Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
  • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
  • A61K9/51—Nanocapsules; Nanoparticles
  • A61K9/5107—Excipients; Inactive ingredients
  • A61K9/5123—Organic compounds, e.g. fats, sugars
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/10—Dispersions; Emulsions
  • A61K9/127—Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
  • A61K9/1271—Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7088—Compounds having three or more nucleosides or nucleotides
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
  • A61K38/46—Hydrolases (3)
  • A61K38/465—Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
  • A61K47/08—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
  • A61K47/14—Esters of carboxylic acids, e.g. fatty acid monoglycerides, medium-chain triglycerides, parabens or PEG fatty acid esters
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
  • A61K47/20—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing sulfur, e.g. dimethyl sulfoxide [DMSO], docusate, sodium lauryl sulfate or aminosulfonic acids
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
  • A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
  • A61K48/0041—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid the non-active part being polymeric
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/0012—Galenical forms characterised by the site of application
  • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P3/00—Drugs for disorders of the metabolism
  • A61P3/06—Antihyperlipidemics
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
  • C07C323/00—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups
  • C07C323/10—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and singly-bound oxygen atoms bound to the same carbon skeleton
  • C07C323/11—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and singly-bound oxygen atoms bound to the same carbon skeleton having the sulfur atoms of the thio groups bound to acyclic carbon atoms of the carbon skeleton
  • C07C323/12—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and singly-bound oxygen atoms bound to the same carbon skeleton having the sulfur atoms of the thio groups bound to acyclic carbon atoms of the carbon skeleton the carbon skeleton being acyclic and saturated
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
  • C07C323/00—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups
  • C07C323/23—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and nitrogen atoms, not being part of nitro or nitroso groups, bound to the same carbon skeleton
  • C07C323/24—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and nitrogen atoms, not being part of nitro or nitroso groups, bound to the same carbon skeleton having the sulfur atoms of the thio groups bound to acyclic carbon atoms of the carbon skeleton
  • C07C323/25—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and nitrogen atoms, not being part of nitro or nitroso groups, bound to the same carbon skeleton having the sulfur atoms of the thio groups bound to acyclic carbon atoms of the carbon skeleton the carbon skeleton being acyclic and saturated
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
  • C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2320/00—Applications; Uses
  • C12N2320/30—Special therapeutic applications
  • C12N2320/32—Special delivery means, e.g. tissue-specific
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2800/00—Nucleic acids vectors
  • C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites

Definitions

• Angiopoietin-like 3 (ANGPTL3) is an enzyme which serves to regulate plasma lipoprotein levels.
• ANGPTL3 deficiency resulting from naturally- occurring loss-of-function mutations in the ANGPTL3 gene. These patients show lowered blood triglycerides (TG) and low density lipoprotein cholesterol (LDL-C), without any apparent clinical risks or complications resulting from this loss.
• TG blood triglycerides
• LDL-C low density lipoprotein cholesterol
• Recent genetic and pharmacologic studies have validated this finding and indicated that ANGPTL3 knockdown may confer some protective benefits, making ANGPTL3 an attractive therapeutic target for the treatment of human lipoprotein metabolism disorders. Two different therapeutic inhibition strategies against ANGPTL3 have recently been validated.
• an ANGPTL3 targeting monoclonal antibody has proven effective reduction in LDL-C and TG levels in healthy human volunteers.
• ASO antisense oligonucleotides
• mRNA messenger RNA
• CRISPRj/CRISPR-associated protein 9 is one of the most revolutionary genome editing tools.
• CRISPR/Cas9 introduces DNA double-strand breaks (DSBs) in a targeted (i.e. sequence-specific) fashion, followed by repair of the DSBs either by nonhomologous end joining (NHEJ) or homology directed repair (HDR).
• NHEJ nonhomologous end joining
• HDR homology directed repair
• the CRISPR/Cas9 system can induce permanent loss-of-function target gene mutations which result in long-term therapeutic effects in the edited cells, making CRISPR/Cas9 a promising candidate for the treatment of human diseases.
• lipid nanoparticles LNPs
• gold nanoparticles gold nanoparticles
• polymeric nanoparticles with better safety profile have been developed for the delivery of CRISPR plasmid DNA, messenger RNA (mRNA), and ribonucleoproteins (RNPs), typically at the cost of reduced delivery efficiency.
• CRISPR delivery in each of the DNA, mRNA, and RNP formats has potential strengths, mRNA delivery may be particularly promising for in vivo genome editing applications.
• the present disclosure provides methods of treating a human lipoprotein metabolism disorder or a cardiovascular disease, comprising administering to a subject in need thereof a lipidoid nanoparticle, which comprises a lipid, a CRISPR/Cas9 mRNA, and a single guide RNA (sgRNA), wherein
• the sgRNA is single guide Angiopoietin-like 3 (sgANGPTL3) or single guide proprotein convertase subtilisin/kexin type 9 (sgPCSK9);
• R a , R a ⁇ R a ”, and R a ’ each independently is R Lipid , H, C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C 1-C20 heteroalkyl, C1-C20 heterocycloalkyl, aryl, or heteroaryl, wherein R a and R a ’ or R a ’’ and R a ’’’ are not both R Lipid ;
• Z is a C1-C20 bivalent aliphatic radical, a C1-C20 bivalent heteroaliphatic radical, a bivalent aryl radical, or a bivalent heteroaryl radical;
• R 1 and R 2 are H, OH, NHR 30 , or SH;
• X is CH 2 , O, NR 30 , or S;
• R 30 is H, Ci- 6 alkyl, Ci- 6 alkenyl, or Ci- 6 alkynyl;
• n is an integer selected from 1-3;
• n is an integer selected from 1-14;
• p is 0 or 1;
• q is an integer selected from 1-10;
• t 0, 1, or 2.
• the present disclosure provides lipids selected from the group consisting of
• Fig. 1A is a schematic diagram of Cas9 mRNA delivery in vitro and in vivo illustrating formulating bioreducible Iipid/Cas9 mRNA/sgRNA nanoparticle for
• Fig. IB is a schematic diagram depicting the synthesis route, lipid nomenclature and chemical structure of amines used for lipid synthesis.
• Fig. 2A is a bar graph depicting the Luciferase expression of A375 cells treated with luciferase mRNA alone (160 ng/mL) or in the form of nanocomplexes of different lipid nanoparticles.
• Fig. 2B are CLSM images depicting HeLa cells transfected with RFP mRNA alone (320 ng/mL) or in the form of BAMEA-016B/RFP mRNA nanoparticles. Scale bars: 20 pm.
• Fig. 2C is a bar graph depicting mRNA dose dependent RFP expression of HeLa cells treated with increased concentration of BAMEA-016B/RFP mRNA. RFP expression profile was quantified 24 h after mRNA delivery.
• Fig. 3A shows the chemical structures of BAMEA-016B and BAMEA-016.
• Fig. 3B is a bar graph depicting the cellular uptake efficiency of BAMEA-
• Fig. 3C are CLSM images of HeLa cells treated with BAMEA-016B/Cy3-RNA OR BAMEA-016/Cy3-RNA nanoparticles HeLa cells were delivered with 10 nM Cy3-RNA complexed with the lipids at indicated ratios for delivery, the endosome was co-stained using LysoTracker@Green (Scale bars: 20 pm).
• Fig. 3D is a plot depicting BAMEA-016B/mRNA delivery shown an enhanced RFP expression in HeLa cells than that of BAMEA-016 nanoparticles.
• Fig. 4A are CLSM images of HEK-GFP cells treated with Cas9 mRNA/sgGFP alone or BAMEA/Cas9 mRNA/sgGFP nanoparticles. Scale bar: 20 pm.
• Fig. 4B is a bar graph depicting the delivery of BAMEA/ Cas9 mRNA/sgGFP nanoparticles for fast and efficient genome editing.
• HEK-GFP cells were treated with different dose of Cas9 mRNA and sgGFP (13 nM), the GFP expression was quantified at different time points after delivery.
• Fig. 4C is a plot depicting the sgRNA sequence specific genome editing and GFP knock out using BAMEA/Cas9 mRNA/sgGFP nanoparticles.
• GFP-HEK cells were treated with BAMEA/Cas9 mRNA/sgGFP or BAMEA/Cas9 mRNA/scramble sgRNA
• Fig. 4D is a plot depicting the delivery of BAMEA/Cas9 mRNA/sgHPV18 nanoparticles efficiently and selectively prohibited HeLa cell growth.
• Fig. 5A is a bioluminescence image of the tissues of mice injected with BAMEA- 016B/Cas9 mRNA/Cy3-RNA nanoparticles ⁇ right) or Cas9 mRNA/Cy3-RNA (free).
• Fig. 5B are fluorescent images of mouse liver injected with BAMEA-016B/RFP mRNA nanoparticles indicated the efficient delivery of mRNA into hepatocytes; Scale bar: 20 pm.
• Fig. 5C is a bar graph depicting BAMEA-016B/Cas9 mRNA/sgPCSK9
• nanoparticles treatment effectively decreased mouse serum PCSK9.
• the serum PCSK9 level of Cas9 mRNA nanoparticle treatment was normalized to that injected with DPBS control.
• Fig. 6A is a bar graph depicting cytotoxicity assay of BAMEA-016B, PPPDA- N16B, LPF2K or their mRNA nanocomplexes using Alarmar Blue assay 24 h post delivery.
• Fig. 6B is a bar graph depicting cytotoxicity assay of BAMEA-016B, PPPDA- N16B, LPF2K or their mRNA nanocomplexes using sulforhodamine B (SRB) assay 24 h post-delivery.
• Fig. 7 is an agarose gel electrophoresis image depicting GSH-triggered mRNA release from BAMEA-016B/mRNA complex.
• Fig. 8 is a bar graph depicting the GFP silencing after HEK-GFP cells were treated with Cas9 mRNA (160 ng/mL) and sgGFP (13 nM), nanocomplexes of different lipid nanoparticles the GFP expression was quantified at 48 h post mRNA delivery.
• Fig. 9 is a scanning electron microscope image of BAMEA-016B/Cas9
• Fig. 10 is a bar graph depicting the cytotoxicity assay of BAMEA-016B/Cas9 mRNA/sgRNA nanoparticles against HEK cells.
• HEK cells were treated with the nanocomplex composed of 5 pg/mL lipid and increased concentration of Cas9
• Fig. 11 is bioluminescence imaging of the tissues of mice injected with BAMEA- 016B/Luci mRNA nanoparticles ⁇ right) or free mRNA ⁇ left).
• Fig. 12 depicts the histological analysis of the liver at two-day post-injection by haematoxylin and eosin stain. Scale bars, 20 pm.
• Fig. 13 are bar graphs depicting the liver function tests in BAMEA-016B/Cas9 mRNA/sgPCSK9 injected mice.
• Fig. 14 is a schematic illustration of non-viral lipid nanoparticles (LNPs)-mediated in vivo CRISPR/Cas9-based genome editing to induce loss-of-function mutations in ANGPTL3 to lower blood lipid levels.
• the Cas9 mRNA and ANGPTL3 -specific single guide RNA (sgAngptl3) are encapsulated in the LNPs and delivered to the liver hepatocytes to perform genome editing at the ANGPTL3 target locus, and subsequently lowering low density lipoprotein cholesterol (LDL-C) and triglyceride (TG) levels.
• LDL-C low density lipoprotein cholesterol
• TG triglyceride
• Fig. 15A are the chemical structures of tail-branched bioreducible lipidoids.
• Fig. 15C is a dynamic light scattering graph of size and distribution of 306-O12B LNPs formulated with fLuc mRNA.
• Fig. 16A are chemical structures of three different phospholipids.
• Fig. 16B is a bar graph depicting the efficacy of fLuc mRNA LNPs formulated with Cholesterol, DMG-PEG, and different phospholipid, DSPC or DOPE or DOPC.
• Fig. 16C is an image depicting biodistribution of fLuc mRNA LNPs formulated with Cholesterol, DMG-PEG, and different phospholipid, DSPC or DOPE or DOPC.
• Fig. 16D is a graph depicting the formulation parameters of LNPs formulated with cholesterol, DOPC, DMG-PEG at 7 different mole ratios.
• Fig. 16E is a bar graph depicting the whole body luciferase bioluminescence intensity of different formulations in Balb/c mice at 6 h post-injection at a fLuc mRNA dose of 0.5 mg/kg.
• Fig. 17A is a schematic illustration of codelivery of Cas9 mRNA and LoxP -targeted single guide RNA (sgLoxP) to genetically engineered tdTomato reporter Ail4 mice using 306-O12B LNPs.
• sgLoxP LoxP -targeted single guide RNA
• Fig. 17B is an Ex vivo image of organs collected from Ail4 mice administrated with LNPs encapsulating Cas9 mRNA/sgLoxP (1/1.2, wt) at a total RNA dose of 1.65 mg/kg, td Tomato fluorescence was detected by IVIS imaging system.
• Fig. 17C are confocal fluorescence microscopy images of liver section showed that td Tomato signal was mainly expressed in liver hepatocytes. (Scale bar: 20 pm)
• Fig. 18B is a graph depicting serum ANGPTL3 levels following injections of 306-
• Fig. 19A are graphs depicting the next generation sequence analysis of the indels in liver and serum analyses of ANGPTL3 protein, triglyceride, and LDL-C level of mice at day 7 post administrated with Cas9 mRNA and sgAngptl2 coloaded 306-O12B LNPs at a total RNA dose of 3.0 mg/kg.
• Fig. 19B depicts the editing frequencies of specific edited alleles in most-edited mouse in each treatment group.
• Fig. 19C depicts the editing frequencies at 9-top predicted off-target sites.
• Fig. 20A is a representative TEM image of 306-O12B LNPs before formulated with fLuc mRNA. (Scale bar: 500 nm)
• Fig. 20B is a representative TEM image of 306-012B LNPs after formulated with fLuc mRNA. (Scale bar: 500 nm)
• Fig. 21 is an in vivo imaging of mice injected with fLuc mRNA loaded 306-O12B LNPs and MC-3 LNPs. Images were taken by IVIS imaging system at 6 h post-injection.
• Fig. 22 is a bar graph depicting the encapsulation efficiency of 306-O12B LNPs to fLuc mRNA.
• Fig. 23A is an ex vivo image of organs collected from Ail4/Cas9 mice
• tdTomato fluorescence was detected by IVIS imaging system.
• Fig. 23B are confocal fluorescence microscopy of liver section showed that td
• Tomato signal was mainly expressed in liver hepatocytes. (Scale bar: 20 pm)
• Fig. 24 is a dynamic light scattering graph depicting the size distribution of Cas9 mRNA/sgAngptl3 co-loaded 306-O12B LNPs.
• Fig. 25 is a gel electrophoresis image of T7E1 assays performed with genomic DNA from liver samples from mice taken 7 days after receiving the Cas9 mRNA/sgAngptl3 coloaded 306-O12B LNPs and MC-3 LNPs. Arrows show the cleavage products resulting from the T7E1 assays.
• bioreducible lipids are identified to deliver reporter mRNA and Cas9 mRNA/sgRNA complex both in vitro and in vivo via a screening and optimization approach.
• the bioreducible lipids can encapsulate mRNA via electrostatic interaction to assemble nanoparticle, while releasing mRNA intracellularly in response to the reductive chemical signals through a disulfide bond exchange mechanism (Fig. 1A).
• the present disclosure provides methods of treating a human lipoprotein metabolism disorder or a cardiovascular disease, comprising administering to a subject in need thereof a lipidoid nanoparticle, which comprises a lipid, a CRISPR/Cas9 mRNA, and a single guide RNA (sgRNA), wherein
• the sgRNA is single guide Angiopoietin-like 3 (sgANGPTL3) or single guide proprotein convertase subtilisin/kexin type 9 (sgPCSK9);
• R a , R a ’, R a ”, and R a ”’ each independently is R Lipid , H, C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C 1-C20 heteroalkyl, C1-C20 heterocycloalkyl, aryl, or heteroaryl, wherein R a and R a ’ or R a ’’ and R a ’’’ are not both R Lipid ;
• Z is a C1-C20 bivalent aliphatic radical, a C1-C20 bivalent heteroaliphatic radical, a bivalent aryl radical, or a bivalent heteroaryl radical;
• R 1 and R 2 are H, OH, NHR 30 , or SH;
• X is CH 2 , O, NR 30 , or S;
• R 30 is H, Ci-6 alkyl, Ci-6 alkenyl, or Ci-6 alkynyl;
• n is an integer selected from 1-3;
• n is an integer selected from 1-14;
• p is 0 or 1;
• q is an integer selected from 1-10;
• t 0, 1, or 2.
• R Head is
• R a and R a ’ are R Lipid , H, or C1-C20 alkyl.
• R Head is derived from a compound selected from the group consisting of
• R 1 and R 2 are H. In certain embodiments, R 1 is H; and R 2 is
• Z is CH2, O, or NR 30 . In certain embodiments, Z is CH2. In certain embodiments, Z is O. In certain embodiments, Z is NR 30 .
• m is 1 or 2.
• n is an integer selected from 4-12. In certain embodiments, n is an integer selected from 6-10.
• p is 0. In certain embodiments, p is 1.
• q is an integer selected from 2-8. In certain embodiments, q is an integer selected from 4-8.
• t is 0. In certain embodiments, t is 1.
• R Ll P ld each independently is selected from the group consisting of
• the lipid is selected from the group consisting of
• the ratio of the lipid to the CRISPR/Cas9 mRNA is about: 1 to about 15: 1. In certain embodiments, the ratio of the lipid to the CRISPR/Cas9 mRNA about 7.5: 1.
• the lipidoid nanoparticle further comprises cholesterol.
• the ratio of the lipid to the cholesterol is about 1 : 1 to about
• the lipidoid nanoparticle further comprising DOPE, DSPC, or DOPC, and DMG-PEG2K, wherein
• DSPC has the structure:
• DOPE has the structure:
• DOPC has the structure:
• DMG-PEG2K has the structure:
• the lipidoid nanoparticle further comprising DOPC and DMG-PEG2K.
• the ratio of the lipid to the DOPC is about 4: 1 to about 6: 1 and the ratio of the lipid to the DMG-PEG2K is about 4: 1 to about 100: 1 to about 4: 1 to about 20: 1.
• the lipidoid nanoparticle has a particle size of about 25 nm to about 1000 nm. In certain embodiments, the lipidoid nanoparticle has a particle size of about 50 nm to about 500 nm.
• the human lipoprotein metabolism disorder is associated with loss-of-function mutations in ANGPTL3 gene.
• the cardiovascular disease is associated with proprotein convertase subtilisin/kexin type 9 gene (PCSK9).
• PCSK9 proprotein convertase subtilisin/kexin type 9 gene
• the human lipoprotein metabolism disorder is associated with reduction of plasma high density lipoprotein cholesterol, serum low density lipoprotein cholesterol, or triglycerides level.
• the human lipoprotein metabolism disorder is associated with low levels of plasma high density lipoprotein cholesterol, high levels of serum low density lipoprotein cholesterol, or high levels of triglycerides.
• the cardiovascular disease is selected from the group consisting of homozygous familial hypercholesterolemia, and hypercholesterolemia.
• the present disclosure provides lipids selected from the group consisting of
• “optional” or“optionally” mean that the subsequently described event or circumstance may occur or may not occur, and that the description includes instances where the event or circumstance occurs as well as instances in which it does not.
• “optionally substituted alkyl” refers to the alkyl may be substituted as well as where the alkyl is not substituted.
• substituents and substitution patterns on the compounds of the present invention can be selected by one of ordinary skilled person in the art to result chemically stable compounds which can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials. If a substituent is itself substituted with more than one group, it is understood that these multiple groups may be on the same carbon or on different carbons, so long as a stable structure results.
• the term“optionally substituted” refers to the replacement of one to six hydrogen radicals in a given structure with the radical of a specified substituent including, but not limited to: hydroxyl, hydroxyalkyl, alkoxy, halogen, alkyl, nitro, silyl, acyl, acyloxy, aryl, cycloalkyl, heterocyclyl, amino, aminoalkyl, cyano, haloalkyl, haloalkoxy, -OCO-CEh-O-alkyl, -0P(0)(0-alkyl)2 or -CH2-0P(0)(0-alkyl)2.
• “optionally substituted” refers to the replacement of one to four hydrogen radicals in a given structure with the substituents mentioned above. More preferably, one to three hydrogen radicals are replaced by the substituents as mentioned above. It is understood that the substituent can be further substituted.
• Articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context.
• the invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process.
• the invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.
• the term“alkyl” refers to saturated aliphatic groups, including but not limited to Ci-Cio straight-chain alkyl groups or Ci-Cio branched-chain alkyl groups.
• the“alkyl” group refers to C1-C 6 straight-chain alkyl groups or C1-C 6 branched- chain alkyl groups.
• the“alkyl” group refers to C1-C4 straight-chain alkyl groups or C1-C4 branched-chain alkyl groups.
• “alkyl” examples include, but are not limited to, methyl, ethyl, 1 -propyl, 2-propyl, n-butyl, sec-butyl, tert-butyl, 1 -pentyl, 2- pentyl, 3 -pentyl, neo-pentyl, 1 -hexyl, 2-hexyl, 3 -hexyl, 1-heptyl, 2-heptyl, 3-heptyl, 4- heptyl, 1 -octyl, 2-octyl, 3 -octyl or 4-octyl and the like.
• The“alkyl” group may be optionally substituted.
• acyl is art-recognized and refers to a group represented by the general formula hydrocarbylC(O)-, preferably alkylC(O)-.
• acylamino refers to an amino group substituted with an acyl group and may be represented, for example, by the formula
• hydrocarbylC(0)NH- hydrocarbylC(0)NH-.
• acyloxy is art-recognized and refers to a group represented by the general formula hydrocarbylC(0)0-, preferably alkylC(0)0-.
• alkoxy refers to an alkyl group having an oxygen attached thereto.
• Representative alkoxy groups include methoxy, ethoxy, propoxy, tert-butoxy and the like.
• alkoxyalkyl refers to an alkyl group substituted with an alkoxy group and may be represented by the general formula alkyl-O-alkyl.
• alkyl refers to saturated aliphatic groups, including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl-substituted cycloalkyl groups, and cycloalkyl-substituted alkyl groups.
• a straight chain or branched chain alkyl has 30 or fewer carbon atoms in its backbone (e.g., Ci-30 for straight chains, C3-30 for branched chains), and more preferably 20 or fewer.
• alkyl as used throughout the specification, examples, and claims is intended to include both unsubstituted and substituted alkyl groups, the latter of which refers to alkyl moieties having substituents replacing a hydrogen on one or more carbons of the hydrocarbon backbone, including haloalkyl groups such as trifluoromethyl and 2,2,2-trifluoroethyl, etc.
• Cx- y or“Cx-C y ”, when used in conjunction with a chemical moiety, such as, acyl, acyloxy, alkyl, alkenyl, alkynyl, or alkoxy is meant to include groups that contain from x to y carbons in the chain.
• Coalkyl indicates a hydrogen where the group is in a terminal position, a bond if internal.
• a Ci- 6 alkyl group for example, contains from one to six carbon atoms in the chain.
• alkylamino refers to an amino group substituted with at least one alkyl group.
• alkylthio refers to a thiol group substituted with an alkyl group and may be represented by the general formula alkylS-.
• amide refers to a group
• R 9 and R 10 each independently represent a hydrogen or hydrocarbyl group, or R 9 and R 10 taken together with the N atom to which they are attached complete a heterocycle having from 4 to 8 atoms in the ring structure.
• the terms“amine” and“amino” are art-recognized and refer to both unsubstituted and substituted amines and salts thereof, e.g., a moiety that can be represented by
• R 9 , R 10 , and R 10 ’ each independently represent a hydrogen or a hydrocarbyl group, or R 9 and R 10 taken together with the N atom to which they are attached complete a heterocycle having from 4 to 8 atoms in the ring structure.
• aminoalkyl refers to an alkyl group substituted with an amino group.
• aralkyl refers to an alkyl group substituted with an aryl group.
• aryl as used herein include substituted or unsubstituted single-ring aromatic groups in which each atom of the ring is carbon.
• the ring is a 5- to 7- membered ring, more preferably a 6-membered ring.
• the term“aryl” also includes polycyclic ring systems having two or more cyclic rings in which two or more carbons are common to two adjoining rings wherein at least one of the rings is aromatic, e.g., the other cyclic rings can be cycloalkyls, cycloalkenyls, cycloalkynyls, aryls, heteroaryls, and/or heterocyclyls.
• Aryl groups include benzene, naphthalene, phenanthrene, phenol, aniline, and the like.
• R 9 and R 10 independently represent hydrogen or a hydrocarbyl group.
• carbocyclylalkyl refers to an alkyl group substituted with a carbocycle group.
• the term“carbocycle” includes 5-7 membered monocyclic and 8-12 membered bicyclic rings. Each ring of a bicyclic carbocycle may be selected from saturated, unsaturated and aromatic rings. Carbocycle includes bicyclic molecules in which one, two or three or more atoms are shared between the two rings.
• the term“fused carbocycle” refers to a bicyclic carbocycle in which each of the rings shares two adjacent atoms with the other ring. Each ring of a fused carbocycle may be selected from saturated, unsaturated and aromatic rings.
• an aromatic ring e.g., phenyl
• a saturated or unsaturated ring e.g., cyclohexane, cyclopentane, or cyclohexene.
• Exemplary“carbocycles” include cyclopentane, cyclohexane, bicyclo[2.2.1]heptane, 1,5-cyclooctadiene, 1,2,3,4-tetrahydronaphthalene, bicyclo[4.2.0]oct-3-ene, naphthalene and adamantane.
• Exemplary fused carbocycles include decalin, naphthalene, 1,2,3,4-tetrahydronaphthalene, bicyclo[4.2.0]octane, 4, 5,6,7- tetrahydro-lH-indene and bicyclo[4.1.0]hept-3-ene.“Carbocycles” may be substituted at any one or more positions capable of bearing a hydrogen atom.
• carbocyclylalkyl refers to an alkyl group substituted with a carbocycle group.
• carbonate is art-recognized and refers to a group -OCO2-.
• ester refers to a group -C(0)0R 9 wherein R 9 represents a hydrocarbyl group.
• ether refers to a hydrocarbyl group linked through an oxygen to another hydrocarbyl group. Accordingly, an ether substituent of a hydrocarbyl group may be hydrocarbyl-O-. Ethers may be either symmetrical or unsymmetrical.
• ethers include, but are not limited to, heterocycle-O-heterocycle and aryl-O- heterocycle.
• Ethers include“alkoxyalkyl” groups, which may be represented by the general formula alkyl-O-alkyl.
• halo and“halogen” as used herein means halogen and includes chloro, fluoro, bromo, and iodo.
• heteroalkyl and“heteroaralkyl”, as used herein, refers to an alkyl group substituted with a hetaryl group.
• heteroaryl and“hetaryl” include substituted or unsubstituted aromatic single ring structures, preferably 5- to 7-membered rings, more preferably 5- to 6- membered rings, whose ring structures include at least one heteroatom, preferably one to four heteroatoms, more preferably one or two heteroatoms.
• heteroaryl and “hetaryl” also include polycyclic ring systems having two or more cyclic rings in which two or more carbons are common to two adjoining rings wherein at least one of the rings is heteroaromatic, e.g., the other cyclic rings can be cycloalkyls, cycloalkenyls, cycloalkynyls, aryls, heteroaryls, and/or heterocyclyls.
• Heteroaryl groups include, for example, pyrrole, furan, thiophene, imidazole, oxazole, thiazole, pyrazole, pyridine, pyrazine, pyridazine, and pyrimidine, and the like.
• heteroatom as used herein means an atom of any element other than carbon or hydrogen. Preferred heteroatoms are nitrogen, oxygen, and sulfur.
• heterocyclylalkyl refers to an alkyl group substituted with a heterocycle group.
• heterocyclyl refers to substituted or unsubstituted non-aromatic ring structures, preferably 3- to 10-membered rings, more preferably 3- to 7-membered rings, whose ring structures include at least one heteroatom, preferably one to four heteroatoms, more preferably one or two heteroatoms.
• heterocyclyl and“heterocyclic” also include polycyclic ring systems having two or more cyclic rings in which two or more carbons are common to two adjoining rings wherein at least one of the rings is heterocyclic, e.g., the other cyclic rings can be cycloalkyls, cycloalkenyls, cycloalkynyls, aryls, heteroaryls, and/or heterocyclyl s.
• Heterocyclyl groups include, for example, piperidine, piperazine, pyrrolidine, morpholine, lactones, lactams, and the like.
• Hydrocarbyl groups include, but are not limited to aryl, heteroaryl, carbocycle, heterocycle, alkyl, alkenyl, alkynyl, and combinations thereof.
• hydroxyalkyl refers to an alkyl group substituted with a hydroxy group.
• lower when used in conjunction with a chemical moiety, such as, acyl, acyloxy, alkyl, alkenyl, alkynyl, or alkoxy is meant to include groups where there are ten or fewer atoms in the substituent, preferably six or fewer.
• acyl, acyloxy, alkyl, alkenyl, alkynyl, or alkoxy substituents defined herein are respectively lower acyl, lower acyloxy, lower alkyl, lower alkenyl, lower alkynyl, or lower alkoxy, whether they appear alone or in combination with other substituents, such as in the recitations hydroxyalkyl and aralkyl (in which case, for example, the atoms within the aryl group are not counted when counting the carbon atoms in the alkyl substituent).
• each ring of the polycycle contains from 3 to 10 atoms in the ring, preferably from 5 to 7.
• sulfate is art-recognized and refers to the group -OSChH, or a pharmaceutically acceptable salt thereof.
• R 9 and R 10 independently represents hydrogen or hydrocarbyl.
• sulfoxide is art-recognized and refers to the group-S(O)-.
• sulfonate is art-recognized and refers to the group SChH, or a pharmaceutically acceptable salt thereof.
• substitution refers to moieties having substituents replacing a hydrogen on one or more carbons of the backbone. It will be understood that“substitution” or “substituted with” includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc.
• substitution or “substituted with” includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc.
• substitution or “substituted with” includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., which does not spontaneous
• “substituted” is contemplated to include all permissible substituents of organic compounds.
• the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and non-aromatic substituents of organic compounds.
• the permissible substituents can be one or more and the same or different for appropriate organic compounds.
• the heteroatoms such as nitrogen may have hydrogen substituents and/or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms.
• Substituents can include any substituents described herein, for example, a halogen, a hydroxyl, a carbonyl (such as a carboxyl, an alkoxycarbonyl, a formyl, or an acyl), a thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), an alkoxyl, a phosphoryl, a phosphate, a phosphonate, a phosphinate, an amino, an amido, an amidine, an imine, a cyano, a nitro, an azido, a sulfhydryl, an alkylthio, a sulfate, a sulfonate, a sulfamoyl, a sulfonamido, a sulfonyl, a heterocyclyl, an aralkyl, or an aromatic or heteroaromatic mo
• thioalkyl refers to an alkyl group substituted with a thiol group.
• thioester refers to a group -C(0)SR 9 or -SC(0)R 9 wherein R 9 represents a hydrocarbyl.
• thioether is equivalent to an ether, wherein the oxygen is replaced with a sulfur.
• R 9 and R 10 independently represent hydrogen or a hydrocarbyl.
• module includes the inhibition or suppression of a function or activity (such as cell proliferation) as well as the enhancement of a function or activity.
• phrases“pharmaceutically acceptable” is art-recognized.
• the term includes compositions, excipients, adjuvants, polymers and other materials and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
• Salt is used herein to refer to an acid addition salt or a basic addition salt.
• stereogenic center in their structure.
• This stereogenic center may be present in a R or a S configuration, said R and S notation is used in correspondence with the rules described in Pure Appl. Chem. (1976), 45, 11-30.
• the disclosure contemplates all stereoisomeric forms such as enantiomeric and diastereoisomeric forms of the compounds, salts, prodrugs or mixtures thereof (including all possible mixtures of stereoisomers). See, e.g., WO 01/062726.
• “Pharmaceutically acceptable” means approved or approvable by a regulatory agency of the Federal or a state government or the corresponding agency in countries other than the United States, or that is listed in the U.S. Pharmacopoeia or other generally recognized pharmacopoeia for use in animals, and more particularly, in humans.
• “Pharmaceutically acceptable salt” refers to a salt of a compound of the invention that is pharmaceutically acceptable and that possesses the desired pharmacological activity of the parent compound.
• such salts are non-toxic may be inorganic or organic acid addition salts and base addition salts.
• such salts include: (1) acid addition salts, formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; or formed with organic acids such as acetic acid, propionic acid, hexanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethane-disulfonic acid, 2- hydroxyethanesulfonic acid, benzenesulfonic acid, chlorobenzenesulfonic acid, 2- naphthalenesulfonic acid, 4-toluenesulfonic acid
• Salts further include, by way of example only, sodium potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like; and when the compound contains a basic functionality, salts of nontoxic organic or inorganic acids, such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate and the like.
• pharmaceutically acceptable cation refers to an acceptable cationic counterion of an acidic functional group. Such cations are exemplified by sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium cations, and the like (see, e. g., Berge, et ah, J. Pharm. Sci. 66 (1): 1-79 (January 77).
• “Pharmaceutically acceptable vehicle” refers to a diluent, adjuvant, excipient or carrier with which a compound of the invention is administered.
• “Pharmaceutically acceptable metabolically cleavable group” refers to a group which is cleaved in vivo to yield the parent molecule of the structural formula indicated herein.
• Examples of metabolically cleavable groups include -COR, -COOR, -CONRR and -CH2OR radicals, where R is selected independently at each occurrence from alkyl, trialkylsilyl, carbocyclic aryl or carbocyclic aryl substituted with one or more of alkyl, halogen, hydroxy or alkoxy.
• Specific examples of representative metabolically cleavable groups include acetyl, methoxycarbonyl, benzoyl, methoxymethyl and trimethyl silyl groups.
• Prodrugs refers to compounds, including derivatives of the compounds of the invention, which have cleavable groups and become by solvolysis or under physiological conditions the compounds of the invention which are pharmaceutically active in vivo. Such examples include, but are not limited to, choline ester derivatives and the like, N- alkylmorpholine esters and the like. Other derivatives of the compounds of this invention have activity in both their acid and acid derivative forms, but in the acid sensitive form often offers advantages of solubility, tissue compatibility, or delayed release in the mammalian organism (see, Bundgard, EL, Design of Prodrugs, pp. 7-9, 21-24, Elsevier, Amsterdam 1985).
• Prodrugs include acid derivatives well known to practitioners of the art, such as, for example, esters prepared by reaction of the parent acid with a suitable alcohol, or amides prepared by reaction of the parent acid compound with a substituted or unsubstituted amine, or acid anhydrides, or mixed anhydrides. Simple aliphatic or aromatic esters, amides and anhydrides derived from acidic groups pendant on the compounds of this invention are particular prodrugs. In some cases it is desirable to prepare double ester type prodrugs such as (acyl oxy)alkyl esters or (alkoxycarbonyl)oxy)alkylesters.
• Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, aryl, C7-C12 substituted aryl, and C7-C12 arylalkyl esters of the compounds of the invention are particularly the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, aryl, C7-C12 substituted aryl, and C7-C12 arylalkyl esters of the compounds of the invention.
• Solidate refers to forms of the compound that are associated with a solvent or water (also referred to as“hydrate”), usually by a solvolysis reaction. This physical association includes hydrogen bonding.
• solvents include water, ethanol, acetic acid and the like.
• the compounds of the invention may be prepared e.g., in crystalline form and may be solvated or hydrated. Suitable solvates include
• pharmaceutically acceptable solvates such as hydrates, and further include both
• solvates will be capable of isolation, for example when one or more solvent molecules are incorporated in the crystal lattice of the crystalline solid.
• solvent molecules include hydrates, ethanolates and methanol ate s.
• A“subject” to which administration is contemplated includes, but is not limited to, humans (i.e., a male or female of any age group, e.g., a pediatric subject (e.g, infant, child, adolescent) or adult subject (e.g., young adult, middle aged adult or senior adult) and/or a non- human animal, e.g., a mammal such as primates (e.g., cynomolgus monkeys, rhesus monkeys), cattle, pigs, horses, sheep, goats, rodents, cats, and/or dogs.
• the subject is a human.
• the subject is a non-human animal.
• the terms“human,”“patient,” and“subject” are used interchangeably herein.
• An“effective amount” means the amount of a compound that, when administered to a subject for treating or preventing a disease, is sufficient to effect such treatment or prevention.
• The“effective amount” can vary depending on the compound, the disease and its severity, and the age, weight, etc., of the subject to be treated.
• A“therapeutically effective amount” refers to the effective amount for therapeutic treatment.
• prophylatically effective amount refers to the effective amount for prophylactic treatment.
• Preventing or“prevention” or“prophylactic treatment” refers to a reduction in risk of acquiring or developing a disease or disorder (i.e., causing at least one of the clinical symptoms of the disease not to develop in a subject not yet exposed to a disease-causing agent, or predisposed to the disease in advance of disease onset.
• prophylaxis is related to“prevention,” and refers to a measure or procedure the purpose of which is to prevent, rather than to treat or cure a disease.
• prophylactic measures may include the administration of vaccines; the administration of low molecular weight heparin to hospital patients at risk for thrombosis due, for example, to immobilization, and the administration of an anti-malarial agent such as chloroquine, in advance of a visit to a geographical region where malaria is endemic or the risk of contracting malaria is high.
• Treating” or“treatment” or“therapeutic treatment” of any disease or disorder refers, in one embodiment, to ameliorating the disease or disorder (i.e., arresting the disease or reducing the manifestation, extent or severity of at least one of the clinical symptoms thereof).
• “treating” or“treatment” refers to ameliorating at least one physical parameter, which may not be discernible by the subject.
• “treating” or“treatment” refers to modulating the disease or disorder, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter), or both.
• “treating” or“treatment” relates to slowing the progression of the disease.
• an“isotopic variant” of a compound can contain one or more non-radioactive isotopes, such as for example, deuterium ( 2 H or D), carbon-13 ( 13 C), nitrogen-15 ( 15 N), or the like.
• non-radioactive isotopes such as for example, deuterium ( 2 H or D), carbon-13 ( 13 C), nitrogen-15 ( 15 N), or the like.
• the invention may include the preparation of isotopic variants with radioisotopes, in the instance for example, where the resulting compounds may be used for drug and/or substrate tissue distribution studies.
• the radio-active isotopes tritium, i.e., 3 H, and carbon-14, i.e., 14 C, are particularly useful for this purpose in view of their ease of incorporation and ready means of detection.
• com pounds may be prepared that are substituted with positron emitting isotopes, such as U C, 18 F, 15 0 and 13 N, and would be useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy. All isotopic variants of the compounds provided herein, radioactive or not, are intended to be encompassed within the scope of the invention.
• enantiomers When a compound has an asymmetric center, for example, it is bonded to four different groups, a pair of enantiomers is possible.
• An enantiomer can be characterized by the absolute configuration of its asymmetric center and is described by the R - and S - sequencing rules of Cahn and Prelog, or by the manner in which the molecule rotates the plane of polarized light and designated as dextrorotatory or levorotatory (i.e., as (+)- or (-)- isomers respectively).
• a chiral compound can exist as either individual enantiomer or as a mixture thereof. A mixture containing equal proportions of the enantiomers is called a “racemic mixture”.
• Tautomers refer to compounds that are interchangeable forms of a particular compound structure, and that vary in the displacement of hydrogen atoms and electrons. Thus, two structures may be in equilibrium through the movement of it electrons and an atom (usually H). For example, ends and ketones are tautomers because they are rapidly interconverted by treatment with either acid or base. Another example of tautomerism is the aci- and nitro-forms of phenylnitromethane, that are likewise formed by treatment with acid or base. Tautomeric forms may be relevant to the attainment of the optimal chemical reactivity and biological activity of a compound of interest.
• a pure enantiomeric compound is substantially free from other enantiomers or stereoisomers of the compound (i.e., in enantiomeric excess).
• an“S” form of the compound is substantially free from the“R” form of the compound and is, thus, in enantiomeric excess of the“R” form.
• “enantiomerically pure” or“pure enantiomer” denotes that the compound comprises more than 95% by weight, more than 96% by weight, more than 97% by weight, more than 98% by weight, more than 98.5% by weight, more than 99% by weight, more than 99.2% by weight, more than 99.5% by weight, more than 99.6% by weight, more than 99.7% by weight, more than 99.8% by weight or more than 99.9% by weight, of the enantiomer.
• the weights are based upon total weight of all enantiomers or stereoisomers of the compound.
• the term“enantiomerically pure R- compound” refers to at least about 95% by weight R-compound and at most about 5% by weight S-compound, at least about 99% by weight R-compound and at most about 1% by weight S-compound, or at least about 99.9 % by weight R-compound and at most about 0.1% by weight S-compound. In certain embodiments, the weights are based upon total weight of compound.
• the term“enantiomerically pure S- compound” or“S-compound” refers to at least about 95% by weight S-compound and at most about 5% by weight R-compound, at least about 99% by weight S-compound and at most about 1% by weight R-compound or at least about 99.9% by weight S-compound and at most about 0.1% by weight R-compound. In certain embodiments, the weights are based upon total weight of compound.
• compositions provided herein an enantiomerically pure compound or a pharmaceutically acceptable salt, solvate, hydrate or prodrug thereof can be present with other active or inactive ingredients.
• a pharmaceutical composition for example, a pharmaceutical composition
• enantiomerically pure R-compound can comprise, for example, about 90% excipient and about 10% enantiomerically pure R-compound.
• the enantiomerically pure R-compound in such compositions can, for example, comprise, at least about 95% by weight R-compound and at most about 5% by weight S-compound, by total weight of the compound.
• a pharma ceutical composition comprising enantiomerically pure S-compound can comprise, for example, about 90% excipient and about 10% enantiomerically pure S-compound.
• the enantiomerically pure R-compound in such compositions can, for example, comprise, at least about 95% by weight R-compound and at most about 5% by weight S-compound, by total weight of the compound.
• a pharma ceutical composition comprising enantiomerically pure S-compound can comprise, for example, about 90% excipient and about 10% enantiomerically pure S-compound.
• enantiomerically pure S-compound in such compositions can, for example, comprise, at least about 95% by weight S-compound and at most about 5% by weight R-compound, by total weight of the compound.
• the active ingredient can be formulated with little or no excipient or carrier.
• the compounds of this invention may possess one or more asymmetric centers; such compounds can therefore be produced as individual (R)- or (S)- stereoisomers or as mixtures thereof.
• heterocyclic ring may have one to four heteroatoms so long as the heteroaromatic ring is chemically feasible and stable.
• mRNA (L-7606) were purchased from Tri-Link Biotechnologies.
• Mouse serum PCSK9 was determined using a PCSK9 ELISA Kit (Sino Biological, China). Cell viability was determined using Alamar Blue assay or SRB cell proliferation and cytotoxicity assay kit (Yeasen Biotech Co., Ltd. China).
• Cy3-RNA (43 nt) were purchased from Biosyntech (Suzhou, Chian).
• gRNA targeting GFP was prepared according to our previous reports, sgRNA targeting mouse PCSK9 and human HP VI 8 was prepared using in vitro
• RFP-encoding mRNA was prepared using in vitro transcription method with pcDNA3.1-RFP (Yingrun, Changsha, China) as a template using the RiboMAXTM Large Scale RNA Production Systems (Promega, USA). Flow cytometry was performed on Beckman Coulter CytoFLEX. HeLa, A375 and HEK-GFP cells were maintained in DMEM (Sigma-Aldrich) supplemented with 10% FBS (Sigma- Aldrich) and 1% penicillin-streptomycin (Life Technologies). All animal care and experimental procedures were approved by the Institutional Animal Care and Use
• the lipids were synthesized by heating amines and acrylate or acrylamide using the methods described according to our previous reports ( 9 ), and purified using flash chromatography on silica gel.
• the purified lipids were mixed with cholesterol, DOPE and DSPE-PEG2000 at a weight/weight ratio of 16:8:4: 1 in chloroform in a 2 mL vial, the organic solvent was evaporated under vacuum, the resulted mixtures was further dried overnight to form a thin layer film.
• the resulted nanoparticles were dialysed against phosphate buffered saline (PBS) to remove excessive ethanol.
• PBS phosphate buffered saline
• the resulted mRNA lipoplexes were then added to cells, and incubated with cells for additional 6 h before refreshing cell culture medium.
• the luciferase activity was assayed using a firefly luciferase activity assay kit according to the instruction of manufacturer (Promega, EISA).
• HEK cells were treated with 160 ng/mL of luciferase mRNA nanoparticles or different lipids nanoparticles similarly to that of genome editing efficiency study.
• the cell viability was determined using Alamar Blue or SRB cell proliferation and cytotoxicity assay 24 h post delivery.
• RFP mRNA delivery HeLa cells seeded in 48-well plate (25 K cells per well) were treated with BAMEA-016B/RFP mRNA nanoparticle at the optimized conditions for 8 h before changing fresh cell culture medium.
• the RFP expression profile was imaged using CLSM on an Olympus FV-IX81 confocal system or quantified by flow cytometry on a Beckman Coulter CytoFLEX 24 h post mRNA delivery.
• the resulted nanocomplexes were treated with 5mM GSH for 4 h at 37 °C before agarose gel electrophoresis, and compared to mRNA nanocomplexes without GSH treatment.
• RNA nanoparticles For the cellular uptake study of RNA nanoparticles, a 43 -nucleotide RNA labeled with Cy3 was mixed with BAMEA-016B or BAMEA-016 nanoparticle at a weight ratio of 30: 1 before adding to HeLa cells.
• BAMEA-016B or BAMEA-016/RNA nanoparticles For the CLSM imaging study, HeLa cells were treated with Cy3-RNA nanoparticles for 8 h, and the endosome was co-stained using LysoTracker Green (ThermoFisher Scientific, USA).
• LysoTracker Green ThermoFisher Scientific, USA.
• cells treated with different concentrations of above RNA nanoparticles were analyzed using flow cytometry and quantifying Cy3-positive cells.
• GFP-stably expressed HEK cells were seeded in 48-well plate a day before experiment at a density of 25 K per well.
• the BAMEA-016B/Cas9 mRNA/sgGFP nanoparticle was then added to cells and incubated for 10 h before changing fresh cell culture medium.
• the GFP expression profile was imaged using CLSM or quantified using flow cytometry analysis at different time points post Cas9 mRNA delivery, and normalized to cells without Cas9 mRNA/sgGFP delivery to determine genome editing efficiency.
• sgGFP was replaced with a scramble sgRNA, and delivered into HEK-GFP cells similarly to that of Cas9 mRNA/sgGFP delivery.
• HEK cells were treated with different concentration of Cas9 mRNA nanoparticles similarly to that of genome editing efficiency study.
• the cell viability was determined using Alamar Blue 48 h post Cas9 mRNA delivery.
• mice Female athymic nude mice were injected via tail vein with BAMEA-016B/Luci-mRNA nanoparticle at a mRNA dose of 0.6 mg/kg or same dose of free mRNA. 24 h post nanoparticle or free mRNA injection, the mice were sacrificed to harvest different tissues for bioluminescence imaging on an IVIS spectrum In Vivo imaging system (Perkin Elmer, USA). To study the delivery of mRNA into hepatocytes, BAMEA-016B/RFP mRNA nanoparticle was injected to C57BL/6 mouse similarly to luciferase mRNA delivery. 24 h post nanoparticle delivery, the mice were sacrificed to harvest liver for fluorescence imaging study.
• mice Female athymic nude mice were injected via tail vein with BAMEA-016B/ Cas9 mRNA/Cy3-RNA nanoparticle at dose of 9 mg/kg BAMEA-016B, 0.6 mg/kg Cas9 mRNA and 0.8 mg/kg Cy3-RNA or same dose of free mRNA. 6 h post nanoparticle or free mRNA injection, the mice were sacrificed to harvest different tissues for bioluminescence imaging on an IVIS spectrum In Vivo imaging system (Perkin Elmer, USA).
• mice were injected via tail vein with BAMEA-016B/Cas9 mRNA/sgPCSK9 or BAMEA-016B/Cas9 mRNA/sgRNA with a scramble sgRNA sequence at a dose of 9 mg/kg BAMEA-016B, 0.6 mg/kg Cas9 mRNA and 0.8 mg/kg sgRNA.
• BAMEA-016B 0.6 mg/kg Cas9 mRNA
• 0.8 mg/kg sgRNA 0.8 mg/kg sgRNA.
• mice were sacrificed to withdraw mouse serum for PCSK9 and liver toxicity assay. Meanwhile, liver tissues were collected for H&E staining to study the possible liver injury of nanoparticle injections.
• Figs. 2A - 2C are graphs and images depicting the intracellular delivery of
• the bioreducible lipids was synthesized by heating amine and acrylates or acrylamides featuring a disulfide bond according to our previous reports (Fig. 1A).
• the lipids were named by amine number or name followed by 016B or N16B to discriminate the use of acrylate or acrylamide, respectively (Fig. IB).
• the as-purified lipids were formulated with cholesterol, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and DSPE-PEG2000 for all cellular delivery experiments in this study (see Materials and
• luciferase-encoding mRNA was assembled with different lipids at weight ratio of 1 : 15 to transfect A375 human melanoma cells.
• the luciferase expression of transfected A375 cells was measured and compared to cells treated with luciferase mRNA alone or luciferase mRNA complexed with a commercial transfection lipid, Lipofectamine 2000 (LPF2K). As shown in Fig.
• the representative lipid BAMEA-016B is a general nanocarrier for mRNA delivery, as evidenced by its capability and high efficiency to deliver red fluorescent protein (RFP)-encoding mRNA into HeLa cells.
• RFP red fluorescent protein
• Flow cytometry analysis (Fig. 2C) indicated that the RFP-positive cells is dependent on mRNA dose, and the transfection efficiency could be as high as 90% when 160 ng/mL of RFP mRNA was delivered into HeLa cells.
• both luciferase and RFP mRNA delivery demonstrated the effectiveness of B AMEA-016B nanoparticle for efficient yet safe mRNA delivery.
• Figs. 3A- 3D are graphs and images depicting cellular uptake and endosome escape study of B AMEA-016B/RNA nanoparticles.
• Figs. 4A - 4D CRISPR/Cas9 mRNA delivery and genome editing in cultured cells.
• BAMEA-016B a control lipid with a chemical structure similar to BAMEA-016B, while lacking the disulfide bond, named as BAMEA-016 (Fig. 3A).
• BAMEA-016B or BAMEA-016 showed a comparable RNA delivery efficiency.
• the treatment of HeLa cells with fluorescent-labeled RNA complexes (10 nM) of B AMEA-016B or BAMEA-016 resulted in RNA internalization efficiency higher than 90% at all different lipid and RNA ratios (Fig. 3B).
• Confocal laser scanning microscopy (CLSM) imaging of HeLa cells indicated that the BAMEA- 016B/RNA treated cells shown a higher endosome escape efficiency than that of BAMEA- 016/RNA treatment (Fig. 3C), this is mostly due to the bioreducible nature of BAMEA- 016B that facilitates the release of RNA more efficiently in response to the reductive intracellular environment.
• RFP mRNA delivery using BAMEA-016B nanoparticles resulted in a higher RFP expression in HeLa cells than that of BAMEA-016 facilitated mRNA delivery.
• the delivery of 160 ng/mL RFP mRNA using BAMEA-016B resulted in four-time fold enhancement of RFP expression than using BAMEA-016 nanoparticles (Fig. 3D).
• Cas9 mRNA is around 4500 nucleotides in size, it is much longer than luciferase or RFP mRNA (-1000 nt ) and therefore much more difficult for intracellular delivery.
• GFP stably-expressed FfEK cells were treated with the lipid nanoparticle encapsulating Cas9 mRNA and GFP-targeting sgRNA, and monitored the GFP expression change before and after mRNA delivery.
• the on-target GFP genome editing could induce the shift of reading frame of GFP gene, and thereby preventing GFP expression.
• seven of the thirty-two lipids can efficiently deliver Cas9 mRNA and sgRNA to knock down GFP expression of FfEK cells, among which lipid BAMEA-016B showed the highest genome editing and GFP knock out efficiency. It is found that the electrostatic interaction of BAMEA-016B and Cas9 mRNA/sgRNA assembled well-dispersed nanoparticles around 230 nm in size (Table 2, Fig. 9). Meanwhile, the BAMEA-016B/Cas9 mRNA nanocomplex is highly biocompatible for genome editing delivery.
• Figs. 5A - 5C are graphs and images depicting Cas9 mRNA/sgRNA delivery and genome editing in vivo.
• BAMEA-016B mediated Cas9 mRNA delivery is able to regulate endogenous gene expression, and therefore of great potential for developing new gene therapy.
• Human papillomavirus type 18 HPV18
• SgRNA that targets HPV18 was delivered into HeLa cells along with Cas9 mRNA using BAMEA-016B, the viability of HeLa cells followed the treatment was measured and compared to that with scramble sgRNA and Cas9 mRNA treatment. As shown in Fig.
• BAMEA-016B/Cas9 mRNA/sgHPV18 treatment significantly prohibited HeLa growth compared to that of a scramble sgRNA and Cas9 mRNA delivery (Fig. 4D).
• the delivery of 320 ng/mL Cas9 mRNA and 26 nM sgHPV18 reduced HeLa cell viability down to 30%, while the replacement of sgHPV18 with a scramble sgRNA did not show similar effect on prohibiting HeLa cell growth.
• PCSK9 proprotein convertase subtilisin/kexin type 9
• PCSK9 plays an important role in lipid metabolism by modulating the density of low-density lipoprotein cholesterol receptors (LDL-R) in liver, genetic studies reveal that the loss of PCSK9 is associated with a reduced risk of cardiovascular disease.
• LDL-R low-density lipoprotein cholesterol receptors
• BAMEA-016B nanoparticle for in vivo mRNA delivery was first studied.
• BAMEA-016B/Luciferase mRNA nanoparticle or fluorescently labeled BAMEA-016B/Cas9 mRNA/Cy3-RNA nanoparticles were formulated and intravenously injected to mice via tail vein at an mRNA dosage of 0.6 mg/kg or 0.8 mg/kg sgRNA, followed by bioluminescence or fluorescence imaging of tissue organs to study the biodistribution of the nanoparticles.
• BAMEA-016B/Luciferase mRNA nanoparticle resulted in effective expression of luciferase in mouse liver
• BAMEA-016B/Cas9 mRNA/Cy3-RNA nanoparticle administration showed effective accumulation of fluorescent signal in mouse liver.
• a detailed cellular localization study by delivering BAMEA-016B/RFP mRNA nanoparticles revealed that the BAMEA-016B/RFP mRNA nanoparticle was mostly accumulated in hepatocytes (Fig. 5B), which could be used for PCSK9 genome editing in hepatocytes, as to be discussed below.
• BAMEA-016B nanoparticle for in vivo genome editing was studied by injecting BAMEA-016B/Cas9 mRNA/sgPCSK9 nanoparticles into C57BL/6 mice, followed by serum PCSK9 level quantification to evaluate the in vivo genome editing efficacy.
• the intravenous injection of BAMEA- 016B/Cas9 mRNA/sgPCSK9 nanoparticle reduced mouse serum PCSK9 down to 20% of that with DPBS injection or BAMEA-016B/Cas9 mRNA/scramble sgRNA nanoparticle injections (Fig. 5C). Meanwhile, histological examination of the mouse liver after
• BAMEA-016B/Cas9 mRNA/sgRNA nanoparticle treatment using haematoxylin and eosin (H&E) staining did not show signs of inflammation (Fig. 12).
• the nanoparticle injections did not induce obvious hepatocellular injury, as revealed by the minimal change of serum aspartate transaminase (AST), alanine aminotransferase (ALT), and total bilirubin of mice with all injections (Fig. 13).
• lipidoids were synthesized as per our previous reports.
• LNPs were prepared using a NanoAssemblr microfluidic system (Precision Nanosystems). Briefly, lipidoids, cholesterol (Sigma), phospholipids (DSPC, DOPE, and DOPC, Avanti Polar Lipids), and DMG-PEG (Avanti Polar Lipids) were dissolved in 100% ethanol at molar ratios of 50/38.5/10/1.5 at a final lipidoids concentration of 10 mg/mL.
• Cas9 mRNA and gRNA were mixed at the appropriate weight ratio in sodium acetate buffer (25 mM, pH 5.2).
• the mRNA solution and the lipid solution were each injected into the NanoAssemblr microfluidic device at a ratio of 3 : 1, and the device resulted in the rapid mixing of the two components and thus the self-assembly of LNPs.
• Formulations were further dialyzed against PBS (10 mM, pH 7.4) in dialysis cassettes overnight at 4° C.
• the particle size of formulations was measured by dynamic light scattering (DLS) using a ZetaPALS DLS machine (Brookhaven Instruments).
• RNA encapsulation efficiency was characterized by Ribogreen assay.
• mice All procedures for animal experiment were approved by the Tufts University Institutional Animal Care and Use Committee (IACUC) and performed in accordance with the National Institutes of Health (NIH) guidelines for the care and use of experimental animals. All the animals were ordered from Charles River. Female Balb/c mice (6-8 weeks) were used for in vivo firefly luciferase mRNA (fLuc mRNA, TriLink Biotechnologies) encapsulated LNPs screening and formulations optimization. Briefly, fLuc mRNA LNPs were intravenously injected into the mice at a dose of 0.5 mg/kg mRNA.
• IACUC Tufts University Institutional Animal Care and Use Committee
• NASH National Institutes of Health
• mice were injected with 100 pL of D-Luciferin potassium salt (Goldbio) solution (15 mg/mL in PBS), anesthetized under isoflurane anesthesia, and measured by IVIS imaging system (Caliper Life Sciences).
• D-Luciferin potassium salt Goldbio
• Cas9 mRNA TriLink Biotechnologies
• LoxP-targeted single guide RNA sgLoxP, sequence: 5’-AAGTAAAACCTCTACAAATG, Synthego
• Tissue samples were embedded with OCT, frozen completely in liquid nitrogen, and stored at -80 °C until ready for sectioning.
• the frozen tissue block was sectioned into a desired thickness (10 pm) using the cryotome and placed onto glass slides suitable for immunofluorescence staining.
• the tissue sections were fixed with pre-cooled acetone (-20 °C) for 10 min, and then washed twice with PBS, 5 min each.
• the fixed tissue sections were incubated in 10% BSA blocking buffer at room temperature (r.t.) for 1 h, and then washed with PBS.
• a hepatocyte specific primary antibody (1 : 100 diluted in 1% BSA buffer, anti- hepatocyte specific antigen (HepParl), Novus) was applied to the sections on the slides and incubated in a humidified chamber at 4 °C overnight.
• the slides were rinsed with PBS for 2 changes, 5 min each, and then stained with eFlour660 conjugated F(ab’)2-Goat anti-mouse secondary antibody (1 :50, Invitrogen) s and incubated in a humidified chamber protected from light at room temperature for 1 h, and then washed 3 times with PBS. Fluorescent mounting medium containing DAPI(Sigma) was used to coverslip the slides. Sections were analyzed using a Leica SP8 confocal microscope.
• RNA sequence targeting ANGPTL3 gene was designed using the Benchling software.
• Female wild-type C57BL/6 mice were intravenously dosed with Cas9 mRNA and ANGPTL3 -targeted single guide RNA (sgAngptl3, sequence: 5’- AGCCCTTCAACACAAGGTCA, Synthego) co-loaded 306-012B LNPs at a dose of 1.0, 2.0, and 3.0 mg/kg in total RNA.
• PBS administrated mice were treated as negative control.
• mice were sacrificed, blood was collected for circulating RNA sequence targeting ANGPTL3 gene was designed using the Benchling software.
• Cas9 mRNA and ANGPTL3 -targeted single guide RNA sgAngptl3, sequence: 5’- AGCCCTTCAACACAAGGTCA, Synthego
• ANGPTL3 protein and blood lipids quantitation by ELISA was collected from the median and left lateral lobe for DNA extraction and next generation sequence (NGS) analysis.
• NGS next generation sequence
• blood was collected and proceeded to serum from mice 2 days after the injection.
• Aspartate aminotransferase (AST) and alanine aminotransferase (ALT), and tumor necrosis factor alpha (TNF-alpha) were measured using assay kits for AST (G-Biosciences), ALT (G- Biosciences), and TNF-alpha (R&D Systems) per manufacturer’s protocols.
• PCR primers were designed to amplify the region surrounding the target site in the Angptl3 gene, or the regions surrounding the predicted off-target sites (Table SI). Off-target sites were predicted using the Cas Off Finder software (rgenome.net/cas-offmder/). PCR amplicons were prepared for sequencing on an Illumina MiSeq (Tufts Genomics Core Facility). Sequencing data was analyzed using the OutKnocker 2 software (outknocker.org/outknocker2.htm). Serum ANGPTL3 protein, low density lipoprotein cholesterol (LDL-C ), and triglyceride (TG) analysis
• LDL-C low density lipoprotein cholesterol
• TG triglyceride
• Mouse blood was collected without using an anticoagulant and allow to clot for 2 h at r.t., and centrifuged at 2000 x g for 15-20 min at r.t. to collect mouse serum.
• Serum levels of ANGPTL3 protein, LDL-C, and TG were determined using a Mouse
• genomic regions flanking the on-target sites were amplified using extracted genomic DNA template, Platinum SuperFi Green DNA polymerase (Invitrogen), and specific primers (Table 3).
• the following cycles were run: 30 s at 98 °C, followed by 33 cycles of 10 s at 98 °C , 15 s at 65 °C, and 30 s at 72 °C, followed 10 min at 72 °C.
• the PCR products were purified using the GeneJET PCR Purification Kit (Thermo Scientific). 400 ng of purified PCR products were hybridized in NEBuffer 2 (New England Biolabs) by heating to 95°C for 5 min, followed by a 2 °C / second ramp down to 85 °C and a 0.1 °C / second ramp down to 25 °C on a AppliedBiosystems PCR system (Thermo Fisher Scientific).
• the annealed samples were digested by T7 Endonuclease I (New England Biolabs) at 37 °C for 15 min, followed by incubating at 65 °C for 5 min to stop the reaction.
• the products were further purified and run on a 4-20% Novex TBE gel (Invitrogen).
• Figs. 15A - 15C depict syntheses of lipidoid nanoparticles.
• the tail-branched bioreducible lipidoids were prepared via a combinatory solvent free Michael -Addition reaction between disulfide bond-incorporated acrylate lipid tails and amine-containing heads. (Fig. 15A).
• the in vivo mRNA delivery efficacy of these lipids was first evaluated by encapsulating firefly luciferase mRNA (fLuc mRNA) into LNPs and delivering these LNPs intravenously to female wild-type Balb/c mice.
• fLuc mRNA firefly luciferase mRNA
• These LNPs were formulated with our synthetic ionizable lipids, along with the excipient compounds cholesterol, DSPC, and DMG-PEG.
• Fig. 20A and Fig. 20B Representative transmission electron microscopy images of blank (unloaded) and fLuc mRNA-loaded LNPs were shown in Fig. 20A and Fig. 20B.
• the gold standard MC-3 LNPs was included as a positive control.
• 6 hours after mRNA delivery mice were injected intraperitoneally with luciferin substrate, and whole- body fLuc activity was measured using an IVIS in vivo imaging system (PerkinElmer).
• Fig. 15B mRNA delivery with 306-O12B, 113-012B, and 306-010B LNPs resulted in comparable or even higher luciferase bioluminescence intensity as compared with MC-3 LNPs delivery.
• In vivo images of mouse clearly showed that the luciferase protein was mainly expressed in the liver (Fig. 21).
• 306-O12B was used as the
• fLuc mRNA could be efficiently encapsulated into the 306-O12B LNPs with an encapsulation efficiency of -98% (Fig. 22).
• 306-O12B LNPs had an average diameter of 112 nm (Fig. 15C).
• Example 5 Optimization of the Formulation of 306-O12B LNPs.
• Figs. 16A - 16F depict the optimization of fLuc mRNA 306-O12B LNPs formulations.
• DOPE and DOPC which have similar structure, but differing head groups and tail saturation comparing to the original DSPC phospholipid, were selected to evaluate the effect of phospholipid excipient on the efficacy of luciferase expression in vivo.
• DOPC and DOPE each contain one degree of unsaturation in the carbon tail, while DSPC is fully saturated.
• DSPC and DOPE each contain a quaternary amine headgroup, while DOPE contains a primary amine headgroup.
• lipid tail has been shown to influence membrane fluidity, which may also influence endosomal escape. Unsaturated lipid tails may result in higher membrane fluidity, which may also help to improve endosomal escape via destabilization of the endosomal membrane upon fusion of the LNP with the membrane.
• LNPs formed with DOPC containing a quaternary amine and unsaturated tail, would show the most efficient fLuc delivery.
• fLuc mRNA LNPs formulated with DOPC indeed resulted in significantly higher luciferase expression in the liver than that of formulations with DOPE and the original DSPC phospholipid.
• fLuc mRNA delivered with DOPC- containing LNPs resulted in approximately 4-fold higher luminescence signal compared with the original DSPC-containing LNPs.
• the active lipid and excipient components were formulated at a molar ratio of [Lipid : Cholesterol : DSPC : DMG-PEG] of [50 : 38.5 : 10 : 1.5]
• LNPs formulated at a variety of molar ratios was tested to identify the optimal parameters (Fig. 16D).
• the original formulation O (306-O12B : cholesterol : DOPC : DMG-PEG at a molar ratio of 50 : 38.5 : 10 : 1.5
• the LNPs with this optimal ratio of four components were formulated with different weight ratios of active lipid 306-O12B : mRNA ranging from 5 : 1 to 25 : 1. Interestingly, it is found that the highest efficacy was achieved when the weight ratio was 7.5 : 1. It appears as though increasing the amount of lipid beyond this point did not benefit the in vivo delivery efficacy (Fig. 16F). Collectively, these results indicated that the opimized formulation of 306-O12B LNPs had 50% 306- 012B, 38.5% cholesterol, 10% DOPC, and 1.5% DMG-PEG molar composition with a 7.5/1 weight ratio of 306-O12B/mRNA.
• Example 6 In vivo hepatocytes specific codelivery of Cas9 mRNA and sgRNA with mRNA-optimized LNPs.
• Figs. 17A - 17C depict 306-O12B LNPs enabled Cas9/sgLoxP-mediated genome editing in Ail 4 mice.
• Fig. 23A - 23B are images that depicts 306-O12B LNPs enabled sgLoxP-mediated genome editing in Ail4/Cas9 crossing mice.
• the Ail4 reporter mouse line which is genetically engineered with a LoxP -Flanked STOP cassette controlling tdTomato expression, was used. While this mouse line is frequently used with Cre recombinase, successful CRISPR-mediated excision of the LoxP-flanked stop codon will also induce the expression of tdTomato. By examining the cells which have tdTomato expression, cell types our LNP delivery system could successfully target can be determined.
• sgLoxP LoxP- targeted sgRNA
• mice engineered to express both the Ail 4 construct and a constitutively-expressed Cas9 construct (Ail4+/Cas9+ mouse model).
• sgLoxP LoxP- targeted sgRNA
• FIG. 23A and Fig. 23B delivery of sgLoxP with our LNP system resulted in red fluorescence detected specifically in the liver.
• tdTomato signal was mainly observed in the liver hepatocytes, indicating that 306-O12B LNPs can also specifically deliver sgRNA to this therapeutically relevant cell type.
• RNA and sgLoxP were co-formulated into one single LNPs and injected into Ail4 mice via tail vein at 1.65 mg/kg total RNA dose (Fig. 17A).
• organs were harvested and imaged ex vivo using the IVIS system.
• the ex vivo image of mouse organs analyzed by IVIS system showed that this system could indeed induce red fluorescence, indicating successful functional codelivery of both the mRNA and sgRNA components, and that tdTomato signal was predominantly detected in the liver (Fig. 17B).
• Figs. 18A - 18B depict 306-O12B LNPs-mediated significant levels of in vivo genome editing of ANGPTL3 in wild-type C57BL/6 mice.
• Figs. 19A - 19C show that 306-O12B LNPs is more efficient than MC-3 LNPs in inducing the loss-of-function mutations in ANGPTL3 through CRISPR/Cas9-based genome editing.
• ANGPTL3 angiopoietin-like 3
• ANGPTL3 angiopoietin-like 3
• Wild-type C57BL/6 mice were used to study the non-viral Cas9 mRNA/sgAngptl3 LNPs-mediated in vivo genome editing of ANGPTL3.
• Cas9 mRNA and sgAngptl3 were encapsulated into the 306-012B LNPs simultaneously.
• the ratio of these two components may affect the in vivo genome editing efficacy.
• the mice is injected with 306-O12B LNPs co-formulated with different Cas9 mRNA to sgAngptl3 mass ratios of 2: 1, 1 : 1.2, and 1 :2 at a total RNA dose of 3.0 mg/kg.
• blood serum was collected for ELISA analysis of serum ANGPTL3 protein levels, and liver tissue samples were collected for DNA extraction and NGS sequencing to determine targeted Cas9-mediated genome editing.
• Vitamin lipid nanoparticles enable adoptive macrophage transfer for the treatment of multi drug-resistant bacterial sepsis. Nat. Nanotechnol. 15, 41-+, (2020).

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Medicinal Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Organic Chemistry (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Animal Behavior & Ethology (AREA)
• Pharmacology & Pharmacy (AREA)
• Genetics & Genomics (AREA)
• Epidemiology (AREA)
• Biomedical Technology (AREA)
• Molecular Biology (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Biotechnology (AREA)
• Wood Science & Technology (AREA)
• Zoology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• General Engineering & Computer Science (AREA)
• Biochemistry (AREA)
• Physics & Mathematics (AREA)
• Microbiology (AREA)
• Nanotechnology (AREA)
• Heart & Thoracic Surgery (AREA)
• Cardiology (AREA)
• Diabetes (AREA)
• Hematology (AREA)
• Obesity (AREA)
• Optics & Photonics (AREA)
• Plant Pathology (AREA)
• Biophysics (AREA)
• Oil, Petroleum & Natural Gas (AREA)
• Dispersion Chemistry (AREA)
• Dermatology (AREA)
• Gastroenterology & Hepatology (AREA)
• Immunology (AREA)

Priority Applications (8)

Applications Claiming Priority (2)

Related Child Applications (1)

Publications (1)

Family

ID=73652953

Family Applications (1)

Country Status (9)

Cited By (10)

Families Citing this family (5)

Citations (2)

Family Cites Families (5)

• 2020
  • 2020-06-04 JP JP2021571709A patent/JP7691742B2/ja active Active
  • 2020-06-04 AU AU2020287624A patent/AU2020287624A1/en not_active Abandoned
  • 2020-06-04 KR KR1020227000096A patent/KR20220017466A/ko not_active Ceased
  • 2020-06-04 EP EP20817914.3A patent/EP3979988B1/en active Active
  • 2020-06-04 MX MX2021014911A patent/MX2021014911A/es unknown
  • 2020-06-04 WO PCT/US2020/036085 patent/WO2020247604A1/en not_active Ceased
  • 2020-06-04 CA CA3142725A patent/CA3142725A1/en active Pending
  • 2020-06-04 CN CN202080054813.2A patent/CN114173762A/zh active Pending
• 2021
  • 2021-12-06 US US17/543,173 patent/US20220168231A1/en active Pending

Patent Citations (2)

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events