WO2021108755A2 - Microdystrophin gene therapy constructs and uses thereof - Google Patents

Microdystrophin gene therapy constructs and uses thereof Download PDF

Info

Publication number
WO2021108755A2
WO2021108755A2 PCT/US2020/062484 US2020062484W WO2021108755A2 WO 2021108755 A2 WO2021108755 A2 WO 2021108755A2 US 2020062484 W US2020062484 W US 2020062484W WO 2021108755 A2 WO2021108755 A2 WO 2021108755A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
seq
acid sequence
aav
dystrophin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/062484
Other languages
English (en)
French (fr)
Other versions
WO2021108755A3 (en
Inventor
Chunping Qiao
Devin MCDOUGALD
Ye Liu
Olivier Danos
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Regenxbio Inc
Original Assignee
Regenxbio Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to JP2022531343A priority Critical patent/JP7822933B2/ja
Priority to KR1020227021099A priority patent/KR20220107222A/ko
Priority to MX2022006427A priority patent/MX2022006427A/es
Priority to EP20845454.6A priority patent/EP4065596A2/en
Priority to CA3159516A priority patent/CA3159516A1/en
Priority to AU2020392243A priority patent/AU2020392243A1/en
Priority to BR112022009895A priority patent/BR112022009895A2/pt
Priority to IL293334A priority patent/IL293334A/en
Application filed by Regenxbio Inc filed Critical Regenxbio Inc
Priority to US17/778,651 priority patent/US20230270886A1/en
Publication of WO2021108755A2 publication Critical patent/WO2021108755A2/en
Publication of WO2021108755A3 publication Critical patent/WO2021108755A3/en
Anticipated expiration legal-status Critical
Priority to US19/234,261 priority patent/US20250367328A1/en
Priority to US19/234,243 priority patent/US20250367326A1/en
Priority to US19/234,245 priority patent/US20250367327A1/en
Priority to JP2025175606A priority patent/JP2026027271A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4707Muscular dystrophy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/76Viruses; Subviral particles; Bacteriophages
    • A61K35/761Adenovirus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4707Muscular dystrophy
    • C07K14/4708Duchenne dystrophy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/035Animal model for multifactorial diseases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14151Methods of production or purification of viral material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14171Demonstrated in vivo effect
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/22Vectors comprising a coding region that has been codon optimised for expression in a respective host
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/008Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/42Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA

Definitions

  • dystrophinopathies A group of neuromuscular diseases called dystrophinopathies are caused by mutations in the DMD gene. Each dystrophinopathy has a distinct phenotype, with all patients suffering from muscle weakness and ultimately cardiomyopathy with ranging severity.
  • Duchenne muscular dystrophy (DMD) is a severe, X-linked, progressive neuromuscular disease affecting approximately one in 3,600 to 9,200 live male births. The disorder is caused by frameshift mutations in the dystrophin gene abolishing the expression of the dystrophin protein. Due to the lack of the dystrophin protein, skeletal muscle, and ultimately heart and respiratory muscles (e.g., intercostal muscles and diaphragm), degenerate causing premature death. Progressive weakness and muscle atrophy begin in childhood.
  • BMD Becker muscular dystrophy
  • Dystrophin is a cytoplasmic protein encoded by the DMD gene, and functions to link cytoskeletal actin filaments to membrane proteins. Normally, the dystrophin protein, located primarily in skeletal and cardiac muscles, with smaller amounts expressed in the brain, acts as a shock absorber during muscle fiber contraction by linking the actin of the contractile apparatus to the layer of connective tissue that surrounds each muscle fiber. In muscle, dystrophin is localized at the cytoplasmic face of the sarcolemma membrane.
  • the DMD gene is the largest known human gene.
  • the most common mutations that cause DMD or BMD are large deletion mutations of one or more exons (60-70%), but duplication mutations (5-10%), and single nucleotide variants (including small deletions or insertions, single-base changes, and splice site changes accounting for approximately 25-35% of pathogenic variants in males with DMD and about 10-20% of males with BMD), can also cause pathogenic dystrophin variants.
  • mutations often lead to a frame shift resulting in a premature stop codon and a truncated, non-functional or unstable protein. Nonsense point mutations can also result in premature termination codons with the same result.
  • full-length dystrophin is a large (427 kDa) protein comprising a number of subdomains that contribute to its function. These subdomains include, in order from the amino-terminus toward the carboxy-terminus, the N-terminal actin- binding domain, a central so-called “rod” domain, a cysteine-rich domain and lastly a carboxy-terminal domain or region.
  • the rod domain is comprised of 4 proline- rich hinge domains (abbreviated H), and 24 spectrin-like repeats (abbreviated R) in the following order: a first hinge domain (H1), 3 spectrin-like repeats (R1, R2, R3), a second hinge domain (H2), 16 more spectrin-like repeats (R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, R16, R17, R18, R19), a third hinge domain (H3), 5 more spectrin-like repeats (R20, R21, R22, R23, R24), and a fourth hinge domain (H4) (including the WW domain).
  • H proline- rich hinge domains
  • R spectrin-like repeats
  • AAV adeno-associated virus
  • AAV-mediated minidystrophin gene therapy in mdx mice was reported as exhibiting efficient expression in muscle and improved muscle function (See, e.g., Wang et al., J. Orthop. Res. 27:421 (2009)).
  • AAV vectors encoding micro- or mini- dystrophins that can be expressed at effective levels in transduced cells of subjects with DMD or BMD and preferably minimizing immune responses to the therapeutic protein.
  • microdystrophin gene constructs and expression cassettes were engineered for improved therapy with respect to efficacy, potency and safety to the subject when expressed by a viral vector in muscle cells and/or CNS cells.
  • the microdystrophin gene therapies of the present disclosure showed measured improvements in grip strength, maximal and specific muscle force and/or reduction in organ and muscle weight.
  • improved gene therapy vectors for example, recombinant AAV vectors, such as recombinant AAV8 or AAV9 vectors, comprising these constructs for gene therapy expression of the microdystrophin proteins, and methods of using these gene therapy vectors in therapeutic methods and methods of making these gene therapy vectors as described herein.
  • microdystrophin proteins and nucleic acid constructs encoding same that comprise the N-terminal actin binding domain and a subset of the hinge, rod and spectrin domains, followed by the cysteine-rich domain and, optionally, all or a portion, for example, a helix 1-containing portion, of the C- terminal domain.
  • the microdystrophin has all or a portion of the C-terminal domain, or an ⁇ 1-syntrophin and/or ⁇ -dystrobrevin binding portion thereof.
  • Microdystrophins having a C-terminal domain, or an ⁇ 1- syntrophin and/or ⁇ -dystrobrevin binding portion thereof, may have improved cardio-protective activity and/or result in improvement in or decrease/delay the progression of weakened cardiac muscle function.
  • Exemplary microdystrophins encoding constructs are illustrated in FIGS. 1A and 22.
  • Embodiments described herein are a microdystrophin protein having from amino-terminus to the carboxy terminus: [0013] ABD-H1-R1-R2-R3-H3-R24-H4-CR, [0014] ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT [0015] ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT, or [0016] ABD-H1-R1-R2-R16-R17-R24-H4-CR, [0017] wherein ABD is an actin-binding domain of dystrophin, H1 is a hinge 1 region of dystrophin, R1 is a spectrin 1 region of dystrophin, R2 is a spectrin 2 region of dystrophin, R3 is a spectrin 3 region of dystrophin, H3 is a hinge 3 region of dystrophin, R16 is a spectrin
  • the CT domain has an amino acid sequence of SEQ ID NO: 35, 70, or 83.
  • the H3 domain is the entire sequence of SEQ ID NO: 11.
  • the CR domain may be the full length CR domain or a shortened CR domain, particularly a shortened CR domain which binds ⁇ -dystroglycan.
  • the CR domain has an amino acid sequence of SEQ ID NO: 15 or 90.
  • endogenous linker sequences link domains, for example, all or a 3 amino acid portion of the linker between R23 and R24 in the endogenous human dystrophin protein, link the H3 domain and the R24 domain.
  • H3 can be substituted with hinge 2 region of dystrophin (H2).
  • the microdystrophins provided herein exhibit dystrophin functions (see FIG. 13), such as (1) binding to one of, a combination of, or all of actin, ⁇ - dystroglycan, ⁇ 1-syntrophin, ⁇ -dystrobrevin, and nNOS (including nNOS binding indirectly via ⁇ 1-syntrophin); (2) promoting improved muscle function or slowing in the progression of reduction in muscle function in an animal model (for example, in the mdx mouse model described herein) or in human subjects; and/or (3) having a cardioprotective function or promoting improvement in cardiac muscle function or attenuation of cardiac dysfunction or slowing the progression of degeneration of cardiac function in animal models or human patients.
  • the microdystrophin has an amino acid sequence of SEQ ID NOs: 1, 2, 79, 91, 92, or 93.
  • nucleic acids encoding microdystrophins including transgenes or gene cassettes for use in gene therapy.
  • the microdystrophins are encoded by a nucleotide sequence of SEQ ID NOs: 20, 21, 81, 101, 102, or 103 or any nucleotide sequence encoding the amino acid sequence of SEQ ID NOs: 1, 2, 79, 91, 92, or 93. Exemplary constructs are illustrated in FIGS. 1A and 22.
  • the constructs include an intron 5’ of the microdystrophin encoding sequence.
  • the intron is less than 100 nucleotides in length.
  • the constructs include the human immunoglobulin heavy chain variable region (VH) 4 (VH4) intron and the intron is located 5’ of the microdystrophin encoding sequence. The presence of the VH4 intron may lead to improved expression of the microdystrophin in cells relative to expression from nucleic acid constructs not having the VH4 intron.
  • VH human immunoglobulin heavy chain variable region
  • the transgenes provided herein contain promoters that drive expression of the microdystrophin in appropriate cell types, such as muscle cells (including skeletal muscle, cardiac muscle, and/or smooth muscle) and/or CNS cells. Reducing the size of transgenes used in gene therapy, such as with recombinant AAV vector therapy, may improve the efficacy and efficiency of the recombinant AAV vectors.
  • the promoter is a muscle- specific promoter, CNS specific promoter, or both.
  • the promoter is a muscle-specific promoter that is less than 350 kb in length.
  • the promoter is an SPc5-12 promoter (SEQ ID NO: 39).
  • transgenes in which the promoter is a truncated SPc5-12 promoter (SEQ ID NO: 40) that directs expression of the microdystrophin and is shorter than the SPc5-12 promoter as described more fully herein.
  • the promoter is a CNS specific promoter.
  • transgenes or gene cassettes in which the microdystrophin coding sequence has been codon optimized for increased expression.
  • the microdystrophin coding sequences and/or the transgene sequences may be depleted of CpG to reduce immunogenicity.
  • the microdystrophin transgene has fewer than two (2) CpG islands, or one (1) CpG island (in particular, as defined herein) and in certain embodiments has no CpG islands.
  • the transgene with fewer than 2, 1 or has 0 CpG islands has reduced immunogenicity as measured by anti-drug antibody titer compared to microdystrophin constructs having more than 2 CpG islands.
  • nucleic acids comprising nucleotide sequences of SEQ ID NO: 53, 54, 55, 56, 82, 104, 105, or 106 which encode exemplary gene cassettes or transgenes.
  • the recombinant vector for delivering the transgenes described herein includes non-replicating recombinant adeno-associated virus vectors (rAAV), and may be of an AAV8 or AAV9 serotype or any other serotype appropriate for delivery of the microdystrophin coding sequences to muscle cells, including both skeletal muscle and cardiac muscle, and/or CNS cells which will express the microdystrophin and provide additional benefit to the patient, and/or deliver to muscle cells.
  • rAAV non-replicating recombinant adeno-associated virus vectors
  • compositions comprising the recombinant vectors encoding the microdystrophins provided herein, including with a pharmaceutically acceptable excipient and methods of treatment for any dystrophinopathy, such as for Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD), X-linked dilated cardiomyopathy, as well as DMD or BMD female carriers, by administration of the gene therapy vectors described herein to a subject in need thereof.
  • DMD Duchenne muscular dystrophy
  • BMD Becker muscular dystrophy
  • X-linked dilated cardiomyopathy as well as DMD or BMD female carriers
  • a dystrophinopathy such as Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD), X-linked dilated cardiomyopathy by administration of an rAAV containing a transgene or gene cassette described herein, by administration to a subject in need thereof such that the microdystrophin is delivered to the muscle (including skeletal muscle, cardiac muscle, and/or smooth muscle) and/or the CNS.
  • the rAAV is administered systemically.
  • a method of producing recombinant AAVs comprising culturing a host cell containing an artificial genome comprising a cis expression cassette flanked by AAV ITRs, wherein the cis expression cassette comprises a transgene encoding a therapeutic microdystrophin operably linked to expression control elements that will control expression of the transgene in human cells; a trans expression cassette lacking AAV ITRs, wherein the trans expression cassette encodes an AAV rep and capsid protein operably linked to expression control elements that drive expression of the AAV rep and capsid proteins in the host cell in culture and supply the rep and cap proteins in trans; sufficient adenovirus helper functions to permit replication and packaging of the artificial genome by the AAV capsid proteins; and recovering recombinant AAV encapsidating the artificial genome from the cell culture.
  • a nucleic acid composition comprising a nucleic acid sequence encoding a microdystrophin protein wherein the microdystrophin protein comprises or consists of dystrophin domains arranged from amino-terminus to the carboxy terminus: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, wherein ABD is an actin- binding domain of dystrophin, H1 is a hinge 1 region of dystrophin, R1 is a spectrin 1 region of dystrophin, R2 is a spectrin 2 region of dystrophin, R3 is a spectrin 3 region of dystrophin, H3 is a hinge 3 region of dystrophin, R24 is a spectrin 24 region of dystrophin, H4 is hinge 4
  • nucleic acid composition of embodiment 1 (1) comprising a nucleic acid sequence encoding the microdystrophin protein with an amino acid sequence of SEQ ID NO: 1 or 91, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof encoding a therapeutically functional microdystrophin protein, or (2) comprising or consisting of a nucleic acid sequence of SEQ ID NO: 20 or 100 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof, wherein the nucleic acid sequence encodes a therapeutically functional microdystrophin protein. 3.
  • nucleic acid composition of embodiment 1 (1) comprising a nucleic acid sequence encoding the microdystrophin protein with an amino acid sequence of SEQ ID NO: 79 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof encoding a therapeutically functional microdystrophin protein, or (2) comprising or consisting of a nucleic acid sequence of SEQ ID NO: 81 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof, wherein the nucleic acid encodes a therapeutically functional microdystrophin protein. 4.
  • a nucleic acid composition comprising a nucleic acid sequence comprising an intron (I) coupled to the 5’ end of a nucleic acid sequence encoding a microdystrophin protein, wherein the microdystrophin protein comprises or consists of dystrophin domains arranged from amino-terminus to the carboxy terminus: ABD-H1-R1-R2-R3-H3-R24-H4-CR, wherein ABD is an actin-binding domain of dystrophin, H1 is a hinge 1 region of dystrophin, R1 is a spectrin 1 region of dystrophin, R2 is a spectrin 2 region of dystrophin, R3 is a spectrin 3 region of dystrophin, H3 is a hinge 3 region of dystrophin, R24 is a spectrin 24 region of dystrophin, H4 is hinge 4 region of dystrophin, CR is a cysteine-rich region of dystrophin.
  • ABD is an actin-binding
  • nucleic acid composition of embodiment 4 (1) comprising a nucleic acid sequence encoding the microdystrophin protein with an amino acid sequence of SEQ ID NO: 2 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof or (2) comprising or consisting of a nucleic acid sequence of SEQ ID NO: 21 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof, wherein the nucleic acid encodes a therapeutically functional dystrophin. 6.
  • the nucleic acid composition of embodiments 1 to 3 further comprising an intron (I) coupled to the 5’ end of the nucleic acid sequence encoding the microdystrophin protein. 7.
  • nucleic acid composition of embodiment 7, wherein the nucleic acid sequence encoding the VH4 intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 41 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof and increases microdystrophin expression relative to a reference nucleic acid lacking the VH4 intron sequence; wherein the nucleic acid sequence encoding a chimeric intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 75 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof and increases microdystrophin expression relative to a reference nucleic acid lacking the chimeric intron sequence; or wherein the nucleic acid sequence encoding a SV40 intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 76 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof and increases microdystrophin
  • nucleic acid composition of any of embodiments 1-3 or 6-8 wherein the nucleic acid sequence encoding the CT domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 35 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof and increases binding of the microdystrophin to ⁇ ⁇ ⁇ syntrophin, ⁇ -syntrophin, and/or dystrobrevin relative to a reference microdystrophin lacking the CT domain sequence; wherein the nucleic acid sequence encoding the CT domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 70 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof and increases binding of the microdystrophin to ⁇ ⁇ ⁇ syntrophin, ⁇ -syntrophin, and/or dystrobrevin relative to a reference microdystrophin lacking the CT domain sequence; or wherein the nucleic acid sequence
  • nucleic acid composition of embodiment 9 wherein the CT domain has an amino acid sequence of SEQ ID NO: 16 or 83 or comprises the amino acid sequence of SEQ ID NO: 84.
  • nucleic acid composition of any of the foregoing embodiments wherein the nucleic acid sequence encoding the CR domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 34 or 69 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof and increases binding of the microdystrophin to ⁇ ⁇ dystroglycan relative to a reference microdystrophin lacking the CR domain sequence; wherein the nucleic acid sequence encoding the CR domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 100 or 109 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof and increases binding of the microdystrophin to ⁇ ⁇ dystroglycan relative to a reference microdys
  • nucleic acid composition of embodiment 11, wherein the CR domain has an amino acid sequence of SEQ ID NO: 15 or 90.
  • the nucleic acid composition of any one of the foregoing embodiments wherein the nucleic acid sequence encoding ABD consists of SEQ ID NO: 22 or 57 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 22 or 57; the nucleic acid sequence encoding H1 consists of SEQ ID NO: 24 or 59 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 24 or 59; the nucleic acid sequence encoding R1 consists of SEQ ID NO: 26 or 61 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at
  • nucleic acid composition of any one of the foregoing embodiments wherein the nucleic acid sequence that encodes ABD consists of SEQ ID NO: 22 or 57; the nucleic acid sequence that encodes H1 consists of SEQ ID NO: 24 or 59; the nucleic acid sequence that encodes R1 consists of SEQ ID NO: 26 or 61; the nucleic acid sequence that encodes R2 consists of SEQ ID NO: 27 or 62; the nucleic acid sequence that encodes R3 consists of SEQ ID NO: 29 or 64; the nucleic acid sequence that encodes H2 consists of SEQ ID NO: 38; the nucleic acid sequence that encodes H3 consists of SEQ ID NO: 30 or 65; the nucleic acid sequence that encodes H4 consists of SEQ ID NO: 33 or 68; the nucleic acid sequence that encodes R24 consists of SEQ ID NO: 32 or 67; the nucleic acid sequence that encodes CR consists of SEQ ID NO: 34, 69,
  • micro dystrophin protein comprises or consists of dystrophin sequences arranged from amino-terminus to the carboxy terminus: ABD-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24-H4-CR-CT or ABD-L1-H1-L2-R1- R2-L3-R3-H3-L4-R24-H4-CR., wherein L1, L2, L3, and L4 are linkers. 16.
  • nucleic acid composition of any one of the foregoing embodiments wherein the nucleic acid sequences encoding L1 comprise or consist of SEQ ID NO: 23 or 58, L2 comprise or consist of SEQ ID NO: 25 or 60, L3 comprise or consist of SEQ ID NO: 28 or 63, and L4 comprise or consist of SEQ ID NO: 31, 36, 37, 66, 71 or 72. 17.
  • a nucleic acid composition comprising a nucleic acid sequence encoding a microdystrophin protein, wherein the microdystrophin protein comprises or consists of dystrophin domains arranged from amino-terminus to the carboxy terminus: ABD-H1-R1-R2-R16-R17-R24-H4-CR, wherein ABD is an actin-binding domain of dystrophin, H1 is a hinge 1 region of dystrophin, R1 is a spectrin 1 region of dystrophin, R2 is a spectrin 2 region of dystrophin, R16 is a spectrin 16 region of dystrophin, R17 is a spectrin 17 region of dystrophin, R24 is a spectrin 24 region of dystrophin, H4 is hinge 4 region of dystrophin, and CR is a cysteine-rich region of dystrophin 18.
  • nucleic acid composition of embodiment 17 (1) comprising a nucleic acid sequence encoding the microdystrophin protein with an amino acid sequence of SEQ ID NO: 93 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof or (2) comprising or consisting of a nucleic acid sequence of SEQ ID NO: 103 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof, wherein the nucleic acid encodes a therapeutically functional microdystrophin. 19.
  • nucleic acid composition of any one of embodiment 19 (1) comprising a nucleic acid sequence encoding the microdystrophin protein with an amino acid sequence of SEQ ID NO: 92 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof or (2) comprising or consisting of a nucleic acid sequence of SEQ ID NO: 102 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof, wherein the nucleic acid encodes a therapeutically functional microdystrophin. 21.
  • nucleic acid composition of embodiment 19 or 20, wherein the nucleic acid sequence encoding the CT domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 35 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof and increases binding of the microdystrophin to ⁇ 1-syntrophin, ⁇ -syntrophin, and/or dystrobrevin relative to a reference microdystrophin lacking the CT domain sequence; wherein the nucleic acid sequence encoding the CT domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 70 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof and increases binding of the microdystrophin to ⁇ 1-syntrophin, ⁇ -syntrophin, and/or dystrobrevin relative to a reference microdystrophin lacking the CT domain sequence; or wherein the nucleic acid sequence encoding a minimal CT domain or consists
  • nucleic acid composition of embodiments 17 to 23 further comprising an intron (I) coupled to the 5’ end of the nucleic acid sequence encoding the microdystrophin protein.
  • I is the human immunoglobin heavy chain variable region (VH) 4 intron (VH4) or the SV40 intron or the chimeric intron located 5’ of the microdystrophin encoding sequence.
  • nucleic acid composition of any one of the foregoing embodiments wherein the nucleic acid is a nucleic acid vector comprising a transcription regulatory element that promotes expression in muscle and/or CNS tissue operably linked to the nucleic acid sequence coding for the microdystrophin protein.
  • the transcription regulatory element comprises a muscle-specific promoter, optionally, skeletal, smooth, or/or cardiac muscle specific promoter.
  • the promoter is SPc5-12 or a transcriptionally active portion thereof.
  • the nucleic acid composition of embodiment 31, wherein the promoter consists of nucleic acid sequence of SEQ ID NO: 39 or 40. 33.
  • the promoter is a CB7 promoter, cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, MMT promoter, EF-1 alpha promoter (SEQ ID NO: 118), UB6 promoter, chicken beta-actin promoter, CAG promoter (SEQ ID NO: 116), RPE65 promoter, opsin promoter, TBG (Thyroxine-binding Globulin) promoter, APOA2 promoter, SERPINA1 (hAAT) promoter, MIR122 promoter, or an inducible promoter such as a hypoxia-inducible or rapamycin-inducible promoter.
  • the muscle-specific transcriptional regulatory element is one of a CK1 promoter, a CK4 promoter, a CK5 promoter, a CK6 promoter, a CK7 promoter, a CK8 promoter (SEQ ID NO: 115), a MCK promoter (or truncated form thereof) (SEQ ID NO: 121), a desmin promoter (SEQ ID NO: 119), a MHCK7 promoter (SEQ ID NO: 120), an enh358MCK promoter, a dMCK promoter, or a tMCK promoter. 36.
  • nucleic acid composition of any of the foregoing embodiments which has fewer than 2, or 1 CpG islands, or has no CpG islands.
  • 41. The nucleic acid composition of embodiment 40, which exhibits reduced immunogenicity when administered to a human subject as measured by anti-drug antibody titer compared to a microdystrophin construct having more than 0 CpG islands. 42.
  • nucleic acid composition of any one of the foregoing embodiments comprising a nucleic acid sequence of SEQ ID NO: 53, 54, 55, 56, 82, 104, 105, or 106 43.
  • the nucleic acid composition of any one of the foregoing embodiments comprising an AAV vector nucleotide sequence comprising an AAV ITR at the 5’ and 3’ ends of the nucleic acid sequence, wherein the AAV ITR is optionally AAV2 ITR. 44.
  • a rAAV particle comprising an expression cassette comprising the nucleic acid composition of any one of the foregoing embodiments. 46.
  • the rAAV particle of embodiment 45 which has a capsid protein from at least one AAV type selected from AAV type 1 (AAV1), type 2 (AAV2), type 3 (AAV3), type 4 (AAV4), type 5 (AAV5), type 6 (AAV6), type 7 (AAV7), type 8 (AAV8), type rh8 (AAVrh8), type 9 (AAV9), type PHP.B (AAVPHP.B), type hu37 (AAV.hu37), type hu31 (AAV.hu31), type hu32 (AAV.hu32), type rh10 (AAVrh10), type rh20 (AAVrh20), type rh39 (AAVrh39), and type rh74 (AAVrh74).
  • AAV type 1 AAV1
  • AAV2 AAV2
  • the rAAV particle of embodiment 45 or 46, wherein said capsid protein has an amino acid sequence that is at least 95% identical to SEQ ID NO: 77 (AAV8 capsid) or has an amino acid sequence of SEQ ID NO: 77.
  • the rAAV particle of embodiment 45 or 46, wherein said capsid protein has an amino acid sequence that is at least 95% identical to SEQ ID NO 78 (AAV9 capsid) or has an amino acid sequence of SEQ ID NO: 78.
  • a pharmaceutical composition comprising a therapeutically effective amount of an rAAV particle of any one of embodiments 45 to 48 and a pharmaceutically acceptable carrier. 50.
  • a method of delivering a transgene to a cell comprising contacting said cell with the rAAV particle of any one of embodiments 45 to 49, wherein said cell is contacted with the vector.
  • a pharmaceutical composition for treating a dystrophinopathy in a human subject in need thereof comprising a therapeutically effective amount of an rAAV particle of any one of embodiments 45 to 49, optionally wherein said rAAV particle is formulated for administration to the circulation, muscle tissue, or CNS of said subject said subject. 52.
  • a method of treating a dystrophinopathy in a human subject in need thereof comprising: administering to said subject a pharmaceutical composition comprising a therapeutically effective amount of a rAAV particle of any one of embodiments 45 to 49, so that a depot is formed in the muscle of said subject that releases a microdystrophin protein.
  • a method of preventing transmission of a dystrophinopathy to progeny of a human subject in need thereof comprising: administering to said subject a pharmaceutical composition comprising a therapeutically effective amount of a rAAV particle of any one of embodiments 45 to 49, such that the nucleic acid encoding the microdystrophin is incorporated into the germline of said subject. 54.
  • the pharmaceutical composition or the method of embodiment 55 wherein the second agent is selected from the group consisting of an antisense oligonucleotide that causes exon skipping of the DMD gene, an anti-myostatin antibody, an agent that promotes ribosomal read-through of nonsense mutations, an agent that suppresses premature stop codons, an anabolic steroid and a corticosteroid.
  • the pharmaceutical composition or method of any one of embodiments 51 to 58, wherein administration of the rAAV particle increases muscle mass or strength or maintains muscle mass or strength or reduces the likelihood of loss of muscle mass or strength. 60.
  • a microdystrophin protein comprising or consisting of dystrophin domains arranged from the amino-terminus to the carboxy terminus ABD-H1-R1- R2-R3-H3-R24-H4-CR-CT, wherein ABD is an actin-binding domain of dystrophin, H1 is a hinge 1 region of dystrophin, R1 is a spectrin 1 region of dystrophin, R2 is a spectrin 2 region of dystrophin, R3 is a spectrin 3 region of dystrophin, H3 is a hinge 3 region of dystrophin, R24 is a spectrin 24 region of dystrophin, CR is a cysteine-rich region of dystrophin, and CT is at least a portion of a C-terminal region of dystrophin comprising an ⁇ 1-syntrophin binding site, ⁇ - syntrophin binding site, and/or dystrobrevin site.
  • the microdystrophin protein of embodiment 60 comprising or consisting of an amino acid sequence of SEQ ID NOs: 1, 79, or 91.
  • ABD consists of SEQ ID NO: 3 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 3
  • H1 consists of SEQ ID NO: 5 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 5
  • R1 consists of SEQ ID NO: 7 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity
  • microdystrophin protein of any one of embodiments 60 to 67 comprising dystrophin domains arranged from the amino-terminus to the carboxy terminus: ABD-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24-H4-CR-CT, wherein L1, L2, L3, and L4 are linkers.
  • the microdystrophin protein of embodiment 68 wherein the amino acid sequences of L1, L2, L3, and L4 consist of SEQ ID NOs: 4, 6, 9, and 12, respectively. 70.
  • a microdystrophin protein comprising or consisting of dystrophin domains arranged from the amino-terminus to the carboxy terminus ABD-H1-R1- R2-R16-R17-R24-H4-CR, wherein ABD is an actin-binding domain of dystrophin, H1 is a hinge 1 region of dystrophin, R1 is a spectrin 1 region of dystrophin, R2 is a spectrin 2 region of dystrophin, R16 is a spectrin 16 region of dystrophin, R17 is a spectrin 17 region of dystrophin, R24 is a spectrin 24 region of dystrophin, and CR is a cysteine-rich region of dystrophin. 71.
  • the microdystrophin protein of embodiment 70 comprising or consisting of the amino acid sequence of SEQ ID NO: 93.
  • the microdystrophin protein of embodiment 70 comprising or consisting of dystrophin domains arranged from the amino-terminus to the carboxy terminus ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT wherein CT is at least a portion of a C-terminal region of dystrophin comprising an ⁇ ⁇ ⁇ syntrophin binding site or a dystrobrevin binding site. 73.
  • microdystrophin protein of embodiment 72 wherein the CT domain comprises or consist of the amino acid sequence of SEQ ID NO: 16 or 83 or comprises the amino acid sequence of SEQ ID NO: 84.
  • CT domain comprises or consist of the amino acid sequence of SEQ ID NO: 16 or 83 or comprises the amino acid sequence of SEQ ID NO: 84.
  • the microdystrophin protein of embodiment 72 or 73 comprising or consisting of the amino acid sequence of SEQ ID NOS: 92.
  • ABD consists of SEQ ID NO: 3 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 3;
  • H1 consists of SEQ ID NO: 5 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 5;
  • R1 consists of SEQ ID NO: 7 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 7;
  • R2 consists of SEQ ID NO: 8 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least
  • microdystrophin protein of any of embodiments 70 to 76 comprising or consisting of a CT domain at the C terminus of the CR domain wherein the CT consists of SEQ ID NOs: 16 or 83 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 16 or 83. 78.
  • microdystrophin protein of any one of embodiments 70 to 77 wherein ABD consists of SEQ ID NO: 3, H1 consists of SEQ ID NO: 5; R1 consists of SEQ ID NO: 7; R2 consists of SEQ ID NO: 8; R16 consists of SEQ ID NO: 86; R17 consists of SEQ ID NO: 87; R24 consists of SEQ ID NO: 13; H4 consists of SEQ ID NO: 14; and CR consists of SEQ ID NO: 15 or 90; and/or CT consists of SEQ ID NO: 16 or 83. 79.
  • the microdystrophin protein of any one of embodiments 70 to 80 comprising dystrophin domains arranged from the amino-terminus to the carboxy terminus: ABD-L1-H1-L2-R1-R2-L3-R16-L4.1-R17-L4.2-R24-H4-CR-CT or ABD-L1-H1-L2-R1-R2-L3-R16-L4.1-R17-L4.2-R24-H4-CR, wherein L1, L2, L3, L4.1 and L4.2 are linkers.
  • the microdystrophin protein of embodiment 80 wherein the amino acid sequences of L1, L2, L3, L4.1 and L4.2 consist of SEQ ID NOs: 4, 6, 9, 110, and 89, respectively.
  • a method of treating a dystrophinopathy in a human subject in need thereof comprising delivering to the circulation, muscle tissue and/or cerebrospinal fluid of said human subject, a therapeutically effective amount of a microdystrophin protein according to any one of embodiments 60 to 81.
  • a pharmaceutical composition for treatment of a dystrophinopathy in a human subject comprising a therapeutically effective amount of a microdystrophin protein according to any one of embodiments 60 to 81 formulated for delivery to the circulation, muscle tissue and/or cerebrospinal fluid of said human subject.
  • the method or pharmaceutical composition of embodiment 82 or 83, wherein the dystrophinopathy is DMD, BMD or X-linked dilated cardiomyopathy.
  • CT domain comprises an ⁇ 1-syntrophin binding site, a ⁇ -syntrophin binding site, and/or a dystrobrevin binding site.
  • CT domain is a truncated CT domain comprising an ⁇ 1-syntrophin binding site.
  • H4 comprises ⁇ -dystroglycan binding site.
  • a method of producing recombinant AAVs comprising: (a) culturing a host cell containing: (i) an artificial genome comprising a cis expression cassette, wherein the cis expression cassette comprises a nucleic acid composition of any one of embodiments 38 to 44; (ii) a trans expression cassette lacking AAV ITRs, wherein the trans expression cassette encodes an AAV rep and capsid protein operably linked to expression control elements that drive expression of the AAV rep and capsid proteins in the host cell in culture and supply the rep and cap proteins in trans; (iii) sufficient adenovirus helper functions to permit replication and packaging of the artificial genome by the AAV capsid proteins; and (b) recovering recombinant AAV encapsidating the artificial genome from the cell culture.
  • a host cell comprising: a. an artificial genome comprising a cis expression cassette, wherein the cis expression cassette comprises a nucleic acid composition of any one of embodiments 38 to 44; b. a trans expression cassette lacking AAV ITRs, wherein the trans expression cassette encodes an AAV rep and capsid protein operably linked to expression control elements that drive expression of the AAV rep and capsid proteins in the host cell in culture and supply the rep and cap proteins in trans; and c. sufficient adenovirus helper functions to permit replication and packaging of the artificial genome by the AAV capsid proteins. 4. BRIEF DESCRIPTION OF THE FIGURES [0028] FIGS. 1A-C. FIG.
  • FIGS. 1A illustrate vector gene expression cassettes and microdystrophin constructs for use in a Cis-plasmid for gene therapy. DNA length for each component and complete transgene are listed for each construct.
  • SPc5-12 synthetic muscle-specific promoter
  • Mini-SPc truncated synthetic muscle-specific promoter
  • CT1.5 truncated/minimal CT domain
  • VH4 human immunoglobin heavy chain variable region intron
  • ABD actin binding domain
  • H hinge
  • R rod
  • CR cysteine rich domain
  • CT C-terminal domain
  • smPA small polyA
  • ABD Actin Binding Domain 1 (ABD1).
  • FIGS. 2A-F depict fluorescent microscopy of differentiated C2C12 cells three days post-infection with reporter AAV vectors AAV8-GFP (A-C) and AAV8- VH4-GFP (D-F) at various dosage (indicated above the images: 5 x 10e5 vg/cell (A, D), 1 x 10e5 vg/cell (B, E), 0.2 x 10e5 vg/cell (C, F)).
  • FIG. 3 shows mean fluorescence intensity (units) of transduced C2C12 cells measured three days post infection with AAV8-GFP and AAV8-VH4-GFP vectors at three different dosages: 5 x 10e5 vg/cell, 1 x 10e5 vg/cell, and 0.2 x 10e5 vg/cell.
  • FIGS.4A-C depict fluorescent microscopy of differentiated C2C12 cells six days post infection with AAV8-CAG-GFP.
  • FIGS. 5A-H depicts in vitro potency testing of microdystrophin vector (RGX-DYS1-03, E-H) as compared to the reference control (RGX-DYS-RS, A-D) by immunofluorescent staining of dystrophin protein.
  • FIG.6 provides infectivity data in mouse muscle cell line C2C12 cells for each vector, as a measure of vector potency. Normalized data (vector copy number/reference control) for each vector batch RGX-DYS1-01, RGX-DYS1-02, RGX-DYS2-01, RGX-DYS3-01, RGX-DYS3-02, RGX-DYS4-01, and RGX- DYS1-RS are shown.
  • FIG. 7 provides microdystrophin data in mouse muscle cell line C2C12 cells for each vector from different production batches each using the same process (RGX-DYS1-01, RGX-DYS1-02, RGX-DYS2-01, RGX-DYS3-01, RGX-DYS3- 02, RGX-DYS4-01, and RGX-DYS1-RS), as a measure of mRNA expression.
  • Two different vector dosages were used to infect C2C12 cells (1e5 vg/cell and 5e4 vg/cell).
  • FIGS. 9A-B depicts mouse muscle and organ weight measurements (normalized to body weight, g/kg). Quadriceps and soleus weights are shown in FIG.
  • FIG. 9A depicts grip strength measurement (KGF/kg). *-One way ANOVA (***P ⁇ 0.001); #- t-test (### p ⁇ 0.001). The forearm muscle grip force was normalized for each mouse by muscle weight.
  • FIG. 12 Vector copy numbers (vg/diploid genome) in skeletal muscle, cardiac muscle, and liver by ddPCR method.
  • the Naica Crystal Digital PCR system from Stilla Technologies was used.
  • n 13 for each treated tissue.
  • the numbers listed are average ⁇ Stdev.
  • Vector copy number was calculated as 2X microdystrophin transgene copy number/endogenous control mouse glucagon copy number.
  • TA tibialis anterior muscle
  • EDL extensor digitorum longus.
  • FIG.14 Immunofluorescent staining on gastrocnemius muscle from mdx RGX-DYS1, mdx control, and WT control groups. Cryo-sections were stained with anti- ⁇ -dystrobrevin, anti- ⁇ -dystroglycan, anti-nNos, anti-dystrophin (anti-dys), and anti- ⁇ -syntrophin. The secondary antibody was labelled with CY3 and all sections were counterstained with DAPI before mounting.
  • FIG. 15 Western blot against dystrophin extracted from AAV- ⁇ - dystrophin vector-injected gastrocnemius muscle tissues.
  • Lanes 1 through 4 protein samples from AAV8-RGX-DYS1-injected mdx mice
  • Lanes 5 through 8 protein samples from AAV8-RGX-DYS5 injected mdx mice
  • Lanes 9 through 12 protein samples from AAV8-RGX-DYS3 injected mdx mice.
  • ⁇ 1-actin serves as the loading control in each lane.
  • Mdx (Lane 13) indicated an un-injected mdx mice.
  • mouse anti-dystrophin monoclonal antibody was used (1:100 dilution).
  • FIGS. 16A-C Quantification of ⁇ -dystrophin bands by western blot (Panel A), AAV- ⁇ -Dys vector copy numbers by ddPCR (Panel B), and quantification of ⁇ -dystrophin bands normalized by AAV- ⁇ -Dys vector copy numbers (Panel C). * p ⁇ 0.05; ** P ⁇ 0.01; ***P ⁇ 0001. [0044] FIGS.
  • 17A-B mRNA expression of ⁇ -dystrophin and wild-type (WT) dystrophin in skeletal muscles (gastrocnemius). Total RNA was extracted from the skeletal muscles and cDNA synthesized. The copies numbers of ⁇ -dystrophin, WT- dystrophin, and endogenous control Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA were measured using digital PCR (Naica Crystal Digital PCR system, Stilla technologies).
  • A. Relative ⁇ - or WT-dystrophin mRNA expression normalized by GAPDH. The ratio of WT-dystrophin to GAPDH in B6-WT skeletal muscle was considered as 1.
  • FIG.18 Gastrocnemius muscle extracted from mdx mice, tissue sections prepared and immunofluorescently (IF) stained against dystrophin and dystrophin associated protein complexes including dystrobrevin, ⁇ -dystroglycan, and syntrophin.
  • FIGS. 19A-C Syntrophin expression in skeletal muscles.
  • FIGS. 20A-C nNOS expression in skeletal muscles.
  • FIGS. 21A-E Transduction of satellite cells and amelioration of cell regeneration by AAV vector encoding ⁇ -dystrophin gene.
  • A-B RNAScope Images of RGX-DYS1-treated mdx mice (panel A) and untreated mdx mice (panel B) revealing co-expression of ⁇ -dystrophin (red) and pax7 satellite cells (green). The RNAscope multiplex fluorescent analysis of AAV transgene and Pax7 mRNA expression service was performed at Advanced Cell Diagnostics Inc (Newark, CA).
  • C
  • FIG. 22 Illustration of additional modified ⁇ -dystrophin constructs.
  • CR short Cysteine-rich domain is 150 bp shorter than in wild-type dystrophin.
  • FIGS. 23A-C In vitro infection of C2C12 myotubes with different versions of AAV8- ⁇ -dystrophin constructs. C2C12 myoblast cells were induced in differentiation media, then infected with AAV vectors.
  • the cells were harvested five days after infection for western blot or mRNA expression.1: Negative control; 2: RGX-DYS8; 3: RGX-DYS7; 4: RGX-DYS6; 5: RGX-DYS3; 6: RGX-DYS5; 7: RGX-DYS1; 8: RGX-DYS1; 9: RGX-DYS1; 10: RGX-DYS1; 11: RGX-DYS1.
  • A Western blot analysis of ⁇ -dystrophin expression from C2C12 cells.
  • B Quantification of western blot analysis.
  • C Detection of ⁇ -dystrophin mRNA expression by ddPCR. 5.
  • microdystrophin protein for example, as shown in FIG.1A and FIG. 22 and nucleic acid compositions and rAAV vectors encoding the same as well as pharmaceutical compositions and treatment methods related thereto.
  • AAV or “adeno-associated virus” refers to a Dependoparvovirus within the Parvoviridae genus of viruses.
  • the AAV can be an AAV derived from a naturally occurring “wild-type” virus, an AAV derived from a rAAV genome packaged into a capsid comprising capsid proteins encoded by a naturally occurring cap gene and/or from a rAAV genome packaged into a capsid comprising capsid proteins encoded by a non-naturally occurring capsid cap gene.
  • An example of the latter includes a rAAV having a capsid protein having a modified sequence and/or a peptide insertion into the amino acid sequence of the naturally- occurring capsid.
  • rAAV refers to a “recombinant AAV.”
  • a recombinant AAV has an AAV genome in which part or all of the rep and cap genes have been replaced with heterologous sequences.
  • rep-cap helper plasmid refers to a plasmid that provides the viral rep and cap gene function and aids the production of AAVs from rAAV genomes lacking functional rep and/or the cap gene sequences.
  • cap gene refers to the nucleic acid sequences that encode capsid proteins that form or help form the capsid coat of the virus.
  • the capsid protein may be VP1, VP2, or VP3.
  • nucleic acids and “nucleotide sequences” include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), combinations of DNA and RNA molecules or hybrid DNA/RNA molecules, and analogs of DNA or RNA molecules. Such analogs can be generated using, for example, nucleotide analogs, which include, but are not limited to, inosine or tritylated bases.
  • Such analogs can also comprise DNA or RNA molecules comprising modified backbones that lend beneficial attributes to the molecules such as, for example, nuclease resistance or an increased ability to cross cellular membranes.
  • the nucleic acids or nucleotide sequences can be single-stranded, double-stranded, may contain both single-stranded and double-stranded portions, and may contain triple-stranded portions, but preferably is double-stranded DNA.
  • Amino acid residues as disclosed herein can be modified by conservative substitutions to maintain, or substantially maintain, overall polypeptide structure and/or function.
  • “conservative amino acid substitution” indicates that: hydrophobic amino acids (i.e., Ala, Cys, Gly, Pro, Met, Val, lie, and Leu) can be substituted with other hydrophobic amino acids; hydrophobic amino acids with bulky side chains (i.e., Phe, Tyr, and Trp) can be substituted with other hydrophobic amino acids with bulky side chains; amino acids with positively charged side chains (i.e., Arg, His, and Lys) can be substituted with other amino acids with positively charged side chains; amino acids with negatively charged side chains (i.e., Asp and Glu) can be substituted with other amino acids with negatively charged side chains; and amino acids with polar uncharged side chains (i.e., Ser, Thr, Asn, and Gln) can be substituted with other amino acids with polar uncharged side chains.
  • hydrophobic amino acids i.e., Ala, Cys, Gly, Pro, Met, Val, lie, and Leu
  • subject refers to any subject in any subject.
  • a subject is preferably a mammal such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats etc.) or a primate (e.g., monkey and human), most preferably a human.
  • a primate e.g., monkey and human
  • therapeutic efficacy means that the microdystrophin exhibits therapeutic efficacy in one or more of the assays for therapeutic utility described in Section 5.4 herein or in assessment of methods of treatment described in Section 5.5 herein.
  • subject refers to assess the methods of treatment described in Section 5.5 herein.
  • a subject is preferably a mammal such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats etc.) or a primate (e.g., monkey and human), most preferably a human.
  • a non-primate e.g., cows, pigs, horses, cats, dogs, rats etc.
  • a primate e.g., monkey and human
  • a “therapeutically effective amount” refers to the amount of agent, (e.g., an amount of product expressed by the transgene) that provides at least one therapeutic benefit in the treatment or management of the target disease or disorder, when administered to a subject suffering therefrom.
  • a therapeutically effective amount with respect to an agent of the invention means that amount of agent alone, or when in combination with other therapies, that provides at least one therapeutic benefit in the treatment or management of the disease or disorder.
  • the term “prophylactic agent” refers to any agent which can be used in the prevention, reducing the likelihood of, delay, or slowing down of the progression of a disease or disorder, where the disease or disorder is associated with a function to be provided by a transgene.
  • a “prophylactically effective amount” refers to the amount of the prophylactic agent (e.g., an amount of product expressed by the transgene) that provides at least one prophylactic benefit in the prevention or delay of the target disease or disorder, when administered to a subject predisposed thereto.
  • a prophylactically effective amount also may refer to the amount of agent sufficient to prevent, reduce the likelihood of, or delay the occurrence of the target disease or disorder; or slow the progression of the target disease or disorder; the amount sufficient to delay or minimize the onset of the target disease or disorder; or the amount sufficient to prevent or delay the recurrence or spread thereof.
  • a prophylactically effective amount also may refer to the amount of agent sufficient to prevent or delay the exacerbation of symptoms of a target disease or disorder.
  • a prophylactically effective amount with respect to a prophylactic agent of the invention means that amount of prophylactic agent alone, or when in combination with other agents, that provides at least one prophylactic benefit in the prevention or delay of the disease or disorder.
  • a prophylactic agent of the invention can be administered to a subject “pre-disposed” to a target disease or disorder.
  • a subject that is “pre-disposed” to a disease or disorder is one that shows symptoms associated with the development of the disease or disorder, or that has a genetic makeup, environmental exposure, or other risk factor for such a disease or disorder, but where the symptoms are not yet at the level to be diagnosed as the disease or disorder.
  • a patient with a family history of a disease associated with a missing gene may qualify as one predisposed thereto.
  • a patient with a dormant tumor that persists after removal of a primary tumor may qualify as one predisposed to recurrence of a tumor.
  • CpG islands means those distinctive regions of the genome that contain the dinucleotide CpG (e.g. C (cytosine) base followed immediately by a G (guanine) base (a CpG)) at high frequency, thus the G+C content of CpG islands is significantly higher than that of non-island DNA.
  • CpG islands can be identified by analysis of nucleotide length, nucleotide composition, and frequency of CpG dinucleotides.
  • CpG island content in any particular nucleotide sequence or genome may be measured using the following criteria: island size greater than 100, GC Percent greater than 50.0 %, and ratio greater than 0.6 of observed number of CG dinucleotides to the expected number on the basis of the number of Gs and Cs in the segment (Obs/Exp greater than 0.6).
  • Embodiments described herein comprise a microdystrophin protein having from amino-terminus to the carboxy terminus: ABD-H1-R1-R2-R3-H3- R24-H4-CR (e.g., SEQ ID NO: 2) or ABD1-H1-R1-R2-R16-R17-R24-H4-CR (SEQ ID NO: 93), wherein ABD is an actin-binding domain of dystrophin, H1 is a hinge 1 region of dystrophin, R1 is a spectrin 1 region of dystrophin, R2 is a spectrin 2 region of dystrophin, R3 is a spectrin 3 region
  • the microdystrophins in accordance with the present disclosure comprise ABD-H1-R1-R2-R3-R24-H4 or ABD-H1-R1-R2-R16-R17- R24-H4.
  • the NH 2 terminus and a region in the rod domain of dystrophin bind directly to but do not cross-link cytoskeletal actin.
  • the rod domain of wild type dystrophin is composed of 24 repeating units that are similar to the triple helical repeats of spectrin. This repeating unit accounts for the majority of the dystrophin protein and is thought to give the molecule a flexible rod-like structure similar to ⁇ - spectrin.
  • ⁇ -helical coiled-coil repeats are interrupted by four proline-rich hinge regions. At the end of the 24th repeat is the fourth hinge region that is immediately followed by the WW domain [Blake, D. et al, Function and Genetics of Dystrophin and Dystrophin-Related Proteins in Muscle. Physiol. Rev. 82: 291– 329, 2002].
  • Microdystrophins disclosed herein do not include R4 to R23, or, alternatively, do not include R3 (or, in some embodiments R4) to R15 and R18 to R23 (that is, such that the microdystrophin includes R16 and R17, but may not, in certain embodiments, include R3), and only include 2 or 3 of the 4 hinge regions or portions thereof.
  • Embodiments may contain dystrophin spectrin-like repeats 16 and 17 which are understood to anchor nNOS to the sarcolemma. In some embodiments, no new amino acid residues or linkers are introduced into the microdystrophin.
  • microdystrophin comprises H3 (e.g, SEQ ID NOS: 1, 2, or 79).
  • H3 can be a full endogenous H3 domain from N- terminal to C-terminal, e.g., SEQ ID NO: 11. Stated another way, some microdystrophin embodiments do not contain a fragment of the H3 domain but contain the entire H3 domain.
  • the C-terminal amino acid of the R3 domain is coupled directly (or covalently bonded to) the N-terminal amino acid of the H3 domain.
  • the C-terminal amino acid of the R3 domain coupled to the N-terminal amino acid of the H3 domain is Q.
  • microdystrophin comprises H2 instead of H3.
  • H2 can be the full endogenous H2 domain (SEQ ID NO: 19).
  • Such microdystrophin protein embodiments have from amino-terminus to the carboxy terminus: ABD- H1-R1-R2-R3-H2-R24-H4-CR.
  • the C-terminal amino acid of the R3 domain coupled to the N-terminal amino acid of the hinge domain is Q.
  • the N-terminal amino acid of the H2 domain coupled to the R3 domain is P.
  • the C-terminal amino acid of the R3 domain is directly coupled to the N-terminal amino acid of the hinge domain, wherein the N-terminal amino acid of the hinge domain is P or Q. In still other embodiments, the C-terminal amino acid of the R3 domain is directly coupled to the N-terminal amino acid of the H2 domain, wherein the N-terminal amino acid of the H2 domain is P. [0072] Without being bound by any one theory, a full hinge domain may be appropriate in any microdystrophin construct in order to convey full activity upon the derived microdystrophin protein.
  • Microdystrophins disclosed herein comprise the wild-type dystrophin H4 sequence (which contains the WW domain) to and including the CR domain (which contains the ZZ domain, represented by a single underline (UniProtKB-P11532 aa 3307-3354) in SEQ ID NO: 15).
  • the WW domain is a protein-binding module found in several signaling and regulatory molecules.
  • the WW domain binds to proline-rich substrates in an analogous manner to the src homology-3 (SH3) domain. This region mediates the interaction between ⁇ -dystroglycan and dystrophin, since the cytoplasmic domain of ⁇ -dystroglycan is proline rich.
  • the WW domain is in the Hinge 4 (H4 region).
  • the CR domain contains two EF-hand motifs that are similar to those in ⁇ -actinin and that could bind intracellular Ca 2+ .
  • the ZZ domain contains a number of conserved cysteine residues that are predicted to form the coordination sites for divalent metal cations such as Zn 2+ .
  • the ZZ domain is similar to many types of zinc finger and is found both in nuclear and cytoplasmic proteins.
  • the ZZ domain of dystrophin binds to calmodulin in a Ca 2+ - dependent manner.
  • the ZZ domain may represent a functional calmodulin- binding site and may have implications for calmodulin binding to other dystrophin- related proteins.
  • Certain embodiments comprise a truncated portion of the CR domain, which comprises the ZZ domain.
  • the microdystrophin protein comprises from amino-terminus to the carboxy terminus: ABD-H1-R1-R2-R3-H3- R24-H4-CR(short)-CT (e.g., SEQ ID NO: 91, see RGX-DYS6 in FIG. 22).
  • the CR domain for example, has an amino acid sequence of SEQ ID NO: 90.
  • ⁇ 1-syntrophin and ⁇ -dystrobrevin which are members of DAP complex, serving as modular adaptors for signaling proteins recruited to the sarcolemma membrane
  • Delivery of AAV2/9-microdystrophin genes incorporating helix 1 of the coiled-coil motif in the C-terminal domain of dystrophin improves muscle pathology and restores the level of ⁇ ⁇ -syntrophin and ⁇ - dystrobrevin in skeletal muscles of mdx mice.
  • LV left ventricle
  • DCM dilated cardiomyopathy
  • the CT domain of dystrophin contains two polypeptide stretches that are predicted to form ⁇ -helical coiled coils similar to those in the rod domain (see H1 indicated by single underlining and H2 indicated by double underlining in SEQ ID 16 in Table 1 below). Each coiled coil has a conserved repeating heptad (a,b,c,d,e,f,g)n similar to those found in leucine zippers where leucine predominates at the “d” position. This domain has been named the CC (coiled coil) domain.
  • dystrophin forms the binding site for dystrobrevin and may modulate the interaction between ⁇ 1-syntrophin and other dystrophin-associated proteins.
  • ⁇ 1-syntrophin and ⁇ 1 syntrophin are thought to interact directly with dystrophin through more than one binding site in dystrophin exons 73 and 74 (Yang et al, JBC 270(10):4975-8 (1995)).
  • ⁇ 1- and ⁇ 1-syntrophin bind separately to the dystrophin C-terminal domain, and the binding site for ⁇ 1- syntrophin resides at least within the amino acid residues 3447 to 3481, while that for ⁇ 1-syntrophin resides within the amino acid residues 3495 to 3535 (Table 1, SEQ ID NO: 16, italic).
  • Alpha1- ( ⁇ 1-) syntrophin and alpha-syntrophin are used interchangeably throughout.
  • Helix 1 (see H1 indicated as single underlined sequence within SEQ ID NO: 16 in Table 1 below) of the coiled-coil motif in the C-terminal (CT) domain of the microdystrophin gene cassettes may be advantageous for cardiomyocyte protection, and otherwise stabilizing dystrophin-associated (glyco)protein (DAP) complexes (DAPCs).
  • DAP dystrophin-associated protein
  • the DAPC may participate in important signaling roles as well as a structural role.
  • NO nitric oxide
  • microdystrophin constructs disclosed herein were found to bind to and recruit nNOS, as well as alpha-syntrophin, alpha-dystrobrevin and beta-dystroglycan. Binding to nNOS, in the context of a microdystrophin construct including a C-terminal domain of dystrophin binding to nNOS, means that the microdystrophin construct expressed in muscle tissue was determined by immunostaining with appropriate antibodies to identify each of alpha-syntrophin, alpha-dystrobrevin, and nNOS in or near the sarcolemma in a section of the transduced muscle tissue.
  • the microdystrophin protein has a C-terminal domain that “increases binding” to ⁇ 1-syntrophin, ⁇ -syntrophin and/or dystrobrevin compared to a comparable microdystrophin that does not contain the C-terminal domain (but has the same amino acid sequence otherwise, that is a “reference microdystrophin protein”), meaning that the DAPC is stabilized or anchored to the sarcolemma, to a greater extent than a reference microdystrophin that does not have the C-terminal domain (but has the same amino acid sequence otherwise as the microdystrophin), as determined by greater levels of one or more DAPC components in the muscle membrane by immunostaining of muscle sections or western blot analysis of muscle tissue lysates or muscle membrane preparations for one of more DAPC components, including ⁇ 1-syntrophin, ⁇ -syntrophin,
  • the microdystrophin construct including a C- terminal domain of dystrophin comprises a syntrophin binding site and/or a dystrobrevin binding site in the C-terminal domain.
  • the C- terminal domain comprising an ⁇ 1-syntrophin binding site is a truncated C- terminal domain.
  • the amino acid sequence of the truncated C-terminal domain is SEQ ID NO: 83.
  • the truncated C- terminal domain comprises the amino acid sequence MENSNGSYLNDSISPNESIDDEHLLIQHYCQSLNQ ( ⁇ 1-syntrophin binding site) (SEQ ID NO: 84).
  • the truncated C-terminal domain comprises an ⁇ 1-syntrophin binding site, wherein the binding site has amino acid sequence MENSNGSYLNDSISPNESIDDEHLLIQHYCQSLNQ (SEQ ID NO: 84) but does not have a ⁇ 1-syntrophin or dystrobrevin binding site.
  • the microdystrophin constructs of the present disclosure may further prevent progressive ventricular fibrosis, as measured by the reduction in myocardial macrophage concentrations, the reduction of the expression of adhesion molecules, and/or normalized electrocardiogram (ECG) readouts, for example end systolic volume (left ventricle), end diastolic volume, stroke volume, ejection fraction, heart rate, or cardiac output, following administration of the microdystrophin constructs.
  • End systolic volume and other cardiac readouts can also be measured using MRI (magnetic resonance tomography), cardiac CT (computed tomography) or SPECT (single photon emission computed tomography).
  • microdystrophin protein comprises from amino-terminus to the carboxy terminus: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT (e.g., SEQ ID NO: 1, 79 or 91) or ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT (e.g., SEQ ID NO: 92).
  • CT is at least a portion of a C-terminal domain of dystrophin comprising a ⁇ 1-syntrophin binding site and/or a dystrobrevin binding site as illustrated in FIG. 14.
  • the CT domain comprises an ⁇ 1-syntrophin binding site and does not have a ⁇ 1-syntrophin or dystrobrevin binding site, for example it has an amino acid sequence of SEQ ID NO: 83, which function in part to recruit and anchor nNOS to the sarcolemma through ⁇ 1- syntrophin.
  • the CT comprises the amino acid sequence of SEQ ID NO: 16 or 83.
  • Microdystrophin embodiments can further comprise linkers (L1, L2, L3, L4, L4.1 and/or L4.2) or portions thereof connected the domains as shown as follows: ABD1-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24-H4-CR-CT (e.g., SEQ ID NO: 1, 79, or 91), ABD1-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24-H4-CR (e.g., SEQ ID NO: 2), ABD1-L1-H1-L2-R1-R2-L3-R16-L4.1-R17-L4.2-R24-H4-CR (e.g., SEQ ID NO: 92), or ABD1-L1-H1-L2-R1-R2-L3-R16-L4.1-R17-L4.2-R24-H4- CR-CT (e.g., SEQ ID NO
  • L1 can be an endogenous linker L1 (e.g., SEQ ID NO: 4) that can couple ABD1 to H1.
  • L2 can be an endogenous linker L2 (e.g., SEQ ID NO: 6) that can couple H1 to R1.
  • L3 can be an endogenous linker L3 (e.g., SEQ ID NO: 9) that can couple R2 to R3 or R16.
  • L4 can also be an endogenous linker that can couple H3 and R24.
  • L4 is 3 amino acids, e.g. TLE (SEQ ID NO: 12) that precede R24 in the native dystrophin sequence.
  • L4 can be the 4 amino acids that precede R24 in the native dystrophin sequence (SEQ ID NO: 17) or the 2 amino acids that precede R24 (SEQ ID NO: 18). In other embodiments, there is no linker, L4 or otherwise, in between H3 and R24. On the 5’ end of H3, as mentioned above, no linker is present, but rather R3 is directly coupled to H3, or alternatively H2. [0086] L4.1 can be an endogenous linker that can couple R16 and R17. In some embodiments, L4.1 is 2 amino acids, e.g. SV (SEQ ID NO: 110) that precede R17 in the native dystrophin sequence.
  • L4.2 can be an endogenous linker or part of an endogenous linker that can couple R17 and R24.
  • L4.2 is 4 amino acids, e.g. Q that follows R17 and TLE (SEQ ID NO: 12) that precede R24 (SEQ ID NO: 89).
  • the above described components of microdystrophin other domains not specifically described can have the amino acid sequences as provided in Table 1 below.
  • the amino acid sequences for the domains provided herein correspond to the dystrophin isoform of UniProtKB-P11532 (DMD_HUMAN), which is herein incorporated by reference.
  • inventions can comprise the domains from naturally-occurring functional dystrophin isoforms known in the art, such as UniProtKB-A0A075B6G3 (A0A075B6G3_HUMAN), (incorporated by reference herein) wherein, for example, R24 has an R substituted for the Q at amino acid 3 of SEQ ID NO: 13.
  • the present disclosure also contemplates variants of these sequences so long as the function of each domain and linker is substantially maintained and/or the therapeutic efficacy of microdystrophin comprising such variants is substantially maintained.
  • Functional activity includes (1) binding to one of, a combination of, or all of actin, ⁇ -dystroglycan, ⁇ 1-syntrophin, ⁇ -dystrobrevin, and nNOS; (2) improved muscle function in an animal model (for example, in the mdx mouse model described herein) or in human subjects; and/or (3) cardioprotective or improvement in cardiac muscle function in animal models or human patients.
  • microdystrophin can comprise ABD consisting of SEQ ID NO: 3 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 3; H1 consisting of SEQ ID NO: 5 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 5; R1 consisting of SEQ ID NO: 7 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 7; R2 consisting of SEQ ID NO: 8 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, or at
  • H3 domain is replaced by the H2 domain that consists of SEQ ID NO: 19 or a sequence with at least 50%, at least 60%, at least 70 %, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 19, likewise encoding a microdystrophin that has functional activity.
  • microdystrophin can comprise linkers in the locations described above that comprise or consist of sequences as follows: L1 consisting of SEQ ID NO: 4 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 4; L2 consisting of SEQ ID NO: 6 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 6; L3 consisting of SEQ ID NO: 9 or an amino acid sequence with at least 50% identity to SEQ ID NO: 9 or a variant with conservative substitutions for both L3 residues; and L4 consisting of SEQ ID NO: 12, 17, or 18 or an amino acid sequence with at least 50%, at least 75% sequence identity to SEQ ID NO: 12, 17, or 18.
  • microdystrophin can comprise ABD consisting of SEQ ID NO: 3 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 3; H1 consisting of SEQ ID NO: 5 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 5; R1 consisting of SEQ ID NO: 7 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 7; R2 consisting of SEQ ID NO: 8 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%
  • microdystrophin can comprise linkers in the locations described above that comprise or consist of sequences as follows: L1 consisting of SEQ ID NO: 4 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 4; L2 consisting of SEQ ID NO: 6 or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 6; L3 consisting of SEQ ID NO: 9 or an amino acid sequence with at least 50% identity to SEQ ID NO: 9 or a variant with conservative substitutions for both L3 residues; L4.1 consisting of SEQ ID NO: 110 or an amino acid sequence with at least 50%, at least 75% sequence identity to SEQ ID NO: 110.; and L4.2 consisting of SEQ ID NO: 89 or an amino acid sequence with at least 50%, at least 75% sequence identity to SEQ ID NO:
  • Table 2 provides the amino acid sequences of the microdystrophin embodiments in accordance with the present disclosure. It is also contemplated that other embodiments are substituted variant of microdystrophin as defined by SEQ ID NOs: 1, 2, 79, 91, 92, or 93. For example, conservative substitutions can be made to SEQ ID NOs: 1, 2, 79, 91, 92, or 93 and substantially maintain its functional activity.
  • microdystrophin may have at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NOs: 1, 2, 79, 91, 92, or 93 and maintain functional microdystrophin activity, as determined, for example, by one or more of the in vitro assays or in vivo assays in animal models disclosed in Section 5.4, infra.
  • Table 2 Amino acid sequences of RGX-DYS proteins
  • nucleic acids comprising a nucleotide sequence encoding a microdystrophin as described herein.
  • Such nucleic acids comprise nucleotide sequences that encode the microdystrophin that has the domains arranged N-terminal to C-terminal as follows: ABD1-H1-R1-R2-R3-H3- R24-H4-CR-CT, ABD1-H1-R1-R2-R3-H3-R24-H4-CR, ABD1-H1-R1-R2-R16- R17-R24-H4-CR-CT, or ABD1-H1-R1-R2-R16-R17-R24-H4-CR.
  • the nucleotide sequence can be any nucleotide sequence that encodes the domains.
  • the nucleotide sequence may be codon optimized and/or depleted of CpG islands for expression in the appropriate context.
  • the nucleotide sequences encode a microdystrophin having an amino acid sequence of SEQ ID NO: 1, 2, 79, 91, 92, or 93.
  • the nucleotide sequence can be any sequence that encodes the microdystrophin, including the microdystrophin of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 79, SEQ ID NO: 91, SEQ ID NO: 92, or SEQ ID NO: 93, which nucleotide sequence may vary due to the degeneracy of the code.
  • Tables 3 and 4 provide exemplary nucleotide sequences that encode the DMD domains.
  • Table 3 provides the wild type DMD nucleotide sequence for the component
  • Table 4 provides the nucleotide sequence for the DMD component used in the constructs herein, including sequences that have been codon optimized and/or CpG depleted of CpG islands as follows:
  • compositions comprise a nucleic acid sequence encoding ABD1 that consists of SEQ ID NO: 22 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 22; a nucleic acid sequence encoding H1 that consists of SEQ ID NO: 24 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 24; a nucleic acid sequence encoding R1 that consists of SEQ ID NO: 26 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 26; a nucleic acid sequence encoding R2 that consists of SEQ ID NO: 26;
  • H3 nucleic acid sequence is replaced by a nucleic acid encoding H2 that consists of SEQ ID NO: 38 or a sequence with at least 50%, at least 60%, at least 70 %, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 38, likewise encoding a microdystrophin that has functional activity.
  • compositions comprise a nucleic acid sequence encoding ABD1 that consists of SEQ ID NO: 22 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 22 and encodes for the ABD1 domain of SEQ ID NO: 3; a nucleic acid sequence encoding H1 that consists of SEQ ID NO: 24 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 24 and encodes for the H1 domain of SEQ ID NO: 5; a nucleic acid sequence encoding R1 that consists of SEQ ID NO: 26 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 26 and encodes for
  • H3 nucleic acid sequence is replaced by a nucleic acid encoding H2 that consists of SEQ ID NO: 38 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 38 and encodes the H2 domain of SEQ ID NO: 19.
  • nucleic acid compositions can optionally comprise nucleotide sequences encoding linkers in the locations described above that comprise or consist of sequences as follows: a nucleic acid sequence encoding L1 consisting of SEQ ID NO: 23 or a sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 23 (e.g.
  • nucleic acid sequence encoding L2 consisting of SEQ ID NO: 25 or sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 25 (e.g.
  • nucleic acid sequence encoding L3 consisting of SEQ ID NO: 28 or a sequence with at least 50% identity to SEQ ID NO: 28, encoding the L3 domain of SEQ ID NO: 9 or a variant with conservative substitutions for both L3 residues
  • a nucleic acid sequence encoding L4 consisting of SEQ ID NO: 31, 36, or 37 or a sequence with at least 50%, at least 75% sequence identity to SEQ ID NO: 31, 36, or 37 (e.g. encoding the L4 domain of SEQ ID NO: 12, 17, or 18 or a variant with conservative substitutions for any of the L4 residues).
  • compositions comprise a nucleic acid sequence encoding ABD1 that consists of SEQ ID NO: 22 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 22; a nucleic acid sequence encoding H1 that consists of SEQ ID NO: 24 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 24; a nucleic acid sequence encoding R1 that consists of SEQ ID NO: 26 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 26; a nucleic acid sequence encoding R2 that consists of SEQ ID NO: 27 or a sequence with at least 75%, at least
  • H3 nucleic acid sequence is replaced by a nucleic acid encoding H2 that consists of SEQ ID NO: 38 or a sequence with at least 50%, at least 60%, at least 70 %, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 38, likewise encoding a microdystrophin that has functional activity.
  • compositions comprise a nucleic acid sequence encoding ABD1 that consists of SEQ ID NO: 22 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 22 and encodes for the ABD1 domain of SEQ ID NO: 3; a nucleic acid sequence encoding H1 that consists of SEQ ID NO: 24 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 24 and encodes for the H1 domain of SEQ ID NO: 5; a nucleic acid sequence encoding R1 that consists of SEQ ID NO: 26 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 26 and encodes for
  • H3 nucleic acid sequence is replaced by a nucleic acid encoding H2 that consists of SEQ ID NO: 38 or a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 38 and encodes the H2 domain of SEQ ID NO: 19.
  • nucleic acid compositions can optionally comprise nucleotide sequences encoding linkers in the locations described above that comprise or consist of sequences as follows: a nucleic acid sequence encoding L1 consisting of SEQ ID NO: 23 or a sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 23 (e.g.
  • nucleic acid sequence encoding L2 consisting of SEQ ID NO: 25 or sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 25 (e.g.
  • nucleic acid sequence encoding L2 domain of SEQ ID NO: 6 a nucleic acid sequence encoding L3 consisting of SEQ ID NO: 28 or a sequence with at least 50% identity to SEQ ID NO: 28, encoding the L3 domain of SEQ ID NO: 9 or a variant with conservative substitutions for both L3 residues; a nucleic acid sequence encoding L4.1 consisting of SEQ ID NO: 125 or a sequence with at least 50%, at least 75% sequence identity to SEQ ID NO: 125 (e.g.
  • L4.2 a nucleic acid sequence encoding L4.2 consisting of SEQ ID NO: 126 or a sequence with at least 50%, at least 75% sequence identity to SEQ ID NO: 126 (e.g. encoding the L4.2 domain of SEQ ID NO: 89 or a variant with conservative substitutions for any of the L4.2 residues).
  • the nucleic acid comprises a nucleotide sequence encoding the microdystrophin having the amino acid sequence of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO: 79, SEQ ID NO: 91, SEQ ID NO: 92, or SEQ ID NO: 93.
  • the nucleic acid comprises a nucleotide sequence which is SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 81, SEQ ID NO: 101, SEQ ID NO: 102, or SEQ ID NO: 103 (encoding the microdystrophins of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO: 79, SEQ ID NO: 91, SEQ ID NO: 92, and SEQ ID NO: 93, respectively).
  • the nucleotide sequence encoding a microdystrophin may have at least 50%, at least 60%, at least 70 %, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the nucleotide sequence of SEQ ID NO: 20, 21, 83, 101, 102, or 103 (Table 5) or the reverse complement thereof and encode a therapeutically effective microdystrophin.
  • Table 5 RGX-DYS Construct nucleotide sequences 5.2.2.1 Codon Optimization and CpG Depletion
  • the nucleotide sequence encoding the microdystrophin cassette is modified by codon optimization and CpG dinucleotide and CpG island depletion.
  • Immune response against microdystrophin transgene is a concern for human clinical application, as evidenced in the first Duchenne Muscular Dystrophy (DMD) gene therapy clinical trials and in several adeno-associated vial (AAV)- minidystrophin gene therapy in canine models [Mendell, J.R., et al., Dystrophin immunity in Duchenne's muscular dystrophy.
  • DMD Duchenne Muscular Dystrophy
  • AAV adeno-associated vial
  • AAV-directed immune responses can be inhibited by reducing the number of CpG di-nucleotides in the AAV genome [Faust, S.M., et al., CpG-depleted adeno-associated virus vectors evade immune detection. J Clin Invest, 2013. 123(7): p. 2994-3001].
  • the microdystrophin cassette is human codon-optimized with CpG depletion.
  • Codon- optimized and CpG depleted nucleotide sequences may be designed by any method known in the art, including for example, by Thermo Fisher Scientific GeneArt Gene Synthesis tools utilizing GeneOptimizer (Waltham, MA USA)). Nucleotide sequences SEQ ID NOs: 20, 21, 57-72, 80, 81, and 101-103 described herein represent codon-optimized and CpG depleted sequences. [00101] Provided are microdystrophin transgenes that have reduced numbers of CpG dinucleotide sequences and, as a result, have reduced number of CpG islands.
  • the microdystrophin nucleotide sequence has fewer than two (2) CpG islands, or one (1) CpG island orzero (0) CpG islands.
  • the microdystrophin nucleotide sequence consisting essentially of SEQ ID NO: 20, 21, 81, 101, 102 or 103 has zero (0) CpG islands.
  • nucleic acid expression cassettes comprising regulatory elements designed to confer or enhance expression of the microdystrophins.
  • the invention further involves engineering regulatory elements, including promoter elements, and optionally enhancer elements and/or introns, to enhance or facilitate expression of the transgene.
  • the rAAV vector also includes such regulatory control elements known to one skilled in the art to influence the expression of the RNA and/or protein products encoded by nucleic acids (transgenes) within target cells of the subject.
  • Regulatory control elements and may be tissue-specific, that is, active (or substantially more active or significantly more active) only in the target cell/tissue.
  • the expression cassette of an AAV vector comprises a regulatory sequence, such as a promoter, operably linked to the transgene that allows for expression in target tissues.
  • the promoter may be a constitutive promoter, for example, the CB7 promoter.
  • Additional promoters include: cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, MMT promoter, EF-1 alpha promoter (SEQ ID NO: 118), UB6 promoter, chicken beta-actin promoter, CAG promoter (SEQ ID NO: 116), RPE65 promoter, opsin promoter, the TBG (Thyroxine-binding Globulin) promoter, the APOA2 promoter, SERPINA1 (hAAT) promoter, or MIR122 promoter.
  • an inducible promoter is used, e.g., hypoxia-inducible or rapamycin-inducible promoter.
  • the promoter is a muscle-specific promoter.
  • muscle-specific refers to nucleic acid elements that have adapted their activity in muscle cells or tissue due to the interaction of such elements with the intracellular environment of the muscle cells.
  • muscle cells may include myocytes, myotubes, cardiomyocytes, and the like. Specialized forms of myocytes with distinct properties such as cardiac, skeletal, and smooth muscle cells are included.
  • Various therapeutics may benefit from muscle- specific expression of a transgene.
  • gene therapies that treat various forms of muscular dystrophy delivered to and enabling high transduction efficiency in muscle cells have the added benefit of directing expression of the transgene in the cells where the transgene is most needed. Cardiac tissue will also benefit from muscle-directed expression of the transgene. Muscle-specific promoters may be operably linked to the transgenes of the invention.
  • the muscle-specific promoter is selected from an SPc5-12 promoter, a muscle creatine kinase myosin light chain (MLC) promoter, a myosin heavy chain (MHC) promoter, a desmin promoter (SEQ ID NO: 119), a MHCK7 promoter (SEQ ID NO: 120), a CK6 promoter, a CK8 promoter (SEQ ID NO: 115), a MCK promoter (or a truncated form thereof) (SEQ ID NO: 121), an alpha actin promoter, an beta actin promoter, an gamma actin promoter, an E-syn promoter, a cardiac troponin C promoter, a troponin I promoter, a myoD gene family promoter, or a muscle- selective promoter residing within intron 1 of the ocular form of Pitx3.
  • MLC muscle creatine kinase myosin light chain
  • MHC myosin heavy chain
  • Synthetic promoter c5-12 (Li, X. et al. Nature Biotechnology Vol.17, pp. 241-245, MARCH 1999), known as the SPc5-12 promoter, has been shown to have cell type restricted expression, specifically muscle-cell specific expression. At less than 350 bp in length, the SPc5-12 promoter is smaller in length than most endogenous promoters, which can be advantageous when the length of the nucleic acid encoding the therapeutic protein is relatively long.
  • gene therapy cassettes with an SPc5-12 promoter SEQ ID NO: 39).
  • regulatory elements can be a reduced or shortened version (referred to herein as a “minimal promoter”) of any one of the promoters described herein.
  • a minimal promoter comprises at least the transcriptionally active domain of the full-length version and is therefore still capable of driving expression.
  • an AAV vector can comprise the transcriptionally active domain of a muscle-specific promoter, e.g., a minimal SPc5-12 promoter (e.g., SEQ ID NO: 40), operably linked to a therapeutic protein transgene.
  • the therapeutic protein is microdystrophin as described herein.
  • a minimal promoter of the present disclosure may or may not contain the portion of the promoter sequence that contributes to regulating expression in a tissue-specific manner.
  • gene therapy cassettes with an SPc5-12 promoter SEQ ID NO: 39.
  • gene therapy cassettes with minimal promoters that direct expression of the microdystrophin in muscle cells One such promoter is a minimal SPc5-12 promoter of SEQ ID NO: 40. Sequences of these promoters are provided in Table 6. Table 6: Promoter sequences
  • the promoter is a CNS-specific promoter.
  • an expression cassette can comprise a promoter selected from a promoter isolated from the genes of neuron specific enolase (NSE), any neuronal promoter such as the promoter of Dopamine-1 receptor or Dopamine-2 receptor, the synapsin promoter, CB7 promoter (a chicken ⁇ -actin promoter and CMV enhancer), RSV promoter, GFAP promoter (glial fibrillary acidic protein), MBP promoter (myelin basic protein), MMT promoter, EF-1 ⁇ , U86 promoter, RPE65 promoter or opsin promoter, an inducible promoter, for example, a hypoxia-inducible promoter, and a drug inducible promoter, such as a promoter induced by rapamycin and related agents.
  • NSE neuron specific enolase
  • any neuronal promoter such as the promoter of Dopamine-1 receptor or Dopamine-2 receptor
  • the synapsin promoter
  • expression cassettes can comprise multiple promoters which may be placed in tandem in the expression cassette comprising a microdystrophin transgene.
  • tandem or hybrid promoters may be employed in order to enhance expression and/or direct expression to multiple tissue types, (see, e.g. PCT International Publication No. WO2019154939A1, published Aug. 15, 2019, incorporated herein by reference) and, in particular, LMTP6, LMTP13, LMTP14, LMTP15, LMTP18, LMTP19, or LMTP20 as disclosed in PCT International Application No. PCT/US2020/043578, filed July 24, 2020, hereby incorporated by reference).
  • Example 2 demonstrates that the VH4 intron 5’ of the microdystrophin coding sequence enhances proper splicing and, thus, microdystrophin expression.
  • an intron is coupled to the 5’ end of a sequence encoding a microdystrophin protein, e.g., ABD-H1-R1-R2-R3-H3-R24-H4-CR, ABD-H1-R1-R2-R3-H3-R24-H4-CR- CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R16-R17-R24- H4-CR-CT.
  • the intron can be linked to the actin-binding domain.
  • the intron is less than 100 nucleotides in length.
  • the intron is a VH4 intron.
  • the VH4 intron nucleic acid can comprise SEQ ID NO: 41 as shown in Table 7 below.
  • Table 7 Nucleotide sequences for different introns
  • the intron is a chimeric intron derived from human ⁇ -globin and Ig heavy chain (also known as ⁇ -globin splice donor/immunoglobulin heavy chain splice acceptor intron, or ⁇ -globin/IgG chimeric intron) (Table 7, SEQ ID NO: 75).
  • introns well known to the skilled person may be employed, such as the chicken ⁇ -actin intron, minute virus of mice (MVM) intron, human factor IX intron (e.g., FIX truncated intron 1), ⁇ -globin splice donor/immunoglobulin heavy chain splice acceptor intron, adenovirus splice donor /immunoglobulin splice acceptor intron, SV40 late splice donor /splice acceptor (19S/16S) intron (Table 7, SEQ ID NO: 76).
  • MMVM minute virus of mice
  • human factor IX intron e.g., FIX truncated intron 1
  • ⁇ -globin splice donor/immunoglobulin heavy chain splice acceptor intron e.g., FIX truncated intron 1
  • polyA polyadenylation
  • Any polyA site that signals termination of transcription and directs the synthesis of a polyA tail is suitable for use in AAV vectors of the present disclosure.
  • Exemplary polyA signals are derived from, but not limited to, the following: the SV40 late gene, the rabbit ⁇ -globin gene, the bovine growth hormone (BPH) gene, the human growth hormone (hGH) gene, and the synthetic polyA (SPA) site.
  • the polyA signal comprises SEQ ID NO: 42 as shown in Table 8.
  • rAAV recombinant AAV vectors
  • rAAV vectors can comprise an AAV viral capsid and a viral or artificial genome comprising an expression cassette flanked by AAV inverted terminal repeats (ITRs) wherein the expression cassette comprises a microdystrophin transgene, operably linked to one or more regulatory sequences that control expression of the transgene in human muscle or CNS cells to express and deliver the microdystrophin.
  • the provided methods are suitable for use in the production of any isolated recombinant AAV particles for delivery of a microdystrophins described herein, in the production of a composition comprising any isolated recombinant AAV particles encoding a microdystrophin, or in the method for treating a disease or disorder amenable for treatment with a microdystrophin in a subject in need thereof comprising the administration of any isolated recombinant AAV particles encoding a microdystrophin described herein.
  • the rAAV can be of any serotype, variant, modification, hybrid, or derivative thereof, known in the art, or any combination thereof (collectively referred to as “serotype”).
  • the AAV serotype has a tropism for muscle tissue.
  • the AAV serotype has a tropism for the CNS.
  • the AAV serotype has a tropism for both muscle tissue and the CNS.
  • the AAV serotype has a tropism for the liver, in which case the liver cells transduced with the AAV form a depot of microdystrophin secreting cells, secretin the microdystrophin into the circulation.
  • rAAV particles have a capsid protein from an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9,
  • rAAV particles comprise a capsid protein at least 80% or more identical, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e.
  • AAV capsid serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, rAAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HS
  • a population of rAAV particles can comprise two or more serotypes, e.g., comprising two or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC
  • the rAAV particles comprise the capsid with one of the following amino acid insertions: LGETTRP or LALGETTRP, as described in United States Patent Nos. 9,193,956; 9458517; and 9,587,282 and US patent application publication no. 2016/0376323, each of which is incorporated herein by reference in its entirety.
  • rAAV particles comprise the capsid of AAV.7m8, as described in United States Patent Nos. 9,193,956; 9,458,517; and 9,587,282 and US patent application publication no.2016/0376323, each of which is incorporated herein by reference in its entirety.
  • rAAV particles comprise any AAV capsid disclosed in United States Patent No. 9,585,971, such as AAVPHP.B. In some embodiments, rAAV particles comprise any AAV capsid disclosed in United States Patent No.9,840,719 and WO 2015/013313, such as AAV.Rh74 and RHM4- 1, each of which is incorporated herein by reference in its entirety. In some embodiments, rAAV particles comprise any AAV capsid disclosed in WO 2014/172669, such as AAV rh.74, which is incorporated herein by reference in its entirety.
  • rAAV particles comprise the capsid of AAV2/5, as described in Georgiadis et al., 2016, Gene Therapy 23: 857-862 and Georgiadis et al., 2018, Gene Therapy 25: 450, each of which is incorporated by reference in its entirety.
  • rAAV particles comprise any AAV capsid disclosed in WO 2017/070491, such as AAV2tYF, which is incorporated herein by reference in its entirety.
  • rAAV particles comprise the capsids of AAVLK03 or AAV3B, as described in Puzzo et al., 2017, Sci. Transl. Med. 29(9): 418, which is incorporated by reference in its entirety.
  • rAAV particles comprise any AAV capsid disclosed in US Pat Nos. 8,628,966; US 8,927,514; US 9,923,120 and WO 2016/049230, such as HSC1, HSC2, HSC3, HSC4, HSC5, HSC6, HSC7, HSC8, HSC9, HSC10, HSC11, HSC12, HSC13, HSC14, HSC15, or HSC16, each of which is incorporated by reference in its entirety.
  • rAAV particles comprise an AAV capsid disclosed in any of the following patents and patent applications, each of which is incorporated herein by reference in its entirety: United States Patent Nos.
  • rAAV particles have a capsid protein at least 80% or more identical, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e. up to 100% identical, to the VP1, VP2 and/or VP3 sequence of an AAV capsid disclosed in any of the following patents and patent applications, each of which is incorporated herein by reference in its entirety: United States Patent Nos.
  • rAAV particles have a capsid protein disclosed in Intl. Appl. Publ. No.
  • WO 2003/052051 see, e.g., SEQ ID NO: 2 of ⁇ 051
  • WO 2005/033321 see, e.g., SEQ ID NOs: 123 and 88 of ⁇ 321)
  • WO 03/042397 see, e.g., SEQ ID NOs: 2, 81, 85, and 97 of ⁇ 397)
  • WO 2006/068888 see, e.g., SEQ ID NOs: 1 and 3-6 of ⁇ 888
  • WO 2006/110689 see, e.g., SEQ ID NOs: 5-38 of ⁇ 689
  • WO2009/104964 see, e.g., SEQ ID NOs: 1-5, 7, 9, 20, 22, 24 and 31 of ⁇ 964
  • WO 2010/127097 see, e.g., SEQ ID NOs: 5-38 of ⁇ 097)
  • WO 2015/191508 see, e.g., SEQ ID NOs: 80-294 of ⁇ 508
  • rAAV particles have a capsid protein at least 80% or more identical, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e. up to 100% identical, to the VP1, VP2 and/or VP3 sequence of an AAV capsid disclosed in Intl. Appl. Publ. No.
  • WO 2003/052051 see, e.g., SEQ ID NO: 2 of ⁇ 051
  • WO 2005/033321 see, e.g., SEQ ID NOs: 123 and 88 of ⁇ 321)
  • WO 03/042397 see, e.g., SEQ ID NOs: 2, 81, 85, and 97 of ⁇ 397)
  • WO 2006/068888 see, e.g., SEQ ID NOs: 1 and 3-6 of ⁇ 888
  • WO 2006/110689 see, e.g., SEQ ID NOs: 5-38 of ⁇ 689
  • WO2009/104964 see, e.g., SEQ ID NOs: 1-5, 7, 9, 20, 22, 24 and 31 of 964
  • W02010/127097 see, e.g., SEQ ID NOs: 5-38 of ⁇ 097)
  • WO 2015/191508 see, e.g., SEQ ID NOs: 80-294 of ⁇ 508), and U.
  • rAAV particles comprise a pseudotyped AAV capsid.
  • the pseudotyped AAV capsids are rAAV2/8 or rAAV2/9 pseudotyped AAV capsids.
  • Methods for producing and using pseudotyped rAAV particles are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671 (2001); Halbert et al., J. Virol., 74:1524-1532 (2000); Zolotukhin et al., Methods 28:158-167 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075-3081, (2001).
  • ssAAV single-stranded AAV
  • a self-complementary vector e.g., scAAV
  • scAAV self-complementary vector
  • rAAV particles comprise a capsid protein from an AAV capsid serotype selected from AAV8 or AAV9.
  • the rAAV particles comprise a capsid protein from an AAV capsid serotype selected from the group consisting of AAV7, AAV8, AAV9, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, AAV.hu37, AAV.PHP.B, AAV.PHP.eB, and AAV.7m8.
  • AAV capsid protein from an AAV capsid serotype selected from the group consisting of AAV7, AAV8, AAV9, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, AAV.hu37, AAV.PHP.B, AAV.PHP.eB, and AAV.7m8.
  • the rAAV particles comprise a capsid protein with high sequence homology to AAV8 or AAV9 such as, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, and AAV.hu37.
  • the rAAV particles have an AAV capsid serotype of AAV1 or a derivative, modification, or pseudotype thereof.
  • the rAAV particles have an AAV capsid serotype of AAV4 or a derivative, modification, or pseudotype thereof.
  • the rAAV particles have an AAV capsid serotype of AAV5 or a derivative, modification, or pseudotype thereof. In some embodiments, the rAAV particles have an AAV capsid serotype of AAV8 or a derivative, modification, or pseudotype thereof. In some embodiments, the rAAV particles have an AAV capsid serotype of AAV9 or a derivative, modification, or pseudotype thereof. [00124] In some embodiments, rAAV particles comprise a capsid protein that is a derivative, modification, or pseudotype of AAV8 or AAV9 capsid protein.
  • rAAV particles comprise a capsid protein that has an AAV8 capsid protein at least 80% or more identical, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e. up to 100% identical, to the VP1, VP2 and/or VP3 sequence of AAV8 capsid protein.
  • rAAV particles comprise a capsid protein that is a derivative, modification, or pseudotype of AAV9 capsid protein.
  • rAAV particles comprise a capsid protein that has an AAV8 capsid protein at least 80% or more identical, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e. up to 100% identical, to the VP1, VP2 and/or VP3 sequence of AAV9 capsid protein.
  • the rAAV particles comprise a capsid protein that has at least 80% or more identity, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e.
  • the rAAV particles comprise a capsid protein that has at least 80% or more identity, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e. up to 100% identity, to the VP1, VP2 and/or VP3 sequence of an AAV capsid protein with high sequence homology to AAV8 or AAV9 such as, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, and AAV.hu37.
  • rAAV particles comprise a mosaic capsid.
  • Mosaic AAV particles are composed of a mixture of viral capsid proteins from different serotypes of AAV.
  • rAAV particles comprise a mosaic capsid containing capsid proteins of a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC
  • rAAV particles comprise a mosaic capsid containing capsid proteins of a serotype selected from AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.8, and AAVrh.10. [00128] In additional embodiments, rAAV particles comprise a pseudotyped rAAV particle.
  • the pseudotyped rAAV particle comprises (a) a nucleic acid vector comprising AAV ITRs and (b) a capsid comprised of capsid proteins derived from AAVx (e.g., AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10 AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16).
  • AAVx e.g., AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10 AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16.
  • rAAV particles comprise a pseudotyped rAAV particle comprised of a capsid protein of an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.
  • rAAV particles comprise a pseudotyped rAAV particle containing AAV8 capsid protein. In additional embodiments, rAAV particles comprise a pseudotyped rAAV particle is comprised of AAV9 capsid protein. In some embodiments, the pseudotyped rAAV8 or rAAV9 particles are rAAV2/8 or rAAV2/9 pseudotyped particles. Methods for producing and using pseudotyped rAAV particles are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671 (2001); Halbert et al., J.
  • rAAV particles comprise a capsid containing a capsid protein chimeric of two or more AAV capsid serotypes.
  • the capsid protein is a chimeric of 2 or more AAV capsid proteins from AAV serotypes selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4- 1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, rAAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8,
  • the capsid protein is a chimeric of 2 or more AAV capsid proteins from AAV serotypes selected from AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.8, and AAVrh.10.
  • the rAAV particles comprise an AAV capsid protein chimeric of AAV8 capsid protein and one or more AAV capsid proteins from an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.
  • the rAAV particles comprise an AAV capsid protein chimeric of AAV8 capsid protein and one or more AAV capsid proteins from an AAV serotype selected from AAV1, AAV2, AAV5, AAV6, AAV7, AAV9, AAV10, AAVrh.8, and AAVrh.10.
  • the rAAV particles comprise an AAV capsid protein chimeric of AAV9 capsid protein the capsid protein of one or more AAV capsid serotypes selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4- 1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV
  • the rAAV particles comprise an AAV capsid protein chimeric of AAV9 capsid protein the capsid protein of one or more AAV capsid serotypes selected from AAV1, AAV2, AAV3, AAV4, AAV5, AA6, AAV7, AAV8, AAV9, AAVrh.8, and AAVrh.10.
  • the rAAV particles comprises a Clade A, B, E, or F AAV capsid protein.
  • the rAAV particles comprises a Clade F AAV capsid protein.
  • the rAAV particles comprises a Clade E AAV capsid protein.
  • Table 9 below provides examples of amino acid sequences for an AAV8, AAV9, AAV.rh74, AAV.hu31, AAV.hu32, and AAV.hu37 capsid proteins and the nucleic acid sequence of AAV25’- and 3’ ITRs. Table 9:
  • the provided methods are suitable for use in the production of recombinant AAV encoding a transgene.
  • the transgene is a microdystrophin as described herein.
  • the rAAV genome comprises a vector comprising the following components: (1) AAV inverted terminal repeats that flank an expression cassette; (2) regulatory control elements, such as a) promoter/enhancers, b) a poly A signal, and c) optionally an intron; and (3) nucleic acid sequences coding for the described transgene.
  • constructs described herein comprise the following components: (1) AAV2 or AAV8 inverted terminal repeats (ITRs) that flank the expression cassette; (2) control elements, which include a muscle-specific SPc5.12 promoter and a small poly A signal; and (3) transgene providing (e.g., coding for) a nucleic acid encoding microdystrophin as described herein.
  • ITRs inverted terminal repeats
  • the constructs described herein comprise the following components: (1) AAV2 or AAV8 ITRs that flank the expression cassette; (2) control elements, which include a) the muscle-specific SPc5.12 promoter, b) a small poly A signal; and (3) microdystrophin cassette, which includes from the N-terminus to the C-terminus, ABD1-H1-R1-R2-R3-H3-R24-H4-CR, ABD1-H1-R1-R2-R3-H3-R24-H4-CR- CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R16-R17-R24- H4-CR-CT.
  • the constructs described herein comprise the following components: (1) AAV2 or AAV8 ITRs that flank the expression cassette; (2) control elements, which include a) a CNS promoter, b) a small poly A signal; and (3) microdystrophin cassette, which includes from the N-terminus to the C- terminus, ABD1-H1-R1-R2-R3-H3-R24-H4-CR, ABD1-H1-R1-R2-R3-H3-R24- H4-CR-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R16- R17-R24-H4-CR-CT.
  • the constructs described herein comprise the following components: (1) AAV2 or AAV8 ITRs that flank the expression cassette; (2) control elements, which include a) the muscle-specific SPc5.12 promoter, b) an intron (e.g., VH4) and c) a small poly A signal; and (3) microdystrophin cassette, which includes from the N-terminus to the C-terminus ABD1-H1-R1-R2-R3-H3-R24-H4-CR, ABD1-H1-R1-R2-R3-H3-R24-H4-CR- CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R16-R17-R24- H4-CR-CT, ABD1 being directly coupled to VH4.
  • control elements which include a) the muscle-specific SPc5.12 promoter, b) an intron (e.g., VH4) and c)
  • the constructs described herein comprise the following components: (1) AAV2 or AAV8 ITRs that flank the expression cassette; (2) control elements, which include a) a CNS promoter, b) an intron (e.g., VH4) and c) a small poly A signal; and (3) microdystrophin cassette, which includes from the N-terminus to the C-terminus ABD1-H1-R1-R2-R3-H3-R24-H4-CR, ABD1-H1-R1-R2-R3-H3-R24-H4-CR- CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R16-R17-R24- H4-CR-CT, ABD1 being directly coupled to VH4.
  • control elements which include a) a CNS promoter, b) an intron (e.g., VH4) and c) a small poly A signal
  • the constructs described herein comprise the following components: (1) AAV2 or AAV8 ITRs that flank the expression cassette; (2) control elements, which include a) a minimal SPc promoter for muscle-specific transgene expression, b) optionally, a human immunoglobin heavy chain variable region intron (e.g., VH4) and c) a small poly A signal; and (3) microdystrophin cassette, which includes from the N- terminus to the C-terminus ABD1-H1-R1-R2-R3-H3-R24-H4-CR, ABD1-H1-R1- R2-R3-H3-R24-H4-CR-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1- R1-R2-R16-R17-R24-H4-CR-CT.
  • control elements which include a) a minimal SPc promoter for muscle-specific transgene expression, b) optionally,
  • the constructs described herein comprise the following components: (1) AAV2 or AAV8 ITRs that flank the expression cassette; (2) control elements, which include a) the muscle- specific SPc5.12 promoter or a CNS promoter, b) an intron (e.g., VH4) and c) a small poly A signal; and (3) microdystrophin cassette, which includes from the N- terminus to the C-terminus ABD1-H1-R1-R2-R3-H2-R24-H4-CR, ABD1-H1-R1- R2-R3-H2-R24-H4-CR-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1- R1-R2-R16-R17-R24-H4-CR-CT, ABD1 being directly coupled to VH4.
  • control elements which include a) the muscle- specific SPc5.12 promoter or a CNS promoter, b) an intron (
  • nucleic acid embodiments of the present disclosure comprise rAAV vectors encoding microdystrophin comprising or consisting of a nucleotide sequence of SEQ ID NO: 53, 54, 55, 56, or 82 provided in Table 10 below.
  • an rAAV vector comprising a nucleotide sequence that has at least 50%, at least 60%, at least 70 %, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the nucleotide sequence of SEQ ID NO: 53, 54, 55, 56, 82 or the reverse complement thereof and encodes a rAAV vector suitable for expression of a therapeutically effective microdystrophin in muscle cells.
  • Table 10 RGX-DYS cassette nucleotide sequences
  • a molecule according to the invention is made by providing a nucleotide comprising the nucleic acid sequence encoding any of the capsid protein molecules herein; and using a packaging cell system to prepare corresponding rAAV particles with capsid coats made up of the capsid protein.
  • capsid proteins are described in Section 5.3.4, supra.
  • the nucleic acid sequence encodes a sequence having at least 60%, 70%, 80%, 85%, 90%, or 95%, preferably 96%, 97%, 98%, 99% or 99.9%, identity to the sequence of a capsid protein molecule described herein and retains (or substantially retains) biological function of the capsid protein and the inserted peptide from a heterologous protein or domain thereof.
  • the nucleic acid encodes a sequence having at least 60%, 70%, 80%, 85%, 90%, or 95%, preferably 96%, 97%, 98%, 99% or 99.9%, identity to the sequence of the AAV8 capsid protein, while retaining (or substantially retaining) biological function of the AAV8 capsid protein and the inserted peptide.
  • the capsid protein, coat, and rAAV particles may be produced by techniques known in the art.
  • the viral genome comprises at least one inverted terminal repeat to allow packaging into a vector.
  • the viral genome further comprises a cap gene and/or a rep gene for expression and splicing of the cap gene.
  • the cap and rep genes are provided by a packaging cell and not present in the viral genome.
  • the nucleic acid encoding the engineered capsid protein is cloned into an AAV Rep-Cap plasmid in place of the existing capsid gene. When introduced together into host cells, this plasmid helps package an rAAV genome into the engineered capsid protein as the capsid coat.
  • Packaging cells can be any cell type possessing the genes necessary to promote AAV genome replication, capsid assembly, and packaging.
  • Numerous cell culture-based systems are known in the art for production of rAAV particles, any of which can be used to practice a method disclosed herein.
  • the cell culture-based systems include transfection, stable cell line production, and infectious hybrid virus production systems which include, but are not limited to, adenovirus-AAV hybrids, herpesvirus-AAV hybrids and baculovirus-AAV hybrids.
  • rAAV production cultures for the production of rAAV virus particles require: (1) suitable host cells, including, for example, human-derived cell lines, mammalian cell lines, or insect-derived cell lines; (2) suitable helper virus function, provided by wild type or mutant adenovirus (such as temperature-sensitive adenovirus), herpes virus, baculovirus, or a plasmid construct providing helper functions; (3) AAV rep and cap genes and gene products; (4) a transgene (such as a therapeutic transgene) flanked by AAV ITR sequences and optionally regulatory elements; and (5) suitable media and media components (nutrients) to support cell growth/survival and rAAV production.
  • suitable host cells including, for example, human-derived cell lines,
  • Nonlimiting examples of host cells include: A549, WEHI, 10T1/2, BHK, MDCK, COS1, COS7, BSC 1, BSC 40, BMT 10, VERO, W138, HeLa, HEK293 and their derivatives (HEK293T cells, HEK293F cells), Saos, C2C12, L, HT1080, HepG2, primary fibroblast, hepatocyte, myoblast cells, CHO cells or CHO-derived cells, or insect-derived cell lines such as SF-9 (e.g. in the case of baculovirus production systems).
  • SF-9 insect-derived cell lines
  • a method of producing rAAV particles comprising (a) providing a cell culture comprising an insect cell; (b) introducing into the cell one or more baculovirus vectors encoding at least one of: i. an rAAV genome to be packaged, ii. an AAV rep protein sufficient for packaging, and iii. an AAV cap protein sufficient for packaging; (c) adding to the cell culture sufficient nutrients and maintaining the cell culture under conditions that allow production of the rAAV particles.
  • the method comprises using a first baculovirus vector encoding the rep and cap genes and a second baculovirus vector encoding the rAAV genome. In some embodiments, the method comprises using a baculovirus encoding the rAAV genome and an insect cell expressing the rep and cap genes. In some embodiments, the method comprises using a baculovirus vector encoding the rep and cap genes and the rAAV genome.
  • the insect cell is an Sf-9 cell. In some embodiments, the insect cell is an Sf-9 cell comprising one or more stably integrated heterologous polynucleotide encoding the rep and cap genes.
  • a method disclosed herein uses a baculovirus production system.
  • the baculovirus production system uses a first baculovirus encoding the rep and cap genes and a second baculovirus encoding the rAAV genome.
  • the baculovirus production system uses a baculovirus encoding the rAAV genome and a host cell expressing the rep and cap genes.
  • the baculovirus production system uses a baculovirus encoding the rep and cap genes and the rAAV genome.
  • the baculovirus production system uses insect cells, such as Sf-9 cells.
  • a skilled artisan is aware of the numerous methods by which AAV rep and cap genes, AAV helper genes (e.g., adenovirus E1a gene, E1b gene, E4 gene, E2a gene, and VA gene), and rAAV genomes (comprising one or more genes of interest flanked by inverted terminal repeats (ITRs)) can be introduced into cells to produce or package rAAV.
  • AAV helper genes e.g., adenovirus E1a gene, E1b gene, E4 gene, E2a gene, and VA gene
  • ITRs inverted terminal repeats
  • helper viruses including adenovirus and herpes simplex virus (HSV), promote AAV replication and certain genes have been identified that provide the essential functions, e.g. the helper may induce changes to the cellular environment that facilitate such AAV gene expression and replication.
  • AAV rep and cap genes, helper genes, and rAAV genomes are introduced into cells by transfection of one or more plasmid vectors encoding the AAV rep and cap genes, helper genes, and rAAV genome.
  • AAV rep and cap genes, helper genes, and rAAV genomes can be introduced into cells by transduction with viral vectors, for example, rHSV vectors encoding the AAV rep and cap genes, helper genes, and rAAV genome.
  • viral vectors for example, rHSV vectors encoding the AAV rep and cap genes, helper genes, and rAAV genome.
  • one or more of AAV rep and cap genes, helper genes, and rAAV genomes are introduced into the cells by transduction with an rHSV vector.
  • the rHSV vector encodes the AAV rep and cap genes.
  • the rHSV vector encodes the helper genes.
  • the rHSV vector encodes the rAAV genome.
  • the rHSV vector encodes the AAV rep and cap genes. In some embodiments, the rHSV vector encodes the helper genes and the rAAV genome. In some embodiments, the rHSV vector encodes the helper genes and the AAV rep and cap genes. [00145] In one aspect, provided herein is a method of producing rAAV particles, comprising (a) providing a cell culture comprising a host cell; (b) introducing into the cell one or more rHSV vectors encoding at least one of: i. an rAAV genome to be packaged, ii. helper functions necessary for packaging the rAAV particles, iii. an AAV rep protein sufficient for packaging, and iv.
  • the rHSV vector encodes the AAV rep and cap genes. In some embodiments, the rHSV vector encodes helper functions. In some embodiments, the rHSV vector comprises one or more endogenous genes that encode helper functions. In some embodiments, the rHSV vector comprises one or more heterogeneous genes that encode helper functions. In some embodiments, the rHSV vector encodes the rAAV genome. In some embodiments, the rHSV vector encodes the AAV rep and cap genes. In some embodiments, the rHSV vector encodes helper functions and the rAAV genome.
  • the rHSV vector encodes helper functions and the AAV rep and cap genes.
  • the cell comprises one or more stably integrated heterologous polynucleotide encoding the rep and cap genes.
  • a method of producing rAAV particles comprising (a) providing a cell culture comprising a mammalian cell; (b) introducing into the cell one or more polynucleotides encoding at least one of: i. an rAAV genome to be packaged, ii. helper functions necessary for packaging the rAAV particles, iii. an AAV rep protein sufficient for packaging, and iv.
  • the helper functions are encoded by adenovirus genes.
  • the mammalian cell comprises one or more stably integrated heterologous polynucleotide encoding the rep and cap genes.
  • AAV rep and cap genes are encoded by one plasmid vector.
  • AAV helper genes e.g., adenovirus E1a gene, E1b gene, E4 gene, E2a gene, and VA gene
  • the E1a gene or E1b gene is stably expressed by the host cell, and the remaining AAV helper genes are introduced into the cell by transfection by one viral vector.
  • the E1a gene and E1b gene are stably expressed by the host cell, and the E4 gene, E2a gene, and VA gene are introduced into the cell by transfection by one plasmid vector.
  • one or more helper genes are stably expressed by the host cell, and one or more helper genes are introduced into the cell by transfection by one plasmid vector.
  • the helper genes are stably expressed by the host cell.
  • AAV rep and cap genes are encoded by one viral vector.
  • AAV helper genes e.g., adenovirus E1a gene, E1b gene, E4 gene, E2a gene, and VA gene
  • the E1a gene or E1b gene is stably expressed by the host cell, and the remaining AAV helper genes are introduced into the cell by transfection by one viral vector.
  • the E1a gene and E1b gene are stably expressed by the host cell, and the E4 gene, E2a gene, and VA gene are introduced into the cell by transfection by one viral vector.
  • one or more helper genes are stably expressed by the host cell, and one or more helper genes are introduced into the cell by transfection by one viral vector.
  • the AAV rep and cap genes, the adenovirus helper functions necessary for packaging, and the rAAV genome to be packaged are introduced to the cells by transfection with one or more polynucleotides, e.g., vectors.
  • a method disclosed herein comprises transfecting the cells with a mixture of three polynucleotides: one encoding the cap and rep genes, one encoding adenovirus helper functions necessary for packaging (e.g., adenovirus E1a gene, E1b gene, E4 gene, E2a gene, and VA gene), and one encoding the rAAV genome to be packaged.
  • the AAV cap gene is an AAV8 or AAV9 cap gene.
  • the AAV cap gene is an AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.PHB, or AAV.7m8 cap gene.
  • the AAV cap gene encodes a capsid protein with high sequence homology to AAV8 or AAV9 such as, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, and AAV.hu37.
  • the vector encoding the rAAV genome to be packaged comprises a gene of interest flanked by AAV ITRs.
  • the AAV ITRs are from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10 , AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC
  • any combination of vectors can be used to introduce AAV rep and cap genes, AAV helper genes, and rAAV genome to a cell in which rAAV particles are to be produced or packaged.
  • a first plasmid vector encoding an rAAV genome comprising a gene of interest flanked by AAV inverted terminal repeats (ITRs), a second vector encoding AAV rep and cap genes, and a third vector encoding helper genes can be used.
  • ITRs AAV inverted terminal repeats
  • a second vector encoding AAV rep and cap genes a third vector encoding helper genes
  • a mixture of the three vectors is co-transfected into a cell.
  • a combination of transfection and infection is used by using both plasmid vectors as well as viral vectors.
  • one or more of rep and cap genes, and AAV helper genes are constitutively expressed by the cells and does not need to be transfected or transduced into the cells.
  • the cell constitutively expresses rep and/or cap genes.
  • the cell constitutively expresses one or more AAV helper genes.
  • the cell constitutively expresses E1a.
  • the cell comprises a stable transgene encoding the rAAV genome.
  • AAV rep, cap, and helper genes e.g., Ela gene, E1b gene, E4 gene, E2a gene, or VA gene
  • AAV rep, cap, and helper genes can be of any AAV serotype.
  • AAV ITRs can also be of any AAV serotype.
  • AAV ITRs are from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10 , AAV.HSC
  • AAV cap gene is from AAV8 or AAV9 cap gene.
  • an AAV cap gene is from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10
  • AAV rep and cap genes for the production of a rAAV particle are from different serotypes.
  • the rep gene is from AAV2 whereas the cap gene is from AAV8.
  • the rep gene is from AAV2 whereas the cap gene is from AAV9.
  • the rep gene is from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC
  • the rep and the cap genes are from the same serotype. In still other embodiments, the rep and the cap genes are from the same serotype, and the rep gene comprises at least one modified protein domain or modified promoter domain. In certain embodiments, the at least one modified domain comprises a nucleotide sequence of a serotype that is different from the capsid serotype. The modified domain within the rep gene may be a hybrid nucleotide sequence consisting fragments different serotypes.
  • Hybrid rep genes provide improved packaging efficiency of rAAV particles, including packaging of a viral genome comprising a microdystrophin transgene greater than 4 kb, greater than 4.1 kb, greater than 4.2 kB, greater than 4.3 kb, greater than 4.4 kB, greater than 4.5 kb, or greater than 4.6 kb.
  • AAV rep genes consist of nucleic acid sequences that encode the non-structural proteins needed for replication and production of virus. Transcription of the rep gene initiates from the p5 or p19 promoters to produce two large (Rep78 and Rep68) and two small (Rep52 and Rep40) nonstructural Rep proteins, respectively.
  • Rep78/68 domain contains a DNA-binding domain that recognizes specific ITR sequences within the ITR. All four Rep proteins have common helicase and ATPase domains that function in genome replication and/or encapsidation (Maurer AC, 2020, DOI: 10.1089/hum.2020.069). Transcription of the cap gene initiates from a p40 promoter, which sequence is within the C-terminus of the rep gene, and it has been suggested that other elements in the rep gene may induce p40 promoter activity.
  • the p40 promoter domain includes transcription factor binding elements EF1A, MLTF, and ATF, Fos/Jun binding elements (AP-1), Sp1-like elements (Sp1 and GGT), and the TATA element (Pereira and Muzyczka, Journal of Virology, June 1997, 71(6):4300–4309).
  • the rep gene comprises a modified p40 promoter.
  • the p40 promoter is modified at any one or more of the EF1A binding element, MLTF binding element, ATF binding element, Fos/Jun binding elements (AP-1), Sp1-like elements (Sp1 or GGT), or the TATA element.
  • the rep gene is of serotype 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, rh8, rh10, rh20, rh39, rh.74, RHM4-1, or hu37, and the portion or element of the p40 promoter domain is modified to serotype 2.
  • the rep gene is of serotype 8 or 9, and the portion or element of the p40 promoter domain is modified to serotype 2.
  • ITRs contain A and A’ complimentary sequences, B and B’ complimentary sequences, and C and C’ complimentary sequences; and the D sequence is contiguous with the ssDNA genome.
  • the complimentary sequences of the ITRs form hairpin structures by self-annealing (Berns KI. The Unusual Properties of the AAV Inverted Terminal Repeat. Hum Gene Ther 2020).
  • the D sequence contains a Rep Binding Element (RBE) and a terminal resolution site (TRS), which together constitute the AAV origin of replication.
  • RBE Rep Binding Element
  • TRS terminal resolution site
  • the ITRs are also required as packaging signals for genome encapsidation following replication.
  • the ITR sequences and the cap genes are from the same serotype, except that one or more of the A and A’ complimentary sequences, B and B’ complimentary sequences, C and C’ complimentary sequences, or the D sequence may be modified to contain sequences from a different serotype than the capsid.
  • the modified ITR sequences are from the same serotype as the rep gene.
  • the ITR sequences and the cap genes are from different serotypes, except that one or more of the ITR sequences selected from A and A’ complimentary sequences, B and B’ complimentary sequences, C and C’ complimentary sequences, or the D sequence are from the same serotype as the capsid (cap gene), and one or more of the ITR sequences are from the same serotype as the rep gene.
  • the rep and the cap genes are from the same serotype, and the rep gene comprises a modified Rep78 domain, DNA binding domain, endonuclease domain, ATPase domain, helicase domain, p5 promoter domain, Rep68 domain, p5 promoter domain, Rep52 domain, p19 promoter domain, Rep40 domain or p40 promoter domain.
  • the rep and the cap genes are from the same serotype, and the rep gene comprises at least one protein domain or promoter domain from a different serotype.
  • an rAAV comprises a transgene flanked by AAV2 ITR sequences, an AAV8 cap, and a hybrid AAV2/8 rep.
  • the AAV2/8 rep comprises serotype 8 rep except for the p40 promoter domain or a portion thereof is from serotype 2 rep. In other embodiments, the AAV2/8 rep comprises serotype 2 rep except for the p40 promoter domain or a portion thereof is from serotype 8 rep. In some embodiments, more than two serotypes may be utilized to construct a hybrid rep/cap plasmid. [00155] Any suitable method known in the art may be used for transfecting a cell may be used for the production of rAAV particles according to a method disclosed herein. In some embodiments, a method disclosed herein comprises transfecting a cell using a chemical based transfection method.
  • the chemical-based transfection method uses calcium phosphate, highly branched organic compounds (dendrimers), cationic polymers (e.g., DEAE dextran or polyethylenimine (PEI)), lipofection.
  • the chemical-based transfection method uses cationic polymers (e.g., DEAE dextran or polyethylenimine (PEI)).
  • the chemical-based transfection method uses polyethylenimine (PEI).
  • the chemical-based transfection method uses DEAE dextran.
  • the chemical-based transfection method uses calcium phosphate.
  • Standard techniques can be used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., electroporation, lipofection).
  • Enzymatic reactions and purification techniques can be performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein.
  • the foregoing techniques and procedures can be generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)), which is incorporated herein by reference for any purpose.
  • the rAAVs provide transgene delivery vectors that can be used in therapeutic and prophylactic applications, as discussed in more detail below.
  • Therapeutic Utility Provided are methods of assaying the constructs, including recombinant gene therapy vectors, encoding microdystrophins, as disclosed herein, for therapeutic efficacy. Methods include both in vitro and in vivo tests in animal models as described herein or using any other methods known in the art for testing the activity and efficacy of microdystrophins.
  • a recombinant vector disclosed herein for example rAAV particles.
  • the infectivity of recombinant gene therapy vectors in muscle cells can be tested in C2C12 myoblasts as described in Example 2, herein.
  • Several muscle or heart cell lines may be utilized, including but not limited to T0034 (human), L6 (rat), MM14 (mouse), P19 (mouse), G-7 (mouse), G-8 (mouse), QM7 (quail), H9c2(2-1) (rat), Hs 74.Ht (human), and Hs 171.Ht (human) cell lines.
  • Vector copy numbers may be assess using polymerase chain reaction techniques and level of microdystrophin expression may be tested by measuring levels of microdystrophin mRNA in the cells. 5.4.2 Animal Models [00161] The efficacy of a viral vector containing a transgene encoding a microdystrophin as described herein may be tested by administering to an animal model to replace mutated dystrophin, for example, by using the mdx mouse and/or the golden retriever muscular dystrophy (GRMD) model and to assess the biodistribution, expression and therapeutic effect of the transgene expression. The therapeutic effect may be assessed, for example, by assessing change in muscle strength in the animal receiving the microdystrophin transgene.
  • GRMD golden retriever muscular dystrophy
  • compositions and methods for therapeutic administration comprising a dose of a microdystrophin encoding vector disclosed herein in an amount demonstrated to be effective according to the methods for assessing therapeutic efficacy disclosed here.
  • 5.4.2.1 Murine Models [00162] The efficacy of gene therapy vectors may be assessed in murine models of DMD.
  • the mdx mouse model (Yucel, N., et al, Humanizing the mdx mouse model of DMD: the long and the short of it, Regenerative Medicine volume 3, Article number: 4 (2016)), carries a nonsense mutation in exon 23, resulting in an early termination codon and a truncated protein (mdx). Mdx mice have 3-fold higher blood levels of pyruvate kinase activity compared to littermate controls. Like the human DMD disease, mdx skeletal muscles exhibit active myofiber necrosis, cellular infiltration, a wide range of myofiber sizes and numerous centrally nucleated regenerating myofibers.
  • This phenotype is enhanced in the diaphragm, which undergoes progressive degeneration and myofiber loss resulting in an approximately 5-fold reduction in muscle isometric strength. Necrosis and regeneration in hind-limb muscles peaks around 3–4 weeks of age, but plateaus thereafter. In mdx mice and mdx mice crossed onto other mouse backgrounds (for example DBA/2J), a mild but significant decrease in cardiac ejection fraction is observed (Van Westering, Molecules 2015, 20, 8823-8855). Such DMD model mice with cardiac functional defects may be used to assess the cardioprotective effects or improvement or maintenance of cardiac function or attenuation of cardiac dysfunction of the gene therapy vectors described herein.
  • Example 3 herein details use of the mdx mouse model to assess gene therapy vectors encoding microdystrophins.
  • Additional mdx mouse models A number of alternative versions in different genetic backgrounds have been generated including the mdx2cv, mdx3cv, mdx4cv, and mdx5cv lines (C57BL/6 genetic background). These models were created by treating mice with N-ethyl-N-nitrosourea, a chemical mutagen. Each strain carries a different point mutation. As a whole, there are few differences in the presentation of disease phenotypes in the mdxcv models compared to the mdx mouse.
  • mice models have been created by crossing the mdx line to various knock-out mouse models (e.g. Myod1 -/- , ⁇ -Integrin7 -/- , ⁇ -Dystrobrevin -/- , and Utrophin -/- ). All mouse models which are currently used to study DMD have been described in detail by Yucel, N., et al, Humanizing the mdx mouse model of DMD: the long and the short of it, npj Regenerative Medicine volume 3, Article number: 4 (2018), which is incorporated herein by reference.
  • GRMD golden retriever muscular dystrophy
  • Phenotypic features in dogs include elevation of serum CK, CRDs on EMG, and histopathologic evidence of grouped muscle fiber necrosis and regeneration. Phenotypic variability is frequently observed in GRMD, as in humans. GRMD dogs develop paradoxical muscle hypertrophy which seems to play a role in the phenotype of affected dogs, with stiffness at gait, decreased joint range of motion, and trismus being common features. Objective biomarkers to evaluate disease progression include tetanic flexion, tibiotarsal joint angle, % eccentric contraction decrement, maximum hip flexion angle, pelvis angle, cranial sartorius circumference, and quadriceps femoris weight. 5.5.
  • Methods of Treatment Provided are methods of treating human subjects for any muscular dystrophy disease that can be treated by providing a functional dystrophin.
  • DMD is the most common of such disease, but the gene therapy vectors that express microdystrophin provided herein can be administered to treat Becker muscular dystrophy (BMD), myotonic muscular dystrophy (Steinert’s disease), Facioscapulohumeral disease (FSHD), limb-girdle muscular dystrophy, X-linked dilated cardiomyopathy, or oculopharyngeal muscular dystrophy.
  • BMD Becker muscular dystrophy
  • Stepinert myotonic muscular dystrophy
  • FSHD Facioscapulohumeral disease
  • limb-girdle muscular dystrophy X-linked dilated cardiomyopathy
  • oculopharyngeal muscular dystrophy oculopharyngeal muscular dystrophy.
  • the microdystrophin of the present disclosure may be any microdystrophin described herein, including those that have the domains in an N-terminal to C-terminal order of ABD-H1-R1-R2-R3-H3-R24-H4-CR, ABD-H1-R1-R2-R3-H3-R24-H4-CR- CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R16-R17-R24- H4-CR-CT, wherein ABD is an actin-binding domain of dystrophin, H1 is a hinge 1 region of dystrophin, R1 is a spectrin 1 region of dystrophin, R2 is a spectrin 2 region of dystrophin, R3 is a spectrin 3 region of dystrophin, H3 is a hinge 3 region of dystrophin, R16 is a spectrin 16 region of dystroph
  • the microdystrophin has an amino acid sequence of SEQ ID Nos: 1, 2, 79, 91, 92, or 93.
  • the vectors encoding the microdystrophin include those having a nucleic acid sequence of SEQ ID NO: 20, 21, 81, 101, 102 or 103, in certain embodiments, operably linked to regulatory elements for constitutive, muscle- specific (including skeletal, smooth muscle and cardiac muscle-specific) expression, or CNS specific expression, and other regulatory elements such as poly A sites.
  • Such nucleic acids may be in the context of an rAAV genome, for example, flanked by ITR sequences, particularly, AAV2 ITR sequences.
  • the methods and compositions comprising administering to a subject in need thereof, an rAAV comprising the construct having a nucleic acid sequence of SEQ ID NO: 53, 54, 55, 56, 82, 104, 105, or 106.
  • the patient has been diagnosed with and/or has symptom(s) associated with DMD.
  • Recombinant vectors used for delivering the transgene encoding the microdystrophin are described in Section 5.3.4.1. Such vectors should have a tropism for human muscle cells (including skeletal muscle, smooth mucle and/or cardiac muscle) and can include non-replicating rAAV, particularly those bearing an AAV8 capsid.
  • the recombinant vectors such as those shown in FIG.
  • Subjects to whom such gene therapy is administered can be those responsive to gene therapy mediated delivery of a microdystrophin to muscles.
  • the methods encompass treating patients who have been diagnosed with DMD or other muscular dystrophy disease, such as, Becker muscular dystrophy (BMD), myotonic muscular dystrophy (Steinert’s disease), Facioscapulohumeral disease (FSHD), limb-girdle muscular dystrophy, X-linked dilated cardiomyopathy, or oculopharyngeal muscular dystrophy, or have one or more symptoms associated therewith, and identified as responsive to treatment with microdystrophin, or considered a good candidate for therapy with gene mediated delivery of microdystrophin.
  • the patients have previously been treated with synthetic version of dystrophin and have been found to be responsive to one or more of synthetic versions of dystrophin.
  • the synthetic version of dystrophin may be administered directly to the subject.
  • Therapeutically effective doses of any such recombinant vector should be administered in any manner such that the recombinant vector enters the muscle (e.g., skeletal muscle or cardiac muscle), preferably by introducing the recombinant vector into the bloodstream.
  • the vector is administered subcutaneously, intramuscularly or intravenously.
  • Intramuscular, subcutaneous, or intravenous administration should result in expression of the soluble transgene product in cells of the muscle (including skeletal muscle, cardiac muscle, and/or smooth muscle) and/or the CNS.
  • the expression of the transgene product results in delivery and maintenance of the transgene product in the muscle and/or the CNS.
  • the delivery may result in gene therapy delivery and expression of the microdystrophin in the liver, and the soluble microdystrophin product is then carried through the bloodstream to the muscles where it can impart its therapeutic effect.
  • the recombinant vector may be administered such that it is delivered to the CNS, for example, but not limited to, intrathecally, intracerebroventricularly, intranasally or suprachoroidally.
  • the actual dose amount administered to a particular subject can be determined by a clinician, considering parameters such as, but not limited to, physical and physiological factors including body weight, severity of condition, type of disease, previous or concurrent therapeutic interventions, idiopathy of the subject, and/or route of administration.
  • Doses can range from 1 ⁇ 10 8 vector genomes per kg (vg/kg) to 1 ⁇ 10 15 vg/kg.
  • Therapeutically effective amounts can be achieved by administering single or multiple doses during the course of a treatment regimen (i.e., days, weeks, months, etc.).
  • compositions suitable for intravenous, intramuscular, subcutaneous or hepatic administration comprise a suspension of the recombinant vector comprising the transgene encoding microdystrophin in a formulation buffer comprising a physiologically compatible aqueous buffer.
  • the formulation buffer can comprise one or more of a polysaccharide, a surfactant, polymer, or oil.
  • the gene therapy vectors provided herein may be administered in combination with other treatments for muscular dystrophy, including corticosteroids, beta blockers and ACE inhibitors. 5.5.1 Muscle degeneration/regeneration [00172] Deletion of dystrophin results in mechanical instability causing myofibers to weaken and eventually break during contraction.
  • the goal of gene therapy treatment provided herein is to slow or arrest the progression of DMD, or other muscular dystrophy disease, or to reduce the severity of one or more symptoms associated with DMD, or other muscular dystrophy disease.
  • the goal of gene therapy provided herein is to reduce muscle degeneration, induce/improve muscle regeneration, and/or prevent/reduce downstream pathologies including inflammation and fibrosis that interfere with muscle regeneration and cause loss of movement, orthopedic complications, and, ultimately, respiratory and cardiac failure.
  • Efficacy may be monitored by measuring changes from baseline in gross motor function using the North Star Ambulatory Assessment (NSAA) (scale is ordinal with 34 as the maximum score indicating fully-independent function) or an age-appropriate modified assessment, by assessing changes in ambulatory function (e.g.
  • NSAA North Star Ambulatory Assessment
  • scale is ordinal with 34 as the maximum score indicating fully-independent function
  • an age-appropriate modified assessment by assessing changes in ambulatory function (e.g.
  • 6-min distance walked ⁇ 300m, between 300 and 400m, or > 400m
  • a timed function test to measure changes from baseline in time taken to stand from a supine position (1 to 8s (good), 8 to 20s (moderate), and 20 to 35s (poor)
  • time to climb (4 steps)
  • time to run/walk assessments (10 meters)
  • myometry to evaluate changes from baseline in strength of upper and lower extremities
  • Efficacy may also be monitored by measuring changes (reduction) from baseline in serum creatine kinase (CK) levels (normal: 35-175 U/L, DMD: 500- 20,000 U/L), an enzyme that is found in abnormally high levels when muscle is damaged, serum or urine creatinine levels (DMD: 10-25 ⁇ mol/L, mild BMD: 20- 30 ⁇ mol/L, normal > 53 ⁇ mol/L, DMD) and microdystrophin protein levels in muscle biopsies.
  • Magentic Resonance Imaging MRI may also be performed to assess fatty tissue infiltration in skeletal muscle (fat fraction) (Burakiewicz, J. et al.
  • nucleic acid compositions and methods of administering those compositions that improve gross motor function or slow the loss of gross motor function, for example, as measured using the North Start Ambulatory Assessment to assess ambulatory function as compared to an untreated control or to the subject prior to treatment with the nucleic acid composition.
  • nucleic acid compositions described herein and the methods of administering nucleic acid compositions results in an improvement in gross motor function or reduction in the loss of gross motor function as assessed by a timed function test to measure time taken to stand from a supine position, myometry, or reduction in serum creatinine kinase (CK) levels or reduction in fatty tissue infiltration.
  • Serum creatinine kinase levels may be further separated into its isoenzyme fractions, MM-CPK (skeletal muscle), BB-CPK (brain), and MB-CPK (heart).
  • compositions comprising an amount of a nucleic acid composition, including, in particular, gene cassette containing vectors, viral vectors, and AAV vectors, comprising a nucleic acid sequence encoding a microdystrophin described herein that is effective to improve gross motor function or slow the loss of gross motor function, for example, as measured using the North Start Ambulatory Assessment to assess ambulatory function as compared to an untreated control or to the subject prior to treatment with the nucleic acid composition; or as assessed by a timed function test to measure time taken to stand from a supine position, or to demonstrate improvement by myometry, or reduction in serum creatinine kinase levels.
  • a nucleic acid composition including, in particular, gene cassette containing vectors, viral vectors, and AAV vectors, comprising a nucleic acid sequence encoding a microdystrophin described herein that is effective to improve gross motor function or slow the loss of gross motor function, for example, as measured using the North Start Ambulatory Assessment to assess
  • DMD dilated cardiomyopathy
  • LV left ventricle
  • Atrophic cardiomyocytes exhibit a loss of striations, vacuolization, fragmentation, and nuclear degeneration.
  • DMD may be associated with various ECG changes like sinus tachycardia, reduction of circadian index, decreased heart rate variability, short PR interval, right ventricular hypertrophy, S-T segment depression and prolonged QTc.
  • Gene therapy treatment provided herein can slow or arrest the progression of DMD and other dystrophinopathies, particularly to reduce the progression of or attenuate cardiac dysfunction and/or maintain or improve cardiac function.
  • Efficacy may be monitored by periodic evaluation of signs and symptoms of cardiac involvement or heart failure that are appropriate for the age and disease stage of the trial population, using serial electrocardiograms, and serial noninvasive imaging studies (e.g., echocardiography or cardiac magnetic resonance imaging (CMR)).
  • CMR may be used to monitor changes from baseline in forced vital capacity (FVC), forced expiratory volume (FEV1), maximum inspiratory pressure (MIP), maximum expiratory pressure (MEP), peak expiratory flow (PEF), peak cough flow, left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), inflammation, and fibrosis.
  • ECG may be used to monitor conduction abnormalities and arrythmias.
  • ECG may be used to assess normalization of the PR interval, R waves in V1, Q waves in V6, ventricular repolarization, QS waves in inferior and/or upper lateral wall, conduction disturbances in right bundle branch, QT C, and QRS.
  • nucleic acid compositions including compositions comprising gene expression cassettes and viral vectors, comprising a nucleic acid encoding a microdystrophin protein disclosed herein, and methods of administering those compositions that improve or maintain cardiac function or slow the loss of cardiac function, for example, by preventing reductions in decreasing LVEF below 45% and/or normalization of function (LVFS ⁇ 28%) as measured by serial electrocardiograms, and/or serial noninvasive imaging studies (e.g., echocardiography or cardiac magnetic resonance imaging (CMR)). Measurements may be compared to an untreated control or to the subject prior to treatment with the nucleic acid composition.
  • CMR cardiac magnetic resonance imaging
  • nucleic acid compositions described here in and the methods of administering nucleic acid compositions results in an improvement in cardiac function or reduction in the loss of cardiac function as assessed by monitoring changes from baseline in forced vital capacity (FVC), forced expiratory volume (FEV1), maximum inspiratory pressure (MIP), maximum expiratory pressure (MEP), peak expiratory flow (PEF), peak cough flow, left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), inflammation, and fibrosis.
  • FVC forced vital capacity
  • FEV1 forced expiratory volume
  • MIP maximum inspiratory pressure
  • MEP maximum expiratory pressure
  • PEF peak expiratory flow
  • peak cough flow peak cough flow
  • LVEF left ventricular ejection fraction
  • LVFS left ventricular fractional shortening
  • inflammation and fibrosis.
  • ECG may be used to monitor conduction abnormalities and arrythmias.
  • ECG may be used to assess normalization of the PR interval, R waves in V1, Q waves in V6, ventricular repolarization, QS waves in inferior and/or upper lateral wall, conduction disturbances in right bundle branch, QT C, and QRS.
  • a portion of patients with DMD can also have epilepsy, learning and cognitive impairment, dyslexia, neurodevelopment disorders such as attention deficit hyperactive disorder (ADHD), autism, and/or psychiatric disorders, such as obsessive-compulsive disorder, anxiety or sleep disorders.
  • the goal of gene therapy treatments disclosed herein can be to improve cognitive function or alleviate symptoms of epilepsy and/or psychiatric disorders.
  • Efficacy may be assessed by periodic evaluation of behavior and cognitive function that are appropriate for the age and disease stage of the trial population and or by quantifying and qualifying seizure events.
  • nucleic acid compositions and methods of administering the microdystrophin gene therapy compositions that improve cognitive function, reduce the occurrence or severity of seizures, alleviate symptoms of ADHD, obsessive-compulsive disorder, anxiety and/or sleep disorders. 5.5.4 Patient primary endpoints
  • the efficacy of the compositions, including the dosage of the composition, and methods described herein may be assessed in clinical evaluation of subjects being treated.
  • Patient primary endpoints may include monitoring the change from baseline in forced vital capacity (FVC), forced expiratory volume (FEV1), maximum inspiratory pressure (MIP), maximum expiratory pressure (MEP), peak expiratory flow (PEF), peak cough flow, left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), change from baseline in the NSAA, change from baseline in the Performance of Upper Limp (PUL) score, and change from baseline in the Brooke Upper Extremity Scale score (Brooke score), change from baseline in grip strength, pinch strength, change in cardiac fibrosis score by MRI, change in upper arm (bicep) muscle fat and fibrosis assessed by MRI, measurement of leg strength using a dynamometer, walk test 6-minutes, walk test 10-minutes, walk analysis – 3D recording of walking, change in utrophin membrane staining via quantifiable imaging of immunostained biopsy sections, and a change in regenerating fibers by measuring (via muscle biopsy) a combination of fiber size and neonatal my
  • DMD microdystrophin
  • N-terminal-ABD1-H1-R1-R2-R3-H3-R24-H4-CR-CT-C- terminal was synthesized using GeneArt Gene Synthesis (Invitrogen, Thermo Fisher, Waltham, MA).
  • the desired C-terminus was made by site directed mutagenesis using the following two primers: 5′: TGA CTC GAG AGG CCT AAT AAA GAG C (SEQ ID NO: 43), 3′: CCT TGG AGA CTG TGG AGA GGT G (SEQ ID NO: 44).
  • RGX-DYS2 having the VH4 intron sequence (see Section 6.1.4 below)
  • a fragment containing the nucleotide sequence encoding the microdystrophin was cohesively ligated to a backbone plasmid containing AAV ITRs, origin of replication, and antibiotic resistance, to form the RGX-DYS2 plasmid construction.
  • Sequence analysis revealed an extra cytosine (C) in the 5′ splicing site of the intron, therefore, the extra C nucleotide was removed by site- directed mutagenesis method, and the resulting construct RGX-DYS2 contains the VH4 intron.
  • C cytosine
  • RGX-DYS3 (FIG. 1A) was engineered encoding the microdystrophin of the RGX-DYS1 and RGX-DYS2 constructs detailed above without the CT domain. This construct includes the VH4 intron at the 5’end of the construct.
  • RGX-DYS4 (FIG. 1A) was engineered encoding the microdystrophin of the RGX-DYS1 and RGX-DYS2 constructs detailed above without the CT domain. This construct includes the VH4 intron at the 5’end of the construct.
  • RGX-DYS4 (FIG.
  • RGX-DYS5 contains a cassette encoding the microdystrophin and VH4 intron as in RGX-DYS2 linked to a minimal SPc5-12 promoter (SEQ ID NO: 40; see Section 6.1.3) rather than the full length SPc5-12 promoter. 6.1.3. Recombinant engineering of RGX-DYS5 [00189] A construct RGX-DYS5 (FIG.
  • DYS5 amino acid sequence of SEQ ID NO: 79
  • C-terminal domain 140 amino acids in length
  • truncated C-Terminal Domain having an amino acid sequence of SEQ ID NO: 83
  • the plasmid encodes the human codon-optimized and CpG depleted version of microdystrophin DYS5 transgene, a synthetic muscle promoter (e.g.
  • Plasmid RGX-DYS5 was created by replacing the long version of C- terminus of DYS1 in plasmid RGX-DYS1 with an intermediate length version of the C-terminus tail.
  • a gBlock-DMD-1.5 tail was synthesized from Integrated DNA technologies containing the intermediate version of the C-terminus flanked by EcoRV and NheI sites and 17 bp of the overlapping sequence of the RGX-DYS1 plasmid.
  • the source plasmid RGX-DYS1 was digested with restriction enzymes NheI and EcoRV (New England Biolabs), and then in-fusion ligated with the gBlock-DMD1.5 Tail. The final plasmid RGX-DYS5 was confirmed by enzyme digestion and subsequent sequencing. [00191] The length and expression of the protein was confirmed by western blot. Towards this end, different plasmids were transfected into a myoblast cell line C2C12 cells. Four days after differentiation, the cells were harvested in lysis buffer. 20 ⁇ g of cell lysis from each plasmid sample was loaded on the SDS-PAGE gel.
  • microdystrophin protein band generated from plasmid RGX-DYS5 (expressing DYS5) was significantly shorter than RGX-DYS1 (expressing DYS1), and longer than DYS3 (FIGs. 1B and C.).
  • DYS3 transgene was driven by ubiquitous CB promoter, whereas DYS1 and DYS5 transgene expression driven by muscle- specific promoter in the experiment generating FIG. 1B.
  • ⁇ -Actin protein control was used as a measure of consistent total protein recovery (FIG.1C).
  • RGX-DYS5 was packaged into AAV8 vector using HEK293 cells, and the titer of the vector RGX- DYS5 was determined following shake flask culture and affinity purification. Average titer was higher than AAV8 packaged RGX-DYS1 and comparable to AAV8 packaged RGX-DYS3 in these benchtop production runs. (Data not shown.) 6.1.4.
  • VH4 Intron and minSPc5-12 promoter [00193] The VH4 intron in RGX-DYS2, RGX-DYS3 and RGX-DYS4 is obtained from a human immunoglobulin heavy chain variable region (SEQ ID NO: 41; GenBank Accession No.
  • the expected PCR product was gel purified and subjected to sanger sequencing. Sequencing results revealed that accurate splicing events occurred.
  • the function of the VH4 intron was then tested in a construct in which the microdystrophin coding sequence was replaced with the coding sequence for GFP reporter protein. Also tested were AAV8 vectors containing GFP gene driven by the SPc5-12 promoter with or without the VH4 intron in differentiated C2C12 cells at various dosages. Images were taken, and quantitation was done using Cytation 5 cell imaging multi-mode reader. The quantitation and image data all indicated that the VH4 intron increased GFP expression nearly 5-fold (FIGS. 2A-F and FIG.3).
  • Example 2 In Vitro Potency Assay For Microdystrophin Vectors Using Differentiated C2C12 Cells
  • An in vitro assay for testing the potency of microdystrophin vectors was developed by assaying the infectivity of AAV8-CAG-GFP vector in HEK293 cells. After three days of infection (1 x 10E5 vg/cell), few GFP-positive HEK293 cells were observed (data not shown) indicating that the infectivity of HEK293 cells with AAV8 vector was low. The ability of AAV8-CAG-GFP vector to transduce C2C12 myoblasts was then tested in the same manner.
  • Undifferentiated C2C12 myoblasts were infected with AAV8-CAG-GFP vector (1x 10e6 vg/cell), then differentiated for three days. Similar to HEK293 cells, very few GFP-positive cells were observed, demonstrating that undifferentiated C2C12 myoblast cells display low infectivity by rAAV8 (data not shown). Infectivity was tested in differentiated C2C12 cells by culturing the C2C12 cells in differentiation media (DMEM+2% horse serum) for 3 days, and then infecting them with AAV8-CAG-GFP. Images were taken three days post infection, and three days post differentiation.
  • differentiation media DMEM+2% horse serum
  • Relative potency of the tested vector was 81.47% of the reference control (RGX-DYS1-RS, 100%) indicating that the infectivity of those two vectors was very similar (FIGS.5A-H).
  • Batches of recombinant AAV packaging DYS1, DYS2, DYS3, or DYS4 vectors were produced, and their relative infectivity compared in the differentiated muscle cell line C2C12 cells, as a measure of vector potency (FIG. 6).
  • mouse muscle cell line C2C12 cells were seeded at 2x 10E5 cells/well in 6-well plates cultured with 10% fetal bovine serum (FBS) in Dulbecco’s modified eagle medium (DMEM). Then the cells were changed to a differentiation medium (DMEM with 2% horse serum supplemented with insulin (1 ug/ml)) on the second day. After three days of differentiation, the cells were infected with different DMD vectors at the dosage of 2.5E4 vg/cell. Three days after infection, the infected cells were harvested and subjected to DNA extraction followed by Q-PCR. The DNeasy Blood and Tissue kit (Cat No: 69504, Qiagen) was used to extract the DNA.
  • FBS fetal bovine serum
  • DMEM Dulbecco’s modified eagle medium
  • Taqman assay was used for both endogenous control (glucagon gene) and AAV vectors.
  • the mouse glucagon gene as an endogenous control allowed normalization of vector copy numbers.
  • the sequences for mouse glucagon primers and probes were as follows: Glucagon-real-F (mouse): AAGGGACCTTTACCAGTGATGTG (SEQ ID NO: 47); Glucagon-real-R (mouse): ACTTACTCTCGCCTTCCTCGG (SEQ ID NO: 48); Taqman mouse glucagon probe: FAM- CAGCAAAGGAATTCA-MGB (SEQ ID NO: 49).
  • primers and probes were designed to recognize the micro-dys sequence and were as follows: Dys-C-F: TGG GCC TGC TCC TGC ATG (SEQ ID NO: 50); Dys-C-R: ATC TCA GGC TTG GCA AAC (SEQ ID NO: 51); Dys-C-probe: FAM-CAA TAT TGA GCC ATC AGT C-MGB (SEQ ID NO: 52).
  • the copy number per diploid cell was calculated as: ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ 2.
  • the DYS1-RS batch was considered as reference control (set to 1.0), and all other vectors were compared against it (vector copy number/reference control (fold-change)).
  • RNA expression level of the microdystrophin gene was determined after infection of differentiated C2C12 cells with the various AAV8 vectors at two different dosages (1e5 vg/cell and 5e4 vg/cell).
  • Cells transfected with RGX-DYS3 vectors had 2-3 fold higher mRNA levels of the microdystrophin compared to microdystrophin mRNA levels in cells transfected with RGX-DYS1 vectors (FIG. 7).
  • mice were usually heavier than wild-type mice. As revealed in FIG. 8, the treatment with the RGX-DYS1 vector significantly decreased the body weight. In fact, the body weight of the treated mice was similar to the wild-type counterparts at 2 weeks post treatment. [00201] All mice were euthanized at 6 weeks post injection and various organs and muscles were weighed.
  • mice displayed a significant reduction in organ and muscle weight including soleus, quadriceps, and triceps muscles and the tibialis anterior (TA) (FIGS.9A and 9B). 6.3.3. Grip Strength [00202] To measure the grip strength mice were acclimated to the testing room for approximately 10 minutes before beginning the procedure. Experimenter was blinded to the treatment and the mouse to be measured was handed over to the experimenter by another person. The mouse was gently placed on top of the forelimb wire grid so that only its front paws were allowed to grip one of the horizontal bars.
  • mice were anesthetized using Ketamine and Xylazine.
  • the EDL muscle of the right hindlimb were removed from each mouse and immersed in an oxygenated bath (95% O2, 5% CO2) that contains Ringer’s solution (pH 7.4) at 25°C.
  • an oxygenated bath (95% O2, 5% CO2) that contains Ringer’s solution (pH 7.4) at 25°C.
  • the muscle was adjusted to the optimal length for force generation.
  • the muscles were stimulated with electrode to elicit tetanic contractions that were separated by 2-minute rest intervals. With each subsequent tetanus, the stimulation frequency was increased in steps of 20, 30 or 50Hz until the force reached a plateau which usually occurred around 250Hz.
  • the cross-sectional area of the muscles was measured based on muscle mass, fiber length, and tissue density.
  • a BP cuff is placed around the tail, and the tail is then placed in a sensor assembly for noninvasive BP monitoring during anesthesia. Ten consecutive BP measurements are taken. Qualitative and quantitative measurements of tail BP, including systolic pressure, diastolic pressure and mean pressure, are made offline using analytic software. See, for example, Wehling-Henricks et al, Human Molecular Genetics, 2005, Vol. 14, No. 14; Uaesoontrachoon et al, Human Molecular Genetics, 2014, Vol.23, No.12. [00207] To monitor ECG wave heights and interval durations in awake, freely moving mice, radio telemetry devices are used.
  • Transmitter units are implanted in the peritoneal cavity of anesthetized mice and the two electrical leads are secured near the apex of the heart and the right acromion in a lead II orientation.
  • Mice are housed singly in cages over antenna receivers connected to a computer system for data recording.
  • Unfiltered ECG data is collected for 10 seconds each hour for 35 days. Thefirst 7 days of data are discarded to allow for recovery from the surgical procedure and ensure any effects of anesthesia has subsided.
  • Data waveforms and parameters are analyzed with the DSI analysis packages (ART 3.01 and Physiostat 4.01) and measurements are compiled and averaged to determine heart rates, ECG wave heights and interval durations.
  • Raw ECG waveforms are scanned for arrhythmias by two independent observers.
  • Picro-Sirius red staining is performed to measure the degree of fibrosis in the heart of trial mice.
  • the heart muscle is removed and fixed in 10% formalin for later processing.
  • the heart is sectioned and paraffin sections are deparaffinized in xylene followed by nuclear staining with Weigert’s hematoxylin for 8 min. They are then washed and then stained with Picro-Sirius red (0.5 g of Sirius red F3B, saturated aqueous solution of picric acid) for an additional 30 min. The sections are cleared in three changes of xylene and mounted in Permount.
  • Example 4 Vector biodistribution
  • Vehicle- and RGX-DYS1-treated mdx mice were sacrificed at 6 weeks after treatment, and the vector copy numbers were assessed on various tissues including skeletal muscle, cardiac muscle, and liver cells using Naica crystal digital PCR system from Stilla Technologies.
  • RGX-DYS1 vector was administered into four-weeks-old male muscular dystrophic mdx mice via tail vein injection.
  • mice Six weeks post injection, the mice were sacrificed, and tissues were subjected to total DNA extraction and ddPCR assay for vector copy numbers.
  • Total DNA from collected tissues was extracted with the DNeasy Blood & Tissue Kit and the DNA concentration was measured using a Nanodrop spectrophotometer.
  • digital PCR was performed with Naica Crystal Digital PCR system (Stilla technologies). Two color multiplexing system were applied here to simultaneously measure the dystrophin transgene and endogenous control gene.
  • the dystrophin probe was labelled with FAM (6-carboxyfluorescein) dye while the endogenous control glucagon probe was labelled with VIC fluorescent dye.
  • mouse glucagon primers and probes were as follows: Glucagon-real-F (mouse): AAG GGA CCT TTA CCA GTG ATG TG (SEQ ID NO: X); Glucagon-real-R (mouse): ACT TAC TCT CGC CTT CCT CGG; Taqman mouse glucagon probe: VIC-CAG CAA AGG AAT TCA-MGB.
  • Dys-dd-F2 ACA GAT ACC TGT TCA AGC AAG TGG C (SEQ ID NO: 122);
  • Dys-dd-R2 TCA ATC TCA GGC TTG GC (SEQ ID NO: 123);
  • Dys-C-Probe FAM-CAA TAT TGA GCC ATC AGT C-MGB (SEQ ID NO: 124).
  • DAPC dystrophin associated protein complex
  • Dystrobrevin and dystrophin an interaction through coiled-coil motifs. (1997) Proc Natl Acad Sci USA 94:12413-8.
  • the DAPC is comprised of several subcomplexes: dystroglycan, sacroglycan, and syntrophin/dystrobrevin, which are collectively attributed to maintaining fiber integrity during repeated cycles of contraction and relaxation and in cell signaling. Id. (FIG.13).
  • the ⁇ -dystroglycan binding site is located at hinge 4 and cysteine-rich (CR) domain.
  • the WW domain of dystrophin requires EF-hands region to interact with beta-dystroglycan (Rentschler, S., et al. 1999, Biol Chem 380:431-42).
  • RGX-DYS1 includes a portion of the C- terminus (SEQ ID NO: 16), which contains dystrobrevin and syntrophin binding domains (see Table 1).
  • One of the important functions of syntrophin is to anchor signaling proteins such as neuronal nitric oxide synthase (nNOS) to the sarcolemma. Adams, M.E., et al, 2000. Absence of ⁇ 1-syntrophin leads to structurally aberrant neuromuscular synapses deficient in utrophin.
  • Tissue was affixed to cutting block by adding a few drops of OCT (Optimal cutting temperature) compound and then placing the tissue on the block in the desired cutting orientation.
  • OCT and tissue were frozen in place in cryostat (hold tissue in desired orientation until OCT is solid) and tissue was sectioned at 10 ⁇ m (8-10 ⁇ m acceptable).
  • Four to six sections were arranged on each slide and store at -80 degrees.
  • Muscle cryo-section slides were removed from -80 degrees storage and air dried for 10 minutes at room temperature (RT). Marks are then made around the tissue section area with a PAP pen. If the primary antibody is from mouse monoclonal antibody, two blocking steps are required.
  • M.O.M. is the removed by aspiration and subsequently blocked with 10% horse serum (in PBS) for 1 hour at RT. If the primary antibody is not from mouse origin, samples is directly blocked with 10% horse serum (in PBS) by using a pipette to add an appropriate volume of PBS to cover the full area enclosed by the PAP pen and subsequently incubated for 1 hour at RT.
  • Primary antibodies were diluted in 2% horse serum (in PBS) and samples were incubated for 1-2 hours at RT.
  • the dystrophin protein and examined DAPC proteins were all absent in mdx mouse muscle untreated with RGX-DYS1.
  • Systemic delivery of RGX-DYS1 efficiently restored dystrophin expression, as well as anchored ⁇ ⁇ -syntrophin, ⁇ -dystrobrevin, ⁇ - dystroglycan and nNOS to the sarcolemma (Table 14).
  • two commercial antibodies were used for nNOS staining. In both instances, nNOS expression was significantly restored to the muscle membrane as compared to the untreated control group.
  • the RGX-DYS1 microdystrophin was able to restore dystrophin-associated protein complexes, including nNOS, to the sarcolemma in vivo.
  • tissue was homogenized in protein lysis buffer (15%SDS, 75mM Tri-HCl pH6.8, proteinase inhibitor, 20% glycerol, 5% beta-mercaptoethanol) (Bead Mill homogenizer Bead Ruptor 12, SKU:19050A, OMNI International). After homogenizing, the samples were spun down for 5 mins at top speed at room temperature, and the supernatants were subjected to protein quantification. The protein stock supernatants were quantified using Qubit protein assay kit (Catalog # Q33211, ThermoFisher Scientific). Total protein concentration per stock was calculated, then 20 ug of protein stock supernatant was loaded onto an SDS-PAGE gel.
  • protein lysis buffer 15%SDS, 75mM Tri-HCl pH6.8, proteinase inhibitor, 20% glycerol, 5% beta-mercaptoethanol
  • Bead Mill homogenizer Bead Ruptor 12 SKU:19050A, OMNI International
  • Western blot was performed using a primary anti-dystrophin antibody (MANEX1011B(1C7), Developmental Studies Hybridoma Bank) at 1:1000 dilution, and the secondary antibody applied was goat anti-mouse IgG2a conjugate to horseradish peroxidase (HRP) (Thermo Fisher Scientific, Cat. No.62-6520).
  • HRP horseradish peroxidase
  • ⁇ 1- actin serves as the loading control in each lane of the gel.
  • rabbit polyclonal anti- ⁇ 1-actin antibody PA5-78715, Thermo Fisher
  • the RGX-DYS1 vector-delivered tissues indeed had higher vector genome copy numbers (50 ⁇ 14 gc/cell) than RGX-DYS5 (17 ⁇ 4 gc/cell) and RGX-DYS3 (16 ⁇ 5 gc/cell) vector-delivered tissues (values were normalized to glucagon genome copies). The relative ⁇ -dystrophin expression was then compared to vector copy numbers.
  • Total RNA were extracted from the muscle tissue using RNeasy Fibrous Tissue Mini Kit (REF 74704, Qiagen).
  • cDNA was synthesized using High-capacity cDNA reverse transcription kit with RNAse inhibitor (Ref 4374966, Applied Biosystems by Thermo Fisher Scientific). The RNA concentration was measured using a Nanodrop spectrophotometer.
  • the copy numbers of ⁇ -dystrophin, WT-dystrophin, and endogenous control Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA were measured using digital PCR (Naica Crystal Digital PCR system, Stilla technologies). Primers and probe against mouse WT-dystrophin (mm01216951_m1, Thermo Fisher Scientific)(also described in the biodistribution study above in Section 6.4 (Example 4)), and mouse GAPDH (mm99999915_g1, Thermo Fisher Scientific) were commercially available.
  • the dystrophin protein and examined DAPC proteins were all absent in the untreated mdx muscle, while they were strongly present on the wild-type B6 muscle membrane.
  • ⁇ -dystrophin protein was expressed on nearly 100% muscle fibers and they were indistinguishable amongst the different treatment groups.
  • the three treatment groups displayed restoration of dystrobrevin expression on muscle membranes with a very similar pattern observed.
  • ⁇ - dystroglycan staining the muscles in the RGX-DYS1-treated group displayed a more uniform and more intense ⁇ -dystroglycan staining (expression). [00230] The more dramatic difference amongst the treatment groups was observed in syntrophin staining.
  • the level of syntrophin expression in skeletal muscle was additionally examined on total muscle membrane extracts by western blot.
  • Total skeletal muscle protein was extracted using Mem-Per Plus membrane protein extraction kit (Cat# 89842, Thermo Fisher) (gastrocnemius muscle tissue from each of the mdx treated and untreated groups, and quadriceps from the B6 mice group). 20 ug of total membrane protein was loaded into each lane (FIG. 19D).
  • the polyclonal anti- syntrophin antibody (Abcam, ab11187) was used at 1:10,000 incubation at 4oC overnight.
  • the loading control polyclonal anti-actin (PA5-78715, Thermo Fisher) was applied at 1:10,000 dilution for overnight incubation at 4 0C.
  • nNOS western blots were prepared analogously using muscle membranes (gastrocnemius muscle tissue/mdx, and quadriceps/B6 groups). Total muscle membrane protein was extracted using Mem-Per Plus membrane protein extraction kit (Cat# 89842, Thermo Fisher). 20 ug of total membrane protein was loaded into each lane of an SDS-PAGE gel.
  • nNOS The primary antibody against nNOS (SC-5302, Santa Cruz Biotechnology) was used at 1:500, and polyclonal anti-actin (PA5- 78715, Thermo Fisher) was applied at 1:10,000 dilution. Secondary goat anti- Mouse IgG antibody, HRP (62-6520, ThermoFisher) was applied. With respect to nNOS expression, we observed a noticeable difference between the RGX-DYS1 and RGX-DYS3 group images following IF staining (FIG.20A).
  • RNAscope is a cutting-edge in situ hybridization (ISH) technology that enables simultaneous signal amplification and background noise suppression, which allows for the visualization of single molecule gene expression directly in intact tissue with single cell resolution.
  • RNAscope multiplex fluorescent analysis was utilized with AAV ⁇ -dystrophin probe labelled with fluorophore, Opal 570 (red), and muscle satellite cell marker, pax7, labelled with fluorophore, Opal 520 (green).
  • the RNAscope multiplex fluorescent analysis of AAV transgene and Pax7 mRNA expression was performed at Advanced Cell Diagnostics Inc (Newark, CA). Total RNA was extracted from skeletal muscles using RNeasy® Fibrous Tissue Mini Kit (Qiagen Cat. No.74704), and cDNA was synthesized with High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems Cat. No.4374966).
  • FIGS.21A-B Blue color of DAPI staining (left and right panels, FIGS.21A-B) indicated nucleus staining.
  • the ⁇ -dystrophin transduced satellite cells were counted, and the satellite cell transduction rate was calculated. In AAV- ⁇ -dys transduced skeletal muscles, the transduction rate of satellite cells was 23 ⁇ 1.5% (FIG. 21C). This indicated AAV vector was able to transduce muscle satellite cells although at much lower transduction rate than mature myofibers.
  • RNAscope technology analysis we extracted total muscle RNA and performed cDNA synthesis.
  • Total RNA was extracted from skeletal muscles using RNeasy® Fibrous Tissue Mini Kit (Qiagen Cat. No. 74704), and cDNA was synthesized with High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems Cat. No. 4374966).
  • mice were subjected to ddPCR analysis using mouse pax7 specific primers and probe sets (available commercially: mm01354484_m1 Pax7, Thermo Fisher Scientific; and TaqMan TM MGB Probe from Applied Biosystems Cat. No.4316034, respectively).
  • the mouse GAPDH primers and probe set were used to normalize the RNA and cDNA input.
  • the absolute copy numbers of ⁇ -dystrophin mRNA and endogenous control GAPDH mRNA were measured using digital PCR (Naica Crystal Digital PCR system, Stilla technologies). The ratio of pax7 mRNA copy numbers to GAPDH mRNA copy numbers were compared among groups (FIG. 21E).
  • RGX-DYS7 SEQ ID NO: 92
  • the nNOS-anchoring spectrin repeat domains R16 and R17 SEQ ID NO: 86 and 87
  • RGX-DYS8 SEQ ID NO: 93
  • CT C-terminal domain
  • ⁇ -dystrophin Cis plasmids were packaged into AAV8 vectors, and the vectors (2x 10 5 gc/cell) were infected on differentiated C2C12 myotubes as described in Section 6.2 (Example 2). Five days after infection, the cells were harvested and subjected to western blot analysis using anti-dystrophin primary antibody (MANEX1011B(1C7) as described herein to detect ⁇ -dystrophin protein. All methods used are analogous to those describe in Section 6.7 (Example 7). As shown in FIG. 23A, AAV vector carrying different versions of ⁇ -dystrophin generated different lengths of ⁇ -dystrophin proteins and their sizes migrated as expected.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Neurology (AREA)
  • Immunology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Mycology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US2020/062484 2019-11-28 2020-11-27 Microdystrophin gene therapy constructs and uses thereof Ceased WO2021108755A2 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
IL293334A IL293334A (en) 2019-11-28 2020-11-27 Microdystrophin gene therapy constructs and uses thereof
KR1020227021099A KR20220107222A (ko) 2019-11-28 2020-11-27 마이크로디스트로핀 유전자 치료 작제물 및 이의 용도
MX2022006427A MX2022006427A (es) 2019-11-28 2020-11-27 "construcciones para terapia génica con microdistrofina y uso de las mismas.
EP20845454.6A EP4065596A2 (en) 2019-11-28 2020-11-27 Microdystrophin gene therapy constructs and uses thereof
CA3159516A CA3159516A1 (en) 2019-11-28 2020-11-27 Microdystrophin gene therapy constructs and uses thereof
AU2020392243A AU2020392243A1 (en) 2019-11-28 2020-11-27 Microdystrophin gene therapy constructs and uses thereof
BR112022009895A BR112022009895A2 (pt) 2019-11-28 2020-11-27 Construtos de terapia de gene de microdistrofina e usos dos mesmos
JP2022531343A JP7822933B2 (ja) 2019-11-28 2020-11-27 マイクロジストロフィン遺伝子治療コンストラクト及びその使用
US17/778,651 US20230270886A1 (en) 2019-11-28 2020-11-27 Microdystrophin gene therapy constructs and uses thereof
US19/234,261 US20250367328A1 (en) 2019-11-28 2025-06-10 Methods of manufacturing microdystrophin gene therapy constructs
US19/234,245 US20250367327A1 (en) 2019-11-28 2025-06-10 Treatment of dystrophinopathies with microdystrophin gene therapy constructs
US19/234,243 US20250367326A1 (en) 2019-11-28 2025-06-10 Microdystrophin nucleic acid gene therapy constructs and uses thereof
JP2025175606A JP2026027271A (ja) 2019-11-28 2025-10-17 マイクロジストロフィン遺伝子治療コンストラクト及びその使用

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201962941719P 2019-11-28 2019-11-28
US62/941,719 2019-11-28
US202063024933P 2020-05-14 2020-05-14
US63/024,933 2020-05-14

Related Child Applications (4)

Application Number Title Priority Date Filing Date
US17/778,651 A-371-Of-International US20230270886A1 (en) 2019-11-28 2020-11-27 Microdystrophin gene therapy constructs and uses thereof
US19/234,245 Division US20250367327A1 (en) 2019-11-28 2025-06-10 Treatment of dystrophinopathies with microdystrophin gene therapy constructs
US19/234,243 Division US20250367326A1 (en) 2019-11-28 2025-06-10 Microdystrophin nucleic acid gene therapy constructs and uses thereof
US19/234,261 Division US20250367328A1 (en) 2019-11-28 2025-06-10 Methods of manufacturing microdystrophin gene therapy constructs

Publications (2)

Publication Number Publication Date
WO2021108755A2 true WO2021108755A2 (en) 2021-06-03
WO2021108755A3 WO2021108755A3 (en) 2021-07-08

Family

ID=74206146

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/062484 Ceased WO2021108755A2 (en) 2019-11-28 2020-11-27 Microdystrophin gene therapy constructs and uses thereof

Country Status (11)

Country Link
US (4) US20230270886A1 (cg-RX-API-DMAC7.html)
EP (1) EP4065596A2 (cg-RX-API-DMAC7.html)
JP (2) JP7822933B2 (cg-RX-API-DMAC7.html)
KR (1) KR20220107222A (cg-RX-API-DMAC7.html)
AU (1) AU2020392243A1 (cg-RX-API-DMAC7.html)
BR (1) BR112022009895A2 (cg-RX-API-DMAC7.html)
CA (1) CA3159516A1 (cg-RX-API-DMAC7.html)
CL (1) CL2022001372A1 (cg-RX-API-DMAC7.html)
MX (1) MX2022006427A (cg-RX-API-DMAC7.html)
TW (1) TWI908746B (cg-RX-API-DMAC7.html)
WO (1) WO2021108755A2 (cg-RX-API-DMAC7.html)

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022076750A2 (en) 2020-10-07 2022-04-14 Regenxbio Inc. Recombinant adeno-associated viruses for cns or muscle delivery
WO2022232141A1 (en) * 2021-04-26 2022-11-03 Regenxbio Inc. Microdystrophin gene therapy administration for treatment of dystrophinopathies
US11535868B2 (en) 2020-04-29 2022-12-27 Bristol-Myers Squibb Company Miniaturized dystrophins having spectrin fusion domains and uses thereof
WO2022269269A1 (en) * 2021-06-23 2022-12-29 Synpromics Limited Regulatory nucleic acid sequences
WO2022261143A3 (en) * 2021-06-07 2023-01-19 University Of Florida Research Foundation, Incorporated Gene therapy for duchenne muscular dystrophy
WO2023004331A1 (en) * 2021-07-19 2023-01-26 New York University Auf1 combination therapies for treatment of muscle degenerative disease
WO2023019168A1 (en) * 2021-08-11 2023-02-16 Ultragenyx Pharmaceutical Inc. Compositions and methods for treating a muscular dystrophy
WO2023056367A1 (en) * 2021-09-30 2023-04-06 The Board Of Regents Of The Universityof Texas System Slc13a5 gene therapy vectors and uses thereof
WO2023060269A1 (en) 2021-10-07 2023-04-13 Regenxbio Inc. Recombinant adeno-associated viruses for targeted delivery
WO2023064947A1 (en) 2021-10-15 2023-04-20 Regenxbio Inc. Antibodies and methods of using thereof
WO2023018854A3 (en) * 2021-08-11 2023-06-22 Solid Biosciences Inc. Treatment of muscular dystrophy
WO2023135316A1 (en) * 2022-01-17 2023-07-20 Dinaqor Ag Gene therapy composition and treatment for dystrophin-related cardiomyopathy
WO2023141582A1 (en) 2022-01-21 2023-07-27 Regenxbio Inc. Engineered promoters
EP4230196A1 (en) 2022-02-21 2023-08-23 Som Innovation Biotech, S.A. Compounds for use in the treatment of dystrophinopathies
WO2023183623A1 (en) 2022-03-25 2023-09-28 Regenxbio Inc. Dominant-negative tumor necrosis factor alpha adeno-associated virus gene therapy
WO2023248251A1 (en) * 2022-06-24 2023-12-28 Indian Institute Of Technology Kanpur An optimized aav vector for gene therapy of muscular dystrophy
WO2024044725A2 (en) 2022-08-24 2024-02-29 Regenxbio Inc. Recombinant adeno-associated viruses and uses thereof
WO2024081746A2 (en) 2022-10-11 2024-04-18 Regenxbio Inc. Engineered nucleic acid regulatory elements and methods and uses thereof
WO2024091495A1 (en) * 2022-10-24 2024-05-02 Biogen Ma Inc. Compositions and methods for treating retinitis pigmentosa
WO2024138158A2 (en) 2022-12-23 2024-06-27 Ultragenyx Pharmaceutical Inc. Method of producing soluble microdystrophin protein and uses of the same
WO2024216244A2 (en) 2023-04-13 2024-10-17 Regenxbio Inc. Targeting aav capsids, methods of manufacturing and using same
WO2025072197A2 (en) 2023-09-25 2025-04-03 Sarepta Therapeutics, Inc. Adapted human dystrophins with enhanced actin-binding affinity for treating muscular dystrophies
WO2025250909A1 (en) 2024-05-31 2025-12-04 Sarepta Therapeutics, Inc. Muscle-tropic recombinant aav
WO2026080823A1 (en) 2024-10-10 2026-04-16 Research Institute At Nationwide Children's Hospital Methods for diagnosing and treating muscular dystrophy diseases

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115838725B (zh) * 2022-12-30 2023-09-08 广州派真生物技术有限公司 在哺乳动物心脏中特异性启动基因的启动子序列及其应用

Citations (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003042397A2 (en) 2001-11-13 2003-05-22 The Trustees Of The University Of Pennsylvania A method of detecting and/or identifying adeno-associated virus (aav) sequences and isolating novel sequences identified thereby
WO2003052051A2 (en) 2001-12-17 2003-06-26 The Trustees Of The University Of Pennsylvania Adeno-associated virus (aav) serotype 8 sequences
US6596535B1 (en) 1999-08-09 2003-07-22 Targeted Genetics Corporation Metabolically activated recombinant viral vectors and methods for the preparation and use
WO2005033321A2 (en) 2003-09-30 2005-04-14 The Trustees Of The University Of Pennsylvania Adeno-associated virus (aav) clades, sequences, vectors containing same, and uses therefor
WO2006068888A1 (en) 2004-12-22 2006-06-29 Raytheon Company System and technique for calibrating radar arrays
WO2006110689A2 (en) 2005-04-07 2006-10-19 The Trustees Of The University Of Pennsylvania Method of increasing the function of an aav vector
US7456683B2 (en) 2005-06-09 2008-11-25 Panasonic Corporation Amplitude error compensating device and quadrature skew error compensating device
WO2009104964A1 (en) 2008-02-19 2009-08-27 Amsterdam Molecular Therapeutics B.V. Optimisation of expression of parvoviral rep and cap proteins in insect cells
WO2010127097A1 (en) 2009-04-30 2010-11-04 The Trustees Of The University Of Pennsylvania Compositions for targeting conducting airway cells comprising adeno-associated virus constructs
US20130224836A1 (en) 2010-10-27 2013-08-29 Jichi Medical University Adeno-Associated Virus Virion for Gene Transfer to Nervous System Cells
US8628966B2 (en) 2010-04-30 2014-01-14 City Of Hope CD34-derived recombinant adeno-associated vectors for stem cell transduction and systemic therapeutic gene transfer
US8734809B2 (en) 2009-05-28 2014-05-27 University Of Massachusetts AAV's and uses thereof
WO2014172669A1 (en) 2013-04-20 2014-10-23 Research Institute At Nationwide Children's Hospital Recombinant adeno-associated virus delivery of exon 2-targeted u7snrna polynucleotide constructs
US8927514B2 (en) 2010-04-30 2015-01-06 City Of Hope Recombinant adeno-associated vectors for targeted treatment
US20150023924A1 (en) 2013-07-22 2015-01-22 The Children's Hospital Of Philadelphia Variant aav and compositions, methods and uses for gene transfer to cells, organs and tissues
US20150126588A1 (en) 2012-05-09 2015-05-07 Oregon Health & Science University Adeno associated virus plasmids and vectors
US9169299B2 (en) 2011-08-24 2015-10-27 The Board Of Trustees Of The Leleand Stanford Junior University AAV capsid proteins for nucleic acid transfer
US9193956B2 (en) 2011-04-22 2015-11-24 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
WO2015191508A1 (en) 2014-06-09 2015-12-17 Voyager Therapeutics, Inc. Chimeric capsids
US20150374803A1 (en) 2013-03-13 2015-12-31 The Children's Hospital Of Philadelphia Adeno-associated virus vectors and methods of use thereof
WO2016049230A1 (en) 2014-09-24 2016-03-31 City Of Hope Adeno-associated virus vector variants for high efficiency genome editing and methods thereof
US20160215024A1 (en) 2013-10-11 2016-07-28 Massachusetts Eye & Ear Infirmary Methods of Predicting Ancestral Virus Sequences and Uses Thereof
US9409953B2 (en) 2011-02-10 2016-08-09 The University Of North Carolina At Chapel Hill Viral vectors with modified transduction profiles and methods of making and using the same
US9585971B2 (en) 2013-09-13 2017-03-07 California Institute Of Technology Recombinant AAV capsid protein
US20170067908A1 (en) 2014-04-25 2017-03-09 Oregon Health & Science University Methods of viral neutralizing antibody epitope mapping
WO2017070491A1 (en) 2015-10-23 2017-04-27 Applied Genetic Technologies Corporation Ophthalmic formulations
US9923120B2 (en) 2015-09-26 2018-03-20 Nichia Corporation Semiconductor light emitting element and method of producing the same
WO2019154939A1 (en) 2018-02-07 2019-08-15 Genethon Hybrid regulatory elements

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101711164B (zh) 2007-01-18 2014-06-04 密苏里-哥伦比亚大学 可修复肌纤维膜中的神经元型一氧化氮合酶的合成小/微-抗肌萎缩蛋白基因
WO2016100575A1 (en) 2014-12-16 2016-06-23 Board Of Regents Of The University Of Nebraska Gene therapy for juvenile batten disease
JP6832280B2 (ja) * 2015-01-16 2021-02-24 ユニバーシティ オブ ワシントンUniversity of Washington 新規のマイクロジストロフィンおよび使用の関連する方法
MX388739B (es) 2015-02-06 2025-03-20 Univ North Carolina Chapel Hill Casetes optimizados de expresión del gen humano del factor viii de coagulación y su uso.
GB201507842D0 (en) * 2015-05-07 2015-06-17 New Royal Holloway & Bedford Production of large-sized microdystrophins in an AAV-based vector configuration
AU2016366560A1 (en) 2015-12-11 2018-06-28 The Trustees Of The University Of Pennsylvania Gene therapy for treating familial hypercholesterolemia
JP7676111B2 (ja) 2017-03-17 2025-05-14 リサーチ インスティチュート アット ネイションワイド チルドレンズ ホスピタル 筋ジストロフィーを治療するための筋肉特異的マイクロジストロフィンのアデノ随伴ウイルスベクター送達

Patent Citations (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7125717B2 (en) 1999-08-09 2006-10-24 Targeted Genetics Corporation Metabolically activated recombinant viral vectors and methods for their preparation and use
US6596535B1 (en) 1999-08-09 2003-07-22 Targeted Genetics Corporation Metabolically activated recombinant viral vectors and methods for the preparation and use
WO2003042397A2 (en) 2001-11-13 2003-05-22 The Trustees Of The University Of Pennsylvania A method of detecting and/or identifying adeno-associated virus (aav) sequences and isolating novel sequences identified thereby
US8524446B2 (en) 2001-11-13 2013-09-03 The Trustees Of The University Of Pennsylvania Method for detecting adeno-associated virus
US7790449B2 (en) 2001-12-17 2010-09-07 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) serotype 8 sequences, vectors containing the same, and uses therefor
US7282199B2 (en) 2001-12-17 2007-10-16 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) serotype 8 sequences, vectors containing same, and uses therefor
US8962332B2 (en) 2001-12-17 2015-02-24 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) serotype 8 sequences, vectors containing same, and uses therefor
WO2003052051A2 (en) 2001-12-17 2003-06-26 The Trustees Of The University Of Pennsylvania Adeno-associated virus (aav) serotype 8 sequences
US8318480B2 (en) 2001-12-17 2012-11-27 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) serotype 8 sequences, vectors containing same, and uses therefor
WO2005033321A2 (en) 2003-09-30 2005-04-14 The Trustees Of The University Of Pennsylvania Adeno-associated virus (aav) clades, sequences, vectors containing same, and uses therefor
US7906111B2 (en) 2003-09-30 2011-03-15 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) clades, sequences, vectors containing same, and uses therefor
WO2006068888A1 (en) 2004-12-22 2006-06-29 Raytheon Company System and technique for calibrating radar arrays
WO2006110689A2 (en) 2005-04-07 2006-10-19 The Trustees Of The University Of Pennsylvania Method of increasing the function of an aav vector
US8999678B2 (en) 2005-04-07 2015-04-07 The Trustees Of The University Of Pennsylvania Method of increasing the function of an AAV vector
US7456683B2 (en) 2005-06-09 2008-11-25 Panasonic Corporation Amplitude error compensating device and quadrature skew error compensating device
WO2009104964A1 (en) 2008-02-19 2009-08-27 Amsterdam Molecular Therapeutics B.V. Optimisation of expression of parvoviral rep and cap proteins in insect cells
WO2010127097A1 (en) 2009-04-30 2010-11-04 The Trustees Of The University Of Pennsylvania Compositions for targeting conducting airway cells comprising adeno-associated virus constructs
US8734809B2 (en) 2009-05-28 2014-05-27 University Of Massachusetts AAV's and uses thereof
US9284357B2 (en) 2009-05-28 2016-03-15 University Of Massachusetts AAV's and uses thereof
US8628966B2 (en) 2010-04-30 2014-01-14 City Of Hope CD34-derived recombinant adeno-associated vectors for stem cell transduction and systemic therapeutic gene transfer
US8927514B2 (en) 2010-04-30 2015-01-06 City Of Hope Recombinant adeno-associated vectors for targeted treatment
US20130224836A1 (en) 2010-10-27 2013-08-29 Jichi Medical University Adeno-Associated Virus Virion for Gene Transfer to Nervous System Cells
US9409953B2 (en) 2011-02-10 2016-08-09 The University Of North Carolina At Chapel Hill Viral vectors with modified transduction profiles and methods of making and using the same
US9587282B2 (en) 2011-04-22 2017-03-07 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US9193956B2 (en) 2011-04-22 2015-11-24 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US20160376323A1 (en) 2011-04-22 2016-12-29 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US9458517B2 (en) 2011-04-22 2016-10-04 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US9169299B2 (en) 2011-08-24 2015-10-27 The Board Of Trustees Of The Leleand Stanford Junior University AAV capsid proteins for nucleic acid transfer
US20150126588A1 (en) 2012-05-09 2015-05-07 Oregon Health & Science University Adeno associated virus plasmids and vectors
US20150374803A1 (en) 2013-03-13 2015-12-31 The Children's Hospital Of Philadelphia Adeno-associated virus vectors and methods of use thereof
WO2014172669A1 (en) 2013-04-20 2014-10-23 Research Institute At Nationwide Children's Hospital Recombinant adeno-associated virus delivery of exon 2-targeted u7snrna polynucleotide constructs
US20150023924A1 (en) 2013-07-22 2015-01-22 The Children's Hospital Of Philadelphia Variant aav and compositions, methods and uses for gene transfer to cells, organs and tissues
WO2015013313A2 (en) 2013-07-22 2015-01-29 The Children's Hospital Of Philadelphia Variant aav and compositions, methods and uses for gene transfer to cells, organs and tissues
US9840719B2 (en) 2013-07-22 2017-12-12 The Children's Hospital Of Philadelphia Variant AAV and compositions, methods and uses for gene transfer to cells, organs and tissues
US9585971B2 (en) 2013-09-13 2017-03-07 California Institute Of Technology Recombinant AAV capsid protein
US20160215024A1 (en) 2013-10-11 2016-07-28 Massachusetts Eye & Ear Infirmary Methods of Predicting Ancestral Virus Sequences and Uses Thereof
US20170051257A1 (en) 2013-10-11 2017-02-23 Massachusetts Eye And Ear Infirmary Methods of predicting ancestral virus sequences and uses thereof
US20170067908A1 (en) 2014-04-25 2017-03-09 Oregon Health & Science University Methods of viral neutralizing antibody epitope mapping
WO2015191508A1 (en) 2014-06-09 2015-12-17 Voyager Therapeutics, Inc. Chimeric capsids
WO2016049230A1 (en) 2014-09-24 2016-03-31 City Of Hope Adeno-associated virus vector variants for high efficiency genome editing and methods thereof
US9923120B2 (en) 2015-09-26 2018-03-20 Nichia Corporation Semiconductor light emitting element and method of producing the same
WO2017070491A1 (en) 2015-10-23 2017-04-27 Applied Genetic Technologies Corporation Ophthalmic formulations
WO2019154939A1 (en) 2018-02-07 2019-08-15 Genethon Hybrid regulatory elements

Non-Patent Citations (45)

* Cited by examiner, † Cited by third party
Title
"GenBank", Database accession no. AB019438.1
ABDELRAHIM ABDRABOU SADEK ET AL.: "Evaluation of cardiac functions in children with Duchenne Muscular Dystrophy: A prospective case-control study", ELECTRON PHYSICIAN, vol. 9, no. 11, November 2017 (2017-11-01), pages 5732 - 5739
ADAMS, M.E. ET AL.: "Absence of al-syntrophin leads to structurally aberrant neuromuscular synapses deficient in utrophin", J CELL BIOL, vol. 150, no. 6, 2000, pages 1385 - 1409
APONTE-UBILLUS ET AL., APPL. MICROBIOL. BIOTECHNOL., vol. 102, 2018, pages 1045 - 1054
AURICCHIO ET AL., HUM. MOLEC. GENET., vol. 10, 2001, pages 3075 - 3081
BERNS KI: "The Unusual Properties of the AAV Inverted Terminal Repeat", HUM GENE THER, 2020
BLAKE, D. ET AL.: "Function and Genetics of Dystrophin and Dystrophin-Related Proteins in Muscle", PHYSIOL. REV., vol. 82, 2002, pages 291 - 329
BURAKIEWICZ, J. ET AL.: "Quantifying fat replacement of muscle by quantitative MRI in muscular dystrophy", JOURNAL OF NEUROLOGY, vol. 264, no. 10, 2017, pages 2053 - 2067, XP036329915, DOI: 10.1007/s00415-017-8547-3
DUAN ET AL., J. VIROL., vol. 75, 2001, pages 7662 - 7671
FAUST, S.M. ET AL.: "CpG-depleted adeno-associated virus vectors evade immune detection", J CLIN INVEST, vol. 123, no. 7, 2013, pages 2994 - 3001, XP055646367, DOI: 10.1172/JCI68205
GARDINER-GARDENFROMMER, J MOL BIOL., vol. 196, no. 2, 20 July 1987 (1987-07-20), pages 261 - 82
GEORGIADIS ET AL., GENE THERAPY, vol. 23, 2016, pages 857 - 862
GEORGIADIS ET AL., GENE THERAPY, vol. 25, 2018, pages 450
HALBERT ET AL., J. VIROL., vol. 74, 2000, pages 1524 - 1532
KOO, T. ET AL.: "Delivery of AAV2/9-microdystrophin genes incorporating helix 1 of the coiled-coil motif in the C-terminal domain of dystrophin improves muscle pathology and restores the level of al-syntrophin and a- dystrobrevin in skeletal muscles of mdx mice", HUM GENE THER, vol. 22, no. 11, 2011, pages 1379 - 88, XP055217972, DOI: 10.1089/hum.2011.020
KORNEGAY, J.N. ET AL.: "Widespread muscle expression of an AAV9 human mini-dystrophin vector after intravenous injection in neonatal dystrophin-deficient dogs", MOL THER, vol. 18, no. 8, 2010, pages 1501 - 8, XP055299801, DOI: 10.1038/mt.2010.94
KORNEYGAY, J.N. ET AL.: "The golden retriever model of Duchenne muscular dystrophy", SKELETMUSCLE, vol. 7, 2017, pages 9
LI LCDAHIYA R: "MethPrimer: designing primers for methylation PCRs", BIOINFORMATICS, vol. 18, no. 11, November 2002 (2002-11-01), pages 1427 - 31
LI, X. ET AL., NATURE BIOTECHNOLOGY, vol. 17, March 1999 (1999-03-01), pages 241 - 245
MAGRATH, P. ET AL.: "Cardiac MRI biomarkers for Duchenne muscular dystrophy", BIOMARKERS IN MEDICINE, vol. 12, no. 11, 2018
MAZZONE E ET AL.: "Ambulatory Assessment, 6-minute walk test and timed items in ambulant boys with Duchenne muscular dystrophy", NEUROMUSCULAR DISORDERS, vol. 20, 2010, pages 712 - 716, XP027403997
MAZZONE ET AL.: "North Star Ambulatory Assessment, 6-minute walk test and timed items in ambulant boys with Duchenne muscular dystrophy", NEUROMUSCULAR DISORDERS, vol. 20, 2010, pages 712 - 716, XP027403997
MCCARTY ET AL., GENE THERAPY, vol. 8, 2001, pages 1248 - 1254
MENDELL, J.R. ET AL.: "Dystrophin immunity in Duchenne's muscular dystrophy", N ENGL J MED, vol. 363, no. 15, 2010, pages 1429 - 37, XP055152462, DOI: 10.1056/NEJMoa1000228
PANE, M. ET AL.: "Upper limb function in Duchenne muscular dystrophy: 24 month longitudinal data", PLOS ONE, vol. 13, no. 6, 20 June 2018 (2018-06-20), pages e0199223
PEREIRAMUZYCZKA, JOURNAL OF VIROLOGY, vol. 71, no. 6, June 1997 (1997-06-01), pages 4300 - 4309
PUZZO ET AL., SCI. TRANSL. MED., vol. 29, no. 9, 2017, pages 418
RABINOWITZ, J.Y.K. CHANR.J. SAMULSKI: "Adeno-associated Virus (AAV) versus Immune Response", VIRUSES, vol. 11, no. 2, 2019
RAMOS, J.N ET AL., MOLECULAR THERAPY, vol. 27, no. 3, 2019, pages 1 - 13
RENTSCHLER, S. ET AL., BIOL CHEM, vol. 380, 1999, pages 431 - 42
SADOULET-PUCCIO, H.M. ET AL.: "Dystrobrevin and dystrophin: an interaction through coiled-coil motifs", PROC NATL ACAD SCI USA, vol. 94, 1997, pages 12413 - 8
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
STEVENSON, S. ET AL.: "Spatial relationship of the C-terminal domains of dystrophin and beta-dystroglycan in cardiac muscle support a direct molecular interaction at the plasma membrane interface", CIRC RES, vol. 82, no. 1, 1998, pages 82 - 93
TANDON, A. ET AL.: "Dystrophin genotype-cardiac phenotype correlations in Duchenne and Becker muscular dystrophies using cardiac magnetic resonance imaging", AM J CARDIOL, vol. 115, no. 7, 2015, pages 967 - 71
UAESOONTRACHOON ET AL., HUMAN MOLECULAR GENETICS, vol. 23, no. 12, 2014
VAN WESTERING, MOLECULES, vol. 20, 2015, pages 8823 - 8855
WANG ET AL., J. ORTHOP. RES., vol. 27, 2009, pages 421
WANG, D.P.W.L. TAIG. GAO: "Adeno-associated virus vector as a platform for gene therapy delivery", NAT REV DRUG DISCOV, vol. 18, no. 5, 2019, pages 358 - 378, XP055735836, DOI: 10.1038/s41573-019-0012-9
WEHLING-HENRICKS ET AL., HUMAN MOLECULAR GENETICS, vol. 14, no. 14, 2005
WU, HUMAN GENE THERAPY, vol. 18, no. 2, 2007, pages 171 - 82
YANG ET AL., JBC, vol. 270, no. 10, 1995, pages 4975 - 8
YUCEL, N. ET AL.: "Humanizing the mdx mouse model of DMD: the long and the short of it", REGENERATIVE MEDICINE, vol. 3, no. 4, 2018
YUCEL, N. ET AL.: "umanizing the mdx mouse model of DMD: the long and the short of it", REGENERATIVE MEDICINE, vol. 3, no. 4, 2018
ZINN ET AL., CELL REP, vol. 12, no. 6, 2015, pages 1056 - 1068
ZOLOTUKHIN ET AL., METHODS, vol. 28, 2002, pages 158 - 167

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11535868B2 (en) 2020-04-29 2022-12-27 Bristol-Myers Squibb Company Miniaturized dystrophins having spectrin fusion domains and uses thereof
WO2022076750A2 (en) 2020-10-07 2022-04-14 Regenxbio Inc. Recombinant adeno-associated viruses for cns or muscle delivery
WO2022232141A1 (en) * 2021-04-26 2022-11-03 Regenxbio Inc. Microdystrophin gene therapy administration for treatment of dystrophinopathies
WO2022261143A3 (en) * 2021-06-07 2023-01-19 University Of Florida Research Foundation, Incorporated Gene therapy for duchenne muscular dystrophy
WO2022269269A1 (en) * 2021-06-23 2022-12-29 Synpromics Limited Regulatory nucleic acid sequences
WO2023004331A1 (en) * 2021-07-19 2023-01-26 New York University Auf1 combination therapies for treatment of muscle degenerative disease
WO2023019168A1 (en) * 2021-08-11 2023-02-16 Ultragenyx Pharmaceutical Inc. Compositions and methods for treating a muscular dystrophy
WO2023018854A3 (en) * 2021-08-11 2023-06-22 Solid Biosciences Inc. Treatment of muscular dystrophy
WO2023056367A1 (en) * 2021-09-30 2023-04-06 The Board Of Regents Of The Universityof Texas System Slc13a5 gene therapy vectors and uses thereof
WO2023060269A1 (en) 2021-10-07 2023-04-13 Regenxbio Inc. Recombinant adeno-associated viruses for targeted delivery
WO2023064947A1 (en) 2021-10-15 2023-04-20 Regenxbio Inc. Antibodies and methods of using thereof
WO2023135316A1 (en) * 2022-01-17 2023-07-20 Dinaqor Ag Gene therapy composition and treatment for dystrophin-related cardiomyopathy
WO2023141582A1 (en) 2022-01-21 2023-07-27 Regenxbio Inc. Engineered promoters
EP4230196A1 (en) 2022-02-21 2023-08-23 Som Innovation Biotech, S.A. Compounds for use in the treatment of dystrophinopathies
WO2023156645A1 (en) 2022-02-21 2023-08-24 Som Innovation Biotech, S.A. Compounds for use in the treatment of dystrophinopathies
WO2023183623A1 (en) 2022-03-25 2023-09-28 Regenxbio Inc. Dominant-negative tumor necrosis factor alpha adeno-associated virus gene therapy
WO2023248251A1 (en) * 2022-06-24 2023-12-28 Indian Institute Of Technology Kanpur An optimized aav vector for gene therapy of muscular dystrophy
WO2024044725A2 (en) 2022-08-24 2024-02-29 Regenxbio Inc. Recombinant adeno-associated viruses and uses thereof
WO2024081746A2 (en) 2022-10-11 2024-04-18 Regenxbio Inc. Engineered nucleic acid regulatory elements and methods and uses thereof
WO2024091495A1 (en) * 2022-10-24 2024-05-02 Biogen Ma Inc. Compositions and methods for treating retinitis pigmentosa
WO2024138158A2 (en) 2022-12-23 2024-06-27 Ultragenyx Pharmaceutical Inc. Method of producing soluble microdystrophin protein and uses of the same
WO2024216244A2 (en) 2023-04-13 2024-10-17 Regenxbio Inc. Targeting aav capsids, methods of manufacturing and using same
WO2025072197A2 (en) 2023-09-25 2025-04-03 Sarepta Therapeutics, Inc. Adapted human dystrophins with enhanced actin-binding affinity for treating muscular dystrophies
WO2025250909A1 (en) 2024-05-31 2025-12-04 Sarepta Therapeutics, Inc. Muscle-tropic recombinant aav
WO2026080823A1 (en) 2024-10-10 2026-04-16 Research Institute At Nationwide Children's Hospital Methods for diagnosing and treating muscular dystrophy diseases

Also Published As

Publication number Publication date
CL2022001372A1 (es) 2023-01-13
WO2021108755A3 (en) 2021-07-08
US20250367327A1 (en) 2025-12-04
US20250367326A1 (en) 2025-12-04
AU2020392243A1 (en) 2022-06-16
US20230270886A1 (en) 2023-08-31
TWI908746B (zh) 2025-12-21
MX2022006427A (es) 2022-09-07
JP2023503637A (ja) 2023-01-31
US20250367328A1 (en) 2025-12-04
JP2026027271A (ja) 2026-02-18
JP7822933B2 (ja) 2026-03-03
EP4065596A2 (en) 2022-10-05
CA3159516A1 (en) 2021-06-03
BR112022009895A2 (pt) 2022-08-09
TW202134260A (zh) 2021-09-16
KR20220107222A (ko) 2022-08-02

Similar Documents

Publication Publication Date Title
US20250367328A1 (en) Methods of manufacturing microdystrophin gene therapy constructs
AU2022200936B2 (en) Methods And Materials For Activating An Internal Ribosome Entry Site In Exon 5 Of The DMD Gene
KR20220133854A (ko) 유전적 청력 상실 치료를 위한 아데노 관련 바이러스(aav) 시스템
US20240216543A1 (en) Microdystrophin gene therapy administration for treatment of dystrophinopathies
JP2023501897A (ja) C9orf72関連疾患の治療のための三重機能アデノ随伴ウイルス(aav)ベクター
Chwalenia et al. AAV microdystrophin gene replacement therapy for Duchenne muscular dystrophy: progress and prospects
US20240409955A1 (en) Auf1 combination therapies for treatment of muscle degenerative disease
US20240358857A1 (en) Treatment of duchenne muscular dystrophy and combinations thereof
EP4558514A2 (en) Auf1 gene therapy for limb girdle muscular dystrophy
IL293334A (en) Microdystrophin gene therapy constructs and uses thereof
WO2026006341A1 (en) Microdystrophin gene therapy administration for treatment of dystrophinopathies
EP4680741A2 (en) Exon skipping gene therapy constructs, vectors and uses thereof
WO2025227131A1 (en) Dystrophin constructs and methods of use thereof
AU2024256934A1 (en) Gene therapy for treating limb girdle muscular dystrophy r9 and congenital muscular dystrophy 1c

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20845454

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 3159516

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2022531343

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022009895

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2020392243

Country of ref document: AU

Date of ref document: 20201127

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20227021099

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020845454

Country of ref document: EP

Effective date: 20220628

ENP Entry into the national phase

Ref document number: 112022009895

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20220520

WWD Wipo information: divisional of initial pct application

Ref document number: 827690

Country of ref document: NZ