.0 mM, or from 0.1 - 0.5 mM. Fermentation can be continued for 20-24 hours, or in some embodiments, for 40-60 hours.
- IPTG isopropyl b-d-l-thiogalactopyranoside
- such generated recombinant cells e.g., recombinant bacteria transformed with the expression vector
- intracellularly express the non-naturally occurring polypeptides e.g., truncated collagen, collagen fragments, or collagen
- Such intracellularly expressed polypeptides e.g., truncated collagen, collagen fragments, or collagen
- the culture media can contain secreted recombinant protein (e.g., truncated collagen, collagen fragments, or collagen) encoded by the nucleic acids.
- compositions including the non-naturally occurring polypeptide (e.g., recombinant collagen, truncated collagen, collagen fragments, or collagen) encoded by the nucleic acids.
- the composition may include the recombinant cell comprising an integrated heterologous nucleic acid sequence encoding a non- naturally occurring polypeptide (e.g., collagen, a truncated collagen, or fragment thereof), and/or the culture medium (e.g., growth media, cultivation media, etc.) for the recombinant cell.
- the composition may include purified recombinant proteins from the recombinant cells and/or the culture medium.
- the recombinant proteins are purified from the culture medium where the recombinant cells grow and secrete the recombinant proteins thereto.
- the recombinant protein is coupled with a tag (e.g., histidine tag, etc) such that the recombinant protein can be purified using affinity purification is known as immobilized metal affinity chromatography (IMAC).
- IMAC immobilized metal affinity chromatography
- the recombinant protein can be purified via column chromatography.
- the recombinant protein can be purified by acid treatment of homogenized growth media.
- the pH of the growth media e.g., fermentation broth
- the recombinant cells are then separated using centrifugation. Supernatant of the acidified broth can be tested on a polyacrylamide gel and determined whether it contains the recombinant protein in relatively high abundance compared to starting pellet.
- the recombinant protein slurry obtained is generally high in salts.
- concentration and diafiltration steps can be performed using filtration steps.
- the filtration step can be performed using EMD Millipore Tangential Flow Filtration system with ultrafiltration cassettes of 0.1 m 2 each. Total area of filtration in this example can be 0.2 m 2 using two cassettes in parallel.
- a volume reduction of 5x and a salt reduction of 19x can be achieved in the TFF stage.
- Final collagen slurry can be run on an SDS-PAGE gel to confirm presence of the recombinant protein.
- the purified recombinant protein can then be analyzed on an SDS-PAGE gel to identify a corresponding thick and clear band observed at the expected sizes for each respective protein. Quantification of titers and purity can be further conducted using reverse phase and size exclusion HPLC chromatography. It is preferred that the purity of the purified recombinant proteins is at least at least 80%, at least 85%, at least 90%, at least 95%, or at least 99%.
- the composition including the non-naturally occurring polypeptides provided herein can be formulated for consumption by an individual (e.g., a human, a patient, a person, an animal, etc.).
- the non-naturally occurring polypeptides e.g., recombinant proteins and/or purified recombinant proteins
- the non-naturally occurring polypeptides e.g., recombinant proteins and/or purified recombinant proteins
- the non-naturally occurring polypeptides can be formulated as a protein supplement.
- the non-naturally occurring polypeptides e.g., recombinant proteins and/or purified recombinant proteins
- the composition may include vitamins (e.g.
- vitamin A, vitamin B, vitamin C, vitamin D, vitamin E, etc. minerals (e.g., calcium, zinc, copper, manganese, chromium, molundenum, boron, etc), sugar (e.g., cellulose, dextrose, maltose, etc.), and/or natural extracts (e.g., herb, ginseng, echinacea, green tea, glucosamine, omega-3, lutein, folic acid, liver oil, fish oil, coffee extracts, etc.).
- minerals e.g., calcium, zinc, copper, manganese, chromium, molundenum, boron, etc
- sugar e.g., cellulose, dextrose, maltose, etc.
- natural extracts e.g., herb, ginseng, echinacea, green tea, glucosamine, omega-3, lutein, folic acid, liver oil, fish oil, coffee extracts, etc.
- Formulations suitable for consumption by an individual include, without limitation, ready-to-mix powders, ready-to-drink beverages, functional shots, supplement tablets and capsules, coffee creamers, bars, bites or baked goods, “no bone” broth, non-dairy frozen novelty, gummies (e.g., candy), chocolates, and meat snacks.
- suitable for consumption by an individual include, without limitation, ready-to-mix powders, ready-to-drink beverages, functional shots, supplement tablets and capsules, coffee creamers, bars, bites or baked goods, “no bone” broth, non-dairy frozen novelty, gummies (e.g., candy), chocolates, and meat snacks.
- a composition, formulation, or product is "nutritional” or “nutritive” if it provides an appreciable amount of nourishment to its intended consumer, meaning the consumer assimilates all or a portion of the composition or formulation into a cell, organ, and/or tissue.
- such assimilation into a cell, organ, and/or tissue provides a benefit or utility to the consumer, e.g., by maintaining or improving the health and/or natural function(s) of said cell, organ, and/or tissue.
- a nutritional composition or formulation that is assimilated as described herein is termed “nutrition”.
- a polypeptide is nutritional if it provides an appreciable amount of polypeptide nourishment to its intended consumer, meaning the consumer assimilates all or a portion of the protein, typically in the form of single amino acids or small peptides, into a cell, organ, and/or tissue.
- “Nutrition” also means the process of providing to a subject, such as a human or other mammal, a nutritional composition, formulation, product, or other material.
- a nutritional product need not be “nutritionally complete”, meaning if consumed in sufficient quantity, the product provides all carbohydrates, lipids, essential fatty acids, essential amino acids, conditionally essential amino acids, vitamins, and minerals required for health of the consumer.
- a “nutritionally complete protein” contains all protein nutrition required (meaning the amount required for physiological normalcy by the organism) but does not necessarily contain micronutrients such as vitamins and minerals, carbohydrates, or lipids.
- a composition or formulation is nutritional in its provision of polypeptide capable of decomposition (e.g., the breaking of a peptide bond, often termed protein digestion) to single amino acids and/or small peptides (e.g., two amino acids, three amino acids, or four amino acids, possibly up to ten amino acids) in an amount sufficient to provide a “nutritional benefit”.
- polypeptide capable of decomposition e.g., the breaking of a peptide bond, often termed protein digestion
- small peptides e.g., two amino acids, three amino acids, or four amino acids, possibly up to ten amino acids
- nutritional polypeptides that transit across the gastrointestinal wall and are absorbed into the bloodstream as small peptides (e.g., larger than single amino acids but smaller than about ten amino acids) or larger peptides, oligopeptides, or polypeptides (e.g., >11 amino acids).
- a nutritional benefit in a polypeptide-containing composition can be demonstrated and, optionally, quantified, by a number of metrics.
- a nutritional benefit is the benefit to a consuming organism equivalent to or greater than at least about 0.5% of a reference daily intake value of protein, such as about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100% or greater than about 100% of a reference daily intake value.
- a nutritional benefit is demonstrated by the feeling and/or recognition of satiety by the consumer.
- a nutritional benefit is demonstrated by incorporation of a substantial amount of the polypeptide component of the composition or formulation into the cells, organs, and/or tissues of the consumer, such incorporation generally meaning that single amino acids or short peptides are used to produce polypeptides de novo intracellularly.
- a “consumer” or a “consuming organism” means any animal capable of ingesting the product having the nutritional benefit.
- the consumer is a mammal such as a healthy human, e.g., a healthy infant, child, adult, or older adult.
- the consumer is a mammal such as a human (e.g., an infant, child, adult, or older adult) at risk of developing or suffering from a disease, disorder, or condition characterized by (i) the lack of adequate nutrition and/or (ii) the alleviation thereof by the nutritional products of the present disclosure.
- a human e.g., an infant, child, adult, or older adult
- An “infant” is generally a human under about age 1 or 2
- a “child” is generally a human under about age 18, and an “older adult” or “elderly” human is a human aged about 65 or older.
- nutritive polypeptides capable of transforming health and treating, preventing and reducing the severity of a multitude of diseases, disorders, and conditions associated with amino acid pathophysiology, as they are selected for specific physiologic benefits to improve health and address many nutrition-related conditions, including gastrointestinal malabsorption, muscle wasting, diabetes or pre-diabetes, obesity, oncology, metabolic diseases, and other cellular and systemic diseases.
- compositions and formulations that contain the nutritive polypeptides (e.g., non-naturally occurring polypeptides described herein), as food, beverages, medical foods, supplements, and pharmaceuticals.
- Nutritive polypeptides e.g., non-naturally occurring polypeptides described herein
- properties can be evaluated (see, e.g., Example 7).
- Such properties may include digestibility, allergenicity, thermostability, solubility, aggregation, toxicity, taste, and mouth/feel characteristics.
- the formulations are incorporated into food products having advantages over similar food products lacking the nutritive polypeptides (e.g., non-naturally occurring polypeptides described herein), or the formulations are incorporated into other products such as beverage products or animal feed products.
- the food products have a reduced fat content, a reduced sugar content, and/or a reduced calorie content compared to a food product not having the nutritive polypeptide (e.g., non-naturally occurring polypeptides described herein).
- the nutritive polypeptide e.g., non-naturally occurring polypeptides described herein
- gelatin an animal- derived material
- a non-animal derived product containing one or more nutritive polypeptides (e.g., non-naturally occurring polypeptides described herein).
- the nutritive polypeptide e.g., non-naturally occurring polypeptides described herein
- the gelatin replacement is incorporated into a food product, a beverage product, or an animal feed product, and the formulation is substantially free of non-comestible products.
- formulations containing a nutritive polypeptide present in a functional and/or nutritional amount, which increases the viscosity of a food or beverage product, such as formulations containing viscosity-increasing nutritive polypeptides (e.g., non-naturally occurring polypeptides described herein) incorporated into food products having advantages over similar food products lacking the nutritive polypeptides (e.g., non-naturally occurring polypeptides described herein).
- the food products have a reduced fat content, a reduced sugar content, and/or a reduced calorie content compared to a food product not having the nutritive polypeptide (e.g., non-naturally occurring polypeptides described herein).
- Viscous nutritive polypeptides can be used as a nutritionally favorable low calorie substitute for fat.
- the non-naturally occurring polypeptides of the disclosure may be combined with other ingredients to provide combination products.
- ingredients may include carbohydrates, lipids, supplemental minerals, supplemental vitamins, excipients or buffering agents, flavoring agents, sweeteners, or coloring agents.
- a “carbohydrate” refers to a sugar or polymer of sugars.
- saccharide “polysaccharide,” “carbohydrate”, and “oligosaccharide” can be used interchangeably.
- Most carbohydrates are aldehydes or ketones with many hydroxyl groups, usually one on each carbon atom of the molecule.
- Carbohydrates generally have the molecular formula CnH2nOn.
- a carbohydrate can be a monosaccharide, a disaccharide, trisaccharide, oligosaccharide, or polysaccharide.
- the most basic carbohydrate is a monosaccharide, such as glucose, sucrose, galactose, mannose, ribose, arabinose, xylose, and fructose.
- Disaccharides are two joined monosaccharides. Exemplary disaccharides include sucrose, maltose, cellobiose, and lactose.
- an oligosaccharide includes between three and six monosaccharide units (e.g., raffmose, stachyose), and polysaccharides include six or more monosaccharide units.
- Exemplary polysaccharides include starch, glycogen, and cellulose.
- Carbohydrates may contain modified saccharide units such as 2'-deoxyribose wherein a hydroxyl group is removed, 2'-fluororibose wherein a hydroxyl group is replace with a fluorine, or N-acetylglucosamine, a nitrogen- containing form of glucose (e.g., 2'-fluororibose, deoxyribose, and hexose).
- Carbohydrates may exist in many different forms, for example, conformers, cyclic forms, acyclic forms, stereoisomers, tautomers, anomers, and isomers.
- lipid includes fats, oils, triglycerides, cholesterol, phospholipids, fatty acids in any form including free fatty acids. Fats, oils and fatty acids can be saturated, unsaturated (cis or trans) or partially unsaturated (cis or trans).
- the lipid comprises at least one fatty acid selected from lauric acid (12:0), myristic acid (14:0), palmitic acid (16:0), palmitoleic acid (16:1), margaric acid (17:0), heptadecenoic acid (17:1), stearic acid (18:0), oleic acid (18:1), linoleic acid (18:2), linolenic acid (18:3), octadecatetraenoic acid (18:4), arachidic acid (20:0), eicosenoic acid (20:1), eicosadienoic acid (20:2), eicosatetraenoic acid (20:4), eicosapentaenoic acid (20:5) (EPA), docosanoic acid (22:0), docosenoic acid (22:1), docosapentaenoic acid (22:5), docosahexaenoic acid (22:6) (DHA), and t
- Additional ingredients also include supplemental minerals or mineral sources.
- minerals include, without limitation: chloride, sodium, calcium, iron, chromium, copper, iodine, zinc, magnesium, manganese, molybdenum, phosphorus, potassium, and selenium.
- Suitable forms of any of the foregoing minerals include soluble mineral salts, slightly soluble mineral salts, insoluble mineral salts, chelated minerals, mineral complexes, non-reactive minerals such as carbonyl minerals, and reduced minerals, and combinations thereof.
- Additional ingredients also include one or more supplemental vitamins.
- the vitamin can be fat-soluble or water soluble vitamins. Suitable vitamins include but are not limited to vitamin C, vitamin A, vitamin E, vitamin B12, vitamin K, riboflavin, niacin, vitamin D, vitamin B6, folic acid, pyridoxine, thiamine, pantothenic acid, and biotin. Suitable forms of any of the foregoing are salts of the vitamin, derivatives of the vitamin, compounds having the same or similar activity of the vitamin, and metabolites of the vitamin.
- the formulations may also include excipients or buffering agents.
- suitable excipients include a tastant, a flavorant, a buffering agent, a preservative, a stabilizer, a binder, a compaction agent, a lubricant, a dispersion enhancer, a disintegration agent, a flavoring agent, a sweetener, a coloring agent.
- suitable buffering agents include sodium citrate, magnesium carbonate, magnesium bicarbonate, calcium carbonate, and calcium bicarbonate.
- the formulations may also include a preservative.
- suitable preservatives include organic acids that are naturally derived from fermentation (such as citric, ascorbic, propionic acids), antimicrobial peptides (nisin) or other suitable preservatives (such as salt, calcium sorbate, sodium sorbate).
- Binding agents, lubricants, dispersion enhancers, disintegrants and the like may also be used as an excipient.
- suitable binders include starches, pregelatinized starches, gelatin, polyvinylpyrolidone, cellulose, methylcellulose, sodium carboxymethylcellulose, ethylcellulose, polyacrylamides, polyvinyloxoazolidone, polyvinylalcohols, C12-C18 fatty acid alcohol, polyethylene glycol, polyols, saccharides, oligosaccharides, and combinations thereof.
- Non-limiting examples of suitable lubricants include magnesium stearate, calcium stearate, zinc stearate, hydrogenated vegetable oils, sterotex, polyoxyethylene monostearate, talc, polyethyleneglycol, sodium benzoate, sodium lauryl sulfate, magnesium lauryl sulfate, and light mineral oil.
- suitable dispersants include starch, alginic acid, polyvinylpyrrolidones, guar gum, kaolin, bentonite, purified wood cellulose, sodium starch glycolate, isoamorphous silicate, and microcrystalline cellulose as high HLB emulsifier surfactants.
- Non-limiting examples of suitable non-effervescent disintegrants include starches such as com starch, potato starch, pregelatinized and modified starches thereof, sweeteners, clays, such as bentonite, micro- crystalline cellulose, alginates, sodium starch glycolate, gums such as agar, guar, locust bean, karaya, pecitin, and tragacanth.
- the disintegrant is an effervescent disintegrant.
- suitable effervescent disintegrants include sodium bicarbonate in combination with citric acid, and sodium bicarbonate in combination with tartaric acid.
- Additional ingredients may also include flavoring agents, sweeteners, or coloring agents.
- Flavoring agents incorporated into the outer layer can be chosen from synthetic flavor oils and flavoring aromatics; natural oils; extracts from plants, leaves, flowers, and fruits; and combinations thereof.
- suitable sweeteners include glucose (com syrup), dextrose, invert sugar, fructose, and mixtures thereof (when not used as a carrier); saccharin and its various salts such as the sodium salt; dipeptide sweeteners such as aspartame; dihydrochalcone compounds, glycyrrhizin; Stevia Rebaudiana (Stevioside); chloro derivatives of sucrose such as sucralose; and sugar alcohols such as sorbitol, mannitol, sylitol, and the like.
- suitable color agents include food, drug and cosmetic colors (FD&C), drug and cosmetic colors (D&C), and external drug and cosmetic colors (Ext. D&C).
- Solid dosage forms for oral administration include capsules, tablets, caplets, pills, troches, lozenges, powders, and granules.
- a capsule typically comprises a core material comprising a protein or composition and a shell wall that encapsulates the core material.
- the core material comprises at least one of a solid, a liquid, and an emulsion.
- the shell wall material comprises at least one of a soft gelatin, a hard gelatin, and a polymer.
- Powders or granules embodying the polypeptides and compositions disclosed herein can be incorporated into a food product.
- the food product is a drink for oral administration.
- suitable drink include fruit juice, a fruit drink, an artificially flavored drink, an artificially sweetened drink, a carbonated beverage, a sports drink, a liquid diary product, a shake, an alcoholic beverage, a caffeinated beverage, infant formula, and so forth.
- suitable means for oral administration include aqueous and nonaqueous solutions, creams, pastes, emulsions, suspensions and slurries, each of which may optionally also contain at least one of suitable solvents, preservatives, emulsifying agents, suspending agents, diluents, sweeteners, coloring agents, a tastant, a flavorant, and flavoring agents.
- Suitable examples of a solid foodstuff include without limitation a food bar, a snack bar, a cookie, a brownie, a muffin, a cracker, a biscuit, a cream or paste, an ice cream bar, a frozen yogurt bar, and the like.
- a formulation can contain a nutritive polypeptide (e.g., non-naturally occurring polypeptides as described herein) in an amount based on the concentration of the nutritive polypeptide (e.g., non-naturally occurring polypeptides as described herein) (e.g., on a weight- to-weight basis), such that the nutritive polypeptide (e.g., non-naturally occurring polypeptides as described herein) accounts for up to 100% of the weight of the formulation, meaning that all or essentially all of the matter present in the formulation is in the form of the nutritive polypeptide (e.g., non-naturally occurring polypeptides as described herein).
- a nutritive polypeptide e.g., non-naturally occurring polypeptides as described herein
- the formulation contains 10 mg, 100 mg, 500 mg, 750 mg, 1 g, 2 g, 3 g, 4 g, 5 g, 6 g, 7 g, 8 g, 9, 10 g, 15 g, 20 g, 25 g, 30 g, 35 g, 40 g, 45 g, 50 g, 60 g, 70 g, 80 g, 90 g, 100 g, or over 100 g of nutritive polypeptide.
- the polypeptides or compositions are provided in a dosage form.
- the dosage form is designed for administration of at least one polypeptide disclosed herein, wherein the total amount of polypeptide administered is selected from 0.1 g to 1 g, 1 g to 5 g, from 2 g to 10 g, from 5 g to 15 g, from 10 g to 20 g, from 15 g to 25 g, from 20 g to 40 g, from 25 g to 50 g, and from 30 g to 60 g.
- the dosage form is designed for administration of at least one protein disclosed herein, wherein the total amount of protein administered is selected from about 0.1 g, 0.1 g to 1 g, 1 g, 2 g, 3 g, 4 g, 5 g, 6 g, 7 g, 8 g, 9 g, 10 g, 15 g, 20 g, 25 g, 30 g, 35 g, 40 g, 45 g, 50 g, 55 g, 60 g, 65 g, 70 g, 75 g, 80 g, 85 g, 90 g, 95 g, and 100 g.
- the protein or composition is consumed at a rate of from 0.1 g to 1 g a day, 1 g to 5 g a day, from 2 g to 10 g a day, from 5 g to 15 g a day, from 10 g to 20 g a day, from 15 g to 30 g a day, from 20 g to 40 g a day, from 25 g to 50 g a day, from 40 g to 80 g a day, from 50 g to 100 g a day, or more.
- this disclosure provides methods of maintaining or increasing at least one of muscle mass, muscle strength, and functional performance in a subject.
- the methods comprise providing to the subject a sufficient amount of a polypeptide of this disclosure, a composition of this disclosure, or a composition made by a method of this disclosure.
- the subject is at least one of elderly, critically - medically ill, and suffering from protein-energy malnutrition.
- the sufficient amount of a polypeptide of this disclosure, a composition of this disclosure, or a composition made by a method of this disclosure is consumed by the subject in coordination with performance of exercise.
- the polypeptide of this disclosure, composition of this disclosure, or composition made by a method of this disclosure is consumed by the subject by an oral, enteral, or parenteral route. In some embodiments, the polypeptide of this disclosure, composition of this disclosure, or composition made by a method of this disclosure is consumed by the subject by an oral route. In some embodiments, the polypeptide of this disclosure, composition of this disclosure, or composition made by a method of this disclosure is consumed by the subject by an enteral route.
- this disclosure provides methods of maintaining or achieving a desirable body mass index in a subject.
- the methods comprise providing to the subject a sufficient amount of a polypeptide of this disclosure, a composition of this disclosure, or a composition made by a method of this disclosure.
- the subject is at least one of elderly, critically-medically ill, and suffering from protein-energy malnutrition.
- the sufficient amount of a polypeptide of this disclosure, a composition of this disclosure, or a composition made by a method of this disclosure is consumed by the subject in coordination with performance of exercise.
- the polypeptide of this disclosure, composition of this disclosure, or composition made by a method of this disclosure is consumed by the subject by an oral, enteral, or parenteral route.
- this disclosure provides methods of providing a polypeptide (e.g., of the disclosure) to a subject with protein-energy malnutrition.
- the methods comprise providing to the subject a sufficient amount of a polypeptide of this disclosure, a composition of this disclosure, or a composition made by a method of this disclosure.
- the polypeptide of this disclosure, composition of this disclosure, or composition made by a method of this disclosure is consumed by the subject by an oral, enteral, or parenteral route.
- polypeptides of this disclosure are useful for treating sarcopenia or frailty once it develops in a subject or for preventing the onset of sarcopenia or frailty in a subject who is a member of an at risk groups.
- all of the polypeptide consumed by the subject is a polypeptide according to this disclosure.
- polypeptides according to this disclosure are combined with other sources of protein and/or free amino acids to provide the total protein intake of the subject.
- the subject is at least one of elderly, critically-medically ill, and suffering from protein-energy malnutrition.
- the polypeptide according to disclosure, the composition according to disclosure, or the composition made by a method according to disclosure is consumed by the subject in coordination with performance of exercise. In some embodiments, the polypeptide according to this disclosure, the composition according to disclosure, or the composition made by a method according to disclosure is consumed by the subject by an oral, enteral, or parenteral route.
- incorporating at least one polypeptide or composition of this disclosure into the diet of a subject has at least one effect selected from inducing postprandial satiety (including by suppressing hunger), inducing thermogenesis, reducing glycemic response, positively affecting energy expenditure positively affecting lean body mass, reducing the weight gain caused by overeating, and decreasing energy intake.
- incorporating at least one polypeptide or composition of this disclosure into the diet of a subject has at least one effect selected from increasing loss of body fat, reducing lean tissue loss, improving lipid profile, and improving glucose tolerance and insulin sensitivity in the subject.
- the composition including the non-naturally occurring polypeptides can be formulated for topical application.
- the topical application can be for medical purpose or cosmetic purpose.
- the composition may further include at least one of a carrier molecule (e.g., vehicle), a preservative, and/or additional edible ingredients.
- any suitable carrier molecules are contemplated, and the exemplary carrier molecule may include water, oil, alcohol, propylene glycol, or emulsifiers in addition, any suitable preservatives are contemplated, and the exemplary preservatives include zinc oxide, parabens, formaldehyde releasers, isothiazolinones, phenoxyethanol, or organic acids such as benzoic acid, sodium benzoate, or butylene glycol, hexanediol, or potassium sorbate.
- the compositions that comprise non-naturally occurring polypeptides may be personal care products (e.g., a cosmetic).
- the compositions are formulated for topical administration.
- the compositions can contain other cosmetic ingredients suitable for human use.
- the personal care products may be useful for preventing or treating ultraviolet radiation damage to human skin or hair.
- the personal care products may be useful for increasing the firmness, elasticity, brightness, hydration, tactile texture or visual texture of skin and/or stimulate collagen production.
- the personal care products may be useful for reducing redness of the skin.
- the personal care products may be applied to skin or hair.
- compositions include, for example, masks, skin cleaners such as soap, cleansing creams, cleansing lotions, facial cleansers, cleansing milks, cleansing pads, facial washes, facial and body creams and moisturizers, facial serums, facial and body masks, facial toners and mists, eye creams and eye treatments, exfoliator formulas, lip balms and lipsticks, hair shampoo, hair conditioner and body shampoos, hair and scalp serums, hair mists and sprays, eye shadow, concealer, mascara and other color cosmetics.
- skin cleaners such as soap, cleansing creams, cleansing lotions, facial cleansers, cleansing milks, cleansing pads, facial washes, facial and body creams and moisturizers, facial serums, facial and body masks, facial toners and mists, eye creams and eye treatments, exfoliator formulas, lip balms and lipsticks, hair shampoo, hair conditioner and body shampoos, hair and scalp serums, hair mists and sprays, eye shadow, concealer, mascara and other color cosmetics.
- compositions that comprise the non-naturally occurring polypeptide can further comprise at least one additional ingredient comprising a topical carrier or a preservative.
- the topical carrier may comprise a topical carrier selected from the group consisting of liposome, biodegradable microcapsule, lotion, spray, aerosol, dusting powder, biodegradable polymer, mineral oil, triglyceride oil, silicone oil, glycerin, glycerin monostearate, alcohols, emulsifying agents, liquid petroleum, white petrolatum, propylene glycol, polyoxyethylene, polyoxypropylene, wax, sorbitan monostearate, polysorbate, cetyl ester wax, cetearyl alcohol, 2- octyldodecanol, benzyl alcohol, cyclomethicone, cyclopentasiloxane and water.
- the preservative may comprise a preservative selected from the group consisting of tocopherol, diiodomethyl-p-tolylsulfone, 2-Bromo-2-nitropropane-l,3-diol, cis isomer l-(3-chloroallyl)- 3,5,7-triaza-l-azoniaadamantane chloride, glutaraldehyde, 4,4-dimethyl oxazolidine, 7- Ethylbicyclooxazolidine, phenoxyethanol, butylene glycol, 1,2 Hexanediol, methyl paraben, sorbic acid, Germaben ® II, rosemary extract, and EDTA
- methods of decreasing skin damage, promoting the repair of damaged skin, protecting skin against UV damage, and/or protecting skin cells against the effects of exposure to urban dust are provided.
- the methods may comprise a step of applying a composition comprising a non-naturally occurring polypeptide of the disclosure to the skin of a subject.
- the non-naturally occurring polypeptide in the composition may decrease skin damage by protecting against UV damage.
- the non-naturally occurring polypeptide in the composition may promote the repair of damaged skin by increasing the viability of cells.
- the non-naturally occurring polypeptide in the composition may decrease skin damage and/or promote repair of cells by increasing procollagen synthesis when applied to skin, and/or promoting the viability of skin cells. In some cases, the non-naturally occurring polypeptide decreases the formation of thymine-thymine (TT) dimer formation.
- TT thymine-thymine
- compositions for treatment indicated in the method such as by the steps provided herein.
- the disclosure provides the use of a composition provided herein (e.g., a non-naturally occurring polypeptide or a formulation comprising a non-naturally occurring polypeptide) in a method for decreasing skin damage, promoting the repair of damaged skin, protecting skin against UV damage, and/or protecting skin cells against the effects of exposure to urban dust (e.g., such as by administering to the skin of a subject a composition provided herein).
- a composition provided herein e.g., a non-naturally occurring polypeptide or a formulation comprising a non-naturally occurring polypeptide
- the disclosure provides the use of a composition provided herein (e.g., a non-naturally occurring polypeptide or a formulation comprising a non-naturally occurring polypeptide) in a method for increasing the firmness, elasticity, brightness, hydration, tactile texture, or visual texture of skin and/or stimulating collagen production.
- a composition provided herein e.g., a non-naturally occurring polypeptide or a formulation comprising a non-naturally occurring polypeptide
- compositions or formulations comprising one or more non-naturally occurring polypeptide provided herein (e.g., for cosmetic use).
- the composition provides any suitable amount of polypeptide provided herein, such as in any suitable amount (e.g., an amount suitable to provide a benefit when given or administered to an individual or cell).
- the composition comprises an amount suitable to provide a beneficial effect to the skin of an individual when (e.g., topically) administered to the skin of the individual.
- the composition comprises between 0.001% and 30% w/w of a polypeptide (or non-naturally occurring collagen polypeptide) such as provided herein.
- the composition comprises between 0.001% and 20% w/w of a polypeptide (or non-naturally occurring collagen polypeptide) such as provided herein, between 0.001% and 10% w/w of a polypeptide (or non-naturally occurring collagen polypeptide) such as provided herein, between 0.001% and 5% w/w of a polypeptide (or non-naturally occurring collagen polypeptide) such as provided herein, between 0.001% and 2% w/w of a polypeptide (or non- naturally occurring collagen polypeptide) such as provided herein, between 0.001% and 1% w/w of a polypeptide (or non-naturally occurring collagen polypeptide) such as provided herein, between 0.001% and 0.5% w/w of a polypeptide (or non-naturally occurring collagen polypeptide) such as provided herein, and between 0.001% and 0.2% w/w of a polypeptide (or non-naturally occurring collagen polypeptide) such as provided herein.
- a polypeptide or
- the concentration or amount of a non-naturally occurring polypeptide (e.g., recombinant protein) provided herein is in a composition provided herein in any suitable amount and may, e.g., vary depending on the use or formulation (e.g., gel, capsule, liquid, powder, etc.).
- Exemplary concentrations of the non-naturally occurring polypeptides (e.g., recombinant proteins) in the composition can be at least about 0.01%, at least about 0.05%, at least about 0.1%, at least about 0.2 %, at least about 0.5%, at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98% (w/v or w/w) in the composition.
- the exemplary concentration of the non-naturally occurring polypeptides (e.g., recombinant proteins) in the composition can be about 0.01%, about 0.05%, about 0.1%, about 0.2 %, at least 0.5%, 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98% (w/v or w/w) in the composition.
- the exemplary concentration of the non-naturally occurring polypeptides (e.g., recombinant proteins) in the composition can range from about 0.01% to about 99%, from about 0.05% to about 99%, from about 0.1% to about 99%, from about 0.1% to about 99%, from about 0.5% to about 99%, from about 0.1% to about 10%, from about 1% to about 99%, from about 5% to about 99%, from about 10% to about 99%, from about 15% to about 99%, from about 20% to about 99%, from about 25% to about 99%, from about 30% to about 99%, from about 35% to about 99%, from about 40% to about 99%, from about 45% to about 99%, from about 50% to about 99%, from about 55% to about 99%, from about 60% to about 99%, from about 65% to about 99%, from about 70% to about 99%, from about 75% to about 99%, from about 80% to about 99%, from about 85% to about 99%, from about 90% to about 99%
- the exemplary concentration of the non-naturally occurring polypeptides (e.g., recombinant proteins) in the composition can be less than about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55%, about 50%, about 45%, about 40%, etc.
- Certain aspects of the disclosure include methods of improving the appearance of the skin, the hair, and/or the nails of a subject by administering the composition to the subject. Additionally and/or alternatively, the disclosure includes a method of improving the joint health and/or restoring bone density in a subject. In some embodiments, the subject has or is suspected to have osteoporosis and/or osteoarthritis. Alternatively and/or additionally, the disclosure includes a method of improving gut health, altering or improving the microbiome of a subject, or altering and/or reducing inflammation or tissue repair in a subject.
- the composition is administered orally in a dose and schedule sufficient or effective for improving the appearance of the skin, the hair, and/or the nails of a subject, improving the joint health and/or restoring bone density in a subject having osteoporosis and/or osteoarthritis, and/or improving gut health, altering or improving the microbiome of a subject, or altering and/or reducing inflammation or tissue repair in a subject. Any suitable dose is optionally used.
- the dose used is from about 0.1 mg/kg to about 200 mg/kg, from about 0.2 mg/kg to about 150 mg/kg, from about 0.5 mg/kg to about 150 mg/kg, from about 0.5 mg/kg to about 100 mg/kg, from about 0.8 mg/kg to about 100 mg/kg, from about 1.0 mg/kg to about 100 mg/kg, from about 1.0 mg/kg to about 90 mg/kg, from about 1.0 mg/kg to about 80 mg/kg, from about 1.0 mg/kg to about 70 mg/kg, from about 1.0 mg/kg to about 60 mg/kg, from about 1.0 mg/kg to about 50 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 1.5 mg/kg, about 2.0 mg/kg, about 2.5 mg/kg, about 3.0 mg/kg, about 3.5 mg/kg, about 4.0 mg/kg, about 4.5 mg/kg, or about 5.0 mg/kg, about 10 mg/kg, about 15 mg/kg, about 20 mg/kg, about 25 mg/kg, or about 5.0 mg
- the dose may increase or decrease by the schedule of the administration.
- the dose for administering to a subject e.g., human
- the dose for administering to a subject can be increased or decreased for about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, about 6 mg/kg, about 7 mg/kg, about 8 mg/kg, about 9 mg/kg, or about 1.0 mg/kg per each administration (e.g., for 3 consecutive administration, the dose can be increased from 2.0 mg/kg, 2.2 mg/kg, 2.4 mg/kg, respectively, etc.).
- the dose for administering to a subject can be increased and then decreased, or decreased and then increased for about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, about 6 mg/kg, about 7 mg/kg, about 8 mg/kg, about 9 mg/kg, or about 1.0 mg/kg per each administration (e.g., for 5 consecutive administration, the dose can be increased from 2.0 mg/kg, 2.2 mg/kg, 2.4 mg/kg, then 2.2 mg/kg, and 2.0 mg/kg, respectively, etc.).
- the schedule of administration varies depending on the purpose, gender, age, or health condition of the subject.
- the composition is administered once a day, twice a day, three times a day, up to 6 times a day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, etc.
- the composition is administered a plurality of times in an irregular interval, or increased interval, or decreased interval.
- the composition is topically applied in a dose and/or schedule sufficient or effective for improving the appearance of the skin, the hair, and/or the nails of a subject, and/or reducing inflammation in a subject.
- the dose varies depending on the target area for the topical application (e.g., hair, skin, wound, nail, etc.), and can range from about 0.1 g/inch 2 to about 10 g/inch 2 , from about 0.1 g/inch 2 to about 9 g/inch 2 , from about 0.1 g/inch 2 to about 8 g/inch 2 , from about 0.1 g/inch 2 to about 7 g/inch 2 , from about 0.1 g/inch 2 to about 6 g/inch 2 , from about 0.1 g/inch 2 to about 5 g/inch 2 , from about 0.1 g/inch 2 to about 4 g/inch 2 , from about 0.1 g/inch 2 to about 3 g/inch 2 , from about 0.5 g/
- the dose varies depending on the purpose, gender, age, severity of damage on the area, or health condition.
- the composition can be applied to the target area of the subject at least three times a day, at least twice a day, once a day, up to 6 times a day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, etc.
- Skin appearance and quality In some embodiments, provided herein are methods of improving skin appearance and/or quality, such as by administering an effective amount of a product or composition (e.g., containing a non-naturally occurring polypeptide described herein) provided herein to an individual (e.g., an individual in need of such improvement). In some embodiments, administration is orally or topically. In some instances, administration results in various changes or effects on the skin of the individual. In some instances, the skin of the individual demonstrates increased proliferation and/or reduced cell death rate (e.g., when tested using a colorimetric assay for assessing cell metabolic activity (e.g., MTT assay)).
- a product or composition e.g., containing a non-naturally occurring polypeptide described herein
- administration is orally or topically.
- administration results in various changes or effects on the skin of the individual.
- the skin of the individual demonstrates increased proliferation and/or reduced cell death rate (e.g., when tested using a colorimetric assay for
- the skin demonstrates improved production of extracellular matrix (ECM) components such as collagen, elastin, fibronectin, fibrillin and/or decreased production of matrix degrading proteins (e.g., matrix metalloproteinases (MMPs) and proteases).
- ECM extracellular matrix
- MMPs matrix metalloproteinases
- the skin shows resistance or improved outcome upon exposure to harmful agents like photodamage (e.g., UV irradiation), pollution (e.g., urban dust), and/or harsh skincare actives (e.g., retinoic acid, benzoyl peroxide, salicylic acid).
- such resistance or improved outcome is shown via improved cell viability or proliferation (or reduced cell death) that can be assessed using MTT viability assay, via improved DNA repair that can be assessed by thymidine-dimer ELISA detection, reduced inflammation that can be assessed by Luminex detection, reduced reactive oxidative stress (ROS) that can be assessed by CM-EEDCFDA (General oxidative stress indicator) detection.
- improved cell viability or proliferation or reduced cell death
- MTT viability assay via improved DNA repair that can be assessed by thymidine-dimer ELISA detection
- reduced inflammation can be assessed by Luminex detection
- ROS reduced reactive oxidative stress
- CM-EEDCFDA General oxidative stress indicator
- the skin demonstrates reduction in wrinkles and/or fine lines, reduction in skin redness and/or hyperpigmentation, increase in skin brightness, decrease in pore size, decrease in skin roughness, and/or reduction in acne (e.g., when assessed using CLARITY analysis).
- the skin demonstrates improvement in skin elasticity, increase in skin firmness, increase in skin hydration, increase in skin barrier function, increase in skin collagen and elastin content, and/or increase in dermal density.
- hair Quality In some embodiments, provided herein are methods of improving hair appearance and/or quality, such as by administering an effective amount of a product or composition provided herein (e.g., containing a non-naturally occurring polypeptide as described herein) to an individual (e.g., an individual in need of such improvement).
- administration is orally or topically.
- administration results in various changes or effects on the hair of the individual.
- the hair demonstrates improved hair fiber thickness and/or density, increases in moisture, faster growth rate, reduced split ends, reduced frizz/increased static control, improved fiber alignment/shine, increased combability, and/or stronger resistance to hair breakage.
- the hair demonstrates improved hair growth, thicker hair fiber diameter, increased combability, reduced hair loss, and/or increased hair tensile strength.
- Nail Quality In some embodiments, provided herein are methods of improving nail appearance and/or quality, such as by administering an effective amount of a product or composition provided herein (e.g., containing a non-naturally occurring polypeptide as described herein) to an individual (e.g., an individual in need of such improvement). In some embodiments, administration is orally or topically. In some instances, administration results in various changes or effects on the nail of the individual. In certain instances, the nail demonstrates improved (reductions in) nail peeling, nail edge irregularities and/or nail roughness, frequency of cracked/chipped nails, and/or increases in nail growth rate.
- a product or composition provided herein e.g., containing a non-naturally occurring polypeptide as described herein
- administration is orally or topically.
- administration results in various changes or effects on the nail of the individual.
- the nail demonstrates improved (reductions in) nail peeling, nail edge irregularities and/or nail roughness, frequency of cracked/chipped nails, and/or
- Joint health In some embodiments, provided herein are methods of improving j oint health, such as by administering an effective amount of a product or composition provided herein (e.g., containing a non-naturally occurring polypeptide as described herein) to an individual (e.g., an individual in need of such improvement). In some embodiments, administration is orally. In some instances, administration results in various changes or effects in joint health of the individual. In certain instances, the improved joint health is demonstrated by reduction in reported joint pain and/or increase in range of joint mobility.
- a product or composition provided herein e.g., containing a non-naturally occurring polypeptide as described herein
- administration is orally.
- administration results in various changes or effects in joint health of the individual.
- the improved joint health is demonstrated by reduction in reported joint pain and/or increase in range of joint mobility.
- Inflammation in some embodiments, provided herein are methods of improving inflammatory effects, such as by administering an effective amount of a product or composition provided herein (e.g., containing a non-naturally occurring polypeptide as described herein) to an individual (e.g., an individual in need of such improvement).
- administration is orally or topically.
- administration results in various changes or effects in inflammation in the individual.
- the improved inflammatory effect is demonstrated by lower cytokine levels in the bloodstream (e.g., assessed by Luminex detection) and/or restore healthy levels of immune cells (e.g., by blood differential counts).
- Gut health In some embodiments, provided herein are methods of improving gut health, such as by administering an effective amount of a product or composition provided herein (e.g., containing a non-naturally occurring polypeptide as described herein) to an individual (e.g., an individual in need of such improvement). In some embodiments, administration is orally. In some instances, administration results in various changes or effects in gut health of the individual. In certain instances, the improved gut health is demonstrated by improved bowel movements and/or decrease in gastrointestinal discomfort/pain.
- a product or composition provided herein e.g., containing a non-naturally occurring polypeptide as described herein
- administration is orally.
- administration results in various changes or effects in gut health of the individual.
- the improved gut health is demonstrated by improved bowel movements and/or decrease in gastrointestinal discomfort/pain.
- Microbiome In some embodiments, provided herein are methods of altering and/or improving the microbiome, such as by administering an effective amount of a product or composition provided herein (e.g., containing a non-naturally occurring polypeptide as described herein) to an individual (e.g., an individual in need of such improvement). In some embodiments, administration is orally. In some instances, administration results in various changes or effects in the microbiome of the individual. In certain instances, the improved microbiome is demonstrated by increased diversity of microbes and/or increased abundance of beneficial microbes (e.g., assessed by 16S DNA sequencing stool samples).
- Example 1 Generation of non-naturally occurring polypeptides of the disclosure.
- This example shows the generation of a recombinant polypeptide of the disclosure by genetically engineered microorganisms and purification process of such generated polypeptides.
- the polynucleotides of SEQ ID NOs: 1, 3, 5, and 7 were synthesized and at least one of the polynucleotides were inserted into a pET vector.
- Overlaps between a pET vector and SEQ ID NOs: 1, 3, 5, and 7 were designed to be between 20 and 30 bp long and added using PCR with the enzyme PRIMESTAR ® GXL polymerase (www.takarabio.com/products/pcr/gc-rich- pcr/primestar-gxl-dna-polymerase).
- PRIMESTAR ® GXL polymerase www.takarabio.com/products/pcr/gc-rich- pcr/primestar-gxl-dna-polymerase.
- the opened pET vector and insert DNA e.g., polynucleotide of SEQ ID NO: 1
- IN-FUSION ® Cloning www.takarabio.com/products/cloning/in-fusion-cloning.
- the nucleic acid sequences were preceded by a secretion signal sequence disclosed as SEQ ID NOs: 9, 11, 13,
- the fermentations were performed at various temperature ranging from 25° to 28° C.
- the temperature of the fermentation was maintained at a constant temperature and immediately upon completion of fermentation the polypeptide was purified.
- the temperature of the fermentations was maintained for a desired period of time and when cell densities of OD600 of 10-20 were reached, the temperature was reduced to induce protein production. Typically, the temperature was reduced from 28° C to 25° C. Induction was carried out by adding IPTG to the media at concentrations ranging from 0.1 - 0.5 mM. Fermentations were continued for 40-60 hours.
- the recombinant polypeptide was purified as follows: The pH of the fermentation broth was decreased to between 3-3.5 using 5-50% Sulfuric Acid. The cells were then separated using centrifugation or centrifugation followed by microfiltration. Supernatant of the acidified broth was tested on a polyacrylamide gel and found to contain recombinant polypeptide in relatively high abundance compared to starting pellet. To obtain volume and salt reduction, concentration and diafiltration steps were performed ultrafiltration. Final polypeptide slurry was run on an SDS- PAGE gel to confirm presence of the recombinant polypeptide.
- FIGS. 2A-2C depict SDS-PAGE gels of non-naturally occurring polypeptides of the disclosure before and after treatment at pH 3.0.
- FIG. 2A depicts an SDS-PAGE gel of fermentation supernatant containing a non-naturally occurring polypeptide having an amino acid sequence of SEQ ID NO: 2 before (Lane 1) and after (Lane 2) treatment at pH 3.0.
- the expected molecular weight of such polypeptide was about 17.9 kDa.
- the identity of the polypeptide was confirmed by mass spectrometry (data not shown).
- FIG. 2B depicts an SDS-PAGE gel of fermentation supernatant containing a non-naturally occurring polypeptide having an amino acid sequence of SEQ ID NO: 8 before (Lane 3) and after (Lane 4) treatment at pH 3.0.
- the expected molecular weight of such polypeptide was about 17.6 kDa.
- the identity of the polypeptide was confirmed by mass spectrometry (data not shown).
- FIG. 2C depicts an SDS-PAGE gel of fermentation supernatant containing a non-naturally occurring polypeptide produced in various bacterial host strains having an amino acid sequence of SEQ ID NO: 8 before (Lanes 3-5) and after (Lanes 6-8) treatment at pH 3.0.
- Example 2 Human clinical study of the non-naturally occurring polypeptides of the disclosure.
- Skin appearance and quality Patients are recruited and/or cultured human skin cells or patient-derived skin samples are provided to evaluate the benefit of recombinant polypeptides provided herein.
- Non-naturally occurring polypeptides as described herein (or products containing non-naturally occurring polypeptides as described herein) and control products are administered (orally or topically) to separate (in vitro or in vivo) cohorts to evaluate for various effects on skin. Skin effects are evaluated quantitatively and/or qualitatively.
- the cultured human skin cells in vitro either primary culture or cell line
- human skin tissue ex vivo the cultured human skin cells or cells in the human skin tissue show increased proliferation or reduced cell death rate (e.g., when tested using a colorimetric assay for assessing cell metabolic activity (e.g., MTT assay)).
- a colorimetric assay for assessing cell metabolic activity e.g., MTT assay
- such cultured human skin cells or cells in the human skin tissue contacted or treated with the compositions including the non-naturally occurring polypeptides described herein may show, via RNA-seq transcriptomic analysis or proteomics analysis, increased production of extracellular matrix (ECM) components such as collagen, elastin, fibronectin, fibrillin, and decreased production of matrix-degrading proteins (e.g., matrix metalloproteinases (MMPs) and proteases).
- ECM extracellular matrix
- MMPs matrix metalloproteinases
- Such treated cultured human skin cells or cells in the human skin tissue are evaluated to demonstrate resistance or improved outcome upon exposure to harmful agents like photodamage (e.g., UV irradiation), pollution (e.g., urban dust), and harsh skincare actives (e.g., retinoic acid, benzoyl peroxide, salicylic acid).
- harmful agents e.g., UV irradiation
- pollution e.g., urban dust
- harsh skincare actives e.g., retinoic acid, benzoyl peroxide, salicylic acid.
- Such resistance or improved outcome is shown via improved cell viability or proliferation (or reduced cell death) that is assessed using MTT viability assay, via improved DNA repair that is assessed by thymidine-dimer ELISA detection, reduced inflammation that is assessed by Luminex detection, and/or reduced reactive oxidative stress (ROS) that is assessed by CM-EEDCFDA (General oxidative stress indicator) detection.
- ROS reactive oxidative stress
- composition including a non-naturally occurring polypeptide e.g., as described herein
- the subject when applied to, or administered to the subject orally or topically on the skin, the subject’s skin is evaluated for reduction in wrinkles and fine lines, reduction in skin redness and hyperpigmentation, increase in skin brightness, decrease in pore size, decrease in skin roughness, and reduction in acne (e.g., when assessed using CLARITY analysis).
- the skin is also further evaluated (before and after administration) to show change in skin elasticity, change in skin firmness, change in skin hydration, change in skin barrier function, change in skin collagen and elastin content, and/or change in dermal density.
- Hair Quality Effects of products (e.g., containing a non-naturally occurring polypeptide as described herein) provided herein (e.g., relative to control products) on hair are also evaluated.
- products e.g., containing a non-naturally occurring polypeptide as described herein
- hair quality is measured, such as by measuring changes in hair fiber thickness and density, changes in moisture, changes in growth rate, changes in prevalence of split ends, changes in frizz/increased static control, changes in fiber alignment/shine, changes in combability, and/or changes in resistance to hair breakage (e.g., measured by in vitro hair tress testing).
- clinical testing measures changes in hair growth, hair fiber diameter, combability, hair loss, and/or hair tensile strength.
- Nail Quality Effects of products (e.g., containing a non-naturally occurring polypeptide as described herein) provided herein (e.g., relative to control products) on nails are also evaluated. For example, when the products provided herein (e.g., containing a non-naturally occurring polypeptide as described herein) are applied to nail or orally administered to a subject, nail quality is measured, such as by measuring changes in nail hardness, nail peeling, nail edge irregularities and nail roughness, frequency of cracked/chipped nails, and/or nail growth rate.
- products e.g., containing a non-naturally occurring polypeptide as described herein
- nail quality is measured, such as by measuring changes in nail hardness, nail peeling, nail edge irregularities and nail roughness, frequency of cracked/chipped nails, and/or nail growth rate.
- Joint health Effects of products (e.g., containing a non-naturally occurring polypeptide as described herein) provided herein (e.g., relative to control products) on joints are also evaluated. For example, when the products provided herein (e.g., containing a non-naturally occurring polypeptide as described herein) are orally administered to a subject, joint quality is measured, such as by measuring changes in reported joint pain and/or range of joint mobility.
- Inflammation Effects of products (e.g., containing a non-naturally occurring polypeptide as described herein) provided herein (e.g., relative to control products) on inflammation are also evaluated. For example, when the products provided herein (e.g., containing a non-naturally occurring polypeptide as described herein) are orally administered to a subject, changes in inflammation are measured, cytokine levels in the bloodstream are measured (e.g., assessed by Luminex detection), and/or levels of immune cells are measured (by blood differential counts).
- products e.g., containing a non-naturally occurring polypeptide as described herein
- cytokine levels in the bloodstream are measured (e.g., assessed by Luminex detection), and/or levels of immune cells are measured (by blood differential counts).
- Gut health Effects of products (e.g., containing a non-naturally occurring polypeptide as described herein) provided herein (e.g., relative to control products) in gut health are also evaluated. For example, when the products provided herein (e.g., containing a non-naturally occurring polypeptide as described herein) are orally administered to a subject, changes in bowel movements and/or gastrointestinal discomfort/pain are measured.
- products e.g., containing a non-naturally occurring polypeptide as described herein
- changes in bowel movements and/or gastrointestinal discomfort/pain are measured.
- Microbiome Effects of products (e.g., containing a non-naturally occurring polypeptide described herein) provided herein (e.g., relative to control products) in the microbiome are also evaluated. For example, when the products provided herein (e.g., containing a non-naturally occurring polypeptide described herein) are orally administered to a subject, changes in diversity of microbes or abundance of beneficial microbes is measured, which can be assessed by 16S DNA sequencing stool samples. Also, such effect can be shown in vitro as the composition supports growth of beneficial microbes in broth co-cultures.
- Example 3 In vitro studies of non-naturally occurring polypeptides of the disclosure. [0176] This example demonstrates functional effects on cells in vitro after treatment with a non- naturally occurring polypeptide having the amino acid sequence of SEQ ID NO: 2.
- a non-naturally occurring polypeptide of SEQ ID NO: 2 increases viability of human dermal fibroblasts.
- a non-naturally occurring polypeptide of SEQ ID NO: 2 increases collagen type I production in human dermal fibroblasts.
- Human primary fibroblasts were cultured in media alone (FIG. 4; “A”), or with 0.025% w/w (FIG. 4; “B”), 0.05% w/w (FIG. 4; “C”), or 0.1% w/w (FIG. 4; “D”) of a non-naturally occurring polypeptide having the amino acid sequence of SEQ ID NO: 2 for 24 hours.
- Fibroblast production of collagen type I was determined by analyzing the supernatants with an enzyme- linked immunosorbent assay (ELISA) for pro-collagen type I C-peptide, which is a readout for total secreted collagen type I. As shown in FIG. 4, fibroblasts treated with the polypeptide of SEQ ID NO: 2 secreted higher levels of collagen type I than media control-treated fibroblasts.
- ELISA enzyme- linked immunosorbent assay
- a non-naturally occurring polypeptide of SEQ ID NO: 2 increases collagen type I production in human tenocytes.
- Example 4 Sports drink containing a non-naturally occurring polypeptide of the disclosure.
- a non-naturally occurring polypeptide of the disclosure was formulated in a sports drink.
- Example 5 Gummies containing a non-naturally occurring polypeptide of the disclosure. [0193] In this example, a non-naturally occurring polypeptide of the disclosure was formulated in a gummy.
- Tapioca syrup cane sugar, water, collagen peptides, citric acid, pectin, sodium citrate, natural flavor, sodium hyaluronate, fruit and vegetable juice [for color]
- Polypeptide of SEQ ID NO: 2 has a buffering effect; tested different citrate/citric acid levels.
- Example 6 Brownies containing a non-naturally occurring polypeptide of the disclosure.
- (Bread) flour cane sugar, cocoa powder, water, coconut oil, polypeptide of SEQ ID NO: 2, olive oil, glycerin, vanilla extract, baking soda, salt, xanthan, lecithin.
- Example 7 Properties of non-naturally occurring polypeptides of the disclosure related to nutritional use
- the non-naturally occurring polypeptide of SEQ ID NO: 2 was evaluated for various properties related to nutritional use.
- the non-naturally occurring polypeptides provided herein can be evaluated for viscosity in solution.
- a polypeptide of SEQ ID NO: 2 was shown to be soluble up to 43% w/w at pH 4.5 and 50% w/w at pH 6.5, using a flow sweep on DHR-II rheometer with 40 mm parallel plate at 25° C.
- a polypeptide of SEQ ID NO: 2 as a spray dried powder was found to go into solution slower in water at 50° C or higher versus water at ambient temperature. Results are depicted in FIG. 7A and FIG. 7B.
- Interactions of a polypeptide of SEQ ID NO: 2 with hydrocolloids and oils was also evaluated. Blends of a polypeptide of SEQ ID NO: 2 and gum arabic were prepared in DI water and evaluated for viscosity in the ratios according to Table 4.
- Blends of a polypeptide of SEQ ID NO: 2 and xanthan were prepared in DI water and evaluated for viscosity in various ratios.
- FIG. 8 depicts results of this study.
- SDA represents a polypeptide of SEQ ID NO: 2 spray dried at pH 6.5.
- SDB represents a polypeptide of SEQ ID NO: 2 spray dried with a feed of 20% solids at pH 4.5.
- the non-naturally occurring polypeptides of the disclosure can be evaluated for gel hardness in solution. Briefly, 5% protein solutions (containing a polypeptide of SEQ ID NO: 2) were crosslinked with 100 u transglutaminase enzyme. Protein and enzyme mixtures were deposited in 12-well cell plates and incubated at 50° C for 2 hours. Gels were heated to 100° C for 10 minutes to inactivate transglutaminase enzyme. Gels were cooled at ambient temperature and stored in 4° C overnight. Gel hardness was evaluated by molding 4 mL of gel mixture in 23 mm diameter wells.
- Protein solutions were prepared in DI water or 10 mM sodium phosphate buffer, pH 7.2. Solutions were adjusted to target pH using 1M HC1 or 2N NaOH prior to addition of enzyme. Results of this study are depicted in FIG. 9.
- Protein solutions were prepared in DI water or 10 mM sodium phosphate buffer, pH 7.2. Solutions were adjusted to target pH using 1M HC1 or 2N NaOH prior to addition of enzyme. Results are depicted in FIG. 10A and FIG. 10B. At pH 5.5, crosslinked GL21 gels range in hardness from 27-35 g. Between pH 6.3-6.4, crosslinked polypeptide gels range in hardness from 20-3 lg.
- the non-naturally occurring polypeptides described herein can be evaluated for emulsion properties in solution.
- Protein solutions at pH 4.5 were mixed with canola oil at a 5: 1 ratio and were homogenized using IKA Ultra Turrax at 10000 rpm for 10 min. Stability of emulsion was evaluated after 24 hours at ambient temperature in 12 mL conical tubes.
- non-naturally occurring polypeptides described herein can be evaluated for foaming properties in solution. 10 mL of 5% w/w of a polypeptide of SEQ ID NO: 2 solution from various lots was shaken in a conical 50 mL tube for 2 minutes. Volume of foam and time of foam collapse were recorded, and results are depicted in Table 5.
- non-naturally occurring polypeptides of the disclosure can be evaluated for sensory properties, including odor and flavor.
- Spray dried polypeptide of SEQ ID NO: 2 from various lots was evaluated either dried or in solution, and the results are depicted in Table 6.
- Non-naturally occurring polypeptides of the disclosure can be evaluated for solubility.
- the effect of agglomeration with lecithin solution on compacted powder forms of a polypeptide of SEQ ID NO: 2 to increase particle size and improve solubility was evaluated.
- 2.5 g protein powder was dropped into 50 mL water. Wettability was evaluated by observing sinking within 20 seconds. Dissolution was evaluated with 40 seconds of slow stirring and 60 seconds of rest. Results are depicted in Table 7.
- Viscosity of solutions of a polypeptide of SEQ ID NO: 2 at 20% w/w solutions were also determined at 25° C, and results are depicted in FIG. 11.
- 8% w/w protein solution (containing a polypeptide of SEQ ID NO: 2) at pH 5.5 and 100 u transglutaminase enzyme was homogenized with 50% w/w oil at 26000 rpm with Polytron for 1 minute on ice. 4g of mixture was deposited into each well of a 12-well cell plate and incubated for 2 hours at 50° C. Gels were heated to 100° C for 10 minutes to inactivate the enzyme. Gels were cooled at ambient temperature and stored at 4° C overnight. A polypeptide of SEQ ID NO:2 stabilized high oil emulsion during crosslinking reaction to form protein oil gel. Results are depicted in FIG.
- Example 8 Polypeptide sequence confirmation of products and lack of hydroxyproline residues
- the truncated collagen polypeptides of the present disclosure also differ from naturally occurring collagen polypeptides in their lack of hydroxyproline residues. Table 10. Analysis of amino acid and peptide modifications of the polypeptide of SEQ ID NO: 2.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Molecular Biology (AREA)
- Nutrition Science (AREA)
- Polymers & Plastics (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pharmacology & Pharmacy (AREA)
- Dermatology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Mycology (AREA)
- Rheumatology (AREA)
- Gerontology & Geriatric Medicine (AREA)
- Wood Science & Technology (AREA)
- Epidemiology (AREA)
- Physical Education & Sports Medicine (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Pain & Pain Management (AREA)
- Birds (AREA)
- Immunology (AREA)
- Orthopedic Medicine & Surgery (AREA)
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| MX2022009036A MX2022009036A (es) | 2020-01-24 | 2021-01-22 | Colageno dietetico no de animales. |
| AU2021211721A AU2021211721A1 (en) | 2020-01-24 | 2021-01-22 | Animal-free dietary collagen |
| EP21745159.0A EP4093761A4 (en) | 2020-01-24 | 2021-01-22 | Animal-free dietary collagen |
| BR112022014586A BR112022014586A2 (pt) | 2020-01-24 | 2021-01-22 | Colágeno dietário não derivado de animais |
| JP2022545046A JP7794745B2 (ja) | 2020-01-24 | 2021-01-22 | 動物質を含まない食事性コラーゲン |
| CN202180022766.8A CN115298212A (zh) | 2020-01-24 | 2021-01-22 | 无动物膳食胶原蛋白 |
| GB2212264.2A GB2610313B (en) | 2020-01-24 | 2021-01-22 | Animal-free dietary collagen |
| CA3168802A CA3168802A1 (en) | 2020-01-24 | 2021-01-22 | Animal-free dietary collagen |
| US17/171,874 US11174300B2 (en) | 2020-01-24 | 2021-02-09 | Animal-free dietary collagen |
| US17/493,627 US11332505B2 (en) | 2020-01-24 | 2021-10-04 | Animal-free dietary collagen |
| US17/714,896 US20220332775A1 (en) | 2020-01-24 | 2022-04-06 | Animal-free dietary collagen |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202062965700P | 2020-01-24 | 2020-01-24 | |
| US62/965,700 | 2020-01-24 | ||
| US202063117243P | 2020-11-23 | 2020-11-23 | |
| US63/117,243 | 2020-11-23 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US17/171,874 Continuation US11174300B2 (en) | 2020-01-24 | 2021-02-09 | Animal-free dietary collagen |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2021150959A1 true WO2021150959A1 (en) | 2021-07-29 |
Family
ID=76991717
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2021/014714 Ceased WO2021150959A1 (en) | 2020-01-24 | 2021-01-22 | Animal-free dietary collagen |
Country Status (11)
| Country | Link |
|---|---|
| US (3) | US11174300B2 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4093761A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP7794745B2 (cg-RX-API-DMAC7.html) |
| CN (1) | CN115298212A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2021211721A1 (cg-RX-API-DMAC7.html) |
| BR (1) | BR112022014586A2 (cg-RX-API-DMAC7.html) |
| CA (1) | CA3168802A1 (cg-RX-API-DMAC7.html) |
| GB (1) | GB2610313B (cg-RX-API-DMAC7.html) |
| MX (1) | MX2022009036A (cg-RX-API-DMAC7.html) |
| TW (1) | TW202134267A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2021150959A1 (cg-RX-API-DMAC7.html) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11174300B2 (en) | 2020-01-24 | 2021-11-16 | Geltor, Inc. | Animal-free dietary collagen |
| WO2023009673A1 (en) * | 2021-07-28 | 2023-02-02 | Geltor, Inc. | Animal-free cosmetic collagens |
| CN118255873A (zh) * | 2024-04-30 | 2024-06-28 | 安徽中生安兰健康产业有限公司 | 重组人源iii型胶原蛋白及基因、表达载体、菌和应用 |
| WO2024238910A1 (en) * | 2023-05-17 | 2024-11-21 | Htl Biotechnology Innovation, Inc. | Collagen production process |
| EP4376872A4 (en) * | 2021-07-28 | 2025-10-29 | Geltor Inc | Pharmaceutical compositions and methods for treating connective tissue disorders with collagen polypeptides |
| US12570723B2 (en) * | 2023-04-10 | 2026-03-10 | Shandong D-nutrimec Biomedical Co., Ltd. | Recombinant humanized collagen type III alpha-1, and expression vector and use thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3953380A4 (en) | 2019-04-12 | 2023-01-25 | Geltor, Inc. | RECOMBINATION ELASTIN AND ASSOCIATED PRODUCTION |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004052910A1 (en) * | 2002-11-14 | 2004-06-24 | Affiliated Hospital Of Academy Of Military Medical Sciences, Pla | A full-length polynucleotide coding chicken type ii collagen and the use of it |
| US20150175969A1 (en) * | 2012-09-26 | 2015-06-25 | Fujifilm Corporation | Polypeptide, scaffold composition, composition for cartilage tissue restoration, composition for cartilage cell culture, and composition for promoting glycosaminoglycan production |
| WO2019068018A2 (en) * | 2017-09-28 | 2019-04-04 | Geltor, Inc. | RECOMBINANT COLLAGEN AND ELASTIN MOLECULES AND USES THEREOF |
| WO2019103981A1 (en) * | 2017-11-22 | 2019-05-31 | Geltor Inc. | Methods and systems for engineering collagen |
Family Cites Families (54)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6653450B1 (en) | 1993-01-28 | 2003-11-25 | Cohesion Technologies, Inc. | Mutated recombinant collagens |
| WO1997038710A1 (en) | 1996-04-12 | 1997-10-23 | Fibrogen, Inc. | Synthesis of human procollagens and collagens in recombinant dna systems |
| FR2757874B1 (fr) | 1996-12-17 | 2003-04-25 | Biocem | Collagenes recombinants et proteines derivees produits par les plantes, leurs procedes d'obtention et leurs utilisations |
| AUPO811797A0 (en) | 1997-07-18 | 1997-08-14 | University Of Sydney, The | Tropoelastin derivatives |
| US6428978B1 (en) | 1998-05-08 | 2002-08-06 | Cohesion Technologies, Inc. | Methods for the production of gelatin and full-length triple helical collagen in recombinant cells |
| RU2002112751A (ru) * | 1999-11-12 | 2004-02-27 | Файброджен, Инк. (Us) | Рекомбинантные желатины |
| US6992172B1 (en) | 1999-11-12 | 2006-01-31 | Fibrogen, Inc. | Recombinant gelatins |
| US6682760B2 (en) | 2000-04-18 | 2004-01-27 | Colbar R&D Ltd. | Cross-linked collagen matrices and methods for their preparation |
| TW499433B (en) * | 2000-12-27 | 2002-08-21 | Ind Tech Res Inst | Novel human Α1-chain collagen |
| EP1584630A1 (en) | 2004-04-08 | 2005-10-12 | Nederlandse Organisatie voor toegepast-natuurwetenschappelijk Onderzoek TNO | Method for preparing a modified protein outside a host cell |
| DE602006015289D1 (de) | 2005-02-23 | 2010-08-19 | Fujifilm Mfg Europe Bv | Nicht-glycosylierte rekombinante collagen-ähnliche polypeptide |
| AU2006255140A1 (en) | 2005-06-03 | 2006-12-14 | The Texas A & M University System | Specific binding sites in collagen for integrins and use thereof |
| WO2007044945A2 (en) | 2005-10-13 | 2007-04-19 | Gu, Jennifer, L. | Mineral collagen chelates and methods of making and using same |
| US7279329B2 (en) | 2005-10-17 | 2007-10-09 | Industrial Technology Research Institute | Expression system for producing collagen |
| US8841255B2 (en) | 2005-12-20 | 2014-09-23 | Duke University | Therapeutic agents comprising fusions of vasoactive intestinal peptide and elastic peptides |
| ATE455153T1 (de) | 2006-03-13 | 2010-01-15 | Becker & Co Naturinwerk | Kollagenpulver und auf kollagen basierende thermoplastische zusammensetzung zur herstellung von formkörpern |
| EP2054442A2 (en) * | 2006-06-14 | 2009-05-06 | Cell-Matrix, Inc. | Denatured collagen peptides and uses thereof |
| EP2117620A4 (en) | 2006-09-29 | 2010-12-01 | Martin Kean Chong Ng | PROTOELASTINE BIOMATERIALS FROM TROOELASTINE |
| WO2009053985A1 (en) | 2007-10-26 | 2009-04-30 | Collplant Ltd. | Methods of processing recombinant procollagen |
| US7910134B2 (en) | 2007-10-29 | 2011-03-22 | Ayman Boutros | Alloplastic injectable dermal filler and methods of use thereof |
| US8507652B2 (en) | 2008-02-08 | 2013-08-13 | Luis Eduardo da Cruz | Pharmaceutical composition, dressing and method for treating skin lesion, intermediate composition and process for preparing said dressing, and use of cerium salt associated with a collagen matrix |
| GB0820784D0 (en) * | 2008-11-13 | 2008-12-24 | Nordic Bioscience As | Assessment of protein degradation by measurement of isomerised neo-epitope containing fragments |
| WO2010091251A2 (en) | 2009-02-06 | 2010-08-12 | The University Of Medicine And Dentistry Of New Jersey | Modular triple-helical collagen-like products |
| EP2770327B1 (en) * | 2009-03-30 | 2017-06-14 | Nordic Bioscience A/S | Fibrosis biomarker assay |
| EP2454367B1 (en) | 2009-07-17 | 2013-10-16 | The Texas A&M University System | Designer collagens and uses thereof |
| US9402857B2 (en) | 2009-07-23 | 2016-08-02 | U.S. Nutraceuticals, LLC | Composition and method to alleviate joint pain using low molecular weight hyaluronic acid and astaxanthin |
| CN103641896B (zh) * | 2009-11-19 | 2015-08-05 | 浙江大学 | 明胶样单元的用途 |
| EP2566516B1 (en) * | 2010-05-03 | 2019-07-03 | aTyr Pharma, Inc. | Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of seryl-trna synthetases |
| DE102010060564A1 (de) | 2010-11-15 | 2012-05-16 | Gelita Ag | Verwendung von Kollagenhydrolysat zur Verbesserung der Gesundheit der menschlichen Haut, Haare und/oder Nägel |
| US9040484B2 (en) | 2011-04-26 | 2015-05-26 | The Board Of Trustees Of The Leland Stanford Junior University | Production and delivery of a stable collagen |
| EP2753704A4 (en) | 2011-08-03 | 2015-07-08 | Lotus Tissue Repair Inc | COLLAGEN 7 AND ASSOCIATED METHODS |
| TWI592421B (zh) | 2011-08-09 | 2017-07-21 | 双美生物科技股份有限公司 | 一種三重交聯之膠原蛋白、製造方法及其用途 |
| AU2012312170C1 (en) | 2011-09-21 | 2018-01-04 | Shiseido Company, Ltd. | Compositions and methods for treating conditions of compromised skin barrier function |
| US9591853B2 (en) | 2013-01-07 | 2017-03-14 | Ramot At Tel-Aviv University Ltd. | Jellyfish-derived polymer |
| WO2014146175A1 (en) * | 2013-03-21 | 2014-09-25 | Commonwealth Scientific And Industrial Research Organisation | Purification of triple helical proteins |
| CN105764920B (zh) | 2013-09-09 | 2020-07-24 | 联邦科学工业研究组织 | 修饰的细菌胶原蛋白样蛋白 |
| RU2016110800A (ru) | 2013-09-25 | 2017-10-30 | Пронутриа Биосайенсис, Инк. | Составы и композиции для поддержания и увеличения мышечной массы, силы и результативности, и способы их производства и использования |
| US10232008B1 (en) | 2015-10-05 | 2019-03-19 | Michael P. Moran | Multi-purpose nutritional supplement composition |
| CN113797119A (zh) | 2015-11-09 | 2021-12-17 | 株式会社资生堂 | 用于在皮肤上应用的组合物和方法 |
| GB201601136D0 (en) | 2016-01-21 | 2016-03-09 | Mörgelin Matthias And Abdillahi Suado M | Novel polypeptides and medical uses thereof |
| US10226550B2 (en) | 2016-03-11 | 2019-03-12 | Brigham Young University | Cationic steroidal antimicrobial compositions for the treatment of dermal tissue |
| MX2018011162A (es) | 2016-03-16 | 2018-11-22 | Phoenix Tissue Repair Inc | Metodos de purificacion de colageno 7. |
| CN106554410B (zh) | 2016-06-02 | 2019-11-26 | 陕西东大生化科技有限责任公司 | 一种重组人源胶原蛋白及其编码基因和制备方法 |
| CN106119322B (zh) | 2016-07-22 | 2019-10-15 | 江苏江山聚源生物技术有限公司 | 一种提高重组人源胶原蛋白生产水平的发酵工艺 |
| WO2018041684A1 (de) | 2016-08-30 | 2018-03-08 | Gelita Ag | Verwendung von kollagenhydrolysat zur verbesserung der ausdauerleistungsfähigkeit und zur stimulation des fettabbaus |
| FR3058142B1 (fr) | 2016-10-28 | 2023-11-24 | Gelatines Weishardt | Composition de peptides de collagene de peau de poisson et son utilisation a titre de medicament |
| CL2016003387A1 (es) | 2016-12-29 | 2018-10-12 | Univ De Santiago De Chile Usach | Recubrimiento y/o película comestible para la conservación de productos cárneos |
| WO2019023555A1 (en) | 2017-07-28 | 2019-01-31 | Evelo Biosciences, Inc. | POLYMER COMPOSITIONS |
| WO2019046943A1 (en) | 2017-09-06 | 2019-03-14 | University Of Ottawa | PROTEINS OF THE COLLAGEN TYPE |
| GB201717134D0 (en) | 2017-10-18 | 2017-12-06 | Univ Swansea | Monomeric collagen |
| DE102018104590A1 (de) | 2018-02-28 | 2019-08-29 | Gelita Ag | Nutrazeutische oder pharmazeutische Zusammensetzung |
| SG11202110982WA (en) * | 2019-04-01 | 2021-10-28 | Geltor Inc | Topical formulations of recombinant collagens |
| WO2020247438A1 (en) | 2019-06-03 | 2020-12-10 | Vital Proteins LLC | Recover dietary supplement |
| GB2610313B (en) * | 2020-01-24 | 2024-07-03 | Geltor Inc | Animal-free dietary collagen |
-
2021
- 2021-01-22 GB GB2212264.2A patent/GB2610313B/en active Active
- 2021-01-22 AU AU2021211721A patent/AU2021211721A1/en active Pending
- 2021-01-22 CA CA3168802A patent/CA3168802A1/en active Pending
- 2021-01-22 MX MX2022009036A patent/MX2022009036A/es unknown
- 2021-01-22 TW TW110102587A patent/TW202134267A/zh unknown
- 2021-01-22 BR BR112022014586A patent/BR112022014586A2/pt unknown
- 2021-01-22 JP JP2022545046A patent/JP7794745B2/ja active Active
- 2021-01-22 CN CN202180022766.8A patent/CN115298212A/zh active Pending
- 2021-01-22 WO PCT/US2021/014714 patent/WO2021150959A1/en not_active Ceased
- 2021-01-22 EP EP21745159.0A patent/EP4093761A4/en active Pending
- 2021-02-09 US US17/171,874 patent/US11174300B2/en active Active
- 2021-10-04 US US17/493,627 patent/US11332505B2/en active Active
-
2022
- 2022-04-06 US US17/714,896 patent/US20220332775A1/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004052910A1 (en) * | 2002-11-14 | 2004-06-24 | Affiliated Hospital Of Academy Of Military Medical Sciences, Pla | A full-length polynucleotide coding chicken type ii collagen and the use of it |
| US20150175969A1 (en) * | 2012-09-26 | 2015-06-25 | Fujifilm Corporation | Polypeptide, scaffold composition, composition for cartilage tissue restoration, composition for cartilage cell culture, and composition for promoting glycosaminoglycan production |
| WO2019068018A2 (en) * | 2017-09-28 | 2019-04-04 | Geltor, Inc. | RECOMBINANT COLLAGEN AND ELASTIN MOLECULES AND USES THEREOF |
| WO2019103981A1 (en) * | 2017-11-22 | 2019-05-31 | Geltor Inc. | Methods and systems for engineering collagen |
Non-Patent Citations (1)
| Title |
|---|
| See also references of EP4093761A4 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11174300B2 (en) | 2020-01-24 | 2021-11-16 | Geltor, Inc. | Animal-free dietary collagen |
| US11332505B2 (en) | 2020-01-24 | 2022-05-17 | Geltor, Inc. | Animal-free dietary collagen |
| WO2023009673A1 (en) * | 2021-07-28 | 2023-02-02 | Geltor, Inc. | Animal-free cosmetic collagens |
| EP4376872A4 (en) * | 2021-07-28 | 2025-10-29 | Geltor Inc | Pharmaceutical compositions and methods for treating connective tissue disorders with collagen polypeptides |
| EP4376951A4 (en) * | 2021-07-28 | 2026-04-29 | Geltor Inc | COSMETIC COLLAGENS OF NON-ANIMAL ORIGIN |
| US12570723B2 (en) * | 2023-04-10 | 2026-03-10 | Shandong D-nutrimec Biomedical Co., Ltd. | Recombinant humanized collagen type III alpha-1, and expression vector and use thereof |
| WO2024238910A1 (en) * | 2023-05-17 | 2024-11-21 | Htl Biotechnology Innovation, Inc. | Collagen production process |
| CN118255873A (zh) * | 2024-04-30 | 2024-06-28 | 安徽中生安兰健康产业有限公司 | 重组人源iii型胶原蛋白及基因、表达载体、菌和应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| JP7794745B2 (ja) | 2026-01-06 |
| CA3168802A1 (en) | 2021-07-29 |
| US20220017581A1 (en) | 2022-01-20 |
| MX2022009036A (es) | 2022-11-14 |
| GB202212264D0 (en) | 2022-10-05 |
| US11332505B2 (en) | 2022-05-17 |
| JP2023513435A (ja) | 2023-03-31 |
| BR112022014586A2 (pt) | 2022-09-13 |
| CN115298212A (zh) | 2022-11-04 |
| US20220332775A1 (en) | 2022-10-20 |
| GB2610313A (en) | 2023-03-01 |
| AU2021211721A1 (en) | 2022-08-18 |
| GB2610313B (en) | 2024-07-03 |
| EP4093761A1 (en) | 2022-11-30 |
| US11174300B2 (en) | 2021-11-16 |
| EP4093761A4 (en) | 2024-04-17 |
| TW202134267A (zh) | 2021-09-16 |
| US20210277075A1 (en) | 2021-09-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11174300B2 (en) | Animal-free dietary collagen | |
| JP5894341B2 (ja) | コラーゲンペプチド、エラスチンペプチドおよびプロテオグリカンを含む組成物 | |
| KR20090089411A (ko) | 콜라겐 펩티드 조성물 및 이것을 함유하는 음식품 | |
| KR20120024646A (ko) | 혈중 이행성이 높은 콜라겐 펩티드 조성물 및 이것을 함유하는 음식품 | |
| JP5712393B2 (ja) | コラーゲン類吸収促進剤及びその利用 | |
| JP6259209B2 (ja) | コラーゲン産生促進剤 | |
| JP5027361B2 (ja) | ヒアルロン酸産生促進剤 | |
| US20210128640A1 (en) | Hyaluronic acid production promoting agent | |
| CN111093770A (zh) | 健康促进组合物和使用补剂方法的相关应用 | |
| JP2007261999A (ja) | ローヤルゼリー由来の降圧ペプチド | |
| JP2006143671A (ja) | 経口用皮膚老化予防・改善剤。 | |
| JP2024074955A (ja) | ペプチド、組成物及び気分障害を治療、予防、又は改善する方法 | |
| JP5394644B2 (ja) | アスペルロシドまたはその類縁体を含む筋肉増強剤 | |
| JP7060890B2 (ja) | ヒアルロン酸産生促進剤 | |
| JP7220457B2 (ja) | ヒアルロン酸産生促進剤、関節機能改善剤、及び経口用組成物 | |
| JP6456032B2 (ja) | Sirt1活性化剤および当該Sirt1活性化剤の利用 | |
| JP7677804B2 (ja) | エラスチン産生促進剤及び細胞の遊走促進剤 | |
| JP6779851B2 (ja) | ヒアルロン酸産生促進剤 | |
| JP6547183B2 (ja) | トリテルペンを有効成分として含有する変形性関節症の予防又は治療の為の組成物 | |
| JP7539533B2 (ja) | 髪の外観改善用組成物 | |
| JP6629469B1 (ja) | コンドロイチン硫酸含有ブタ軟骨抽出物を有効成分とする血圧上昇抑制剤およびそれを含有する食品組成物 | |
| JP6091067B2 (ja) | 細胞賦活剤およびその用途 | |
| JP2023067042A (ja) | 歩行機能における動的バランスの改善剤、転倒不安感の軽減剤および移動機能の低下を有する人に対する歩行機能改善剤 | |
| JP2025152733A (ja) | 環状ペプチド、その生産方法、及びその利用 | |
| KR101617770B1 (ko) | 장 내 기생 선충에서 유래한 T.s 15-1 단백질을 유효성분으로 포함하는 피부 노화 억제 또는 상처 치료용 조성물 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21745159 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3168802 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2022545046 Country of ref document: JP Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112022014586 Country of ref document: BR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202217045693 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 2021211721 Country of ref document: AU Date of ref document: 20210122 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 202212264 Country of ref document: GB Kind code of ref document: A Free format text: PCT FILING DATE = 20210122 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2212264.2 Country of ref document: GB |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2021745159 Country of ref document: EP Effective date: 20220824 |
|
| ENP | Entry into the national phase |
Ref document number: 112022014586 Country of ref document: BR Kind code of ref document: A2 Effective date: 20220722 |
|
| WWP | Wipo information: published in national office |
Ref document number: 2212264.2 Country of ref document: GB |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2212264.2 Country of ref document: GB |