WO2017070491A1 - Ophthalmic formulations - Google Patents

Abstract

The present invention provides ophthalmic formulations for the delivery of a gene therapy vector into the eye of a patient in need thereof, wherein the formulation comprises a density modifying agent. The invention also provides methods of treating X-linked retinoschisis by administering an effective amount of an ophthalmic formulations of the present invention.

Description

OPHTHALMIC FORMULATIONS

RELATED APPLICATIONS

This application claims priority to U.S. Provisional Patent Application Serial No. 62/245,584, filed on October 23, 2015, the entire contents of which are incorporated herein by reference.

BACKGROUND OF THE INVENTION

A promising approach to treating and preventing ophthalmic disease that addresses the limitations of existing treatment is delivery of therapeutic agents to the eye with a gene therapy vector such as an adeno-associated virus (AAV). AAV is a 4.7 kb, single stranded DNA virus. Recombinant vectors based on AAV are associated with excellent clinical safety, since wild-type AAV is nonpathogenic and has no etiologic association with any known diseases. In addition, AAV offers the capability for highly efficient gene delivery and sustained transgene expression in numerous tissues, including eye, muscle, lung, and brain. AAV has shown promise in human clinical trials.

However, challenges remain with regard to formulating expression vectors in gene therapy to treat eye diseases. One challenge is obtaining sufficient expression of the transgene in target cells, especially in the cells of the retina. An unmet need in the art has been sufficient delivery and expression of transgenes. In some cases, more targeted delivery or greater expression is required for the efficacy of certain vectors or to allow for a lower therapeutic dose that has a more favorable safety profile or a less invasive route of administration.

The present invention provides novel formulations for the delivery of therapeutics including gene therapy vectors into the eye.

SUMMARY OF THE INVENTION

The present invention is based upon the surprising finding that an ophthalmic formulation comprising a density modifying agent can be used to deliver a therapeutic into the eye, and in particular to the back of the eye. In one exemplary embodiment, the therapeutic is a gene therapy vector. The formulations of the invention have a number of uses in methods of treating ocular diseases or disorders where the back of the eye or retina is the preferred target. Exemplary methods include treating X-linked retinoschisis (XLRS) and treating macular degeneration. Accordingly, in a first aspect, the present invention features an ophthalmic

formulation for delivery of a therapeutic, e.g., a gene therapy vector, into the eye of a patient in need thereof, wherein the formulation comprises a density modifying agent.

In one embodiment, the density modifying agent is dextrose. In a further

embodiment, the dextrose is present in a range of about 2% to about 10% (v/v). In another further embodiment, the dextrose comprises about 5% (v/v).

In one embodiment, the density modifying agent is glucose. In a further embodiment, the glucose is present in a range of about 2% to about 10% (v/v). In another further embodiment, the glucose comprises about 5% (v/v).

In one embodiment, the density modifying agent is sucrose. In a further embodiment, the sucrose is present in a range of about 2% to about 10% (v/v). In another further embodiment, the sucrose comprises about 5% (v/v).

In another embodiment, the density modifying agent is D₂0. In a further

embodiment, the D₂0 is present in a range of about 25% to about 75% (v/v). In another further embodiment, the D₂0 comprises about 50% (v/v).

In another embodiment, the density modifying agent is polyethylene glycol (PEG). In a further embodiment, the PEG is present in a range of about 2% to about 10% (v/v). In another further embodiment, the PEG comprises about 4% (v/v).

In another embodiment, the density modifying agent is glycerin. In a further embodiment, the glycerin is present in a range of about 0.05% to about 10% (v/v). In a further embodiment, the glycerin is present in a range of about 0.01% to about 5% (v/v).

In one embodiment, the ophthalmic formulation further comprises Tween-20 in a range of about 0.005% to about 0.025% (v/v). In a further embodiment, the Tween-20 comprises about 0.014% (v/v).

In another embodiment, the formulation further comprises a balanced salt solution

(BSS).

In one embodiment, the gene therapy vector is targeted to the back of the eye.

In a further embodiment, the vector is a recombinant adeno-associated virus (rAAV). In a further related embodiment, the rAAV-based gene therapy vector is AAV2tYF (SEQ ID NO: 1). In a further related embodiment, the gene therapy vector is present in a concentration of about 1 x 10 11 to about 1 x 1013 vg/mL. In a further related embodiment, the gene therapy vector is present in a concentration of about 3 x 10 12 vg/mL. In a further related

embodiment, the gene therapy vector is present in a concentration of about 1 x 10 12 vg/mL. In a further related embodiment, the gene therapy vector is present in a concentration of about

2 x 10 12 vg/mL. In a further related embodiment, the gene therapy vector is present in a concentration of about 4 x 10 12 vg/mL.

In another aspect, the present invention features a method of treating X-linked retinoschisis (XLRS) by administering an effective amount of an ophthalmic formulation according to any one of the above aspects or embodiments, for delivery of a gene therapy vector into the eye of a patient in need thereof, wherein the vector comprises the

Retinoschisin (RS I) gene or a fragment thereof.

In still another aspect, the present invention features a method of treating macular degeneration by administering a therapeutic, e.g., an anti-VEGF.

In one embodiment of any one of the above aspects or embodiments, the formulation is delivered by intravitreal injection. In another embodiment of any one of the above aspects or embodiments, the formulation is delivered sub-retinally. In another further embodiment of any one of the above aspects or embodiments, the formulation is delivered suprachoridally.

In one embodiment, the formulation, as described in any one of the above aspects and embodiments, is administered to the patient in need thereof while the patient's head is in a horizontal position. In a related embodiment, the method further comprises keeping the patient's head in a horizontal position for a period of time from about 15 minutes to about 4 hours. In a related embodiment, the formulation, as described in any one of the above aspects and embodiments, is administered to the patient in need thereof while the patient is in a supine position (i.e., in dorsal recumbrance). In a related embodiment, the method further comprises keeping the patient in a supine position for a period of time from about 15 minutes to about 4 hours. In other related embodiments, the method further comprises keeping the patient in a supine position for a period of time of 30 minutes.

Other embodiments of the present invention are provided infra.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides novel ophthalmic formulations that can be used to target a therapeutic, e.g., a gene therapy vector, to the back of the eye.

Definitions

In order that the present invention may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention. Unless otherwise clear from context, all numerical values provided herein can be modified by the term about.

The articles "a", "an" and "the" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article unless otherwise clearly indicated by contrast. By way of example, "an element" means one element or more than one element.

The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to."

The term "or" is used herein to mean, and is used interchangeably with, the term "and/or," unless context clearly indicates otherwise.

The term "such as" is used herein to mean, and is used interchangeably, with the phrase "such as but not limited to."

The recitation of a listing of chemical group(s) in any definition of a variable herein includes definitions of that variable as any single group or combination of listed groups. The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.

Ranges provided herein are understood to be shorthand for all of the values within the range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.

The term "about" means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, "about" can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term "about" meaning within an acceptable error range for the particular value should be assumed. The term "adeno-associated virus" (AAV) in the context of the present invention includes without limitation AAV type 1, AAV type 2, AAV type 3 (including types 3 A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, avian AAV, bovine AAV, canine AAV, equine AAV, and ovine AAV and any other AAV now known or later discovered. See, e.g. , BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). The genomic sequences of various AAV and autonomous parvoviruses, as well as the sequences of the ITRs, Rep proteins, and capsid subunits are known in the art. Such sequences may be found in the literature or in public databases such as the GENBANK database. See, e.g. , GenBank Accession Numbers NC 002077, NC 001401, NC 001729, NC 001863, NC 001829, NC 001862, NC 000883, NC 001701, NC 001510, AF063497, U89790, AF043303, AF028705, AF028704, J02275, J01901, J02275, X01457, AF288061, AH009962, AY028226,

AY028223, NC 001358, NC 001540, AF513851, AF513852, AY530579, AY631965, AY631966; the disclosures of which are incorporated herein in their entirety. See also, e.g., Srivistava et al., (1983) J. Virol. 45:555; Chiorini et al., (1998) J. Virol. 71 :6823; Chiorini et al., (1999) J. Virol. 73: 1309; Bantel-Schaal et al., (1999) J. Virol. 73:939; Xiao et al., (1999) J. Virol. 73:3994; Muramatsu et al., (1996) Virology 221 :208; Shade et al., (1986) J. Virol. 58:921 ; Gao et al., (2002) Proc. Nat. Acad. Sci. USA 99: 11854; international patent publications WO 00/28061, WO 99/61601, WO 98/11244; U.S. Pat. No. 6, 156,303; the disclosures of which are incorporated herein in their entirety.

An "AAV virus" refers to a viral particle composed of at least one AAV capsid protein (typically by all of the capsid proteins of a wild-type AAV) and an encapsidated polynucleotide rAAV vector. If the particle comprises a heterologous polynucleotide (i.e. a polynucleotide other than a wild-type AAV genome such as a transgene to be delivered to a mammalian cell), it is typically referred to as a "rAAV virus" or a "rAAV vector."

The abbreviation "rAAV" refers to recombinant adeno-associated virus, also referred to as a recombinant AAV vector (or "rAAV vector"). A "rAAV vector" as used herein refers to an AAV vector comprising a polynucleotide sequence not of AAV origin (i.e. , a polynucleotide heterologous to AAV), typically a sequence of interest for the genetic transformation of a cell. In general, the heterologous polynucleotide is flanked by at least one, and generally by two AAV inverted terminal repeat sequences (ITRs). The term rAAV vector encompasses both rAAV vector particles and rAAV vector plasmids. The term "back of the eye" is meant to refer to the retina, the light-sensitive layer of tissue at the back of the inner eye. The back of the eye includes ocular cells. The term "ocular cells" refers to any cell in, or associated with the function of, the eye. The term may refer to any one of photoreceptor cells, including rod, cone and photosensitive ganglion cells or retinal pigment epithelium (RPE) cells.

The term "density modifying agent" is meant to refer to any component that may be added to an ophthalmic formulation that increases the density of the formulation. In certain embodiments, the density modifying agent increases the amount of a formulation that is delivered to the back of the eye. The density modifying agent may be, e.g., dextrose, sucrose, glucose, D₂0, PEG or glycerin.

By the term "treat," "treating," or "treatment of (or grammatically equivalent terms) it is meant that the severity of the subject's condition is reduced or at least partially improved or ameliorated and/or that some alleviation, mitigation or decrease in at least one clinical symptom is achieved and/or there is a delay in the progression of the condition and/or prevention or delay of the onset of a disease or disorder. The term "treat," "treats," "treating," or "treatment of and the like also include prophylactic treatment of the subject (e.g., to prevent the onset of infection or cancer or a disorder). As used herein, the term "prevent," "prevents," or "prevention" (and grammatical equivalents thereof) are not meant to imply complete abolition of disease and encompasses any type of prophylactic treatment that reduces the incidence of the condition, delays the onset and/or progression of the condition, and/or reduces the symptoms associated with the condition. Thus, unless the context indicates otherwise, the term "treat," "treating," or "treatment of (or grammatically equivalent terms) refer to both prophylactic and therapeutic regimens.

An "effective" or "therapeutically effective" amount as used herein is an amount that is sufficient to provide some improvement or benefit to the subject. Alternatively stated, an "effective" or "therapeutically effective" amount is an amount that will provide some alleviation, mitigation, or decrease in at least one clinical symptom in the subject. Those skilled in the art will appreciate that the therapeutic effects need not be complete or curative, as long as some benefit is provided to the subject.

As used herein, the term "vector," "virus vector," "delivery vector" (and similar terms) generally refers to a virus particle that functions as a nucleic acid delivery vehicle, and which comprises the viral nucleic acid (i.e. , the vector genome) packaged within the virion. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described.

Reference will now be made in detail to preferred embodiments of the invention. While the invention will be described in conjunction with the preferred embodiments, it will be understood that it is not intended to limit the invention to those preferred embodiments. To the contrary, it is intended to cover alternatives, modifications, and equivalents as may be included within the spirit and scope of the invention as defined by the appended claims.

I. OPHTHALMIC FORMULATIONS

The present invention features ophthalmic formulations for the delivery of a gene therapy vector into the eye of a patient in need thereof, wherein the formulation comprises a density modifying agent.

Formulations described herein are aqueous formulations.

Certain formulations preferably comprise dextrose as the density modifying agent. Dextrose is a synonym of D-glucose (chemical formula C₆Hi₂0₆) and refers to the pure, crystalline monosaccharide obtained after a total hydrolysis of starch. In certain

embodiments, the dextrose is present in the ophthalmic formulation in a range of about 2% to about 10% (v/v), that is about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10% (v/v). In certain preferred embodiments, the dextrose comprises about 5% (v/v).

Certain formulations preferably comprise glucose as the density modifying agent. Glucose (chemical formula C₆Hi₂0₆) refers to the pure, crystalline monosaccharide obtained after a total hydrolysis of starch. In certain embodiments, the glucose is present in the ophthalmic formulation in a range of about 2% to about 10% (v/v), that is about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10% (v/v). In certain preferred embodiments, the glucose comprises about 5% (v/v).

Certain formulations preferably comprise glucose as the density modifying agent.

Sucrose (chemical formula C12H22O11) refers to the pure, disaccharide containing glucose and fructose. In certain embodiments, the glucose is present in the ophthalmic formulation in a range of about 2% to about 10% (v/v), that is about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10% (v/v). In certain preferred embodiments, the sucrose comprises about 5% (v/v).

Other formulations of the invention comprise D₂0 as the density modifying agent. D₂0, also called heavy water, is a form of water that contains a larger than normal amount of the hydrogen isotope deuterium (2 H or D, also known as heavy hydrogen), rather than the common hydrogen- 1 isotope (1 H or H, also called protium) that makes up most of the hydrogen in regular water. Heavy water is denser than ordinary water.

In certain embodiments, the D₂0 is present in a range of about 25% to about 75% (v/v), that is about 25%, 26%, 27%, 28%,29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74% or 75% (v/v). In certain preferred embodiments, the D₂0 comprises about 50% (v/v).

Other formulations of the invention comprise polyethylene glycol (PEG, chemical formula C₂nH4_n+2O_n+i) as the density modifying agent. PEG refers to an oligomer or polymer of ethylene oxide. In certain embodiments, the PEG is present in a range of about 2% to about 10% (v/v), that is about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10% (v/v). In certain preferred embodiments, the PEG comprises about 4% (v/v).

Other formulations of the invention comprise glycerin as the density modifying agent. Glycerin (or glycerol, chemical formula C₃H₈O₃) is a simple polyol compound. In certain embodiments, the glycerin is present in a range of about 0.05% to about 10% (v/v), that is about 0.05%, 0.10%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5% or 10% (v/v). In other embodiments, the glycerin is present in a range of about 0.01% to about 5% (v/v), that is about 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.11%, 0.12%, 0.13%, 0.14%, 0.15%, 00.16%, 0.17%, 0.18%, 0.19%, 0.2%, 0.21%, 0.22%, 0.23%, 0.24%, 0.25%, 0.26%, 0.27%, 0.28%, 0.29%, 0.3%, 0.31%, 0.32%, 0.33%, 0.34%, 0.35%, 0.36%, 0.37%, 0.38%, 0.39%, 0.4%, 0.41%, 0.42%, 0.43%, 0.44%, 0.45%, 0.46%, 0.47%, 0.48%, 0.49%, 0.5%, 0.51%, 0.52%, 0.53%, 0.54%, 0.55%, 0.56%, 0.57%, 0.58%, 0.59%, 0.6%, 0.61%, 0.62%, 0.63%, 0.64%, 0.65%, 0.66%, 0.67%, 0.68%, 0.69%, 0.7%, 0.71%, 0.72%, 0.73%, 0.74%, 0.75%, 0.76%, 0.77%, 0.78%, 0.79%, 0.8%, 0.81%, 0.82%, 0.83%, 0.84%, 0.85%, 0.86%, 0.87%, 0.88%, 0.89%, 0.9%, 0.91%, 0.92%, 0.93%, 0.94%, 0.95%, 0.96%, 0.97%, 0.98%, 0.99%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6% , I.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6% , 3.7%, 3.8%, 3.9%, 4.0%, 4.1%, 4.2%, 4.3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9% to 5.0% (v/v).

The ophthalmic formulations of the present invention may further comprise Tween- 20. Tween-20 (also known as polysorbate 20, chemical formula C58H114O26 ) is a polysorbate surfactant. In certain embodiments, the Tween-20 is present in a range of about 0.005% to about 0.025% (v/v), that is about 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.010%, 0.011%, 0.012%, 0.013%, 0.014%, 0.015%, 0.016%, 0.017%, 0.018%, 0.019%, 0.020%, 0.021%, 0.022%, 0.023%, 0.024% to 0.025% (v/v). In certain preferred embodiments, the Tween-20 comprises about 0.014% (v/v).

The ophthalmic formulation of the present invention may further comprise a balanced salt solution (BSS).

A BSS is made to a physiological pH and salt concentration. Solutions most commonly include, but are not limited to, sodium, potassium, calcium, magnesium, and chloride. A BSS ophthalmic irrigation solution is commercially available (Alcon) and comprises as a composition per lmL: sodium chloride (NaCl) 6.4mg, potassium chloride (KC1) 0.75mg, calcium chloride dihydrate (CaCi₂*2H₂0) 0.48mg, magnesium chloride hexahydrate (MgCi₂*6H₂0) 0.3mg, sodium acetate trihydrate (C₂H₃Na0₂*3H₂0) 3.9mg, sodium citrate dihydrate (C₆HsNa₃0₇*2H₂0) 1.7mg, sodium hydroxide and/or hydrochloric acid (to adjust pH), and water for injection. The pH is approximately 7.5. The osmolality is approximately 300 mOsm/Kg. Another BSS ophthalmic irrigation solution is commercially available (Alcon) and comprises as a composition per lmL (once preparation complete): sodium chloride 7.14mg (122.17 mmol), potassium chloride 0.38mg (5.097 mmol), calcium chloride dihydrate 0.154mg (1.04754 mmol), magnesium chloride hexahydrate 0.2mg (0.983767 mmol), dibasic sodium phosphate 0.42mg (2.95858 mmol), sodium bicarbonate 2.1mg (24.998mmol), dextrose 0.92mg (5.1067 mmol), glutathione disulfide (oxidized glutathione) 0.184mg (0.3003 mmol), hydrochloric acid and/or sodium hydroxide (to adjust pH), in water for injection. The reconstituted product has a pH of approximately 7.4.

Osmolality is approximately 305mOsm.

II. ADENO-ASSOCIATED VIRUS VECTORS

As described herein, the present invention provides novel and inventive ophthalmic formulations for the delivery of a gene therapy vector into the eye of a patient in need thereof. In certain embodiments of this invention, the Retinoschisin 1 (RS I) nucleic acid, or a fragment thereof, is delivered to the eye of the patient in need thereof, and in particular to the ocular cells in need of treatment, by means of a viral vector, of which many are known and available in the art. As used herein, the term "ocular cells" refers to any cell in, or associated with the function of, the eye. The term may refer to any one of photoreceptor cells, including rod, cone and photosensitive ganglion cells or retinal pigment epithelium (RPE) cells.

For delivery to the eye, the therapeutic vector is desirably non-toxic, non- immunogenic, easy to produce, and efficient in protecting and delivering DNA into the target cells. In one particular embodiment, the viral vector is an adeno-associated virus vector (AAV). In one embodiment, the invention provides an ophthalmic formulation for delivery of a gene therapy vector into the eye of a patient in need thereof, wherein the vector comprises the RS 1 gene or a fragment thereof. In another embodiment, the invention provides an ophthalmic formulation for delivery of a gene therapy vector into the eye of a patient in need thereof, wherein the vector comprises the RPGR gene or a fragment thereof.

In one embodiment, the RS I sequence is encoded by SEQ ID NO: 2. In another embodiment, the RPGR sequence is a condon optimized version of SEQ ID NO:2.

More than 30 naturally occurring serotypes of AAV are available. Many natural variants in the AAV capsid exist, allowing identification and use of an AAV with properties specifically suited for ocular cells. AAV viruses may be engineered by conventional molecular biology techniques, making it possible to optimize these particles for cell specific delivery of RS 1 or RPGR nucleic acid sequences, for minimizing immunogenicity, for tuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus, etc.

Thus, RS I or RPGR overexpression can be achieved in the eye through delivery by recombinantly engineered AAVs or artificial AAVs that contain sequences encoding RS 1 or RPGR. The use of AAVs is a common mode of delivery of DNA as it is relatively non-toxic, provides efficient gene transfer, and can be easily optimized for specific purposes. Among the serotypes AAVs isolated from human or non-human primates (NHP) and well characterized, human serotype 2 is the first AAV that was developed as a gene transfer vector. It has been widely used for efficient gene transfer experiments in different target tissues and animal models. Clinical trials of the experimental application of AAV2 based vectors to some human disease models are in progress, and include such diseases as cystic fibrosis and hemophilia B. Other AAV serotypes include, but are not limited to, AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 and AAV9. See, e.g., WO 2005/033321 for a discussion of various AAV serotypes, which is incorporated herein by reference.

Desirable AAV fragments for assembly into vectors include the cap proteins, including the vpl, vp2, vp3 and hypervariable regions, the rep proteins, including rep 78, rep 68, rep 52, and rep 40, and the sequences encoding these proteins. These fragments may be readily utilized in a variety of vector systems and host cells. Such fragments may be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements from other AAV non-AAV viral sequences. As used herein, artificial AAV serotypes include, without limitation, AAV with a non-naturally occurring capsid protein. Such an artificial capsid may be generated by any suitable technique, using a selected AAV sequence {e.g. , a fragment of a vpl capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV serotype, non-contiguous portions of the same AAV serotype, from a non-AAV viral source, or from anon- viral source. An artificial AAV serotype may be, without limitation, a pseudotyped AAV, a chimeric AAV capsid, a recombinant AAV capsid, or a "humanized" AAV capsid. Pseudotyped vectors, wherein the capsid of one AAV is replaced with a heterologous capsid protein, are useful in the invention.

In one embodiment, the vectors useful in compositions and methods described herein contain, at a minimum, sequences encoding a selected AAV serotype capsid protein, or a fragment thereof. In another embodiment, useful vectors contain, at a minimum, sequences encoding a selected AAV serotype rep protein, or a fragment thereof. Optionally, such vectors may contain both AAV cap and rep proteins. In vectors in which both AAV rep and cap are provided, the AAV rep and AAV cap sequences can both be of one serotype e.g. , all AAV2 origin. Alternatively, vectors may be used in which the rep sequences are from an AAV serotype which differs from that which is providing the cap sequences. In one embodiment, the rep and cap sequences are expressed from separate sources {e.g. , separate vectors, or a host cell and a vector). In another embodiment, these rep sequences are fused in frame to cap sequences of a different AAV serotype to form a chimeric AAV vector.

In certain preferred embodiments of the invention, the vector is a recombinant adeno- associated virus (rAAV). In further preferred embodiment, the rAAV-based vector is AAV2tYF (SEQ ID NO: l) and described in US Patent 8,880,244.

A suitable recombinant adeno-associated virus (AAV) is generated by culturing a host cell which contains a nucleic acid sequence encoding an adeno-associated virus (AAV) serotype capsid protein, or fragment thereof, as defined herein; a functional rep gene; a minigene composed of, at a minimum, AAV inverted terminal repeats (ITRs) and a RPGR nucleic acid sequence; and sufficient helper functions to permit packaging of the minigene into the AAV capsid protein. The components required to be cultured in the host cell to package an AAV minigene in an AAV capsid may be provided to the host cell in trans.

Alternatively, any one or more of the required components (e.g., minigene, rep sequences, cap sequences, and/or helper functions) may be provided by a stable host cell which has been engineered to contain one or more of the required components using methods known to those of skill in the art.

Most suitably, such a stable host cell will contain the required component(s) under the control of an inducible promoter. However, the required component(s) may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein, in the discussion below of regulatory elements suitable for use with the transgene, i.e., RS I or RPGR. In still another alternative, a selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters. For example, a stable host cell may be generated which is derived from 293 cells (which contain El helper functions under the control of a constitutive promoter), but which contains the rep and/or cap proteins under the control of inducible promoters. Still other stable host cells may be generated by one of skill in the art.

The minigene, rep sequences, cap sequences, and helper functions required for producing the rAAV of the invention may be delivered to the packaging host cell in the form of any genetic element which transfers the sequences carried thereon. The selected genetic element may be delivered by any suitable method, including those described herein. The methods used to construct any embodiment of this invention are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g. , Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present invention. See, e.g. , K. Fisher et al, 1993 J. Viral., 70:520-532 and U.S. Pat. No. 5,478,745, among others. These publications are incorporated by reference herein.

Unless otherwise specified, the AAV ITRs, and other selected AAV components described herein, may be readily selected from among any AAV serotype, including, without limitation, AAVl, AAV2, AAV3, AAV5, AAV6, AAV7, AAV8, AAV9 or other known and unknown AAV serotypes. These ITRs or other AAV components may be readily isolated using techniques available to those of skill in the art from an AAV serotype. Such AAV may be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, Va.). Alternatively, the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like.

In exemplary embodiments, the minigene is composed of, at a minimum, RS I or RPGR nucleic acid sequence (the transgene), as described above, and its regulatory sequences, and 5' and 3' AAV inverted terminal repeats (ITRs). It is this minigene which is packaged into a capsid protein and delivered to a selected host cell.

The regulatory sequences include conventional control elements which are operably linked to RS 1 or RPGR in a manner which permits its transcription, translation and/or expression in a cell transfected with the vector or infected with the virus produced by the invention. As used herein, "operably linked" sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.

Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e. , Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. A great number of expression control sequences, including promoters, are known in the art and may be utilized.

The regulatory sequences useful in the constructs of the present invention may also contain an intron, desirably located between the promoter/enhancer sequence and the gene. One desirable intron sequence is derived from SV-40, and is a 100 bp mini-intron splice donor/splice acceptor referred to as SD-SA. Another suitable sequence includes the woodchuck hepatitis virus post-transcriptional element. (See, e.g., L. Wang and I. Verma, 1999 Proc. Natl. Acad. Sci., USA, 96:3906-3910). PolyA signals may be derived from many suitable species, including, without limitation SV-40, human and bovine.

Another regulatory component of the rAAV useful in the method of the invention is an internal ribosome entry site (IRES). An IRES sequence, or other suitable systems, may be used to produce more than one polypeptide from a single gene transcript. An IRES (or other suitable sequence) is used to produce a protein that contains more than one polypeptide chain or to express two different proteins from or within the same cell. An exemplary IRES is the polio virus internal ribosome entry sequence, which supports transgene expression in photoreceptors, RPE and ganglion cells. Preferably, the IRES is located 3' to the transgene in the rAAV vector.

The selection of the promoter to be employed in the rAAV may be made from among a wide number of constitutive or inducible promoters that can express the selected transgene in the desired an ocular cell. In another embodiment, the promoter is cell- specific. The term "cell- specific" means that the particular promoter selected for the recombinant vector can direct expression of the selected transgene in a particular ocular cell type, for example the promoter may be specific for expression of the transgene in photoreceptor cells or rods and cones.

The promoter may be derived from any species. The promoter may be the native promoter for the gene to be expressed. Other promoters include, without limitation, the rod opsin promoter, the red-green opsin promoter, the blue opsin promoter, the cGMP-.beta.- phosphodiesterase promoter, the mouse opsin promoter, the rhodopsin promoter (Mussolino et al, Gene Ther, July 2011, 18(7):637-45); the alpha-subunit of cone transducin (Morrissey et al, BMC Dev, Biol, January 2011, 11:3); beta phosphodiesterase (PDE) promoter; the retinitis pimentosa (RP1) promoter (Nicord et al, J. Gene Med, December 2007, 9(12): 1015- 23); the NXNL2,/NXNL1 promoter (Lombard et al, PLoS One, October 2010, 5(10):el3025), the RPE65 promoter; the retinal degeneration slow/peripherin 2 (Rds/perph2) promoter (Cai et al, Exp Eye Res. 2010 August; 91(2): 186-94); and the VMD2 promoter (Kochi et al, Human Gene Therapy, 2009(20:31-9)). Each of these documents is incorporated by reference herein. In one embodiment, the promoter is of a small size, under 1000 bp, due to the size limitations of the AAV vector. In another embodiment, the promoter is under 400 bp.

Examples of constitutive promoters include, without limitation, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the

cytomegalovirus (CMV) promoter (optionally with the CMV enhancer), the SV40 promoter, the dihydrofolate reductase promoter, the chicken .beta.-actin (CBA) promoter, the phosphoglycerol kinase (PGK) promoter, the EF1 promoter (Invitrogen), and the immediate early CMV enhancer coupled with the CBA promoter (Beltran et al, Gene Therapy 2010).

Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, acute phase, a particular differentiation state of the cell, or in replicating cells only. Inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech and Ariad. Many other systems have been described and can be readily selected by one of skill in the art.

Examples of inducible promoters regulated by exogenously supplied compounds, include, the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system; the ecdysone insect promoter, the tetracycline-repressible system, the tetracycline-inducible system, the RU486-inducible system and the rapamycin-inducible system. Other types of inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only. Any type of inducible promoter which is tightly regulated and is specific for the particular target ocular cell type may be used.

Other regulatory sequences useful in the invention include enhancer sequences.

Enhancer sequences useful in the invention include the IRBP enhancer (Nicord 2007, cited above), immediate early cytomegalovirus enhancer, one derived from an immunoglobulin gene or SV40 enhancer, the cis-acting element identified in the mouse proximal promoter, etc.

Selection of these and other common vector and regulatory elements are conventional and many such sequences are available. See, e.g., Sambrook et al, and references cited therein at, for example, pages 3.18-3.26 and 16.17- 16.27 and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989). Of course, not all vectors and expression control sequences will function equally well to express all of the transgenes of this invention. However, one of skill in the art may make a selection among these, and other, expression control sequences without departing from the scope of this invention.

III. METHODS

The present invention provides various methods of treating, preventing, arresting progression of or ameliorating various ocular diseases, and the retinal changes associated therewith. Generally, the methods include administering an effective amount of an ophthalmic formulation described herein for delivery of a gene therapy vector into the eye of a patient in need thereof. The ophthalmic formulations of the present invention are based on the surprising finding that including a density modifying agent in the inventive formulations enables delivery of the gene therapy vector to the eye, and in particular to the back of the eye.

Accordingly, in certain embodiments, the ophthalmic formulations comprising a gene therapy vector as described herein are targeted to the back of the eye.

The back of the eye includes the retina. The retina is the light-sensitive layer of tissue that lines the inside of the eye and sends visual messages through the optic nerve to the brain. The vertebrate retina has ten distinct layers, including the photoreceptor layer and the ganglion nerve layer.

A patient in need thereof can be a patient suffering from an ocular disease, and in particular from a retinal disease. An ocular disease is meant to refer to a disorder or pathological condition of the eye, for example a retinal disease refers to a disorder or pathological condition of the retina, which is not normal to the animal in a healthy state, whether as the result of a genetic defect, injury or other trauma, disease or other disorder. The ocular disease, for example a retinal disease, may be caused by a genetic defect.

Examples of genetic retinal diseases include retinitis pigmentosa, choroideremia, Leber congenital amaurosis, X-linked Retinoschisis, including juvenilie X-linked retinoschisis, Stargardt disease, Usher disease and Bardet Biedl. Ocular disorders also include dystrophies of the macula. A large number of inherited retinal dystrophies primarily affect the macula, the part of the retina specialized for central vision and advanced visual function. These macular dystrophies are characterized by gradual loss of acuity, color vision and contrast sensitivity with onset usually by the second decade of life. Age-related macular degeneration is the leading cause of blindness in the Western World for individuals over 65 years of age. Its incidence is expected to double in the next three decades. The disease's hallmark is the subretinal accumulation of lipid and protein-containing deposits at the macula. Subsequently, vision is lost because the macula becomes degenerate, either atrophic (dry) or scarred following neovascularization invading from the underlying choroid (wet age-related macular degeneration).

In exemplary aspects, the present invention features methods of treating XLRS with the formulations described herein.

X-linked retinoschisis (XLRS) is a genetic disorder that causes splitting through the layers of the retina, the light-sensitive neural tissue in the back of the eye. XLRS gene mutations are inherited from mother to child; however, typically only males develop symptoms. X-linked juvenile retinoschisis is a condition characterized by impaired vision that begins in childhood and slowly worsens over the next several decades as cells in the retina lose function and die.

The causative gene was identified in 1997 and named Retinoschisin 1 (RS I). RS I (NG_008659.3 RefSeqGene) codes for the retinoschisin protein, which normally provides lateral adhesion that holds retinal cells together. RS 1 gene mutations alter the protein and thereby interfere with the ability of cells to maintain proper structure of the retina.

In one aspect, the invention features methods of treating XLRS by administering an effective amount of an ophthalmic formulation described herein for delivery of a gene therapy vector into the eye of a patient in need thereof, wherein the vector comprises the RS 1 gene or a fragment thereof.

The invention also features methods of treating macular degeneration by

administering an effective amount of an ophthalmic formulation described herein for delivery of a therapeutic into the eye of a patient in need thereof, wherein the therapeutic comprises an anti-VEGF therapeutic. In one example, the anti-VEGF therapeutic is aflibercept.

A patient in need thereof may also be a patient who is at risk of an ocular disease or disorder, in particular a genetic ocular disease or disorder, and more particularly X-linked retinoschisis (XLRS) or macular degeneration. Accordingly, in another embodiment, a method of treating or preventing XLRS or macular degeneration in a subject in need thereof is provided. The method includes identifying a subject having, or at risk of developing, XLRS or macular degeneration by performing non-invasive retinal imaging and functional studies and identifying areas to be targeted for therapy; and administering to the subject an effective amount of an ophthalmic formulation, whereby XLRS or macular degeneration is prevented, arrested or ameliorated. Genotypic analysis is routine in the art and may include the use of PCR to identify one or more mutations in the nucleic acid sequence of the RS 1 or RPGR gene. See, e.g., Meindl et al, Nat Gen, May 1996, 13:35, Vervoort, R. et al, 2000. Nat Genet 25(4): 462-466 and Vervoort, R. and Wright, A. F. 2002, Human Mutation 19: 486- 500, each of which is incorporated herein by reference.

In another embodiment of the invention, the method includes performing functional and imaging studies to determine the efficacy of the treatment. These studies include ERG and in vivo retinal imaging, as described in the examples below. In addition visual field studies, perimetry, and microperimetry, mobility testing, visual acuity, color vision testing may be performed. In yet another embodiment of the invention, any of the above described methods is performed in combination with another, or secondary, therapy. The therapy may be any now known, or as yet unknown, therapy which helps prevent, arrest or ameliorate XLRS or macular degeneration, or any of the above-described effects associated therewith. The secondary therapy can be administered before, concurrent with, or after administration of the therapeutic described above.

The methods of the invention are useful in both human and veterinary medical applications. Suitable patients include mammals, such as humans. Mammals also include bovines, ovines, caprines, equines, felines, and canines. Human patients are the most preferred, and may include fetal, neonatal, infant, juvenile and adult subjects.

IV. ADMINISTRATION

The ophthalmic formulations of the present invention may be delivered by a number of different methods, including intravitreal injection, subretinal injection, or suprachordial injection.

In certain embodiments, the formulation is delivered to the patient while the patient's head is in a horizontal position. In further embodiments, after the formulation is delivered to the eye, the patient's head is maintained in a horizontal position for a period of time from about 15 minutes to about 4 hours. In certain related embodiments, the formulation is administered to the patient in need thereof while the patient is in a supine position (i.e., in dorsal recumbrance). In a related embodiment, after the formulation is delivered to the eye, the patient's body is maintained in a supine position for a period of time from about 15 minutes to about 4 hours or in other embodiments, for a period of time of 30 minutes.

In certain embodiments of the invention, the subject's head may be positioned such that the formulations described herein are delivered to the appropriate area of the eye.

In certain embodiments of the invention it is desirable to perform non- invasive retinal imaging and functional studies to identify areas to be targeted for therapy. In these embodiments, clinical diagnostic tests are employed to determine the precise location(s) for deliver, e.g. the location for one or more intravitreal, subretinal or suprachordial injection(s). These tests may include electroretinography (ERG), perimetry, topographical mapping of the layers of the retina and measurement of the thickness of its layers by means of confocal scanning laser ophthalmoscopy (cSLO) and optical coherence tomography (OCT), topographical mapping of cone density via adaptive optics (AO), functional eye exam, etc. These, and other desirable tests, are described in the examples below. In view of the imaging and functional studies, in some embodiments of the invention one or more injections are performed in the same eye in order to target different areas of retained photoreceptors. The volume and viral titer of each injection is determined individually, and may be the same or different from other injections performed in the same, or contralateral, eye. The volume and concentration of the formulation is selected so that only the region to be treated (e.g. a damaged region) is impacted. Alternatively, the volume and/or concentration of the formulation is a greater amount, in order to reach larger portions of the eye.

The formulation may be delivered in a volume of from about 50 to about 1 mL, including all numbers within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. The formulation may also be delivered in a volume of from about 30 to about 1 mL, including all numbers within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method.

The vector dose to achieve a therapeutic effect, e.g., the dose in vector genomes/per kilogram of body weight (vg/kg), or transducing units will vary based on several factors including, but not limited to: route of administration, the level of transgene expression required to achieve a therapeutic effect, the specific disease treated, any host immune response to the vector (e.g., AAV), a host immune response to the transgene or expression product (protein), and the stability of the protein expressed. One skilled in the art can readily determine a AAV vector dose range to treat a patient having a particular disease or disorder based on the aforementioned factors, as well as other factors. An effective concentration of a recombinant adeno-associated virus carrying a nucleic acid sequence encoding the desired transgene under the control of the cell- specific promoter sequence desirably ranges between

11 13

about 1 x 10 to about 1 x 10 vg/mL vector genomes per milliliter (vg/mL), and in certain

12

embodiments preferably 3 x 10 vg/mL. The rAAV infectious units are measured as described in S. K. McLaughlin et al, 1988 J. Virol., 62: 1963. It is desirable that the lowest effective concentration of virus be utilized in order to reduce the risk of undesirable effects, such as toxicity, retinal dysplasia and detachment. Still other dosages in these ranges may be selected by the attending physician, taking into account the physical state of the subject, preferably human, being treated, the age of the subject, the particular ocular disorder and the degree to which the disorder, if progressive, has developed. A number of embodiments of the invention have been described. Nevertheless, one skilled in the art, without departing from the spirit and scope of the invention, can make various changes and modifications of the invention to adapt it to various usages and conditions. Accordingly, the following examples are intended to illustrate, but not limit, the scope of the invention claimed.

EXAMPLES

Example 1. In vitro and ex vivo studies for the comparison of formulations for AAV preparation in intra vitreal injection

The major goal of this study is to compare different formulations of AAVs in intravitreal injection by measuring the retina surface coverage, retinal layer penetration and gene expression between different retina regions.

Study Design

1. In vitro solution density effect

To study the effect of in vitro solution density, 0.15% Trypan blue will be dissolved in Alcon BSS containing 0.014% Tween-20 with or without 5% dextrose or 50% D₂0 or 4% PEG 3350 or glycerin. After being fully dissolved, the dye will be injected into either BSS containing 0.014% Tween-20 or vitreous humor in a tube with a spherical bottom, such as FALCON Round-Bottom Polystyrene Tubes. The precipitation and dispersion of the blue dye will be recorded, pictures of the final droplet will be taken, and the droplet size will be measured on the bottom. The experimental groups are shown in Table 1 below.

Table 1

2. Ex vivo retina staining/transduction

AAVs with GFP gene cassette and capsid labeled with cyanine dye (Cy3) will be used to evaluate the different formulations for AAV preparation (Cy3-AAV-GFP). 2.1 Overnight GFP expression level will be firstly confirmed in HEK293 cells by infection with AAV2tYF-CBA-GFP or scAAV2-CBA-GFP.

2.2 To determine whether Cy3 labeling is going to affect the AAV infection efficiency, Cy3-labeled AAVs (Cy3-AAV2tYF-CBA-GFP or Cy3-scAAV2-CBA-GFP) will be used to infect HEK293 cells. GFP expression will be used to evaluate their infectivity. AAVs without Cy3 labeling (AAV2tYF-CBA-GFP or scAAV2-CBA-GFP) will be used as controls.

2.3 Enucleated eyes from monkey, cow or pig and Cy3-AAV-GFP will be used to evaluate the different formulations for AAV preparation. The AAV-covered retina surface will be measured, calculating the depth of AAV particle penetration in the layers of retina and assessing the GFP expression pattern in retinal cells.

2.3.1 A two-photon laser scanning microscope will be used for in vivo imaging, recording and tracing the AAVs during and after injection.

2.3.2 To test and optimize the ex vivo system, 2-3 nucleated eyes will firstly be injected by AAVs (Cy3-AAV2tYF-CBA-GFP and Cy3-scAAV2-CBA-GFP) for 24 h (or longer). After that, fluorescent images (both red and green channels) of retinal flat mounts will be used to analyze the pattern of AAV-covered retina surface. Retinal cross sections will be used to determine the penetration of AAV particles in the retina layers and examine the expression pattern of transgenes (GFP) as well.

2.4 After optimization is performed in 2.3.2, more enucleated eyes will be treated as shown in Table 2, below. The Cy3-labeled AAVs will be monitored by two-photon laser scanning microscope during and after injection. After a short-term (24 h or longer) AAV infection, 2 eyes from each group will be used for flat mounts to observe the location of Cy3- AAV-GFP on the retinal surface and the other 2 will be used for retinal cross sections to examine which retina layer contains the Cy3-AAV and expresses GFP transgene.

Table 2. Design of formulation comparison

4 4 scAAV2-GFP-Cy3 with 1 x 10¹² Intravitreal 100 1 x 10^U 5% Dextrose

5 4 AAV2tYF-GFP-Cy3 1 x 10¹² Intravitreal 100 1 x 10¹¹ with 5% Dextrose

Methods

The foregoing experiments will be carried out, but not limited to, the methods described below.

Fluorescent labeling of AAV with Cy3

AAV viral particles can be labeled by cyanine dyes generating a stable N- hydroxysuccinimide (NHS)-ester with amino groups at the capsid surface. Cy3 labeling kits are commercially available (e.g., GE Healthcare Life Sciences, Thermo Fisher Scientific). Specifically, in this study, AAV particles will be labeled with the carbocyanine dyes Cy3 in sodium carbonate- sodium bicarbonate buffer, pH 9.3 (Amersham kit). Unconjugated dye molecules will be separated from labeled viral particles using buffer exchange on Amicon Ultra- 15 Centrifugal Filters. Finally, the AAVs will be formulated with BSS containing 0.014% Tween-20 with or without 5% Dextrose. Example 2. Transduction Efficiency of AAV2tYF-CB-GFP after Administration to Nonhuman Primates

Study Design

An AAV vector for treatment of X-linked retinoschisis (XLRS) is being developed, with the preferred route of delivery as intravitreal injection. Previous studies have shown that intravitreal injection of AAV vectors packaged in AAV2tYF capsids and formulated in balanced salt solution (BSS) containing 0.014% Triton X-100 are able to transduce retinal ganglion cells in the macula and scattered foci near blood vessels in the peripheral retina. This study is designed in two parts: (i) to investigate and compare the transduction efficiency of AAV vectors (e.g., AAV2tYF-CB-GFP) expressing GFP packaged in AAV2tYF capsids and formulated in BSS/0.014% Tween 20 with or without 5% dextrose when administered via intravitreal injection; and (ii) to investigate and compare the transduction efficiency of AAV vectors (e.g., AAV2tYF-CB-GFP) expressing GFP packaged in AAV2tYF capsids and formulated in BSS/0.014% Tween 20 when delivered subretinally or suprachoroidally. An outline of the study is provided below. A total of 10 cynomolgus macaques will be used, as shown below in Table 3.

OD = right eye; OS = left eye

bAnimals were dosed on Study Day 1, which was considered the day of dosing of each animal

The AAV2tYF-CB-GFP vector of Group 1 was administered by intravitreal injection (50 μί.) in both eyes: one eye (i.e., OS) with vector formulated in BSS/0.014% Tween 20 and 5% dextrose (final concentration) and the other eye (i.e., OD) with the same vector but formulated in BSS/0.014% Tween 20 only (i.e., no dextrose). The vector was provided at a concentration of > 3 x 10 12 vg/mL and was thawed and formulated on the day of

administration (i.e., Study Day 1). During vector administration, the position of the tips of needle was at the mid-globe above the macula and consistent across all eyes injected.

Animals remained supine (i.e., in dorsal recumbrance) for approximately 30 minutes post- injection. After dosing, animals were observed for approximately 12 weeks post- administration to assess transfection efficiency in rods and cones, retinal pigment epithelium (RPE), and choroid in the fovea, surrounding cone-enriched perifovea, and the retinal periphery. Assessment of transduction efficiency was based on autofluoresence imaging, fluorescence imaging of flat mounts and immunohistochemistry (IHC).

The AAV2tYF-CB-GFP vector of Group 2 was administered by subretinal (OD) or suprachoroidal (OS) injection (100 μί.) to the eye. The vector was provided at a

concentration of > 3 x 10 12 vg/mL and was thawed and formulated on the day of

administration (i.e., Study Day 1). Animals remained supine (i.e., in dorsal recumbrance) for approximately 30 minutes post-injection. After dosing, animals were observed for approximately 12 weeks post-administration to assess transfection efficiency in rods and cones, retinal pigment epithelium (RPE), and choroid in the fovea, surrounding cone-enriched perifovea, and the retinal periphery. Assessment of transduction efficiency was based on autofluoresence imaging, fluorescence imaging of flat mounts and IHC.

Ophthalmic examinations, including slit lamp biomicroscopy, indirect

ophthalmoscopy, and measurement of intraocular pressure, were performed once during the predose phase; once on Study Days 3, 8, and 15; and once during Study Weeks 5, and 9. Fundus autofluorescence was performed once during the predose phase and at Study Weeks 1, 2, 4 and 8.

At the time of sacrifice, the animal's eyes were enucleated and processed for evaluation of GFP expression.

For eyes that received AAV-GFP vector by subretinal or suprachoridal injection, eyes were fixed, paraffin-embedded and sections cut through bleb including macula were stained for GFP and with DAPI.

For eyes that received AAV-GFP vector by intravitreal injection, a whole flat mount retina was prepared for GFP fluorescence image of the entire retina with same settings of the camera for each eye. Retina were fixed, paraffin-embedded, and sections cut though macula and the entire retina was stained for GFP and DAPI.

Intensity of GFP staining was graded in each cell layer (from RGC to RPE layer for intravitreal injection, and photoreceptor to choroid for suprachoridal layer), and averaged from 4 individual sections examined from each eye.

Results

Green fluorescent protein (GFP) autofluorescence was observed in the eyes of Group 1 animals administered the AAV2tYF-CB-GFP vector via intravitreal injection, however, the autofluorescence was limited to certain retinal ganglion cells (RGCs) surrounding the fovea and their axons. Certain OS eyes also demonstrated GFP labeling of cones in the

photoreceptor layer subjacent to the labeled ganglion cells. In addition, certain RGCs in the far periphery of the eye and their axons from the Group 1 animals also showed GFP autofluorescence. Non-fluorescent based IHC analysis demonstrated that when compared to the eye administered AAV2tYF-CB-GFP vector without dextrose {i.e., OD; see Table 3)), the eye administered AAV2tYF-CB-GFP vector with dextrose {i.e., OS; see Table 3)) showed an increased incidence and severity of GFP labeling, therefore suggesting that the intravitreal formulation with 5% dextrose appeared to be more efficient at facilitating GFP expression in ganglion cells at the foveal slope. All four Group 2 eyes subretinally administered AAV2tYF-CB-GFP vector (i.e., OD) showed marked GFP fluorescence with in vivo fundus autofluorescence imaging and whole- mount epifluorescence imaging. The areas corresponding to the subretinal blebs also labeled strongly with anti-GFP antibody. Further, marked GFP fluorescence was observed in rods and cones located over the subretinal delivery site (i.e., OD, Group 2).

Example 3. Transduction Efficiency of AAV2tYF-CB-hRSl after Intravitreal Injection in Nonhuman Primates

Study Design

This study is designed to investigate and compare the transduction efficiency of AAV vectors (e.g., AAV2tYF-CB-hRS 1) formulated in BSS/0.014% Tween 20 with or without 5% dextrose when administered via intravitreal injection.

An outline of the study is provided below. A total of 9 cynomolgus macaques will be used, as shown below in Table 4.

aOD = right eye; OS = left eye

bAnimals were dosed on Study Day 1, which was considered the day of dosing of each animal

cDose levels were based on a dose volume of 70

Doses were given as two separate injections (of

40 μί and 30 μί^ε, given approximately 10 minutes apart)

dNA = Not Applicable (i.e., not dosed)

The Group 1 animals were administered by intravitreal injection (70 μί) in the right eye (i.e., OD) a solution of 0.014% Tween 20 prepared in BSS (i.e., no dextrose) and in the left eye (i.e., OS) a solution of 0.014% Tween 20 prepared in BSS with 5% dextrose (final concentration). The Group 2 animals were administered by intravitreal injection (70 μί) to the right eye (i.e., OD) the AAV2tYF-CB-hRS 1 vector formulated in 0.014% Tween 20 prepared in BBS (i.e., no dextrose). The Group 3 animals were administered by intravitreal injection (70 μί) to the right eye (i.e., OD) the AAV2tYF-CB-hRS 1 vector formulated in 0.014% Tween 20 prepared in BBS with 5% dextrose (final concentration). The vector, prior to administration, was thawed and formulated on the day of administration (i.e., Study Day 1). Animals remained supine (i.e., in dorsal recumbrance) for approximately 30 minutes post-injection. After dosing, animals were observed for approximately 16 weeks post- administration to assess transfection

Ophthalmic examinations, as generally described in Example 2, were conducted for all animals once during the predose phase and on Study Days 3, 8, 15, 23, 38, 58, 86, and 113. Methods

Immunohistochemistry was performed on eyes of all animals at the scheduled time. Staining for RS I protein and Anti-RS I (mouse polyclonal antibody to RS I) was performed. Evaluation included peripheral cornea, ciliary body, and retina (to include fovea and optic nerve). Special focus was put on defining the extent of RS I staining in retinal ganglion cells within and beyond the foveal slope.

All animals had tissues embedded in paraffin, sectioned, and slides were prepared and stained with hematoxylin and eosin. Tissues from all animals were examined

microscopically. Examination of the left (i.e., OS) and right (i.e., OD) eyes included a section through fovea and optic disc. Results

AAV2tYF-CB -hRS l -related immunohistochemistry (IHC) RS I labeling of the ganglion cell layer at the foveal slope was observed in eyes administered AAV2tYF-CB- hRS l in vehicle (i.e., with dextrose) and in vehicle/diluent (i.e., without dextrose). The IHC labeling was stronger in eyes administered vector in vehicle (i.e., with dextrose), compared with eyes administered vehicle/diluent (i.e., without dextrose).

Equivalents

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the following claims.

Incorporation by reference

Each reference, patent and patent application referred to in the instant application is hereby incorporated by reference as if each reference were noted to be incorporated individually.

SED ID NO: l atggctgccgatggttatcttccagattggctcgaggacactctctctgaaggaataagacagtggtggaagctc aaacctggcccaccaccaccaaagcccgcagagcggcataaggacgacagcaggggtcttgtgcttcctgggtac aagtacctcggacccttcaacggactcgacaagggagagccggtcaacgaggcagacgccgcggccctcgagcac gacaaagcctacgaccggcagctcgacagcggagacaacccgtacctcaagtacaaccacgccgacgcggagttt caggagcgccttaaagaagatacgtcttttgggggcaacctcggacgagcagtcttccaggcgaaaaagagggtt cttgaacctctgggcctggttgaggaacctgttaagacggctccgggaaaaaagaggccggtagagcactctcct gtggagccagactcctcctcgggaaccggaaaggcgggccagcagcctgcaagaaaaagattgaattttggtcag actggagacgcagactcagtacctgacccccagcctctcggacagccaccagcagccccctctggtctgggaact aatacgatggctacaggcagtggcgcaccaatggcagacaataacgagggcgccgacggagtgggtaattcctcg ggaaattggcattgcgattccacatggatgggcgacagagtcatcaccaccagcacccgaacctgggccctgccc acctacaacaaccacctctacaaacaaatttccagccaatcaggagcctcgaacgacaatcactactttggctac agcaccccttgggggtattttgacttcaacagattccactgccacttttcaccacgtgactggcaaagactcatc aacaacaactggggattccgacccaagagactcaacttcaagctctttaacattcaagtcaaagaggtcacgcag aatgacggtacgacgacgattgccaataaccttaccagcacggttcaggtgtttactgactcggagtaccagctc ccgtacgtcctcggctcggcgcatcaaggatgcctcccgccgttcccagcagacgtcttcatggtgccacagtat ggatacctcaccctgaacaacgggagtcaggcagtaggacgctcttcattttactgcctggagtactttccttct cagatgctgcgtaccggaaacaactttaccttcagctacacttttgaggacgttcctttccacagcagctacgct cacagccagagtctggaccgtctcatgaatcctctcatcgaccagtacctgtatttcttaagcagaacaaacact ccaagtggaaccaccacgcagtcaaggcttcagttttctcaggccggagcgagtgacattcgggaccagtctagg aactggcttcctggaccctgttaccgccagcagcgagtatcaaagacatctgcggataacaacaacagtgaattc tcgtggaccggtgctaccaagtaccacctcaatggcagagactctctggtgaatccgggcccggccatggcaagc cacaaggacgatgaagaaaagttttttcctcagagcggggttctcatctttgggaagcaaggctcagagaaaaca aatgtggacattgaaaaggtcatgattacagacgaagaggaaatcaggacaaccaatcccgtggctacggagcag tatggttctgtatctaccaacctccagagaggcaacagacaagcagctaccgcagatgtcaacacacaaggcgtt cttccaggcatggtctggcaggacagagatgtgtaccttcaggggcccatctgggcaaagattccacacacggac ggacattttcacccctctcccctcatgggtggattcggacttaaacaccctcctccacagattctcatcaagaac accccggtacctgcgaatccttcgaccaccttcagtgcggcaaagtttgcttccttcatcacacagtactccacg ggacaggtcagcgtggagatcgagtgggagctgcagaaggaaaacagcaaacgctggaatcccgaaattcagtac acttccaactacaacaagtctgttaatgtggactttactgtggacactaatggcgtgtattcagagcctcgcccc attggtaccagattcctgactcgtaatctgtaa SEQ ID NO:2

1 gaggacgagg ggaagatgtc acgcaagata gaaggctttt tgttattact tctctttggc

61 tatgaagcca cattgggatt atcgtctacc gaggatgaag gcgaggaccc ctggtaccaa

121 aaagcatgca agtgcgattg ccaaggagga cccaatgctc tgtggtctgc aggtgccacc

181 tccttggact gtataccaga atgcccatat cacaagcctc tgggtttcga gtcaggggag

241 gtcacaccgg accagatcac ctgctctaac ccggagcagt atgtgggctg gtattcttcg

301 tggactgcaa acaaggcccg gctcaacagt caaggctttg ggtgtgcctg gctctccaag

361 ttccaggaca gtagccagtg gttacagata gatctgaagg agatcaaagt gatttcaggg

421 atcctcaccc aggggcgctg tgacatcgat gagtggatga ccaagtacag cgtgcagtac

481 aggaccgatg agcgcctgaa ctggatttac tacaaggacc agactggaaa caaccgggtc

541 ttctatggca actcggaccg cacctccacg gttcagaacc tgctgcggcc ccccatcatc

601 tcccgcttca tccgcctcat cccgctgggc tggcacgtcc gcattgccat ccggatggag

661 ctgctggagt gcgtcagcaa gtgtgcctga tgcctgcctc agctcggcgc ctgccagggg

721 gtgactggca cagagcgggc cgtagggacc ccctcacaca ccaccgagat ggacagggct

781 atatttcgca aagcaattgt aactgcagtg ctgggtagat aatttttttt tttttaagat

841 atagctttct gatttcaatg aaataaaaat gaacttattc cccactcagg gccagagaaa

901 gtcagaacaa agaaaatgtc cccgaaacga attttcttac aaaagcctaa gtagcagggg

961 taattttctg ctcatttttt gtctcagtga tactgtgaaa ggtgcagtct caggggaaca

1021 caaagcagcc ctgataattt gaaaattcat ttgctttacc acattcaaga tagaaacata

1081 cagtttccta aagcctggct ttgaatgcag aagggagcag ctcctcctag ttaagtttcc

1141 actaaatcat cgccaaagag gacttcacag ccctggggag gcanctgagg gtctcaaggg

1201 tgactgggtg gcacggatga atgcggtggg tgagaatccc ggtgccctga gaggctatac

1261 gtgacaaatg accaaaagcc caacgtaggg gagtttcctc tgctcacagt tcttaccttc

1321 aaggcggatc tgggcttcca ccctcatgaa cacagggatt ggggagggac cagagcgccc

1381 aatacacaca gctccattat gcaatccatt ccagcaaatt cccgtgtctg tggtcaccat

1441 ttaggtgatc atacaggaca ggctgcacat ctcagtatat gtagggaccc caaatgacca

1501 caacacagta caattgccct ttacctaggg ctaccatttc ctagcaaacc aaacatagtt

1561 cgagaacagc tggcccagga gctaccactg gctactcaga ggaggctcat tagctggcta

1621 catgcttcgc aggaagtggg aaggactcac atcataaaaa ggaccatgta gctttttccc

1681 tgaaagcttc tcaccctcca ccctctgcct tgcaatacgc aaactgcgcc tgctcctgaa

1741 aagctctctg ggaaggaatg ggcctggctt tccgttcctg gaggcggcgc ttagattggg

1801 aggcctcatt ggcacttaga gcgcacgctg agtttccagg ccccttcctg ggagaggctg

1861 ttaacacggg ggaggggcag gagagggata tggagagcag gtggtggaat cagaggacga

1921 ggctgctcta aagactgttc tggccccaga cacagggtag tctttgctag cagctcattt

1981 ccgagttact tttcattttc aaatgccaag gcaagtgact agactcgcgc taatacagtg

2041 ctggacaaca cattcacctt ttctgtgaac aggcagcctt ctaaaagccc caaacatcct

2101 tcttgatgct ttgggggctc aattatttta tatccaaccc cagcatnttt ntagtcccta

2161 tgctgtatgc ttgaacttcg gaaaatgctt tttccccgcc caatnttctc ttcaaatata

2221 aacacatcac aacagggtgt tgggggtggg gggggggtgg ggggacttat ccctggcctt

2281 aggacacagg acaaatctat tttggataga aatgcctgaa cagagaccct tattggaaag

2341 ggaattaact ttggtcacga catggactgt cagacaaaat ggcagtatcc taagagttaa

2401 ggcacatcaa acacaggagt cgagagaggc agttcaggga aaaaggagag gaggaaacna

2461 gtgaggcagg gagaaagctt tccaaataag agttcatgtt ggaaactttt gtcacggctt

2521 tattgagatt aagttcacat acaatttgta tccatttaaa gtgtacaatt tgatgacttt

2581 tggtatattc agagttgtgc aaccattatc actagatcaa ttttagaaag tttatcaccc

2641 caaagagaaa tcctgcaccc atcagccaac actccccaac ccatcggcca ccccaagccc

2701 tctgcaacca cgaatcgact gtctctgtag attggccttc tggacgttct acataaatga

2761 aatcatatag ta

Claims

CLAIMS What is claimed is:

1. An ophthalmic formulation for delivery of a therapeutic into the eye of a patient in need thereof, wherein the formulation comprises a density modifying agent.

2. The ophthalmic formulation of claim 1, wherein the therapeutic is a gene therapy vector.

3. The formulation of claim 1 or 2, wherein the density modifying agent is dextrose.

4. The formulation of claim 3, wherein the dextrose is present in a range of about 2% to about 10% (v/v).

5. The formulation of claim 4, wherein the dextrose comprises about 5% (v/v).

6. The formulation of claim 1 or 2, wherein the density modifying agent is sucrose.

7. The formulation of claim 6, wherein the sucrose is present in a range of about 2% to about 10% (v/v).

8. The formulation of claim 7, wherein the sucrose comprises about 5% (v/v).

9. The formulation of claim 1 or 2, wherein the density modifying agent is glucose.

10. The formulation of claim 9, wherein the glucose is present in a range of about 2% to about 10% (v/v).

11. The formulation of claim 10, wherein the glucose comprises about 5% (v/v).

12. The formulation of claim 1 or 2, wherein the density modifying agent is D₂0.

13. The formulation of claim 12, wherein the D₂0 is present in a range of about 25% to about 75% (v/v).

14. The formulation of claim 13, where in the D₂0 comprises about 50% (v/v).

15. The formulation of claim 1 or 2, wherein the density modifying agent is PEG.

16. The formulation of claim 15, wherein the PEG is present in a range of about 2% to about 10% (v/v).

17. The formulation of claim 16, wherein the PEG comprises about 4% (v/v).

18. The formulation of claim 1 or 2, wherein the density modifying agent is glycerin.

19. The formulation of claim 18, wherein the glycerin is present in a range of about

0.05% to about 10% (v/v).

20. The formulation of claim 19, wherein the glycerin is present in a range of about

0.01% to about 5% (v/v).

21. The formulation of claim 1 or 2, further comprising Tween-20 in a range of about

0.005% to about 0.025% (v/v).

22. The formulation of claim 21, wherein the Tween-20 comprises about 0.014% (v/v).

23. The formulation of claim 1 or 2, further comprising a balanced salt solution (BSS).

24. The formulation of claim 1 or 2, wherein the therapeutic or gene therapy vector is targeted to the back of the eye.

25. The formulation of claim 2, wherein the vector is a recombinant adeno-associated virus (rAAV).

26. The formulation of claim 25, wherein the rAAV-based gene therapy vector is

AAV2tYF. (SEQ ID NO: l)

27. The formulation of claim 2, wherein the gene therapy vector is present in a

concentration of about 1 x 10 11 to about 1 x 1013 vg/mL.

28. The formulation of claim 27, wherein the gene therapy vector is present in a

concentration of about 3 x 10 12 vg/mL.

29. The formulation of claim 1 or 2, wherein the formulation is for intravitreal injection.

30. A method of treating X-linked retinoschisis (XLRS) by administering an effective amount of an ophthalmic formulation according to any one of claims 2-29 for delivery of a gene therapy vector into the eye of a patient in need thereof, wherein the vector comprises the retinoschisin 1 (RS I) gene or a fragment thereof.

31. The method of claim 30, wherein the density modifying agent of the formulation is dextrose.

32. The method of claim 31, wherein the dextrose is present in a range of about 2% to about 10% (v/v).

33. The method of claim 32, wherein the dextrose comprises about 5% (v/v).

34. The method of claim 30, wherein the density modifying agent of the formulation is sucrose.

35. The method of claim 34, wherein the sucrose is present in a range of about 2% to about 10% (v/v).

36. The method of claim 35, wherein the sucrose comprises about 5% (v/v).

37. The method of claim 30, wherein the density modifying agent of the formulation is glucose.

38. The method of claim 37, wherein the glucose is present in a range of about 2% to about 10% (v/v).

39. The method of claim 38, wherein the glucose comprises about 5% (v/v).

40. The method of claim 30, wherein the density modifying agent of the formulation is

D₂0.

41. The method of claim 40, wherein the D₂0 is present in a range of about 25% to about

75% (v/v).

42. The method of claim 41, where in the D₂0 comprises about 50% (v/v).

43. The method of claim 30, wherein the density modifying agent of the formulation is polyethylene glycol (PEG).

44. The method of claim 43, wherein the PEG is present in a range of about 2% to about

10% (v/v).

45. The method of claim 44, wherein the PEG comprises about 4% (v/v).

46. The method of claim 30, wherein the density modifying agent of the formulation is glycerin.

47. The method of claim 46, wherein the glycerin is present in a range of about 0.05% to about 10% (v/v).

48. The method of claim 47, wherein the glycerin is present in a range of about 0.01% to about 5% (v/v).

49. The method of claim 23, wherein the formulation further comprises Tween-20 in a range of about 0.005% to about 0.025% (v/v).

50. The method of claim 49, wherein the Tween-20 comprises about 0.014% (v/v).

51. The method of claim 30, wherein the formulation further comprises a balanced salt solution (BSS).

52. The method of claim 30, wherein the vector is a recombinant adeno-associated virus

(rAAV).

53. The method of claim 52, wherein the rAAV is AAV2tYF. (SEQ ID NO: l)

54. The method of claim 30, wherein the gene therapy of the formulation is present in a concentration of about 1 x 10¹¹ to about 1 x 1013 vg/mL.

55. The method of claim 54, wherein the gene therapy of the formulation is present in a concentration of about 3 x 10 12 vg/mL.

56. The method of claim 30, wherein the formulation is delivered by intravitreal injection.

57. The method of claim 56, wherein the formulation is administered to the patient in need thereof while the patient's head is in a horizontal position.

58. The method of claim 57, further comprising the step of keeping the patient's head in a horizontal position for a period of time from about 15 minutes to about 4 hours.

59. A method of treating macular degeneration by administering an effective amount of an ophthalmic formulation according to into the eye of a patient in need thereof.

60. The method of claim 59, wherein the density modifying agent of the formulation is dextrose, sucrose, glucose, D₂0, PEG, or glycerin.

61. The method of claim 59, wherein the formulation is administered to the patient in need thereof while the patient's head is in a horizontal position.

62. The method of claim 61, further comprising the step of keeping the patient's head in a horizontal position for a period of time from about 15 minutes to about 4 hours.