WO2020198413A1 - Tn-muc1 chimeric antigen receptor (car) t cell therapy - Google Patents

Tn-muc1 chimeric antigen receptor (car) t cell therapy Download PDF

Info

Publication number
WO2020198413A1
WO2020198413A1 PCT/US2020/024825 US2020024825W WO2020198413A1 WO 2020198413 A1 WO2020198413 A1 WO 2020198413A1 US 2020024825 W US2020024825 W US 2020024825W WO 2020198413 A1 WO2020198413 A1 WO 2020198413A1
Authority
WO
WIPO (PCT)
Prior art keywords
domain
seq
cell
set forth
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/024825
Other languages
English (en)
French (fr)
Inventor
Avery D. Posey
Carl H. June
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Pennsylvania Penn
Original Assignee
University of Pennsylvania Penn
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Pennsylvania Penn filed Critical University of Pennsylvania Penn
Priority to JP2021557613A priority Critical patent/JP7654557B2/ja
Priority to EP20776961.3A priority patent/EP3947471A4/en
Priority to CN202511107158.3A priority patent/CN120944827A/zh
Priority to CN202080025068.9A priority patent/CN113661180B/zh
Publication of WO2020198413A1 publication Critical patent/WO2020198413A1/en
Anticipated expiration legal-status Critical
Priority to JP2024217382A priority patent/JP2025038057A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/66Phosphorus compounds
    • A61K31/675Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • A61K31/7064Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
    • A61K31/7076Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/31Chimeric antigen receptors [CAR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/421Immunoglobulin superfamily
    • A61K40/4211CD19 or B4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4256Tumor associated carbohydrates
    • A61K40/4257Mucins, e.g. MUC-1
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70507CD2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70517CD8
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70578NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70596Molecules with a "CD"-designation not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3076Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells against structure-related tumour-associated moieties
    • C07K16/3092Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells against structure-related tumour-associated moieties against tumour-associated mucins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/31Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the route of administration
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/48Blood cells, e.g. leukemia or lymphoma
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/49Breast
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/54Pancreas
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/55Lung
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/59Reproductive system, e.g. uterus, ovaries, cervix or testes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/33Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells

Definitions

  • Chimeric antigen receptor (CAR) T cells are effector immune cells that are genetically-modified to recognize a specific tumor-associated antigen and subsequently kill the tumor cell. While success with CAR T therapy has led to approval for use in hematologic malignancy, the effectiveness of CAR T therapy in the treatment of solid tumors, such as breast cancer, remains uncertain. There are several obstacles to CAR T therapy in solid tumors. Foremost, most of the identified and best-studied cell-surface antigens expressed by tumors are also expressed by normal tissue, resulting in nonspecific targeting by CAR T cells (on-target, off-tumor activity). Second, solid tumors have a generally immunosuppressive tumor microenvironment, which may inhibit CAR T cell activity once the cells reach the tumor and recognize the antigen. Third, the durability of anti-tumor responses is highly correlated with the persistence of the adoptively-transferred cells and optimal persistence for CAR T cells in solid tumors has yet to match the persistence observed in hematopoietic malignancies.
  • Identifying tumor-specific antigens is essential in the continuing application of CAR T cell therapy to solid tumors.
  • the present invention satisfies this need.
  • Mucin 1 is a cell surface mucin that typically undergoes serial addition of glycans to form a hyperglycosylated protein (FIG. 1).
  • the O-glycosylation process begins with GalNAc addition on serine and threonine residues.
  • Elongation begins by addition of galactose by Core 1 synthase (composed of CIGalTl and its chaperone CIGalTICl (Cosmc)) or GlcNAc addition by Core 3 synthase (B3GNT6).
  • Core 1 synthase composed of CIGalTl and its chaperone CIGalTICl (Cosmc)
  • B3GNT6 Core 3 synthase
  • a modified immune cell or precursor cell thereof comprising a chimeric antigen receptor (CAR) that specifically binds MUC1, wherein the CAR comprises: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain
  • CAR chimeric antigen receptor
  • CDR complementarity determining region
  • the MUC1 -specific antigen binding domain is specific for a gly coepitope ofMUCl. In certain exemplary embodiments, the MUC1- specific antigen binding domain is specific for a truncated gly coepitope ofMUCl.
  • the VH domain comprises the amino acid sequence set forth in SEQ ID NO: 5.
  • the VL domain comprises the amino add sequence set forth in SEQ ID NO: 6.
  • the VH domain comprises the amino acid sequence set forth in SEQ ID NO: 5, and the VL domain comprises the amino add sequence set forth in SEQ ID NO: 6.
  • the MUC1 -specific antigen binding domain comprises the amino acid sequence set forth in SEQ ID NO: 4.
  • the transmembrane domain comprises a transmembrane region of a protein selected from the group consisting of a type I transmembrane protein, an alpha, beta, or zeta chain of a T cell receptor, CD28, CD2, CD3 epsilon, CD45, CD4, CDS, CD7, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9.
  • a protein selected from the group consisting of a type I transmembrane protein, an alpha, beta, or zeta chain of a T cell receptor, CD28, CD2, CD3 epsilon, CD45, CD4, CDS, CD7, CDS, CD9, CD
  • the transmembrane domain comprises a CDS transmembrane region.
  • the transmembrane domain comprises the amino add sequence set forth in SEQ ID NO: 7.
  • the costimulatoiy signaling domain comprises a costimulatoiy domain of a protein selected from the group consisting of a TNFR superfamily member, CD27, CD28, 4-1BB (CD137), 0X40 (CD134), CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CDS, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83, DAP10, DAP 12, Lck, Fas, and any derivative or variant thereof.
  • the costimulatoiy signaling domain is a CD2 costimulatoiy signaling domain. In certain exemplary embodiments, the costimulatoiy signaling domain comprises the amino acid sequence set forth in SEQ ID NO: 28.
  • the intracellular signaling domain comprises a signaling domain of a protein selected from the group consisting of CD3 zeta,
  • the intracellular signaling domain comprises a signaling domain of CD3 zeta.
  • the intracellular signaling domain comprises the amino acid sequence set forth in SEQ ID NO: 30.
  • the CAR further comprises a leader sequence.
  • the leader sequence is a CDS leader sequence.
  • the leader sequence comprises the amino acid sequence set forth in SEQ ID NO: 48.
  • the CAR further comprises a hinge domain.
  • the hinge domain is from a protein selected from the group consisting of an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial spacer sequence, a hinge comprising an amino acid sequence of CDS, and any combination thereof.
  • the hinge domain is a CDS hinge domain.
  • the hinge domain comprises the amino acid sequence set forth in SEQ ID NO: 13.
  • the modified immune cell further comprises a dominant negative receptor and/or switch receptor.
  • the dominant negative receptor is a truncated variant of a wild-type protein associated with a negative signal.
  • the truncated variant of a wild-type protein associated with a negative signal comprises the amino add sequence set forth in SEQ ID NO:76.
  • the switch receptor comprises: a first domain, wherein the first domain is derived from a first polypeptide that is associated with a negative signal; and a second domain, wherein the second domain is derived from a second polypeptide that is assodated with a positive signal.
  • the first domain comprises at least a portion of the extracellular domain of the first polypeptide that is associated with a negative signal
  • the second domain comprises at least a portion of the intracellular domain of the second polypeptide that is associated with a positive signal.
  • the switch receptor further comprises a switch receptor transmembrane domain. In one embodiment, the switch receptor
  • transmembrane domain comprises: the transmembrane domain of the first polypeptide that is associated with a negative signal; or the transmembrane domain of the second polypeptide that is assodated with a positive signal.
  • the first polypeptide that is associated with a negative signal is seletied from the group consisting of CTLA4, PD-1, BTLA, ⁇ M-3, and a TORbK.
  • the second polypeptide that is assodated with a positive signal is selected from the group consisting of CD28, 1COS, 4-1BB, and a IL-12R.
  • the switch receptor comprises: a first domain comprising at least a portion of the extracellular domain of PD 1; a switch receptor transmembrane domain comprising at least a portion of the transmembrane domain of CD28; and a second domain comprising at least a portion of the intracellular domain of CD28.
  • the switch receptor comprises the amino acid sequence set forth in SEQ ID NO: 78.
  • the switch receptor comprises: a first domain comprising at least a portion of the extracellular domain of PD1; a switch receptor transmembrane domain comprising at least a portion of the transmembrane domain of PD1; and a second domain comprising at least a portion of the intracellular domain of CD28.
  • the switch receptor comprises the amino add sequence set forth in SEQ ID NO: 80.
  • the first domain comprises at least a portion of the extracellular domain of PD1 comprises an alanine (A) to leucine (L) substitution at amino add position 132.
  • the switch receptor comprises the amino acid sequence set forth in SEQ ID NO: 82.
  • the switch receptor comprises: a first domain comprising at least a portion of the extracellular domain of PD1 comprising an alanine (A) to leucine (L) substitution at amino acid position 132; and a second domain comprising at least a portion of the intracellular domain of CD28.
  • the switch receptor comprises: a first domain comprising at least a portion of the extracellular domain of PD1 comprising an alanine (A) to leucine (L) substitution at amino acid position 132; and a second domain comprising at least a portion of the intracellular domain of 4- IBB.
  • the switch receptor comprises the amino acid sequence set forth in SEQ ID NO: 86.
  • the switch receptor comprises: a first domain comprising at least a portion of the extracellular domain of TIM-3; and a second domain comprising at least a portion of the intracellular domain of CD28.
  • the switch receptor comprises the amino acid sequence set forth in SEQ ID NO: 92.
  • the switch receptor comprises: a first domain comprising at least a portion of the extracellular domain of a TGFpR; and a second domain comprising at least a portion of the intracellular domain of IL12R ⁇ xl.
  • the switch receptor comprises the amino acid sequence set forth in SEQ ID NO: 88.
  • the switch receptor comprises: a first domain comprising at least a portion of the extracellular domain of a TGPPR; and a second domain comprising at least a portion of the intracellular domain of IL12Rpi.
  • the switch receptor comprises the amino acid sequence set forth in SEQ ID NO: 90.
  • the modified cell is a modified natural killer (NK) cell, a modified natural killer T (NKT) cell, or a modified T cell.
  • the modified immune cell is a modified T cell.
  • the modified immune cell is autologous.
  • a modified T cell comprising a chimeric antigen receptor (CAR) that specifically binds MUC1, wherein the CAR comprises: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; a hinge domain; a transmembrane domain; a CD2 costimulatory signaling domain; and an intracellular signaling domain, is provided.
  • CAR chimeric antigen receptor
  • a modified T cell comprising a chimeric antigen receptor (CAR) that specifically binds MUC1, wherein the CAR comprises: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; a hinge domain; a transmembrane domain; a CD2 costimulatory signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 28; and an intracellular signaling domain, is provided.
  • CAR chimeric antigen receptor
  • a modified T cell comprising a chimeric antigen receptor (CAR) that specifically binds MUC1, wherein the CAR comprises: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; a CDS hinge domain; a CDS transmembrane domain; a CD2 costimulatory signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 28; and a CD3 zeta intracellular signaling domain, is provided.
  • CAR chimeric antigen receptor
  • a modified T cell comprising a chimeric antigen receptor (CAR) that specifically binds MUC1, comprising the amino acid sequence set forth in SEQ ID NOs: 2, 39, 41, 43, 45, or 47, is provided.
  • CAR chimeric antigen receptor
  • an isolated nucleic acid sequence encoding a chimeric antigen receptor comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain, is provided.
  • VH domain heavy chain variable
  • VL light chain variable
  • CDR light chain complementarity determining region
  • the MUC1 -specific antigen binding domain is specific for a gly coepitope ofMUCl. In certain exemplary embodiments, the MUC1- specific antigen binding domain is specific for a truncated gly coepitope ofMUCl.
  • the VH domain comprises the amino acid sequence set forth in SEQ ID NO: 5.
  • the VL domain comprises the amino add sequence set forth in SEQ ID NO: 6.
  • the VH domain comprises the amino acid sequence set forth in SEQ ID NO: 5, and the VL domain comprises the amino add sequence set forth in SEQ ID NO: 6.
  • the MUC1 -specific antigen binding domain comprises the amino acid sequence set forth in SEQ ID NO: 4
  • the MUC1 -specific antigen binding domain is encoded by a nucldc acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 3.
  • the transmembrane domain comprises a transmembrane region of a protein selected from the group consisting of a type I transmembrane protein, an alpha, beta, or zeta chain of a T cell receptor, CD28, CD2, CD3 epsilon, CD45, CD4, CDS, CD7, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9.
  • a protein selected from the group consisting of a type I transmembrane protein, an alpha, beta, or zeta chain of a T cell receptor, CD28, CD2, CD3 epsilon, CD45, CD4, CDS, CD7, CDS, CD9, CD
  • the transmembrane domain comprises a CDS transmembrane region.
  • the transmembrane domain is encoded by a nucldc acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 8.
  • the costimulatory signaling domain comprises a costimulatory domain of a protein selected from the group consisting of a TNFR superfamily member, CD27, CD28, 4-1BB (CD137), 0X40 (CD134), CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CDS, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83, DAP10, DAP 12, Lck, Fas, and any derivative or variant thereof.
  • the costimulatory signaling domain is a CD2 costimulatory signaling domain.
  • the costimulatoiy signaling domain comprises the amino acid sequence set forth in SEQ ID NO: 28. In certain exemplary embodiments, the costimulatory signaling domain is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 29.
  • the intracellular signaling domain comprises a signaling domain of CDS zeta.
  • the intracellular signaling domain is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 31.
  • the CAR further comprises a CDS leader sequence.
  • the leader sequence comprises the amino acid sequence set forth in SEQ ID NO: 48.
  • the CAR further comprises a CDS hinge domain.
  • the hinge domain is encoded by a nucleic acid sequence comprising a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 14.
  • an isolated nucleic acid sequence encoding a chimeric antigen receptor comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; a hinge domain; a transmembrane domain; a CD2 costimulatoiy signaling domain; and an intracellular signaling domain, is provided.
  • VH domain heavy chain variable
  • VL light chain variable
  • CDR light chain complementarity determining region
  • an isolated nucleic acid sequence encoding a chimeric antigen receptor comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; a hinge domain; a transmembrane domain; a CD2 costimulatoiy signaling domain comprising a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 29; and an intracellular signaling domain, is provided.
  • an isolated nucleic acid sequence encoding a chimeric antigen receptor comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; a CDS hinge domain; a CDS transmembrane domain; a CD2 costimulatory signaling domain comprising a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 29; and a CD3 zeta intracellular signaling domain, is provided.
  • an isolated nucleic acid sequence encoding a chimeric antigen receptor comprising a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NOs: 1, 38, 40, 42, 44, or 46, is provided.
  • an isolated nucleic acid sequence encoding an ICOS costimulatory signaling domain comprising the nucleotide sequence set forth in SEQ ID NO: 27, is provided.
  • a chimeric antigen receptor that specifically binds MUC1 encoded by the nucleic add of any one of the preceding embodiments.
  • a chimeric antigen receptor (CAR) that specifically binds MUC1, comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; a hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain, is provided.
  • CAR chimeric antigen receptor
  • a chimeric antigen receptor (CAR) that specifically binds MUC1, comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; a hinge domain; a transmembrane domain; a CD2 costimulatoiy signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 28; and an intracellular signaling domain, is provided.
  • CAR chimeric antigen receptor
  • a chimeric antigen receptor (CAR) that specifically binds MUC1, comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; a CDS hinge domain; a CDS transmembrane domain; a CD2 costimulatory signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 28; and a CDS zeta intracellular signaling domain, is provided.
  • CAR chimeric antigen receptor
  • a chimeric antigen receptor that specifically binds MUC1 comprising the amino acid sequence set forth in SEQ ID NO: 47.
  • an expression construct comprising the isolated nucleic acid of any one of the preceding embodiments.
  • the expression construct further comprises an EF-la promoter. In certain exemplary embodiments, the expression construct further comprises a rev response element (RRE). In certain exemplary embodiments, the expression construct further comprises a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE). In certain exemplary embodiments, the expression construct further comprises a cPPT sequence. In certain exemplary embodiments, the expression construct further comprises an EF-la promoter, a rev response element (RRE), a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE), and a cPPT sequence.
  • RRE rev response element
  • WPRE woodchuck hepatitis virus posttranscriptional regulatory element
  • the expression construct is a viral vector selected from the group consisting of a retroviral vector, a lentiviral vector, an adenoviral vector, and an adeno- associated viral vector.
  • the expression construct is a lentiviral vector.
  • the expression construct is a self-inactivating lentiviral vector.
  • a method for generating the modified immune cell or precursor cell thereof of any one of the preceding embodiments comprising introducing into an immune cell or precursor cell thereof the isolated nucleic acid of any one of the preceding embodiments, or the expression construct of any one of the preceding embodiments, is provided.
  • a method of treating a MUC 1 -associated cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective composition comprising the modified immune cell of any one of the preceding embodiments is provided.
  • the MUCl-associated cancer is selected from the group consisting of multiple myeloma, non-small cell lung cancer, breast cancer, pancreatic adenocarcinoma, and ovarian and fallopian tube cancer.
  • the MUCl-associated cancer is breast cancer.
  • the breast cancer is characterized by abnormal glycosylation of MUC 1.
  • the breast cancer is selected from the group consisting of a hormone receptor-positive breast cancer, a hormone receptor-negative breast cancer, an estrogen receptor-negative breast cancer, a progesterone receptor-negative breast cancer, and aHer2 receptor-negative breast cancer.
  • the breast cancer is a metastatic breast cancer.
  • the breast cancer is triple negative breast cancer.
  • a method of treating a MUC1 -associated cancer in a subject in need thereof comprising: administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain
  • CDR complementarity determining region
  • a hinge domain optionally a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain, is provided.
  • a method of treating a MUC1 -associated multiple myeloma in a subject in need thereof comprising: administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC 1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; optionally a hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain, is provided.
  • a therapeutically effective composition comprising a modified T cell comprising: a MUC 1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the V
  • a method of treating a MUC1 -associated non-small cell lung cancer in a subject in need thereof comprising: administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain
  • CDR complementarity determining region
  • a method of treating a MUC 1 -associated triple negative breast cancer in a subject in need thereof comprising: administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC 1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain
  • CDR complementarity determining region
  • a method of treating a MUC 1 -associated pancreatic adenocarcinoma in a subject in need thereof comprising: administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC 1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain
  • CDR complementarity determining region
  • a method of treating a MUC 1 -associated ovarian and fallopian tube cancer in a subject in need thereof comprising: administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain
  • CDR complementarity determining region
  • the method of any one of the preceding embodiments further comprises administering to the subject a lymphodepleting chemotherapy.
  • the lymphodepleting chemotherapy comprises administering to the subject a therapeutically effective amount of
  • the lymphodepleting chemotherapy comprises administering to the subject a therapeutically effective amount of fludarabine. In certain exemplary embodiments, the lymphodepleting chemotherapy comprises administering to the subject a therapeutically effective amount of
  • cyclophosphamide and a therapeutically effective amount of fludarabine.
  • the method of any one of the preceding embodiments further comprises administering to the subject a cytokine release syndrome (CRS) management regimen.
  • CRS cytokine release syndrome
  • the CRS management regimen comprises a therapeutically effective amount of tocilizumab.
  • the CRS management regimen comprises a therapeutically effective amount of tocilizumab and/or corticosteroids.
  • the modified immune cell or modified T cell is autologous.
  • the administering of the modified immune cell or modified T cell is performed via intratumoral delivery. In certain exemplary embodiments, the administering of the modified immune cell or modified T cell is performed via intravenous delivery. In certain exemplary embodiments, the
  • administering of the modified immune cell or modified T cell is performed via intraperitoneal delivery.
  • the modified immune cell or precursor cell thereof of any one of the preceding embodiments for use in the method of any one of the preceding embodiments.
  • the isolated nucleic acid sequence of any one of the preceding embodiments for use in the method of any one of the preceding embodiments.
  • the chimeric antigen receptor of any one of the preceding embodiments for use in the method of any one of the preceding embodiments.
  • FIG. 1 is a schematic illustrating the initiation of O-glycan biosynthesis highlighting core glycans and associated glycotransferases.
  • FIGs. 2A and 2B are a set of plots illustrating gene expression analysis of MUC1 and glycosylation enzymes by qPCR. Gene expression was measured in 4 breast cancer cell lines (BT-20, MCF7, MDA-MB-231, and MDA-MB-453) and compared to that of MCF10A, a non-tumorigenic breast epithelium cell line.
  • FIGs. 3 A and 3B are a set of images depicting expression of Tn-MUCl in breast cancer tissue as assessed by immunohistochemistry with anti-5E5 antibody.
  • FIG. 3A illustrates 3+ staining in breast cancer tissue without staining of the surrounding stroma.
  • FIG. 3B illustrates 2+ staining in breast cancer tissue without staining of the surrounding stroma.
  • FIG. 4 is a series of plots illustrating results from cytotoxicity assays using anti- Tn-MUCl CAR T cells and four breast cancer cell lines.
  • 5E5-CAR, CD 19-specific CAR, or NTD T cells were co-cultured with breast cancer cell lines at an effector: target ratio of 10: 1. Cytolysis was measured through real-time impedance measurements every 15 minutes for 100 hours post-T cell addition.
  • FIGs. 5A-5C are a series of plots and images illustrating the finding that intraperitoneal and intratumoral delivery of 5E5-CAR T cells enhances anti-tumor efficacy.
  • FIGs. 6A and 6B are a series of plots and images illustrating the finding that intraperitoneal delivery of murine HMFG1-CAR T cells in human MUC1 transgenic mice causes off-tumor, on-target toxicity not observed from murine 5E5-CAR T cells.
  • FIGs. 7A-7C are a series of plots illustrating gene expression of MUC1, ST6GALNAC1, B3GNT6, C1GALT1, and C1GALT1C1 in 50 patient-derived breast cancer samples compared to mean gene expression of 10 matched patient-derived normal breast tissue samples.
  • FIG. 8 is a set of flow cytometry plots showing the expression of the various TnMUCl CAR transgenes as indicated.
  • FIG. 9 shows the results of a CFSE assay, demonstrating that the various TnMUCl CAR-T cells as indicated proliferate in response to MCF7 cells.
  • FIG. 10 is a set of three charts showing, from left to right, the level of IL-2, TNFa, and IFNg secretion of the various TnMUCl CAR-T cells as indicated.
  • FIG. 11 is a graph showing the total flux in photons per second measured in mice post-intravenous administration of the various TnMUCl CAR-T cells as indicated, over time.
  • FIGs. 12A and 12B are plots showing the level of various TnMUCl CAR-T cells measured in the peripheral blood of infused mice at day 42 post infusion.
  • FIG. 13 is a graph demonstrating the cytotoxicity of CART-TnMUCl, CART- TnMUCl-BBz, and negative control cells (CART-19 and NTD) towards the Hs766T pancreatic cancer cell line.
  • FIGs. 14A-14C are a series of graphs showing targeted cell killing by CART- TnMUCl cells of various cell lines as indicated.
  • FIGs. 15A and 15B are a series of graphs showing targeted cell killing by CART-TnMUCl cells in response to Tn antigen of various cell lines as indicated.
  • FIG. 16 shows a series of graphs plotting the bioluminescent imaging of tumor burden in a mouse model of pancreatic cancer.
  • FIGs. 17A-17C are a series of graphs and images showing the proliferation of CART-TnMUCl cells in response to antigen-expressing target cells.
  • FIG. 18 is a series of graphs showing the production of cytokines and chemokines in various cell lines as indicated.
  • FIG. 19 is a graph showing data obtained from an IFNy ELISA experiment.
  • FIG. 20 is a series of graphs showing the quantitation of various T cells as indicated, in peripheral blood of mice at days 21 and 42 post-T cell infusion.
  • FIG. 21 are micrographs of Jurkat CBG/GFP CD19-P2A-Cosmc cells (left) and MCF-7 cells (right) stained with an anti -TnMUCl antibody.
  • FIG. 22 is a schematic showing the experimental setup for testing the reproducibility of the TnMUCl CTA assay.
  • FIG. 23 is a schematic of the plasmid map of pTRPE_5E5(H2L)_CD2z.
  • FIG. 24 is a schematic of the plasmid map of pGEM-SSl-CD2z.
  • FIG. 25 is a schematic of the plasmid map of pTRPE_5E5-BBz.
  • FIG. 26 is a schematic showing the pTRPE_5E5(H2L) vector backbone.
  • FIG. 27 is a schematic showing the study design of the Phase 1 and Phase la portions of the clinical trial.
  • FIG. 28 is a schematic showing the overall patient pathway of the clinical trial.
  • FIG. 29 is a schematic showing the dose escalation scheme of the clinical trial.
  • FIG. 30 is a schematic showing the dose escalation cohorts of the clinical trial.
  • FIG. 31 is a series of graphs showing the total cell numbers for T cells from 5 different normal healthy donors transduced with the indicated CARs.
  • FIG. 32 is a series of graphs showing the population doublings of T cells from 5 different normal healthy donors transduced with the indicated CARs.
  • FIG. 33 is a series of graphs showing the mean cell volumes of T cells from 4 different normal healthy donors transduced with the indicated CARs.
  • FIG. 34 is a set of flow cytometry plots showing the expression of the indicated CARs in T cells of 5 different normal healthy donors.
  • the articles“a” and“an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.
  • “an element” means one element or more than one element.
  • “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ⁇ 20% or ⁇ 10%, more preferably ⁇ 5%, even more preferably ⁇ 1%, and still more preferably ⁇ 0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
  • Activation refers to the state of a T cell that has been sufficiently stimulated to induce detectable cellular proliferation. Activation can also be associated with induced cytokine production, and detectable effector functions.
  • the term“activated T cells” refers to, among other things, T cells that are undergoing cell division.
  • to“alleviate” a disease means reducing the severity of one or more symptoms of the disease.
  • Allogeneic refers to any material derived from a different animal of the same species.
  • antibody refers to an immunoglobulin molecule which specifically binds with an antigen.
  • Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of
  • the antibodies in the present invention may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)a, as well as single chain antibodies (scFv) and humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879- 5883; Bird et al., 1988, Science 242:423-426).
  • antibody fragment refers to a portion of an intact antibody and refers to the antigenic determining variable regions of an intact antibody.
  • antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, scFv antibodies, and multispecific antibodies formed from antibody fragments.
  • An“antibody heavy chain,” as used herein, refers to the larger of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformations.
  • An“antibody light chain,” as used herein, refers to the smaller of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformations a and b light chains refer to the two mzyor antibody light chain isotypes.
  • “synthetic antibody” as used herein, is meant an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage as described herein.
  • the term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino add sequence technology which is available and well known in the art.
  • antigen or“Ag” as used herein is defined as a molecule that provokes an immune response. This immune response may involve dther antibody production, or the activation of specific immunologically-competent cells, or both.
  • antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an“antigen” as that term is used herein.
  • an antigen need not be encoded solely by a full-length nucleotide sequence of a gene. It is readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a“gene” at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid.
  • autologous is meant to refer to any material derived from the same individual to which it is later to be re-introduced into the individual.
  • CAR chimeric antigen receptor
  • T cells are removed from a patient and modified so that they express the receptors specific to a particular form of antigen.
  • the CAR has specificity to a selected target, for example MUC1.
  • CARs may- also comprise an intracellular activation domain, a transmembrane domain and an extracellular domain comprising an antigen binding region.
  • cleavage refers to the breakage of covalent bonds, such as in the backbone of a nucleic acid molecule or the hydrolysis of peptide bonds. Cleavage can be initiated by a variety of methods, including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible. Double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events. DNA cleavage can result in the production of either blunt ends or staggered ends. In certain embodiments, fusion polypeptides may be used for targeting cleaved double-stranded DNA.
  • conservative sequence modifications is intended to refer to amino add modifications that do not significantly affect or alter the binding characteristics of the antibody containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into an antibody of the invention by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are ones in which the amino acid residue is replaced with an amino add residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art.
  • amino adds with basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g., aspartic acid, glutamic acid
  • uncharged polar side chains e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cystdne, tryptophan
  • nonpolar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine
  • beta-branched side chains e.g., threonine, valine, isoleucine
  • aromatic side drains e.g., tyrosine, phenylalanine, tryptophan, histidine.
  • one or more amino acid residues within the CDR regions of an antibody can be replaced with other amino add residues from the same side chain family and the altered antibody can be tested for the ability to bind antigens using
  • Co-stimulatory ligand includes a molecule on an antigen presenting cell (e.g., an aAPC, dendritic cell, B cell, and the like) that specifically binds a cognate co-stimulatory molecule on a T cell, thereby providing a signal which, in addition to the primary signal provided by, for instance, binding of a TCR/CD3 complex with an MHC molecule loaded with peptide, mediates a T cell response, including, but not limited to, proliferation, activation, differentiation, and the like.
  • an antigen presenting cell e.g., an aAPC, dendritic cell, B cell, and the like
  • a co-stimulatory ligand can include, but is not limited to, CD7, B7-1 (CD80), B7- 2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin beta receptor, 3/TR6, ILT3, ILT4, HVEM, an agonist or antibody that binds Toll ligand receptor and a ligand that specifically binds with B7-H3.
  • a co-stimulatory ligand also encompasses, inter alia, an antibody that specifically binds with a co-stimulatory molecule present on a T cell, such as, but not limited to, CD27, CD28, 4-1BB, 0X40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds with CD83.
  • an antibody that specifically binds with a co-stimulatory molecule present on a T cell such as, but not limited to, CD27, CD28, 4-1BB, 0X40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds with CD83.
  • A“co-stimulatory molecule” refers to the cognate binding partner on a T cell that specifically binds with a co-stimulatory ligand, thereby mediating a co-stimulatory response by the T cell, such as, but not limited to, proliferation.
  • Co-stimulatory molecules include, but are not limited to an MHC class I molecule, BTLA and a Toll ligand receptor.
  • A“co-stimulatory signal”, as used herein, refers to a signal, which in combination with a primary signal, such as TCR/CD3 ligation, leads to T cell proliferation and/or upregulation or downregulation of key molecules.
  • A“disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal’s health continues to deteriorate.
  • a“disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal’s state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal’s state of health.
  • Donor antigen refers to an antigen expressed by the donor tissue to be transplanted into the recipient.
  • Recipient antigen refers to a target for the immune response to the donor antigen.
  • downstreamregulation refers to the decrease or elimination of gene expression of one or more genes.
  • results may include, but are not limited to an amount that when administered to a mammal, causes a detectable level of immune suppression or tolerance compared to the immune response detected in the absence of the composition of the invention.
  • the immune response can be readily assessed by a plethora of art-recognized methods.
  • the skilled artisan would understand that the amount of the composition administered herein varies and can be readily determined based on a number of factors such as the disease or condition being treated, the age and health and physical condition of the mammal being treated, the severity of the disease, the particular compound being administered, and the like.
  • Encoding refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and die biological properties resulting therefrom.
  • a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system.
  • Both the coding strand the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
  • endogenous refers to any material from or produced inside an organism, cell, tissue or system.
  • epitope is defined as a small chemical molecule on an antigen that can elicit an immune response, inducing B and/or T cell responses.
  • An antigen can have one or more epitopes. Most antigens have many epitopes; i.e., they are multivalent. In general, an epitope is roughly about 10 amino acids and/or sugars in size. In certain exemplary embodiments, die epitope is about 4-18 amino acids, about 5-16 amino acids, about 6-14 amino acids, about 7-12 amino acids, or about 8-10 amino acids.
  • a peptide used in the present invention can be an epitope.
  • the term“exogenous” refers to any material introduced from or produced outside an organism, cell, tissue or system
  • ex vivo refers to cells that have been removed from a living organism, (e.g., a human) and propagated outside the organism (e.g., in a culture dish, test tube, or bioreactor).
  • expression as used herein is defined as the transcription and/or translation of a particular nucleotide sequence driven by its promoter.
  • Expression vector refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed.
  • An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by die host cell or in an in vitro expression system
  • Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., Sendai viruses, lend viruses, retroviruses, adenoviruses, and adeno- associated viruses) that incorporate the recombinant polynucleotide.
  • “Homologous” as used herein refers to the subunit sequence identity between two polymeric molecules, e.g., between two nucleic acid molecules, such as, two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by die same monomeric subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position.
  • the homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 of 10), are matched or homologous, the two sequences are 90% homologous.
  • “Humanized” forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
  • humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a complementary-determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity.
  • humanized antibodies can comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and optimize antibody performance.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence.
  • the humanized antibody optimally also will comprise at least a portion of an
  • Fc immunoglobulin constant region
  • Fully human refers to an immunoglobulin, such as an antibody, where the whole molecule is of human origin or consists of an amino acid sequence identical to a human form of the antibody.
  • Identity refers to the subunit sequence identity between two polymeric molecules particularly between two amino acid molecules, such as, between two polypeptide molecules.
  • two amino acid sequences have the same residues at the same positions; e.g., if a position in each of two polypeptide molecules is occupied by an arginine, then they are identical at that position.
  • the identity or extent to which two amino acid sequences have the same residues at the same positions in an alignment is often expressed as a percentage.
  • the identity between two amino acid sequences is a direct function of the number of matching or identical positions; e.g., if half (e.g., five positions in a polymer ten amino acids in length) of the positions in two sequences are identical, the two sequences are 50% identical; if 90% of the positions (e.g., 9 of 10), are matched or identical, the two amino adds sequences are 90% identical.
  • immunoglobulin or“Ig,” as used herein is defined as a class of proteins, which function as antibodies. Antibodies expressed by B cells are sometimes referred to as the BCR (B cell receptor) or antigen receptor. The five members included in this class of proteins are IgA, IgG, IgM, IgD, and IgE.
  • IgA is the primary antibody that is present in body secretions, such as saliva, tears, breast milk, gastrointestinal secretions and mucus secretions of the respiratory and genitourinary tracts.
  • IgG is the most common circulating antibody.
  • IgM is the main immunoglobulin produced in the primary immune response in most subjects.
  • IgD is the immunoglobulin that has no known antibody function, but may serve as an antigen receptor.
  • IgE is the immunoglobulin that mediates immediate hypersensitivity by causing release of mediators from mast cells and basophils upon exposure to allergen.
  • immune response is defined as a cellular response to an antigen that occurs when lymphocytes identify antigenic molecules as foreign and induce the formation of antibodies and/or activate lymphocytes to remove the antigen.
  • immunological is used herein to refer to increasing overall immune response.
  • immunosuppressive is used herein to refer to reducing overall immune response.
  • an“instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the compositions and methods of the invention.
  • the instructional material of tire kit of the invention may, for example, be affixed to a container which contains the nucleic add, peptide, and/or composition of the invention or be shipped together with a container which contains the nucldc acid, peptide, and/or composition.
  • the instructional material may be shipped separately from the container with the intention that the instructional material and the compound be used
  • isolated means altered or removed from the natural state.
  • a nucleic add or a peptide naturally present in a living animal is not“isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is“isolated.”
  • An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
  • knockdown refers to a decrease in gene expression of one or more genes.
  • A“lentivirus” as used herein refers to a genus of the Retroviridae family.
  • Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell, so they are one of the most efficient methods of a gene delivery vector.
  • HTV, SIV, and FIV are all examples of lentiviruses.
  • Vectors derived from lentiviruses offer the means to achieve significant levels of gene transfer in vivo.
  • polynucleotides, cells and/or antibodies of the invention manifesting a lack of substantially negative biological effects, anti-tumor effects, or substantially negative physiological symptoms toward a healthy cell, non-tumor cell, non-diseased cell, non- target cell or population of such cells either in vitro or in vivo.
  • “modified” as used herein is meant a changed state or structure of a molecule or cell of the invention.
  • Molecules may be modified in many ways, including chemically, structurally, and functionally.
  • Cells may be modified through the introduction of nucleic acids.
  • moduleating mediating a detectable increase or decrease in the level of a response in a subject compared with the level of a response in the subject in the absence of a treatment or compound, and/or compared with the level of a response in an otherwise identical but untreated subject.
  • the term encompasses perturbing and/or affecting a native signal or response thereby mediating a beneficial therapeutic response in a subject, e.g., a human.
  • nucleic acid bases In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. “A” refers to adenosine,“C” refers to cytosine,“G” refers to guanosine,“T” refers to thymidine, and“U” refers to uridine.
  • nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence.
  • the phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding die protein may in some version contain an intron(s).
  • parenteral administration of an immunogenic composition includes, e.g., subcutaneous (s.c.), intravenous (i.v.), intramuscular (i.m), or intrastemal injection, or infusion techniques.
  • nucleic acids are polymers of nucleotides.
  • nucleic acids and polynucleotides as used herein are interchangeable.
  • nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric“nucleotides.” The monomeric nucleotides can be hydrolyzed into nucleosides.
  • polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic add sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCRTM, and the like, and by synthetic means.
  • recombinant means i.e., the cloning of nucleic add sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCRTM, and the like, and by synthetic means.
  • polypeptide As used herein, the terms“peptide,”“polypeptide,” and“protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds.
  • a protein or peptide must contain at least two amino adds, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence.
  • Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds.
  • the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.
  • Polypeptides include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others.
  • the polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
  • self-antigen as used herein is defined as an antigen that is expressed by a host cell or tissue. Self-antigens may be tumor antigens, but in certain
  • embodiments are expressed in both normal and tumor cells.
  • a skilled artisan would readily understand that a self-antigen may be overexpressed in a cell.
  • an antibody which recognizes a specific antigen, but does not substantially recognize or bind other molecules in a sample.
  • an antibody that specifically binds to an antigen from one species may also bind to that antigen from one or more species. But, such cross-species reactivity does not itself alter the classification of an antibody as specific.
  • an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, such cross reactivity does not itself alter the classification of an antibody as specific.
  • the terms“specific binding” or“specifically binding,” can be used in reference to the interaction of an antibody, a protein, or a peptide with a second chemical species, to mean that the interaction is dependent upon the presence of a particular structure (e.g., an antigenic determinant or epitope) on the chemical species; for example, an antibody recognizes and binds to a specific protein structure rather than to proteins generally. If an antibody is specific for epitope“A,” the presence of a molecule containing epitope A (or free, unlabeled A), in a reaction containing labeled “A” and the antibody, will reduce the amount of labeled A bound to the antibody.
  • a particular structure e.g., an antigenic determinant or epitope
  • stimulation is meant a primary response induced by binding of a stimulatory molecule (e.g., a TCR/CD3 complex) with its cognate ligand thereby mediating a signal transduction event, such as, but not limited to, signal transduction via the TCR/CD3 complex.
  • a stimulatory molecule e.g., a TCR/CD3 complex
  • Stimulation can mediate altered expression of certain molecules, such as downregulation of TGF-beta, and/or reorganization of cytoskeletal structures, and the like.
  • A“stimulatory molecule,” as the term is used herein, means a molecule on a T cell that specifically binds with a cognate stimulatory ligand present on an antigen presenting cell.
  • A“stimulatory ligand,” as used herein, means a ligand that when present on an antigen presenting cell (e.g., an aAPC, a dendritic cell, a B-cell, and the like) can specifically bind with a cognate binding partner (referred to herein as a“stimulatory molecule”) on a T cell, thereby mediating a primary response by the T cell, including, but not limited to, activation, initiation of an immune response, proliferation, and the like.
  • an antigen presenting cell e.g., an aAPC, a dendritic cell, a B-cell, and the like
  • a“stimulatory molecule” a cognate binding partner
  • Stimulatory ligands are well-known in the art and encompass, inter alia, an MHC Class I molecule loaded with a peptide, an anti-CD3 antibody, a superagonist anti- CD28 antibody, and a superagonist anti-CD2 antibody.
  • A“subject” is intended to include living organisms in which an immune response can be elicited (e.g., mammals).
  • A“subject” or“patient,” as used therein, may be a human or non-human mammal.
  • Non-human mammals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals.
  • the subject is human.
  • a“substantially purified” cell is a cell that is essentially free of other cell types.
  • a substantially purified cell also refers to a cell which has been separated from other cell types with which it is normally associated in its naturally occurring state.
  • a population of substantially purified cells refers to a homogenous population of cells. In other instances, this term refers simply to cell that have been separated from the cells with which they are naturally associated in their natural state.
  • the cells are cultured in vitro. In other
  • the cells are not cultured in vitro.
  • A“target site” or“target sequence” refers to a genomic nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule may specifically bind under conditions sufficient for binding to occur.
  • T cell receptor refers to a complex of membrane proteins that participate in the activation of T cells in response to the presentation of antigen.
  • the TCR is responsible for recognizing antigens bound to major histocompatibility complex molecules.
  • TCR is composed of a heterodimer of an alpha (a) and beta (b) chain, although in some cells the TCR consists of gamma and delta (g/d) chains.
  • TCRs may exist in alpha/beta and gamma/delta forms, which are structurally similar but have distinct anatomical locations and functions. Each chain is composed of two extracellular domains, a variable and constant domain.
  • the TCR may be modified on any cell comprising a TCR, including, for example, a helper T cell, a cytotoxic T cell, a memory T cell, regulatory T cell, natural killer T cell, and gamma delta T cell.
  • a helper T cell including, for example, a helper T cell, a cytotoxic T cell, a memory T cell, regulatory T cell, natural killer T cell, and gamma delta T cell.
  • therapeutic means a treatment and/or prophylaxis.
  • a therapeutic effect is obtained by suppression, remission, or eradication of a disease state.
  • transfected or“transformed” or“transduced” as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell.
  • A“transfected” or“transformed” or“transduced” cell is one which has been transfected, transformed or transduced with exogenous nucleic acid.
  • the cell includes the primary subject cell and its progeny.
  • To“treat” a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.
  • A“vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell.
  • the term“vector” includes an autonomously repheating plasmid or a virus.
  • the term should also be construed to include non-plasmid and non- viral compounds which facilitate transfer of nucleic add into cells, such as, for example, polylysine compounds, liposomes, and the like.
  • viral vectors include, but are not limited to, Sendai virus vectors, adenovirus vectors, adeno- associated virus vectors, retrovirus vectors, lentivirus vectors, and the like.
  • Xenogeneic refers to any material derived from an animal of a different species.
  • ranges throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
  • the present invention provides MUC1 specific chimeric antigen receptors (CARs; e.g., a Tn-MUCl CAR) and modified cells comprising the same. Also provided are compositions and methods for utilizing MUC1 specific CARs to treat cancer.
  • a Tn-MUCl CAR of the present invention may be suitable for treating both liquid (e.g., multiple myeloma and the like) and solid tumors (e.g., breast cancer, nonsmall cell lung cancer, ovarian and fallopian tube cancer, pancreatic adenocarcinoma and the like).
  • Tn-MUCl is an attractive tumor-specific antigen in various cancers for antibody-directed adoptive immunotherapy.
  • CAR T cells directed against Tn-MUCl demonstrated potent cytolytic activity against cancer cell lines in vitro and significant tumor eradication in vivo.
  • Strategies to target MUC1 outside of the context of tumor-specific glycosylation may demonstrate on-target, off- tumor toxicities, but Tn-MUCl -targeting CAR T cells surmount the potential toxicities and extend the therapeutic window for solid tumors, such as breast cancer.
  • Chimeric Antigen Receptor (CAR) Chimeric Antigen Receptor
  • the present invention provides compositions and methods for modified immune cells or precursor cells thereof, e.g., modified T cells, comprising a chimeric antigen receptor (CAR) having affinity for MUC1 or a glycosylated form of MUC1 (e.g. Tn- MUC1).
  • CAR chimeric antigen receptor
  • a subject CAR of the invention comprises an antigen binding domain (e.g., Tn-MUCl binding domain), a transmembrane domain, a costimulatoiy signaling domain, and an intracellular signaling domain.
  • a subject CAR of the invention may optionally comprise a hinge domain.
  • a subject CAR of the invention comprises an antigen binding domain (e.g., Tn-MUCl binding domain), a hinge domain, a transmembrane domain, a costimulatoiy signaling domain, and an intracellular signaling domain.
  • an antigen binding domain e.g., Tn-MUCl binding domain
  • a hinge domain e.g., a transmembrane domain
  • a costimulatoiy signaling domain e.g., CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34, CD34,
  • the antigen binding domain may be operably linked to another domain of the CAR, such as the transmembrane domain, the costimulatoiy signaling domain or the intracellular signaling domain, each described elsewhere herein, for expression in the cell.
  • a first nucleic acid sequence encoding the antigen binding domain is operably linked to a second nucleic add encoding a transmembrane domain, and further operably linked to a third a nucleic acid sequence encoding a costimulatoiy signaling domain.
  • antigen binding domains described herein can be combined with any of the transmembrane domains, any of the costimulatoiy signaling domains, any of the intracellular signaling domains, or any of the other domains described herein that may be included in a CAR of the present invention.
  • the invention includes a chimeric antigen receptor (CAR) that specifically binds MUC1, comprising: a MUC1 -specific antigen binding domain, optionally a hinge domain, a transmembrane domain, a costimulatoiy signaling domain, and an intracellular signaling domain.
  • CAR chimeric antigen receptor
  • the invention includes a chimeric antigen receptor (CAR) that specifically binds MUC1, comprising: a TnMUCl -specific antigen binding domain, optionally a hinge domain, a transmembrane domain, a costimulatoiy signaling domain, and an intracellular signaling domain.
  • CAR chimeric antigen receptor
  • the invention includes a chimeric antigen receptor (CAR) that specifically binds MUC1, comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain
  • CAR chimeric antigen receptor
  • CDR complementarity determining region
  • the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; a CDS hinge domain; a CDS transmembrane domain; a CD2 costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
  • the invention includes a chimeric antigen receptor (CAR) that specifically binds MUC1, comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain
  • CAR chimeric antigen receptor
  • CDR complementarity determining region
  • the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21 a CDS hinge domain; a CDS transmembrane domain; a 4- IBB costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
  • the invention includes a chimeric antigen receptor (CAR) that specifically binds MUC1, comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain
  • CAR chimeric antigen receptor
  • CDR complementarity determining region
  • the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; a CDS hinge domain; a CDS transmembrane domain; an ICOS costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
  • a genetically modified immune cell e.g., T cell or precursor cell thereof of the present invention comprises a chimeric antigen receptor (CAR) having affinity for MUC1.
  • a genetically modified immune cell e.g., T cell or precursor cell thereof of the present invention comprises a chimeric antigen receptor (CAR) having affinity for Tn-MUCl.
  • the genetically modified cell is a T cell. In certain embodiments, the genetically modified cell is a natural killer (NK) cell. In certain embodiments, the genetically modified cell is aNKT cell.
  • NK natural killer
  • a genetically modified T cell comprising a chimeric antigen receptor (CAR) that specifically binds MUC1, comprising: a MUC1 -specific antigen binding domain, an optional hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
  • CAR chimeric antigen receptor
  • a genetically modified T cell comprising a chimeric antigen receptor (CAR) that specifically binds MUC1, comprising: a TnMUCl-specific antigen binding domain, an optional hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
  • CAR chimeric antigen receptor
  • a genetically modified T cell comprising a chimeric antigen receptor (CAR) that specifically binds MUC1, comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; a CDS hinge domain; a CDS transmembrane domain; a CD2 costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
  • CAR chimeric antigen receptor
  • a genetically modified T cell comprising a chimeric antigen receptor (CAR) that specifically binds MUC1, comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; a CDS hinge domain; a CDS transmembrane domain; a 4- IBB costimulatoiy signaling domain; and a CDS zeta intracellular signaling domain.
  • CAR chimeric antigen receptor
  • a genetically modified T cell comprising a chimeric antigen receptor (CAR) that specifically binds MUC1, comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; a CDS hinge domain; a CDS transmembrane domain; an ICOS costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
  • CAR chimeric antigen receptor
  • the CAR is encoded by a nucleic acid sequence comprising the nucleotide sequence of SEQ ID NOs: 1, 38, 40, 42, 44, or 46. In certain embodiments of the invention, the CAR comprises the amino acid sequence of SEQ ID NOs: 2, 39, 41, 43, 45, or 47.
  • a subject CAR may be a CAR having affinity for Tn-MUCl, comprising a Tn-MUCl binding domain comprising the amino acid sequence set forth in SEQ ID NOs: 4, 5, 6, and/or 19-24.
  • a subject Tn-MUCl CAR may further comprise a leader sequence comprising an amino acid sequence set forth in SEQ ID NO: 48.
  • a subject Tn-MUCl CAR may further comprise a hinge domain comprising an amino acid sequence set forth in SEQ ID NO: 13.
  • a subject Tn-MUCl CAR may further comprise a transmembrane domain comprising an amino acid sequence set forth in SEQ ID NOs: 7 and/or 15.
  • a subject Tn-MUCl CAR may further comprise a costimulatory signaling domain comprising an amino add sequence set forth in SEQ ID NOs: 9, 17, 25, 28, 32, 34, and/or 36.
  • a subject Tn-MUCl CAR may further comprise an intracellular signaling domain comprising an amino acid sequence set forth in SEQ ID NOs: 11 and/or 30.
  • a subject Tn-MUCl CAR may comprise an amino acid sequence set forth in SEQ ID NOs: 2, 39, 41, 43, 45, and/or 47.
  • a subject CAR may be a CAR having affinity for Tn-MUCl, comprising a Tn-MUCl binding domain comprising the amino acid sequence set forth in SEQ ID NOs: 4, 5, 6, and/or 19-24.
  • a subject Tn-MUCl CAR may further comprise a leader sequence comprising an amino acid sequence set forth in SEQ ID NO: 48.
  • a subject Tn-MUCl CAR may further comprise a hinge domain comprising an amino acid sequence set forth in SEQ ID NO: 13.
  • a subject Tn-MUCl CAR may further comprise a transmembrane domain comprising an amino acid sequence set forth in SEQ ID NOs: 7 or 15.
  • a subject Tn-MUCl CAR may further comprise a costimulatory signaling domain comprising an amino add sequence set forth in SEQ ID NOs: 9, 17, 25, 28, 32, 34, or 36.
  • a subject Tn-MUCl CAR may further comprise an intracellular signaling domain comprising an amino add sequence set forth in SEQ ID NOs: 11 or 30.
  • a subjed Tn-MUCl CAR may comprise an amino add sequence set forth in SEQ ID NOs: 2, 39, 41, 43, 45, or 47.
  • the antigen binding domain of a CAR is an extracellular region of the CAR for binding to a specific target antigen including proteins, carbohydrates, and glycolipids.
  • the CAR comprises affinity to a target antigen (e.g. a tumor associated antigen) on a target cell (e.g. a cancer cell).
  • a target antigen e.g. a tumor associated antigen
  • the target antigen may include any type of protein, or epitope thereof, associated with the target cell.
  • the CAR may comprise affinity to a target antigen on a target cell that indicates a particular status of the target cell.
  • the CAR of the invention comprises an antigen binding domain that binds to MUC1.
  • the antigen binding domain binds to a glycosylated form or gly coepitope of MUC1.
  • the antigen binding domain is specific for a truncated gly coepitope of MUC1.
  • the antigen binding domain is specific for Tn-MUCl.
  • the antigen binding domain of the invention comprises an antibody or fragment thereof, that binds to a MUC1 molecule or glycoepitope of MUC1 (Tn- MUCl).
  • the antigen binding domain is an scFv antibody that binds to Tn-MUCl.
  • the choice of antigen binding domain depends upon the type and number of antigens that are present on the surface of a target cell.
  • the antigen binding domain may be chosen to recognize an antigen that acts as a cell surface marker on a target cell associated with a particular status of the target cell.
  • a CAR of the present disclosure having affinity for a specific target antigen on a target cell may comprise a target-specific binding domain.
  • the target-specific binding domain is a murine target-specific binding domain, e.g., the target-specific binding domain is of murine origin.
  • the target-specific binding domain is a human target-specific binding domain, e.g., the target-specific binding domain is of human origin.
  • a CAR of the present disclosure having affinity for Tn-MUCl on a target cell may comprise a Tn-MUCl binding domain.
  • the Tn-MUCl binding domain is a murine Tn-MUCl binding domain, e.g., the Tn-MUCl binding domain is of murine origin.
  • the Tn-MUCl binding domain is a humanized Tn-MUCl binding domain. In some embodiments, the Tn-MUCl binding domain is a human Tn-MUCl binding domain, e.g., the Tn-MUCl binding domain is of human origin.
  • the Tn-MUCl binding domain is derived from the 5E5 antibody disclosed in PCT Publication No. W02008/040362, the disclosure of which is incorporated herein by reference in its entirety. Accordingly, a CAR of the present disclosure comprises a Tn-MUCl binding domain derived from the 5E5 antibody disclosed in PCT Publication No. W02008/040362.
  • the Tn- MUCl binding domain is a humanized Tn-MUCl binding domain.
  • the humanized Tn-MUCl binding domain is derived from any one of the humanized 5E5 heavy and light drain sequences disclosed in PCT Publication No. WO2015/159076, the disclosure of which is incorporated herein by reference in its entirety.
  • a CAR of the present disclosure comprises a humanized Tn- MUCl binding domain derived from any one of tire humanized 5E5 heavy and light chain sequences disclosed in PCT Publication No. WO2015/159076.
  • a CAR of the present disclosure may comprise a humanized Tn-MUCl binding domain, any transmembrane domain, optionally any hinge domain, any costimulatory domain and any intracellular signaling domain as disclosed herein.
  • a CAR of the present disclosure may have affinity for one or more target antigens on one or more target cells.
  • a CAR may have affinity for one or more target antigens on a single target cell.
  • the CAR is a bispecific CAR, or a multispecific CAR
  • the CAR comprises one or more target-specific binding domains that confer affinity for one or more target antigens.
  • the CAR comprises one or more target-specific binding domains that confer affinity for the same target antigen.
  • a CAR comprising one or more target-specific binding domains having affinity for the same target antigen could bind distinct epitopes of the target antigen.
  • the binding domains may be arranged in tandem and may be separated by linker peptides.
  • the binding domains are connected to each other covalently on a single polypeptide drain, through a polypeptide linker, an Fc hinge region, or a membrane hinge region.
  • the antigen binding domain can include any domain that binds to the antigen and may include, but is not limited to, a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a non-human antibody, and any fragment thereof.
  • the antigen binding domain portion comprises a mammalian antibody or a fragment thereof.
  • the antigen binding domain of the CAR is selected from the group consisting of an anti -Tn-MUCl antibody or a fragment thereof. In some embodiments, the antigen binding domain is selected from the group consisting of an antibody, an antigen binding fragment (Fab), and a single-chain variable fragment (scFv). In some embodiments, a Tn-MUCl binding domain of the present invention is selected from the group consisting of a Tn-MUCl -specific antibody, a Tn-MUCl -specific Fab, and a Tn- MUCl -specific scFv. In one embodiment, a Tn-MUCl binding domain is a Tn-MUCl - specific antibody. In one embodiment, a Tn-MUCl binding domain is a Tn-MUCl - specific Fab. In one embodiment, a Tn-MUCl binding domain is a Tn-MUCl -specific scFv.
  • the term“single-chain variable fragment” or“scFv” is a fusion protein of the variable regions of the heavy (VH) and light chains (VL) of an immunoglobulin (e.g., mouse or human) covalently linked to form a VH:: VL heterodimer.
  • the heavy (VH) and light chains (VL) are either joined directly or joined by a peptide-encoding linker or spacer, which connects the N-terminus of the VH with the C -terminus of the VL, or the C -terminus of die VH with the N-terminus of the VL.
  • linker and“spacer” are used interchangeably herein.
  • the antigen binding domain (e.g., Tn-MUCl binding domain) comprises an scFv having the configuration from N-terminus to C -terminus, VH - linker - VL.
  • the antigen binding domain (e.g., Tn-MUCl binding domain) comprises an scFv having the configuration from N-terminus to C -terminus, VL - linker - VH.
  • the linker is typically rich in glycine for flexibility, as well as serine or threonine for solubility.
  • the linker can link the heavy chain variable region and the light chain variable region of die extracellular antigen-binding domain.
  • Non-limiting examples of linkers are disclosed in Shen et ai., Anal. Chem. 80(6): 1910-1917 (2008) and WO 2014/087010, the contents of which are hereby incorporated by reference in their entireties.
  • GS linkers such as (GS)n, (GSGGS)n (SEQ ID NO: 52), (GGGS)n (SEQ ID NO: 53), and (GGGGS) utilizat(SEQ ID NO: 54), where n represents an integer of at least 1.
  • Exemplary linker sequences can comprise amino acid sequences including, without limitation, GGSG (SEQ ID NO: 55), GGSGG (SEQ ID NO: 56), GSGSG (SEQ ID NO: 57), GSGGG (SEQ ID NO: 58), GGGSG (SEQ ID NO: 59), GSSSG (SEQ ID NO: 60), GGGGS (SEQ ID NO: 61), GGGGSGGGGSGGGGS (SEQ ID NO: 62) and the like.
  • GGSG SEQ ID NO: 55
  • GGSGG SEQ ID NO: 56
  • GSGSG SEQ ID NO: 57
  • GSGGG SEQ ID NO: 58
  • GGGSG SEQ ID NO: 59
  • GSSSG SEQ ID NO: 60
  • GGGGS SEQ ID NO: 61
  • GGGGSGGGGSGGGGS SEQ ID NO: 62
  • an antigen binding domain e.g., Tn-MUCl binding domain
  • Tn-MUCl binding domain comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH and VL is separated by the linker sequence having the amino acid sequence
  • GGGGSGGGGSGGGGS (SEQ ID NO: 62), which may be encoded by a nucleic acid sequence comprising the nucleotide sequence GGTGGCGGTGGCTCGGGCGG TGGTGGGTCGGGTGGCGGCGGATCT (SEQ ID NO: 63).
  • Single drain Fv polypeptide antibodies can be expressed from a nucleic acid comprising VH- and VL- encoding sequences as described by Huston, et al. (Proc. Nat. Acad. Sci. USA, 85:5879- 5883, 1988). See, also, U.S. Patent Nos. 5,091,513, 5,132,405 and 4,956,778; and U.S. Patent Publication Nos. 20050196754 and 20050196754.
  • Antagonistic scFvs having inhibitory activity have been described (see, e.g., Zhao et al., Hybridoma (Larchmt) 2008 27(6):455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 August 12; Shieh et al., JImunol 2009 183(4):2277-85; Giomarelli et al., Thromb Haemost 2007
  • Tab refers to a fragment of an antibody structure that binds to an antigen but is monovalent and does not have a Fc portion, for example, an antibody digested by the enzyme papain yields two Fab fragments and an Fc fragment (e.g., a heavy (H) chain constant region; Fc region that does not bind to an antigen).
  • an antibody digested by the enzyme papain yields two Fab fragments and an Fc fragment (e.g., a heavy (H) chain constant region; Fc region that does not bind to an antigen).
  • “F(ab')2” refers to an antibody fragment generated by pepsin digestion of whole IgG antibodies, wherein this fragment has two antigen binding (ah') (bivalent) regions, wherein each (ah') region comprises two separate amino add chains, a part of a H chain and a light (L) chain linked by an S— S bond for binding an antigen and where the remaining H chain portions are linked together.
  • A“F(ab')2” fragment can be split into two individual Fab' fragments.
  • the antigen binding domain may be derived from the same species in which the CAR will ultimately be used.
  • the antigen binding domain of the CAR may comprise a human antibody as described elsewhere herein, or a fragment thereof.
  • a Tn-MUCl CAR of the present invention comprises a Tn-MUCl binding domain, e.g., a Tn-MUCl -specific scFv.
  • the Tn-MUCl binding domain comprises the amino acid sequence set forth in SEQ ID NO: 4.
  • the Tn-MUCl binding domain is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO:
  • the Tn-MUCl binding domain comprises a light chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 6.
  • the light chain variable region of the Tn-MUCl binding domain comprises three light chain complementarity-determining regions (CDRs).
  • CDRs light chain complementarity-determining regions
  • a“complementarity- determining region” or“CDR” refers to a region of the variable drain of an antigen binding molecule that binds to a specific antigen.
  • a Tn-MUCl binding domain may comprise a light chain variable region that comprises a CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 19; a CDR2 comprising an amino add sequence set forth in SEQ ID NO: 20; and a CDRS comprising an amino acid sequence set forth in SEQ ID NO: 21.
  • the Tn-MUCl binding domain comprises a heavy chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 5.
  • a Tn- MUCl binding domain may comprise a heavy chain variable region that comprises a CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 22; a CDR2 comprising an amino acid sequence set forth in SEQ ID NO: 23; and a CDRS comprising an amino acid sequence set forth in SEQ ID NO: 24.
  • Tn-MUCl binding domain comprises an amino acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 4-6 and 19-24.
  • the Tn-MUCl binding domain is encoded by a nucleic acid sequence comprising the nucleotide sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 3.
  • the antigen binding domain may be operably linked to another domain of the CAR, such as the transmembrane domain or the costimulatoiy signaling domain, both described elsewhere herein.
  • a nucleic add encoding the antigen binding domain is operably linked to a nucleic acid encoding a transmembrane domain and a nucleic acid encoding a costimulatoiy signaling domain.
  • antigen binding domains described herein such as the antibody or fragment thereof that binds to Tn-MUCl, can be combined with any of the transmembrane domains described herein, any of the intracellular domains or cytoplasmic domains described herein, or any of the other domains described herein that may be included in the CAR
  • the CAR of the present invention can be designed to comprise a transmembrane domain that connects the antigen binding domain of the CAR to the intracellular domain.
  • the transmembrane domain of a subject CAR is a region that is capable of spanning the plasma membrane of a cell (e.g., an immune cell or precursor thereof).
  • transmembrane domain is for insertion into a cell membrane, e.g., a eukaryotic cell membrane.
  • the transmembrane domain is interposed between the antigen binding domain and the intracellular domain of a CAR
  • the transmembrane domain is naturally associated with one or more of the domains in the CAR.
  • the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.
  • the transmembrane domain may be derived either from a natural or from a synthetic source. Where the source is natural, the domain may be derived from any membrane-bound or transmembrane protein, e.g., a Type I transmembrane protein. Where the source is synthetic, the transmembrane domain may be any artificial sequence that facilitates insertion of the CAR into a cell membrane, e.g., an artificial hydrophobic sequence.
  • transmembrane regions of particular use in this invention include, without limitation, transmembrane domains derived from (i.e., comprise at least the transmembrane region(s) of) the alpha, beta or zeta chain of the T- cell receptor, CD28, CD2, CD3 epsilon, CD45, CD4, CDS, CD7, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9.
  • the transmembrane domains derived from (i.e., comprise at least the transmembrane region(s) of) the alpha, beta or zeta chain of the T- cell receptor, CD28, CD2, CD3 epsilon
  • transmembrane domain may be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine.
  • a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.
  • transmembrane domains described herein can be combined with any of the antigen binding domains described herein, any of the costimulatory signaling domains described herein, any of the intracellular signaling domains described herein, or any of the other domains described herein that may be included in a subject CAR.
  • the transmembrane domain further comprises a hinge region.
  • a subject CAR of the present invention may also include a hinge region.
  • the hinge region of the CAR is a hydrophilic region which is located between the antigen binding domain and the transmembrane domain. In some embodiments, this domain facilitates proper protein folding for the CAR.
  • the hinge region is an optional component for the CAR
  • the hinge region may include a domain selected from Fc fragments of antibodies, hinge regions of antibodies, CH2 regions of antibodies, CH3 regions of antibodies, artificial hinge sequences or combinations thereof.
  • hinge regions include, without limitation, a CD8a hinge, artificial hinges made of polypeptides which may be as small as, three glycines (Gly), as well as CHI and CHS domains of IgGs (such as human IgG4).
  • a subject CAR of the present disclosure includes a hinge region that connects the antigen binding domain with the transmembrane domain, which, in turn, connects to the intracellular domain.
  • the hinge region is preferably capable of supporting the antigen binding domain to recognize and bind to the target antigen on the target cells (see, e.g., Hudecek et al., Cancer Immunol. Res. (2015) 3(2): 125-135).
  • the hinge region is a flexible domain, thus allowing the antigen binding domain to have a structure to optimally recognize the specific structure and density of the target antigens on a cell such as tumor cell. The flexibility of the hinge region permits the hinge region to adopt many different conformations.
  • the hinge region is an immunoglobulin heavy chain hinge region. In some embodiments, the hinge region is a hinge region polypeptide derived from a receptor (e.g., a CD8-derived hinge region).
  • the hinge region can have a length of from about 4 amino acids to about 50 amino acids, e.g., from about 4 amino acids to about 10 amino acids, from about 10 amino adds to about 15 amino acids, from about 15 amino acids to about 20 amino acids, from about 20 amino acids to about 25 amino acids, from about 25 amino adds to about 30 amino acids, from about 30 amino acids to about 40 amino acids, or from about 40 amino acids to about 50 amino acids.
  • Suitable hinge regions can be readily selected and can be of any of a number of suitable lengths, such as from 1 amino acid (e.g., Gly) to 20 amino adds, from 2 amino acids to 15 amino acids, from 3 amino acids to 12 amino acids, including 4 amino acids to 10 amino adds, 5 amino acids to 9 amino acids, 6 amino acids to 8 amino acids, or 7 amino adds to 8 amino acids, and can be 1, 2, 3, 4, 5, 6, or 7 amino acids.
  • 1 amino acid e.g., Gly
  • suitable lengths such as from 1 amino acid (e.g., Gly) to 20 amino adds, from 2 amino acids to 15 amino acids, from 3 amino acids to 12 amino acids, including 4 amino acids to 10 amino adds, 5 amino acids to 9 amino acids, 6 amino acids to 8 amino acids, or 7 amino adds to 8 amino acids, and can be 1, 2, 3, 4, 5, 6, or 7 amino acids.
  • hinge regions include glycine polymers (G) neighbor, glydne-serine polymers (including, for example, (GS)n, (GSGGS) opposition (SEQ ID NO: 52) and (GGGS)n (SEQ ID NO: 53), where n is an integer of at least one), glycine-alanine polymers, alanine-serine polymers, and other flexible linkers known in the art.
  • Glydne and glycine-serine polymers can be used; both Gly and Ser are relatively unstructured, and therefore can serve as a neutral tether between components.
  • Glycine polymers can be used; glycine accesses significantly more phi-psi space than even alanine, and is much less restricted than residues with longer side drains (see, e.g., Scheraga, Rev.
  • Exemplary hinge regions can comprise amino acid sequences including, but not limited to, GGSG (SEQ ID NO: 55), GGSGG (SEQ ID NO: 56), GSGSG (SEQ ID NO: 57), GSGGG (SEQ ID NO: 58), GGGSG (SEQ ID NO: 59), GSSSG (SEQ ID NO: 60), and the like.
  • the hinge region is an immunoglobulin heavy chain hinge region.
  • Immunoglobulin hinge region amino acid sequences are known in the art; see, e.g., Tan et al., Proc. Natl. Acad. Sci. USA (1990) 87(1): 162-166; and Huck et al., Nucleic Acids Res. (1986) 14(4): 1779-1789.
  • an immunoglobulin heavy chain hinge region amino acid sequences
  • immunoglobulin hinge region can include one of the following amino add sequences: DKTHT (SEQ ID NO: 64); CPPC (SEQ ID NO: 65); CPEPKSCDTPPPCPR (SEQ ID NO: 66) (see, e.g., Glaser et al., J. Biol. Chem. (2005) 280:41494-41503);
  • ELKTPLGDTTHT SEQ ID NO: 67
  • KSCDKTHTCP SEQ ID NO: 68
  • KCCVDCP SEQ ID NO: 69
  • KYGPPCP SEQ ID NO: 70
  • EPKSCDKTHTCPPCP SEQ ID NO: 71
  • ERKCCVECPPCP SEQ ID NO: 72
  • ELKTPLGDTTHTCPRCP SEQ ID NO: 73
  • SPNMVPHAHHAQ (SEQ ID NO: 74) (human IgG4 hinge); and the like.
  • the hinge region can comprise an amino add sequence of a human IgGl, IgG2, IgG3, or IgG4, hinge region.
  • the hinge region can include one or more amino acid substitutions and/or insertions and/or deletions compared to a wild- type (naturally-occurring) hinge region.
  • His229 of human IgGl hinge can be substituted with Tyr, so that the hinge region comprises the sequence
  • EPKSCDKTYTCPPCP (SEQ ID NO: 75); see, e.g., Yan et al., J. Biol. Chem. (2012) 287: 5891-5897.
  • the hinge region can comprise an amino add sequence derived from human CDS, or a variant thereof.
  • the transmembrane domain comprises a CD8a
  • a subjed CAR comprises a CD8a transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO: 7, which may be encoded by a nucleic add sequence comprising the nucleotide sequence set forth in SEQ ID NO: 8.
  • a subject CAR comprises a CD8a hinge domain and a CD8a transmembrane domain.
  • the CD8a hinge domain comprises the amino add sequence set forth in SEQ ID NO: 13, which may be encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 14.
  • the transmembrane domain comprises a CD28
  • a subject CAR comprises a CD28 transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO:
  • nucleic add sequence comprising the nucleotide sequence set forth in SEQ ID NO: 16.
  • a transmembrane domain or hinge domain comprises an amino acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any of the amino add sequences set forth in SEQ ID NO: 7, 13, and 15.
  • a transmembrane domain or hinge domain is encoded by a nucldc acid sequence comprising the nucleotide sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any of the nucleotide sequences set forth in SEQ ID NO: 8, 14, and 16.
  • the transmembrane domain may be combined with any hinge domain and/or may comprise one or more transmembrane domains described herein.
  • transmembrane domains described herein such as a transmembrane region of alpha, beta or zeta chain of the T-cell receptor, CD28, CD2, CD3 epsilon, CD45, CD4, CDS, CD7, CDS, CD9, CD 16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9, can be combined with any of the antigen binding domains described herein, any of the costimulatoiy signaling domains or intracellular domains or cytoplasmic domains described herein, or any of the other domains described herein that may be included in the CAR
  • the transmembrane domain may be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine.
  • a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.
  • a subject CAR may further comprise, between the extracellular domain and the transmembrane domain of the CAR, or between the intracellular domain and the transmembrane domain of the CAR, a spacer domain.
  • spacer domain generally means any oligo- or polypeptide that functions to link the transmembrane domain to, either the extracellular domain or, the intracellular domain in the polypeptide chain.
  • a spacer domain may comprise up to 300 amino adds, e.g., 10 to 100 amino acids, or 25 to 50 amino acids.
  • the spacer domain may be a short oligo- or polypeptide linker, e.g., between 2 and 10 amino acids in length.
  • glycine-serine doublet provides a particularly suitable linker between the transmembrane domain and the intracellular signaling domain of the subject CAR.
  • a subject CAR of the present disclosure may comprise any of the transmembrane domains, hinge domains, or spacer domains described herein.
  • a subject CAR of the present invention also includes an intracellular domain.
  • the intracellular domain of the CAR is responsible for activation of at least one of the effector functions of the cell in which the CAR is expressed (e.g., immune cell).
  • the intracellular domain transduces the effector function signal and directs the cell (e.g., immune cell) to perform its specialized function, e.g., harming and/or destroying a target cell.
  • the intracellular domain or otherwise the cytoplasmic domain of the CAR is responsible for activation of the cell in which the CAR is expressed.
  • Examples of an intracellular domain for use in the invention include, but are not limited to, the cytoplasmic portion of a surface receptor, co-stimulatoiy molecule, and any molecule that acts in concert to initiate signal transduction in the T cell, as well as any derivative or variant of these elements and any synthetic sequence that has the same functional capability.
  • the intracellular domain comprises a costimulatory signaling domain. In certain embodiments, the intracellular domain comprises an intracellular signaling domain. In certain embodiments, the intracellular domain comprises a costimulatory signaling domain and an intracellular signaling domain. In certain embodiments, the intracellular domain comprises 4-1BB and CDS zeta. In certain embodiments, the costimulatoiy signaling domain comprises 4-1BB. In certain embodiments, the intracellular signaling domain comprises CDS zeta.
  • the intracellular domain of the CAR comprises a costimulatoiy signaling domain which includes any portion of one or more costimulatory molecules, such as at least one signaling domain from CD2, CDS, CDS, CD27, CD28, 0X40, ICOS, 4-1BB, PD-1, any derivative or variant thereof, any synthetic sequence thereof that has the same functional capability, and any combination thereof.
  • a costimulatoiy signaling domain which includes any portion of one or more costimulatory molecules, such as at least one signaling domain from CD2, CDS, CDS, CD27, CD28, 0X40, ICOS, 4-1BB, PD-1, any derivative or variant thereof, any synthetic sequence thereof that has the same functional capability, and any combination thereof.
  • intracellular signaling domain examples include, without limitation, the z chain of the T cell receptor complex or any of its homologs, e.g., h chain, FcsRIy and b chains, MB 1 (Iga) chain, B29 (Ig) chain, etc., human CDS zeta chain, CDS
  • the intracellular signaling domain may be human CDS zeta chain, FcyRin, FcsRI, cytoplasmic tails of Fc receptors, an immunoreceptor tyrosine-based activation motif (IT AM) bearing cytoplasmic receptors, and combinations thereof.
  • intracellular domain examples include a fragment or domain from one or more molecules or receptors including, but are not limited to, TCR, CDS zeta, CDS gamma, CDS delta, CDS epsilon, CD86, common FcR gamma, FcR beta (Fc Epsilon Rib), CD79a, CD79b, Fc gamma R1 la, DAP10, DAP12, T cell receptor (TCR), CDS, CD27, CD28, 4-1BB (CD137), 0X9, 0X40, CD30, CD40, PD-1, ICOS, a KIR family protein, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83, CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKpSO (KLRF1), CD127, CD160, CD
  • intracellular domains include, without limitation, intracellular signaling domains of several types of various other immune signaling receptors, including, but not limited to, first, second, and third generation T cell signaling protdns including CDS, B7 family costimulatory, and Tumor Necrosis Factor Receptor (TNFR) superfamily receptors (see, e.g., Park and Brentjens, J. Clin. Oncol. (2015) 33(6): 651-653). Additionally, intracellular signaling domains may include signaling domains used by NK and NKT cells (see, e.g., Hermanson and Kaufman, Front. Immunol.
  • Intracellular signaling domains suitable for use in a subject CAR of the present invention include any desired signaling domain that provides a distinct and detectable signal (e.g., increased production of one or more cytokines by the cell; change in transcription of a target gene; change in activity of a protein; change in cell behavior, e.g., cell death; cellular proliferation; cellular differentiation; cell survival; modulation of cellular signaling responses; etc.) in response to activation of the CAR (i.e., activated by antigen and dimerizing agent).
  • the intracellular signaling domain includes at least one (e.g., one, two, three, four, five, six, etc.) GGAM motifs as described below.
  • the intracellular signaling domain includes DAP10/CD28 type signaling chains.
  • the intracellular signaling domain is not covalently attached to the membrane bound CAR, but is instead diffused in the cytoplasm.
  • Intracellular signaling domains suitable for use in a subject CAR of the present invention include immunoreceptor tyrosine-based activation motif (ITAM)-containing intracellular signaling polypeptides.
  • ITAM immunoreceptor tyrosine-based activation motif
  • an IT AM motif is repeated twice in an intracellular signaling domain, where the first and second instances of the ITAM motif are separated from one another by 6 to 8 amino adds.
  • the intracellular signaling domain of a subject CAR comprises 3 ITAM motifs.
  • intracellular signaling domains includes the signaling domains of human immunoglobulin receptors that contain immunoreceptor tyrosine based activation motifs (IT AMs) such as, but not limited to, Fc gamma RI, Fc gamma RIIA, Fc gamma RIIC, Fc gamma RIIIA, FcRL5 (see, e.g., Gillis et al., Front (2014) Immunol. 5:254).
  • IT AMs immunoreceptor tyrosine based activation motifs
  • a suitable intracellular signaling domain can be an IT AM motif-containing portion that is derived from a polypeptide that contains an GGAM motif.
  • a suitable intracellular signaling domain can be an ITAM motif-containing domain from any ITAM motif-containing protein.
  • a suitable intracellular signaling domain need not contain the entire sequence of the entire protein from which it is derived.
  • ITAM motif-containing polypeptides include, but are not limited to: DAP12, FCER1G (Fc epsilon receptor I gamma chain), CD3D (CDS delta), CD3E (CDS epsilon), CD3G (CDS gamma), CD3Z (CDS zeta), and CD79A (antigen receptor complex-associated protein alpha chain).
  • the intracellular signaling domain is derived from DAP 12 (also known as TYROBP; TYRO protein tyrosine kinase binding protein; KARAP; PLOSL; DNAX-activation protein 12; KAR-associated protein; TYRO protein tyrosine kinase-binding protein; killer activating receptor associated protein; killer-activating receptor-associated protein; etc.).
  • DAP 12 also known as TYROBP; TYRO protein tyrosine kinase binding protein; KARAP; PLOSL; DNAX-activation protein 12; KAR-associated protein; TYRO protein tyrosine kinase-binding protein; killer activating receptor associated protein; killer-activating receptor-associated protein; etc.
  • the intracellular signaling domain is derived from FCER1G (also known as FCRG; Fc epsilon receptor I gamma chain; Fc receptor gamma-chain; fc-epsilon RI -gamma; fcR gamma; fceRl gamma; high affinity immunoglobulin epsilon receptor subunit gamma; immunoglobulin E receptor, high affinity, gamma chain; etc.).
  • FCER1G also known as FCRG
  • Fc epsilon receptor I gamma chain Fc receptor gamma-chain
  • fcR gamma fceRl gamma
  • high affinity immunoglobulin epsilon receptor subunit gamma immunoglobulin E receptor, high affinity, gamma chain; etc.
  • the intracellular signaling domain is derived from T-cell surface glycoprotein CDS delta chain (also known as CD3D; CD3- DELTA; T3D; CDS antigen, delta subunit; CDS delta; CD3d antigen, delta polypeptide (TiT3 complex); OKT3, delta chain; T-cell receptor T3 delta chain; T-cell surface glycoprotein CDS delta chain; etc.).
  • CDS delta chain also known as CD3D; CD3- DELTA; T3D; CDS antigen, delta subunit; CDS delta; CD3d antigen, delta polypeptide (TiT3 complex); OKT3, delta chain; T-cell receptor T3 delta chain; T-cell surface glycoprotein CDS delta chain; etc.
  • the intracellular signaling domain is derived from T-cell surface glycoprotein CDS epsilon chain (also known as CD3e, T-cell surface antigen T3/Leu-4 epsilon chain, T-cell surface glycoprotein CDS epsilon chain, AI504783, CDS, CDSepsilon, T3e, etc.).
  • the intracellular signaling domain is derived from T-cell surface glycoprotein CDS gamma chain (also known as CD3G, T-cell receptor T3 gamma chain, CD3-GAMMA, T3G, gamma polypeptide (TiT3 complex), etc.).
  • the intracellular signaling domain is derived from T-cell surface glycoprotein CDS zeta chain (also known as CD3Z, T-cell receptor T3 zeta chain, CD247, CD3-ZETA, CD3H, CD3Q, T3Z, TCRZ, etc.).
  • the intracellular signaling domain is derived from CD79A (also known as B-cell antigen receptor complex-associated protein alpha chain; CD79a antigen (immunoglobulin-assodated alpha); MB-1 membrane glycoprotein; Ig-alpha; membrane-bound immunoglobulin-associated protein; surface IgM-associated protein; etc.).
  • an intracellular signaling domain suitable for use in a subject CAR of the present disclosure includes a DAP10/CD28 type signaling chain. In one embodiment, an intracellular signaling domain suitable for use in a subject CAR of the present disclosure includes a ZAP70 polypeptide. In some embodiments, the intracellular signaling domain includes a cytoplasmic signaling domain of TCR zeta, FcR gamma, FcR beta, CDS gamma, CDS delta, CDS epsilon, CDS, CD22, CD79a, CD79b, or CD66d. In one embodiment, the intracellular signaling domain in the CAR includes a cytoplasmic signaling domain of human CDS zeta.
  • intracellular signaling domain While usually the entire intracellular signaling domain can be employed, in many cases it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such truncated portion may be used in place of the intact chain as long as it transduces the effector function signal.
  • the intracellular signaling domain includes any truncated portion of the intracellular signaling domain sufficient to transduce the effector function signal.
  • intracellular signaling domains described herein can be combined with any of tire costimulatory signaling domains described herein, any of the antigen binding domains described herein, any of the transmembrane domains described herein, or any of tiie other domains described herein that may be included in the CAR
  • variant intracellular signaling domains suitable for use in a subject CAR are known in the art.
  • the YMFM motif is found in ICOS and is a SH2 binding motif that recruits both p85 and pSOalpha subunits of PI3K, resulting in enhanced AKT signaling. See, e.g., Simpson et al. (2010) Curr. Opin. Immunol., 22:326-332.
  • a CD28 intracellular domain variant may be generated to comprise a YMFM motif.
  • the intracellular domain of a subject CAR comprises a 4- 1BB costimulatory domain comprising the amino add sequence set forth in SEQ ID NO: 9, which may be encoded by a nucleic add sequence comprising the nucleotide sequence set forth in SEQ ID NO: 10.
  • the intracellular domain of a subject CAR comprises a CD28 costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO: 17, which may be encoded by a nucleic add sequence comprising the nucleotide sequence set forth in SEQ ID NO: 18.
  • the intracellular domain of a subject CAR comprises an ICOS
  • the intracellular domain of a subject CAR comprises a CD2 costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO: 28, which may be encoded by a nucleic add sequence comprising the nucleotide sequence set forth in SEQ ID NO: 29.
  • the intracellular domain of a subject CAR comprises a CD28 YMFM variant costimulatoiy domain comprising the amino add sequence set forth in SEQ ID NO: 32, which may be encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 33.
  • the intracellular domain of a subject CAR comprises a CD27 costimulatoiy domain comprising the amino acid sequence set forth in SEQ ID NO: 34, which may be encoded by a nucleic add sequence comprising the nucleotide sequence set forth in SEQ ID NO: 35.
  • the intracellular domain of a subject CAR comprises a 0X40
  • costimulatoiy domain comprising the amino acid sequence set forth in SEQ ID NO: 36, which may be encoded by a nucleic add sequence comprising the nucleotide sequence set forth in SEQ ID NO: 37.
  • the intracellular domain of a subjed CAR comprises a CD3 zeta intracellular signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 11 or 30, which may be encoded by a nucleic add sequence comprising the nucleotide sequence set forth in SEQ ID NO: 12 or 31.
  • the intracellular domain comprises an amino acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 9, 11, 17, 25, 28, 32, 34, or 36.
  • the intracellular domain is encoded by a nucleic acid sequence comprising a nucleotide sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any of the nucleotide sequences set forth in SEQ ID NOs: 10, 12, 18, 26, 27, 29, 31, 33, 35, or 37.
  • the intracellular domain of a subjed CAR comprises an ICOS costimulatoiy domain and a CD3 zeta intracellular signaling domain.
  • the intracellular domain of a subject CAR comprises a CD28
  • the intracellular domain of a subject CAR comprises a CD28 YMFM variant costimulatoiy domain and a CD3 zeta intracellular signaling domain. In one embodiment, the intracellular domain of a subject CAR comprises a CD27
  • the intracellular domain of a subject CAR comprises a 0X40
  • the intracellular domain of a subject CAR comprises a 4- IBB
  • the intracellular domain of a subject CAR comprises a CD2 costimulatoiy domain and a CD3 zeta intracellular signaling domain.
  • a subject CAR of the present invention may be a CAR having affinity for MUC1 (e.g. MUC1).
  • the Tn-MUCl CAR of the present invention comprises a 4- IBB costimulatoiy domain and a CDS zeta intracellular signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 2, which may be encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 1.
  • the Tn-MUCl CAR of the present invention comprises a CD28 costimulatoiy domain and a CDS zeta intracellular signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 39, which may be encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 38.
  • the Tn-MUCl CAR of the present invention comprises a CD28 YMFM variant costimulatoiy domain and a CD3 zeta intracellular signaling domain comprising the amino add sequence set forth in SEQ ID NO: 41, which may be encoded by a nucleic add sequence comprising the nucleotide sequence set forth in SEQ ID NO: 40.
  • the Tn-MUCl CAR of the present invention comprises a CD27 costimulatoiy domain and a CD3 zeta intracellular signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 43, which may be encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 42.
  • the Tn-MUCl CAR of the present invention comprises a 0X40 costimulatoiy domain and a CD3 zeta intracellular signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 45, which may be encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 44.
  • the Tn-MUCl CAR of the present invention comprises a CD2
  • costimulatoiy domain and a CD3 zeta intracellular signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 47, which may be encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 46.
  • the CAR comprises an amino acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NOs: 2, 39, 41, 43, 45, or 47.
  • the CAR is encoded by a nucleic add sequence comprising a nucleotide sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 1, 38, 40, 42, 44, or 46.
  • a subject CAR of the present invention comprises a MUC1 binding domain and a transmembrane domain.
  • the CAR comprises a MUC1 binding domain and a transmembrane domain, wherein the transmembrane domain comprises a CDS hinge region.
  • the CAR comprises a MUC1 binding domain and a transmembrane domain, wherein the transmembrane domain comprises a CD8a transmembrane domain.
  • the CAR comprises a MUC1 binding domain and a transmembrane domain, wherein the transmembrane domain comprises a CDS hinge region and a CD8a transmembrane domain.
  • a subject CAR of the present invention comprises a MUC1 binding domain, a transmembrane domain, and an intracellular domain.
  • the CAR comprises a Tn-MUCl binding domain, a transmembrane domain, and an intracellular domain.
  • the CAR comprises a Tn- MUCl binding domain, a transmembrane domain, and an intracellular domain comprising a 4- IBB costimulatoiy domain and a CDS zeta domain.
  • the CAR comprises a Tn-MUCl binding domain, a transmembrane domain, and an intracellular domain comprising a CD28 costimulatoiy domain and a CDS zeta domain.
  • the CAR comprises a Tn-MUCl binding domain, a transmembrane domain, and an intracellular domain comprising a CD28 YMFM variant costimulatoiy domain and a CDS zeta domain. In one embodiment, the CAR comprises a Tn-MUCl binding domain, a transmembrane domain, and an intracellular domain comprising a CD27 domain and a CDS zeta domain. In one embodiment, the CAR comprises a Tn- MUCl binding domain, a transmembrane domain, and an intracellular domain comprising an 0X40 domain and a CDS zeta domain. In one embodiment, the CAR comprises a Tn-MUCl binding domain, a transmembrane domain, and an intracellular domain comprising a CD2 domain and a CDS zeta domain.
  • the present invention provides a modified immune cell or precursor cell thereof, e.g., a modified T cell, a modified NK cell, a modified NKT cell, comprising a chimeric antigen receptor (CAR) having affinity for MUC1 as described herein.
  • a modified immune cell or precursor cell thereof e.g., a modified T cell, a modified NK cell, a modified NKT cell, comprising a chimeric antigen receptor (CAR) having affinity for MUC1 as described herein.
  • CAR chimeric antigen receptor
  • the antigen binding domains of the CAR comprise human antibodies or fragments thereof.
  • Fully human antibodies are particulaiiy desirable for therapeutic treatment of human subjects.
  • Human antibodies can be made by a variety of methods known in the art including phage display methods using antibody libraries derived from human immunoglobulin sequences, including improvements to these techniques. See, also, U.S. Pat. Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated herein by reference in its entirety.
  • Human antibodies can also be produced using transgenic mice which are incapable of expressing functional endogenous immunoglobulins, but which can express human immunoglobulin genes.
  • the human heavy and light chain immunoglobulin gene complexes may be introduced randomly or by homologous recombination into mouse embryonic stem cells.
  • the human variable region, constant region, and diversity region may be introduced into mouse embryonic stem cells in addition to the human heavy and light chain genes.
  • the mouse heavy and light chain immunoglobulin genes may be rendered non-functional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination.
  • the modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice.
  • the chimeric mice are then bred to produce homozygous offspring which express human antibodies.
  • the transgenic mice are immunized in the normal fashion with a selected antigen, e.g., all or a portion of a polypeptide of the invention.
  • Antibodies directed against the target of choice can be obtained from the immunized, transgenic mice using conventional hybridoma technology.
  • the human immunoglobulin transgenes harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation.
  • IgG, IgA, IgM and IgE antibodies including, but not limited to, IgGl (gamma 1) and IgG3.
  • IgGl gamma 1
  • IgG3 IgG3
  • companies such as Abgenix, Inc. (Freemont, Calif.) and Genpharm (San Jose, Calif.) can be engaged to provide human antibodies directed against a selected antigen using technology similar to that described above.
  • Human antibodies can also be derived from phage-display libraries
  • Phage display technology can be used to produce human antibodies and antibody fragments in vitro, from immunoglobulin variable (V) domain gene repertoires from unimmunized donors.
  • antibody V domain genes are cloned in-frame into either a major or minor coat protein gene of a filamentous bacteriophage, such as M13 or fd, and displayed as functional antibody fragments on the surface of the phage particle.
  • a filamentous bacteriophage such as M13 or fd
  • selections based on the functional properties of the antibody also result in selection of the gene encoding the antibody exhibiting those properties.
  • the phage mimics some of the properties of the B cell.
  • Phage display can be performed in a variety of formats; for their review see, e.g., Johnson, Kevin S, and Chiswell, David J., Current Opinion in Structural Biology 3:564-571 (1993).
  • V-gene segments can be used for phage display.
  • Clackson et al., Nature, 352:624-628 (1991) isolated a diverse array of anti-oxazolone antibodies from a small random combinatorial library of V genes derived from the spleens of unimmunized mice.
  • a repertoire of V genes from unimmunized human donors can be constructed and antibodies to a diverse array of antigens (including selfantigens) can be isolated essentially following the techniques described by Marks et al., J. Mol. Biol., 222:581-597 (1991), or Griffith et al., EMBOJ., 12:725-734 (1993). See, also, U.S. Pat. Nos. 5,565,332 and 5,573,905, each of which is incorporated herein by reference in its entirety.
  • Human antibodies may also be generated by in vitro activated B cells (see, U.S. Pat Nos. 5,567,610 and 5,229,275, each of which is incorporated herein by reference in its entirety). Human antibodies may also be generated in vitro using hybridoma techniques such as, but not limited to, that described by Roder et al. (Methods Enzymol., 121:140-167 (1986)).
  • the present invention provides compositions and methods for modified immune cells or precursors thereof, e.g., modified T cells, comprising a dominant negative receptor and/or a switch receptor.
  • modified T cells comprising a dominant negative receptor and/or a switch receptor.
  • the immune cell has been genetically modified to express the dominant negative receptor and/or switch receptor. Sequences of dominant negative receptors and switch receptors are found in Table 1.
  • the term“dominant negative receptor” refers to a molecule designed to reduce the effect of a negative signal transduction molecule, e.g., the effect of a negative signal transduction molecule on a modified immune cell of the present invention.
  • a dominant negative receptor of the present invention may bind a negative signal transduction molecule, e.g., TGF-b or PD-1, by virtue of an extracellular domain associated with the negative signal, and reduce the effect of the negative signal transduction molecule.
  • a modified immune cell comprising a dominant negative receptor may bind a negative signal transduction molecule in the microenvironment of the modified immune cell, and reduce the effect the negative signal transduction molecule may have on the modified immune cell.
  • a switch receptor of the present invention may be designed to, in addition to reducing the effects of a negative signal transduction molecule, to convert the negative signal into a positive signal, by virtue of comprising an intracellular domain associated with the positive signal.
  • Switch receptors designed to convert a negative signal into a positive signal are described herein. Accordingly, switch receptors comprise an extracellular domain associated with a negative signal and/or an intracellular domain associated with a positive signal.
  • Tumor cells generate an immunosuppressive microenvironment that serves to protect them from immune recognition and elimination.
  • This immunosuppressive microenvironment can limit the effectiveness of immunosuppressive therapies such as CAR-T cell therapy.
  • the secreted cytokine Transforming Growth Factor b (TORb) directly inhibits the function of cytotoxic T cells and additionally induces regulatory T cell formation to further suppress immune responses.
  • T cell immunosuppression due to TORb in the context of prostate cancers has been previously demonstrated (Donkor et al., 2011; Shalapour et al., 2015).
  • immune cells can be modified to express a dominant negative receptor that is a dominant negative receptor for TGF-b.
  • the dominant negative receptor is a truncated variant of a wild-type protein associated with a negative signal.
  • the dominant negative receptor is a dominant negative receptor for TGF-b.
  • the dominant negative receptor for TGF-b is a truncated variant of a wild-type TGF-b receptor.
  • the dominant negative receptor is a truncated dominant negative variant of the TGF-b receptor type P (TORbKP-ON).
  • the TORbKII-ON comprises the amino acid sequence of SEQ ID NO: 76, which may be encoded by the nucleic acid sequence of SEQ ID NO:77.
  • a dominant negative receptor of the present invention is TORbMI-ON comprising an amino acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 76
  • the dominant negative receptor is TORbMI-ON comprising the amino acid sequence set forth in SEQ ID NO:76.
  • a dominant negative receptor of the present invention is TORbKII-ON encoded by a nucleic acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO:77.
  • the dominant negative receptor is TORbMI-ON encoded by the nucleic acid sequence set forth in SEQ ID NO:77.
  • a switch receptor suitable for use in the present invention is a PD1-CTM-CD28 receptor.
  • the PD1-CTM-CD28 receptor converts a negative PD1 signal into a positive CD28 signal when expressed in a cell.
  • the PD1-CTM-CD28 receptor comprises a variant of the PD1 extracellular domain, a CD28 transmembrane domain, and a CD28 cytoplasmic domain.
  • the PD1-CTM-CD28 receptor comprises an amino acid sequence of SEQ ID NO: 78, which may be encoded by tiie nucleic acid sequence of SEQ ID NO:79.
  • PD1-CTM-CD28 receptor Tolerable variations of the PD1-CTM-CD28 receptor will be known to those of skill in the art, while maintaining its intended biological activity (e.g., converting a negative PD1 signal into a positive CD28 signal when expressed in a cell).
  • a PD1-CTM-CD28 receptor of the present invention may comprise an amino arid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the PD1-CTM-CD28 receptor amino acid sequence set forth in SEQ ID NO:78.
  • a PD1-CTM-CD28 receptor of the present invention may be encoded by a nucleic acid comprising a nucleic add sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the PD1- CTM-CD28 receptor nucleic acid sequence set forth in SEQ ID NO:79.
  • a switch receptor suitable for use in the present invention is a PD1-PTM-CD28 receptor.
  • the PD1-PTM-CD28 receptor converts a negative PD1 signal into a positive CD28 signal when expressed in a cell.
  • the PD1-PTM-CD28 receptor comprises a variant of the PD1 extracellular domain, a PD1 transmembrane domain, and a CD28 cytoplasmic domain.
  • the PD1-PTM-CD28 receptor comprises an amino acid sequence of SEQ ID NO: 80, which may be encoded by the nucleic acid sequence of SEQ ID NO:81.
  • PD1-PTM-CD28 receptor Tolerable variations of the PD1-PTM-CD28 receptor will be known to those of skill in the art, while maintaining its intended biological activity (e.g., converting a negative PD1 signal into a positive CD28 signal when expressed in a cell).
  • a PD1-PTM-CD28 receptor of the present invention may comprise an amino add sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the PD1-PTM-CD28 receptor amino acid sequence set forth in SEQ ID NO: 80.
  • a PD1-PTM-CD28 receptor of the present invention may be encoded by a nucldc acid comprising a nucleic add sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the PD1- PTM-CD28 receptor nucleic acid sequence set forth in SEQ ID NO:81.
  • a switch receptor suitable for use in the present invention is a PD1 A132L -PTM-CD28 receptor.
  • the PD1 A132L -PTM-CD28 receptor converts a negative PD1 signal into a positive CD28 signal when expressed in a cell.
  • a point mutation at amino acid position 132, substituting alanine with leucine (A132L), ofPDl was found to increase its affinity with PD-L1 by two fold (see, e.g., Zhang et al., Immunity (2004) 20(3), 337-347).
  • the PD1 A132L -PTM-CD28 receptor comprises a variant of the PD1 extracellular domain that has an amino acid substitution at position 132 (A132L), a PD1 transmembrane domain, and a CD28 cytoplasmic domain.
  • the PD 1 A132L -PTM-CD28 receptor comprises an amino acid sequence of SEQ ID NO: 82, which may be encoded by the nucldc acid sequence of SEQ ID NO: 83.
  • PD1 A132L -PTM-CD28 receptor Tolerable variations of the PD1 A132L -PTM-CD28 receptor will be known to those of skill in the art, while maintaining its intended biological activity (e.g., converting a negative PD1 signal into a positive CD28 signal when expressed in a cell).
  • aPDl A132L -PTM-CD28 receptor of the present invention may comprise an amino add sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the PD1 A132L -PTM-CD28 receptor amino acid sequence set forth in SEQ ID NO: 82.
  • a PD1 A132L -PTM-CD28 receptor of the present invention may be encoded by a nucleic acid comprising a nucleic acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the
  • a switch receptor suitable for use in the present invention is a PD1-4-1BB receptor.
  • the PD1-4-1BB receptor (also referred to herein as PD1-BB) converts a negative PD1 signal into a positive 4-1BB signal when expressed in a cell.
  • the PD1-4-1BB receptor comprises an amino acid of SEQ ID NO: 84, which may be encoded by the nucleic acid of SEQ ID NO: 85.
  • a PD1- 4- IBB receptor of the present invention may comprise an amino acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the PD1-4-1BB receptor amino acid sequence set forth in SEQ ID NO:84.
  • a PD1-4-1BB receptor of the present invention may be encoded by a nucleic acid comprising a nucleic acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the PD1-4-1BB receptor nucleic acid sequence set forth in SEQ ID NO:85.
  • a switch receptor suitable for use in the present invention is a PDl A132L -4-lBB receptor.
  • the PDl A132L -4-lBB receptor (also referred to herein as PD1*BB) converts a negative PD1 signal into a positive 4- IBB signal when expressed in a cell.
  • the PDl A132L -4-lBB receptor comprises an amino acid sequence of SEQ ID NO: 86, which may be encoded by the nucleic acid sequence of SEQ ID NO: 87.
  • PDl A132L -4-lBB receptor Tolerable variations of the PDl A132L -4-lBB receptor will be known to those of skill in the art, while maintaining its intended biological activity (e.g., converting a negative PD1 signal into a positive 4-1BB signal when expressed in a cell).
  • a PDl A132L -4-lBB receptor of the present invention may comprise an amino add sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the PDl A132L -4-lBB receptor amino acid sequence set forth in SEQ ID NO:86.
  • a PDl A132L -4-lBB receptor of the present invention may be encoded by a nucleic add comprising a nucleic acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the PDl A132L -4-lBB receptor nucleic acid sequence set forth in SEQ ID NO: 87.
  • a switch receptor suitable for use in the present invention is a TGFpR-IL12Rpi receptor.
  • the TORbK.-P_,12Kb1 receptor converts a negative TGF-b signal into a positive IL-12 signal when expressed in a cell.
  • the TORbK.-IIA2K.b1 receptor comprises an amino add sequence of SEQ ID NO:88, which may be encoded by the nucldc acid sequence of SEQ ID NO: 89.
  • TORbK-IE12Kb1 receptor Tolerable variations of the TORbK-IE12Kb1 receptor will be known to those of skill in the art, while maintaining its intended biological activity (e.g., converting a negative TGF-b signal into a positive IL-12 signal when expressed in a cell).
  • a TORbK.-P_,12Kb1 receptor of the present invention may comprise an amino add sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the TORbK-IE12Kb1 receptor amino acid sequence set forth in SEQ ID NO:88.
  • a TORbK-IE12Kb1 receptor of the present invention may be encoded by a nucldc acid comprising a nucleic add sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the TORbK- IE12Kb1 receptor nucleic acid sequence set forth in SEQ ID NO: 89.
  • a switch receptor suitable for use in the present invention is a TORbK-IE12Kb2 receptor.
  • the TORbK-IE12Kb2 receptor converts a negative TGF-b signal into a positive IL-12 signal when expressed in a cell.
  • the TORbK-P,12Kb2 receptor comprises an amino acid sequence set forth belowof SEQ ID NO: 90, which may be encoded by the nucleic acid sequence of SEQ ID NO:91.
  • TORbK-IE12Kb2 receptor Tolerable variations of the TORbK-IE12Kb2 receptor will be known to those of skill in the art, while maintaining its intended biological activity (e.g., converting a negative TGF-b signal into a positive IL-12 signal when expressed in a cell).
  • a TORbK.-P_,12Kb2 receptor of the present invention may comprise an amino add sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the TORbK.-I1A2Kb2 receptor amino acid sequence set forth in SEQ ID NO:90.
  • a TORbK.-I1A2K.b2 receptor of the present invention may be encoded by a nucleic acid comprising a nucleic add sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the TORbK- I1A2Kb2 receptor nucleic acid sequence set forth in SEQ ID NO:91.
  • a switch receptor suitable for use in the present invention is a TIM3-CD28 receptor.
  • the TIM3-CD28 receptor converts a negative ⁇ M-3 signal into a positive CD28 signal when expressed in a cell.
  • the ⁇ M3- CD28 receptor comprises an amino add sequence of SEQ ID NO:92, which may be encoded by the nucleic add sequence of SEQ ID NO:93.
  • a TIM3-CD28 receptor of the present invention may comprise an amino acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the TIM3-CD28 receptor amino acid sequence set forth in SEQ ID NO:92.
  • a TIM3-CD28 receptor of the present invention may be encoded by a nucleic acid comprising a nucleic acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the TIM3-CD28 receptor nucleic acid sequence set forth in SEQ ID NO:93.
  • the present invention provides a modified immune cell or precursor cell thereof (e.g., a modified T cell, a modified NK cell, a modified NKT cell), comprising a subject CAR Accordingly, such modified cells possess the specificity directed by the CAR that is expressed therein.
  • a modified cell of the present invention comprising a TnMUCl CAR possesses specificity for MUC1 on a target cell.
  • Any modified cell comprising a CAR comprising any antigen binding domain, any hinge, any transmembrane domain, any intracellular costimulatory domain, and any intracellular signaling domain described herein is envisioned, and can readily be understood and made by a person of skill in the art in view of the disclosure herein.
  • the modified cell is an immune cell or precursor cell thereof. In an exemplary embodiment, the modified cell is a T cell. In an exemplary embodiment, the modified cell is an autologous cell. In an exemplary embodiment, the modified cell is an autologous immune cell or precursor cell thereof. In an exemplary embodiment, the modified cell is an autologous T cell.
  • the present invention provides a modified immune cell or precursor cell thereof (e.g., a T cell), comprising a CAR and/or a dominant negative receptor and/or a switch receptor. Accordingly, such modified cells possess the specificity directed by the CAR that is expressed therein.
  • a modified cell of the present invention comprising a TnMUCl -CAR possesses specificity for TnMUCl on a target cell.
  • a modified cell of the present invention comprises a CAR
  • a modified cell of the present invention comprises a CAR having affinity for a TnMUCl on a target cell.
  • a modified cell of tire present invention comprises a dominant negative receptor and/or a switch receptor.
  • a modified cell of the present invention comprises a dominant negative receptor capable of reducing the effect of a negative signal transduction molecule in the microenvironment.
  • a modified cell of the present invention comprises a switch receptor capable of reducing the effect of a negative signal transduction molecule in the microenvironment, and converting the negative signal into a positive signal within the modified cell.
  • a modified cell of the present invention comprises a CAR and a dominant negative receptor and/or a switch receptor.
  • a modified cell of the present invention comprises a CAR having affinity for TnMUCl on a target cell, and a dominant negative receptor and/or a switch receptor.
  • Modified cells comprising a dominant negative receptor and/or a switch receptor of the present invention are able to engage negative signal transduction molecules (e.g., inhibitory ligands) in the microenvironment by virtue of their respective extracellular domains.
  • a modified cell of the present invention comprising a dominant negative receptor is capable of reducing the effect of a negative signal transduction molecule in the microenvironment, wherein the dominant negative receptor comprises an extracellular domain associated with the negative signal.
  • a modified cell of the present invention comprising a switch receptor is capable of converting the effect of a negative signal transduction molecule in the
  • the switch receptor comprises an extracellular domain associated with the negative signal and an intracellular domain associated with the positive signal.
  • a modified cell of the present invention comprises a dominant negative receptor that is capable of reducing the effect of a negative signal transduction molecule.
  • a modified cell of the present invention comprises TORbKII-ON.
  • a modified cell of the present invention comprises a switch receptor that is capable of converting the effect of a negative signal transduction molecule into a positive (e.g., activating) signal within tire modified cell.
  • a modified cell of the present invention comprises PD1-CTM- CD28. In one embodiment, a modified cell of the present invention comprises
  • a modified cell of the present invention comprises TIM3-CD28.
  • a modified cell of the present invention comprises a TnMUCl-CAR and a dominant negative receptor that is capable of reducing the effect of a negative signal transduction molecule.
  • a modified cell of the present invention comprises a TnMUCl-CAR and TORbKP- ⁇ N.
  • modified cells e.g., modified T cells
  • Such modified cells are capable of reducing inhibitory TGF-b signals from the microenvironment they reside in.
  • a modified cell of the present invention comprises a MUC1-CAR and a switch receptor that is capable of converting the inhibitory effect of a negative signal transduction molecule into a positive signal within the modified cell.
  • a modified cell of the present invention comprises a MUC1- CAR and PD 1 -CTM-CD28.
  • a modified cell of the present invention comprises a MUC1-CAR and PD1 A132L -PTM-CD28.
  • a modified cell of the present invention comprises a MUC1-CAR and TIM3-CD28.
  • a modified cell of the present invention comprises a MUC1 CAR and
  • a modified cell of the present invention comprises a
  • a modified cell of the present invention comprises a MUC1-CAR and TORbK.-IIA2Kb1.
  • modified cells e.g., modified T cells
  • Such modified cells are capable of converting inhibitory PD-1, TIMI1 or TORb signals from the microenvironment into a positive (e.g., activating) signal within the modified cell.
  • modified cells in addition to having affinity for MUC1 on a target cell, are capable of converting inhibitory PD-1 or ⁇ M-3 signals from the microenvironment into a positive (e.g., activating) CD28 signal within the modified cell.
  • a modified cell of the present invention comprises a MUC1 -CAR, TORbKP-ON, and PD1-CTM-CD28.
  • the present invention provides a nucleic acid encoding a CAR having affinity for MUC1 (e.g. Tn-MUCl).
  • a subject CAR comprises an antigen binding domain (e.g., MUC1 binding domain), a transmembrane domain, and an intracellular domain.
  • the present invention provides a nucleic acid encoding an antigen binding domain (e.g., MUC1 binding domain), a transmembrane domain, and an intracellular domain of a subject CAR
  • a nucleic acid encoding a MUC1 CAR of the present invention is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NOs: 1, 38, 40, 42, 44, or 46.
  • the invention provides a nucleic add encoding a CAR and/or a dominant negative receptor and/or a switch receptor.
  • a nucleic add of the present disclosure comprises a nucleic add sequence encoding a subject CAR of the present invention (e.g., TnMUCl-CAR).
  • a nucleic add of the present disclosure comprises a nucleic add sequence encoding a dominant negative receptor and/or a switch receptor (e.g., a PD1-PTM-CD28 receptor).
  • a nucleic acid of the present disclosure provides for the production of a CAR and/or dominant negative receptor and/or a switch receptor as described herdn, e.g., in a mammalian cell.
  • a nucldc acid of the present disclosure provides for amplification of the CAR and/or dominant negative receptor and/or a switch receptor-encoding nucleic add.
  • a subject CAR comprises an antigen binding domain, a transmembrane domain, and an intracellular domain. Accordingly, the present disclosure provides a nucleic acid encoding an antigen binding domain, a
  • transmembrane domain and an intracellular domain of a subject CAR
  • various dominant negative receptors and switch receptors are provided.
  • the present invention provides a nucleic acid encoding a dominant negative receptor and/or a switch receptor.
  • the nucleic add encoding a CAR is separate from the nucleic add encoding a dominant negative receptor and/or a switch receptor.
  • the nucleic acid encoding a CAR, and the nucleic add encoding a dominant negative receptor and/or a switch receptor resides within the same nucleic acid.
  • a nucleic acid of the present invention comprises a nucleic acid comprising a CAR coding sequence and a dominant negative receptor and/or a switch receptor coding sequence. In some embodiments, a nucleic acid of the present invention comprises a nucleic acid comprising a CAR coding sequence and a dominant negative receptor and/or a switch receptor coding sequence that is separated by a linker.
  • a linker for use in the present invention allows for multiple proteins to be encoded by the same nucleic acid sequence (e.g., a multicistronic or bicistronic sequence), which are translated as a polyprotein that is dissociated into separate protein components.
  • a linker for use in a nucleic acid of the present disclosure comprising a CAR coding sequence and a dominant negative receptor and/or a switch receptor coding sequence, allows for the CAR and dominant negative receptor and/or switch receptor to be translated as a polyprotein that is dissociated into separate CAR and dominant negative receptor and/or switch receptor components.
  • the linker comprises a nucleic acid sequence that encodes for an internal ribosome entry site (IRES).
  • IRS internal ribosome entry site
  • an internal ribosome entry site or“IRES” refers to an element that promotes direct internal ribosome entry to the initiation codon, such as ATG, of a protein coding region, thereby leading to cap- independent translation of the gene.
  • IRES Integrated ribosome entry sites
  • viral or cellular mRNA sources e.g., immunogloublin heavy-chain binding protein (BiP); vascular endothelial growth factor (VEGF); fibroblast growth factor 2; insulin-like growth factor; translational initiation factor eIF4G; yeast transcription factors TFIID and HAP4; and IRES obtainable from, e.g., cardiovirus, rhinovirus, aphthovims, HCV, Friend murine leukemia virus (FrMLV), and Moloney murine leukemia virus
  • the linker comprises a nucleic acid sequence that encodes for a self-cleaving peptide.
  • a“self-cleaving peptide” or“2A peptide” refers to an oligopeptide that allow multiple proteins to be encoded as polyproteins, which dissociate into component proteins upon translation.
  • Use of the term“selfcleaving” is not intended to imply a proteolytic cleavage reaction.
  • Various selfcleaving or 2A peptides are known to those of skill in the art, including, without limitation, those found in members of the Picomaviridae virus family, e.g., foot-and- mouth disease virus (FMDV), equine rhinitis A virus (ERAVO, Thosea asigna virus (TaV), and porcine tescho virus-1 (PTV-1); and carioviruses such as Theilovirus and encephalomyocarditis viruses.
  • FMDV foot-and- mouth disease virus
  • ERAVO equine rhinitis A virus
  • TaV Thosea asigna virus
  • PTV-1 porcine tescho virus-1
  • 2A peptides derived from FMDV, ERAV, PTV-1, and TaV are referred to herein as“F2A,” ⁇ 2A,”“P2A,” and“T2A,” respectively.
  • Those of skill in the art would be able to select the appropriate self-cleaving
  • a nucleic acid of the present disclosure comprises a nucleic acid sequence comprising a CAR coding sequence and a dominant negative receptor and/or a switch receptor coding sequence that is separated by a linker comprising a T2A peptide sequence.
  • the T2A peptide sequence comprises the amino acid sequence EGRGSLLTCGDVEENPGP (SEQ ID NO: 94), which may be encoded by the nucleic acid sequence
  • the linker comprising a T2A peptide sequence may further comprise a spacer sequence as described herein.
  • the linker comprising a T2A peptide sequence may further comprise a spacer sequence comprising the amino acid sequence SGRSGGG (SEQ ID NO:96), which may be encoded by the nucleic acid sequence TCCGGAAGATCTGGCGGCGGA (SEQ ID NO: 97.
  • a nucleic acid of the present disclosure comprises a nucleic acid sequence comprising a CAR coding sequence and a dominant negative receptor and/or a switch receptor coding sequence that is separated by a linker comprising a F2A peptide sequence.
  • the F2A peptide sequence comprises the amino acid sequence VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 98), which may be encoded by the nucleic acid sequence
  • a linker further comprises a nucleic acid sequence that encodes a furin cleavage site.
  • Furin is a ubiquitously expressed protease that resides in the trans-golgi and processes protein precursors before their secretion. Furin cleaves at the COOH- terminus of its consensus recognition sequence.
  • furin consensus recognition sequences are known to those of skill in the art, including, without limitation, Arg-X-Lys-Arg (SEQ ID NO: 100) or Arg-X-Arg-Arg (SEQ ID NO:101), and Aig-X-X-Arg (SEQ ID NO:102), such as an Arg-Gln-Lys-Arg (SEQ ID NO: 103), where X is any naturally occurring amino acid.
  • Another example of a furin cleavage site is XI -Arg-X2-X3-Arg (SEQ ID NO: 104), where XI is Lys or Arg, X2 is any naturally occurring amino acid, and X3 is Lys or Arg.
  • Those of skill in the art would be able to select the appropriate Furin cleavage site for use in the present invention.
  • the linker comprises a nucleic acid sequence encoding a combination of a Furin cleavage site and a 2A peptide.
  • examples include, without limitation, a linker comprising a nucleic add sequence encoding Furin and F2A, a linker comprising a nucleic acid sequence encoding Furin and E2A, a linker comprising a nucleic acid sequence encoding Furin and P2A, a linker comprising a nucleic acid sequence encoding Furin and T2A.
  • the linker may further comprise a spacer sequence between the Furin and 2A peptide.
  • spacer sequences are known in the art, including, without limitation, glycine serine (GS) spacers such as (GS)n, (GSGGS)n (SEQ ID NO:52) and (GGGS)n (SEQ ID NO: 53), where n represents an integer of at least 1.
  • GS glycine serine
  • Exemplary spacer sequences can comprise amino acid sequences including, without limitation, GGSG (SEQ ID NO:55), GGSGG (SEQ ID NO:56), GSGSG (SEQ ID NO:57), GSGGG (SEQ ID NO:58), GGGSG (SEQ ID NO:59), GSSSG (SEQ ID NO:60), and the like.
  • GGSG SEQ ID NO:55
  • GGSGG SEQ ID NO:56
  • GSGSG SEQ ID NO:57
  • GSGGG SEQ ID NO:58
  • GGGSG SEQ ID NO:59
  • GSSSG SEQ ID NO:60
  • a nucleic acid of the present disclosure comprises a nucleic acid sequence comprising a CAR coding sequence and a dominant negative receptor and/or a switch receptor coding sequence that is separated by a Furin-(G4S)2- T2A (F-GS2-T2A) linker.
  • the F-GS2-T2A linker may be encoded by the nucleic acid sequence
  • linkers of the present invention may include tolerable sequence variations.
  • the present invention provides a nucleic acid comprising a nucleic acid sequence encoding a dominant negative receptor and/or a switch receptor as described herein.
  • a nucleic acid comprises a nucleic acid sequence encoding a dominant negative receptor and/or a switch receptor and a nucleic acid sequence encoding a CAR as described herein (e.g., a TnMUCl-CAR).
  • the nucleic add sequence encoding the dominant negative receptor and/or the switch receptor and the nucleic add sequence encoding the CAR resides on separate nucleic adds.
  • the nucleic acid sequence encoding the dominant negative receptor and/or the switch receptor and the nucldc acid sequence encoding the CAR resides within the same nucleic acid.
  • the nucldc acid sequence encoding the dominant negative receptor and/or the switch receptor and the nucleic acid sequence encoding the CAR is separated by a linker as described herein.
  • a nucleic add of the present disclosure may comprise a nucleic acid sequence encoding a dominant receptor, a linker, and a nucleic add sequence encoding a CAR.
  • the linker comprises a nucleic acid sequence encoding a 2A peptide (e.g., T2A).
  • a nucleic acid of the present disclosure may comprise a nucleic acid sequence encoding a dominant negative receptor and/or a switch receptor and a nucldc acid sequence encoding a CAR separated by a linker sequence comprising a nucleic acid sequence encoding T2A.
  • a nucleic acid of the present disclosure comprises from 5’ to 3’: a nucleic acid sequence encoding a dominant negative receptor and/or a switch receptor, a nucleic acid sequence encoding a linker, and a nucleic acid sequence encoding a CAR.
  • a nucleic add of the present disclosure comprises from S’ to 3’: a nucleic acid sequence encoding a CAR, anucldc acid sequence encoding a linker, and a nucleic acid sequence encoding a dominant negative receptor and/or a switch receptor.
  • a nucleic acid of the present invention comprises from 5’ to 3’: a nucleic acid sequence encoding TGFPRII-DN, a nucleic acid sequence encoding a linker comprising a 2A peptide (e.g., T2A), and a nucleic add sequence encoding a MUC1 CAR (e.g., SEQ ID NOs: 1, 38, 40, 42, 44, or 46).
  • a nucleic acid of the present disclosure comprises from S’ to 3’: a nucleic add encoding a MUC1 CAR, a nucldc acid encoding a linker comprising a 2A peptide (e.g., T2A), and a nucleic add encoding a dominant negative receptor and/or a switch receptor.
  • a nucleic acid of the present disclosure may be operably linked to a transcriptional control element, e.g., a promoter, and enhancer, etc.
  • a transcriptional control element e.g., a promoter, and enhancer, etc.
  • Suitable promoter and enhancer elements are known to those of skill in the art.
  • suitable promoters include, but are not limited to, lad, lacZ, T3, T7, gpt, lambda P and trc.
  • suitable promoters include, but are not limited to, light and/or heavy drain immunoglobulin gene promoter and enhancer elements; cytomegalovirus immediate early promoter; herpes simplex virus thymidine kinase promoter; early and late SV40 promoters;
  • telomere promoter present in long terminal repeats from a retrovirus; mouse metallothionein-I promoter; and various art-known tissue specific promoters.
  • Suitable reversible promoters including reversible inducible promoters are known in the art.
  • Such reversible promoters may be isolated and derived from many organisms, e.g., eukaryotes and prokaryotes. Modification of reversible promoters derived from a first organism for use in a second organism, e.g., a first prokaryote and a second a eukaryote, a first eukaryote and a second a prokaryote, etc., is well known in the art.
  • Such reversible promoters, and systems based on such reversible promoters but also comprising additional control proteins include, but are not limited to, alcohol regulated promoters (e.g., alcohol dehydrogenase I (alcA) gene promoter, promoters responsive to alcohol transactivator proteins (AlcR), etc.), tetracycline regulated promoters, (e.g., promoter systems including TetActivators, TetON, TetOFF, etc.), steroid regulated promoters (e.g., rat glucocorticoid receptor promoter systems, human estrogen receptor promoter systems, retinoid promoter systems, thyroid promoter systems, ecdysone promoter systems, mifepristone promoter systems, etc.), metal regulated promoters (e.g., metallothionein promoter systems, etc.), pathogenesis-related regulated promoters (e.g., salicylic acid regulated promoters, ethylene regulated promoters
  • the promoter is a CDS cell-specific promoter, a CD4 cell-specific promoter, a neutrophil-specific promoter, or an NK-specific promoter.
  • a CD4 gene promoter can be used; see, e.g., Salmon et al. Proc. Natl. Acad Sci. USA (1993) 90:7739; and Marodon et al. (2003) Blood 101:3416.
  • a CDS gene promoter can be used.
  • NK cell-specific expression can be achieved by use of an Ncrl (p46) promoter; see, e.g., Eckelhart et al. Blood (2011) 117:1565.
  • a suitable promoter is a constitutive promoter such as an ADH1 promoter, a PGK1 promoter, an ENO promoter, a PYK1 promoter and the like; or a regulatable promoter such as a GAL1 promoter, a GAL 10 promoter, an ADH2 promoter, a PHOS promoter, a CUPl promoter, a GALT promoter, a MET25 promoter, a MET3 promoter, a CYC1 promoter, a HISS promoter, an ADH1 promoter, a PGK promoter, a GAPDH promoter, an ADC1 promoter, a TRP1 promoter, a URAS promoter, a LEU2 promoter, an ENO promoter, a TP1 promoter, and AOX1 (e.g., for use in Pichia).
  • a constitutive promoter such as an ADH1 promoter, a PGK1 promoter, an ENO promoter,
  • Suitable promoters for use in prokaryotic host cells include, but are not limited to, a bacteriophage T7 RN A polymerase promoter; a trp promoter; a lac operon promoter; a hybrid promoter, e.g., a lac/tac hybrid promoter, a tac/trc hybrid promoter, a trp/lac promoter, a T7/lac promoter; a trc promoter; a tac promoter, and the like; an araBAD promoter; in vivo regulated promoters, such as an ssaG promoter or a related promoter (see, e.g., U.S.
  • Patent Publication No. 20040131637 discloses a pagC promoter (Pulkkinen and Miller, J. Bacteriol. (1991) 173(1): 86-93; Alpuche- Aranda et al., Proc. Natl. Acad. Sci. USA (1992) 89(21): 10079-83), anirB promoter (Harbome et al. Mol. Micro. (1992) 6:2805-2813), and the like (see, e.g., Dunstan et al., Infect. Immun.
  • sigma70 promoter e.g., a consensus sigma70 promoter (see, e.g., GenBank Accession Nos.
  • AX798980, AX798961, and AX798183 ); a stationary phase promoter, e.g., a dps promoter, an spy promoter, and the like; a promoter derived from the pathogenicity island SPI-2 (see, e.g., W096/17951); an actA promoter (see, e.g., Shetron-Rama et al., Infect. Immun. (2002) 70: 1087-1096); an rpsM promoter (see, e.g., Valdivia and FalkowM?/. Microbiol. (1996). 22:367); atet promoter (see, e.g., Hillen, W. and Wissmann, A. (1989) In Saenger, W. and
  • Suitable strong promoters for use in prokaryotes include, but are not limited to Trc, Tac, T5, T7, and P Lambda.
  • Non-limiting examples of operators for use in bacterial host cells include a lactose promoter operator (Lacl repressor protein changes conformation when contacted with lactose, thereby preventing the Lad repressor protein from binding to the operator), a tryptophan promoter operator (when complexed with tryptophan, TrpR repressor protein has a conformation that binds the operator; in the absence of tryptophan, the TrpR repressor protein has a conformation that does not bind to the operator), and a tac promoter operator (see, e.g., deBoer et al., Proc. Natl. Acad Sci. U.S.A. (1983) 80:21-25).
  • a lactose promoter operator Lacl repressor protein changes conformation when contacted with lactose, thereby preventing the Lad repressor protein from binding to the operator
  • TrpR repressor protein when complexed with tryptophan, Tr
  • Suitable promoters include the immediate early promoter
  • CMV cytomegalovirus
  • This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operatively linked thereto.
  • other constitutive promoter sequences may also be used, including, but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human
  • HTV immunodeficiency virus
  • LTR long terminal repeat
  • MoMuLV immunodeficiency virus
  • avian leukemia virus promoter an Epstein-Barr virus immediate early promoter
  • Rous sarcoma virus promoter the EF-1 alpha promoter
  • human gene promoters such as, but not limited to, the actin promoter, the myosin promoter, the hemoglobin promoter, and the creatine kinase promoter.
  • the invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the invention.
  • an inducible promoter provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired, or turning off the expression when expression is not desired.
  • inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter.
  • the locus or construct or transgene containing the suitable promoter is irreversibly switched through the induction of an inducible system.
  • Suitable systems for induction of an irreversible switch are well known in the art, e.g., induction of an irreversible switch may make use of a Cre-lox-mediated recombination (see, e.g., Fuhrmann-Benzakein, et al., Proc. Natl. Acad Sci. USA (2000) 28:e99, the disclosure of which is incorporated herein by reference). Any suitable combination of recombinase, endonuclease, ligase, recombination sites, etc. known to the art may be used in generating an irreversibly switchable promoter.
  • a nucleic acid of the present disclosure further comprises a nucleic add sequence encoding a CAR inducible expression cassette.
  • the CAR indurible expression cassette is for the production of a transgenic polypeptide product that is released upon CAR signaling. See, e.g.,
  • a nucleic acid of the present disclosure may be present within an expression vector and/or a cloning vector.
  • An expression vector can include a selectable marker, an origin of replication, and other features that provide for replication and/or maintenance of the vector.
  • Suitable expression vectors include, e.g., plasmids, viral vectors, and the like. Large numbers of suitable vectors and promoters are known to those of skill in the art; many are commercially available for generating a subject recombinant construct.
  • Bacterial Bacterial: pBs, phagescript, PsiX174, pBluescript SK, pBs KS, pNHSa, pNH16a, pNHISa, pNH46a (Stratagene, La Jolla, Calif., USA); pTrc99A, pKK223-3, pKK233-3, pDR540, and pRIT5 (Pharmacia, Uppsala, Sweden).
  • Expression vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding heterologous proteins.
  • a selectable marker operative in the expression host may be present.
  • Suitable expression vectors include, but are not limited to, viral vectors (e.g. viral vectors based on vaccinia virus; poliovirus; adenovirus (see, e.g., Li et al., Invest. Opthalmol. Vis. Sci.
  • a retroviral vector e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus; and the like.
  • Additional expression vectors suitable for use are, e.g., without limitation, a lenti virus vector, a gamma retrovirus vector, a foamy virus vector, an adeno-associated virus vector, an adenovirus vector, a pox virus vector, a herpes virus vector, an engineered hybrid virus vector, a transposon mediated vector, and the like.
  • Viral vector technology is well known in the art and is described, for example, in Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, volumes 1-4, Cold Spring Harbor Press, NY), and in other virology and molecular biology manuals.
  • Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno- associated viruses, herpes viruses, and lenti viruses.
  • a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers, (e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193).
  • an expression vector e.g., a lentiviral vector
  • an immune cell or precursor thereof e.g., a T cell
  • an expression vector (e.g., a lentiviral vector) of the present invention may comprise a nucleic acid encoding a CAR
  • the expression vector e.g., lentiviral vector
  • an expression vector comprising a nucleic acid encoding a CAR further comprises a mammalian promoter.
  • the vector further comprises an elongation-factor- 1 -alpha promoter (EF-la promoter).
  • EF-la promoter elongation-factor- 1 -alpha promoter
  • Use of an EF-la promoter may increase the efficiency in expression of downstream transgenes (e.g., a CAR encoding nucleic acid sequence).
  • Physiologic promoters e.g., an EF-la promoter
  • Other physiological promoters suitable for use in a vector are known to those of skill in the art and may be incorporated into a vector of the present invention.
  • the vector (e.g., a lentiviral vector) further comprises a non-requisite ds acting sequence that may improve titers and gene expression.
  • a non-requisite cis acting sequence is the central polypurine tract and central termination sequence (cPPT/CTS) which is important for effident reverse transcription and nuclear import.
  • CPS central polypurine tract and central termination sequence
  • Other non-requisite cis acting sequences are known to those of skill in the art and may be incorporated into a vector (e.g., lentiviral vector) of the present invention.
  • the vedor further comprises a posttranscriptional regulatory element. Posttranscriptional regulatory elements may improve RNA translation, improve transgene expression and stabilize RNA transcripts.
  • a posttranscriptional regulatory element is the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE).
  • a vector for the present invention further comprises a WPRE sequence.
  • WPRE posttranscriptional regulator elements
  • Various posttranscriptional regulator elements are known to those of skill in the art and may be incorporated into a vector (e.g., a lentiviral vector) of the present invention.
  • a vector of the present invention may further comprise additional elements such as a rev response element (RRE) for RNA transport, packaging sequences, and S’ and 3’ long terminal repeats (LTRs).
  • RRE rev response element
  • LTRs long terminal repeats
  • the term“long terminal repeat” or“LTR” refers to domains of base pairs located at the ends of retroviral DNAs which comprise U3, R and US regions.
  • LTRs generally provide functions required for the expression of retroviral genes (e.g., promotion, initiation and polyadenylation of gene transcripts) and to viral replication.
  • a vector (e.g., lentiviral vector) of tire present invention includes a 3’ U3 deleted LTR
  • a vector (e.g., lentiviral vector) of the present invention may comprise any combination of the elements described herein to enhance the efficiency of functional expression of transgenes.
  • a vector (e.g., lentiviral vector) of the present invention may comprise a WPRE sequence, cPPT sequence, RRE sequence, 5’LTR, 3’ U3 deleted LTR’ in addition to a nucleic acid encoding for a CAR.
  • Vectors of the present invention may be self-inactivating vectors.
  • the term“self-inactivating vector” refers to vectors in which the 3’ LTR enhancer promoter region (U3 region) has been modified (e.g., by deletion or substitution).
  • a self-inactivating vector may prevent viral transcription beyond the first round of viral replication. Consequently, a self-inactivating vector may be capable of infecting and then integrating into a host genome (e.g., a mammalian genome) only once, and cannot be passed further. Accordingly, self-inactivating vectors may greatly reduce the risk of creating a replication-competent virus.
  • a nucleic acid of the present invention may be RNA, e.g., in vitro synthesized RNA.
  • Methods for in vitro synthesis of RNA are known to those of skill in the art; any known method can be used to synthesize RNA comprising a sequence encoding a CAR of the present disclosure.
  • Methods for introducing RNA into a host cell are known in the art. See, e.g., Zhao et al. Cancer Res. (2010) 15: 9053.
  • Introducing RNA comprising a nucleotide sequence encoding a CAR of the present disclosure into a host cell can be carried out in vitro or ex vivo or in vivo.
  • a host cell e.g., an NK cell, a cytotoxic T lymphocyte, etc.
  • RNA comprising a nucleotide sequence encoding a CAR of the present disclosure.
  • the expression vector to be introduced into a cell may also contain either a selectable marker gene or a reporter gene, or both, to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors.
  • the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers include, without limitation, antibiotic-resistance genes. Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences.
  • a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a polypeptide whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assessed at a suitable time after the DNA has been introduced into the recipient cells.
  • Suitable reporter genes may include, without limitation, genes encoding luciferase, beta- galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (e.g., Ui-Tei et al., 2000 FEBS Letters 479: 79-82).
  • the present invention provides methods for producing/generating a modified immune cell or precursor cell thereof (e.g., a T cell/ NK cell / NKT cell).
  • the cells are generally engineered by introducing a nucleic acid encoding a subject CAR (e.g., MUC1 CAR).
  • Methods of introducing nucleic acids into a cell include physical, biological and chemical methods.
  • Physical methods for introducing a polynucleotide, such as RNA, into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like.
  • RNA can be introduced into target cells using commercially available methods which include electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, MA) or the Gene Pulser II (BioRad, Denver, CO), Multiporator (Eppendorf, Hamburg Germany).
  • RNA can also be introduced into cells using cationic liposome mediated transfection using lipofection, using polymer encapsulation, using peptide mediated transfection, or using biolistic particle delivery systems such as“gene guns” (see, for example, Nishikawa, et al. Hum Gene Ther., 12(8): 861-70 (2001).
  • Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors.
  • Viral vectors, and especially retroviral vectors have become the most widely used method for inserting genes into mammalian, e.g., human cells.
  • Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.
  • a nucleic acid encoding a subject CAR of the invention is introduced into a cell by an expression vector.
  • Expression vectors comprising a nucleic acid encoding a subject CAR (e.g., MUC1 CAR) are provided herein.
  • Suitable expression vectors include lentivirus vectors, gamma retrovirus vectors, foamy virus vectors, adeno associated virus (AAV) vectors, adenovirus vectors, engineered hybrid viruses, naked DNA, including but not limited to transposon mediated vectors, such as Sleeping Beauty, Piggyback, and Integrases such as Phi31.
  • Some other suitable expression vectors include herpes simplex virus (HSV) and retrovirus expression vectors.
  • HSV herpes simplex virus
  • Adenovirus expression vectors are based on adenoviruses, which have a low capacity for integration into genomic DNA but a high efficiency for transfecting host cells.
  • Adenovirus expression vectors contain adenovirus sequences sufficient to: (a) support packaging of the expression vector and (b) to ultimately express the subject CAR in the host cell.
  • the adenovirus genome is a 36 kb, linear, double stranded DNA, where a foreign DNA sequence (e.g., a nucleic acid encoding a subject CAR) may be inserted to substitute large pieces of adenoviral DNA in order to make the expression vector of the present invention (see, e.g., Danthinne and Imperiale, Gene Therapy (2000) 7(20): 1707-1714).
  • a foreign DNA sequence e.g., a nucleic acid encoding a subject CAR
  • Another expression vector is based on an adeno associated virus, which takes advantage of the adenovirus coupled systems.
  • This AAV expression vector has a high frequency of integration into the host genome. It can infect non-dividing cells, thus making it useful for delivery of genes into mammalian cells, for example, in tissue cultures or in vivo.
  • the AAV vector has a broad host range for infectivity. Details concerning the generation and use of AAV vectors are described in U.S. Patent Nos. 5,139,941 and 4,797,368.
  • Retrovirus expression vectors are capable of integrating into the host genome, delivering a large amount of foreign genetic material, infecting a broad spectrum of species and cell types and being packaged in special cell lines.
  • the retrovirus vector is constructed by inserting a nucleic acid (e.g., a nucleic acid encoding a subject CAR) into the viral genome at certain locations to produce a virus that is replication defective.
  • a nucleic acid e.g., a nucleic acid encoding a subject CAR
  • the retrovirus vectors are able to infect a broad variety of cell types, integration and stable expression of the subject CAR, requires the division of host cells.
  • Lenti virus vectors are derived from lenti viruses, which are complex retroviruses that, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural function (see, e.g., U.S. Patent Nos. 6,013,516 and 5,994, 136).
  • Some examples of lentiviruses include the human immunodeficiency viruses (HTV-1, HTV-2) and the simian immunodeficiency virus (SIV).
  • Lentivirus vectors have been generated by multiply attenuating the HIV virulence genes, for example, the genes env, vif, vpr, vpu and nef are deleted making the vector biologically safe.
  • Lentivirus vectors are capable of infecting non-dividing cells and can be used for both in vivo and ex vivo gene transfer and expression, e.g., of a nucleic acid encoding a subject CAR (see, e.g., U.S. Patent No. 5,994,136).
  • Expression vectors including a nucleic acid of the present disclosure can be introduced into a host cell by any means known to persons skilled in the art.
  • the expression vectors may include viral sequences for transfection, if desired.
  • the expression vectors may be introduced by fusion, electroporation, biolistics, transfection, lipofection, or the like.
  • the host cell may be grown and expanded in culture before introduction of the expression vectors, followed by the appropriate treatment for introduction and integration of the vectors.
  • the host cells are then expanded and may be screened by virtue of a marker present in the vectors.
  • markers that may be used are known in the art, and may include hprt, neomycin resistance, thymidine kinase, hygromycin resistance, etc.
  • the terms “cell,”“cell line,” and“cell culture” may be used interchangeably.
  • the host cell is an immune cell or precursor thereof, e.g., a T cell, an NK cell, or an NKT cell.
  • the present invention also provides genetically engineered cells which include and stably express a subject CAR of the present disclosure.
  • the genetically engineered cells are genetically engineered T-lymphocytes (T cells), regulatory T cells (Tregs), naive T cells (TN), memory T cells (for example, central memory T cells (TCM), effector memory cells (TEM)), natural killer cells (NK cells), natural killer T cells (NKT cells) and macrophages capable of giving rise to therapeutically relevant progeny.
  • T cells T-lymphocytes
  • Tregs regulatory T cells
  • TN naive T cells
  • memory T cells for example, central memory T cells (TCM), effector memory cells (TEM)
  • NK cells natural killer T cells
  • NKT cells natural killer T cells
  • macrophages capable of giving rise to therapeutically relevant progeny.
  • the genetically engineered cells are autologous cells.
  • Modified cells may be produced by stably transfecting host cells with an expression vector including a nucleic acid of the present disclosure. Additional methods to generate a modified cell of the present disclosure include, without limitation, chemical transformation methods (e.g., using calcium phosphate, dendrimers, liposomes and/or cationic polymers), non-chemical transformation methods (e.g., electroporation, optical transformation, gene
  • Transfected cells expressing a subject CAR of the present disclosure may be expanded ex vivo.
  • Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • colloidal dispersion systems such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
  • Lipids suitable for use can be obtained from commercial sources.
  • DMPC dimyristyl phosphatidylcholine
  • DCP dicetyl phosphate
  • Choi cholesterol
  • DMPG dimyristyl phosphatidylglycerol
  • Liposome is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution.
  • the lipids may assume a micellar structure or merely exist as nonuniform aggregates of lipid molecules.
  • lipofectamine- nucleic acid complexes are also contemplated.
  • assays include, for example,“molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; “biochemical” assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.
  • “molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR
  • biochemical assays such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.
  • nucleic acids may be introduced by any means, such as transducing the expanded T cells, transfecting the expanded T cells, and electroporating the expanded T cells.
  • One nucleic acid may be introduced by one method and another nucleic add may be introduced into the T cell by a different method.
  • the nucleic acids introduced into the host cell are RNA.
  • the RNA is mRNA that comprises in vitro transcribed RNA or synthetic RNA.
  • the RNA is produced by in vitro transcription using a polymerase chain reaction (PCR)-generated template.
  • DNA of interest from any source can be directly converted by PCR into a template for in vitro mRNA synthesis using appropriate primers and RNA polymerase.
  • the source of the DNA can be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequence or any other appropriate source of DNA.
  • PCR can be used to generate a template for in vitro transcription of mRNA which is then introduced into cells.
  • Methods for performing PCR are well known in the art.
  • Primers for use in PCR are designed to have regions that are substantially complementary to regions of the DNA to be used as a template for the PCR
  • Substantially complementary refers to sequences of nucleotides where a majority or all of the bases in the primer sequence are complementary, or one or more bases are non-complementaiy, or mismatched. Substantially complementary sequences are able to anneal or hybridize with the intended DNA target under annealing conditions used for PCR.
  • the primers can be designed to be substantially
  • the primers can be designed to amplify the portion of a gene that is normally transcribed in cells (the open reading frame), including 5' and 3' UTRs.
  • the primers can also be designed to amplify a portion of a gene that encodes a particular domain of interest.
  • the primers are designed to amplify the coding region of a human cDNA, including all or portions of the 5' and 3' UTRs.
  • Primers useful for PCR are generated by synthetic methods that are well known in the art.
  • “Forward primers” are primers that contain a region of nucleotides that are substantially complementary to nucleotides on the DNA template that are upstream of the DNA sequence that is to be amplified.
  • “Upstream” is used herein to refer to a location 5, to the DNA sequence to be amplified relative to the coding strand.
  • “Reverse primers” are primers that contain a region of nucleotides that are substantially complementary to a double-stranded DNA template that are downstream of the DNA sequence that is to be amplified.
  • “Downstream” is used herein to refer to a location 3' to the DNA sequence to be amplified relative to the coding strand.
  • the RNA preferably has 5' and 3' UTRs.
  • the 5' UTR is between zero and 3000 nucleotides in length.
  • the length of 5' and 3' UTR sequences to be added to the coding region can be altered by different methods, including, but not limited to, designing primers for PCR that anneal to different regions of the UTRs. Using this approach, one of ordinary skill in the art can modify the 5' and 3' UTR lengths required to achieve optimal translation efficiency following transfection of the transcribed RNA.
  • the 5' and 3' UTRs can be the naturally occurring, endogenous 5' and 3' UTRs for the gene of interest.
  • UTR sequences that are not endogenous to the gene of interest can be added by incorporating the UTR sequences into the forward and reverse primers or by any other modifications of the template.
  • the use of UTR sequences that are not endogenous to the gene of interest can be useful for modifying the stability and/or translation efficiency of the RNA. For example, it is known that AU-rich elements in 3' UTR sequences can decrease the stability of mRNA. Therefore, 3' UTRs can be selected or designed to increase the stability of the transcribed RNA based on properties of UTRs that are well known in the art.
  • the 5' UTR can contain the Kozak sequence of the endogenous gene.
  • a consensus Kozak sequence can be redesigned by adding the 5' UTR sequence.
  • Kozak sequences can increase the efficiency of translation of some RNA transcripts, but does not appear to be required for all RNAs to enable efficient translation. The requirement for Kozak sequences for many mRNAs is known in the art.
  • the 5' UTR can be derived from an RNA virus whose RNA genome is stable in cells.
  • various nucleotide analogues can be used in the 3' or 5' UTR to impede exonuclease degradation of the mRNA.
  • a promoter of transcription should be attached to the DNA template upstream of the sequence to be transcribed.
  • the RNA polymerase promoter becomes incorporated into the PCR product upstream of the open reading frame that is to be transcribed.
  • the promoter is a T7 polymerase promoter, as described elsewhere herein.
  • Other useful promoters include, but are not limited to, T3 and SP6 RNA polymerase promoters. Consensus nucleotide sequences for T7, T3 and SP6 promoters are known in the art.
  • the mRNA has both a cap on the 5' end and a 3' poly(A) tail which determine ribosome binding, initiation of translation and stability mRNA in the cell.
  • RNA polymerase produces a long concatameric product which is not suitable for expression in eukaryotic cells.
  • the transcription of plasmid DNA linearized at the end of the 3' UTR results in normal sized mRNA which is not effective in eukaryotic transfection even if it is polyadenylated after transcription.
  • phage T7 RNA polymerase can extend the 3' end of the transcript beyond the last base of the template (Schenbom and Mierendorf, Nuc Acids Res., 13:6223-36 (1985); Nacheva and Berzal-Herranz, Eur. J. Biochem, 270:1485-65 (2003).
  • the polyA/T segment of the transcriptional DNA template can be produced during PCR by using a reverse primer containing a polyT tail, such as 100T tail (size can be 50-5000 T), or after PCR by any other method, including, but not limited to, DNA ligation or in vitro recombination.
  • Poly(A) tails also provide stability to RNAs and reduce their degradation. Generally, the length of a poly(A) tail positively correlates with the stability of the transcribed RNA. In one embodiment, the poly(A) tail is between 100 and 5000 adenosines.
  • Poly (A) tails of RNAs can be further extended following in vitro transcription with the use of a poly(A) polymerase, such as E. coli polyA polymerase (E-PAP).
  • E-PAP E. coli polyA polymerase
  • increasing the length of a poly (A) tail from 100 nucleotides to between 300 and 400 nucleotides results in about a two-fold increase in the translation efficiency of the RNA.
  • the attachment of different chemical groups to the 3' end can increase mRNA stability. Such attachment can contain modified/artificial nucleotides, aptamers and other compounds.
  • ATP analogs can be incorporated into the poly(A) tail using poly(A) polymerase. ATP analogs can further increase the stability of the RNA.
  • RNAs produced by the methods disclosed herein include a 5' cap.
  • the 5' cap is provided using techniques known in the art and described herein (Cougot, et al., Trends in Biochem. Sci., 29:436-444 (2001); Stepinski, et al., RNA, 7:1468-95 (2001); Elango, et al., Biochim. Biophys. Res. Commun., 330:958-966 (2005)).
  • RNAs produced by the methods disclosed herein can also contain an internal ribosome entry site (IRES) sequence.
  • IRES sequence may be any viral, chromosomal or artificially designed sequence which initiates cap-independent ribosome binding to mRNA and facilitates the initiation of translation. Any solutes suitable for cell electroporation, which can contain factors facilitating cellular permeability and viability such as sugars, peptides, lipids, proteins, antioxidants, and surfactants can be included.
  • the RNA is electroporated into the cells, such as in vitro transcribed RNA.
  • the disclosed methods can be applied to the modulation of host cell activity in basic research and therapy, in the fields of cancer, stem cells, acute and chronic infections, and autoimmune diseases, including the assessment of the ability of the genetically modified host cell to kill a target cancer cell.
  • the methods also provide the ability to control the level of expression over a wide range by changing, for example, the promoter or the amount of input RNA, making it possible to individually regulate the expression level.
  • the PCR- based technique of mRNA production greatly facilitates the design of the mRNAs with different structures and combination of their domains.
  • RNA transfection is essentially transient and a vector-free.
  • a RNA transgene can be delivered to a lymphocyte and expressed therein following a brief in vitro cell activation, as a minimal expressing cassette without the need for any additional viral sequences. Under these conditions, integration of the transgene into the host cell genome is unlikely. Cloning of cells is not necessary because of the efficiency of transfection of the RNA and its ability to uniformly modify the entire lymphocyte population.
  • TVT-RNA in vitro-transcribed RNA
  • IVT vectors are known in the literature which are utilized in a
  • RNA transcripts are produced.
  • RNA polymerase promoter enabling RNA transcription, followed by a gene of interest which is flanked either 3' and/or 5' by untranslated regions (UTR), and a 3' polyadenyl cassette containing 50-70 A nucleotides.
  • UTR untranslated regions
  • 3' polyadenyl cassette containing 50-70 A nucleotides.
  • the circular plasmid Prior to in vitro transcription, the circular plasmid is linearized downstream of the polyadenyl cassette by type II restriction enzymes (recognition sequence corresponds to cleavage site).
  • the polyadenyl cassette thus corresponds to the later poly(A) sequence in the transcript.
  • RNA has several advantages over more traditional plasmid or viral approaches. Gene expression from an RNA source does not require transcription and the protein product is produced rapidly after the transfection. Further, since the RNA has to only gain access to the cytoplasm, rather than the nucleus, and therefore typical transfection methods result in an extremely high rate of transfection. In addition, plasmid based approaches require that the promoter driving the expression of the gene of interest be active in the cells under study.
  • the RNA construct is delivered into the cells by
  • electroporation See, e.g., the formulations and methodology of electroporation of nucleic add constructs into mammalian cells as taught in US 2004/0014645, US 2005/0052630A1, US 2005/0070841A1, US 2004/0059285 Al, US 2004/0092907 Al.
  • the various parameters including electric field strength required for electroporation of any known cell type are generally known in the relevant research literature as well as numerous patents and applications in the field. See e.g., U.S. Pat. No. 6,678,556, U.S. Pat. No. 7,171,264, and U.S. Pat. No. 7,173,116.
  • Apparatuses for therapeutic application of electroporation are available commercially, e.g., the MedPulserTM DNA Electroporation Therapy System (Inovio/Genetronics, San Diego, CA), and are described in patents such as U.S. Pat. No. 6,567,694; U.S. Pat. No. 6,516,223, U.S. Pat No. 5,993,434, U.S. Pat. No. 6,181,964, U.S. Pat. No. 6,241,701, and U.S. Pat No. 6,233,482; electroporation may also be used for transfection of cells in vitro as described e.g. in US20070128708A1.
  • Electroporation may also be utilized to deliver nucleic acids into cells in vitro. Accordingly, electroporation-mediated administration into cells of nucleic acids including expression constructs utilizing any of the many available devices and electroporation systems known to those of skill in the art presents an exciting new means for delivering an RNA of interest to a target cell.
  • the present invention provides a method for generating a modified immune cell or precursor cell thereof comprising introducing into the cell an isolated nucleic add (e.g., an expression construct) encoding for a subject CAR as described herein, using any of the delivery methods described herein or are known to those of skill in the art.
  • an isolated nucleic add e.g., an expression construct
  • a source of immune cells Prior to expansion, a source of immune cells is obtained from a subject for ex vivo manipulation.
  • Sources of target cells for ex vivo manipulation may also include, e.g., autologous or heterologous donor blood, cord blood, or bone marrow.
  • the source of immune cells may be from the subject to be treated with the modified immune cells of the invention, e.g., the subject's blood, the subject's cord blood, or the subject’s bone marrow.
  • Non-limiting examples of subjects include humans, dogs, cats, mice, rats, and transgenic species thereof.
  • the subject is a human.
  • Immune cells can be obtained from a number of sources, including blood, peripheral blood mononuclear cells, bone marrow, lymph node tissue, spleen tissue, umbilical cord, lymph, or lymphoid organs.
  • Immune cells are cells of the immune system, such as cells of the innate or adaptive immunity, e.g., myeloid or lymphoid cells, including lymphocytes, typically T cells and/or NK cells and/or NKT cells.
  • Other exemplary cells include stem cells, such as multipotent and pluripotent stem cells, including induced pluripotent stem cells (iPSCs).
  • the cells are human cells. With reference to the subject to be treated, the cells may be allogeneic and/or autologous.
  • the cells typically are primary cells, such as those isolated directly from a subject and/or isolated from a subject and frozen.
  • the immune cell is a T cell, e.g., a CD8+ T cell (e.g., a CD8+ naive T cell, central memory T cell, or effector memory T cell), a CD4+ T cell, a natural killer T cell (NKT cells), a regulatory T cell (Treg), a stem cell memory T cell, a lymphoid progenitor cell, a hematopoietic stem cell, a natural killer cell (NK cell), a natural killer T cell (NK cell) or a dendritic cell.
  • a CD8+ T cell e.g., a CD8+ naive T cell, central memory T cell, or effector memory T cell
  • a CD4+ T cell e.g., a CD4+ T cell, a natural killer T cell (NKT cells), a regulatory T cell (Treg), a stem cell memory T cell, a lymphoid progenitor cell, a hematopoietic stem cell
  • the cells are monocytes or granulocytes, e.g., myeloid cells, macrophages, neutrophils, dendritic cells, mast cells, eosinophils, and/or basophils.
  • the target cell is an induced pluripotent stem (iPS) cell or a cell derived from an iPS cell, e.g., an iPS cell generated from a subject, manipulated to alter (e.g., induce a mutation in) or manipulate the expression of one or more target genes, and differentiated into, e.g., a T cell, e.g., a CD8+ T cell (e.g., a CD8+ naive T cell, central memory T cell, or effector memory T cell), a CD4+ T cell, a stem cell memory T cell, a lymphoid progenitor cell or a hematopoietic stem cell.
  • iPS induced pluripotent stem
  • the cells include one or more subsets of T cells or other cell types, such as whole T cell populations, CD4+ cells, CD8+ cells, and
  • subpopulations thereof such as those defined by function, activation state, maturity, potential for differentiation, expansion, recirculation, localization, and/or persistence capacities, antigen-specificity, type of antigen receptor, presence in a particular organ or compartment, marker or cytokine secretion profile, and/or degree of differentiation.
  • T cells and/or of CD4+ and/or of CD8+ T cells are naive T (TN) cells, effector T cells (TEFF), memory T cells and sub-types thereof, such as stem cell memory T (TSCM), central memory T (TCM), effector memory T (TEM), or terminally differentiated effector memory T cells, tumor- infiltrating lymphocytes (TIL), immature T cells, mature T cells, helper T cells, cytotoxic T cells, mucosa-associated invariant T (MAIT) cells, naturally occurring and adaptive regulatory T (Treg) cells, helper T cells, such as TH1 cells, TH2 cells, TH3 cells, TH17 cells, TH9 cells, TH22 cells, follicular helper T cells, alpha/beta T cells, and delta/gamma T cells.
  • TIL tumor- infiltrating lymphocytes
  • TIL tumor- infiltrating lymphocytes
  • immature T cells immature T cells
  • mature T cells mature T
  • the methods include isolating immune cells from the subject, preparing, processing, culturing, and/or engineering them.
  • preparation of the engineered cells includes one or more culture and/or preparation steps.
  • the cells for engineering as described may be isolated from a sample, such as a biological sample, e.g., one obtained from or derived from a subject.
  • the subject from which the cell is isolated is one having the disease or condition or in need of a cell therapy or to which cell therapy will be administered.
  • the subject in some embodiments is a human in need of a particular therapeutic
  • the cells in some embodiments are primary cells, e.g., primary human cells.
  • the samples include tissue, fluid, and other samples taken directly from the subject, as well as samples resulting from one or more processing steps, such as separation, centrifugation, genetic engineering (e.g., transduction with viral vector), washing, and/or incubation.
  • the biological sample can be a sample obtained directly from a biological source or a sample that is processed.
  • Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine and sweat, tissue and organ samples, including processed samples derived therefrom
  • the sample from which the cells are derived or isolated is blood or a blood-derived sample, or is or is derived from an apheresis or leukapheresis product.
  • exemplary samples include whole blood, peripheral blood mononuclear cells (PBMCs), leukocytes, bone marrow, thymus, tissue biopsy, tumor, leukemia, lymphoma, lymph node, gut associated lymphoid tissue, mucosa associated lymphoid tissue, spleen, other lymphoid tissues, liver, lung, stomach, intestine, colon, kidney, pancreas, breast, bone, prostate, cervix, testes, ovaries, tonsil, or other organ, and/or cells derived therefrom.
  • Samples include, in the context of cell therapy, e.g., adoptive cell therapy, samples from autologous and allogeneic sources.
  • the cells are derived from cell lines, e.g., T cell lines.
  • the cells in some embodiments are obtained from a xenogeneic source, for example, from mouse, rat, non-human primate, and pig.
  • isolation of the cells includes one or more preparation and/or non-affinity based cell separation steps.
  • cells are washed, centrifuged, and/or incubated in the presence of one or more reagents, for example, to remove unwanted components, enrich for desired components, lyse or remove cells sensitive to particular reagents.
  • cells are separated based on one or more property, such as density, adherent properties, size, sensitivity and/or resistance to particular components.
  • cells from the circulating blood of a subject are obtained, e.g., by apheresis or leukapheresis.
  • the samples in certain aspects, contain
  • lymphocytes including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and/or platelets, and in certain aspects contains cells other than red blood cells and platelets.
  • the blood cells collected from the subject are washed, e.g., to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing steps.
  • the cells are washed with phosphate buffered saline (PBS).
  • a washing step is accomplished by tangential flow filtration (TFF) according to the manufacturer's instructions.
  • the cells are resuspended in a variety of biocompatible buffers after washing.
  • components of a blood cell sample are removed and the cells directly resuspended in culture media.
  • the methods include density-based cell separation methods, such as the preparation of white blood cells from peripheral blood by lysing the red blood cells and centrifugation through a Percoll or Ficoll gradient.
  • immune cells are obtained from the circulating blood of an individual are obtained by apheresis or leukapheresis.
  • the apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets.
  • the cells collected by apheresis may be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media, such as phosphate buffered saline (PBS) or wash solution lacks calcium and may lack magnesium or may lack many if not all divalent cations, for subsequent processing steps.
  • PBS phosphate buffered saline
  • wash solution lacks calcium and may lack magnesium or may lack many if not all divalent cations, for subsequent processing steps.
  • a washing step may be accomplished by methods known to those in the art, such as by using a semi-automated“flow-through” centrifuge (for example, the Cobe 2991 cell processor, the Baxter CytoMate, or the Haemonetics Cell Saver 5) according to the manufacturer's instructions.
  • the cells may be resuspended in a variety of biocompatible buffers, such as, for example, Ca 2+ -free, Mg 2+ -free PBS, PlasmaLyte A, or another saline solution with or without buffer.
  • the undesirable components of the apheresis sample may be removed and the cells directly resuspended in culture media.
  • the isolation methods include the separation of different cell types based on the expression or presence in the cell of one or more specific molecules, such as surface markers, e.g., surface proteins, intracellular markers, or nucleic acid. In some embodiments, any known method for separation based on such markers may be used. In some embodiments, the separation is affinity- or
  • the isolation in certain aspects includes separation of cells and cell populations based on the cells' expression or expression level of one or more markers, typically cell surface markers, for example, by incubation with an antibody or binding partner that specifically binds to such markers, followed generally by washing steps and separation of cells having bound the antibody or binding partner, from those cells having not bound to the antibody or binding partner.
  • Such separation steps can be based on positive selection, in which the cells having bound the reagents are retained for further use, and/or negative selection, in which the cells having not bound to the antibody or binding partner are retained. In some examples, both fractions are retained for further use.
  • negative selection can be particularly useful where no antibody is available that specifically identifies a cell type in a heterogeneous population, such that separation is best carried out based on markers expressed by cells other than the desired population.
  • the separation need not result in 100% enrichment or removal of a particular cell population or cells expressing a particular marker.
  • positive selection of or enrichment for cells of a particular type such as those expressing a marker, refers to increasing the number or percentage of such cells, but need not result in a complete absence of cells not expressing the marker.
  • negative selection, removal, or depletion of cells of a particular type, such as those expressing a marker refers to decreasing the number or percentage of such cells, but need not result in a complete removal of all such cells.
  • multiple rounds of separation steps are carried out, where the positively or negatively selected fraction from one step is subjected to another separation step, such as a subsequent positive or negative selection.
  • a single separation step can deplete cells expressing multiple markers simultaneously, such as by incubating cells with a plurality of antibodies or binding partners, each specific for a marker targeted for negative selection.
  • multiple cell types can simultaneously be positively selected by incubating cells with a plurality of antibodies or binding partners expressed on the various cell types.
  • one or more of tire T cell populations is enriched for or depleted of cells that are positive for (markeri-) or express high levels (marker high ) of one or more particular markers, such as surface markers, or that are negative for (marker-) or express relatively low levels (marker low ) of one or more markers.
  • markers such as surface markers, or that are negative for (marker-) or express relatively low levels (marker low ) of one or more markers.
  • specific subpopulations of T cells such as cells positive or expressing high levels of one or more surface markers, e.g., CD28+, CD62L+, CCR7+, CD27+, CD127+, CD4+, CD8+, CD45RA+, and/or CD45RO+ T cells, are isolated by positive or negative selection techniques.
  • such markers are those that are absent or expressed at relatively low levels on certain populations of T cells (such as non-memory cells) but are present or expressed at relatively higher levels on certain other populations of T cells (such as memory cells).
  • the cells such as the CD8+ cells or the T cells, e.g., CD3+ cells
  • CD45RA CCR7, CD28, CD27, CD44, CD127, and/or CD62L and/or depleted of (e.g., negatively selected for) cells that are positive for or express high surface levels of CD45RA.
  • cells are enriched for or depleted of cells positive or expressing high surface levels of CD122, CD95, CD25, CD27, and/or IL7-Ra (CD 127).
  • CD8+ T cells are enriched for cells positive for CD45RO (or negative for CD45RA) and for CD62L.
  • CD3+, CD28+ T cells can be positively selected using CD3/CD28 conjugated magnetic beads (e.g., DYNABEADS® M-450 CD3/CD28 T Cell Expander).
  • T cells are separated from a PBMC sample by negative selection of markers expressed on non-T cells, such as B cells, monocytes, or other white blood cells, such as CD14.
  • a CD4+ or CD8+ selection step is used to separate CD4+ helper and CD8+ cytotoxic T cells.
  • Such CD4+ and CD8+ populations can be further sorted into sub-populations by positive or negative selection for markers expressed or expressed to a relatively higher degree on one or more naive, memory, and/or effector T cell subpopulations.
  • CD8+ cells are further enriched for or depleted of naive, central memory, effector memory, and/or central memory stem cells, such as by positive or negative selection based on surface antigens associated with the respective subpopulation.
  • enrichment for central memory T (TCM) cells is carried out to increase efficacy, such as to improve long-term survival, expansion, and/or engraftment following
  • combining TCM-enriched CD8+ T cells and CD4+ T cells further enhances efficacy.
  • memory T cells are present in both CD62L+ and CD62L- subsets of CD8+ peripheral blood lymphocytes.
  • PBMC can be enriched for or depleted of CD62L-CD8+ and/or CD62L+CD8+ fractions, such as using anti-CD8 and anti-CD62L antibodies.
  • a CD4+ T cell population and/or a CD8+ T population is enriched for central memory (TCM) cells.
  • the enrichment for central memory T (TCM) cells is based on positive or high surface expression of CD45RO, CD62L, CCR7, CD28, CDS, and/or CD 127; in certain aspects, it is based on negative selection for cells expressing or highly expressing CD45RA and/or granzyme B.
  • isolation of a CD8+ population enriched for TCM cells is carried out by depletion of cells expressing CD4, CD 14, CD45RA, and positive selection or enrichment for cells expressing CD62L.
  • enrichment for central memory T (TCM) cells is carried out starting with a negative fraction of cells selected based on CD4 expression, which is subjected to a negative selection based on expression of CD 14 and CD45RA, and a positive selection based on CD62L.
  • Such selections in certain aspects are carried out simultaneously and in other aspects are carried out sequentially, in either order.
  • the same CD4 expression- based selection step used in preparing the CD8+ cell population or subpopulation also is used to generate the CD4+ cell population or sub-population, such that both the positive and negative fractions from the CD4-based separation are retained and used in subsequent steps of the methods, optionally following one or more further positive or negative selection steps.
  • CD4+ T helper cells are sorted into naive, central memory, and effector cells by identifying cell populations that have cell surface antigens.
  • CD4+ lymphocytes can be obtained by standard methods.
  • naive CD4+ T lymphocytes are CD45RO-, CD45RA+, CD62L+, CD4+ T cells.
  • central memory CD4+ cells are CD62L+ and CD45RO+.
  • effector CD4+ cells are CD62L- and CD45RO.
  • a monoclonal antibody cocktail typically includes antibodies to CD 14, CD20, CD1 lb, CD16, HLA-DR, and CDS.
  • the antibody or binding partner is bound to a solid support or matrix, such as a magnetic bead or paramagnetic bead, to allow for separation of cells for positive and/or negative selection.
  • the cells are incubated and/or cultured prior to or in connection with genetic engineering.
  • the incubation steps can include culture, cultivation, stimulation, activation, and/or propagation.
  • the compositions or cells are incubated in the presence of stimulating conditions or a stimulatory agent. Such conditions include those designed to induce proliferation, expansion, activation, and/or survival of cells in the population, to mimic antigen exposure, and/or to prime the cells for genetic engineering, such as for the introduction of a recombinant antigen receptor.
  • the conditions can include one or more of particular media, temperature, oxygen content, carbon dioxide content, time, agents, e.g., nutrients, amino acids, antibiotics, ions, and/or stimulatory factors, such as cytokines, chemokines, antigens, binding partners, fusion proteins, recombinant soluble receptors, and any other agents designed to activate the cells.
  • the stimulating conditions or agents include one or more agent, e.g., ligand, which is capable of activating an intracellular signaling domain of a TCR complex.
  • the agent turns on or initiates TCR/CD3 intracellular signaling cascade in a T cell.
  • Such agents can include antibodies, such as those specific for a TCR component and/or costimulatory receptor, e.g., anti-CD3, anti-CD28, for example, bound to solid support such as a bead, and/or one or more cytokines.
  • the expansion method may further comprise the step of adding anti-CD3 and/or anti CD28 antibody to the culture medium (e.g., at a concentration of at least about 0.5 ng/ml).
  • the stimulating agents include IL-2 and/or IL-15, for example, an IL-2 concentration of at least about 10 units/mL.
  • T cells are isolated from peripheral blood by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLLTM gradient.
  • T cells can be isolated from an umbilical cord.
  • a specific subpopulation of T cells can be further isolated by positive or negative selection techniques.
  • the cord blood mononuclear cells so isolated can be depleted of cells expressing certain antigens, including, but not limited to, CD34, CDS, CD14, CD19, and CD56. Depletion of these cells can be accomplished using an isolated antibody, a biological sample comprising an antibody, such as ascites, an antibody bound to a physical support, and a cell bound antibody.
  • Enrichment of a T cell population by negative selection can be accomplished using a combination of antibodies directed to surface markers unique to the negatively selected cells.
  • An exemplary method is cell sorting and/or selection via negative magnetic immunoadherence or flow cytometry that uses a cocktail of monoclonal antibodies directed to cell surface markers present on the cells negatively selected.
  • a monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CDllb, CD16, HLA-DR, and CDS.
  • the concentration of cells and surface can be varied. In certain embodiments, it may be desirable to significantly decrease the volume in which beads and cells are mixed together (i.e., increase the concentration of cells), to ensure maximum contact of cells and beads. For example, in one embodiment, a concentration of 2 billion cells/ml is used. In one embodiment, a concentration of 1 billion cells/ml is used. In a further embodiment, greater than 100 million cells/ml is used. In a further embodiment, a concentration of cells of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells/ml is used. In yet another embodiment, a concentration of cells from 75, 80, 85,
  • concentrations of 125 or 150 million cells/ml can be used. Using high concentrations can result in increased cell yield, cell activation, and cell expansion.
  • T cells can also be frozen after the washing step, which does not require the monocyte-removal step. While not wishing to be bound by theory, the freeze and subsequent thaw step provides a more uniform product by removing granulocytes and to some extent monocytes in the cell population.
  • the cells may be suspended in a freezing solution. While many freezing solutions and parameters are known in the art and will be useful in this context, in anon-limiting example, one method involves using PBS containing 20% DMSO and 8% human serum albumin, or other suitable cell freezing media. The cells are then frozen to -80°C at a rate of 1°C per minute and stored in the vapor phase of a liquid nitrogen storage tank. Other methods of controlled freezing may be used as well as uncontrolled freezing immediately at -20°C or in liquid nitrogen.
  • the population of T cells is comprised within cells such as peripheral blood mononuclear cells, cord blood cells, a purified population of T cells, and a T cell line.
  • peripheral blood mononuclear cells comprise the population of T cells.
  • purified T cells comprise the population of T cells.
  • the cells can be activated and expanded in number using methods as described, for example, in U.S. Patent Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843;
  • the immune cells of the invention may be expanded by contact with a surface having attached thereto an agent that stimulates a CD3/TCR complex associated signal and a ligand that stimulates a co-stimulatory molecule on the surface of the immune cells.
  • immune cell populations may be stimulated by contact with an anti-CD3 antibody, or an antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., biyostatin) in conjunction with a calcium ionophore.
  • a protein kinase C activator e.g., biyostatin
  • a ligand that binds the accessory molecule is used.
  • immune cells can be contacted with an anti-CD3 antibody and an anti-CD28 antibody, under conditions appropriate for stimulating proliferation of the immune cells.
  • an anti-CD28 antibody include 9.3, B-T3, XR-CD28 (Diaclone, Bes ancon, France) and these can be used in the invention, as can other methods and reagents known in the art (see, e.g., ten Berge et al., Transplant Proc. (1998) 30(8): 3975-3977; Haanen et al., J. Exp. Med. (1999) 190(9): 1319-1328; and Garland et al., J. Immunol. Methods (1999) 227(1-2): 53-63).
  • Expanding the immune cells by the methods disclosed herein can be multiplied by about 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700 fold, 800-fold, 900-fold, 1000-fold, 2000-fold, 3000-fold, 4000-fold, 5000-fold, 6000-fold, 7000-fold, 8000-fold, 9000-fold, 10,000-fold, 100,000-fold, 1,000,000-fold, 10,000,000-fold, or greater, and any and all whole or partial integers therebetween.
  • the immune cells expand in the range of about 20-fold to about 50-fold.
  • the immune cells can be incubated in cell medium in a culture apparatus for a period of time or until the cells reach confluency or high cell density for optimal passage before passing the cells to another culture apparatus.
  • the culturing apparatus can be of any culture apparatus commonly used for culturing cells in vitro.
  • the level of confluence is 70% or greater before passing the cells to another culture apparatus.
  • the level of confluence is 90% or greater.
  • a period of time can be any time suitable for the culture of cells in vitro.
  • the immune cell medium may be replaced during the culture of the immune cells at any time. In certain exemplary embodiments, the immune cell medium is replaced about every 2 to 3 days.
  • the immune cells are then harvested from the culture apparatus whereupon the immune cells can be used immediately or cryopreserved to be stored for use at a later time.
  • the invention includes cryopreserving the expanded immune cells.
  • the cryopreserved immune cells are thawed prior to introducing nucleic adds into the immune cell.
  • the method comprises isolating immune cells and expanding the immune cells.
  • the invention further comprises cry opreserving the immune cells prior to expansion.
  • the cryopreserved immune cells are thawed for electroporation with the RNA encoding the chimeric membrane protein.
  • ex vivo expansion cells Another procedure for ex vivo expansion cells is described in U.S. Pat. No. 5,199,942 (incorporated herein by reference). Expansion, such as described in U.S. Pat. No. 5,199,942 can be an alternative or in addition to other methods of expansion described herein. Briefly, ex vivo culture and expansion of immune cells comprises the addition to the cellular growth factors, such as those described in U.S. Pat. No.
  • expanding the immune cells comprises culturing the immune cells with a factor selected from the group consisting of flt3-L, IL-1, IL-3 and c-kit ligand.
  • the culturing step as described herein can be very short, for example less than 24 hours such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours.
  • the culturing step as described further herein can be longer, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more days.
  • Cell culture refers generally to cells taken from a living organism and grown under controlled condition.
  • a primary cell culture is a culture of cells, tissues or organs taken directly from an organism and before the first subculture.
  • Cells are expanded in culture when they are placed in a growth medium under conditions that facilitate cell growth and/or division, resulting in a larger population of the cells.
  • the rate of cell proliferation is typically measured by the amount of time required for the cells to double in number, otherwise known as the doubling time.
  • Each round of subculturing is referred to as a passage.
  • cells When cells are subcultured, they are referred to as having been passaged.
  • a specific population of cells, or a cell line, is sometimes referred to or characterized by the number of times it has been passaged.
  • a cultured cell population that has been passaged ten times may be referred to as a P10 culture.
  • the primary culture i.e., the first culture following the isolation of cells from tissue, is designated P0.
  • the cells are described as a secondary culture (PI or passage 1).
  • the cells become a tertiary culture (P2 or passage 2), and so on.
  • the number of population doublings of a culture is greater than the passage number.
  • the expansion of cells (i.e., the number of population doublings) during the period between passaging depends on many factors, including but is not limited to the seeding density, substrate, medium, and time between passaging.
  • the cells may be cultured for several hours (about 3 hours) to about 14 days or any hourly integer value in between.
  • Conditions appropriate for immune cell culture include an appropriate media (e.g., Minimal Essential Media or RPMI Media 1640 or, X-vivo 15, (Lonza)) that may contain factors necessary for proliferation and viability, including serum (e.g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-gamma, IL-4, IL-7, GM-CSF, IL-10, IL-12, IL-15, TGF-beta, and TNF-a or any other additives for the growth of cells known to the skilled artisan.
  • serum e.g., fetal bovine or human serum
  • IL-2 interleukin-2
  • insulin IFN-gamma
  • IL-4 interleukin-7
  • GM-CSF GM-CSF
  • IL-10 interleukin-12
  • IL-15 IL-15
  • additives for the growth of cells include, but are not limited to, surfactant, plasmanate, and reducing agents such as N-acetyl-cysteine and 2-mercaptoethanol .
  • Media can include RPMI 1640, AIM-V, DMEM, MEM, a-MEM, F-12, X-Vivo 15, and X-Vivo 20, Optimizer, with added amino acids, sodium pyruvate, and vitamins, either serum-free or supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones, and/or an amount of cytokine(s) sufficient for the growth and expansion of immune cells.
  • Antibiotics e.g., penicillin and streptomycin
  • the target cells are maintained under conditions necessary to support growth, for example, an appropriate temperature (e.g., 37° C) and atmosphere (e.g., air plus 5% C0 2 ).
  • the medium used to culture the immune cells may include an agent that can costimulate the immune cells.
  • an agent that can stimulate CDS is an antibody to CDS
  • an agent that can stimulate CD28 is an antibody to CD28.
  • a cell isolated by the methods disclosed herein can be expanded approximately 10-fold, 20-fold, 30-fold, 40-fold, 50- fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold, 2000-fold, 3000-fold, 4000-fold, 5000-fold, 6000-fold, 7000-fold, 8000-fold, 9000-fold, 10,000-fold, 100,000-fold, 1,000,000-fold, 10,000,000-fold, or greater.
  • the immune cells expand in the range of about 2-fold to about 50-fold, or more by culturing the electroporated population.
  • human T regulatory cells are expanded via anti-CDS antibody coated KT64.86 artificial antigen presenting cells (aAPCs).
  • aAPCs antigen presenting cells
  • the method of expanding the immune cells can further comprise isolating the expanded immune cells for further applications. In another embodiment, the method of expanding can further comprise a subsequent
  • the subsequent electroporation may include introducing a nucleic acid encoding an agent, such as a transducing the expanded immune cells, transfecting the expanded immune cells, or electroporating the expanded immune cells with a nucleic acid, into the expanded population of immune cells, wherein the agent further stimulates the immune cell.
  • the agent may stimulate the immune cells, such as by stimulating further expansion, effector function, or another immune cell function.
  • Mucins are high molecular weight glycosylated proteins that function in normal, healthy cells as a physicochemical protection from toxins and mutagens when overexpressed in epithelial cells. Expression is noted in other healthy cell types where mucins can function as adhesion modulators or play a role in signal transduction and regulation of cell growth (Winterford et al. (1999) J Histochem Cytochem, 47(8): 1063- 1074). Tumorigenesis and metastasis have been shown to increase with changes in cell surface glycosylation of mucins (protein modifications after additions of sugar moieties to specific amino acids) of various proteins (Ren et al. (2014) Tumour Biol,
  • Tn GalNAcal-O-Ser/Thr
  • STn sialyl-Tn
  • TnMUCl Mudnl glycoprotein
  • MUC1 cell membrane- bound mucin
  • TnMUCl the aberrantly glycosylated version
  • Tumor-associated TnMUCl is overexpressed in a proportion of multiple myeloma cases (Andrulis et al. (2014 ) Histopathology, 64:799-806; Cloosen et al.
  • the invention includes a method of treating a MUC1 -associated cancer in a subject in need thereof.
  • the invention includes a method of treating a MUC 1 -associated cancer in a subject comprising administering to a subject in need thereof a therapeutically effective population of modified immune cells of the present invention.
  • the MUC 1 -associated cancer is selected from the group consisting of multiple myeloma, breast cancer, colon cancer, lung cancer, stomach cancer, cancer of the ovary, and cancer of the pancreas.
  • the MUC 1 -associated cancer is selected from the group consisting of a MUC1- associated breast cancer, a MUC 1 -associated multiple myeloma, a MUC 1 -associated non-small cell lung cancer, a MUC 1 -associated pancreatic adenocarcinoma, a MUC1- associated ovarian and fallopian tube cancers.
  • the method comprises administering to the subject a modified immune cell (e.g., MUC1 CAR T cell) of the present invention.
  • a modified immune cell e.g., MUC1 CAR T cell
  • the terms“subject” and“patient” refer to organisms to be treated by the methods of the present invention.
  • the terms“subject” and“patient” may be used interchangeably herein.
  • Such organisms include, but are not limited to, mammals (e.g., murines, simians, equines, bo vines, porcines, canines, felines, and the like), and in an exemplary embodiment includes humans.
  • the terms “treat,”“treatment” and“treating” include any effect, e.g., lessening, reducing, modulating, ameliorating or eliminating, that results in the improvement of the condition, disease, disorder, and the like, or ameliorating a symptom thereof, such as for example, reduced number of cancer cells, reduced tumor size, reduced tumor burden, reduced rate of cancer cell infiltration into peripheral organs, or reduced rate of tumor metastasis or tumor growth.
  • Positive therapeutic effects in cancer can be measured in a number of ways (See, W. A. Weber, J. Null. Med. 50:1S-10S (2009); Eisenhauer et al., Eur. J. Cancer 45:228- 247 (2009)).
  • response to a subject CAR T cell therapy e.g., TN- MUC1 CAR T cell therapy
  • RECIST 1.1 criteria see, Eisenhauer et al., supra.
  • the treatment achieved by a therapeutically effective amount is any of a partial response (PR), a complete response (CR), progression free survival (PFS), disease free survival (DFS), objective response (OR), a change in the duration of response (e.g., an increase in the duration of response), a change in the time to response (e.g., a shortened time to response), or overall survival (OS).
  • the therapeutically effective amount described herein that is effective to treat breast cancer in a patient may vary according to various factors such as the disease state, age, and weight of the patient, and the ability of the therapy to elicit an anti-cancer response in the subject.
  • RECIST 1.1 Response Criteria as used herein means the definitions set forth in Eisenhauer et al. (2009) Ear J Cancer, 45(2):228-247 for target lesions or non-target lesions, as appropriate, based on the context in which response is being measured.
  • Tumor refers to a subject diagnosed with, or suspected of having, cancer (e.g., MUC1 -associated breast cancer, MUC1 -associated multiple myeloma, MUC1- associated non-small cell lung cancer, MUC1 -associated pancreatic adenocarcinoma, MUC1 -associated ovarian and fallopian tube cancers), refers to a malignant or potentially malignant neoplasm or tissue mass of any size.
  • cancer e.g., MUC1 -associated breast cancer, MUC1 -associated multiple myeloma, MUC1- associated non-small cell lung cancer, MUC1 -associated pancreatic adenocarcinoma, MUC1 -associated ovarian and fallopian tube cancers
  • cancer e.g., MUC1 -associated breast cancer, MUC1 -associated multiple myeloma, MUC1- associated non-small cell lung cancer, MUC1 -associated pancreatic adenocarcinom
  • Tumor burden also referred to as“tumor load,” refers to the total amount of tumor material distributed throughout the body. Tumor burden refers to the total number of cancer cells or the total size of tumor(s) throughout the body, including lymph nodes and bone narrow. Tumor burden can be determined by a variety of methods known in the art, such as, e.g., by measuring the dimensions of tumor(s) upon removal from the subject, e.g., using calipers, or while in the body using imaging techniques, e.g., ultrasound, bone scan, computed tomography (CT) or magnetic resonance imaging (MRI) scans.
  • CT computed tomography
  • MRI magnetic resonance imaging
  • tumor size refers to the total size of the tumor which can be measured as the length and width of a tumor. Tumor size may be determined by a variety of methods known in the art, such as, e.g., by measuring the dimensions of tumor(s) upon removal from the subject, e.g., using calipers, or while in the body using imaging techniques, e.g., bone scan, ultrasound, CT or MRI scans.
  • imaging techniques e.g., bone scan, ultrasound, CT or MRI scans.
  • the invention includes a method of treating a MUC1 -associated breast cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective population of modified immune cells, wherein the modified immune cells comprise a chimeric antigen receptor (CAR).
  • the CAR comprises a MUC1 -specific antigen binding domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
  • the invention includes a method of treating a MUC1 -associated multiple myeloma in a subject in need thereof, comprising administering to the subject a therapeutically effective population of modified immune cells, wherein the modified immune cells comprise a chimeric antigen receptor (CAR).
  • the CAR comprises a MUC1 -specific antigen binding domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
  • the modified cell further comprises a dominant negative receptor and/or switch receptor.
  • the invention includes a method of treating a MUC1 -associated non-small cell lung cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective population of modified immune cells, wherein the modified immune cells comprise a chimeric antigen receptor (CAR).
  • the CAR comprises a MUC1 -specific antigen binding domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
  • the modified cell further comprises a dominant negative receptor and/or switch receptor.
  • the invention includes a method of treating a MUC1 -associated pancreatic adenocarcinoma in a subject in need thereof, comprising administering to the subject a therapeutically effective population of modified immune cells, wherein the modified immune cells comprise a chimeric antigen receptor (CAR).
  • the CAR comprises a MUC1 -specific antigen binding domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
  • the modified cell further comprises a dominant negative receptor and/or switch receptor.
  • the invention includes a method of treating a MUC1 -associated ovarian and/or fallopian tube cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective population of modified immune cells, wherein the modified immune cells comprise a chimeric antigen receptor (CAR).
  • the CAR comprises a MUC1 -specific antigen binding domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
  • the modified cell further comprises a dominant negative receptor and/or switch receptor.
  • the MUC1 -specific antigen binding domain binds to a glycosylated form of MUC1, i.e. is specific for a gly coepitope of MUC1. In certain embodiments, the MUC1 -specific antigen binding domain is specific for a truncated gly coepitope of MUC1. In certain embodiments, the MUC1 -specific antigen binding domain is specific for TnMUCl. In certain embodiments, the MUC1 -specific antigen binding domain may comprise the heavy chain complementarity determining region (CDR) sequences of SEQ ID NOs: 22, 23 and 24 and/or the light chain
  • CDR heavy chain complementarity determining region
  • the MUC1 -specific antigen binding domain may comprise all six complementarity determining region (CDR) sequences of SEQ ID NOs: 19-24.
  • the MUC1 -specific antigen binding domain may comprise the heavy chain variable domain (VH) sequence of SEQ ID NO: 5 and/or the light chain variable domain (VL) sequence of SEQ ID NO: 6.
  • the MUC1- specific antigen binding domain comprises the amino acid sequence of SEQ ID NO: 2.
  • the CAR used in the methods of the invention may comprise a transmembrane domain selected from the group consisting of an artificial hydrophobic sequence, a transmembrane domain of a type I transmembrane protein, an alpha, beta, or zeta chain of a T cell receptor, CD28, CDS epsilon, CD45, CD4, CDS, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, 0X40 (CD134), 4-1BB (CD137), and CD154.
  • the transmembrane domain comprises a CD8a transmembrane domain.
  • the CAR may comprise a costimulatory signaling domain comprising a costimulatory domain of a protein selected from the group consisting of a TNFR superfamily member, CD27, CD28, 4-1BB (CD137), 0X40 (CD134), CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CDS, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83, DAP10, DAP12, Lck, Fas, and any combination thereof.
  • the costimulatory signaling domain comprises a 4- IBB costimulatory domain.
  • the intracellular signaling domain may comprise a signaling domain of a protein selected from the group consisting of CD3 zeta, FcyRin, FcsRI, a cytoplasmic tail of an Fc receptor, an immunoreceptor tyrosine-based activation motif (IT AM) bearing cytoplasmic receptor, TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CDS, CD22, CD79a, CD79b, and CD66d.
  • the intracellular signaling domain comprises a CD3 zeta signaling domain.
  • the CAR may further comprise a CD8a leader sequence and/or an extracellular hinge domain selected from the group consisting of an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CHS region of an antibody, an artificial spacer sequence, a hinge comprising an amino acid sequence of CDS, and any combination thereof.
  • the extracellular hinge domain comprises a CDSa extracellular hinge domain.
  • the CAR is encoded by a nucleic acid sequence comprising the nucleotide sequence of SEQ ID NOs: 1, 38, 40, 42, 44, or 46. In certain embodiments, the CAR comprises the amino acid sequence of SEQ ID NOs: 2, 39, 41, 43, 45, or 47.
  • the CAR is encoded by a nucleic acid sequence comprising the nucleotide sequence of SEQ ID NO: 46. In certain exemplary embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 47.
  • a CAR of the present disclosure when present in a T lymphocyte or an NK cell, can mediate cytotoxicity toward a target cell.
  • a CAR of the present disclosure binds to an antigen present on a target cell, thereby mediating killing of a target cell by a T lymphocyte or an NK cell genetically modified to produce the CAR
  • the antigenbinding domain of the CAR e.g., anti-TN-MUCl scFv
  • Target cells include, but are not limited to, cancer cells, e.g., breast cancer cells.
  • the present disclosure provides methods of killing, or inhibiting the growth of, a target cancer cell, the method involving contacting a cytotoxic immune effector cell (e.g., a cytotoxic T cell, or an NK cell) that is genetically modified to produce a subject CAR, such that the T lymphocyte or NK cell recognizes an antigen present on the surface of a target cancer cell, and mediates killing of the target cell.
  • a cytotoxic immune effector cell e.g., a cytotoxic T cell, or an NK cell
  • the present disclosure provides a method of treating cancer in a subject having a cancer, the method comprising: i) introducing a chimeric antigen receptor of the present disclosure, or introducing an expression vector of the present disclosure, into a cell, to produce a modified cell; and ii) administering tire modified cell to the subject.
  • the cell is obtained from the subject (i.e., tire cell is autologous), engineered ex vivo, and administered to the same subject.
  • the cell is obtained from one subject, engineered ex vivo, and administered to a second suitable subject (i.e., the cell is allogeneic).
  • a method including retrieving cytotoxic cells from a subject, genetically modifying the cytotoxic cells by introducing a CAR gene of the present invention into the cytotoxic cells, and administering the modified cytotoxic cells to the subject.
  • the cytotoxic cells are selected from T cells, naive T cells, memory T cells, effector T cells, natural killer cells, and macrophages.
  • the cytotoxic cells are T cells.
  • the T cells are obtained from a subject.
  • T cells can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors.
  • any number of T cell lines available in the art may be used.
  • T cells can be obtained from blood collected from a subject using any number of techniques known to the skilled artisan, such as FicollTM separation.
  • T cells are isolated by incubation with anti- CD3/anti-CD28 (i.e., 3x28)-conjugated beads, such as DYNABEADS® M-450 CD3/CD28 T, for a time period sufficient for positive selection of the desired T cells.
  • anti- CD3/anti-CD28 i.e., 3x28
  • 3x28-conjugated beads such as DYNABEADS® M-450 CD3/CD28 T
  • the time period is about 30 minutes. In one embodiment, the time period ranges from 30 minutes to 36 hours or longer and all integer values there between. In one embodiment, the time period is at least 1, 2, 3, 4, 5, or 6 hours. In one embodiment, the time period is 10 to 24 hours. In one embodiment, the incubation time period is 24 hours. For isolation of T cells from patients with leukemia, use of longer incubation times, such as 24 hours, can increase cell yield. Longer incubation times may be used to isolate T cells in any situation where there are few T cells as compared to other cell types, such in isolating tumor infiltrating lymphocytes (TIL) from tumor tissue or from immune-compromised individuals.
  • TIL tumor infiltrating lymphocytes
  • T cells can be preferentially selected for or against at culture initiation or at other time points during the process.
  • subpopulations of T cells can be preferentially selected for or against at culture initiation or at other desired time points.
  • multiple rounds of selection can also be used in the context of this invention. In some embodiments, it may be desirable to perform the selection procedure and use the " unselected" cells in the activation and expansion process.“Unselected” cells can also be subjected to further rounds of selection.
  • a polynucleotide encoding the subject CAR (e.g., a TN-MUC1 CAR), typically located in an expression vector, is introduced into the cytotoxic cells such that the cytotoxic cells will express, preferably stably, the CAR
  • the polynucleotide encoding the CAR also encodes a CAR inducible expression cassette for a transgenic polypeptide product that is produced and released upon CAR signaling.
  • the polynucleotide encoding the CAR also encodes a cytokine (e.g., IL-12) operably linked to a T-cell activation responsive promoter.
  • the expression vector comprises both the polynucleotide encoding the CAR and the polynucleotide encoding the cytokine operably linked to the T-cell activation responsive promoter. See, e.g., Chmielewski and Abken, Expert Opin. Biol. Ther. (2015) 15(8): 1145-1154; and Abken, Immunotherapy (2015) 7(5): 535-544.
  • the cells are genetically engineered with an expression vector comprising the polynucleotide encoding the CAR and an expression vector comprising the polynucleotide encoding the cytokine (e.g., IL-12) operably linked to the T-cell activation responsive promoter.
  • the polynucleotide introduction need not result in integration but rather only transient maintenance of the polynucleotide introduced may be sufficient. In this way, one could have a short term effect, where cytotoxic cells could be introduced into the host and then turned on after a predetermined time, for example, after the cells have been able to migrate to a particular site for treatment.
  • the modified cytotoxic cells may be introduced into the subject, e.g. a mammal, in a wide variety of ways.
  • the genetically engineered cytotoxic cells may be introduced at the site of the tumor.
  • the genetically engineered cytotoxic cells navigate to the cancer or are modified to navigate to the cancer.
  • the number of modified cytotoxic cells that are employed will depend upon a number of factors such as the circumstances, the purpose for the introduction, the lifetime of the cells, the protocol to be used. For example, the number of modified cytotoxic cells that are employed may depend upon the number of administrations, the ability of the cells to multiply, and the stability of the recombinant construct.
  • the modified cytotoxic cells may be applied as a dispersion injected at or near the site of interest.
  • the cells may be in a physiologically-acceptable medium
  • the treatment method is subject to many variables, such as the cellular response to the CAR (e.g., a TN-MUC1 CAR), the efficiency of expression of the CAR by the cytotoxic cells and, as appropriate, the level of secretion, the activity of the expressed CAR, the particular need of the subject, which may vary with time and circumstances, the rate of loss of the cellular activity as a result of loss of modified cytotoxic cells or the expression activity of individual cells, and the like. Therefore, it is expected that for each individual patient, even if there were universal cells which could be administered to the population at large, each patient would be monitored for the proper dosage for the individual, and such practices of monitoring a patient are routine in the art.
  • the present invention provides a method of treating a MUC1 associated cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; optionally a hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain.
  • a therapeutically effective composition comprising a modified T cell comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complement
  • a method of treating a MUC1 associated cancer in a subject in need thereof comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain
  • CDR complementarity determining region
  • modified cytotoxic cells e.g., modified T cells comprising a TN-MUC1 CAR
  • pharmaceutical compositions of the invention include cancers of the breast.
  • the breast cancer treated by any of the methods of the invention is characterized by abnormal glycosylation of MUC1.
  • TNBC triple negative breast cancer
  • Metastatic TNBC represents a high unmet need, with the median OS of 6 months from the time of initial diagnosis with metastatic disease versus 20 months for those patients with hormone receptor-positive and/or Her2-positive metastatic breast cancer. With different biology and targets, the outcomes of metastatic HER2-positive and hormone receptor-positive breast cancer continue to improve, however TNBC remains an unmet need (Ganesan et al. (2014) Mol Cancer Ther, 12:3175-3184). Immunotherapy with PD-1/PD-L1 inhibition have demonstrated promising results in advanced TNBC in clinical studies. A combination of atezolizumab with a standard chemotherapy agent (nab-paclitaxel) in advanced TNBC demonstrated significant improvement in PFS (all patients) and OS (PD-L1 positive, Schmid et al. (2016) /View England J Med, 379(22):2108-2121).
  • the breast cancer is hormone receptor-positive (HRpositive). In some embodiments, the breast cancer is hormone receptor-negative. In some embodiments, the breast cancer is estrogen receptor-negative. In some embodiments, the breast cancer is progesterone receptor-negative. In some embodiments, the breast cancer is Her2 receptor-negative. In some embodiments, the breast cancer is a metastatic breast cancer. In some embodiments, the breast cancer is triple negative breast cancer (ER-negative, PR-negative, and HER2-negative). In some embodiments, the breast cancer is triple positive breast cancer (ER-positive, PR- positive, and HER2-positive). In some embodiments, the breast cancer is triple negative, metastatic breast cancer.
  • the breast cancer is an incurable, unresectable, locally advanced or metastatic breast cancer (LA/MBC).
  • LA/MBC locally advanced or metastatic breast cancer
  • the breast cancer is ER-negative and/or PR-positive and HER2- negative breast cancer.
  • the breast cancer is HER2-positive and LA/MBC.
  • the breast cancer is triple negative breast cancer and LA/MBC.
  • Exemplary breast cancers are those that express abnormally glycosylated MUC1 (e.g., TnMUCl) in a cell expressing the cancer (i.e., TnMUCl -expressing cancers).
  • a breast cancer is selected from the group consisting of carcinomas, sarcomas, phyllodes, Paget disease, and angiosarcomas.
  • a breast cancer is selected from the group consisting of ductal carcinoma in situ, invasive ductal carcinoma or subtype thereof (e.g., tubular carcinoma of die breast, medullary carcinoma of the breast, mucinous carcinoma of the breast, papillary carcinoma of the breast, cribriform carcinoma of the breast, and the like), invasive lobular carcinoma, inflammatory breast cancer, lobular carcinoma in situ, male breast cancer, Paget’s disease of the nipple, phyllodes tumors of the breast, metastatic breast cancer, and certain molecular subtypes (e.g., luminal A breast cancer, luminal B breast cancer, triple-negative/basal-like breast cancer, HER2 -enriched breast cancer, normal-like breast cancer).
  • ductal carcinoma in situ e.g., tubular carcinoma of die breast, medullary carcinoma of the breast, mucinous carcinoma of the breast, papillary carcinoma of the breast, cribriform carcinoma of the breast, and the like
  • invasive lobular carcinoma e
  • a breast cancer may be characterized by the expression of several markers.
  • breast cancer may be an estrogen receptor positive (ER+) breast cancer, a progesterone receptor positive (PR+) breast cancer, a hormone receptor negative (HR-) breast cancer, a HER2 gene overexpressing (HER2+) breast cancer, a HER2 gene wild- type or under-expressing (HER2-) breast cancer.
  • ER+ estrogen receptor positive
  • PR+ progesterone receptor positive
  • HR- hormone receptor negative
  • HER2+ HER2 gene overexpressing
  • HER2 gene wild- type or under-expressing (HER2-) breast cancer HER2 gene wild- type or under-expressing
  • Breast cancer may be a group 1 (luminal A) breast cancer, i.e., ER+/PR+/HER2-, a group 2 (luminal B) breast cancer, i.e., ER+/PR-/HER2+, a group 3 (HER2+) breast cancer, i.e., ER-/PR-/HER2+, or a group 4 (basal-like or triple negative (TN)) breast cancer, i.e., ER-/PR-/HER2-.
  • a group 1 (luminal A) breast cancer i.e., ER+/PR+/HER2-
  • a group 2 (luminal B) breast cancer i.e., ER+/PR-/HER2+
  • HER2+ HER2+
  • TN basic-like or triple negative
  • a breast cancer can be categorized as grade 1, 2 or 3.
  • Grade 1 or well- differentiated (score 3, 4, or 5) breast cancer comprises cells that are slower-growing, and look more like normal breast tissue than the higher grades of breast cancer.
  • Grade 2 or moderately differentiated (score 6, 7) breast cancer comprises cells that grow at a speed of and look like cells somewhere between grades 1 and 3.
  • Grade 3 or poorly differentiated (score 8, 9) breast cancer comprises cells that look very different from normal cells and typically grow and spread faster than grades 1 or 2.
  • the present invention provides a method of treating a MUC1 associated triple negative breast cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC 1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; optionally a hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain.
  • a therapeutically effective composition comprising a modified T cell comprising: a MUC 1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the
  • a method of treating a MUC1 associated triple negative breast cancer in a subject in need thereof comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC 1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light drain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; optionally a CD8a hinge domain; a CD8a transmembrane domain; a 4- IBB costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
  • a MUC 1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light drain variable (VL) domain
  • VH domain comprises the heavy chain complementarity determining
  • a method of treating a MUC1 associated triple negative breast cancer in a subject in need thereof comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC 1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; optionally a CD8a hinge domain; a CD8a transmembrane domain; a CD2 costimulatory signaling domain; and a CDS zeta intracellular signaling domain.
  • a MUC 1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain
  • VH domain comprises the heavy chain complementarity determining region
  • An exemplary type of cancer to be treated with the modified cytotoxic cells (e.g., modified T cells comprising a TN-MUC1 CAR) or pharmaceutical compositions of the invention include multiple myeloma.
  • Multiple myeloma is a disease defined by the accumulation of clonal bone marrow plasma cells and development of clinical complications including hypercalcemia, renal insufficiency, symptomatic anemia, destructive lytic bone lesions, and susceptibility to infections.
  • NCI SEER National Cancer Institute Surveillance, Epidemiology, and End Results
  • MM Multiple myeloma
  • Laboratory tests include: a complete blood count to measure the level of red cells, white cells, and platelets in the blood; a blood chemistry test to measure the level of blood creatinine, albumin, calcium, lactic dehydrogenase, and other electrolytes; a urine test to measure the presence of myeloma protein, e.g., Bence Jones protein (e.g., urine protein electrophoresis, urine
  • immunofixation a quantitative immunoglobulin test to measure the blood levels of different antibodies, where the level of a certain type of antibody may be higher than others in subjects having MM; blood test to assess the presence and level of abnormal protein produced by myeloma cells, e.g., monoclonal immunoglobulin, monoclonal protein (M protein), M spike, paraprotein; blood test to measure light chain levels in the blood; blood test to assess presence and levels of beta-2 microglobulin.
  • myeloma cells e.g., monoclonal immunoglobulin, monoclonal protein (M protein), M spike, paraprotein
  • M protein monoclonal protein
  • M protein monoclonal protein
  • paraprotein e.g., M protein
  • blood test to measure light chain levels in the blood
  • blood test to assess presence and levels of beta-2 microglobulin.
  • a diagnosis of multiple myeloma often requires: (1) a plasma cell tumor (proven by biopsy) or at least 10% plasma cells in the bone marrow; and (2) at least one of high blood calcium level, poor kidney function, low red blood cell counts (anemia), holes in the bones from tumor found on imaging studies (CT, MRI, PET scan), increase in one type of light drain in the blood so that one type is 100 times more common than the other, and 60% or more plasma cells in the bone marrow.
  • RISS stage group I is characterized by serum beta-2-microglobulin less than 3.5 mg/L, albumin level at 3.5 g/dL or greater, cytogenetics considered not high risk, and LDH levels are normal.
  • RISS stage group II is characterized as not belonging in stage group I or stage group III.
  • RISS stage group IP is characterized by serum beta-2-microglobulin at 5.5 mg/L or greater, cytogenetics considered high risk, and/or LDH levels are high.
  • a method of treating a MUC1 associated multiple myeloma in a subject in need thereof comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises tire heavy drain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; optionally a hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain, is provided.
  • VH heavy chain variable
  • VL light chain variable
  • a method of treating a MUC1 associated multiple myeloma in a subject in need thereof comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises tire light chain
  • CDR complementarity determining region
  • Non-small cell lung cancer Lung cancer is a leading cause of cancer-related mortality around the world and remains a significant unmet need despite advances in therapy.
  • Non-small cell lung cancer (NSCLC) accounts for 85% of all lung cancer cases in the US, with a significant proportion of the remaining 15% being small cell lung cancers (SCLC) (Zappa et al. (2016) Transl Lung Cancer Res, 5(3):288-300; Alvarado-Luna et al. (2016) Transl Lung Cancer Res, 5(l):26-38).
  • SCLC small cell lung cancers
  • Platinum-based regimens (doublet chemotherapy; e.g., cisplatin with gemcitabine or carboplatin with paclitaxel/gemcitabine) continues to remain one of the mainstays of treatment for non-res ectable NSCLC, in addition to radiation for stage III or IV lung cancer (Ettinger et al. (2019) website:
  • Single-agent targeted therapy is added to the doublet for patients with anaplastic lymphoma kinase (ALK) or sensitizing epidermal growth factor receptor (EGFR) mutations or other driver mutations/alterations (Ettinger et al, supra, ⁇ Yoon et al. (2017) World J Clin Oncol, 8(1): 1-20).
  • ALK anaplastic lymphoma kinase
  • EGFR epidermal growth factor receptor
  • NSCLCs include adenocarcinomas, squamous cell carcinomas, and large cell carcinomas.
  • NSCLC may be characterized by various methods including laboratory tests, imaging and biopsies. For example, diagnosis of NSCLC may require tests including bone scans, imaging tests (MRI, CT scan, PET scan), microscopic examination of sputum to check for cancer cells, and biopsy of lung.
  • NSCLC can be staged according to the American Joint Committee on Cancer (AJCC) Tumor, Node, Metastasis (TNM) system, which is based on three main factors: (1) the size and extent of the main tumor; (2) the spread to nearby lymph nodes; and (3) the spread to distant sites.
  • AJCC American Joint Committee on Cancer
  • TPM Metastasis
  • stage 0 also called carcinoma in situ
  • Other stages range from stage I to stage IV, with a higher numbered stage meaning that the cancer has spread more.
  • a method of treating a MUC1 associated non-small cell lung cancer in a subject in need thereof comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; optionally a hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain, is provided.
  • a therapeutically effective composition comprising a modified T cell comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the
  • a method of treating a MUC1 associated non-small cell lung cancer in a subject in need thereof comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; optionally a CD8a hinge domain; a CD8a transmembrane domain; a CD2 costimulatory signaling domain; and a CDS zeta intracellular signaling domain.
  • a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain
  • VH domain comprises the heavy chain complementarity
  • An exemplary type of cancer to be treated with the modified cytotoxic cells (e.g., modified T cells comprising a TN-MUC1 CAR) or pharmaceutical compositions of the invention include pancreatic adenocarcinoma.
  • Pancreatic ductal adenocarcinoma is a highly lethal malignancy. It is the fourth leading cause of cancer-related death in the United States with approximately 45,000 new cases per year.
  • Surgical resection is the only potentially curative treatment, however with tire majority of patients presenting with advanced disease only 15-20% of patients are candidates for surgical intervention (Fogel et al. (2017) Am J Gastroenterology, 112(4):537-555). Overall, prognosis is poor even with surgical intervention: the five-year survival with surgery is approximately 25% for node-negative and 10% for node-positive disease. With the majority of patients presenting with unresectable disease, chemotherapy is the mainstay of treatment.
  • FOLFIRINOX treatment demonstrated increased median OS and PFS when compared to gemcitabine alone, although increased toxicity is observed with combination therapy.
  • Alternate combination therapy includes gemcitabine and nab-paclitaxel, which is used more widely than FOLFIRINOX due to its favorable toxicity profile even though median OS was inferior.
  • pancreatic cancer Despite successes with targeted therapy and immunotherapy approaches in other solid tumors, similar improvements in efficacy are not evident with pancreatic cancer (Amanam et al. (2016) Cancers, 10(2). pii:E36). Interestingly, immune-checkpoint inhibitors have had more success in pancreatic adenocarcinoma. Overall, pancreatic adenocarcinoma remains an area of high unmet need and clinical trials are considered part of the standard of care in this disease setting (Tempera et al. (2019) website:
  • Pancreatic adenocarcinoma can be characterized using imaging tests (CT scan, MRI, ultrasound, cholangiopancreatography, PET scan, angiography), blood tests, and biopsies.
  • Blood tests to detect pancreatic adenocarcinoma include liver function tests, and assessing the presence of tumor markers such as CA 19-9 and carcinoembryonic antigen (CEA).
  • Pancreatic adenocarcinoma can be staged according to the American Joint Committee on Cancer (AJCC) Tumor, Node, Metastasis (TNM) system, which is based on three main factors: (1) the size and extent of the main tumor; (2) the spread to nearby lymph nodes; and (3) the spread to distant sites.
  • AJCC American Joint Committee on Cancer
  • TPM Metastasis
  • stage 0 also called carcinoma in situ
  • Other stages range from stage I to stage IV, with a higher numbered stage meaning that the cancer has spread more.
  • a method of treating a MUC1 associated pancreatic adenocarcinoma in a subject in need thereof comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; optionally a hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain, is provided.
  • a therapeutically effective composition comprising a modified T cell comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the
  • a method of treating a MUC1 associated pancreatic adenocarcinoma in a subject in need thereof comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC 1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; optionally a CD8a hinge domain; a CD8a transmembrane domain; a CD2 costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
  • a MUC 1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain
  • VH domain comprises the heavy
  • An exemplary type of cancer to be treated with the modified cytotoxic cells (e.g., modified T cells comprising a TN-MUC1 CAR) or pharmaceutical compositions of the invention include epithelial ovarian cancer.
  • Epithelial ovarian cancers generally include fallopian tube malignancies as well as primary peritoneal cancers. More than 70% of women with epithelial ovarian cancer present with advanced disease at the time of first diagnosis. Although patients with advanced disease can achieve complete remission after surgical cytoreduction and platinum- and taxane-based chemotherapy, up to 80% eventually experience recurrence (Herzog et al. (2017) Gynecol Oncol Res Pract, 4:13).
  • VEGF vascular endothelial growth factor
  • bevacizumab and poly ADP ribose polymerase (PARP, i.e., olaparib, rucaparib, and niraparib) have emerged as treatment options in patients following prior lines of chemotherapy.
  • PARP poly ADP ribose polymerase
  • pembrolizumab is considered acceptable for recurrent disease in patients with MSI-H or dMMR solid tumors as per standard oncology guidelines (Armstrong et al., supra, ⁇ Fan et al. (2016) Curr Treat Options Oncol, 19(12):74).
  • the standard of care for patients with advanced epithelial ovarian cancers remains platinum-based therapy and once patients develop resistant disease, the unmet need is high and new therapy options are needed.
  • Epithelial ovarian cancers can be characterized using imaging tests, blood tests, and biopsies. Blood tests to detect epithelial ovarian cancers include measuring the level of CA-125, human chorionic gonadotropin (HCG), alpha-fetoprotein (AFP), and/or lactate dehydrogenase (LDH). Some epithelial ovarian cancers may be characterized by an elevated level of inhibin and hormones such as estrogen and testosterone.
  • HCG human chorionic gonadotropin
  • AFP alpha-fetoprotein
  • LDH lactate dehydrogenase
  • Ovarian epithelial cancer can be staged according to the International Federation of Gynecology and Obstetrics (FIGO) or American Joint Committee on Cancer (AJCC) Tumor, Node, Metastasis (TNM) system, which are based on three main factors: (1) the size and extent of the main tumor; (2) the spread to nearby lymph nodes; and (3) the spread to distant sites.
  • stage 0 also called carcinoma in situ
  • Other stages range from stage I to stage IV, with a higher numbered stage meaning that the cancer has spread more.
  • a method of treating a MUC1 associated ovarian and/or fallopian tube cancer in a subject in need thereof comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; optionally a hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain, is provided.
  • a therapeutically effective composition comprising a modified T cell comprising: a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the
  • a method of treating a MUC1 associated ovarian and/or fallopian tube cancer in a subject in need thereof comprising: administering to the subject a therapeutically effective composition comprising a modified T cell comprising a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences set forth in SEQ ID NOs: 19, 20, and 21; optionally a CD8a hinge domain; a CD8a transmembrane domain; a CD2 costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
  • a therapeutically effective composition comprising a modified T cell comprising a MUC1 -specific antigen binding domain comprising a heavy chain variable (VH) domain and a light
  • the population of modified immune cells administered to the subject comprises immune cells selected from the group consisting of natural killer (NK) cells, NKT cells, and T cells.
  • the population of modified immune cells comprises modified T cells.
  • the modified T cells are autologous.
  • the cells of the invention may be administered by any means known to one of ordinary skill in the art.
  • the administering may be performed via intratumoral delivery, via intravenous delivery, or via intraperitoneal delivery.
  • modified immune cells e.g., modified T cells
  • a“therapeutically effective amount” refers to a dose of modified immune cells that results in the cytotoxic killing of cancer cells (e.g., breast cancer cells) in the subject.
  • a suitable dose of modified immune cells when administered to the subject results in a reduction of the cancer.
  • Reduction of the cancer can be in the form of an output of one or more parameters indicative of the cancer, and be performed by various methods known in the art, for example, by detection of circulating tumor cells, detection of certain cancer-specific markers in the blood, detection of markers in a biopsy, tumor imaging, and the like.
  • a suitable dose of modified immune cells when administered to the subject results in a reduction of one or more parameters at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more from baseline.
  • the term“effective amount” or“therapeutically effective amount” refers to the amount of an agent (e.g., a TN-MUC1 CAR T cell composition) sufficient to effect beneficial or desired results.
  • An effective amount can be
  • a therapeutically effective amount can vary depending upon known factors, such as the mode and route of administration; the age, health, and weight of the recipient; the type and extent of disease or indication to be treated, the nature and extent of symptoms, kind of concurrent treatment, frequency of treatment, and the effect desired.
  • Cells of the invention can be administered in dosages and routes and at times to be determined in appropriate pre-clinical and clinical experimentation and trials. Cell compositions may be administered multiple times at dosages within these ranges.
  • Administration of the cells of the invention may be combined with other methods useful to treat the desired disease or condition as determined by those of skill in the art.
  • the cells of the invention to be administered may be autologous, with respect to the subject undergoing therapy.
  • the administration of the cells of the invention may be carried out in any convenient manner known to those of skill in the art.
  • the cells of the present invention may be administered to a subject by aerosol inhalation, injection, ingestion, transfusion, implantation or transplantation.
  • the compositions described herein may be
  • the cells of the invention are injected directly into a site of inflammation in the subject, a local disease site in the subject, a lymph node, an organ, a tumor, and the like.
  • the cells are administered at a desired dosage, which in certain aspects include a desired dose or number of cells or cell type(s) and/or a desired ratio of cell types.
  • the dosage of cells in some embodiments is based on a total number of cells (or number per kg body weight) and a desired ratio of the individual populations or sub-types, such as the CD4+ to CD8+ ratio.
  • the dosage of cells is based on a desired total number (or number per kg of body weight) of cells in the individual populations or of individual cell types
  • the dosage is based on a combination of such features, such as a desired number of total cells, desired ratio, and desired total number of cells in the individual populations.
  • the populations or sub-types of cells are administered at or within a tolerated difference of a desired dose of total cells, such as a desired dose of T cells.
  • the desired dose is a desired number of cells or a desired number of cells per unit of body weight of the subject to whom the cells are administered, e.g., cells/kg.
  • the desired dose is at or above a minimum number of cells or minimum number of cells per unit of body weight.
  • the individual populations or sub-types are present at or near a desired output ratio (sudi as CD4 + to CD8 + ratio), e.g., within a certain tolerated difference or error of such a ratio.
  • the cells are administered at or within a tolerated difference of a desired dose of one or more of the individual populations or sub-types of cells, such as a desired dose of CD4+ cells and/or a desired dose of CD8+ cells.
  • the desired dose is a desired number of cells of the sub-type or population, or a desired number of such cells per unit of body weight of the subject to whom the cells are administered, e.g., cells/kg.
  • the desired dose is at or above a minimum number of cells of the population or subtype, or minimum number of cells of the population or sub-type per unit of body weight.
  • the dosage is based on a desired fixed dose of total cells and a desired ratio, and/or based on a desired fixed dose of one or more, e.g., each, of the individual sub-types or sub-populations.
  • the dosage is based on a desired fixed or minimum dose of T cells and a desired ratio of CD4 + to CD8 + cells, and/or is based on a desired fixed or minimum dose of CD4 + and/or CD8 + cells.
  • the cells, or individual populations of sub-types of cells are administered to the subject at a range of about one million to about 100 billion cells, such as, e.g., 1 million to about 50 billion cells (e.g., about 5 million cells, about 25 million cells, about 500 million cells, about 1 billion cells, about 5 billion cells, about 20 billion cells, about 30 billion cells, about 40 billion cells, or a range defined by any two of the foregoing values), such as about 10 million to about 100 billion cells (e.g., about 20 million cells, about 30 million cells, about 40 million cells, about 60 million cells, about 70 million cells, about 80 million cells, about 90 million cells, about 10 billion cells, about 25 billion cells, about 50 billion cells, about 75 billion cells, about 90 billion cells, or a range defined by any two of the foregoing values), and in some cases about 100 million cells to about 50 billion cells (e.g., about 120 million cells, about 250 million cells, about 350 million cells, about 450 million cells, about 650 million cells, about 800 million
  • the dose of total cells and/or dose of individual subpopulations of cells is within a range of between at or about lxlO 5 cells/kg to about lxlO 11 cells/kg, 10 4 , and at or about 10 11 cells/kilograms (kg) body weight, such as between 10 5 and 10 6 cells / kg body weight, for example, at or about 1 x 10 5 cells/kg,
  • the cells are administered at, or within a certain range of error of, between at or about 10 4 and at or about 10 9 T cells/kilograms (kg) body weight, such as between 10 s and 10 6 T cells / kg body weight, for example, at or about 1 x 10 s T cells/kg, 1.5 x 10 s T cells/kg, 2 x 10 5 T cells/kg, or 1 x 10 6 T cells/kg body weight.
  • a suitable dosage range of modified cells for use in a method of the present disclosure includes, without limitation, from about 1x10 s cells/kg to about lxl 0 6 cells/kg, from about lxl 0 6 cells/kg to about lxl 0 7 cells/kg, from about lxlO 7 cells/kg about lxl 0 8 cells/kg, from about lxl 0 8 cells/kg about lxl 0 9 cells/kg, from about lxlO 9 cells/kg about lxlO 10 cells/kg, from about lxl O 10 cells/kg about lxlO 11 cells/kg.
  • a suitable dosage for use in a method of the present disclosure is about 1x10 s cells/kg. In an exemplary embodiment, a suitable dosage for use in a method of the present disclosure is about lxlO 7 cells/kg. In other embodiments, a suitable dosage is from about lxlO 7 total cells to about 5xl0 7 total cells. In some embodiments, a suitable dosage is from about 1x10 s total cells to about 5x10 s total cells. In some embodiments, a suitable dosage is from about 1.4x10 7 total cells to about l.lxlO 9 total cells. In an exemplary embodiment, a suitable dosage for use in a method of the present disclosure is about 7xl0 9 total cells. In an exemplary embodiment, a suitable dosage is from about lxlO 7 total cells to about 3xl0 7 total cells.
  • the dose of total cells and/or dose of individual subpopulations of cells is within a range of between at or about 1x10 s cells/m 2 to about lxlO 11 cells/m 2 . In an exemplary embodiment, the dose of total cells and/or dose of individual sub-populations of cells is within a range of between at or about lxl0 7 /m 2 to at or about 3xl0 7 /m 2 . In an exemplary embodiment, the dose of total cells and/or dose of individual sub-populations of cells is within a range of between at or about lxl0 8 /m 2 to at or about 3xlO s /m 2 . In some embodiments, the dose of total cells and/or dose of individual sub-populations of cells is the maximum tolerated dose by a given patient.
  • the cells are administered at or within a certain range of error of between at or about 10 4 and at or about 10 9 CD4 + and/or CD8 + cells/kilograms (kg) body weight, such as between 10 s and 10 6 CD4 + and/or CD8 + cells / kg body weight, for example, at or about 1 x 10 s CD4 + and/or CD8 + cells/kg, 1.5 x 10 s CD4 + and/or CD8 + cells/kg, 2 x 10 s CD4 + and/or CD8 + cells/kg, or 1 x 10 6 CD4 + and/or CD8 + cells/kg body weight.
  • the cells are administered at or within a certain range of error of, greater than, and/or at least about l x lO 6 , about 2.5 x 10 6 , about 5 x 10 6 , about 7.5 x 10 6 , or about 9 x 10 6 CD4 + cells, and/or at least about 1 x 10 6 , about 2.5 x 10 6 , about 5 x 10 6 , about 7.5 x 10 6 , or about 9 x 10 6 CD8+ cells, and/or at least about 1 x 10 6 , about 2.5 x 10 6 , about 5 x 10 6 , about 7.5 x 10 6 , or about 9 x 10 6 T cells.
  • the cells are administered at or within a certain range of error of between about 10 8 and 10 12 or between about 10 10 and 10 11 T cells, between about 10 8 and 10 12 or between about 10 10 and 10 11 CD4 + cells, and/or between about 10 8 and 10 12 or between about 10 10 and 10 11 CD8 + cells.
  • the cells are administered at or within a tolerated range of a desired output ratio of multiple cell populations or sub-types, such as CD4+ and CD8+ cells or sub-types.
  • the desired ratio can be a specific ratio or can be a range of ratios, for example, in some embodiments, the desired ratio (e.g., ratio of CD4 + to CD8 + cells) is between at or about 5: 1 and at or about 5: 1 (or greater than about 1 :5 and less than about 5: 1), or between at or about 1 :3 and at or about 3: 1 (or greater than about 1 :3 and less than about 3: 1), such as between at or about 2: 1 and at or about 1 :5 (or greater than about 1 :5 and less than about 2: 1, such as at or about 5: 1, 4.5: 1, 4: 1, 3.5: 1, 3: 1, 2.5: 1, 2: 1, 1.9: 1, 1.8: 1, 1.7: 1, 1.6: 1, 1.5: 1, 1.4: 1, 1.3: 1,
  • the tolerated difference is within about 1%, about 2%, about 3%, about 4% about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50% of the desired ratio, including any value in between these ranges.
  • a dose of modified cells is administered to a subject in need thereof, in a single dose or multiple doses. In some embodiments, a dose of modified cells is administered in multiple doses, e.g., once a week or every 7 days, once every 2 weeks or every 14 days, once every 3 weeks or every 21 days, once every 4 weeks or every 28 days. In an exemplary embodiment, a single dose of modified cells is administered to a subject in need thereof. In an exemplary embodiment, a single dose of modified cells is administered to a subject in need thereof by rapid intravenous infusion. In some embodiments, a dose of modified cells is administered to a subject in need thereof, in a fractionated dose or split dose.
  • the first dose is administered, and a subsequent dose is administered 1 or more days, 2 or more days, 3 or more days, 4 or more days, 5 or more days, 6 or more days, 7 or more days, 8 or more days, 9 or more days, 10 or more days, 11 or more days, 12 or more days, 13 or more days, 2 or more weeks, 3 or more weeks, 4 or more weeks, 5 or more weeks, or any period in between, after the first dose.
  • the appropriate dosage may depend on the type of disease to be treated, the type of cells or recombinant receptors, the severity and course of the disease, whether the cells are administered for preventive or therapeutic purposes, previous therapy, the subject's clinical history and response to the cells, and the discretion of the attending physician.
  • the compositions and cells are in some embodiments suitably administered to the subject at one time or over a series of treatments.
  • the cells are administered as part of a combination treatment, such as simultaneously with or sequentially with, in any order, another therapeutic intervention, such as an antibody or engineered cell or receptor or agent, such as a cytotoxic or therapeutic agent.
  • the cells in some embodiments are coadministered with one or more additional therapeutic agents or in connection with another therapeutic intervention, either simultaneously or sequentially in any order.
  • the cells are co-administered with another therapy sufficiently close in time such that the cell populations enhance the effect of one or more additional therapeutic agents, or vice versa.
  • the cells are administered prior to the one or more additional therapeutic agents.
  • the cells are administered after the one or more additional therapeutic agents.
  • the one or more additional agents includes a cytokine, such as IL-2, for example, to enhance persistence.
  • the methods comprise administration of a chemotherapeutic agent.
  • the biological activity of the engineered cell populations in some embodiments is measured, e.g., by any of a number of known methods.
  • Parameters to assess include specific binding of an engineered or natural T cell or other immune cell to antigen, in vivo, e.g., by imaging, or ex vivo, e.g., by ELISA or flow cytometry.
  • the ability of the engineered cells to destroy target cells can be measured using any suitable method known in the art, such as cytotoxicity assays described in, for example, Kochenderfer et al., J. Immunotherapy, 32(7): 689-702 (2009), and Herman et al. J. Immunological Methods, 285(1): 25-40 (2004).
  • the biological activity of the cells is measured by assaying expression and/or secretion of one or more cytokines, such as CD 107a, IFNy, IL-2, and TNF. In certain aspects, the biological activity is measured by assessing clinical outcome, such as reduction in tumor burden or load.
  • the subject can be administered, in addition to the CAR, a secondary treatment.
  • the subject can be administered conditioning therapy prior to CAR T cell therapy.
  • the conditioning therapy comprises administering an effective amount of cyclophosphamide to the subject.
  • the conditioning therapy comprises administering an effective amount of fludarabine to the subject.
  • the conditioning therapy comprises administering an effective amount of a combination of cyclophosphamide and fludarabine to the subject Accordingly, the present disclosure provides a method of treatment comprising administering a conditioning therapy comprising an effective amount of a combination of cyclophosphamide and fludarabine to the subject, prior to administering CAR T therapy (e.g., modified T cells comprising a TN-MUC1 CAR of the present disclosure).
  • CAR T therapy e.g., modified T cells comprising a TN-MUC1 CAR of the present disclosure.
  • Administration of a conditioning therapy prior to CAR T cell therapy may increase the efficacy of the CAR T cell therapy.
  • the subject is provided a secondary treatment.
  • Secondary treatments include but are not limited to chemotherapy, radiation, surgery, and medications.
  • a specific dosage regimen of the present disclosure includes a lymphodepletion step prior to the administration of the modified T cells.
  • the lymphodepletion step includes administration of cyclophosphamide and/or fludarabine.
  • the lymphodepletion step includes administration of cyclophosphamide at a dose of between about 200 mg/m 2 /day and about 2000 mg/m 2 /day (e.g., 200 mg/m 2 /day, 300 mg/m 2 /day, or 500 mg/m 2 /day).
  • the dose of cyclophosphamide is about 300 mg/m 2 /day.
  • the lymphodepletion step includes administration of fludarabine at a dose of between about 20 mg/m 2 /day and about 900 mg/m 2 /day (e.g., 20 mg/m 2 /day, 25 mg/m 2 /day, 30 mg/m 2 /day, or 60 mg/m 2 /day).
  • the dose of fludarabine is about 30 mg/m 2 /day.
  • the lymphodepletion step includes administration of cyclophosphamide at a dose of between about 200 mg/m 2 /day and about 2000 mg/m 2 /day (e.g., 200 mg/m 2 /day, 300 mg/m 2 /day, or 500 mg/m 2 /day), and fludarabine at a dose of between about 20 mg/m 2 /day and about 900 mg/m 2 /day (e.g., 20 mg/m 2 /day, 25 mg/m 2 /day, 30 mg/m 2 /day, or 60 mg/m 2 /day).
  • the lymphodepletion step includes administration of cyclophosphamide at a dose of about 300 mg/m 2 /day, and fludarabine at a dose of about 30 mg/m 2 /day.
  • the dosing of cyclophosphamide is 300 mg/m 2 /day over three days, and the dosing of fludarabine is 30 mg/m 2 /day over three days,
  • Dosing of lymphodepletion chemotherapy may be scheduled on Days -6 to -4 (with a -1 day window, i.e., dosing on Days -7 to -5) relative to TnMUCl CAR-T infusion on day 0.
  • CRS cytokine release syndrome
  • Clinical features include: high fever, malaise, fatigue, myalgia, nausea, anorexia, tachycardia/hypotension, capillary leak, cardiac dysfunction, renal impairment, hepatic failure, and disseminated intravascular coagulation.
  • Dramatic elevations of cytokines including interferon-gamma, granulocyte macrophage colony-stimulating factor, IL-10, and IL-6 have been shown following CAR T-cell infusion.
  • One CRS signature is elevation of cytokines including IL-6 (severe elevation), IFN-gamma, TNF-alpha (moderate), and IL-2 (mild).
  • CRS C-reactive protein
  • the invention provides for, following the diagnosis of CRS, appropriate CRS management strategies to mitigate the physiological symptoms of uncontrolled inflammation without dampening the antitumor efficacy of the engineered cells (e.g., CAR T cells).
  • CRS management strategies are known in the art.
  • systemic corticosteroids may be administered to rapidly reverse symptoms of sCRS (e.g., grade 3 CRS) without compromising initial antitumor response.
  • an anti-IL-6R antibody may be administered.
  • An example of an anti-IL-6R antibody is the Food and Drag Administration-approved monoclonal antibody tocilizumab, also known as atlizumab (marketed as Actemra, or RoActemra).
  • Tocilizumab is a humanized monoclonal antibody against the interleukin- 6 receptor (IL-6R).
  • IL-6R interleukin- 6 receptor
  • CRS is generally managed based on the severity of the observed syndrome and interventions are tailored as such. CRS management decisions may be based upon clinical signs and symptoms and response to interventions, not solely on laboratory values alone.
  • the first-line management of CRS may be tocilizumab, in some embodiments, at the labeled dose of 8 mg/kg IV over 60 minutes (not to exceed 800 mg/dose); tocilizumab can be repeated Q8 hours. If suboptimal response to the first dose of tocilizumab, additional doses of tocilizumab may be considered.
  • Tocilizumab can be administered alone or in combination with corticosteroid therapy. Patients with continued or progressive CRS symptoms, inadequate clinical improvement in 12-18 hours or poor response to tocilizumab, may be treated with high-dose corticosteroid therapy, generally hydrocortisone 100 mg IV or methylprednisolone 1-2 mg/kg.
  • CRS management guidance may be based on published standards (Lee et al. (2019) Biol Blood Marrow Transplant, doi.org/10.1016/j.bbmt.2018.12.758; Neelapu et al. (2016) Nat Rev Clin Oncology, 15:47; Teachey et al. (2016) Cancer Discov, 6(6): 664-679).
  • MAS macrophage activation syndrome
  • HHLH hemophagocytic lymphohistiocytosis
  • MAS appears to be a reaction to immune activation that occurs from the CRS, and should therefore be considered a manifestation of CRS.
  • MAS is similar to HLH (also a reaction to immune stimulation).
  • the clinical syndrome of MAS is characterized by high grade non-remitting fever, cytopenias affecting at least two of three lineages, and hepatosplenomegaly. It is associated with high serum ferritin, soluble interleukin-2 receptor, and triglycerides, and a decrease of circulating natural killer (NK) activity.
  • NK circulating natural killer
  • Methods provided herein involve selecting and treating a subject suitable for treatment. Accordingly, the present disclosure provides inclusion and exclusion criteria for subjects suitable for treatment using a method described herein.
  • a suitable subject must have a confirmed diagnosis of metastatic treatment-resistant ovarian cancer (including cancers of the fallopian tube), pancreatic adenocarcinoma, hormone receptor (HR)-negative and HER2-negative (triple negative) breast cancer (TNBC) or non-small cell lung cancer (NSCLC), or relapsed/refractory multiple myeloma.
  • metastatic treatment-resistant ovarian cancer including cancers of the fallopian tube), pancreatic adenocarcinoma, hormone receptor (HR)-negative and HER2-negative (triple negative) breast cancer (TNBC) or non-small cell lung cancer (NSCLC), or relapsed/refractory multiple myeloma.
  • a suitable subject has an ECOG score of 0 or 1.
  • a suitable subject has received prior therapy for multiple myeloma: relapsed or refractory disease after either one of the following (i) at least 3 prior regimens, which must have contained an alkylating agent, proteasome inhibitor, and thalidomide analog (lenalidomide or pomalidomide), (ii) at least 2 prior regimens if ‘ double-refractory’ to a proteasome inhibitor and thalidomide analog, defined as progression on or within 60 days of treatment with these agents, and/or (iii) patients must be at least 90 days since autologous stem cell transplant (ASCT), if performed.
  • ASCT autologous stem cell transplant
  • induction therapy induction therapy, autologous stem cell transplant (ASCT), and maintenance therapy if given sequentially without intervening progression are considered 1‘regimen.’
  • a suitable subject has received prior therapy for nonsmall cell lung cancer (NSCLC).
  • NSCLC nonsmall cell lung cancer
  • a suitable subject having had prior therapy for NSCLC has received standard therapy, including both checkpoint inhibition (PD-1/PD-L1 directed therapy) and platinum-based chemotherapy or be intolerant of these standard therapies.
  • a suitable subject having had prior therapy for NSCLC with EGFR or ALK alterations has received prior targeted therapy directed at the specific identified mutations in addition to the standard therapy classes described above.
  • a suitable subject has received prior therapy for pancreatic adenocarcinoma.
  • a suitable subject having had prior therapy for pancreatic adenocarcinoma has experienced disease progression following at least one standard of care systemic chemotherapy for metastatic or unresectable disease.
  • a suitable subject has received prior therapy for triplenegative breast cancer (TNBC).
  • TNBC triplenegative breast cancer
  • a suitable subject having had prior therapy for TNBC has experienced disease progression following at least one prior systemic anti-cancer therapy regimen as part of their treatment for management of metastatic breast cancer.
  • a suitable subject has received prior therapy for ovarian cancer.
  • a suitable subject having had prior therapy for ovarian cancer is suitable if considered platinum-resistant (initially sensitive to platinum therapy) and has received at least two prior lines of therapy for metastatic ovarian cancer, including at least one prior line of therapy including a platinum-containing regimen.
  • a suitable subject has an evaluable disease.
  • a suitable subject having multiple myeloma is suitable if: the subject has measurable disease on treatment (study) entry, which includes at least one of the following: (1) Serum M spike > 0.5 g/dL; (2) 24-hour urine M-spike > 200 mg; (3) Involved serum free light drain (FLC) > 50 mg/L with abnormal ratio; (4) Measurable plasmacytoma on examination or imaging; (5) Bone marrow plasma cells > 20%.
  • measurable disease on treatment (study) entry includes at least one of the following: (1) Serum M spike > 0.5 g/dL; (2) 24-hour urine M-spike > 200 mg; (3) Involved serum free light drain (FLC) > 50 mg/L with abnormal ratio; (4) Measurable plasmacytoma on examination or imaging; (5) Bone marrow plasma cells > 20%.
  • subjects with IgA myeloma in whom serum protein electrophoresis is deemed unreliable, due to co-migration of normal serum proteins with the panprotein in the beta region may be suitable as long as total serum IgA level is elevated above normal range.
  • a suitable subject having a solid tumor will have their disease status assessed as per Response Evaluation Criteria In Solid Tumors Criteria (RECIST v.1.1 ; see, Eisenhauer et al. (2009) Eur J Cancer, 45(2):228-247).
  • Tumor imaging may be performed at least within 28 days before apheresis.
  • Phase-specific criteria include: Phase 1 : subjects must have evaluable disease in Phase 1 per RECIST v.1.1; Phase la expansion: subjects must have measurable disease in Phase la expansion per RECISTv.1.1.
  • suitable subjects have a TnMUCl+ disease, determined by centrally tested TnMUCl expression in a prior or archival tumor biopsy. If an archival tumor biopsy sample is not available, then the subject may undergo an optional biopsy for the purposes of screening eligibility with only non-significant risk biopsy procedures.
  • suitable subjects have completed prior anti-cancer therapy at least 2 weeks prior to Screening and toxidties from any previous therapy must have recovered to grade 1 or 0 (with the exception of alopecia, well controlled electrolyte or endocrine abnormalities, well-controlled peripheral neuropathy, and vitiligo).
  • suitable subjects have a life expectancy greater than 3 months.
  • suitable subjects have adequate vital organ function as defined by:
  • ALT Alanine aminotransferase
  • AST aspartate aminotransferase
  • Serum albumin > 3.0 g/dL solid tumor patients in Arm 1 and Phase la only, not applicable to patients with multiple myeloma
  • LVEF Left ventricular ejection fraction
  • suitable subjects have adequate hematologic reserve (without the use of supportive transfusion or hematopoietic growth factors within 4 weeks of apheresis), as defined by:
  • suitable subjects considered for treatment using a method described herein must not meet any of the following criteria:
  • corticosteroid therapy prior to apheresis and be maintained on low-dose corticosteroid therapy or no corticosteroid therapy.
  • Low-dose physiologic replacement therapy with corticosteroids equivalent to prednisone 20 mg/day or lower is acceptable;
  • Active autoimmune disease including connective tissue disease, uveitis, sarcoidosis, inflammatory bowel disease or multiple sclerosis
  • active autoimmune disease including connective tissue disease, uveitis, sarcoidosis, inflammatory bowel disease or multiple sclerosis
  • immunosuppressive therapy any immunosuppressive therapy should have been stopped within 6 weeks prior to screening visit
  • CNS central nervous system
  • a suitable subject must have a confirmed diagnosis of metastatic treatment-resistant ovarian cancer (including cancers of the fallopian tube), pancreatic adenocarcinoma, hormone receptor (HR)-negative and HER2-negative (triple negative) breast cancer (TNBC) or non-small cell lung cancer (NSCLC), or relapsed/refractoiy multiple myeloma.
  • metastatic treatment-resistant ovarian cancer including cancers of the fallopian tube), pancreatic adenocarcinoma, hormone receptor (HR)-negative and HER2-negative (triple negative) breast cancer (TNBC) or non-small cell lung cancer (NSCLC), or relapsed/refractoiy multiple myeloma.
  • a suitable subject has an Eastern Cooperative Oncology Group (ECOG) score of 0 or 1.
  • ECOG Eastern Cooperative Oncology Group
  • a suitable subject has had prior therapies as defined by tumor type, as described herein.
  • a suitable subject has an evaluable disease as defined by tumor type, as described herein.
  • a suitable subject has TnMUCl+ disease, determined by centrally tested TnMUCl expression in a prior or archival tumor biopsy.
  • a suitable subject has completed prior anti-cancer therapy at least 2 weeks prior to Screening and toxicities.
  • a suitable subject has a life expectancy greater than 3 months.
  • a suitable subject has a level of serum creatinine ⁇ 1.2 mg/dL or calculated creatinine clearance > 60 ml/min (using the Cockroft & Gault formula).
  • a suitable subject has a level of asparatate
  • AST aminotransferase
  • ALT alinine aminotransferase
  • a suitable subject has a level of serum total bilirubin ⁇ 1.5 mg/dL with the following exception: patients with known Gilbert's disease, serum total bilirubin ⁇ 3 mg/dL.
  • a suitable subject has a level of serum albumin > 3.0 g/dL (solid tumor patients in Arm 1 and Phase la only, not applicable to patients with multiple myeloma).
  • a suitable subject has been assessed with left ventricular ejection fraction (LVEF) > 50%. LVEF assessment must have been performed within 8 weeks of screening.
  • LVEF left ventricular ejection fraction
  • a suitable subject has a level of hemoglobin > 9 g/dL.
  • a suitable subject has a level of absolute neutrophil count
  • a suitable subject has a level of platelet count >
  • a suitable subject has a level of absolute lymphocyte count of > 500/
  • suitable subjects considered for treatment using a method described herein must not have or be any of the following:
  • Active autoimmune disease including connective tissue disease, uveitis, sarcoidosis, inflammatory bowel disease or multiple sclerosis
  • active autoimmune disease including connective tissue disease, uveitis, sarcoidosis, inflammatory bowel disease or multiple sclerosis
  • immunosuppressive therapy any immunosuppressive therapy should have been stopped within 6 weeks prior to screening visit
  • HTV Human immunodfifficiency virus
  • HCV hepatitis C virus
  • HBV hepatitis B virus
  • a clinical trial assay will be used in patient screening and selection for participation into a clinical trial.
  • the clinical trial assay is a TnMUCl clinical trial assay (CTA).
  • the TnMUCl CTA may be an immunohistodiemistry assay (see, Experimental Example 8 herein), and may be incorporated into an in vitro companion diagnostic device (CDx).
  • the modified immune cell (e.g., a Tn-MUCl CAR T cell) described herein may be included in a composition for immunotherapy, in particular for treating a MUC1- associated cancer.
  • the composition may include a pharmaceutical composition and further include a pharmaceutically acceptable carrier.
  • a therapeutically effective amount of the pharmaceutical composition comprising the modified immune cells may be administered.
  • compositions of the present invention may comprise the modified immune cell as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients.
  • Such compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino adds such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives.
  • buffers such as neutral buffered saline, phosphate buffered saline and the like
  • carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol
  • proteins polypeptides or amino adds such as glycine
  • antioxidants chelating agents
  • adjuvants e.g., aluminum hydroxide
  • preservatives e.
  • compositions of the present invention may be administered in a manner appropriate to the disease to be treated (or prevented).
  • the quantity and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient’s disease, although appropriate dosages may be determined by clinical trials.
  • the cells of the invention to be administered may be autologous, allogeneic or xenogeneic with respect to the subject undergoing therapy.
  • Cells of the invention can be administered in dosages and routes and at times to be determined in appropriate pre-clinical and clinical experimentation and trials.
  • Cell compositions may be administered multiple times at dosages within these ranges.
  • Administration of the cells of the invention may be combined with other methods useful to treat the desired disease or condition as determined by those of skill in the art.
  • compositions containing such cells and/or enriched for such cells such as in which cells expressing the recombinant receptor make up at least 50%, 60%, 70%, 80%, 90%, 91%, 92%,
  • compositions include pharmaceutical compositions and formulations for administration, such as for adoptive cell therapy. Also provided are therapeutic methods for administering the cells and compositions to subjects, e.g., patients.
  • compositions including the cells for administration including pharmaceutical compositions and formulations, such as unit dose form compositions including the number of cells for administration in a given dose or fraction thereof.
  • the pharmaceutical compositions and formulations generally include one or more optional pharmaceutically acceptable carrier or excipient.
  • the pharmaceutical compositions and formulations generally include one or more optional pharmaceutically acceptable carrier or excipient.
  • composition includes at least one additional therapeutic agent.
  • pharmaceutical formulation refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered.
  • A“pharmaceutically acceptable carrier” refers to an ingredient in a
  • a pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative. In certain aspects, the choice of carrier is determined in part by the particular cell and/or by the method of administration.
  • Suitable preservatives may include, for example, methylparaben, propylparaben, sodium benzoate, and
  • benzalkonium chloride In certain aspects, a mixture of two or more preservatives is used. The preservative or mixtures thereof are typically present in an amount of about 0.0001% to about 2% by weight of the total composition. Carriers are described, e.g., by Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980).
  • Pharmaceutically acceptable carriers are generally nontoxic to recipients at the dosages and concentrations employed, and include, but are not limited to: buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol;
  • buffers such as phosphate, citrate, and other organic acids
  • antioxidants including ascorbic acid and methionine
  • preservatives such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parab
  • resorcinol cyclohexanol; 3-pentanol; and m-cresol
  • low molecular weight polypeptides include proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins;
  • chelating agents such as EDTA
  • sugars such as sucrose, mannitol, trehalose or sorbitol
  • salt-forming counter-ions such as sodium
  • metal complexes e.g. Zn-protein complexes
  • non-ionic surfactants such as polyethylene glycol (PEG).
  • Buffering agents in certain aspects are included in the compositions. Suitable buffering agents include, for example, citric acid, sodium citrate, phosphoric acid, potassium phosphate, and various other acids and salts. In certain aspects, a mixture of two or more buffering agents is used. The buffering agent or mixtures thereof are typically present in an amount of about 0.001% to about 4% by weight of the total composition. Methods for preparing administrable pharmaceutical compositions are known. Exemplary methods are described in more detail in, for example, Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins; 21st ed. (May 1, 2005).
  • Formulations described herein can include aqueous solutions.
  • the formulation or composition may also contain more than one active ingredient useful for the particular indication, disease, or condition being treated with the cells, e.g., those with activities complementary to the cells, where the respective activities do not adversely affect one another.
  • active ingredients are suitably present in combination in amounts that are effective for the purpose intended.
  • the pharmaceutical composition further includes other pharmaceutically active agents or drugs, such as chemotherapeutic agents, e.g., asparaginase, busulfan, carboplatin, cisplatin, daunombicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, and/or vincristine.
  • chemotherapeutic agents e.g., asparaginase, busulfan, carboplatin, cisplatin, daunombicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, and/or vincristine.
  • the pharmaceutical composition in some embodiments contains the cells in amounts effective to treat or prevent the disease or condition, such as a therapeutically effective or prophylactically effective amount.
  • Formulations include those for oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, buccal, sublingual, or suppository administration.
  • the cell populations are administered parenterally.
  • parenteral includes intravenous,
  • compositions in some embodiments are provided as sterile liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which may in certain aspects be buffered to a selected pH.
  • sterile liquid preparations e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which may in certain aspects be buffered to a selected pH.
  • Liquid preparations are normally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are somewhat more convenient to administer, especially by injection.
  • Viscous compositions can be formulated within the appropriate viscosity range to provide longer contact periods with specific tissues.
  • Liquid or viscous compositions can comprise carriers, which can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol) and suitable mixtures thereof.
  • Sterile injectable solutions can be prepared by incorporating the cells in a solvent, such as in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, dextrose, or the like.
  • a suitable carrier such as sterile water, physiological saline, glucose, dextrose, or the like.
  • the compositions can contain auxiliary substances such as wetting, dispersing, or emulsifying agents (e.g., methylcellulose), pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, and/or colors, depending upon the route of
  • compositions including antimicrobial preservatives, antioxidants, chelating agents, and buffers, can be added.
  • antimicrobial preservatives for example, parabens, chlorobutanol, phenol, and sorbic acid.
  • Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • the formulations to be used for in vivo administration are generally sterile. Sterility may be readily accomplished, e.g., by filtration through sterile filtration membranes.
  • a pharmaceutical composition comprising the modified immune cells described herein may be administered at a dosage of 10 4 to 10 9 cells/kg body weight, in some instances 10 s to 10 6 cells/kg body weight, including all integer values within those ranges. Immune cell compositions may also be administered multiple times at these dosages.
  • the cells can be administered by using infusion techniques that are commonly known in immunotherapy (see, e.g., Rosenberg et al., New Eng. J. of Med. 319:1676, 1988).
  • the optimal dosage and treatment regime for a particular patient can readily be determined by one skilled in the art of medicine by monitoring the patient for signs of disease and adjusting the treatment accordingly.
  • the administration of the modified immune cells of the invention may be administered by at least one mode selected from parenteral, subcutaneous,
  • the administration of the modified immune cells of the invention may be carried out in any convenient manner known to those of skill in the art.
  • the cells of the present invention may be administered to a subject by aerosol inhalation, injection, ingestion, transfusion, implantation or transplantation.
  • the compositions described herein may be administered to a patient transarterially, subcutaneously, intradermally, intratumorally, intranodally, intramedullary, intramuscularly, by intravenous (i.v.) injection, or intraperitoneally.
  • die cells of the invention are injected directiy into a site of inflammation in the subject, a local disease site in the subject, a lymph node, an organ, a tumor, and the like.
  • the 956-patient breast cancer cohort of The Cancer Genome Atlas was queried for normalized gene expression of MUC1 and of glycosylation enzymes of interest: CIGalTl, CIGalTICl, ST6GalNAcl and B3GNT6. Clinical and tumor characteristics were compared. Tumors were stratified by their Her-2/neu (Her2) receptor expression status as Hei2+ or Her2- and hormone receptor (HR), i.e. estrogen or progesterone receptor, expression status as either HR+ or HR-. Gene expression was analyzed according to subtype using one-way ANOVA.
  • Quantitative polymerase chain reaction qPCR: Several commercially available breast cancer cell lines, MCF10A (cat. no), MCF7 (cat. no), BT20 (cat. no), MDA-MB-231 (cat. no) and MDA-MB-453 (cat no) were purchased from ATCC, expanded and maintained according to manufacturer’s instructions. All cell lines were expanded at the lowest possible passage number for our assays and were all tested negative for mycoplasma. Gene expression of each breast cancer cell line was compared to expression of MCF10A, a non-tumorigenic breast epithelium cell line.
  • a prospective breast cancer tissue bank was maintained with samples collected from patients who present with an operable, palpable breast cancer. Samples of the tumor and normal breast tissue are collected at the time of preparation for pathologic analysis and snap frozen in liquid nitrogen. Samples were stored at -80° C until use.
  • a cohort of 50 breast tumors and 10 matched normal breast tissue samples was selected from the prospectively procured tissue bank. Samples were thawed, mechanically dissociated and homogenized using Lysing Matrix D tubes (MP Biomedicals, Santa Ana, CA). Frozen stocks of five cell lines (MCF10A - non- tumorigenic breast epithelium, MCF7 - HR + Her2 ' , BT20 - TNBC, MDA-MB-231 - TNBC and MDA-MB-453 - TNBC) were thawed. RNA was purified from all samples using the RNeasy Mini Kit (Qiagen, Germantown, MD) and cDNA was prepared via RT-PCR using the Superscript PI First-Strand Synthesis System (Invitrogen, Carlsbad,
  • Estrogen (ER), progesterone (PR) and Her-2/neu (Her2) receptor expression were evaluated by standard immunohistodiemistiy (IHC) staining techniques on formalin-fixed paraffin-embedded (FFPE) breast cancer tissue samples for all participants as part of standard pathology evaluation.
  • H-scores [1 x (% cells 1+) + 2 x (% cells 2+) + 3 x (% cells 3+)].
  • the distribution of H-scores (0-300) was assessed and found to be non-normal with a bimodal distribution centering at H-score value of 142. This value (142) was then used as the cut-off value to dichotomize the results as either positive or negative. Comparisons of H-scores were made between breast cancer subtypes using independent t-tests, and comparisons of clinical characteristics and survival were made between the H-score groups using chi- square and Kaplan-Meier survival tests.
  • Human CAR T cell generation and cytotoxicity assays Normal donor human T cells were activated and transduced to produce control CD19-BBz CAR and 5E5-BBz CAR T cells as previously described (Posey et al., (2016) Immunity 44, 1444-1454). Cytotoxicity assays were performed using the xCELLigence (ACEA Biosciences) real- time cellular impedance assay as previously described (Watanabe et al., (2016) JCI Insight 3). In brief, tumor cells were seeded in e-plates at low density and T cells were co-incubated with tumor cell lines ⁇ 24 hours after seeding at an effector-target ratio of 10:1 for 100 hours and cell index was recorded every 15 minutes.
  • Xenograft mouse model of CAR T cell delivery Breast cancer xenograft models were established by injecting 1 million luciferase-expressing MDA-MB-453 cells in !OOpL of PBS into the mammary fat pad or in 200pL of 50:50 PBS:matrigel subcutaneously on the right flank of the mice.
  • One week post tumor inoculation when the mean total flux of the tumor was ⁇ 10 9 for the fat pad model and 10 s for the subcutaneous model, mice were treated with 5 million NTT), CD19 CAR, or 5E5 CAR T cells injected intravenously in the lateral tail vein, intratumorally into the fat pad or subcutaneous tumor, or intraperitoneally. Mice were serially imaged for tumor bioluminescence using a Xenogen IVIS-200 Spectrum
  • Murine CAR T cell generation, in vitro cytotoxicity assays, and syngeneic mouse model Murine CAR backbone constructs were synthesized with murine elements of homology to human CAR backbones (CD8a leader, CD8a extracellular hinge and transmembrane domain, 4-1BB costimulatory domain and CD3zeta) and cloned into the MSGV retroviral vector, as previously described (Watanabe et al., (2016) JCI Insight 3). 5E5 scFv and HMFG1 scFv were subcloned into the murine CAR backbone through the restriction sites BamHI and BspEI and retrovirus was packaged using the Plat E cell line to produce ecotropic retrovirus.
  • spleens were harvested from hMUCl.tg donor mice and T cells were activated with anti-mouse CD3 and anti-mouse CD28 antibody-coated beads (Dynabeads, Thermo Fisher Scientific). Transduction of T cells with CAR-encoding retrovirus occurred on retronectin-coated plates one day after bead stimulation.
  • Mouse CAR T cells were expanded for 4 days after transduction in the presence of 50U/mL human IL-2 and injected into hMUCl.tg mice on day 5 after T cell activation.
  • mouse CAR T cells were co-cultured with Jurkat luciferase-expressing cell line at an effector to target ratio of 20: 1 for 16 hours. Cells were then washed once in PBS, lysed in ludferase cell culture lysis reagent (Promega), and subsequently mixed with ludferase assay reagent (Promega). Luminescence of the lysates was analyzed using a plate spectrophotometer. Specific lysis of each sample was calculated using the luminescence of target cells alone, and Triton-X lysed target cells, corresponding to 0% lysis and 100% lysis respectively. Statistical analyses: Statistical analyses were performed using SPSS 24 (IBM, Armonk, NY) and Prism (GraphPad). P values were taken to be significant if ⁇ 0.05.
  • Examnle 1 Gene expression analyses of MUC1 and relevant plvrntransferases in breast cancer- a TCGA gene exnression analysis of breast cancer samnles
  • MUC1 expression differed by tumor stage with T1 and T2 tumors exhibiting lower expression than T3 and T4 tumors (pO.OOl).
  • MUC1 and all O-glycotransferases assayed exhibited differential expression when the cohort was stratified by tumor subtype except die T synthase chaperone, CIGalTICl.
  • HR+ cancers had higher expression ofMUCl (pO.OOl) and lower expression of CIGalTl (pO.OOl).
  • MCF10A is a HR- non-invasive breast epithelial cell line.
  • MCF7 is a HR + Her2 " breast cancer cell line.
  • BT20, MDA-MB-231, and MDA-MB-453 are HR- Her2- breast cancer cell lines. All breast cancer cell lines had lower expression of B3GNT6 (MFC 0.04), C1GALT1 (MFC 0.07), and C1GALT1C1 (0.44), and higher expression ofMUCl (142.85) and ST6GALNAC1 (61.06) (FIG.
  • Tn-MUCl Glvcoepitope is specifically expressed in breast cancer and in normal mali g nant breast tissues
  • Tn-MUCl gly coepitope expression was quantified by IHC using the 5E5 anti- Tn-MUCl antibody (FIGs. 3A and 3B).
  • Normal adjacent breast tissues were present in 7 of die 52 breast tumor tissue sections. Tumor epithelial cells stained intensely for TN- MUC1 while staining of adjacent normal breast epithelial cells for TN-MUC1 was lacking or at a significantly lower H-score. The mean H-score for tumor tissue was 183.8 ⁇ 95.7 and for normal breast tissue was 34.9 ⁇ 32.8 (pO.001).
  • Tn-MUCl-sneciflc CAR T cells are efficacious in vitro and in xenograft models
  • Anti-Tn-MUCl CAR T cells which were developed utilizing the scFv of the 5E5 mAh, exhibited potent cytotoxicity against breast cancer cell lines BT20, MDA- MB-231, MCF7, and TB129, a patient-derived TNBC cell line developed at the University of Pennsylvania.
  • tumor growth was impeded after anti-Tn- MUC1 CAR T cell co-culture when compared with negative controls (media alone, non-transduced (NTD) T cells, and anti-CD 19 CAR T cells).
  • the reduction in tumor growth also readied or approached that of the negative control, cells treated with Triton X-100, in under 100 hours of co-culture (FIG. 4).
  • mice were treated with 5 million NTD, anti-CD 19 CAR, or anti -Tn-MUCl (5E5) CAR T cells through intravenous (tail vein), intratumoral, or intraperitoneal delivery, where the CAR was expressed in 50% of cells.
  • trends in anti-tumor efficacy were observed for intraperitoneal and intratumoral delivery of 5E5 CAR T cells for mice bearing subcutaneous tumors as well (FIGs. 5A-5C).
  • the tumor-specificity of a CAR T cell target is important in order to avoid dose- limiting toxicides, which will allow clinicians to reach therapeutic doses where antitumor efficacy is expected.
  • a history of off-tumor, on-taiget toxicides have been reported for CAR T cells targeting Her2 and carbonic anhydrase IX in clinical studies, and EGFR and GD2, among others in preclinical studies.
  • mice In non- tumor bearing human MUC1 transgenic (hMucl.tg) mice, 5 million T cells (NTD, 5E5- CAR, or HMFG1-CAR) were injected n the peritoneal cavity. Three days after injection, mice in the HMFG1-CAR group expectantly died, so necropsy was performed on remaining mice. Destructed glomeruli and hemorrhaging in the kidneys and lungs of mice treated with HMFGl-CARs was observed, but histological toxidties in the tissues from mice treated with NTD or 5E5-CARs was not.
  • MUC1 was highly expressed by all breast cancer subtypes. As expected, HR+ breast cancers had the highest expression since MUC1 is under transcriptional control by steroid hormones. qPCR studies demonstrated that tumor cells have higher expression ofMUCl than normal breast tissue. Without wishing to be bound by specific theory, accumulation ofMUCl may overwhelm the glycosylation pathway, resulting in aberrantly glycosylated mucins being expressed on the cell surface, supporting Tn-MUCl and STn-MUCl expression by tumor cells.
  • Core 1 synthase enzymes CIGalTl and its chaperone CIGalTICl (Cosmc) expression were lower in breast tumor tissue than normal breast tissue.
  • expression of Core 3 synthase (B3GNT6) was decreased in breast tumor tissue.
  • Breast tumor tissues also had higher expression of sialyl transferase, ST6GALNac. This suppression both Core 1 and Core 3 synthase enzymes and increased expression of sialyl transferase would prevent progression along the MUC1 glycosylation pathway, resulting in accumulation of Tn-MUCl and increased synthesis of STn-MUCl (FIGs. 7A-7C).
  • an antigen target for immunotherapy is that it is expressed by tumor tissue and not normal tissue order to limit the on-target off-tumor recognition by CAR T cells. It was demonstrated utilizing an anti-Tn-MUCl antibody that, while there was very limited expression of abnormally glycosylated MUC1 by normal breast tissue, all breast tumor samples expressed them and to a much higher degree. This expression was irrespective of breast cancer subtype, indicating that this targeted therapy, unlike those that currently exist for breast cancer, may not be subtype dependent.
  • Tn-MUCl The anti-Tn-MUCl CAR most notably resulted in target-specific cytotoxicity in in vitro studies using breast cancer cell lines of various subtype. Tn-MUCl was expressed in all breast cancer subtypes regardless of their HR or Her2 expression status, rendering it a versatile breast cancer specific antigen and a viable target for CAR T cell therapy in breast cancer.
  • TnMUCl(5E5)-based chimeric antigen receptors containing various costimulatoiy domains were generated and tested for transgene expression in human T cells.
  • Transgene expression was measured by flow cytometry using biotinylated protein L and streptavidin-PE or Biotin-Goat Anti-Mouse and streptavidin-PE. Expression of the various CARs are shown in FIG. 8.
  • transduction efficiencies for the TnMUCl CARs were 69.3% for CD19BBz (CD19 directed CAR comprising 4-1BB and CD3zeta intracellular signaling domains); 46.8% for 5E5BBz (5E5 scFv based CAR comprising 4-1BB and CD3zeta intracellular signaling domains); 68.3% for 5E528z (5E5 scFv based CAR comprising CD28 and CD3zeta intracellular signaling domains); 51.6% for 5E528z YMFM (5E5 scFv based CAR comprising a CD28 variant (YMFM) domain and CD3zeta intracellular signaling domains); 47.9% for 5E527z (5E5 scFv based CAR comprising CD27 and CD3zeta intracellular signaling domains); 39% for 5E5Ox40z (5E5 scFv based CAR comprising 0X40 and CD3zeta
  • TnMUCl CARs were assessed in a carboxy fluorescein succinimidyl ester (CFSE) assay that measures the dilution of a dye between daughter cells.
  • CFSE carboxy fluorescein succinimidyl ester
  • TnMUCl CAR transduced T cells MCF7 cells were prepared in DIO media at 0.5 x 10 6 /mL, and !OOuL was added in each well (approximately 50,000 tumor cells/well). T cells were counted and resuspended at 1 * 10 6 cells/mL in RIO media. Transduction efficiency of CAR T cells was normalized to 30% using NTD cells. CFSE staining solution was diluted 1:1000 in PBS (5mM), and 1 x 10 6 total T cells (normalized to 30% scFv) were resuspended in lmL CFSE/PBS staining solution. Cells were incubated for 5 minutes at room temperature, protected from light.
  • FIG. 9 shows the results of the CFSE assay, demonstrating that the various TnMUCl CAR-T cells prohferate in response to MCF7 cells. Neither CD19BBz-T cells nor non-transduced cells (NTD) proliferated in response to MCF7 cells.
  • FIG. 10 shows the level ofIL-2, TNFa, and IFNg secretion of the various TnMUCl CAR-T cells as indicated.
  • TnMUCl CAR-T cells were tested in the TnMUCl+ hs766T pancreatic tumor NSG immunodeficient mouse model. Since the murine MUC1 lacks the epitope for 5E5 scFv, the efficacy of the various TnMUCl CARs reflects the background seen with non-transduced (NTD) cells plus any specific efficacy derived from interaction of the TnMUCl CAR with the TnMUCl+ tumor.
  • Hs766T tumors were established via the IP route in mice using S x 10 s Hs766T pancreatic cancer cell line labelled with Click Beetle Green (CBG).
  • mice were dosed IV with the various TnMUCl CAR-T cells as indicated in FIG. 11, which shows the total flux measured in mice post-IV administration of TnMUCl CAR-T cells as a function of the number of days post T cell infusion.
  • mice The levels of the various TnMUCl CAR-T cells in the peripheral blood of the infused mice were measured by retroorbital bleed at day 42 post infusion. As shown in FIGs. 12A and 12B, 5E5CD2z CAR-T infused mice had higher average numbers of human CD4+ T cells (FIG. 12A) and CD8+ T cells (FIG. 12B) in the peripheral blood.
  • a CD2£based CAR was created.
  • This CAR based on a monoclonal antibody (5E5) specific to a Tn-MUCl gly copeptide epitope is described herein.
  • This CAR is composed of the extracellular targeting region (based on the 5E5 monoclonal Ah), the CD8a hinge and transmembrane domain and two intracellular signaling domains of ⁇ 02z and CD3 ⁇ Tthe CD2 signal was observed to be associated with strong persistence of T cells in the setting of autoimmune disease and may lead to better persistence of the CART cell product within a patient (McKinney et al.
  • a lentivirus vector containing the 5E5-based CAR was constructed to transduce autologous T cells obtained by leukapheresis to create the CART product.
  • a self-inactivating lentiviral vector LV will be used to transfer the CAR constructs into autologous T lymphocytes by ex vivo transduction. Lymphocytes will be enriched from leukapheresis product and transduced with the LV.
  • LV -mediated transduction of T lymphocytes isolated from the peripheral blood has been previously tested in other clinical trials.
  • CART-TnMUCl TnMUCl antigen
  • Nonclincal studies have been conducted with CART-TnMUCl (5E5 scFv based CAR comprising a CD2 and CD3zeta intracellular signaling domain) to demonstrate the potential mechanism of action of this approach against multiple tumor models as well as studies to investigate the potential for the CART-TnMUCl cells to target normal human tissues. Data described here are presented to demonstrate the potential for anti-tumor activity with CART-TnMUCl and limited potential to target normal human tissues.
  • Target cell lines (Table 3) were selected to represent both solid and hematological malignancies, and to assess the pharmacology towards target cells with both low and high antigen expression levels as determined by polymerase chain reaction (PCR) and flow cytometry assays (see, Posey et al. (2016 ) Immunity, 44:1444-1454).
  • ATCC American Type Culture Collection
  • CD cluster of differentiation
  • MUC1 mucin, cell surface associated
  • RNA ribonucleic acid
  • UPenn University of Pennsylvania
  • CART-TnMUCl, CART-TnMUCl -BBz and control T cells were stimulated with TnMUCl positive and negative target cells, and investigated for primary and secondary pharmacological properties.
  • the primary pharmacology of CART cells measures their direct anti-tumor activity and was assessed in vitro as the ability to lyse TnMUCl positive target cells, and in vivo as the ability to control disseminated TnMUCl positive tumors in NSG mice.
  • the secondary pharmacology of CART cells is their ability to proliferate, secrete cytokines and diemokines, and for the CD4 subset to express CD40L in response to TnMUCl positive target cells.
  • CART cells result in an antigen-specific increase in the CART population, which facilitates tumor control.
  • the ability to secrete cytokines and diemokines can have direct effects on tumors as well as orchestrating integrated immune responses.
  • CD40L expression by activated CD4 T cells is a key mechanism via which CD4 T cells provide‘help’ to integrated immune responses, in which the endogenous immune cells of the host may contribute to tumor control.
  • CART-TnMUCl cell killing of the TnMUCl+ MCF7 breast cancer cell line and pancreatic cancer cell lines Hs766T and Capan-2 was evaluated using the xCELLigence (ACEA Biosciences) real-time cellular impedance assay as previously described (Watanabe et al. (2016) JCI Insight, 3).
  • CART cells were cultured with tumor cells (MCF7, Hs766T, Capan2) for 24 hours and then cell impedance tested. Tumor growth was impeded by co-culture with CART-TnMUCl cells when compared with negative controls (media alone, NTD cells, CART-19 T cells).
  • CART-TnMUCl cells and CART-TnMUCl -BBz cells showed similar kinetics of cytotoxicity against Hs766T cells (FIG. 13).
  • CART-TnMUCl also showed cytotoxicity against MCF7 (in both assays) and Capan2 cells; however, where directly compared, the kinetics of cytotoxicity for CART-TnMUCl were slower and less potent than CART-TnMUCl- BBz cells. Without being bound to any theory, this may be due to differential CAR expression levels and/or the result of differential signaling pathway activation.
  • FIG. 13 is a graph demonstrating the cytotoxicity of CART-TnMUCl, CART- TnMUCl-BBz, and negative control cells (CART-19 and NTD) towards Hs766T pancreatic cancer cell line. Additional controls were media alone, and Triton X-100, a nonionic surfactant that rapidly lyses membranes leading to cell death.
  • CART-TnMUCl cells The cytotoxicity of CART-TnMUCl cells was further investigated in a luciferase-based assay against labelled Jurkat E6-1, MCF7, and Hs766T cells using NTD cells as a control (FIGs. 14A-14C).
  • CART-TnMUCl cells demonstrated potent killing of Jurkat E6-1 cells at 3:1 and 10:1 E:T ratios (FIG. 14A).
  • Potent killing of MCF7 breast cancer cells was also detected, which increased with E:T ratio (FIG. 14B).
  • FIG. 14C There was also a trend to killing of the Hs766T cells although this did not reach significance
  • FIGs. 14A-14C demonstrate targeted cell killing by CART-TnMUCl cells.
  • CART-TnMUCl or NTD cells were cultured with Jurkat E6-1 cells (left), MCF7 breast cancer cells (center), or Hs766T pancreatic cancer cells (right) at the indicated effector- to-target ratios.
  • MCF7 the total number of tumor cells utilized for the 3: 1 and 10: 1 E:T ratios was reduced by half in order to achieve 6: 1 and 20: 1 E:T ratios, respectively.
  • Hs766T the total number of tumor cells utilized for the 3: 1 and 10: 1 E:T ratios was doubled in order to achieve 1.5:1 and 5:1 E:T ratios, respectively.
  • FIGs. 15A and 15B show targeted cell killing by CART-TnMUCl cells in response to Tn antigen.
  • CART-TnMUCl cells were studied in an animal model of intraperitoneal (IP) TnMUCl+ Hs766T tumors in the immunodefident NSG mouse.
  • the NSG model is a widely used xenotransplantation model for engraftment of human tumor and T cells (Barrett et al. (2011) Hum Gene Ther, 22:1575-1586).
  • Table 4 and Table 5 describe the conditions tested in this tumor challenge model.
  • Hs766T tumors were established via the intraperitoneal (IP) route in mice using 5 x 10 s Hs766T pancreatic cancer cell line labelled with Click Beetle Green (CBG).
  • IP intraperitoneal
  • CBG Click Beetle Green
  • mice were randomized between the treatment groups and dosed IV with CART- TnMUCl cells, or CART-TnMUCl -BBz, or two negative controls: CART-19 and NTD cells.
  • mice and the total number of CAR+ T cells injected are summarized in Table 5 .
  • a staining level of 2.89% was seen in the nontransduced controls which reflects the background of the assay and not CAR expression as these cells were not exposed to CAR-encoding lentivectors.
  • FIG. 16 shows graphs plotting the bioluminescent imaging of tumor burden in a mouse model of pancreatic cancer.
  • NSG mice were injected with CBG+ Hs766T cells and treated with 5 x 10 6 total T cells (1.5 x 10 6 CAR+ cells in CART -treated groups) with CART-TnMUCl, CART-TnMUCl-BBz, CART-19, or NTD cells.
  • Bioluminescent imaging of tumor burden was measured at multiple timepoints as indicated, displayed as photons per second (p/s). Panels represent the results for individual mice, and the mean ⁇ SD. Statistics were determined by unpaired, two-tailed T tests and one-way ANOVA.
  • CART- TnMUCl and CART-TnMUCl-BBz cell treated mice demonstrated a significant reduction in tumor growth compared to mice treated with CART-19 cells and NTD cells, indicating that 5E5 -based CARs mediated TnMUCl -antigen specific eradication of Hs766T tumor cells. There was a non-significant trend towards more robust tumor clearance for the CART-TnMUCl group, which was sustained throughout the study duration.
  • Antigen-Dependent Proliferation The propensity of CART-TnMUCl cells to proliferate in response to cognate antigen was determined in two flow cytometry-based assay formats both based on the principle of the labelling of CART cells with a dye which is diluted between daughter cells during mitosis, and thus provides a measure of the degree of proliferation.
  • T cells were labelled with CellTrace Violet, and in the other they were labeled with CFSE.
  • CART-TnMUCl and control NTD cells were incubated with TnMUCl+ Hs766T pancreatic tumor cells and Jurkat E6-1 leukemia cells, and with the control TnMUCl- Jurkat CD 19t-P2 A-COSMC cells (FIGs. 17A- 17C).
  • CART-TnMUCl cells underwent substantial proliferation in response to Hs766T cells, and modest proliferation in response to Jurkat E6-1 cells, but did not proliferate when exposed to the Jurkat CD 19t-P2A-COSMC cells, which lack surface expressed TnMUCl antigen, demonstrating antigen-specific proliferation.
  • FIGs. 17A-17C demonstrate the proliferation of CART-TnMUCl cells in response to antigen-expressing target cells. Proliferation measured by decrease in CellTrace Violet signal and increase in the percentage of CellTrace Violet low T cells.
  • FIG. 17 A Histograms showing count versus CellTrace Violet signal. T cells are gated as GFP-, CD3+, L/D-near IR low lymphocytes.
  • FIG. 17B The percent of T cells that fall within CellTrace Violet High (no proliferation) versus CellTrace Violet low (proliferation) groups.
  • FIG. 17C Plots showing CAR expression versus CellTrace Violet signal. T cells are gated as GFP-, CD3+, L/D-near IR low lymphocytes.
  • CART-TnMUCl proliferative responses were noted against TnMUCl positive MCF7, Hs766T, and Jurkat E6-1 cells but not TnMUCl negative Jurkat CD19-P2A- COSMC cells, demonstrating antigen-dependent proliferation.
  • Antigen-Dependent Cytokine and Chemokine Production The ability of CART- TnMUCl cells to produce cytokines and chemokines in response to TnMUCl was assessed by Luminex assay, a bead-based flow cytometry assay that simultaneously quantifies the production of a broad array of secreted factors (FIG. 18).
  • the Luminex assay used specifically measures the following cytokines and soluble cytokine receptors: EGF, HGF, G-CSF, GM-CSF, IL-Ib, IL-1R, IL-2, IL- 2R, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-13, IL-15, IFN-g,TNR-a and VEGF; as well as the following chemokines: Eotaxin, IL-8, IP10, MCP-1, MIG, MIR-Ia, MIR-Ib, and RANTES.
  • FIG. 18 shows the production of cytokines and chemokines in various cell lines. Production of cytokines and chemokines by CART-TnMUCl, CART-TnMUCl-BBz analogue, and control cells (CART-19, and NTD) in response to TnMUCl+ targets as measured by Luminex. Supernatants were analyzed after 24h coincubation of effector cells and targets at a 2: 1 ratio.
  • Luminex data demonstrate that CART-TnMUCl cells produced numerous cytokines and chemokines in response to TnMUCl+ cell lines at levels superior to the negative controls and the two 5E5-based CART cells were broadly similar in their cytokine profile, albeit that overall levels of each factor trended lower with CART- TnMUCl compared to CART-TnMUCl-BBz (FIG. 18). Without being bound by theory, this may be due to the lower CAR expression by CART-TnMUCl and/or to differences in the signaling pathways. Specific cytokine production was evident against all three lines tested.
  • Cytokine production favored a Thl -biased response, as the Thl- type cytokines including IFNg, TNFa, and IL-2 were secreted at much higher levels compared to Thl7-type (IL-17) and Th2-type (IL-4, IL-5, IL-13, and IL-10) cytokines.
  • Thl-7-type (IL-17) and Th2-type (IL-4, IL-5, IL-13, and IL-10) cytokines In addition to trending towards lower production of each factor, CART-TnMUCl cells differed from CART-TnMUCl-BBz cells in that production of IL 13 was minimal or absent with the former, whereas the latter secreted IL-13 against all three targets (FIG. 18).
  • IL-13 has previously been observed as part of the cytokine profile of BBz-based CARs (Xue et al. (2017 ) J Immimother Cancer, 5:85).
  • IFNy was measured in an enzyme-linked immunosorbent assay (ELISA) following the coincubation of CART-TnMUCl with TnMUCl+ Hs766T, and Jurkat E6-1 cells and TnMUCl- Jurkat 19COSMC cells (FIG. 19).
  • ELISA enzyme-linked immunosorbent assay
  • FIG. 19 shows data obtained from an IFNy ELISA experiment. Cytokine secretion by CART-TnMUCl cells or NTD cells was measured after 24 hour cocultures at 2:1 E:T ratio with antigen positive (Hs766T, Jurkat E6-1) or antigen negative (Jurkat CD 19-P2A-COSMC) cell lines or media alone. IFNy in the co-culture supernatant was quantified in pg/mL.
  • the monocyte/macrophage derived cytokines IL-6 and IL-1 may play a role in the pathogenesis of CART -related toxicities such as CRS.
  • Monocyte/macrophages produce these cytokines in response to T cell cytokines and chemokines including GM- CSF, MIP la and IFNg, and potentially also through direct activation of
  • FIG. 18 shows that for each target cell line, CART-TnMUCl cells elaborated lower amounts of GM-CSF, MIP- la and IFNg (as well as IL-IB/IL-IRA and IL-6) when compared with CART-TnMUCl -BBz.
  • CART-TnMUCl and CART-TnMUCl -BBz demonstrate antigen-specific production ofThl -biased cytokines and chemokines, which may support the in vivo function of CART cells as well as endogenous tumor-specific immune responses.
  • CD40L Antigen-Dependent CD40L Expression: The expression of CD40L by activated CD4 T cells can stimulate antigen-presenting cells including dendritic cells, B cells and macrophages via CD40 and contribute to an integrated immune response to the tumor. Indeed, the activation of antigen presenting cells via the CD40 - CD40L pathway is a key mechanism of T cell‘help’ for immune responses including the development of anti-tumor CDS T cells (Toes et al. (1998) Semin Immunol, 10(6):443-448). While activation of this pathway may be beneficial to tumor control, the activation of monocytes and macrophages by CD4+ CART cells may also contribute to toxicides such as CRS (Giavridis et al. (2016) Nature Medicine, 24:731-738; Norelli et al. (2016) Nature Medicine 24:739-748; Rooney et al. (2018 ) Nature Medicine, 24:705-706).
  • CRS Chemavridis et al. (2018)
  • CD40L expression by CD4+ CART-TnMUCl and CART-19 (BBz) cells was studied via flow cytometry after 24 hours of coincubation with TnMUCl and CD19 positive and negative cell lines. Both CARTs upregulated CD40L in an antigen-specific manner. While basal levels of CD40L were similar, CART-19 showed approximately twice as much upregulation of CD40L in response to CD19 positive targets as CART- TnMUCl did in response to TnMUCl positive targets. The results demonstrate that CART-TnMUCl and CART-19 are both able to upregulate CD40L expression by CD4 T cells in response to their respective antigens, and that CD40L expression levels were lower for CART-TnMUCl than CART-19.
  • FIG. 20 shows the quantitation in peripheral blood of mice at Days 21 and 42 post-T cell infusion.
  • NSG mice were injected with CBG+ Hs766T cells and treated with CART-TnMUCl, CART-TnMUC 1 -BBz, CART-19, or NTD cells.
  • Blood was collected via retro-orbital bleeding, lysed, and stained in order to detect human T cells.
  • mice treated with the CART-TnMUC 1 had higher mean average numbers of human CD4+ T cells in the peripheral blood (2,774 cells/mL) as compared to all other groups, including the mice treated with CART-TnMUCl-BBz (290.4 cells/mL, ⁇ 10-fold difference) and the mice treated with NTD cells (614.8 cells/mL ⁇ 4.5-fold difference).
  • the mice treated with CART-TnMUCl-BBz 290.4 cells/mL, ⁇ 10-fold difference
  • mice treated with NTD cells 614.8 cells/mL ⁇ 4.5-fold difference.
  • CDS compartment there was an opposing trend to a smaller ⁇ 3-fold increase of CD8+ CART-TnMUC 1 -BBz cells versus CD8+ CART- TnMUC 1 cells.
  • the 5E5 scFv was derived from mAh 5E5 which has previously been shown to bind an epitope comprised of Tn or STn glycans attached to the Ser and Thr residues of the GSTA amino acid sequence of the MUC1 variable number tandem repeat (VNTR) domain.
  • the mAh 5E5 does not bind to other gly coforms of MUC1 including unglycosylated, other aberrant gly coforms or biosynthetic intermediates (T, ST, Core 3), or fully glycosylated forms, and shows minimal binding to Tn haptens at high hapten concentrations, with this specificity reproduced when the 5E5 scFv is used in the CART format (Posey et al. (2016) Immunity, 44:1444-1454; Sorensen et al. (2006) Glycobiology, 16:96-107; Tarp et al. (2007) Glycobiology, 17:197-209).
  • CARs derived from mAh 5E5 retain specificity for Tn or STn glycoforms of the GSTA amino acid sequence of the VNTR domain of MUC1.
  • the epitope for this antibody includes both the specific glycan haptens and the peptide backbone of MUC1, with minimal binding to Tn/STn haptens outside this context, and no binding to MUC1 where the glycans are either absent, restricted to T-, ST- or Core 3-glycans, or represent the normal complex glycans observed in healthy cells. No off- target reactivity of mAh 5E5 has been demonstrated. This specificity to an aberrant glycoform of MUC1 is expected to increase the selectivity for tumor cells.
  • the panel of normal human tissues included: adrenal, bladder, blood vessels, bone marrow, brain (cerebellum, cerebral cortex, and pituitary gland), breast, cardiac muscle, esophagus, eye, fallopian tube, gastrointestinal tract (stomach, small intestine, colon), heart, kidney (cortex, medulla), liver, lung, lymph node, mesothelial cells, ovary, pancreas, placenta, prostate, salivary gland, skeletal muscle, skin, spinal cord, spleen, testis, thymus, thyroid gland, tonsil, ureter, and uterus (cervix, endometrium).
  • the goal of the study was to determine the potential tissues that could be at risk in the clinic for the observation of on-target/off-tumor activity of the CART- TnMUCl.
  • the study was designed to identify the tissues with either strong cytoplasmic expression and/or membranous expression.
  • tissue cross reactivity study At the highest concentration of antibody tested in the tissue cross reactivity study, five tissues were identified with TnMUCl expression observed in more than 75% of tiie donors tested: (1) stomach, 100%; (2) kidney, 89%; (3) pancreas, 86%; (4) colon, 83%; and (5) lung, 75%. Only cytoplasmic expression is noted in all of these tissues, thought to have limited accessibility to the CART-TnMUCl, given the mechanism of action. Tissues that stained in a smaller proportion of cases also showed only cytoplasmic staining.
  • CART-TnMUCl cytotoxicity and cytokine expression in response to minimally cultured primary human cells was determined in vitro using a panel of cells selected on the basis of covering the range of MUC1 transcript and protein expression levels reported in public databases, and on tire results of the GLP tissue cross-reactivity study.
  • the tumor cell lines Hs766T (pancreatic cancer) and MCF7 (breast cancer) served as positive controls, while primary bladder smooth muscle cells served as an antigen negative control. All cells were assessed for MUC1 transcript expression via qPCR, and for TnMUCl expression via immunocytodiemistry using mAb 5E5, and produced the expected patterns of MUC1 and TnMUCl expression.
  • CART-TnMUCl cells killed Hs766T tumor cells efficiently at high E:T ratios. They did not induce cytolysis or exhibited minimum reactivity against primary human stomach epithelial cells, esophageal epithelial cells, and colonic epithelial cells.
  • CART- TnMUCl cells lysed bladder smooth muscle cells and kidney epithelial cells, but only at high E:T ratios and to a lesser degree than Hs766T cells.
  • the bladder smooth muscle cells were selected as a negative control, but had low levels of MUC1 RNA (70- to 870-fold less than the epithelial cells) and minimal 5E5 staining, and did not elicit many cytokines/chemokines at high levels, the lytic activity against this presumed negative control target is difficult to interpret. Low levels of CART cell-mediated cytolysis were observed with mammary and pancreatic epithelial cells at several different E:T ratios.
  • CART-TnMUCl cells were not as reactive against any of the primary normal human cells compared to positive control Hs766T cells, in terms of both the variety and levels of cytokines/ chemokines produced.
  • CART-TnMUCl-BBz cells did not express levels ofIL-2, TNFa or CD107a at levels above the background seen with CART-19 cells against the healthy cell panel in an intracellular cytokine staining assay.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Developmental Biology & Embryology (AREA)
  • Virology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/US2020/024825 2019-03-27 2020-03-26 Tn-muc1 chimeric antigen receptor (car) t cell therapy Ceased WO2020198413A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
JP2021557613A JP7654557B2 (ja) 2019-03-27 2020-03-26 Tn-MUC1キメラ抗原受容体(CAR)T細胞療法
EP20776961.3A EP3947471A4 (en) 2019-03-27 2020-03-26 TN-MUC1 CHIMERIC ANTIGEN RECEPTOR (AUTO) T-CELL THERAPY
CN202511107158.3A CN120944827A (zh) 2019-03-27 2020-03-26 Tn-MUC1嵌合抗原受体(CAR)T细胞疗法
CN202080025068.9A CN113661180B (zh) 2019-03-27 2020-03-26 Tn-MUC1嵌合抗原受体(CAR)T细胞疗法
JP2024217382A JP2025038057A (ja) 2019-03-27 2024-12-12 Tn-MUC1キメラ抗原受容体(CAR)T細胞療法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201962824532P 2019-03-27 2019-03-27
US62/824,532 2019-03-27
US201962881269P 2019-07-31 2019-07-31
US62/881,269 2019-07-31

Publications (1)

Publication Number Publication Date
WO2020198413A1 true WO2020198413A1 (en) 2020-10-01

Family

ID=72606667

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/024825 Ceased WO2020198413A1 (en) 2019-03-27 2020-03-26 Tn-muc1 chimeric antigen receptor (car) t cell therapy

Country Status (6)

Country Link
US (2) US11090336B2 (https=)
EP (1) EP3947471A4 (https=)
JP (2) JP7654557B2 (https=)
CN (2) CN120944827A (https=)
TW (1) TW202042824A (https=)
WO (1) WO2020198413A1 (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022229412A1 (en) * 2021-04-30 2022-11-03 Cellectis S.A. New anti-muc1 cars and gene edited immune cells for solid tumors cancer immunotherapy
WO2023250499A3 (en) * 2022-06-24 2024-01-25 Orgenesis Inc. Chimeric antigen receptor with modified hinge and transmembrane domain and uses thereof
EP4408894A4 (en) * 2021-09-29 2025-08-20 Chimera Bioengineering Inc Compositions and methods for anti-tnmuc1 gold car t-cells
US12576151B2 (en) 2020-09-25 2026-03-17 Beam Therapeutics Inc. Fratricide resistant modified immune cells and methods of using the same
US12594301B2 (en) 2019-09-27 2026-04-07 Beam Therapeutics Inc. Compositions and methods for treatment of liquid cancers
US12600971B2 (en) 2019-02-13 2026-04-14 Beam Therapeutics Inc. Modified immune cells having adenosine deaminase base editors for modifying a nucleobase in a target sequence

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010099205A1 (en) * 2009-02-24 2010-09-02 The Trustees Of The University Of Pennsylvania Methods for treating progressive multifocal leukoencephalopathy (pml)
WO2013126729A1 (en) * 2012-02-22 2013-08-29 The Trustees Of The University Of Pennsylvania Use of the cd2 signaling domain in second-generation chimeric antigen receptors
JP7654557B2 (ja) * 2019-03-27 2025-04-01 ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア Tn-MUC1キメラ抗原受容体(CAR)T細胞療法
GB202004371D0 (en) * 2020-03-26 2020-05-13 Glaxosmithkline Ip Dev Ltd CAR constructs
WO2022087453A1 (en) * 2020-10-22 2022-04-28 Lyell Immunopharma, Inc. Chimeric activation receptors
CN114685684A (zh) * 2020-12-31 2022-07-01 博生吉医药科技(苏州)有限公司 MUC1-Tn嵌合抗原受体修饰的Vγ9Vδ2T细胞及其应用
CN112940137A (zh) * 2021-02-08 2021-06-11 广州安捷生物医学技术有限公司 一种pd-1基因敲除的靶向muc1的car-t细胞及其制备方法和应用
EP4301774A4 (en) * 2021-03-03 2025-08-13 Dragonfly Therapeutics Inc METHODS OF TREATING CANCER USING MULTI-SPECIFIC BINDING PROTEINS THAT BIND TO NKG2D, CD16, AND A TUMOR-ASSOCIATED ANTIGEN
CN113943718B (zh) * 2021-10-11 2023-10-24 北京大学 一种糖基转移酶及其在Tn抗原的标记、成像和检测中的应用
CN116284409A (zh) * 2022-07-08 2023-06-23 上海优替济生生物医药有限公司 Gpc3 car-t细胞及其在制备治疗癌症的药物中的用途
WO2024091848A2 (en) * 2022-10-25 2024-05-02 The Trustees Of The University Of Pennsylvania Anti-ceacam6 car-t cells for the treatment of ceacam6+ tumors
CN119978126A (zh) * 2023-11-10 2025-05-13 深圳市菲鹏生物治疗股份有限公司 抗muc16抗体、靶向muc16的嵌合抗原受体及其应用

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990013644A2 (en) * 1989-05-09 1990-11-15 Dana Farber Cancer Institute Soluble cytoplasmic domain of human cd2 receptor
WO2013126729A1 (en) * 2012-02-22 2013-08-29 The Trustees Of The University Of Pennsylvania Use of the cd2 signaling domain in second-generation chimeric antigen receptors
US20140322212A1 (en) * 2013-02-20 2014-10-30 Jennifer Brogdon Effective targeting of primary human leukemia using anti-cd123 chimeric antigen receptor engineered t cells
US20170166652A1 (en) * 2014-02-05 2017-06-15 The University Of Chicago Chimeric Antigen Receptors Recognizing Cancer-Specific TN Glycopeptide Variants
US20170204177A1 (en) * 2014-07-17 2017-07-20 Carsgen Therapeutics Ltd. Immunologic effector cell of targeted cld18a2, and preparation method and use thereof
US20170267778A1 (en) * 2014-04-15 2017-09-21 Adc Therapeutics S.A. Humanized anti-tn-muc1 antibodies and their conjugates
WO2017172981A2 (en) * 2016-03-29 2017-10-05 University Of Southern California Chimeric antigen receptors targeting cancer
US9845362B2 (en) * 2010-10-08 2017-12-19 The University Of North Carolina At Charlotte Compositions comprising chimeric antigen receptors, T cells comprising the same, and methods of using the same
US20180009895A1 (en) * 2015-01-26 2018-01-11 Cellectis Anti-cll1 specific single-chain chimeric antigen receptors (sccars) for cancer immunotherapy
WO2018006882A1 (zh) * 2016-07-08 2018-01-11 科济生物医药(上海)有限公司 抗密蛋白18a2的抗体及其应用

Family Cites Families (69)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4444887A (en) 1979-12-10 1984-04-24 Sloan-Kettering Institute Process for making human antibody producing B-lymphocytes
US4716111A (en) 1982-08-11 1987-12-29 Trustees Of Boston University Process for producing human antibodies
US4797368A (en) 1985-03-15 1989-01-10 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus as eukaryotic expression vector
US5139941A (en) 1985-10-31 1992-08-18 University Of Florida Research Foundation, Inc. AAV transduction vectors
US5091513A (en) 1987-05-21 1992-02-25 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US5132405A (en) 1987-05-21 1992-07-21 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
JPS6412935A (en) 1987-07-02 1989-01-17 Mitsubishi Electric Corp Constant-speed travel device for vehicle
US6905680B2 (en) 1988-11-23 2005-06-14 Genetics Institute, Inc. Methods of treating HIV infected subjects
US5858358A (en) 1992-04-07 1999-01-12 The United States Of America As Represented By The Secretary Of The Navy Methods for selectively stimulating proliferation of T cells
US6534055B1 (en) 1988-11-23 2003-03-18 Genetics Institute, Inc. Methods for selectively stimulating proliferation of T cells
US6352694B1 (en) 1994-06-03 2002-03-05 Genetics Institute, Inc. Methods for inducing a population of T cells to proliferate using agents which recognize TCR/CD3 and ligands which stimulate an accessory molecule on the surface of the T cells
US5413923A (en) 1989-07-25 1995-05-09 Cell Genesys, Inc. Homologous recombination for universal donor cells and chimeric mammalian hosts
US5585362A (en) 1989-08-22 1996-12-17 The Regents Of The University Of Michigan Adenovirus vectors for gene therapy
DE69120146T2 (de) 1990-01-12 1996-12-12 Cell Genesys Inc Erzeugung xenogener antikörper
WO1996033735A1 (en) 1995-04-27 1996-10-31 Abgenix, Inc. Human antibodies derived from immunized xenomice
ATE158021T1 (de) 1990-08-29 1997-09-15 Genpharm Int Produktion und nützung nicht-menschliche transgentiere zur produktion heterologe antikörper
US5625126A (en) 1990-08-29 1997-04-29 Genpharm International, Inc. Transgenic non-human animals for producing heterologous antibodies
US5633425A (en) 1990-08-29 1997-05-27 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5661016A (en) 1990-08-29 1997-08-26 Genpharm International Inc. Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US5814318A (en) 1990-08-29 1998-09-29 Genpharm International Inc. Transgenic non-human animals for producing heterologous antibodies
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
US5350674A (en) 1992-09-04 1994-09-27 Becton, Dickinson And Company Intrinsic factor - horse peroxidase conjugates and a method for increasing the stability thereof
US5993434A (en) 1993-04-01 1999-11-30 Genetronics, Inc. Method of treatment using electroporation mediated delivery of drugs and genes
US7175843B2 (en) 1994-06-03 2007-02-13 Genetics Institute, Llc Methods for selectively stimulating proliferation of T cells
WO1996034096A1 (en) 1995-04-28 1996-10-31 Abgenix, Inc. Human antibodies derived from immunized xenomice
US7067318B2 (en) 1995-06-07 2006-06-27 The Regents Of The University Of Michigan Methods for transfecting T cells
US6692964B1 (en) 1995-05-04 2004-02-17 The United States Of America As Represented By The Secretary Of The Navy Methods for transfecting T cells
US6013516A (en) 1995-10-06 2000-01-11 The Salk Institute For Biological Studies Vector and method of use for nucleic acid delivery to non-dividing cells
US5916771A (en) 1996-10-11 1999-06-29 Abgenix, Inc. Production of a multimeric protein by cell fusion method
CA2722378C (en) 1996-12-03 2015-02-03 Amgen Fremont Inc. Human antibodies that bind tnf.alpha.
US6261281B1 (en) 1997-04-03 2001-07-17 Electrofect As Method for genetic immunization and introduction of molecules into skeletal muscle and immune cells
BRPI9809391B8 (pt) 1997-04-14 2021-05-25 Amgen Res Munich Gmbh processo para a produção de um receptor de antígeno anti-humano, anticorpo humano e composição farmacêutica
US6235883B1 (en) 1997-05-05 2001-05-22 Abgenix, Inc. Human monoclonal antibodies to epidermal growth factor receptor
US6055453A (en) 1997-08-01 2000-04-25 Genetronics, Inc. Apparatus for addressing needle array electrodes for electroporation therapy
US6241701B1 (en) 1997-08-01 2001-06-05 Genetronics, Inc. Apparatus for electroporation mediated delivery of drugs and genes
US5994136A (en) 1997-12-12 1999-11-30 Cell Genesys, Inc. Method and means for producing high titer, safe, recombinant lentivirus vectors
US6678556B1 (en) 1998-07-13 2004-01-13 Genetronics, Inc. Electrical field therapy with reduced histopathological change in muscle
US7171264B1 (en) 1999-05-10 2007-01-30 Genetronics, Inc. Intradermal delivery of active agents by needle-free injection and electroporation
HK1047109A1 (zh) 1999-10-15 2003-02-07 University Of Massachusetts 作为指定基因干预工具的rna干预轨迹基因
US6326193B1 (en) 1999-11-05 2001-12-04 Cambria Biosciences, Llc Insect control agent
US6797514B2 (en) 2000-02-24 2004-09-28 Xcyte Therapies, Inc. Simultaneous stimulation and concentration of cells
KR20030032922A (ko) 2000-02-24 2003-04-26 싸이트 테라피스 인코포레이티드 세포의 동시 자극 및 농축
US6867041B2 (en) 2000-02-24 2005-03-15 Xcyte Therapies, Inc. Simultaneous stimulation and concentration of cells
US7572631B2 (en) 2000-02-24 2009-08-11 Invitrogen Corporation Activation and expansion of T cells
ATE511400T1 (de) 2000-03-03 2011-06-15 Genetronics Inc Nukleinsäure-fomulierungen zur genverabreichung
US6436703B1 (en) 2000-03-31 2002-08-20 Hyseq, Inc. Nucleic acids and polypeptides
AU2001275474A1 (en) 2000-06-12 2001-12-24 Akkadix Corporation Materials and methods for the control of nematodes
US8209006B2 (en) 2002-03-07 2012-06-26 Vgx Pharmaceuticals, Inc. Constant current electroporation device and methods of use
US20040014645A1 (en) 2002-05-28 2004-01-22 Advisys, Inc. Increased delivery of a nucleic acid construct in vivo by the poly-L-glutamate ("PLG") system
US7328064B2 (en) 2002-07-04 2008-02-05 Inovio As Electroporation device and injection apparatus
US20050070841A1 (en) 2002-07-04 2005-03-31 Inovio As Electroporation device and injection apparatus
WO2005118788A2 (en) 2004-05-27 2005-12-15 The Trustees Of The University Of Pennsylvania Novel artificial antigen presenting cells and uses therefor
AU2006342101A1 (en) 2005-12-07 2007-10-25 Genetronics, Inc Variable volume electroporation chamber and methods therefore
AU2007304590A1 (en) * 2006-10-04 2008-04-10 Cancer Research Technology Limited Generation of a cancer-specific immune response toward MUC1 and cancer specific MUC1 antibodies
KR20140004174A (ko) * 2011-01-18 2014-01-10 더 트러스티스 오브 더 유니버시티 오브 펜실바니아 암 치료를 위한 조성물 및 방법
MX2014001222A (es) * 2011-07-29 2014-09-15 Univ Pennsylvania Receptores coestimuladores de cambio.
EP2817330B1 (en) 2012-02-22 2020-07-08 The Trustees of the University of Pennsylvania Use of icos-based cars to enhance antitumor activity and car persistence
WO2014087010A1 (en) 2012-12-07 2014-06-12 Ablynx N.V. IMPROVED POLYPEPTIDES DIRECTED AGAINST IgE
WO2015120180A1 (en) * 2014-02-05 2015-08-13 The University Of Chicago Chimeric antigen receptors recognizing cancer-specific tn glycopeptide variants
US10828353B2 (en) 2015-01-31 2020-11-10 The Trustees Of The University Of Pennsylvania Compositions and methods for T cell delivery of therapeutic molecules
KR102349677B1 (ko) 2015-05-28 2022-01-12 카이트 파마 인코포레이티드 T 세포 요법을 위해 환자를 컨디셔닝하는 방법
DK3909972T5 (da) 2015-06-19 2024-08-05 Sebastian Kobold Pd1-cd28-fusionsproteiner og disses anvendelse i medicin
CA2997551A1 (en) 2015-09-04 2017-03-09 Memorial Sloan Kettering Cancer Center Immune cell compositions and methods of use
EP3548055A4 (en) * 2016-12-02 2020-08-19 University of Southern California SYNTHETIC IMMUNE RECEPTORS AND THEIR PROCESSES FOR USE
WO2018191490A1 (en) * 2017-04-13 2018-10-18 The Trustees Of The University Of Pennsylvania Use of gene editing to generate universal tcr re-directed t cells for adoptive immunotherapy
CN111051350B (zh) * 2017-09-07 2022-11-01 苏州丁孚靶点生物技术有限公司 包含信号调节蛋白α的免疫缀合物
US10561686B2 (en) * 2018-01-12 2020-02-18 Innovative Cellular Therapeutics CO., LTD. Modified cell expansion and uses thereof
CN110526977A (zh) * 2018-05-25 2019-12-03 深圳宾德生物技术有限公司 一种靶向muc1的单链抗体、嵌合抗原受体t细胞及其制备方法和应用
JP7654557B2 (ja) * 2019-03-27 2025-04-01 ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア Tn-MUC1キメラ抗原受容体(CAR)T細胞療法

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990013644A2 (en) * 1989-05-09 1990-11-15 Dana Farber Cancer Institute Soluble cytoplasmic domain of human cd2 receptor
US9845362B2 (en) * 2010-10-08 2017-12-19 The University Of North Carolina At Charlotte Compositions comprising chimeric antigen receptors, T cells comprising the same, and methods of using the same
WO2013126729A1 (en) * 2012-02-22 2013-08-29 The Trustees Of The University Of Pennsylvania Use of the cd2 signaling domain in second-generation chimeric antigen receptors
US20140322212A1 (en) * 2013-02-20 2014-10-30 Jennifer Brogdon Effective targeting of primary human leukemia using anti-cd123 chimeric antigen receptor engineered t cells
US20170166652A1 (en) * 2014-02-05 2017-06-15 The University Of Chicago Chimeric Antigen Receptors Recognizing Cancer-Specific TN Glycopeptide Variants
US20170267778A1 (en) * 2014-04-15 2017-09-21 Adc Therapeutics S.A. Humanized anti-tn-muc1 antibodies and their conjugates
US20170204177A1 (en) * 2014-07-17 2017-07-20 Carsgen Therapeutics Ltd. Immunologic effector cell of targeted cld18a2, and preparation method and use thereof
US20180009895A1 (en) * 2015-01-26 2018-01-11 Cellectis Anti-cll1 specific single-chain chimeric antigen receptors (sccars) for cancer immunotherapy
WO2017172981A2 (en) * 2016-03-29 2017-10-05 University Of Southern California Chimeric antigen receptors targeting cancer
WO2018006882A1 (zh) * 2016-07-08 2018-01-11 科济生物医药(上海)有限公司 抗密蛋白18a2的抗体及其应用

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
POSEY, AD JR. ET AL.: "Engineered CAR T Cells Targeting the Cancer-Associated Tn-Glycoform of the Membrane Mucin MUC1 Control Adenocarcinoma", IMMUNITY, vol. 44, 21 June 2016 (2016-06-21), pages 1444 - 1454, XP055570946, DOI: 10.1016/j.immuni.2016.05.014 *
See also references of EP3947471A4 *
SIROY, A ET AL.: "MUC1 is Expressed at High Frequency in Early-Stage Basal-Like Triple Negative Breast Cancer", HUMAN PATHOLOGY, vol. 44, no. 10, October 2013 (2013-10-01), pages 2159 - 2166, XP028719927, DOI: 10.1016/j.humpath.2013.04.010 *
WEI, X ET AL.: "PSCA and MUC1 in non-small- cell lung cancer as targets of chimeric antigen receptor T cells", ONCOIMMUNOLOGY, vol. 6, no. 3, 15 March 2017 (2017-03-15), pages e1284722, XP055603482, Retrieved from the Internet <URL:http://dx.doi.org/10.1080/2162402X.2017.1284722> DOI: 10.1080/2162402X.2017.1284722 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12600971B2 (en) 2019-02-13 2026-04-14 Beam Therapeutics Inc. Modified immune cells having adenosine deaminase base editors for modifying a nucleobase in a target sequence
US12594301B2 (en) 2019-09-27 2026-04-07 Beam Therapeutics Inc. Compositions and methods for treatment of liquid cancers
US12576151B2 (en) 2020-09-25 2026-03-17 Beam Therapeutics Inc. Fratricide resistant modified immune cells and methods of using the same
WO2022229412A1 (en) * 2021-04-30 2022-11-03 Cellectis S.A. New anti-muc1 cars and gene edited immune cells for solid tumors cancer immunotherapy
EP4408894A4 (en) * 2021-09-29 2025-08-20 Chimera Bioengineering Inc Compositions and methods for anti-tnmuc1 gold car t-cells
WO2023250499A3 (en) * 2022-06-24 2024-01-25 Orgenesis Inc. Chimeric antigen receptor with modified hinge and transmembrane domain and uses thereof

Also Published As

Publication number Publication date
CN120944827A (zh) 2025-11-14
CN113661180A (zh) 2021-11-16
JP2025038057A (ja) 2025-03-18
EP3947471A4 (en) 2023-03-15
EP3947471A1 (en) 2022-02-09
JP2022527297A (ja) 2022-06-01
US20200306304A1 (en) 2020-10-01
US11090336B2 (en) 2021-08-17
TW202042824A (zh) 2020-12-01
JP7654557B2 (ja) 2025-04-01
US20210338733A1 (en) 2021-11-04
CN113661180B (zh) 2025-08-26

Similar Documents

Publication Publication Date Title
US11090336B2 (en) Tn-MUC1 chimeric antigen receptor (CAR) T cell therapy
US11992503B2 (en) Prostate-specific membrane antigen cars and methods of use thereof
EP3445787B1 (en) Compositions and methods for t-cell receptors reprogramming using fusion proteins
US20210060070A1 (en) Adoptive cell therapy and methods of dosing thereof
EP3941494A1 (en) Compositions and methods for tcr reprogramming using fusion proteins
US20220168407A1 (en) Use of tumor-independent antigens in immunotherapies
EP4125943A1 (en) In vivo use of modified cells of leukemic origin for enhancing the efficacy of adoptive cell therapy
US20240058447A1 (en) Use of fusion constructs for il-2 independent t cell therapy
WO2026085184A1 (en) Cd2 chimeric switch receptors and uses thereof for adoptive cell transfer immunotherapy
HK1261432B (en) Compositions and methods for t-cell receptors reprogramming using fusion proteins
HK1261432A1 (en) Compositions and methods for t-cell receptors reprogramming using fusion proteins
EA043737B1 (ru) Композиции и способы репрограммирования т-клеточных рецепторов с помощью гибридных белков

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20776961

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2021557613

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020776961

Country of ref document: EP

Effective date: 20211027

WWG Wipo information: grant in national office

Ref document number: 202080025068.9

Country of ref document: CN