WO2020204312A1 - Arhgap32 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 - Google Patents
Arhgap32 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 Download PDFInfo
- Publication number
- WO2020204312A1 WO2020204312A1 PCT/KR2019/018406 KR2019018406W WO2020204312A1 WO 2020204312 A1 WO2020204312 A1 WO 2020204312A1 KR 2019018406 W KR2019018406 W KR 2019018406W WO 2020204312 A1 WO2020204312 A1 WO 2020204312A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- snp
- gene
- cerebral aneurysm
- allele
- diagnosing
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- the present invention comprises a SNP of the ARHGAP32 gene, a SNP marker composition for diagnosing a cerebral aneurysm, a composition for diagnosing a cerebral aneurysm comprising an agent capable of detecting or amplifying the SNP marker, a kit for diagnosing a cerebral aneurysm comprising the composition, and the composition And a method of providing information for diagnosing a cerebral aneurysm using a kit.
- Polymorphism refers to a nucleotide sequence variation that appears with a frequency of more than 1%, of which 90% is single nucleotide polymorphism (SNP).
- SNP single nucleotide polymorphism
- the human genetic sequence is 99.9% identical, and SNPs appear every about 250 to 1000 bp. In the case of the human genome, there are about 2 million SNPs and about 21,000 of these genes are present.
- mutations of other single bases that appear with a frequency of 1% or less are commonly referred to as mutations.
- the nucleotide sequence mutation analysis or SNP plays an important role as a marker capable of not only analyzing DNA sequencing, but also discovering genes that cause diseases such as cancer, asthma, and diabetes, or determining association with specific diseases. Therefore, by analyzing single nucleotide polymorphism, it can be helpful in preventing congenital diseases caused by differences in base sequence or treatment of onset diseases by grasping an individual's susceptibility to specific diseases in humans.
- Cerebral aneurysms specifically intracranial aneurysms, account for about 85% of all subarachnoid hemorrhages (subarachnoid hemorrhage), which has a high mortality rate of up to 50%. Cerebral aneurysms are generally caused by subarachnoid hemorrhage, which can be first confirmed by cerebral CT scan. If subarachnoid hemorrhage is suspected but not visible on CT, it can also be diagnosed by checking the blood-infused cerebrospinal fluid through a lumbar puncture.
- the ruptured area In addition, in order to establish a treatment plan for an actually ruptured cerebral aneurysm, the ruptured area must be identified and the location, size, shape, and number of the ruptured cerebral aneurysms must be accurately identified. These include CT angiography and MRI angiography.
- CT angiography CT angiography
- MRI angiography MRI angiography
- the present inventors have endeavored to develop a method for efficiently and easily diagnosing the onset of cerebral aneurysms, predicting the risk of onset, and predicting the prognosis.
- the invention was completed.
- the first aspect of the present application is to provide a SNP marker composition for diagnosing a cerebral aneurysm, comprising rs371331393, which is a single nucleotide polymorphism (SNP) of the ARHGAP32 (Rho GTPase Activating Protein 32) gene.
- SNP single nucleotide polymorphism
- a second aspect of the present application is to provide a composition for diagnosing a cerebral aneurysm, including an agent capable of detecting or amplifying rs371331393, which is the SNP of the ARHGAP32 gene.
- a third aspect of the present application is to provide a kit for diagnosing a cerebral aneurysm, including a composition for diagnosing a cerebral aneurysm.
- a fourth aspect of the present application is to provide a method of providing information for diagnosing a cerebral aneurysm, comprising the step of determining an allele of rs371331393, an SNP of ARHGAP32 gene, from a biological sample isolated from an individual.
- SNP marker composition for diagnosing cerebral aneurysm the composition for diagnosing cerebral aneurysm, the kit for diagnosing cerebral aneurysm, and the method for providing information for diagnosing cerebral aneurysm of the present invention
- single nucleotide polymorphism (SNP) on the ARHGAP32 gene is used to develop cerebral aneurysms in Koreans or Asians It can be used as a marker for risk prediction or diagnosis.
- 1 is a diagram showing a procedure for diagnosing a cerebral aneurysm using SNP of the GBA gene.
- FIG. 2 is a diagram showing the GWAS results in a Manhattan flute.
- FIG. 3 is a diagram showing a regional plot for the position ⁇ 500 kb of the rs371331393 variant, which is a SNP of the ARHGAP32 gene, in which 250 patients with cerebral aneurysms and 294 controls (age, sex, hypertension, diabetes, hyperlipidemia, Smoking and coordinating four major factors) and rs371331393 in association with cerebral aneurysms.
- the X-axis represents the chromosomal location (Mb), and the Y-axis represents the value obtained by converting the P-value to -log 10 .
- 4A is a diagram showing a regional plot for the location ( ⁇ 500kb) of the rs6741819 variant, which is the SNP of the RNF144A gene, in which 250 patients with cerebral aneurysms and 294 controls (age, sex, hypertension, Rs6741819 in diabetes, hyperlipidemia, smoking, and coordinating four major factors) and cerebral aneurysms.
- the X-axis represents the chromosomal location (Mb), and the Y-axis represents the value obtained by converting the P-value to -log 10 .
- the X axis represents the genotype and the Y axis represents the rank-normalized gene expression level.
- the reference type (Ref)/allele (Alt) allele of the variant genotype is the same as the major/minor allele.
- 4C is a diagram showing a regional plot for the location ( ⁇ 500kb) of the rs1052270 variant, the SNP of the TMOD1 gene, in which 250 patients with cerebral aneurysms and 294 controls (age, sex, hypertension, Diabetes mellitus, hyperlipidemia, smoking, and coordinating the four major factors).
- the X-axis represents the chromosomal location (Mb), and the Y-axis represents the value obtained by converting the P-value to -log 10 .
- the X axis represents the genotype and the Y axis represents the rank-normalized gene expression level.
- the reference type (Ref)/allele (Alt) allele of the variant genotype is the same as the major/minor allele.
- 5A is a diagram showing a regional plot for the location ( ⁇ 500kb) of the rs6841581 variant, which is the SNP of the EDNRA gene, in which 250 patients with cerebral aneurysms and 294 controls (age, sex, hypertension, Rs6741819 in diabetes, hyperlipidemia, smoking, and coordinating four major factors) and cerebral aneurysms.
- the X-axis represents the chromosomal location (Mb), and the Y-axis represents the value obtained by converting the P-value to -log 10 .
- the X axis represents the genotype and the Y axis represents the rank-normalized gene expression level.
- the reference type (Ref)/allele (Alt) allele of the variant genotype is the same as the major/minor allele.
- Example 6 shows the results of analysis of the association between cerebral aneurysms and 10 SNPs in Example 4.
- Example 7 shows the results of analysis of the haplotype association between cerebral aneurysms and 10 SNPs in Example 4.
- Example 8 shows the results of analysis of the association between a cerebral aneurysm and four SNPs in Example 4.
- the first aspect of the present application provides a SNP marker composition for diagnosing a cerebral aneurysm, comprising rs371331393, which is a single nucleotide polymorphism (SNP) of the ARHGAP32 (Rho GTPase Activating Protein 32) gene.
- SNP single nucleotide polymorphism
- SNP single nucleotide polymorphism
- the term "marker” used throughout the specification of the present application means a biomarker and can detect changes in a living organism, thereby objectively measuring the normal or pathological state of the living organism, and the degree of reaction to a drug.
- Cerebral aneurysm or brain aneurysm as used throughout the present specification is also referred to as intracranial aneurysm.
- IA intracranial aneurysm
- a common location for a cerebral aneurysm is an artery at the base of the brain, known as the Circle of Willis.
- About 85% of cerebral aneurysms occur in the anterior part of the Willis ring and include the internal carotid arteries and their major branches that supply blood to the anterior and middle parts of the brain. Cerebral aneurysms are classified by size and shape.
- Small aneurysm has a diameter of less than 15 mm. Larger aneurysms include aneurysms classified as large (15-25 mm), giant (25-50 mm), and super giant (> 50 mm).
- a saccular aneurysm is an aneurysm with saccular outpouching and is the most common form of cerebral aneurysm.
- Strawberry-like aneurysms are cystic aneurysms with a strawberry-like neck or stem. Fusiform aneurysm (fusiform aneurysm) is a stemless aneurysm.
- the SNP marker composition for diagnosing a cerebral aneurysm of the present application may diagnose the onset of a cerebral aneurysm, predict the risk of developing a cerebral aneurysm, or predict the prognosis of a cerebral aneurysm, but is not limited thereto.
- diagnosis means determining whether a cerebral aneurysm has already occurred in a specific individual.
- prediction is to determine whether there is a possibility of developing a cerebral aneurysm in a specific individual, or whether the likelihood of developing a cerebral aneurysm is relatively high compared to a large number of unspecified individuals. it means.
- rs371331393 which is the SNP of the ARHGAP32 gene, may include the 26th nucleotide of SEQ ID NO: 4, and the allele of the base of rs371331393 may be G or A.
- the allele of the base of rs371331393 is G or the allele of its complementary base is C, the occurrence of a cerebral aneurysm can be diagnosed or the risk of developing a cerebral aneurysm can be predicted at a high level.
- rs371331393 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 1.00) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
- allele or “allele” as used throughout this specification refers to multiple types of a gene present at the same locus of a homologous chromosome. Alleles are sometimes used to represent polymorphism, for example SNP has two or more types, for example, two types of alleles.
- the SNP marker composition for diagnosing a cerebral aneurysm is 1) rs75822236, which is a SNP of the GBA (Glucocerebrosidase) gene, 2) rs112859779, which is a SNP of the TCF24 (transcription factor 24) gene, 3) OLFML2A (Olfactomedin Like 2A)
- the SNP of the CD163L1 (CD163 Molecule Like 1) gene rs138525217, 5) The SNP of the CUL4A (cullin 4A) gene rs74115822, 6)
- the SNP of the LOC102724084 gene rs75861150 is 7) LRRC3 (Leucine rich repeat) containing 3) SNP of gene rs116969723, 8) RNF144A (Ring Finger Protein 144A) SNP of rs6741819, 9) FLJ
- rs75822236 which is the SNP of the GBA (Glucocerebrosidase) gene, may include the 26th nucleotide of SEQ ID NO: 1, and the allele of the base of rs75822236 may be C or T.
- the allele of the base of rs75822236 is C or the allele of its complementary base is G, it is possible to diagnose the occurrence of a cerebral aneurysm or to predict the risk of the onset at a high level.
- rs75822236 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 1.00) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
- rs112859779 which is the SNP of the TCF24 gene, may include the 26th nucleotide of SEQ ID NO: 2, and the allele of the base of rs112859779 may be C or T.
- the allele of the base of rs112859779 is C or the allele of its complementary base is G, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level.
- rs112859779 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 0.94) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
- rs79134766 which is the SNP of the OLFML2A gene, may include the 26th nucleotide of SEQ ID NO: 3, and the allele of the base of rs79134766 may be G or A.
- the allele of the base of rs79134766 is A or the allele of its complementary base is T, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level.
- rs79134766 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 0.96) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
- rs138525217 which is the SNP of the CD163L1 gene, may include the 26th nucleotide of SEQ ID NO: 5, and the allele of the base of rs138525217 may be C or T.
- the allele of the base of rs138525217 is C or the allele of its complementary base is G, the occurrence of a cerebral aneurysm can be diagnosed or the risk of developing a cerebral aneurysm can be predicted at a high level.
- rs138525217 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 1.00) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
- rs74115822 which is the SNP of the CUL4A gene, may include the 26th nucleotide of SEQ ID NO: 6, and the allele of the base of rs74115822 may be G or A.
- the allele of the base of rs74115822 is G or the allele of its complementary base is C, the occurrence of a cerebral aneurysm can be diagnosed or the risk of developing a cerebral aneurysm can be predicted at a high level.
- rs74115822 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 0.80) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
- rs75861150 which is the SNP of the LOC102724084 gene, may include the 26th nucleotide of SEQ ID NO: 7, and the allele of the base of rs75861150 may be T or C.
- the allele of the base of rs75861150 when the allele of the base of rs75861150 is C or the allele of its complementary base is G, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level.
- rs75861150 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 1.00) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
- rs116969723 which is the SNP of the LRRC3 gene, may include the 26th nucleotide of SEQ ID NO: 8, and the allele of the base of rs116969723 may be G or A.
- the allele of the base of rs116969723 is A or the allele of its complementary base is T, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing it may be predicted at a low level.
- rs116969723 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 0.81) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm can do.
- rs6741819 which is the SNP of the RNF144A gene, may include the 26th nucleotide of SEQ ID NO: 9, and the allele of the base of rs6741819 may be C or T.
- the allele of the base of rs6741819 when the allele of the base of rs6741819 is T or the allele of its complementary base is A, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level.
- rs6741819 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 0.72) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm can do.
- rs59626274 which is the SNP of the FLJ45964 gene, may include the 26th nucleotide of SEQ ID NO: 10, and the allele of the base of rs59626274 may be C or T.
- the allele of the base of rs59626274 when the allele of the base of rs59626274 is T or the allele of its complementary base is A, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level.
- rs59626274 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 0.71) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
- rs17688188 which is the SNP of the SPCS3 gene, may include the 26th nucleotide of SEQ ID NO: 11, and the allele of the base of rs17688188 may be G or A.
- the allele of the base of rs17688188 when the allele of the base of rs17688188 is A or the allele of its complementary base is T, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level.
- rs17688188 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 0.73) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm can do.
- rs56942085 which is the SNP of the LINGO2 gene, may include the 26th nucleotide of SEQ ID NO: 12, and the allele of the base of rs56942085 may be G or A.
- the allele of the base of rs56942085 is G or the allele of its complementary base is C, the occurrence of a cerebral aneurysm can be diagnosed or the risk of developing a cerebral aneurysm can be predicted at a high level.
- rs56942085 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 0.78) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
- rs72835045 which is the SNP of the MINK1 gene, may include the 26th nucleotide of SEQ ID NO: 13, and the allele of the base of rs72835045 may be G or A.
- the allele of the base of rs72835045 when the allele of the base of rs72835045 is A or the allele of its complementary base is T, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level.
- rs72835045 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 0.79) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
- the SNP marker composition for diagnosing a cerebral aneurysm is a polynucleotide consisting of 10 or more consecutive bases including the 205th base (rs2303656) of the sequence of SEQ ID NO: 14 in the LOX (lysyl oxidase) gene, or A complementary polynucleotide, a polynucleotide consisting of 10 or more consecutive bases including the 488th base (rs3900446) of the sequence of SEQ ID NO: 15, or a complementary polynucleotide thereof, the 678th base (rs763497) of the sequence of SEQ ID NO: 15
- a polynucleotide composed of 10 or more consecutive bases, or a complementary polynucleotide thereof, and a combination thereof may be additionally included, but are not limited thereto.
- the allele of the 205th base of SEQ ID NO: 14 when the allele of the 205th base of SEQ ID NO: 14 is T or the allele of its complementary base is A, the allele of the 205th base of SEQ ID NO: 14 is G or its It can be predicted that the risk of developing a cerebral aneurysm is lower than when the allele of the complementary base is C.
- the allele of the 488th base of SEQ ID NO: 15 when the allele of the 488th base of SEQ ID NO: 15 is G or the allele of its complementary base is C, the allele of the 488th base of SEQ ID NO: 15 is A or its It can be predicted that the risk of developing a cerebral aneurysm is higher than that of the case where the allele of the complementary base is T, or it can be diagnosed.
- the allele of the 678th base of SEQ ID NO: 15 when the allele of the 678th base of SEQ ID NO: 15 is G or the allele of its complementary base is C, the allele of the 678th base of SEQ ID NO: 15 is A or its It can be predicted that the risk of developing a cerebral aneurysm is higher than that of the case where the allele of the complementary base is T, or it can be diagnosed.
- the allele of the 488th base of SEQ ID NO: 15 is G or the allele of its complementary base is C, and the allele of the 678th base of SEQ ID NO: 15 is G or its complementary
- the allele of the base base is C
- the allele of the 488th base of SEQ ID NO: 15 is A or the allele of the complementary base is T
- the allele of the 678th base of SEQ ID NO: 15 is A or its It can be predicted that the risk of developing a cerebral aneurysm is higher than that of the case where the allele of the complementary base is T, or it can be diagnosed.
- the SNP marker composition for diagnosing a cerebral aneurysm is a polynucleotide consisting of 10 or more consecutive bases including the 326th base (rs1072737) of the sequence of SEQ ID NO: 38 in the SOX17 (SRY-box 17) gene. Or it may be to further include a complementary polynucleotide thereof, but is not limited thereto.
- the allele of the 326th base of SEQ ID NO: 38 when the allele of the 326th base of SEQ ID NO: 38 is C or the allele of its complementary base is G, the allele of the 326th base of SEQ ID NO: 38 is A or its It can be predicted that the risk of developing a cerebral aneurysm is higher than when the allele of the complementary base is T.
- Genetic information of the SNP contained in the SNP marker composition for diagnosing a cerebral aneurysm according to an embodiment of the present application can be obtained from a known database, for example, GenBank of the National Center for Biotechnology Information (NCBI). Etc., but is not limited thereto.
- the SNP marker composition for diagnosing a cerebral aneurysm may be used to diagnose a cerebral aneurysm in Koreans and Asians, but is not limited thereto.
- the SNP contained in the SNP marker composition for diagnosing a cerebral aneurysm was developed through a full-length genome-related analysis, and by confirming the allele of the SNP, it is possible to diagnose a cerebral aneurysm simply and efficiently. .
- GWAS gene-wide association study
- a second aspect of the present application provides a composition for diagnosing a cerebral aneurysm, including an agent capable of detecting or amplifying rs371331393, which is a SNP of the ARHGAP32 gene.
- the content overlapping with the first aspect also applies to the composition for diagnosing a cerebral aneurysm of the second aspect.
- the composition for diagnosing a cerebral aneurysm comprises 1) rs75822236, which is the SNP of the GBA gene, 2) rs112859779, which is the SNP of the TCF24 gene, 3) rs79134766, which is the SNP of the OLFML2A gene, 4) rs138525217, which is the SNP of the CD163L1 gene, 5) CUL4A gene SNP rs74115822, 6) LOC102724084 gene SNP rs75861150, 7) LRRC3 gene SNP rs116969723, 8) RNF144A gene SNP rs6741819, 9) FLJ45964 gene SNP rs59626274, 10) SPCS3 gene It may further include an agent capable of detecting or amplifying one or more SNPs selected from the group consisting of SNPs rs17688188, 11) LINGO2 SNPs rs56
- agent capable of detecting SNP refers to an agent capable of specifically binding and recognizing the SNP marker or SNP contained in the SNP marker composition, or detecting and amplifying the SNP.
- an agent capable of amplifying a SNP marker refers to an agent capable of increasing the number of SNP markers or SNPs contained in the SNP marker composition by repeating replication, for example, including the SNP It may refer to a primer capable of specifically amplifying the polynucleotide or a probe capable of specifically binding, but is not limited thereto.
- the primers used for the SNP amplification are under appropriate conditions (e.g., 4 different nucleoside triphosphates and a polymerizing agent such as DNA, RNA polymerase or reverse transcriptase) and a template-directed DNA synthesis under an appropriate temperature. It may be a single-stranded oligonucleotide that can serve as a starting point of, and the appropriate length of the primer may vary depending on the purpose of use, but is usually 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template.
- the primer sequence need not be completely complementary to the polynucleotide containing the SNP, but must be sufficiently complementary to hybridize with the polynucleotide containing the SNP.
- primer is a base sequence having a short free 3'hydroxyl group, which can form a base pair with a complementary template, and the template strand copy Refers to a short sequence that functions as a starting point for Primers can initiate DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer and temperature. At this time, PCR conditions, the length of the sense and antisense primers can be modified based on those known in the art.
- a reagent for polymerization ie, DNA polymerase or reverse transcriptase
- the probe used for SNP detection may refer to a hybridization probe, and refers to an oligonucleotide capable of sequence-specific binding to a complementary strand of a nucleic acid.
- Hybridization conditions should be sufficiently stringent so that only one of the alleles hybridizes to show a significant difference in hybridization strength between alleles. It is preferable that the central region of the probe of the present invention is aligned with the polymorphic region of the polymorphic sequence. Accordingly, a good hybridization difference between different allelic forms can be induced.
- the probe may be used in a kit such as a microarray or a prediction method for diagnosing cerebral aneurysms by detecting alleles.
- the probes of interest can be labeled to detect, for example, radioisotopes, fluorescent compounds, bioluminescent compounds, chemiluminescent compounds, metal chelates or enzymes. Appropriately labeling such a probe is a technique well known in the art, and can be performed through a conventional method.
- the primer or probe may be chemically synthesized using a phosphoramidite solid support method, or other well-known method.
- Such nucleic acid sequences can also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, encapsulation, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, e.g., uncharged linkers (e.g. methyl phosphonate, phosphotriester, phosphoro Amidates, carbamates, etc.) or to charged linkers (eg phosphorothioate, phosphorodithioate, etc.).
- uncharged linkers e.g. methyl phosphonate, phosphotriester, phosphoro Amidates, carbamates, etc.
- charged linkers eg phosphorothioate, phosphorodithioate, etc.
- rs371331393 which is the SNP of the ARHGAP32 gene, may include the 26th nucleotide of SEQ ID NO: 4, and the allele of the base of rs371331393 may be G or A.
- the composition for diagnosing a cerebral aneurysm is a polynucleotide consisting of 10 or more consecutive bases including the 205th base (rs2303656) of the sequence of SEQ ID NO: 14 in the LOX (lysyl oxidase) gene or a complementary thereof.
- Polynucleotide a polynucleotide consisting of 10 or more consecutive bases including the 488th base (rs3900446) of the sequence of SEQ ID NO: 15, or a complementary polynucleotide thereof, comprising the 678th base of the sequence of SEQ ID NO: 15 (rs763497)
- a polynucleotide composed of 10 or more consecutive bases or a complementary polynucleotide thereof, and an agent capable of detecting or amplifying a combination thereof may be additionally included, but is not limited thereto.
- the composition for diagnosing a cerebral aneurysm is a polynucleotide consisting of 10 or more consecutive bases including the 326th base (rs1072737) of the sequence of SEQ ID NO: 38 in the SOX17 (SRY-box 17) gene, or It may further include an agent capable of detecting or amplifying the complementary polynucleotide, but is not limited thereto.
- a third aspect of the present application provides a kit for diagnosing a cerebral aneurysm, including the composition for diagnosing a cerebral aneurysm.
- the content overlapping with the first side and the second side also applies to the second side of the cerebral aneurysm diagnosis kit.
- the kit may be a PCR kit, an RT-PCR kit, or a DNA chip kit, but is not limited thereto.
- the kit may include SNP, polynucleotide, cDNA, etc. of the present application, as well as other constituent compositions, solutions, or devices suitable for analysis methods.
- the PCT kit for diagnosing a cerebral aneurysm may be a kit including essential elements necessary to perform PCR.
- PCR kits in addition to the polynucleotides, primers or probes specific for the SNP, test tubes or other suitable containers, reaction buffers (varies in pH and magnesium concentration), deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase.
- Enzymes such as, DNase, RNAse inhibitor, DEPC-water and sterile water may be included.
- the DNA chip kit for diagnosing a cerebral aneurysm may be a kit including essential elements necessary to perform a DNA chip, and the DNA chip kit includes a specific polynucleotide, primer, or probe for the SNP. It includes a substrate to which it is attached, and the substrate may include a nucleic acid corresponding to a quantitative control gene or a fragment thereof.
- the RT-PCR kit for diagnosing a cerebral aneurysm may be a kit including essential elements necessary to perform RT-PCR, and the RT-PCR kit is each primer specific for the SNP.
- reaction buffers varies in pH and magnesium concentration
- deoxynucleotides dNTPs
- didioxynucleotides ddNTPs
- enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterilized water, and the like may be included.
- a fourth aspect of the present application provides a method of providing information for diagnosing a cerebral aneurysm, comprising determining an allele of rs371331393, an SNP of ARHGAP32 gene, from a biological sample isolated from an individual.
- the content overlapping with the first to third aspects also applies to the method of providing information for diagnosing a cerebral aneurysm of the fourth aspect.
- the diagnosis of a cerebral aneurysm of the present application may be diagnosing the onset of a cerebral aneurysm, predicting the risk of developing a cerebral aneurysm, or diagnosing the prognosis of a cerebral aneurysm, but is not limited thereto.
- the term "individual” refers to any organism that has or is likely to develop a cerebral aneurysm, and specific examples include mammals including mice, monkeys, cows, pigs, mini pigs, livestock, humans, etc. It may include animals, farmed fish, etc., but is not limited thereto.
- sample refers to a substance derived from an individual who develops or is likely to develop a cerebral aneurysm, and specifically, tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, urine It may include, but is not limited thereto.
- a gene sample may be obtained from these samples, and the gene sample may include a nucleic acid, for example, DNA, mRNA, or cDNA synthesized from mRNA, and as long as the base information of the SNP can be confirmed therefrom, The kind is not limited thereto.
- the individual may be a human, and specifically, may be a Korean or Asian, but is not limited thereto.
- non-genetic information in order to perform risk prediction or diagnosis of the individual, further comprising the step of analyzing non-genetic information, wherein the non-genetic information is sex, age, hypertension, diabetes, It may be one or more selected from the group consisting of hyperlipidemia, smoking, family history of aneurysms, biochemical scales, and clinical scales.
- determining the base of the SNP in the information providing method may mean a step of confirming the genotype of the SNP.
- the step of confirming the genotype of SNP includes sequencing analysis, e.g., sequencing analysis using an automatic sequencing analyzer, pyrosequencing, hybridization by microarray, PCR-RELP (restriction fragment length polymorphism) method, PCR -SSCP (single strand conformation polymorphism) method, PCR-SSO (specific sequence oligonucleotide) method, ASO (allele specific oligonucleotide) hybridization method combining PCR-SSO method and dot hybridization method, TaqMan-PCR method, MALDI-TOF/MS method , Rolling circle amplification (RCA) method, high resolution melting (HRM) method, primer extension method, Southern blot hybridization method, dot hybridization method, and the like.
- sequencing analysis e.g., sequencing analysis using an automatic sequencing analyzer, pyrosequencing, hybrid
- the step of determining the base of the SNP in the method for providing information of the present application includes, for example, sequencing a nucleotide sequence containing the SNP site from a nucleic acid isolated from a sample obtained from a subject, and determining the SNP allele. It can be done by checking directly. Sequencing of the nucleotide sequence may be performed through a method known in the art. For example, sequencing of the base sequence is performed using a nucleic acid isolated from a sample obtained from an individual as a template, and performing PCR using a primer capable of amplifying a gene site including each SNP site, and the PCR reaction product It can be accomplished by sequentially performing the step of confirming the sequence by the restriction enzyme cleavage method.
- rs371331393 which is the SNP of the ARHGAP32 gene, may include the 26th nucleotide of SEQ ID NO: 4, and when the allele of rs371331393 is G, it is diagnosed as developing a cerebral aneurysm or risk of developing it. It may be to further include the step of predicting to a high level.
- the method of providing information for diagnosing a cerebral aneurysm is from a biological sample isolated from an individual, 1) rs75822236, which is the SNP of the GBA gene, 2) rs112859779, which is the SNP of the TCF24 gene, 3) the SNP of the OLFML2A gene.
- the method of providing information for diagnosing a cerebral aneurysm includes 1) when the allele of rs75822236, which is the SNP of the GBA gene, is C, 2) when the allele of rs138525217, which is the SNP of the CD163L1 gene, is C, 3) If the allele of rs74115822, the SNP of the CUL4A gene is G, 4) If the allele of rs56942085, the SNP of the LINGO2 gene, is G, or a combination of two or more of them, it is diagnosed as developing or onset of a cerebral aneurysm It may be to further include a step of predicting the risk at a high level.
- the method of providing information for diagnosing a cerebral aneurysm includes 1) when the allele of rs112859779, which is the SNP of the TCF24 gene, is T, 2) when the allele of rs79134766, which is the SNP of the OLFML2A gene, is A, 3) When the allele of rs75861150, the SNP of the LOC102724084 gene is C, 4) When the allele of rs116969723, the SNP of the LRRC3 gene, is A, 5) When the allele of rs6741819, the SNP of the RNF144A gene is T, 6) When the allele of rs59626274, the SNP of the FLJ45964 gene is T, 7) When the allele of rs17688188, the SNP of the SPCS3 gene, is A, 8) When the allele of rs72835045, the SNP of the MINK1 gene is
- the method of providing information for diagnosing a cerebral aneurysm is from a biological sample isolated from an individual, the 205th base of the sequence of SEQ ID NO: 14 (rs2303656) in the LOX gene, the 488th of the sequence of SEQ ID NO: 15 The base (rs3900446), the 678th base (rs763497) of the sequence of SEQ ID NO: 15, and the allele of a combination thereof may be further included.
- the method of providing information for diagnosing a cerebral aneurysm further includes the step of confirming the allele of the 326th base (rs1072737) of the sequence of SEQ ID NO: 38 in the SOX17 gene from a biological sample isolated from the individual. It may be included as.
- the results of the SNP polymorphism may be statistically processed using a statistical analysis method commonly used in the art, for example, Student t -Student's t-test, Chi-square test, linear regression line analysis, multiple logistic regression analysis, meta-analysis, etc. It can be analyzed using variables such as continuous variables, categorical variables, odds ratio (OR), and 95% confidence interval (CI).
- a statistical analysis method commonly used in the art, for example, Student t -Student's t-test, Chi-square test, linear regression line analysis, multiple logistic regression analysis, meta-analysis, etc. It can be analyzed using variables such as continuous variables, categorical variables, odds ratio (OR), and 95% confidence interval (CI).
- the cohort for carrying out the present invention was derived from the Chuncheon Sacred Heart Hospital stroke database (2015-2018), and for database collection, patients showing clinical diagnosis and neuroimaging consistent with hemorrhagic or ischemic stroke were recruited.
- patients over 18 years of age with saccular and sporadic cerebral aneurysms were analyzed.
- non-cystic aneurysms such as vertebral, anatomical, traumatic, and infectious aneurysms, and familial aneurysms were excluded.
- the control group satisfied the following criteria: 1) Patients who underwent computed tomography or magnetic resonance angiography for headache diagnosis or health examination, and 2) no neurological disorders such as cerebral arteriovenous malformation, intracranial hemorrhage, or infarction. , 3) no family history of cerebral aneurysm or subarachnoid hemorrhage in close relatives, 4) no Parkinson's or Alzheimer's disease, and 5) over 18 years of age.
- the medical records were reviewed in consideration of various variables such as gender, age, clinical symptoms such as non-ruptured cerebral aneurysm or subarachnoid hemorrhage, high blood pressure, diabetes, hyperlipidemia, smoking, and family history of aneurysms, and the size and location of aneurysms (anterior circulation Or posterior circulation), and angiographic parameters for number (singular or plural) were reviewed.
- This study was approved by the Clinical Trial Committee of Chuncheon Sacred Heart Hospital (No. 2016-3, 2017-9).
- Genomic DNA was obtained from peripheral blood of the experimental group and the control group using the HiGene TM Genomic DNA Prep Kit (BIOFACT, Daejeon, Korea).
- HiGene TM Genomic DNA Prep Kit BIOFACT, Daejeon, Korea.
- PMRA Asia Precision Medicine Research Array
- Kit Thermo Fisher Scientific, MA, USA
- Descriptive analysis is expressed using the number of subjects (percentages) of individual and categorical variables, and the mean is expressed as standard error.
- a multivariate symbol having 7 confounding factors (gender, age, hypertension, diabetes, hyperlipemia, smoking and 4 major factors) for 250 cerebral aneurysms and 294 controls.
- a multivariate logistic analysis was performed, and the analysis was performed using STATA v11.2 (Stata Corp., TX, USA).
- full-length genome-related analysis was performed to identify candidate genetic mutations for cerebral aneurysm susceptibility under an additional loci effect model after adjusting the seven confounding factors, and the PLINK 1.9 program ( https://www.cog-genomics). .org/plink/1.9/ ) was used.
- Genotype-Tissue Expression (https://gtexportal.org/home/) was used to analyze a single tissue expression quantitative trait loci (eQTL).
- the Manhattan plot and regional association plot are the " qqman " command ( https://cran.r-project.org/web/packages/qqman ) and LocusZoom v1 of the R package v3.4.0, respectively. 3 ( http://locuszoom.org/ ) was used.
- the main elements are estimated by performing main element analysis with 4 clusters.
- SNPs with a pairwise linkage disequilibrium of less than 0.8 were removed, and a p-value of less than 5 x 10 -8 , a genome-wide significance threshold, was removed.
- a total of 29 SNPs were selected. Details of the selected SNP are shown in Table 2 below.
- SNPs located on the GBA , TCF24 , OLFML2A , ARHGAP32 , CD163L1 , CUL4A , LOC102724084 , and LRRC3 genes show statistical significance of 0.8 or more, and RNF144A , FLJ45964 SPCS3 , LINGO2 , and MINK1 genes
- the located SNP has a statistical significance of 0.7 to 0.8, and the 13 SNPs can be used to predict the risk of developing a cerebral aneurysm or to diagnose the onset.
- the control group consisted of matched patients who underwent computed tomography or magnetic resonance angiography for headache diagnosis or health examination, excluding other neurological disorders such as arteriovenous malformations, intracranial hemorrhage or infarction.
- the medical records were reviewed in consideration of various variables such as sex, age, clinical symptoms such as non-ruptured cerebral aneurysm or subarachnoid hemorrhage, hypertension, diabetes, hyperlipidemia, smoking, and family history of aneurysms. Angiographic parameters for the size, location (anterior or posterior circulation), and number (singular or plural) of aneurysms were reviewed. This study was approved by the Clinical Trial Committee of Chuncheon Sacred Heart Hospital (No. 2016-31).
- genomic DNA was extracted from peripheral blood of 160 subjects using a HiGene TM Genomic DNA preparation kit (BIOFACT, Daejeon, Korea).
- Ten SNP primers were designed using the Primer-3 v.0.4.0 program (http://bioinfo.ut.ee/primer3-0.4.0/), and the designed primers are shown in Table 4 below.
- PCR Polymerase chain reaction
- the Kruskal-Wallis test was performed to evaluate the difference in non-genetic factors between 80 patients with cerebral aneurysms and 80 controls. Fisher's exact test was performed to estimate the antagonistic relationship between a cerebral aneurysm and 10 SNPs located near or on the LOX gene to estimate the odds ratio (OR).
- rs2303656, rs3900446, and rs763497 showed a statistically significant association with cerebral aneurysms (p ⁇ 0.05) (Fig. 6).
- Two SNPs (rs2303656 and rs3900446) reached Bonferroni-corrected levels of significance (p ⁇ 0.005).
- 187 patients with a cerebral aneurysm confirmed to have a saccular shape radiologically and 372 controls matched with the age and sex of the patients in the patient group were recruited (the ratio of the patient group and the control group was 1:2).
- the cerebral aneurysm fusiform or anatomical non-cystic aneurysm and traumatic or infectious aneurysm were excluded.
- the control group consisted of matched patients who underwent computed tomography or magnetic resonance angiography for headache diagnosis or health examination, excluding other neurological disorders such as arteriovenous malformations, intracranial hemorrhage or infarction.
- the medical records were reviewed in consideration of various variables such as sex, age, clinical symptoms such as non-ruptured cerebral aneurysm or subarachnoid hemorrhage, hypertension, diabetes, hyperlipidemia, smoking, and family history of aneurysms. Angiographic parameters for the size, location (anterior or posterior circulation), and number (singular or plural) of aneurysms were reviewed. This study was approved by the Clinical Trial Committee of Chuncheon Sacred Heart Hospital (No. 2017-9).
- genomic DNA was extracted from peripheral blood of 559 subjects using a HiGene TM Genomic DNA preparation kit (BIOFACT, Daejeon, Korea).
- Five SNP primers were designed using the Primer-3 v.0.4.0 program (http://bioinfo.ut.ee/primer3-0.4.0/), and the designed primers are shown in Table 6 below.
- PCR Polymerase chain reaction
- Univariate logistic regression analysis was performed to evaluate the difference between 187 patients with cerebral aneurysms and 372 controls for age, sex, hypertension, diabetes, hyperlipidemia, and smoking.
- a generalized linear model was performed to evaluate the genetic association between cerebral aneurysms and SOX17 gene polymorphism under an additional effect inheritance model to estimate a 95% confidence interval (CI) and correspondence ratio (OR).
- CI 95% confidence interval
- OR correspondence ratio
- Genotype and haplotype associations were analyzed using the PLINK program 1.07 (http://zzz.bwh.harvard.edu/plink/).
- Example 2 After quality control assay, 4 out of the 5 SNPs selected in Example 2 had a complete genotype classification rate (GCR), a minor allele frequency (MAF) greater than 10%, and a Hardy-Weinberg equilibrium (HWE) P value of 0.05. The excess, pairwise linkage disequilibrium (LD) was greater than 0.8. Rs12541742, located in the intron region of the SOX17 gene, was excluded from this association test due to the Hardy-Weinberg equilibrium (HWE).
- GCR genotype classification rate
- MAF minor allele frequency
- HWE Hardy-Weinberg equilibrium
Abstract
본 발명은 ARHGAP32 유전자의 SNP를 포함하는, 뇌동맥류 진단용 SNP 마커 조성물, 상기 SNP 마커를 검출 또는 증폭할 수 있는 제제를 포함하는 뇌동맥류 진단용 조성물, 상기 조성물을 포함하는 뇌동맥류 진단용 키트, 및 상기 조성물 및 키트를 이용한 뇌동맥류 진단을 위한 정보 제공 방법에 관한 것이다. 본 발명의 뇌동맥류 진단용 SNP 마커 조성물, 뇌동맥류 진단용 조성물, 뇌동맥류 진단용 키트 및 뇌동맥류 진단을 위한 정보 제공 방법에 따르면, ARHGAP32 유전자 상의 단일염기다형성(SNP)을 한국인 또는 아시아인에서 뇌동맥류의 발병 위험 예측 또는 진단을 위한 마커로서 이용할 수 있다.
Description
본 발명은 ARHGAP32 유전자의 SNP를 포함하는, 뇌동맥류 진단용 SNP 마커 조성물, 상기 SNP 마커를 검출 또는 증폭할 수 있는 제제를 포함하는 뇌동맥류 진단용 조성물, 상기 조성물을 포함하는 뇌동맥류 진단용 키트, 및 상기 조성물 및 키트를 이용한 뇌동맥류 진단을 위한 정보 제공 방법에 관한 것이다.
염기서열 다형성(Polymorphism)은 1% 초과하는 빈도로 나타나는 염기서열의 변이를 일컫는 것으로, 이 중 90%는 단일염기 다형성(single nucleotide polymorphism, SNP)이다. 인간 유전적 서열은 99.9% 동일하고, SNP는 약 250~1000bp 마다 하나씩 나타나며, 인간 유전체의 경우 약 2백만개의 SNP가 존재하고 이중 유전자에는 약 21,000개가 존재한다. 또한 1% 이하의 빈도로 나타나는 다른 단일염기의 변이는 통상 돌연변이(mutation)로 칭한다.
염기서열 돌연변이 분석 또는 SNP는 DNA 서열분석은 분석은 물론, 질환 예를 들어 암, 천식, 당뇨와 같은 질환을 야기하는 유전자 발굴 또는 특정 질환과의 연관성을 판단할 수 있는 마커로서 중요한 역할을 한다. 따라서 단일염기다형성을 분석함으로써 사람의 경우 특정 질환에 대한 개인의 감수성을 파악하여 염기서열의 차이로 인해 발생하는 선천성 질병에 대한 예방 또는 발병한 질환의 치료에 도움이 될 수 있다.
뇌동맥류, 구체적으로 두개내 동맥류는 모든 지주막하 출혈(지주막하 출혈)의 약 85%를 차지하며, 이는 50%까지의 높은 사망률을 가진다. 뇌동맥류는 일반적으로 지주막하출혈이 발생하게 되어 이를 먼저 뇌CT 촬영으로 확인할 수 있으며, 지주막하출혈이 의심되나 CT에서 안보일 경우에는 요추부 천자를 통해서 피가 섞인 뇌척수액을 확인함으로써 진단할 수도 있다. 또한, 실제로 파열된 뇌동맥류의 치료계획을 세우기 위해서는 파열된 부위를 찾아내어 위치, 크기, 모양, 갯수등을 정확히 파악해야 하는데 이를 위해서는 '뇌혈관 조영술' 이라는 검사를 해야 하며, 그 외의 방법으로는 CT 혈관촬영술이나 MRI 혈관촬영술등이 있다. 다만, 상기와 같은 방법은 번거로울 뿐만 아니라, 뇌동맥류가 발병하기 전이나 또는 예후를 예측하기에는 어렵다는 문제점이 있다.
이에 본 발명자들은 뇌동맥류 발병 진단, 발병 위험 예측 및 예후 예측을 효율적이고 손쉽게 할 수 있는 방법을 개발하고자 노력한 결과, 특정 유전자 상의 SNP 대립형질로부터 뇌동맥류를 진단 또는 예측할 수 있는 진단용 조성물을 개발하여 본 발명을 완성하였다.
본원의 제 1 측면은, ARHGAP32(Rho GTPase Activating Protein 32) 유전자의 단일염기다형성(single nucleotide polymorphism, SNP)인 rs371331393을 포함하는, 뇌동맥류 진단용 SNP 마커 조성물을 제공하는 것이다.
본원의 제 2 측면은, ARHGAP32 유전자의 SNP인 rs371331393를 검출 또는 증폭할 수 있는 제제를 포함하는, 뇌동맥류 진단용 조성물을 제공하는 것이다.
본원의 제 3 측면은, 뇌동맥류 진단용 조성물을 포함하는, 뇌동맥류 진단용 키트를 제공하는 것이다.
본원의 제 4 측면은, 개체로부터 분리된 생물학적 시료로부터, ARHGAP32 유전자의 SNP인 rs371331393의 대립형질을 결정하는 단계를 포함하는, 뇌동맥류 진단을 위한 정보 제공 방법을 제공하는 것이다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
본 발명의 뇌동맥류 진단용 SNP 마커 조성물, 뇌동맥류 진단용 조성물, 뇌동맥류 진단용 키트 및 뇌동맥류 진단을 위한 정보 제공 방법에 따르면, ARHGAP32 유전자 상의 단일염기다형성(SNP)을 한국인 또는 아시아인에서 뇌동맥류의 발병 위험 예측 또는 진단을 위한 마커로서 이용할 수 있다.
<1. 13개의 뇌동맥류 진단용 SNP 마커 개발>
도 1은 GBA 유전자의 SNP를 이용한 뇌동맥류 진단 과정을 나타낸 도면이다.
도 2는 GWAS 결과를 맨하탄 플룻으로 나타낸 도면이다. 빨간선은 전장유전체 유의적 임계적 (P-value= 5 x 10-8)을 표시하는 것이다.
도 3은 ARHGAP32 유전자의 SNP인 rs371331393 변이체의 위치 ± 500kb에 대한 지역 플랏(regional plot)을 나타내는 도면으로서, 상기 도면은 250명의 뇌동맥류 환자 및 294명의 대조군(연령, 성별, 고혈압, 당뇨병, 고지혈증, 흡연 및 4가지 주요 요소를 조정)에서의 rs371331393와 뇌동맥류와의 연관성을 나타낸다. X축은 염색체 위치(Mb)를 나타내고, Y축은 P-값을 -log10로 변환한 수치를 나타낸다. 보라색 마름모는 본원의 GWAS에서 가장 유의미한 연관성을 나타내는 rs371331393 변이체를 나타내며(P = 9.3Х10-27), 회색원은 rs371331393 변이체의 500kb 내의 다른 SNP를 나타낸다.
도 4의 A는 RNF144A 유전자의 SNP인 rs6741819 변이체의 위치(± 500kb)에 대한 지역 플랏(regional plot)을 나타내는 도면으로서, 상기 도면은 250명의 뇌동맥류 환자 및 294명의 대조군(연령, 성별, 고혈압, 당뇨병, 고지혈증, 흡연 및 4가지 주요 요소를 조정)에서의 rs6741819와 뇌동맥류와의 연관성을 나타낸다. X축은 염색체 위치(Mb)를 나타내고, Y축은 P-값을 -log10로 변환한 수치를 나타낸다. 보라색 마름모는 본원의 GWAS에서의 rs6741819 변이체를 나타내며(P = 4.0Х10-14), 회색원은 rs6741819 변이체의 500kb 내의 다른 SNP를 나타낸다.
도 4의 B는 단일-세포 eQTL을 이용하여 부신 조직(n=175)에서의 rs6741819 변이체의 발현수준을 나타낸 도면이다. X 축은 유전자형을 나타내고, Y 축은 순위-표준화된 유전자 발현 수준을 나타낸다. 상기 변이체 유전자형의 참조형(Ref)/대립형(Alt) 대립형질은 메이저/마이너 대립형질과 동일하다.
도 4의 C는 TMOD1 유전자의 SNP인 rs1052270 변이체의 위치(± 500kb)에 대한 지역 플랏(regional plot)을 나타내는 도면으로서, 상기 도면은 250명의 뇌동맥류 환자 및 294명의 대조군(연령, 성별, 고혈압, 당뇨병, 고지혈증, 흡연 및 4가지 주요 요소를 조정)에서의 rs1052270와 뇌동맥류와의 연관성을 나타낸다. X축은 염색체 위치(Mb)를 나타내고, Y축은 P-값을 -log10로 변환한 수치를 나타낸다. 보라색 마름모는 본원의 GWAS에서의 rs1052270 변이체를 나타내며(P = 4.0Х10-14), 회색원은 rs1052270 변이체의 500kb 내의 다른 SNP를 나타낸다.
도 4의 D는 단일-세포 eQTL을 이용하여 고환 조직(n=225)에서의 rs1052270 변이체의 발현수준을 나타낸 도면이다. X 축은 유전자형을 나타내고, Y 축은 순위-표준화된 유전자 발현 수준을 나타낸다. 상기 변이체 유전자형의 참조형(Ref)/대립형(Alt) 대립형질은 메이저/마이너 대립형질과 동일하다.
도 5의 A는 EDNRA 유전자의 SNP인 rs6841581 변이체의 위치(± 500kb)에 대한 지역 플랏(regional plot)을 나타내는 도면으로서, 상기 도면은 250명의 뇌동맥류 환자 및 294명의 대조군(연령, 성별, 고혈압, 당뇨병, 고지혈증, 흡연 및 4가지 주요 요소를 조정)에서의 rs6741819와 뇌동맥류와의 연관성을 나타낸다. X축은 염색체 위치(Mb)를 나타내고, Y축은 P-값을 -log10로 변환한 수치를 나타낸다. 보라색 마름모는 본원의 GWAS에서의 rs6841581 변이체를 나타내며(P = 4.0Х10-14), 회색원은 rs6841581 변이체의 500kb 내의 다른 SNP를 나타낸다.
도 5의 B 및 C는 단일-세포 eQTL을 이용하여 식도(점막)(B) (358개 샘플, effect size = 0.38, p = 5.2Х10-12) 및 햇빛에 노출되지 않은 피부(치골상부)(C) (335개 샘플, effect size = 0.21, p = 1.2Х10-6)에서의 rs6841581 변이체의 발현수준을 나타낸 도면이다. X 축은 유전자형을 나타내고, Y 축은 순위-표준화된 유전자 발현 수준을 나타낸다. 상기 변이체 유전자형의 참조형(Ref)/대립형(Alt) 대립형질은 메이저/마이너 대립형질과 동일하다.
<2. LOX(Lysyl oxidase) 유전자의 SNP 이용한 뇌동맥류 진단>
도 6은 실시예 4에서의 뇌동맥류와 10개의 SNP와의 연관성 분석 결과를 나타낸다.
도 7은 실시예 4에서의 뇌동맥류와 10개의 SNP의 일배체형 연관성 분석 결과를 나타낸다.
<3. SOX17(SRY-box 17) 유전자의 SNP 이용한 뇌동맥류 진단>
도 8은 실시예 4에서의 뇌동맥류와 4개의 SNP와의 연관성 분석 결과를 나타낸다.
도 9는 실시예 4에서의 뇌동맥류 파열과 4개의 SNP의 연관성 분석 결과를 나타낸다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
본원의 제 1 측면은, ARHGAP32(Rho GTPase Activating Protein 32) 유전자의 단일염기다형성 (single nucleotide polymorphism, SNP)인 rs371331393을 포함하는, 뇌동맥류 진단용 SNP 마커 조성물을 제공한다.
본원 명세서 전체에서 사용되는 용어, "SNP(single nucleotide polymorphism)”는 단일염기다형성을 의미하며, 염색체의 단일부위에서 여러 가지 DNA 염기들 중의 하나에 나타나는 일반적인 돌연변이로 SNP는 그 빈도가 높고 안정하며 유전체 전체에 분포되어 있고 이에 의하여 개인의 유전적 다양성이 발생한다. 본원에서, 상기 “SNP 마커”는 “SNP”와 혼용되어 명명될 수 있다.
본원 명세서 전체에서 사용되는 용어, "마커(marker)"는 바이오마커를 의미하며 생명체의 변화를 탐지할 수 있어 생명체의 정상 또는 병리적인 상태, 약물에 대한 반응 정도 등을 객관적으로 측정할 수 있다.
본원 명세서 전체에서 사용되는 용어, "뇌동맥류(cerebral aneurysm 또는 brain aneurysm)"는 두개내 동맥류(Intracranial aneurysm. IA)로도 지칭되며, 뇌동맥 또는 뇌정맥의 벽의 약화가 혈관의 국소적 확장 또는 풍선확장(ballooning)을 유발하는 뇌혈관 질환이다. 뇌동맥류의 일반적인 위치는 윌리스환(Circle of Willis)이라고 알려진, 뇌의 기부에 있는 동맥이다. 뇌동맥류의 약 85%가 윌리스환의 앞부분에서 발생하고, 뇌의 앞부분과 중간부분에 혈액을 공급하는 내부 경동맥 및 그들의 주요 분지를 포함한다. 뇌동맥류는 크기와 형태에 의해 분류된다. 소 동맥류(small aneurysm)는 15 mm 미만의 직경을 갖는다. 더 큰 동맥류(larger aneurysm)는 대형(large)(15 내지 25mm), 특대형(giant)(25 내지 50mm), 및 초특대형(super giant)(50mm 초과)으로 분류되는 동맥류를 포함한다. 낭형 동맥류(saccular aneurysm)는 낭형 돌출(saccular outpouching)을 갖는 동맥류이고, 뇌동맥류의 가장 흔한 형태이다. 딸기형 동맥류는 딸기를 닮은 목 또는 줄기를 갖는 낭형 동맥류이다. 방추형 동맥류(fusiform aneurysm)는 줄기가 없는 동맥류이다.
본원의 일 구현예에 따르면, 본원의 뇌동맥류 진단용 SNP 마커 조성물은 뇌동맥류 발병을 진단하거나, 뇌동맥류 발병 위험을 예측하거나 또는 뇌동맥류의 예후를 예측하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본원 명세서 전체에서 사용되는 용어 "진단"은, 특정 개인에 대하여 뇌동맥류가 이미 발병하였는지 여부를 판별하는 것을 의미한다.
본원 명세서 전체에서 사용되는 용어 "예측"은, 특정 개인에 대하여 뇌동맥류가 발병할 가능성이 있는지, 발병할 가능성이 있다면 뇌동맥류가 발병할 가능성이 불특정 다수인에 비하여 상대적으로 높은지 여부를 판별하는 것을 의미한다.
본원의 일 구현예에 따르면, 상기 ARHGAP32 유전자의 SNP인 rs371331393는 서열번호 4의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs371331393의 염기의 대립형질은 G 또는 A일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs371331393의 염기의 대립형질이 G이거나 그의 상보적인 염기의 대립형질이 C인 경우, 뇌동맥류가 발병한 것으로 진단하거나 발병 위험을 높은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs371331393가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 1.00)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.
본원 명세서 전체에서 사용되는 용어 "대립형질" 또는 "대립유전자"는 상동염색체의 동일한 유전자 좌위에 존재하는 한 유전자의 여러 유형을 의미한다. 대립유전자는 다형성을 나타내는데 사용되기도 하며, 예컨대, SNP는 두 종류 이상, 예를 들어 두 종류의 대립형질을 갖는다.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 SNP 마커 조성물은 1) GBA(Glucocerebrosidase) 유전자의 SNP인 rs75822236, 2) TCF24(transcription factor 24) 유전자의 SNP인 rs112859779, 3) OLFML2A(Olfactomedin Like 2A) 유전자의 SNP인 rs79134766, 4) CD163L1(CD163 Molecule Like 1) 유전자의 SNP인 rs138525217, 5) CUL4A(cullin 4A) 유전자의 SNP인 rs74115822, 6) LOC102724084 유전자의 SNP인 rs75861150, 7) LRRC3(Leucine rich repeat containing 3) 유전자의 SNP인 rs116969723, 8) RNF144A(Ring Finger Protein 144A) 유전자의 SNP인 rs6741819, 9) FLJ45964 유전자의 SNP인 rs59626274, 10) SPCS3(Signal Peptidase Complex Subunit 3) 유전자의 SNP인 rs17688188, 11) LINGO2(Leucine Rich Repeat And Ig Domain Containing 2) 유전자의 SNP인 rs56942085, 및 12) MINK1(misshapen/Nck-interacting kinase(NIK)-related kinase 1) 유전자의 SNP인 rs72835045으로 이루어진 군에서 선택되는 하나 이상의 SNP를 추가로 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본원의 일 구현예에 따르면, 상기 GBA(Glucocerebrosidase) 유전자의 SNP인 rs75822236는 서열번호 1의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs75822236의 염기의 대립형질은 C 또는 T일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs75822236의 염기의 대립형질이 C이거나 그의 상보적인 염기의 대립형질이 G인 경우, 뇌동맥류가 발병한 것으로 진단하거나 발병 위험을 높은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs75822236가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 1.00)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.
본원의 일 구현예에 따르면, 상기 TCF24 유전자의 SNP인 rs112859779는 서열번호 2의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs112859779의 염기의 대립형질은 C 또는 T일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs112859779의 염기의 대립형질이 C이거나 그의 상보적인 염기의 대립형질이 G인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs112859779가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.94)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.
본원의 일 구현예에 따르면, 상기 OLFML2A 유전자의 SNP인 rs79134766는 서열번호 3의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs79134766의 염기의 대립형질은 G 또는 A일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs79134766의 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs79134766가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.96)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.
본원의 일 구현예에 따르면, 상기 CD163L1 유전자의 SNP인 rs138525217는 서열번호 5의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs138525217의 염기의 대립형질은 C 또는 T일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs138525217의 염기의 대립형질이 C이거나 그의 상보적인 염기의 대립형질이 G인 경우, 뇌동맥류가 발병한 것으로 진단하거나 발병 위험을 높은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs138525217가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 1.00)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.
본원의 일 구현예에 따르면, 상기 CUL4A 유전자의 SNP인 rs74115822는 서열번호 6의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs74115822의 염기의 대립형질은 G 또는 A일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs74115822의 염기의 대립형질이 G이거나 그의 상보적인 염기의 대립형질이 C인 경우, 뇌동맥류가 발병한 것으로 진단하거나 발병 위험을 높은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs74115822가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.80)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.
본원의 일 구현예에 따르면, 상기 LOC102724084 유전자의 SNP인 rs75861150는 서열번호 7의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs75861150의 염기의 대립형질은 T 또는 C일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs75861150의 염기의 대립형질이 C이거나 그의 상보적인 염기의 대립형질이 G인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs75861150가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 1.00)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.
본원의 일 구현예에 따르면, 상기 LRRC3 유전자의 SNP인 rs116969723는 서열번호 8의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs116969723의 염기의 대립형질은 G 또는 A일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs116969723의 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs116969723가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.81)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.
본원의 일 구현예에 따르면, 상기 RNF144A 유전자의 SNP인 rs6741819는 서열번호 9의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs6741819의 염기의 대립형질은 C 또는 T일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs6741819의 염기의 대립형질이 T이거나 그의 상보적인 염기의 대립형질이 A인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs6741819가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.72)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.
본원의 일 구현예에 따르면, 상기 FLJ45964 유전자의 SNP인 rs59626274는 서열번호 10의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs59626274의 염기의 대립형질은 C 또는 T일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs59626274의 염기의 대립형질이 T이거나 그의 상보적인 염기의 대립형질이 A인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs59626274가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.71)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.
본원의 일 구현예에 따르면, 상기 SPCS3 유전자의 SNP인 rs17688188는 서열번호 11의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs17688188의 염기의 대립형질은 G 또는 A일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs17688188의 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs17688188가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.73)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.
본원의 일 구현예에 따르면, 상기 LINGO2 유전자의 SNP인 rs56942085는 서열번호 12의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs56942085의 염기의 대립형질은 G 또는 A일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs56942085의 염기의 대립형질이 G이거나 그의 상보적인 염기의 대립형질이 C인 경우, 뇌동맥류가 발병한 것으로 진단하거나 발병 위험을 높은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs56942085가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.78)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.
본원의 일 구현예에 따르면, 상기 MINK1 유전자의 SNP인 rs72835045는 서열번호 13의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs72835045의 염기의 대립형질은 G 또는 A일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs72835045의 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs72835045가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.79)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 SNP 마커 조성물은 LOX(lysyl oxidase) 유전자 중의 서열번호 14의 서열의 205번째 염기(rs2303656)를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드, 서열번호 15의 서열의 488번째 염기(rs3900446)를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드, 서열번호 15의 서열의 678번째 염기(rs763497)를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드, 및 이들의 조합을 추가로 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 실시예에 따르면, 상기 서열번호 14의 205번째 염기의 대립형질이 T이거나 그의 상보적인 염기의 대립형질이 A인 경우가 상기 서열번호 14의 205번째 염기의 대립형질이 G이거나 그의 상보적인 염기의 대립형질이 C인 경우보다 뇌동맥류의 발병 위험이 낮다고 예측할 수 있다.
본 발명의 일 실시예에 따르면, 상기 서열번호 15의 488번째 염기의 대립형질이 G이거나 그의 상보적인 염기의 대립형질이 C인 경우가 상기 서열번호 15의 488번째 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T인 경우보다 뇌동맥류의 발병 위험이 높다고 예측하거나 뇌동맥류의 발병을 진단할 수 있다.
본 발명의 일 실시예에 따르면, 상기 서열번호 15의 678번째 염기의 대립형질이 G이거나 그의 상보적인 염기의 대립형질이 C인 경우가 상기 서열번호 15의 678번째 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T인 경우보다 뇌동맥류의 발병 위험이 높다고 예측하거나 뇌동맥류의 발병을 진단할 수 있다.
본 발명의 일 실시예에 따르면, 상기 서열번호 15의 488번째 염기의 대립형질이 G이거나 그의 상보적인 염기의 대립형질이 C이고, 상기 서열번호 15의 678번째 염기의 대립형질이 G이거나 그의 상보적인 염기의 대립형질이 C인 경우가 상기 서열번호 15의 488번째 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T이고, 상기 서열번호 15의 678번째 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T인 경우보다 뇌동맥류의 발병 위험이 높다고 예측하거나 뇌동맥류의 발병을 진단할 수 있다.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 SNP 마커 조성물은 SOX17(SRY-box 17) 유전자 중의 서열번호 38의 서열의 326번째 염기(rs1072737)를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드를 추가로 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 실시예에 따르면, 상기 서열번호 38의 326번째 염기의 대립형질이 C이거나 그의 상보적인 염기의 대립형질이 G인 경우가 상기 서열번호 38의 326번째 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T인 경우보다 뇌동맥류의 발병 위험이 높다고 예측할 수 있다.
본원의 일 구현예에 따른 상기 뇌동맥류 진단용 SNP 마커 조성물에 포함되는 SNP의 유전적 정보는 공지의 데이터 베이스에서 얻을 수 있으며, 그 예로 미국 국립생물정보센터 (National Center for Biotechnology Information; NCBI)의 GenBank 등이 있으나, 이에 제한되지 않는다.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 SNP 마커 조성물은 한국인 및 아시아인을 대상으로 뇌동맥류를 진단하는 데에 사용할 수 있으나, 이에 제한되는 것은 아니다.
본원의 일 실시예에 따르면, 상기 뇌동맥류 진단용 SNP 마커 조성물에 포함되는 SNP는 전장유전체 관련분석을 통해 개발된 것으로서, 상기 SNP의 대립형질을 확인함으로써, 뇌동맥류를 간단하고 효율적으로 진단할 수 있다.
본원 명세서 전체에서 사용되는 용어, "전장유전체 관련분석(Genome-wide association study; GWAS)"은 약 50만-200만개 단일염기다형성의 유전자형을 탐색하여 질병과의 연관성을 통계적으로 분석하는 방법을 일컫는 것으로서, 일본 이화학연구소의 Ozaki(2002) 그룹에서 최초로 시도된 연구 방법이다. 구체적으로, GWAS 연구는 환자와 건강한 사람의 DNA 또는 SNP를 비교 분석하는 방식으로 진행되며, 만약 질병을 갖고 있는 사람에게서 유전적 변이가 더 많이 발견된다면, 연구자들은 이 변이가 앓고 있는 질병과 '연관이 있다'고 본다. 현재, HapMap 프로젝트의 완성 및 마이크로어레이 기술의 급속한 발전으로, 유전자 다형성에 관한 전장유전체 스캔이 일상적인 작업이 되었고, 수백의 전장유전체 연관 분석이 성공적으로 수행되어, 심혈관 질환, 당뇨 등의 통상적인 질병과 관련된 다수의 공지되거나 신규한 유전자 변이체의 발견을 이끌고 있다. 또한, 이러한 기술은 다양한 질환의 진단과 관련된 유전자 다형성 식별에 대한 강력한 수단을 제공하고 있다.
본원의 제 2 측면은, ARHGAP32 유전자의 SNP인 rs371331393를 검출 또는 증폭할 수 있는 제제를 포함하는, 뇌동맥류 진단용 조성물을 제공한다. 제1측면과 중복되는 내용은 제2측면의 뇌동맥류 진단용 조성물에도 공히 적용된다.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 조성물은 1) GBA 유전자의 SNP인 rs75822236, 2) TCF24 유전자의 SNP인 rs112859779, 3) OLFML2A 유전자의 SNP인 rs79134766, 4) CD163L1 유전자의 SNP인 rs138525217, 5) CUL4A 유전자의 SNP인 rs74115822, 6) LOC102724084 유전자의 SNP인 rs75861150, 7) LRRC3 유전자의 SNP인 rs116969723, 8) RNF144A 유전자의 SNP인 rs6741819, 9) FLJ45964 유전자의 SNP인 rs59626274, 10) SPCS3 유전자의 SNP인 rs17688188, 11) LINGO2 유전자의 SNP인 rs56942085, 및 12) MINK1 유전자의 SNP인 rs72835045로 이루어진 군에서 선택되는 하나 이상의 SNP를 검출 또는 증폭할 수 있는 제제를 추가로 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본원 명세서 전체에서 사용되는 용어, "SNP를 검출할 수 있는 제제”는 상기 SNP 마커 조성물에 포함된 SNP 마커 또는 SNP에 특이적으로 결합하여 인식할 수 있도록 하거나 상기 SNP를 검출하여 증폭시킬 수 있는 제제를 의미하고, “SNP 마커를 증폭할 수 있는 제제”는 상기 SNP 마커 조성물에 포함된 SNP 마커 또는 SNP의 복제를 반복하여 그 수를 증가시킬 수 있는 제제를 의미하며, 예를 들어 상기 SNP를 포함하는 폴리뉴클레오티드를 특이적으로 증폭할 수 있는 프라이머 또는 특이적으로 결합할 수 있는 프로브를 의미하는 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 SNP 증폭에 사용되는 프라이머는, 적절한 버퍼 중의 적절한 조건(예를 들면, 4개의 다른 뉴클레오시드 트리포스페이트 및 DNA, RNA 폴리머라제 또는 역전사 효소와 같은 중합제) 및 적당한 온도 하에서 주형-지시 DNA 합성의 시작점으로서 작용할 수 있는 단일가닥 올리고뉴클레오티드가 될 수 있는데, 상기 프라이머의 적절한 길이는 사용 목적에 따라 달라질 수 있으나, 통상 15 내지 30 뉴클레오티드이다. 짧은 프라이머 분자는 일반적으로 주형과 안정한 혼성체를 형성하기 위해서는 더 낮은 온도를 필요로 한다. 상기 프라이머 서열은 상기 SNP를 포함하는 폴리뉴클레오티드와 완전하게 상보적일 필요는 없으나, 상기 SNP를 포함하는 폴리뉴클레오티드와 혼성화 할 정도로 충분히 상보적이어야 한다.
본원 명세서 전체에서 사용되는 용어 "프라이머"는, 짧은 자유 3' 말단 수산화기(free 3' hydroxyl group)를 가지는 염기 서열로 상보적인 템플레이트(template)와 염기쌍(base pair)을 형성할 수 있고 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 폴리머레이즈 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성을 개시할 수 있다. 이때, PCR 조건, 센스 및 안티센스 프라이머의 길이는 당업계에 공지된 것을 기초로 변형할 수 있다.
상기 SNP 검출에 사용되는 프로브는 혼성화 프로브를 의미하는 것일 수 있으며, 핵산의 상보성 가닥에 서열 특이적으로 결합할 수 있는 올리고뉴클레오티드를 의미한다. 혼성화 조건은 대립형질 간의 혼성화 강도에 있어서 유의한 차이를 보여 대립형질 중 하나에만 혼성화되도록 충분히 엄격해야 한다. 이러한 본 발명의 프로브는 중앙 부위가 다형성 서열의 다형성 부위와 정렬하는 것이 바람직하다. 이에 따라 서로 다른 대립형질성 형태 간에 좋은 혼성화 차이를 유발할 수 있다. 상기 프로브는 대립형질을 검출하여 뇌동맥류를 진단하기 위한 마이크로어레이 등의 키트나 예측 방법 등에 사용될 수 있다. 중요한 프로브는 검출할 수 있도록 표지될 수 있으며, 예를 들면 방사선 동위원소, 형광 화합물, 바이오 발광 화합물, 화학 발광 화합물, 금속 킬레이트 또는 효소로 표지될 수 있다. 상기와 같은 프로브를 적당하게 표지하는 것은 당해 분야에서 널리 알려진 기술이며, 통상적인 방법을 통하여 수행할 수 있다.
본원의 일 구현예에 따르면, 상기 프라이머 또는 프로브는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 상기 변형의 비-제한적인 예로는 메틸화, 캡화, 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체 (예: 메틸 포스포네이트, 포스포트리에스테르,포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체 (예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다.
본원의 일 구현예에 따르면, 상기 ARHGAP32 유전자의 SNP인 rs371331393는 서열번호 4의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs371331393의 염기의 대립형질은 G 또는 A일 수 있다.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 조성물은 LOX(lysyl oxidase) 유전자 중의 서열번호 14의 서열의 205번째 염기(rs2303656)를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드, 서열번호 15의 서열의 488번째 염기(rs3900446)를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드, 서열번호 15의 서열의 678번째 염기(rs763497)를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드, 및 이들의 조합을 검출 또는 증폭할 수 있는 제제를 추가로 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 조성물은 SOX17(SRY-box 17) 유전자 중의 서열번호 38의 서열의 326번째 염기(rs1072737)를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드를 검출 또는 증폭할 수 있는 제제를 추가로 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본원의 제 3 측면은, 상기 뇌동맥류 진단용 조성물을 포함하는, 뇌동맥류 진단용 키트를 제공한다. 제1측면 및 제2측면과 중복되는 내용은 제2측면의 뇌동맥류 진단용 키트에도 공히 적용된다.
본원의 일 구현예에 따르면, 상기 키트는 PCR 키트, RT-PCR 키트 또는 DNA 칩 키트일 수 있으나, 이에 제한되는 것은 아니다.
본원의 일 구현예에 따르면, 상기 키트는 본원의 SNP, 폴리뉴클레오티드, cDNA 등뿐만 아니라 분석 방법에 적합한 다른 구성 성분 조성물, 용액 또는 장치가 포함될 수 있다.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 PCT 키트는 PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. PCR 키트는, 상기 SNP 에 대한 특이적인 폴리뉴클레오티드, 프라이머 또는 프로브 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액 (pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드 (dNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNAse 억제제, DEPC-수 (DEPC-water) 및 멸균수 등을 포함할 수 있다.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 DNA 칩 키트는 DNA 칩을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있으며, DNA 칩 키트는 상기 SNP에 대한 특이적인 폴리뉴클레오티드, 프라이머 또는 프로브가 부착되어 있는 기판을 포함하고 기판은 정량 대조구 유전자 또는 그의 단편에 해당하는 핵산을 포함할 수 있다.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 RT-PCR 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있으며, RT-PCR 키트는, 상기 SNP에 대한 특이적인 각각의 프라이머 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 디옥시뉴클레오타이드(dNTPs), 디디옥시뉴클레오타이드(ddNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNAse 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다.
본원의 제 4 측면은, 개체로부터 분리된 생물학적 시료로부터, ARHGAP32 유전자의 SNP인 rs371331393의 대립형질을 결정하는 단계를 포함하는, 뇌동맥류 진단을 위한 정보 제공 방법을 제공한다. 제1측면 내지 제3측면과 중복되는 내용은 제4측면의 뇌동맥류 진단을 위한 정보 제공 방법에도 공히 적용된다.
본원의 일 구현예에 따르면, 본원의 뇌동맥류 진단은 뇌동맥류 발병을 진단하거나, 뇌동맥류 발병 위험을 예측하거나 또는 뇌동맥류의 예후를 진단하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본원 명세서 전체에서 사용되는 용어, "개체"는 뇌동맥류가 발병되거나 발병될 가능성이 있는 모든 생물체를 의미하며, 구체적인 예로, 마우스, 원숭이, 소, 돼지, 미니돼지, 가축, 인간 등을 포함하는 포유동물, 양식어류 등을 포함할 수 있으며, 이에 제한되는 것은 아니다.
본원 명세서 전체에서 사용되는 용어, "시료"는 뇌동맥류가 발병되거나 발병될 가능성이 있는 개체로부터 유래한 물질을 의미하며, 구체적으로 조직, 세포, 전혈, 혈청, 혈장, 타액, 객담, 뇌척수액, 소변 등을 포함할 수 있으며, 이에 제한되는 것은 아니다. 또한, 이들 시료로부터 유전자 시료를 얻을 수 있으며, 유전자 시료는 핵산, 예를 들어, DNA, mRNA, 또는 mRNA로부터 합성되는 cDNA 등을 포함할 수 있으며, 이로부터 SNP의 염기 정보를 확인할 수 있는 한, 그 종류는 이에 제한되는 것은 아니다.
본원의 일 구현예에 따르면, 상기 개체는 인간일 수 있으며, 구체적으로 한국인 또는 아시아인일 수 있으나, 이에 제한되는 것은 아니다.
본원의 일 구현예에 따르면, 상기 개체의 위험 예측 또는 진단을 수행하기 위해, 비유전적(non-genetic) 정보를 분석하는 단계를 더 포함하고, 상기 비유전적 정보는 성별, 연령, 고혈압, 당뇨, 고지혈증, 흡연, 동맥류의 가족력, 생화학적 척도 및 임상적 척도로 구성되는 군으로부터 선택되는 하나 이상일 수 있다.
본원의 일 구현예에 따르면, 상기 정보 제공 방법에서 SNP의 염기를 결정하는 단계는 SNP의 유전자형을 확인하는 단계를 의미하는 것일 수 있다. SNP의 유전자형을 확인하는 단계는, 시퀀싱 분석, 예를 들어, 자동염기서열분석기를 사용한 시퀀싱 분석, 파이로시퀀싱(pyrosequencing), 마이크로어레이에 의한 혼성화, PCR-RELP(restriction fragment length polymorphism)법, PCR-SSCP(single strand conformation polymorphism)법, PCR-SSO(specific sequence oligonucleotide)법, PCR-SSO법과 도트 하이브리드화법을 조합한 ASO(allele specific oligonucleotide) 하이브리드화법, TaqMan-PCR법, MALDI-TOF/MS법, RCA(rolling circle amplification)법, HRM(high resolution melting)법, 프라이머 신장법, 서던 블롯 하이브리드화법, 도트 하이브리드화법 등의 방법에 의하여 수행될 수 있다. 구체적으로, 본원의 정보 제공 방법에서 SNP의 염기를 결정하는 단계는, 예를 들어, 대상으로부터 얻은 시료로부터 분리한 핵산으로부터 SNP 부위를 포함하는 염기서열을 시퀀싱(sequencing)하고, SNP의 대립형질을 직접적으로 확인함으로써 수행될 수 있다. 염기서열의 시퀀싱은 당 업계에 공지된 방법을 통하여 수행될 수 있다. 예를들어, 염기서열의 시퀀싱은 개체로부터 얻은 시료로부터 분리한 핵산을 주형으로 하고, 각 SNP 부위를 포함하는 유전자 부위를 증폭할 수 있는 프라이머를 사용하여 PCR을 수행하는 단계, 및 상기 PCR 반응물을 제한효소 절단방법으로 그 서열을 확인하는 단계를 순차적으로 수행함으로써 이뤄질 수 있다.
본원의 일 구현예에 따르면, 상기 ARHGAP32 유전자의 SNP인 rs371331393는 서열번호 4의 26번째 뉴클레오타이드를 포함하는 것일 수 있고, 상기 rs371331393의 대립형질이 G인 경우, 뇌동맥류가 발병한 것으로 진단하거나 발병 위험을 높은 수준으로 예측하는 단계를 추가로 포함하는 것일 수 있다.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단을 위한 정보 제공 방법은 개체로부터 분리된 생물학적 시료로부터, 1) GBA 유전자의 SNP인 rs75822236, 2) TCF24 유전자의 SNP인 rs112859779, 3) OLFML2A 유전자의 SNP인 rs79134766, 4) CD163L1 유전자의 SNP인 rs138525217, 5) CUL4A 유전자의 SNP인 rs74115822, 6) LOC102724084 유전자의 SNP인 rs75861150, 7) LRRC3 유전자의 SNP인 rs116969723, 8) RNF144A 유전자의 SNP인 rs6741819, 9) FLJ45964 유전자의 SNP인 rs59626274, 10) SPCS3 유전자의 SNP인 rs17688188, 11) LINGO2 유전자의 SNP인 rs56942085, 및 12) MINK1 유전자의 SNP인 rs72835045로 이루어진 군에서 선택되는 하나 이상의 SNP의 대립형질을 결정하는 단계를 추가로 포함하는 것일 수 있다.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단을 위한 정보 제공 방법은 1) GBA 유전자의 SNP인 rs75822236의 대립형질이 C인 경우, 2) CD163L1 유전자의 SNP인 rs138525217의 대립형질이 C인 경우, 3) CUL4A 유전자의 SNP인 rs74115822의 대립형질이 G인 경우, 4) LINGO2 유전자의 SNP인 rs56942085의 대립형질이 G인 경우, 또는 이들 중 둘 이상의 조합인 경우, 뇌동맥류가 발병한 것으로 진단하거나 발병 위험을 높은 수준으로 예측하는 단계를 추가로 포함하는 것일 수 있다.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단을 위한 정보 제공 방법은 1) TCF24 유전자의 SNP인 rs112859779의 대립형질이 T인 경우, 2) OLFML2A 유전자의 SNP인 rs79134766의 대립형질이 A인 경우, 3) LOC102724084 유전자의 SNP인 rs75861150의 대립형질이 C인 경우, 4) LRRC3 유전자의 SNP인 rs116969723의 대립형질이 A인 경우, 5) RNF144A 유전자의 SNP인 rs6741819의 대립형질이 T인 경우, 6) FLJ45964 유전자의 SNP인 rs59626274의 대립형질이 T인 경우, 7) SPCS3 유전자의 SNP인 rs17688188의 대립형질이 A인 경우, 8) MINK1 유전자의 SNP인 rs72835045의 대립형질이 A인 경우, 또는 이들 중 둘 이상의 조합인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측하는 단계를 추가로 포함하는 것일 수 있다.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단을 위한 정보 제공 방법은 개체로부터 분리된 생물학적 시료로부터, LOX 유전자 중의 서열번호 14의 서열의 205번째 염기(rs2303656), 서열번호 15의 서열의 488번째 염기(rs3900446), 서열번호 15의 서열의 678번째 염기(rs763497) 및 이들의 조합의 대립형질을 확인하는 단계를 추가로 포함하는 것일 수 있다.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단을 위한 정보 제공 방법은 개체로부터 분리된 생물학적 시료로부터, SOX17 유전자 중의 서열번호 38의 서열의 326번째 염기(rs1072737)의 대립형질을 확인하는 단계를 추가로 포함하는 것일 수 있다.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단을 위한 정보 제공 방법에서상기 SNP 다형성의 결과들은 당업계에서 일반적으로 사용되는 통계학적 분석 방법을 이용하여 통계처리 할 수 있으며, 예를 들어, 스튜던트 t-검정(Student's t-test), 카이-스퀘어 검정(Chi-square test), 선형 회귀선 분석(linear regression line analysis), 다변량 로지스틱 회귀분석(multiple logistic regression analysis), 메타 분석(meta-analysis) 등을 통해 얻은 연속 변수(continuous variables), 절대 변수 (categorical variables), 대응비(odds ratio, OR) 및 95% 신뢰구간(confidence interval, CI) 등의 변수를 이용하여 분석할 수 있다.
이하 본원을 실시예 및 실험예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예 및 실험예는 본 발명을 예시적으로 설명하기 위한 것으로 본원의 범위가 이들 실시예 및 실험예에 한정되는 것은 아니다.
<1. 13개의 뇌동맥류 진단용 SNP 마커 개발>
실시예 1: 실험군 및 대조군 수집
본 발명을 수행하기 위한 코호트(cohort)는 춘천 성심병원 뇌졸중 데이터베이스(2015-2018)로부터 유래되었으며, 데이터베이스 수집을 위해, 출혈성 또는 허혈성 뇌졸중과 일치하는 임상적 진단 및 신경영상을 나타내는 환자를 모집했으며, GWAS 연구에서, 낭형(saccular) 및 산발성(sporadic) 뇌동맥류를 갖는 18세 이상의 환자를 분석하였다. 또한, 추형, 해부학, 외상성, 및 전염성 동맥류, 및 가족성 동맥류와 같은, 비낭형 동맥류는 제외하였다.
대조군은 다음과 같은 기준을 만족시켰다: 1) 두통 진단 또는 건강 검진을 위해 전산화 단층 촬영 또는 자기 공명 혈관 조영술을 받은 환자, 2) 뇌동정맥기형, 두개내 출혈 또는 경색과 같은 신경질환이 수반되지 않음, 3) 가까운 친척에게서 뇌동맥류 또는 지주막하 출혈에 대한 가족력이 없음, 4) 파킨슨병 또는 알츠하이머병이 없음, 및 5) 18세 이상.
또한, 성별, 연령, 비파열 뇌동맥류 또는 지주막하 출혈과 같은 임상 증상, 고혈압, 당뇨, 고지혈증, 흡연, 동맥류의 가족력 등 여러 변수를 고려하여 의료 기록을 검토하였으며, 동맥류의 크기, 위치(전방 순환 또는 후방 순환), 및 수(단수 또는 복수)에 대한 혈관조영 변수를 검토하였다. 본 연구는 춘천 성심 병원의 임상 시험 위원회에 의해 승인되었다(No. 2016-3, 2017-9).
실시예 2: 유전자형 분석(Genotyping) 및 샘플 품질 관리(sample quality control)
게놈 DNA는 HiGeneTM Genomic DNA Prep Kit (BIOFACT, 대전, 한국)를 이용하여 실험군 및 대조군의 말초혈액으로부터 수득하였다. 상기 샘플들의 유전자형 분석을 위해, 인간 게놈 version 19(build 37)을 기반으로 하고, 동남아시아 인구를 포괄하며, 5만개의 신규한 마커를 포함하는 75만개 SNP가 포함된 AxiomTM Asia Precision Medicine Research Array (PMRA) 키트 (Thermo Fisher Scientific, MA, USA)를 사용하였다. 작은 삽입/결실(indels)를 포함하는 798,148개의 변이 중 508,192개의 변이가 다음 기준의 품질 평가 검정을 통과하였고(유전자형 call rate = 95%, 마이너 대립유전자 빈도(MAF) = 0.01, 및 하디-바인버그 평형(HWE) p-값 = 1Х10-6), 통과된 변이를 이용하여 GWAS를 수행하였다.
실시예 3: 통계적 분석
기술적 분석(Descriptive analysis)은 개별형 및 범주형 변수의 주체수(백분율)를 사용하여 표시되며, 평균은 표준 오류로 표시된다. 본 발명에서는 2가지 누락된 값을 제거한 후에, 250명의 뇌동맥류 환자 및 294명의 대조군에 대해 7개의 교란 인자(성별, 나이, 고혈압, 당뇨, 고질혈증, 흡연 및 4개의 주요 요인)를 갖는 다변량 기호 논리학 해석(multivariate logistic analysis)을 수행하였으며, 상기 분석은 STATA v11.2 (Stata Corp., TX, USA)을 이용하여 수행하였다. 또한 전장유전체 관련 분석은 상기 7개의 교란 인자를 조정한 후, 추가 유적적 효과 모델 하에서 뇌동맥류 감수성에 대한 후보 유전 변이를 확인하기 위해 수행하였으며, PLINK 1.9 프로그램(https://www.cog-genomics.org/plink/1.9/)을 이용하였다.
또한, GWAS에서의 잠재적인 유전적 신뢰성을 평가하기 위한 통계적 유의성(statistics power)을 산정하기 위해, 하기와 같은 가정에 근거하여, Genetic Power Calculator (http://pngu.mgh.harvard.edu/~purcell/gpc/)을 사용하였다: 5% 확률의 뇌동맥류 발병; 부가적 효과 모델(additive effect model)에서의 오즈비(odds-ratio, OR); D-prime 0.8; 1:1.18의 실험군-대조군 비율; 및 5Х10-8(전장유전체 유의 수준)의 타입 1 에러 비율.
추가적으로, 차후의 분석에서 151명의 지주막하출혈 및 99명의 비파열성 뇌동맥류 환자 사이의 유전적 연관성을 평가하였으며, GWAS에서 전장유전체의 연관성을 나타내는 개별 변이체의 발현 수준에 대한 유전적 영향을 평가하기 위해, Genotype-Tissue Expression (GTEx v7) (https://gtexportal.org/home/)을 이용하여 단일 조직 발현 양적형질 유전자좌(expression quantitative trait loci, eQTL)를 분석하였다. 맨하탄 플룻(Manhattan plot) 및 지역 관련 플룻(regional association plot)은 각각 R 패키지 v3.4.0의 "qqman" 명령어(https://cran.r-project.org/web/packages/qqman) 및 LocusZoom v1.3 (http://locuszoom.org/)을 이용하였다.
실험예 1: 실험군 및 대조군의 구체적 특성 확인
실시예 1에 기재된 기준으로 환자(실험군) 및 대조군(비환자)을 분류하였으며, 이의 특성은 하기 표 1에 기재되어 있다. 구체적으로, 546명 중, 250명은 뇌동맥류(intracranial aneurysm, IA) 환자로 분류되었고, 나머지 296명은 비환자(대조군)로 분류되었다. 상기 두 그룹간에 성별, 고혈압(Hypertension, HTN), 당뇨병(Diabetes mellitus, DM), 고지혈증(hyperlipidemia) 및 흡연에 따른 통계적 차이는 없었고, 대조군은 뇌동맥류 환자보다 젊었다(p < 0.001). 상기 뇌동맥류 환자 중 지주막하 출혈(subarachnoid hemorrhage, SAH) 및 비파열성 뇌동맥류(unruptured intracranial aneurysm, UIA)가 발생한 환자는 각각 151명(60.4%) 및 99명(39.6%)였다. 또한, 뇌동맥류 환자 중 대부분은 전방순환동맥류(Anterior-circulation aneurysms)였고(n=221, 88.4%), 상기 전방순환동맥류는 중대뇌동맥(middle cerebral artery)(n=71), 전교통동맥(anterior communicating artery) 또는 전대뇌동맥(anterior cerebral artery) (n=50), 내경동맥(internal carotid artery)(n=38) 및 후교통동맥(posterior communicating artery)(n=53)으로 나타났다.
변수a | 실험군 (n = 250) | 대조군 (n = 296) | Pb |
여성, 명(%) | 146 (58.4) | 154 (52.0) | 0.74 |
연령, 세 | 59.3±0.8 | 52.1±1.0 | < 0.001 |
고혈압(Hypertension), 명(%) | 93 (37.2) | 88 (29.7) | 0.865 |
당뇨(Diabetes mellitus), 명(%) | 17 (6.8) | 37 (12.5) | 0.001 |
고지혈증(Hyperlipidemia), 명(%) | 29 (11.6) | 27 (9.1) | 0.476 |
흡연(Cigarette smoking), 명(%) | 26 (10.4) | 37 (12.5) | 0.615 |
주요 요소(Principal components), 평균c | |||
주요 요소 1 | 0.0014 | -0.0012 | 0.169 |
주요 요소 2 | -0.0002 | 0.0001 | 0.656 |
주요 요소 3 | -0.0010 | 0.0008 | 0.039 |
주요 요소 4 | -0.0011 | 0.0009 | 0.031 |
파열 상태(Rupture status), N (%) | |||
비파열성 뇌동맥류(UIA) | 99 (39.6) | - | - |
지주막하 출혈(SAH) | 151 (60.4) | - | - |
* a: 표의 데이터는 환자의 수(%) 및 평균 ± 표준오차로 표현함
* b: P 값은 다변량 논리학적 회귀 모델에서 평가됨.
* c: 주요 요소는 4개의 클러스터로 주요 요소 분석을 수행하여 추정됨.
실험예 2: 전장유전체 연관분석(GWAS) 결과 분석
뇌동맥류 발병과 관련된 SNP 마커를 발굴하기 위해 하기와 같은 실험을 수행하였다.
먼저, 상기 실험예 1에서 확인한 실험군 및 대조군에서 교란 요인(나이, 성별, 고혈압, 당뇨, 고지혈증, 흡연) 및 4가지 주요 요소(principal components)를 조정한 후, 전장유전체 연관분석(genome-wide association study, GWAS)을 통해, p-값이 1Х10-5 미만의 암시적 연관성을 나타내는, 총 315개의 SNP(indel 포함)를 선별하였다(도 2).
다음으로, 상기의 315개의 SNP 중 pairwise 연관불균형(linkage disequilibrium)이 0.8 미만인 SNP를 제거하였고, 전장유전체 유의적 임계적(genome-wide significance threshold)인 5 x 10-8 미만의 p-값을 나타내는 총 29개의 SNP를 선별하였다. 선별된 SNP의 구체적인 내용은 하기 표 2에 기재하였다.
유전자 | 염색체. | SNP | 클래스(class) | M/ma | MAFb | ORc | L95c | U95c | Pc | 통계적유의성d |
PRDM2 | 1p36.21 | rs61775135 | intron | C/A | 0.16/0.41 | 0.32 | 0.23 | 0.43 | 3.6E-13 | 0.42 |
GBA | 1q22 | rs75822236 | R535H | C/T | 0.33/0.01 | 161.40 | 53.86 | 483.60 | 1.1E-19 | 1.00 |
FMO4 | 1q24.3 | rs3737926 | F281F | C/T | 0.16/0.37 | 0.36 | 0.27 | 0.50 | 1.8E-10 | 0.32 |
RNF144A | 2p25.1 | rs6741819 | intron | C/T | 0.13/0.37 | 0.25 | 0.18 | 0.36 | 4.0E-14 | 0.72 |
FLJ45964 | 2q37.3 | rs59626274 | stop-gained | C/T | 0.13/0.36 | 0.26 | 0.18 | 0.37 | 5.8E-14 | 0.71 |
LINC01237 | 2q37.3 | rs78458145 | intron | G/A | 0.17/0.4 | 0.24 | 0.17 | 0.35 | 3.1E-15 | 0.68 |
SPCS3 | 4q34.2 | rs17688188 | intergenic | G/A | 0.11/0.33 | 0.27 | 0.19 | 0.38 | 6.0E-13 | 0.73 |
TCF24 | 8q13.1 | rs112859779 | G141S | C/T | 0.1/0.33 | 0.19 | 0.12 | 0.28 | 3.3E-16 | 0.94 |
C9orf92 | 9p22.3 | rs12350582 | intergenic | A/G | 0.33/0.18 | 2.43 | 1.79 | 3.31 | 1.5E-08 | 0.20 |
LINGO2 | 9p21.1 | rs56942085 | intron | G/A | 0.1/0.03 | 6.11 | 3.20 | 11.64 | 3.9E-08 | 0.78 |
TMOD1 | 9q22.33 | rs1052270 | intron | C/T | 0.27/0.42 | 0.41 | 0.30 | 0.56 | 2.7E-08 | 0.15 |
SUSD1 | 9q31.3 | rs79461840 | intron | T/C | 0.13/0.02 | 6.92 | 3.55 | 13.49 | 1.4E-08 | 0.65 |
LINC00474 | 9q33.1 | rs4979583 | intergenic | C/T | 0.41/0.24 | 2.45 | 1.82 | 3.31 | 4.6E-09 | 0.24 |
OLFML2A | 9q33.3 | rs79134766 | A208T | G/A | 0.07/0.37 | 0.14 | 0.09 | 0.21 | 1.7E-19 | 0.96 |
MYEOV | 11q13.3 | rs76855873 | intron | C/T | 0.16/0.37 | 0.33 | 0.24 | 0.46 | 1.2E-11 | 0.43 |
ARHGAP32 | 11q24.3 | rs371331393 | stop-gained | G/A | 0.32/0.02 | 43.57 | 21.84 | 86.95 | 9.3E-27 | 1.00 |
CD163L1 | 12p13.31 | rs138525217 | splice-site | C/T | 0.31/0.01 | 75.98 | 32.13 | 179.70 | 6.2E-23 | 1.00 |
SLC2A14 | 12p13.31 | rs118107419 | intron | C/A | 0.14/0.39 | 0.25 | 0.17 | 0.35 | 1.4E-14 | 0.67 |
DRAM1 | 12q23.2 | rs7964241e | intergenic | A/G | 0.35/0.21 | 2.49 | 1.81 | 3.42 | 2.0E-08 | 0.25 |
CUL4A | 13q34 | rs74115822 | intergenic | G/A | 0.19/0.03 | 6.25 | 3.58 | 10.90 | 1.1E-10 | 0.80 |
LINC02130 | 16p13.12 | rs11646803 | intron | C/T | 0.28/0.48 | 0.45 | 0.35 | 0.58 | 4.8E-10 | 0.06 |
LOC102724084 | 16q23.2 | rs75861150 | intron | T/C | 0.02/0.16 | 0.14 | 0.07 | 0.28 | 1.3E-08 | 1.00 |
SCARF1 | 17p13.3 | rs3744644 | E639D | G/C | 0.18/0.35 | 0.39 | 0.28 | 0.54 | 6.0E-09 | 0.26 |
MINK1 | 17p13.2 | rs72835045 | intron | G/A | 0.11/0.33 | 0.25 | 0.17 | 0.37 | 1.7E-12 | 0.79 |
SLC47A1 | 17p11.2 | rs2440154e | intron | G/A | 0.28/0.13 | 2.67 | 1.90 | 3.75 | 1.4E-08 | 0.26 |
NAPA-AS1 | 19q13.32 | rs55800589 | intron | G/C | 0.32/0.4 | 0.38 | 0.29 | 0.49 | 3.4E-13 | 0.23 |
DSCAM | 21q22.2 | rs727333 | intron | C/A | 0.14/0.38 | 0.26 | 0.18 | 0.36 | 3.7E-14 | 0.69 |
LRRC3 | 21q22.3 | rs116969723 | P63P | G/A | 0.11/0.35 | 0.24 | 0.16 | 0.34 | 3.8E-15 | 0.81 |
SLC5A4-AS1 | 22q12.3 | rs117398778 | intron | T/C | 0.21/0.07 | 3.74 | 2.43 | 5.75 | 2.0E-09 | 0.56 |
* L95, lower 95% confidence interval; OR, odds ratio; U95, upper 95% confidence interval.
* a: M/m, 주 대립형질(major allele type)/부 대립형질(minor allele type)
* b: MAF, 실험군(왼쪽) 및 대조군(오른쪽)의 대립유전자형빈도(minor allele frequency)
* c: OR, 95% 신뢰구간 및 P-값은 연령, 성별, 고혈압, 당뇨병, 고지혈증, 흡연 및 4가지 주요 요소를 보정한 후, 다변량 논리학적 회귀 분석에서 추정됨.
* d: 각 SNP의 통계적 유의성(power)은 웹-기반의 Genetic Power Calculator (http://zzz.bwh.harvard.edu/gpc/cc2.html)을 이용하여 추정되었고, 하기의 파라미터를 사용하였다: 5% 확률의 뇌동맥류 발병, 대조군에서의 MAF, 부가적 효과 모델에서의 OR, D-prime 0.8; 1:1.18의 실험군-대조군 비율(대조군 296명/실험군 250명 = 1.18), 및 5Х10-8(전장유전체 유의 수준)의 타입 1 에러 비율.
* e: pairwise 연관 불균형(LD, r
2 < 0.8)에서 나타난 1개의 SNP: rs7964241 및 rs56168082 (r
2 =0.81); rs2440154 및 rs2289668 (r
2 = 1.0)
구체적으로, ARHGAP32 (11q24.3) 상에 위치하는 rs371331393가 뇌동맥류 형성에 있어서 가장 유의미한 연관성을 나타냈으며(OR = 43.57, 95% 신뢰구간 21.84-86.95; p = 9.3Х10-27) (도 3), GBA 유전자 상에 위치하는 rs75822236 SNP 또한 뇌동맥류 형성에 있어서 유의미한 연관성을 나타냈으며(OR = 161.46, 95% CI 53.86-483.60; p = 1.1 Х10-19), 상기 변이의 경우, 대조군에서의 "T" 대립형질은 뇌동맥류 환자에서의 "C" 대립형질에 비해 희귀했다(MAF = 0.01 vs 0.33). 또한, CD163L1 유전자 3' 비번역 부위(untranslated region, UTR) 상에 위치한 rs138525217 SNP에서의 "T" 대립형질은 드물게 나타나며, 큰 효과 크기(effect size)를 보여준다(MAF 실험군/대조군 = 0.31/0.01, OR = 75.98; p = 6.2Х10-23).
또한, 추가적으로 4개의 SNP[rs75822236 (R535H, GBA, 1q22), rs112859779 (G141S, TCF24, 8q13.1), rs79134766 (A208T, OLFML2A, 9q33.3), rs3744644 (E639D, SCARF1, 17p13.3)] 및 추가적인 넌센스 SNP인 rs59626274 (stop-gained, FLJ45964, 2q37.3)은 서열상에 암호화된 단백질과 잠재적인 직접적 연관성이 있음을 확인하였다.
결론적으로, 뇌동맥류 발병과 관련하여, GBA, TCF24, OLFML2A, ARHGAP32, CD163L1, CUL4A, LOC102724084, 및 LRRC3 유전자 상에 위치한 SNP는 0.8 이상의 통계적 유의성을 나타내며, RNF144A, FLJ45964 SPCS3, LINGO2, MINK1 유전자 상에 위치하는 SNP는 0.7 내지 0.8의 통계적 유의성을 나타내는 바, 상기 13개의 SNP를 이용하여 뇌동맥류의 발병 위험을 예측하거나 발병 여부를 진단하는 데 유용하게 이용할 수 있다.
실험예 3: 단일-세포 eQTL 분석
상기 실험예 2에서 선별한 SNP 마커의 조직에서의 발현여부를 확인하기 위해 하기와 같은 실험을 수행하였다.
구체적으로, 45개의 인간 조직으로부터 얻은 70개 이상의 샘플을 이용한 단일-세포 eQTL(single-cell eQTL) 분석에서, 3개의 SNP가 발현상의 유의미한 차이를 나타냈다(p < 1Х10-5). 구체적으로, rs6741819 (RNF144A, 2p25.1; p = 4.0Х10-14)는 부신 조직에서 하향-조절되었고(175개 샘플, effect size = -0.36, p = 1.5Х10-6) (도 4A, B), rs1052270 (TMOD1. 9q22.33; p = 2.7Х10-8)는 고환 조직에서 상향-조절되었다(225개 샘플, effect size = 0.42, p = 8.6Х10-10) (도 4C, D).
또한, rs6841581 (EDNRA, 4q31.22; p = 6.5Х10-4)는 식도(점막) (358개 샘플, effect size = 0.38, p = 5.2Х10-12) 및 햇빛에 노출되지 않은 피부(치골상부) (335개 샘플, effect size = 0.21, p = 1.2Х10-6) 모두에서 상향-조절되었다(도 5).
<2. LOX(Lysyl oxidase) 유전자의 SNP 이용한 뇌동맥류 진단>
실시예 1. 연구 대상
단일 기관에서 방사선학적으로 낭형(saccular shape)을 갖는 것으로 확인된 뇌동맥류 환자군 80명과, 환자군의 환자의 나이 및 성별과 매칭된 대조군 80명을 모집하였다. 상기 뇌동맥류에서, 방추형 또는 해부학 비낭성 동맥류 및 외상성 또는 전염성 동맥류는 제외하였다. 대조군은, 동정맥 기형, 두개내 출혈 또는 경색 등과 같은 다른 신경계 질환을 제외한, 두통 진단 또는 건강 검진을 위해 전산화 단층 촬영 또는 자기 공명 혈관 조영술을 받은, 매칭된 환자들로 구성하였다. 성별, 연령, 비파열 뇌동맥류 또는 지주막하 출혈과 같은 임상 증상, 고혈압, 당뇨, 고지혈증, 흡연, 동맥류의 가족력 등 여러 변수를 고려하여 의료 기록을 검토하였다. 동맥류의 크기, 위치(전방 순환 또는 후방 순환), 및 수(단수 또는 복수)에 대한 혈관조영 변수를 검토하였다. 본 연구는 춘천 성심 병원의 임상 시험 위원회에 의해 승인되었다(No. 2016-31).
검토 결과, 뇌동맥류 환자군에서, 여성의 수는 43명(53.8%)이었고, 평균 연령은 57.1 ± 12.9세였다. 지주막하 출혈 증상은 41명(51.3%)의 환자에게서 나타났다. 동맥류 위치와 관련하여, 전방순환동맥류(n = 73, 91.3%)가 다음과 같이 기록되었다: 내경동맥, n = 15; 전교통동맥 또는 전대뇌동맥, n = 21; 중간대뇌동맥, n = 25; 및 후교통동맥, n = 12. 단일 동맥류가 있는 환자는 75명(93.8%)이었으며, 지주막하 출혈의 가족력이 없는 환자는 없었다. 두 군간에 고혈압, 당뇨, 고지혈증 및 흡연의 발생률은 유의하게 다르지 않았다.
실시예 2. 단일염기 다형성 선택 및 검사
LOX 유전자 상의 단일염기 다형성과 뇌동맥류 발병 가능성의 연관성을 조사하기 위하여, 대립형질에 대한 SNPinfo(https://snpinfo.niehs.nih.gov/)의 LD TAG SNP 셀렉션(TagSNP)로부터의 일본 및 중국(JPT+CHB) HapMap 데이터베이스(Phase II)에서 연관불균형(linkage disequilibrium, LD; r2 < 0.8)을 적용한 후, LOX 유전자의 5'-상류와 3'-하류 사이에 위치한 10개의 태그(tag) SNP를 선택하였다(서열번호 14 내지 서열번호 21 참조).
SNP | 서열 | 서열번호 |
rs2303656 | 5'-TACGCATGATGTCCTGTGTAGCGAATGTCACAGCGCACAACATTGTTGGTATAGTCAGATTCAGGAACCAGGTAGCTGGGGTTTACACTGACCTGGGCAACACAAAGAGTTCCTCAGTATTTCTTTTTCCATAGGGCTACAATAAGGAAATTGTTAATGAGGACTTAGCTAAATCAAGCAGGGAAGGGATTTTAACTTAAGTAA [G/T] TGGTTAAACTCTGGAGACGTTATGGAAAGAGACTGCATATTTTCCCCTGAAGTTCTTTAAAATAAGACAGATTAGATTAGATTAGATTGTTTATAAATAGTTTGAGGATGTATAATTGCTTCCAATACCATGATTATTTAACATTTGAATCCAGAGAAGAGGGCCTATTGATCTGCAATATCAATATATGATATATTTTCAAAGGTCTTTACCTTTAGGATATAGTTTCCAGGTTTTACATCTGTAATATCAATCCACTGGCAGTCTATGTCTGCACCATAGGTATCATAACAGCCAGG-3' | 14 |
rs3900446a 및 rs763497b | 5'-GAGCATGCAACCTAAATCCCTCATATGCACAGTTCACAATGGGGTTCACGCTCATATGAGAATCTAATGCCATGATTGATCTGACAGGAAGCAAAGCTCAGGTGGTAATGTGAGGAAAGAGGATCTTGGTAAACATGCTATTGTAAGTTTAATGTCTCTACTCCCCTTCCGAGAACCCCATGTCTCCTTACTGGGAAACTTCAAGTCAAATGGTTTTAGGATTTACTGACAGAGGTTACTTGCTAGTATGAATTTGAGAAATTCATGGGAGGTACCTCACCAGGAACCCAAAAAATGGAATTTTTGACGTGGGGAGTGTCTGTAAATACAGATGAAGCTTCACTTGCTGGCCCACTGCTCACCTCCTGCTGTGCAGCCCAGTTCCTAACAGGGATGGTACTGGTCCGTGTCCTGGGGTTTGGGAACCACTGGTTTATTGAAAAGACATTCTGCTGGGTTGGTATGGAGCCCAAGTTATATTTGGGTT [A/G] aCACATTAGGGACTACTTCTTGTGATTTTGAGCCTAAATTATAATAAACTCTAGATATACACACCCTATGCCTATCAGAATAGTAATGAAGGGGTAAATGGCCCCCAACACAAGTGGCAATGGTTTTTGGAATAATACCAAAAGCCAACGAAATGTGATGGAGATTTACTGAAGCTAAGC [A/G] bTTAATTTTGGGGATAGGATGTTCTCGATGTAGGCCTAGATGTATGCAGCATCGTGTAAGGCTATCTATTAAAGAAGTCTAAAAAATTCACTTGTGATATTGAGTCATAAAGTTGGTTTTTAATCCATTCTCAACAGACTCTCAATTT-3' | 15 |
rs10040971 | 5'-TCTAGCTCAGGGCATCAACAAACAGTACAAAAATGAGAGTGCAAATGAATAAATAAATGGAGAATGGATGAATAAATTAAGGAATTATAAAAATTAAGAAAAAACTAATCTGTTTATTTAAGTGCAAATTATTTTAGCTTAAATTATAATGGTGTTCTGGCGGTGGGGGTCGGGGGTTGGTTCTACTATAACCAACTCCACACAATATGGGCCATAAAACCTGCCAGGTTTTCTGTGCTGTGGGCATGTTCAGAAGAATGTATGTGACTCTGTTTTTTCAGTGCTATCCTTTTGCTATCACAGGCTTCATCTATCTCTAA [T] GTTGTGACAACACTTGTAAAGCACAGTCTCTGCTTCTTTATGTAGAAAGTCCTGGGTTTTTGTATCAGGCAGAAATTTCTATTAATTATGAGATTCTAGTATAGCTCTGCTATACCTGTCTGTATGATCCAGTGGCACTGGTGGTTCTCCAGTGACAAAGCAAAGCTGATGAGTGTTGAGTATCATTCCAATGGAAATAGTATTCTCATTGTTGGGAAGGCATAACTCAAGTGGCATATGTAATTATAATCTAGCACCCAGCAACACTTGGGGAGGTAGTGC -3' | 16 |
rs17148773a 및 rs3792801b | 5'-AATAGGCAGAAACTGGACCAAAGCTAATCAATCAAATATTACTGTCTTTAAATGTGACCATAGATCTTCATGTAAGGAAGTGAAAATTCACTTATTCAAATCATAAACTACCAATTTCCAAACAGTAAATTCTGTGAGGAGAAAAAAAAAAACTTACATAGTATCTTATAACTGAAAGAAGCCTCAGAGTCACCTGGTC [C] aGTACATTTTGTTTCAGTGAGGAAAATGAAGGAGAGAGGGTACATTAACAGCACATACCTATTCAACTATTTACTGGGTGGCTTTTACACATCAACAGAATGCTCTTAAATATCTGGCAGGAAAAGCAATCAGTGAACTGATACATGATATGTCTTCAGAGTCACACTCACTGCTGCTTACACAGCCACCAGACTGACCTGATGGCCTTAGGCAAGTTACACTTCCTGCTCAAAAAGCTTCAGCCTCCCACTGCCTCCAGAATAAATTTTAGCCTGCTCTTCAGGGCTGTCTTCCATCTGGCTCAACTTACTTTTCCATCCTTTTTGTCCAACTCGTAACTCCACAAAATT [C] bATGCTTTAGCCAAACTAGAAGACTTGTTTTTCCAAACATGCCCTGCAGTTTCCTCCTGCCATGCAAGTTGCCTGTGACGTTGACTTGCCCTGGGCTTCCTTTCCTTAATGCTCCCCGGTGCATTCCCCAGACTTCAAGGCTCAA-3' | 17 |
rs10519694 | 5'-CTACATGAGGGGCTATTATCTCCATTTTATAGATGAGAAAACTAAGGCACACTAAGATCAAATAACTTACCCAAGGGTATCCAGCCTAGTAAGTGGCTAAGCTGGTTTTGAGTTTAGGTAATCAAGGTCCAGAGTCCCTGTTCTTAACTACCCCACTATACTCTCTCTCATACAGTCACTGAAATATGACATATTTTGTTGAAGGGGTAAATGCATGACTAAATTGATGAATGCCACATCACTCCACTTGCTAAAATATTCACATCAATAAGTAAATGAATG [C] CTTCTACAGGCTGGGAGGAGAAAAATATAACAAATACAATCCTTGCTTTTAAGAATGTTATAGTCTAGAGAAGTTTCCTCAGATTGGAGTCTGTAGGTATATTCTTGATTCCATTAGTTCTTCACAAAAAGTTTTAACTTGTATTTTTATTCTAATAGTAATTTAAATTCAAAGTACATGCTAGATTCATTTTAACTCAATACTGCCATTCAATTCTAGCAACCAATATTGCTTTGCTGTTTAAGATCACTTTGGTCACCCAAGAG-3' | 18 |
rs1800449 | 5'- CCGGGACTGCAAAGCAATGTGAAAAGGAAGCAGGAGGGGCCAGACGCGCGGTTTGCACTGGATTCCAGGGCTGCCACTGCAGGCGCGTGGGGGAGGGATCGGATCTGCGAGGACCGGGGCCCGCCGCGCCCAGGCAGCCACGTCGAGAAGCCACATAGCTGGGGACCAGGTGCACGGGTGCTTCCAGCGGACTTGGGGGTACTTACCGTACTGGAAGTAGCCAGTGCCGTATCCGGGCCGGTACCTGCCCCCAGGTCTGGGCCTTTCATAAGTATCGTAGTAGTTGTAATAAGGGTTGTCGTCAGAGTACTTGTAGGGGTTGTAAGGGTCGTCGCCCACCATGCCGTCCACGCGGCTGGGCGGC [C] GCAGGTTACTGAGCGCAGGAACTTCTCCCGGCGCTGTCTGGTTCTCCGCGCGCGAGGCGCCAGCTTCGCGGGCTCTAGATGTCGAGTAGCCAGCTTGGAACCAGTGACGGGCGGTGGGCCTGGGGCGGCCAGCGGTGACTCCAGATGAGCCGGCCGTCCGCGTTCGCGCCGCGGCGGTGCGGTTGTCGCGGATCAGCAGGATCGGAGTGCGGGGCTGCTGGGCGGAGGCGTTGGCTGCACCAGGGACGGCGGCGCCCGGGTCCCGGCGGCGCTGAGGCTGGTACTGTGAGCCCAGGCTCAGCAAGCTGAACACCTGCCCGTTGTTCTCCCATTGGATCTGC-3' | 19 |
rs2956540 | 5'- GATCTGGGCGGGAGTCAAATTATAATGTCCTTTTACAAATTAGGGTTTCATATGGAAATACTGACATAGATTTTAACTGACACGCATTTTCCAATGATAAAACATGCAAACTGCTTAGTTCAGCACTACTTTAAAAAAATCCATCCAAACAACATCTGACATCAATTATACTGTAGATTTAAATATATATGTGTGGAGAAAGAAATGGTGTCCTTCTGCTCTTATTTGCATTATTAAAAGAGGCAACTTTTTAAAGTGCTTTTAAAGAAACTTATTTTTCCTCCATTTGCTAACC [G] CAACCACTATTCTATTTTCAGCATAAAACAGAAGGAAGGAATGGTTTCACAGGTGAAAAAACAGAGATATCTTTTTTTACAGTTATTTACTAAGCCGGTTAAGGAATACAGAATGGGTGCATATGTTGTCAACCATTCAGACTTTTTCAGAGAGTAAATTTTTGTTCTTCATTGTGGACTGTAACAAGGACCCACACTGACCTGTGATC-3' | 20 |
rs3853401 | 5'- CTACCCTTTGTCACACATGCTAATGAAAAGCTTAGTTGATTTTCACTCTCCTTCATTTCCTCTAAAATCTCTCTGGCTTAGGACTCTGTCAGCTGAAAAACAAACATGTGGCTACCACATTTGGGGACAATACAGTGTTTGCAAGCCCTGCGGGAGATAATCTAGCCACACATTGTGTTCCCTGTTCAATAACAAAACTATTATTCACAAAATTGGAGAAACCATAGTTCCTTTCCACTCAAATCTGAGATGATAATGATGATGACAATAATAATAATAAGCCACGGCTACATCAAGATACAAACAGCTTTTTTTGCTTTGATAAGATCCACAGCTGATTTCACTTTTGACCATGAGATTTTCTTCTC [G] TGAACAATTCTGCAGTATGTGCCATAAGAGAAGGGAAGGAATGTTGCTAATTCTTTTTTTGAGTTTCTAGCCCATCAATATCAAATCTTTAAATGGCAATGTCTGGCCCATTGGCCAAGAAATGAAAGTTGTTGTAATGCTATGTTCCTGGTATTTGTTAAATACATTTATTTTTGTAGGACATTTCACATAAATGGAAAACAGAAAGCCGAAACCATAAAGCAGGGCCTCTGAATTGCAGAAGCCAGAACAGTAATGCCACATTCAAAGCAATCAGGTTCAAGTGTAAATTCTTTTGTTTGAGGCTCAAGAAGCTCATACAAAGCTTG-3' | 21 |
10개의 태그 SNP의 유전자형 분석(genotyping)을 위해, HiGeneTM Genomic DNA 프렙 키트(BIOFACT, 대전, 한국)를 이용하여, 피험자 160명의 말초 혈액으로부터 게놈 DNA를 추출하였다. 10개의 SNP 프라이머는 프라이머-3 v.0.4.0 프로그램(http://bioinfo.ut.ee/primer3-0.4.0/)을 사용하여 설계되었으며, 설계된 프라이머는 하기 표 4에 나타내었다.
SNP | 프라이머 | 서열 | 서열번호 |
rs2303656 | 정방향역방향 | 5'-CGCATGATGTCCTGTGTAGC-3'5'-TGGCTGTTATGATACCTATGGTG-3' | 2223 |
rs3900446, rs763497 | 정방향역방향 | 5'-CATGCAACCTAAATCCCTCAT-3'5'-TTGAGAGTCTGTTGAGAATGGA-3' | 2425 |
rs10040971 | 정방향역방향 | 5'-AGCTCAGGGCATCAACAAAC-3'5'-CTACCTCCCCAAGTGTTGCT-3' | 2627 |
rs17148773, rs3792801 | 정방향역방향 | 5'-AGGCAGAAACTGGACCAAAG-3'5'-AGCCTTGAAGTCTGGGGAAT-3' | 2829 |
rs10519694 | 정방향역방향 | 5'-CATGAGGGGCTATTATCTCCA-3'5'-TTGGGTGACCAAAGTGATCTT-3' | 3031 |
rs1800449 | 정방향역방향 | 5'-GGACTGCAAAGCAATGTGAA-3'5'-GATCCAATGGGAGAACAACG-3' | 3233 |
rs2956540 | 정방향역방향 | 5'-CTGGGCGGGAGTCAAATTAT-3'5'-CACAGGTCAGTGTGGGTCCT-3' | 3435 |
rs3853401 | 정방향역방향 | 5'-CCCTTTGTCACACATGCTAATG-3'5'-GCTTTGTATGAGCTTCTTGAGC-3' | 3637 |
상기 표 4의 프라이머와 SolgTM 2X Taq PCR Pre-Mix(Solgent, 대전, 한국)를 이용하여 중합효소 연쇄반응(PCR)을 수행하였다. 예비 변성은 95℃에서 5분간 수행되었고, 95℃에서 30초간 변성, 63℃에서 30초간 어닐링, 72℃에서 1분간 연장, 및 72℃에서 5분간 최종연장이 34사이클 수행되었다. 1.5% 아가로스 겔 전기 영동에 의해 증폭된 단편을 확인하고, SolgTM PCR 정제 키트(SolGent, 대전, 한국)로 정제한 후, ABI PRISM 3730XL 분석기(Applied Biosystems, 캘리포니아, USA)에 의해 각 서열을 분석하였다.
실시예 3. 통계 분석
크러스칼-왈리스(Kruskal-Wallis) 검정을 수행하여, 뇌동맥류 환자 80명 및 대조군 80명 사이의 비유전적 인자에 대한 차이를 평가했다. 피셔 정확검정은, 교차비(OR)를 추정하기 위해, 뇌동맥류와 LOX 유전자 근처 또는 LOX 유전자 상에 위치하는 10개의 SNP 사이의 대립 관계를 평가하기 위해 수행되었다.
후속 분석에서, 동맥류 파열에 따른 뇌동맥류 형성에의 LOX 유전자의 유전적 영향을 분석했다. 또한, h-1의 자유도(h는 SNP의 수에 따라 슬라이딩 윈도우에서 모든 가능한 일배체형의 수)를 포함하는, 점근선 카이-제곱 통계를 통해 일배체형-특이적 연관 분석을 사용한 옴니버스 검정을 수행하어 뇌동맥류와의 유의한 일배체형 연관성을 검정하였다. 상기 검정에서 10개의 SNP를 사용하여 가능한 조합의 0.01 미만의 마이너 일배체형 빈도(MHF)를 갖는 일배체형 구조를 제외하였다.
단일 SNP 및 일배체형 연관에서 각각 0.01 및 0.001의 다중 비교 보정 및 암시적 유효 p값을 시험한 후, 본페로니(Bonferroni)-보정된 유의한 p값을 0.005 미만 및 2.0 x 10-4 미만으로 적용하였다. 기술 및 단변수 분석은 STATA 소프트웨어 v.11.2(Stata Corp., College Station, 텍사스, 미국)에 의해 수행되었다. 유전자형 분류율(genotyping call rate, GCR), 마이너 대립유전자 빈도(MAF), 하디-바인버그 평형(Hardy Weinberg equilibrium, HWE) p값 및 쌍별 LD(pairwise LD)를 평가하기 위해, Haploview v.4.2 (https://www.broadinstitute.org /haploview/haploview)를 사용하여 10개의 SNP에 대한 품질 관리 검정을 수행하였다. 유전자형 및 일배체형 연관성을 PLINK 프로그램 v.1.07(http://zzz.bwh.harvard.edu/plink/)을 사용하여 분석하였다.
실시예 4. 단일염기 다형성과 뇌동맥류와의 유전적 연관성의 검토
상기 실시예 2에서 선택된 10개의 모든 SNP는, 품질 관리 검정 후, 완전한 유전자형 분류율(GCR), 마이너 대립유전자 빈도(MAF)는 0.01 초과, 하디-바인버그 평형(HWE) p값은 0.05 초과, 쌍별 연관불균형(LD)은 0.8 초과였다.
10개의 SNP 중 3개의 SNP(rs2303656, rs3900446 및 rs763497)는 뇌동맥류와 통계적으로 유의한 연관성을 보였다(p < 0.05)(도 6). 2개의 SNP(rs2303656 및 rs3900446)는 본페로니-보정된 유의 수준(p < 0.005)에 도달했다. rs3900446의 C 대립 유전자는 뇌동맥류의 위험이 증가하면서 가장 유의미하고 강한 연관성을 보였다(OR = 20.15, p = 4.8 Υ 10-5). 반대로, rs2303656의 A 대립 유전자는 뇌동맥류에서 보호 효과가 있었고, 환자군에서는 빈번하게 관찰되지 않았다(p = 8.2 Υ 10-4). rs763497의 G 대립 유전자는 증가된 뇌동맥류 위험과의 연관성을 보여 주었다(OR = 2.26, p = 0.009). 그러나, 이후의 분석에서 뇌동맥류를 가진 80명의 환자 중 뇌동맥류 파열과 연관된 SNP는 없었다(p > 0.05).
일배체형 연관성에 대한 옴니버스 검정에서, 45개의 슬라이딩 윈도우(SNP 세트)에서 전체 247개 일배체형 구조 중 136개는 0.05 미만의 점근선 p값을 보였으며, 17개의 일배체형은 뇌동맥류와 암시적 연관성을 보였다(점근선 p < 0.001, 도 7). 10개의 SNP 일배체형 조합 중 rs3900446과 rs763497의 CG 조합은 단일 SNP 분석(MHF = 0.113, 점근선 p = 1.3 Υ 10-5)에서 유의한 연관성을 보였다.
단일 SNP 분석에서 6개의 SNP(rs10040971, rs17148773, rs3792801, rs10519694, rs2956540 및 rs1800449)가 독립적으로 연관되어 있지는 않았지만, 이들 SNP를 rs2303656, rs3900446 또는 rs763497과 조합한 일배체형 구조는 일배체형 분석에서 유의했다(6.5Υ10-4<p<7.5Υ10-4).
<3. SOX17(SRY-box 17) 유전자의 SNP 이용한 뇌동맥류 진단>
실시예 1. 연구 대상
단일 기관(춘천 성심 병원)에서 방사선학적으로 낭형(saccular shape)을 갖는 것으로 확인된 뇌동맥류 환자군 187명과, 환자군의 환자의 나이 및 성별과 매칭된 대조군 372명을 모집하였다(환자군 및 대조군의 비율은 1:2임). 상기 뇌동맥류에서, 방추형 또는 해부학 비낭성 동맥류 및 외상성 또는 전염성 동맥류는 제외하였다. 대조군은, 동정맥 기형, 두개내 출혈 또는 경색 등과 같은 다른 신경계 질환을 제외한, 두통 진단 또는 건강 검진을 위해 전산화 단층 촬영 또는 자기 공명 혈관 조영술을 받은, 매칭된 환자들로 구성하였다. 성별, 연령, 비파열 뇌동맥류 또는 지주막하 출혈과 같은 임상 증상, 고혈압, 당뇨, 고지혈증, 흡연, 동맥류의 가족력 등 여러 변수를 고려하여 의료 기록을 검토하였다. 동맥류의 크기, 위치(전방 순환 또는 후방 순환), 및 수(단수 또는 복수)에 대한 혈관조영 변수를 검토하였다. 본 연구는 춘천 성심 병원의 임상 시험 위원회에 의해 승인되었다(No. 2017-9).
검토 결과, 뇌동맥류 환자군 및 대조군에서, 여성의 수는 각각 108명(57.8%) 및 212명(57.9%)이었고, 평균 연령은 각각 58.2 ± 11.5세 및 56.9 ± 14.2세였다(P = 0.305). 고혈압, 당뇨, 고지혈증 및 흡연 상태를 포함하는 다른 요인들은 두 군 간에 크게 다르지 않았다. 지주막하 출혈 증상은 95명(50.8%)의 환자에게서 나타났다. 동맥류 위치와 관련하여, 전방순환동맥류(n = 167; 89.3%)가 다음과 같이 기록되었다: 내경동맥, n = 34; 전교통동맥 또는 전대뇌동맥, n = 39; 중간대뇌동맥, n = 56; 및 후교통동맥, n = 38. 본 코호트에서 뇌동맥류의 가족력은 언급되지 않았다.
실시예 2. 단일염기 다형성 선택 및 검사
SOX17 유전자 상의 단일염기 다형성과 뇌동맥류 발병 가능성의 연관성을 조사하기 위하여, 동아시아인 및 유럽인 조성 집단으로 구성된 이전의 GWAS로부터 이전에 보고된 SNP 5개(rs1072737, rs1504749, rs10958409, rs12541742 및 rs9298506)를 선택하였다(표 5의 서열번호 38 내지 서열번호 42 참조).
SNP | 서열 | 서열번호 |
rs1072737 | 5'- GACATGGTTTTGCCATGTTGGCCCGGCTGGTATCAAACTCCTGGCCTCAGGTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTATAGGCGTGAGCCACCGTGGCTTAACCTAAACTTCTAGATATGAAAACTATAATGTCTGAGGTGAAAAATAGACTGGAGGAAGAAAAAGGCAGATTGGACATTGTAGAAGAAAGGCGAGATCAGTGAAATTAAAAGTGTGGCAATGAAAACTACCCAAAATAAAACACGCAGAAAATAAAATTCCAAAAAATGAAAAAGCATAAGTGATATGTGGGATAGTTTCAGTGGCCTAATAC [A/C] TGAGTAACTGGAGTCCCTGAAGAAGAAAGACTGAAAAATATATTTTTAGAAATAATGGCTGAAAAATTTCCAAACTTAGTGAAGCTATAAACCTACAGATCTAAGCTCAATGAACACCAAGAAAAATAAACATGAAAATAACTACCCCAAATTACAGCATAAGTTACTAAAAAACAATGACAAAGAGAAAAATCTGACAGCCAGAAAATATACCCGTATTACATCCAGAGAAACAAAGATAAGGCTG-3' | 38 |
rs1504749 | 5'-CGTGCTGGCAAACTTGAAATCTGATGAACCCACTACCTTCACTACACTCACTGTCTGGTCTCTCTCAGGTAGCTGAGGACTGAGAAACACCCCAGCCAGGCAGGTTGGGGTCACTATAAATTCACAGTCACCAACCACACATGGTGCTCTGTTTGGCTGGCCATCTCATTATACCTGTCTGACTTGCTTACTGTCCTGCCCTCCGAAAAAGCTTTTCAAACACTATCTCCTTCTGCCTCAAATGT [A] TCACCTCCCCCTCAATGACTTTGCTTCATATGTGACACAAAGAAATGTTAATACCAGCCAAGACCTTCCTCAACTTCCGGCCAGCAAATCTGGAACACAAGCTGCATCTGTCCTGGTTTGCCTCTTCTCTCTTCTCGTTACAGTAGAGTAGCCATTCCTCTTCTAAAAAACACTGATCTCCCATCCTGCTCTGGACATTAAAGTACTGAGAAGTGGTTTTGTGTTCCCAGCAATATGGGAGTCATTGG-3' | 39 |
rs10958409 | 5'-AAGTGATCCACCCACCTGAGCCTCCCAAAGTTCTGGGATTACAGGCTTGAGCCACTGCGCCCAGCTATAACCTTCACGTTCAAAGCACTCTCCCATCTATTATTAAGGCCTCTGAGAAAATCTCCTTTTTATATATATTCTCAAGTCAGAATTATTAGTCTCCATCTTTCATCTTAGTCTTCTTCAAATACCAAACTCTTTACTAAGCAGTTAGACACAAGTAGTTTCACCAGTTCTATCACTCAAATACGGTTTCATAAGTTCTGCCTAGTGATTGCCCATCAGAGGGGATATGGATTT [G] TGGGCAGGAAATAGAATAGAAACCTAACTCTAACTCTTCTGTGAAATGTAGTGTTTAGGTTAATATTCTTCCTTAACTGCCATCTGCTTTTTTTTGTTTGTTTAACACTTTGTCCAAATCTCTCAAACCTTACACCGCAGAATCATGGA-3' | 40 |
rs12541742 | 5'-GCTTTCATGGTGTGGGCTAAGGACGAGCGCAAGCGGCTGGCGCAGCAGAATCCAGACCTGCACAACGCCGAGTTGAGCAAGATGCTGGGTGAGTCCGAGTCGCAGACCCAGGCGGCCGGGCGCGCTGGCGCGAATCGCTAGGCCGATTTCTTAAACCCCAAACTGTTCTTTGCGAGCCTGACGCCCAAAACCAGGGGTGTGTAGCGGCCACGTCCTTTCTTAAGGCTCTGGGTTCC [C] TTCCCGCTTCCCGCCCTCCGACCCTCCAAAGCAGCTTTCCGCCTTGCTCTCCGGCTCCCGGATTCCCCAGGTGGCCGGGGGCGCGGGTCCAACGGCTCTGGGAAGGCGACTTCCCGGCACCTCCGGGCGGCGCGAGAGCACCCTTGGCCCTGAACTGGGCCGGTTGTGTCCATCCCTCGACCCCTTCCCTAGTTAGGTGTCCTTTTCTGTTTTTCGAACGACCGGGTGATGGGTGAGCGGAAAGCCGCTTCCAGGAGACCAAAAGAAAGGGGTGCCTTTAGAGGACGGGTGTTCCCCAAGGGCTCGGACTCAGGAGTCCCAGATCTCCCTC-3' | 41 |
rs9298506 | 5'- AGGTGTACCAACCCCAGACACTGGCAGAACGCTCTCTTTATGTAAGACCTCAAAATCTTACTGGTTGGTGTCTGCTGACTTGTTTTTCTCTGTTATCTTGCCTGTCTGCAGTGACAAATTCAGTGCAGCTCTAACTCATGTGGACAGGGAGGAAATGATTCTAGGATTGAGGACTTAAGGGTGTCTGGAAGAGAAGAGAATTGTTTTGTTTTGTTTTGTTTTGTTAGTTGTTGTTTTCCTCAGACAGGACCTTGTCA [A] CGCTTTCAAATATGTAGGCTGTTTGCTGTTTCCTTTATGTTGGTCCCTGAGAAGGATCTGCCCTTCTACCCTGTTTCCCTGGGGGGTGTGGACAGAGCCTTTGTCTTTGGGGAAGGGGGTCATCTTGGGAAAAGGAGAACAGGGCATCCTGAGGACCTGCTCCGTCTAAGGAGAGAAAGCCGAACAGATGGCAGCTGCCACGCAGAGGGCACTTTGTAGGAACTCTGGCTGGAGCAGGCTTCCTGCGCTCCAATGCCAAATCCTTCCCTTC-3' | 42 |
5개의 SNP의 유전자형 분석(genotyping)을 위해, HiGeneTM Genomic DNA 프렙 키트(BIOFACT, 대전, 한국)를 이용하여, 피험자 559명의 말초 혈액으로부터 게놈 DNA를 추출하였다. 5개의 SNP 프라이머는 프라이머-3 v.0.4.0 프로그램(http://bioinfo.ut.ee/primer3-0.4.0/)을 사용하여 설계되었으며, 설계된 프라이머는 하기 표 6에 나타내었다.
SNP | 프라이머 | 서열 | 서열번호 |
rs1072737 | 정방향역방향 | 5'-GACATGGTTTTGCCATGTTG-3'5'-CAGCCTTATCTTTGTTTCTCTGG-3' | 4344 |
rs1504749 | 정방향역방향 | 5'-CGTGCTGGCAAACTTGAAAT-3'5'-CCAATGACTCCCATATTGCTG-3' | 4546 |
rs10958409 | 정방향역방향 | 5'-AAGTGATCCACCCACCTGAG-3'5'-TCCATGATTCTGCGGTGTAA-3' | 4748 |
rs12541742 | 정방향역방향 | 5'-GCTTTCATGGTGTGGGCTA-3'5'-GAGGGAGATCTGGGACTCCT-3' | 4950 |
rs9298506 | 정방향역방향 | 5'-AGGTGTACCAACCCCAGACA-3'5'-GAAGGGAAGGATTTGGCATT-3' | 5152 |
상기 표 6의 프라이머와 SolgTM 2X Taq PCR Pre-Mix(Solgent, 대전, 한국)를 이용하여 중합효소 연쇄반응(PCR)을 수행하였다. 예비 변성은 95℃에서 5분간 수행되었고, 95℃에서 30초간 변성, 63℃에서 30초간 어닐링, 72℃에서 1분간 연장, 및 72℃에서 5분간 최종연장이 34사이클 수행되었다. 1.5% 아가로스 겔 전기 영동에 의해 증폭된 단편을 확인하고, SolgTM PCR 정제 키트(SolGent, 대전, 한국)로 정제한 후, ABI PRISM 3730XL 분석기(Applied Biosystems, 캘리포니아, USA)에 의해 각 서열을 분석하였다.
실시예 3. 통계 분석
연령, 성별, 고혈압, 당뇨, 고지혈증 및 흡연에 대한 뇌동맥류 환자군 187명과 대조군 372명과의 차이를 평가하기 위해 단변량 로지스틱 회귀 분석(Univariate logistic regression analysis)을 수행했다. 일반화된 선형 모델은 추가적 효과 상속 모델 하에서 뇌동맥류와 SOX17 유전자 다형성 사이의 유전 연관성을 평가하기 위해 수행되어 95% 신뢰구간(CI)과 대응비(OR)를 추정했다. 후속 분석에서 우리는 동맥류 파열에 따른 뇌동맥류 형성에 대한 SOX17의 유전적 효과를 분석했다. 설명적 및 단변량 분석을 Stata II.2(StataCorp LLC, College Station, 텍사스, 미국)를 사용하여 수행하였다. 유전자형 분류율(genotyping call rate, GCR), 마이너 대립유전자 빈도(MAF), 하디-바인버그 평형(Hardy Weinberg equilibrium, HWE) p값 및 쌍별 LD(pairwise LD)를 평가하기 위해, Haploview 4.2(https://www.broadinstitute.org/haploview/haploview)를 사용하여 SOX17 유전자 근처 또는 SOX17 유전자 상에 위치한 5개의 SNP에 대한 품질 관리 검정을 수행하였다. 유전자형 및 일배체형 연관성을 PLINK 프로그램 1.07(http://zzz.bwh.harvard.edu/plink/)을 사용하여 분석하였다.
실시예 4. 단일염기 다형성과 뇌동맥류와의 유전적 연관성의 검토
품질 관리 검정 후, 상기 실시예 2에서 선택된 5개의 SNP 중 4개는 완전한 유전자형 분류율(GCR), 마이너 대립유전자 빈도(MAF)는 10% 초과, 하디-바인버그 평형(HWE) P값은 0.05 초과, 쌍별 연관불균형(LD)은 0.8 초과였다. SOX17 유전자의 인트론 영역에 위치한 rs12541742를 하디-바인버그 평형(HWE) 때문에 본 연관성 시험에서 제외하였다.
4개의 SNP 중 오직 1개의 SNP, 즉 SOX17 유전자의 5'-비번역 영역(5'-UTR)으로부터 약 41kb의 상류 영역에 위치한 rs1072737의 마이너 C 대립유전자만이 뇌동맥류와 통계적으로 유의한 연관성을 보였다(OR = 0.69, 95% CI = 0.49-0. 96, P = 0.03) (도 8). 이 변종은 유럽인 조상 집단을 포함하는 디전 연구와 비교하여 반대 효과 크기를 나타냈다(각각, OR = 0.69 및 OR = 1.02). 후속 분석에서 4개의 SNP 중 뇌동맥류 파열과 관련된 SNP는 없었다(P > 0.2, 도 9).
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
Claims (11)
- ARHGAP32(Rho GTPase Activating Protein 32) 유전자의 단일염기다형성(single nucleotide polymorphism, SNP)인 rs371331393을 포함하는, 뇌동맥류 진단용 SNP 마커 조성물.
- 제1항에 있어서,상기 ARHGAP32 유전자의 SNP인 rs371331393는 서열번호 4의 26번째 뉴클레오타이드를 포함하는 것인, 뇌동맥류 진단용 SNP 마커 조성물.
- 제1항에 있어서, 상기 조성물은1) GBA(Glucocerebrosidase) 유전자의 SNP인 rs75822236,2) TCF24(transcription factor 24) 유전자의 SNP인 rs112859779,3) OLFML2A(Olfactomedin Like 2A) 유전자의 SNP인 rs79134766,4) CD163L1(CD163 Molecule Like 1) 유전자의 SNP인 rs138525217,5) CUL4A(cullin 4A) 유전자의 SNP인 rs74115822,6) LOC102724084 유전자의 SNP인 rs75861150,7) LRRC3(Leucine rich repeat containing 3) 유전자의 SNP인 rs116969723,8) RNF144A(Ring Finger Protein 144A) 유전자의 SNP인 rs6741819,9) FLJ45964 유전자의 SNP인 rs59626274,10) SPCS3(Signal Peptidase Complex Subunit 3) 유전자의 SNP인 rs17688188,11) LINGO2(Leucine Rich Repeat And Ig Domain Containing 2) 유전자의 SNP인 rs56942085, 및12) MINK1(misshapen/Nck-interacting kinase(NIK)-related kinase 1) 유전자의 SNP인 rs72835045로 이루어진 군에서 선택되는 하나 이상의 SNP를 추가로 포함하는 것인, 뇌동맥류 진단용 SNP 마커 조성물.
- ARHGAP32 유전자의 SNP인 rs371331393를 검출 또는 증폭할 수 있는 제제를 포함하는, 뇌동맥류 진단용 조성물.
- 제4항에 있어서, 상기 조성물은1) GBA 유전자의 SNP인 rs75822236,2) TCF24유전자의 SNP인 rs112859779,3) OLFML2A 유전자의 SNP인 rs79134766,4) CD163L1 유전자의 SNP인 rs138525217,5) CUL4A 유전자의 SNP인 rs74115822,6) LOC102724084 유전자의 SNP인 rs75861150,7) LRRC3 유전자의 SNP인 rs116969723,8) RNF144A 유전자의 SNP인 rs6741819,9) FLJ45964 유전자의 SNP인 rs59626274,10) SPCS3 유전자의 SNP인 rs17688188,11) LINGO2 유전자의 SNP인 rs56942085, 및12) MINK1 유전자의 SNP인 rs72835045로 이루어진 군에서 선택되는 하나 이상의 SNP를 검출 또는 증폭할 수 있는 제제를 추가로 포함하는 것인, 뇌동맥류 진단용 조성물.
- 개체로부터 분리된 생물학적 시료로부터, ARHGAP32 유전자의 SNP인 rs371331393의 대립형질을 결정하는 단계를 포함하는, 뇌동맥류 진단을 위한 정보 제공 방법.
- 제6항에 있어서,상기 방법은 ARHGAP32 유전자의 SNP인 rs371331393의 대립형질이 G인 경우, 뇌동맥류가 발병한 것으로 진단하거나 발병 위험을 높은 수준으로 예측하는 단계를 추가로 포함하는 것인, 뇌동맥류 진단을 위한 정보 제공 방법.
- 제6항에 있어서,상기 방법은 개체로부터 분리된 생물학적 시료로부터,1) GBA 유전자의 SNP인 rs75822236,2) TCF24 유전자의 SNP인 rs112859779,3) OLFML2A 유전자의 SNP인 rs79134766,4) CD163L1 유전자의 SNP인 rs138525217,5) CUL4A 유전자의 SNP인 rs74115822,6) LOC102724084 유전자의 SNP인 rs75861150,7) LRRC3 유전자의 SNP인 rs116969723,8) RNF144A 유전자의 SNP인 rs6741819,9) FLJ45964 유전자의 SNP인 rs59626274,10) SPCS3 유전자의 SNP인 rs17688188,11) LINGO2 유전자의 SNP인 rs56942085, 및12) MINK1 유전자의 SNP인 rs72835045로 이루어진 군에서 선택되는 하나 이상의 SNP의 대립형질을 결정하는 단계를 추가로 포함하는, 뇌동맥류 진단을 위한 정보 제공 방법.
- 제8항에 있어서, 상기 방법은1) GBA 유전자의 SNP인 rs75822236의 대립형질이 C인 경우,2) CD163L1 유전자의 SNP인 rs138525217의 대립형질이 C인 경우,3) CUL4A 유전자의 SNP인 rs74115822의 대립형질이 G인 경우,4) LINGO2 유전자의 SNP인 rs56942085의 대립형질이 G인 경우, 또는 이들 중 둘 이상의 조합인 경우, 뇌동맥류가 발병한 것으로 진단하거나 발병 위험을 높은 수준으로 예측하는 단계를 추가로 포함하는 것인, 뇌동맥류 진단을 위한 정보 제공 방법.
- 제8항에 있어서, 상기 방법은1) TCF24 유전자의 SNP인 rs112859779의 대립형질이 T인 경우,2) OLFML2A 유전자의 SNP인 rs79134766의 대립형질이 A인 경우,3) LOC102724084 유전자의 SNP인 rs75861150의 대립형질이 C인 경우,4) LRRC3 유전자의 SNP인 rs116969723의 대립형질이 A인 경우,5) RNF144A 유전자의 SNP인 rs6741819의 대립형질이 T인 경우,6) FLJ45964 유전자의 SNP인 rs59626274의 대립형질이 T인 경우,7) SPCS3 유전자의 SNP인 rs17688188의 대립형질이 A인 경우,8) MINK1 유전자의 SNP인 rs72835045의 대립형질이 A인 경우, 또는 이들 중 둘 이상의 조합인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측하는 단계를 추가로 포함하는 것인, 뇌동맥류 진단을 위한 정보 제공 방법.
- 제6항에 있어서,상기 개체는 한국인 및 아시아인인 것인, 뇌동맥류 진단을 위한 정보 제공 방법.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201980005520.2A CN112424381A (zh) | 2019-04-03 | 2019-12-24 | 包括arhgap32基因单碱基多态性的脑动脉瘤诊断用snp标志物 |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR10-2019-0039224 | 2019-04-03 | ||
KR1020190039224A KR102158716B1 (ko) | 2019-04-03 | 2019-04-03 | Arhgap32 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2020204312A1 true WO2020204312A1 (ko) | 2020-10-08 |
Family
ID=72667383
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2019/018406 WO2020204312A1 (ko) | 2019-04-03 | 2019-12-24 | Arhgap32 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 |
Country Status (3)
Country | Link |
---|---|
KR (1) | KR102158716B1 (ko) |
CN (1) | CN112424381A (ko) |
WO (1) | WO2020204312A1 (ko) |
Family Cites Families (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101211280B1 (ko) * | 2010-03-26 | 2012-12-11 | 가톨릭대학교 산학협력단 | 신규한 뇌손상 질환 진단용 마커 및 이의 용도 |
KR101412649B1 (ko) * | 2012-01-27 | 2014-07-01 | 가천대학교 산학협력단 | 뇌 손상 증세의 경감 또는 완화에 대한 바이오마커 |
KR101991007B1 (ko) | 2016-05-27 | 2019-06-20 | (주)메디젠휴먼케어 | Snp를 이용한 질병 관련 유전체 분석 시스템 및 장치 |
KR102009838B1 (ko) * | 2018-03-19 | 2019-08-12 | 한림대학교 산학협력단 | 뇌동맥류의 발병 위험 예측 또는 진단을 위한 정보를 제공하는 방법 |
KR101974786B1 (ko) * | 2018-08-17 | 2019-05-31 | (주)제이엘케이인스펙션 | 뇌동맥류 병변의 특성을 이용한 중증도 및 예후 예측 방법 및 시스템 |
KR102158713B1 (ko) * | 2019-04-03 | 2020-09-22 | 한림대학교 산학협력단 | Gba 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 |
KR102158715B1 (ko) * | 2019-04-03 | 2020-09-22 | 한림대학교 산학협력단 | Olfml2a 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 |
-
2019
- 2019-04-03 KR KR1020190039224A patent/KR102158716B1/ko active IP Right Grant
- 2019-12-24 CN CN201980005520.2A patent/CN112424381A/zh active Pending
- 2019-12-24 WO PCT/KR2019/018406 patent/WO2020204312A1/ko active Application Filing
Non-Patent Citations (5)
Title |
---|
ALG, VARINDER S. ET AL.: "Genetic risk factors for intracranial aneurysms: a meta-analysis in more than 1 16,000 individuals", NEUROLOGY, vol. 80, 2013, pages 2154 - 2165, XP002775891, DOI: 10.1212/WNL.0b013e318295d751 * |
DBSNP. SUBMITTED SNP(SS) DETAILS: SS3159637254, 30 September 2017 (2017-09-30) * |
HONG, EUN PYO ET AL.: "Genomic variations in susceptibility to intracranial aneurysm in the Korean population", JOURNAL OF CLINICAL MEDICINE, vol. 8, no. 275, 25 February 2019 (2019-02-25), pages 1 - 14 * |
LAARMAN, MELANIE D. ET AL.: "Intracranial aneurysm-associated single-nucleotide polymorphisms alter regulatory DMA in the human circle of willis", STROKE, vol. 49, 2018, pages 447 - 453 * |
NAKAZAWA, TAKANOBU ET AL.: "Emerging roles of ARHGAP33 in intracellular trafficking of TrkB and pathophysiology of neuropsychiatric disorders", NATURE COMMUNICATIONS, vol. 7, no. 10594, 2016, pages 1 - 16 * |
Also Published As
Publication number | Publication date |
---|---|
KR102158716B1 (ko) | 2020-09-22 |
CN112424381A (zh) | 2021-02-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR102009838B1 (ko) | 뇌동맥류의 발병 위험 예측 또는 진단을 위한 정보를 제공하는 방법 | |
KR102158717B1 (ko) | Cd163l1 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 | |
US20100092959A1 (en) | Single nucleotide polymorphisms as genetic markers for childhood leukemia | |
WO2020204313A1 (ko) | Gba 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 | |
WO2017007275A1 (ko) | 코 표현형 판단용 조성물 | |
WO2020060170A1 (ko) | 아토피 피부염 진단을 위한 마커 조성물 및 이를 이용한 아토피 피부염 예측 또는 진단 방법 | |
KR20110034297A (ko) | 내인성 아토피 피부염 진단용 마커 및 그의 용도 | |
KR102158721B1 (ko) | Rnf144a 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 | |
KR102158715B1 (ko) | Olfml2a 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 | |
WO2020204312A1 (ko) | Arhgap32 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 | |
KR102543907B1 (ko) | 치주질환 위험도 평가용 유전자 마커 | |
KR102063486B1 (ko) | Rnf213 단일염기다형성과 한국인 모야모야병 발병 위험도의 연관성 | |
KR102158725B1 (ko) | Mink1 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 | |
KR102158719B1 (ko) | Loc102724084 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 | |
KR102158723B1 (ko) | Spcs3 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 | |
KR102158718B1 (ko) | Cul4a 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 | |
KR102158724B1 (ko) | Lingo2 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 | |
KR102158720B1 (ko) | Lrrc3 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 | |
KR102158714B1 (ko) | Tcf24 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 | |
KR102158722B1 (ko) | Flj45964 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 snp 마커 | |
WO2022075747A1 (ko) | 인체 모발 탄력 인장강도 관련 유전자 다형성 마커 및 이의 용도 | |
WO2023158213A1 (ko) | 관상동맥 질환 발병 저위험 예측용 snp 마커 및 이를 이용한 관상동맥 질환 발병 저위험 예측 방법 | |
WO2020162663A1 (ko) | 성조숙증 진단 또는 치료 예후 예측용 단일염기다형성 마커 및 이의 용도 | |
WO2023018312A1 (ko) | 약물 과민반응 진단용 snp 및 이를 이용한 진단 방법 | |
KR102181563B1 (ko) | 성조숙증 진단 또는 치료 예후 예측용 단일염기다형성 마커 및 이의 용도 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19922456 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 19922456 Country of ref document: EP Kind code of ref document: A1 |