WO2024091848A2 - Anti-ceacam6 car-t cells for the treatment of ceacam6+ tumors - Google Patents

Anti-ceacam6 car-t cells for the treatment of ceacam6+ tumors Download PDF

Info

Publication number
WO2024091848A2
WO2024091848A2 PCT/US2023/077423 US2023077423W WO2024091848A2 WO 2024091848 A2 WO2024091848 A2 WO 2024091848A2 US 2023077423 W US2023077423 W US 2023077423W WO 2024091848 A2 WO2024091848 A2 WO 2024091848A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
domain
seq
cell
amino acid
Prior art date
Application number
PCT/US2023/077423
Other languages
French (fr)
Other versions
WO2024091848A3 (en
Inventor
Avery D. Posey
Original Assignee
The Trustees Of The University Of Pennsylvania
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Trustees Of The University Of Pennsylvania filed Critical The Trustees Of The University Of Pennsylvania
Publication of WO2024091848A2 publication Critical patent/WO2024091848A2/en
Publication of WO2024091848A3 publication Critical patent/WO2024091848A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4611—T-cells, e.g. tumor infiltrating lymphocytes [TIL], lymphokine-activated killer cells [LAK] or regulatory T cells [Treg]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/463—Cellular immunotherapy characterised by recombinant expression
    • A61K39/4631—Chimeric Antigen Receptors [CAR]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464402—Receptors, cell surface antigens or cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/10—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterized by the structure of the chimeric antigen receptor [CAR]
    • A61K2239/11—Antigen recognition domain
    • A61K2239/13—Antibody-based
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/10—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterized by the structure of the chimeric antigen receptor [CAR]
    • A61K2239/22—Intracellular domain

Definitions

  • Chimeric antigen receptors are engineered transmembrane proteins that combine antigen-binding domains derived from antibodies or receptor ligands with intracellular T cell activation and co-activation domains. Upon encountering specific target antigens, CAR- expressing T cells, especially CD8+ T cells, activate and kill the target-expressing cells. Since the first FDA-approved CAR therapy was approved in 2017, this treatment strategy has demonstrated successful clinical use against an increasing number of cancers. However, existing CAR T cell based therapies against solid tumors has been found to be less effective than lymphomas and leukemias for a number of reasons including the selection of a target-antigen.
  • CEACAM6 is a is cell surface adhesion receptor that is highly expressed in pancreatic adenocarcinoma and is associated with poor prognosis. CEACAM6 is also an immune checkpoint molecule that limits T cell activation and blunts anti-tumor immune responses. Thus there is a need for CAR-T cells that can eliminate solid tumors by targeting antigens that contribute to tumor’s aggressiveness, growth, and immunosuppressive functions, as solid tumors represent the bulk of cancer-related deaths. The present invention addresses this need.
  • modified immune cells or precursors thereof comprising chimeric antigen receptors (CARs) specific for CEACAM6.
  • CARs chimeric antigen receptors
  • the present disclosure includes a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEA Cell Adhesion Molecule 6 (CEACAM6), a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain comprises: i. a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid set forth in SEQ ID NO: 3; and ii.
  • CAR chimeric antigen receptor
  • LCDRs light chain complementarity determining regions
  • LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4
  • LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5
  • LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6
  • the antigen binding domain comprises a single-chain variable fragment (scFv)
  • the intracellular signaling domain comprises a costimulatory domain selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain.
  • the antigen binding domain comprises a heavy chain variable region comprising an amino acid sequence having at least 95%-99% identity to the amino acid sequence set forth in SEQ ID NO: 7.
  • the antigen binding domain comprises a heavy chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 7.
  • the antigen binding domain comprises a heavy chain variable region consisting of an amino acid sequence set forth in SEQ ID NO: 7.
  • the antigen binding domain comprises a light chain variable region comprising an amino acid sequence having at least 95-99% identity to the amino acid sequence set forth in SEQ ID NO: 9.
  • the antigen binding domain comprises a light chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 9.
  • the antigen binding domain comprises a light chain variable region consisting of an amino acid set forth in SEQ ID NO: 9.
  • the current disclosure provides a chimeric antigen receptor (CAR) comprising an antigen binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7; and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9.
  • CAR chimeric antigen receptor
  • the current disclosure provides a chimeric antigen receptor (CAR) comprising an antigen binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain comprises any one of the amino acid sequences set forth in SEQ ID NOs: 18 and 20.
  • CAR chimeric antigen receptor
  • the transmembrane domain is selected from the group consisting of an artificial hydrophobic sequence, and a transmembrane domain of a type I transmembrane protein, an alpha, beta, or zeta chain of a T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, 0X40 (CD134), 4-1BB (CD137), and CD 154.
  • an artificial hydrophobic sequence and a transmembrane domain of a type I transmembrane protein, an alpha, beta, or zeta chain of a T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, 0X40 (CD134), 4-1BB (CD137), and CD 154.
  • the transmembrane domain comprises a transmembrane domain of CD8 comprising an amino acid sequence set forth in SEQ ID NO: 14.
  • the CAR of the current disclsoure further comprises a hinge domain.
  • the hinge domain is selected from the group consisting of an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial hinge domain, a hinge comprising an amino acid sequence of a CD8 hinge, or any combination thereof.
  • the hinge domain is a CD8 hinge comprising an amino acid sequence set forth in SEQ ID NO: 13.
  • the costimulatory domain is a CD2 costimulatory domain comprising an amino acid sequence set forth in SEQ ID NO: 15.
  • the intracellular signaling domain comprises an intracellular domain selected from the group consisting of cytoplasmic signaling domains of a human CD3 zeta chain (CD3Q, FcyRIII, FcsRI, a cytoplasmic tail of an Fc receptor, an immunoreceptor tyrosine-based activation motif (IT AM) bearing cytoplasmic receptor, TCR zeta, FcR gamma, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d, or a variant thereof.
  • cytoplasmic signaling domains of a human CD3 zeta chain CD3Q, FcyRIII, FcsRI, a cytoplasmic tail of an Fc receptor
  • IT AM immunoreceptor tyrosine-based activation motif bearing cytoplasmic receptor
  • TCR zeta FcR gamma
  • CD3 gamma CD3 delta
  • the intracellular signaling domain comprises an intracellular domain of CD3 ⁇ .
  • the CD3 ⁇ intracellular domain comprises an amino acid sequence set forth in SEQ ID NO: 16.
  • the current disclosure provides a chimeric antigen receptor (CAR) comprising: i. an antigen binding domain specific for CEACAM6 comprising: a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises and amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; ii.
  • HCDRs heavy chain variable region that comprises three heavy chain complementarity determining regions
  • HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1
  • HCDDR2 comprises an amino acid sequence set forth in S
  • a CD8 transmembrane domain iii. a costimulatory domain; and iv. a CD3( ⁇ intracellular signaling domain; wherein the costimulatory domain is selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain.
  • the current disclosure provides a chimeric antigen receptor (CAR) comprising: i. an antigen binding domain specific for CEACAM6 comprising: a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7; and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9; ii. a CD8 transmembrane domain; iii. a costimulatory domain; and iv.
  • CAR chimeric antigen receptor
  • CD3( ⁇ intracellular signaling domain wherein the costimulatory domain is selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain.
  • the current disclosure provides a chimeric antigen receptor (CAR) comprising any one of the amino acid sequences set forth in SEQ ID NOs: 21, 22, 23, 25, 27, 29, and 31.
  • the current disclosure provides a chimeric antigen receptor (CAR) consisting of any one of the amino acid sequences set forth in SEQ ID NOs: 21, 22, 23, 25, 27, 29, and 31.
  • CAR chimeric antigen receptor
  • the current disclosure provides a nucleic acid encoding the CAR of any one of claims 1-22.
  • the current disclosure provides a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEACAM6, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises: i. a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and ii.
  • CAR chimeric antigen receptor
  • LCDRs light chain complementarity determining regions
  • LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4
  • LCDR2 comprises and amino acid sequence set forth in SEQ ID NO: 5
  • LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6
  • the antigen binding domain comprises a single-chain variable fragment (scFv)
  • the intracellular domain comprises a costimulatory domain selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain.
  • the current disclosure provides a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEACAM6, a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain comprises: i. a heavy chain variable region comprising a nucleic acid sequence set forth in SEQ ID NO: 8; and ii. a light chain variable region comprising a nucleic acid sequence set forth in SEQ ID NO: 10.
  • CAR chimeric antigen receptor
  • the current disclosure provides a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEACAM6, a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain is encoded by any one of the nucleotide sequences set forth in SEQ ID NOs: 17 and 19.
  • CAR chimeric antigen receptor
  • the transmembrane domain comprises a transmembrane domain of CD8.
  • the CAR further comprises a hinge domain.
  • the hinge domain is a CD8 hinge.
  • the intracellular domain comprises a costimulatory signaling domain and an intracellular signaling domain.
  • the intracellular signaling domain comprises an intracellular domain of CD3q,
  • the present disclosure provides a vector comprising the nucleic acid of any one of the above aspects or embodiments or any aspect or embodiment disclosed herein.
  • the vector is an expression vector.
  • the present disclosure provides a cell comprising the CAR, the nucleic acid, and/or the vector of any one of the above aspects or embodiments or any aspect or embodiment disclosed herein.
  • the cell is selected from the group consisting of a T cell, a natural killer (NK) cell, a cytotoxic T lymphocyte (CTL), and a regulatory T cell.
  • the current disclosure provides a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of a modified immune cell comprising the chimeric antigen receptor (CAR) of any one of the above aspects or embodiments or any aspect or embodiment disclosed herein.
  • CAR chimeric antigen receptor
  • the modified immune cell is selected from the group consisting of a T cell, a natural killer (NK) cell, a cytotoxic T lymphocyte (CTL), and a regulatory T cell.
  • the cancer is associated with the over-expression of CEACAM6.
  • the cancer is selected from the group consisting of pancreatic cancer, lung cancer, stomach cancer, breast cancer, prostate cancer, and liver cancer.
  • FIG. 1 illustrates that mAblO9-CAR T cells are lytic and kill BxPC3 cells in vitro.
  • FIG. 2 illustrates that mAb!09-CAR T cells can control BxPC3 tumor growth in vivo as measured by tumor bioluminescence.
  • FIG. 3 illustrates that mAblO9-CAR T cells can control BxPC3 tumor growth in vivo as measured by tumor volume.
  • FIG. 4 illustrates that mAb!09-CAR T cells can control BxPC3 tumor growth in vivo as assessed by determining log cell kill from bioluminescence imaging.
  • FIG. 5 are a series of graphs illustrating that mice treated with mAblO9-CAR T cells demonstrate levels of circulating peripheral blood T cells indicative of anti-tumor immune responses.
  • FIG. 6 illustrates cytokine secretion by the indicated CAR T cells stimulated by ASPC1 or BXPC3 pancreatic cancer cells for 24 hours. Culture supernatant was collected and analyzed for expression of GM-CSF, IL-10, IL -2, TNFa, and other cytokines by Luminex.
  • FIG. 7 illustrates chronic antigen stimulation of the indicated anti-CEACAM6 CAR T cells by BXPC3 cells for 2x3 days per week.
  • FIG. 8 illustrates a study in which NSG mice were subcutaneously implanted with 1 x 10 6 BXPC3 pancreatic cancer cells and treated with 5 x 10 6 CAR T cells when tumor volume averaged 250mm 3 . Tumor volume was monitored weekly by caliper measurements. Thirty-one days after CAR T cell treatment, CD4 and CD8 T cells were measured in the peripheral blood of mice by flow cytometry. DETAILED DESCRIPTION
  • modified immune cells or precursors thereof comprising an exogenous (e.g., recombinant, transgenic or engineered) chimeric antigen receptor (CAR) specific for CEACAM6.
  • exogenous e.g., recombinant, transgenic or engineered
  • CAR chimeric antigen receptor
  • an element means one element or more than one element.
  • “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ⁇ 20% or ⁇ 10%, more preferably ⁇ 5%, even more preferably ⁇ 1%, and still more preferably ⁇ 0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
  • Activation refers to the state of a T cell that has been sufficiently stimulated to induce detectable cellular proliferation. Activation can also be associated with induced cytokine production, and detectable effector functions.
  • the term “activated T cells” refers to, among other things, T cells that are undergoing cell division.
  • to “alleviate” a disease means reducing the severity of one or more symptoms of the disease.
  • antigen as used herein is defined as a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both.
  • antibody production or the activation of specific immunologically-competent cells, or both.
  • any macromolecule including virtually all proteins or peptides, can serve as an antigen.
  • antigens can be derived from recombinant or genomic DNA.
  • any DNA which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an “antigen” as that term is used herein.
  • an antigen need not be encoded solely by a full-length nucleotide sequence of a gene. It is readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to elicit the desired immune response.
  • an antigen need not be encoded by a “gene” at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid.
  • autologous is meant to refer to any material derived from the same individual to which it is later to be re-introduced into the individual.
  • a “co-stimulatory molecule” refers to the cognate binding partner on a T cell that specifically binds with a co-stimulatory ligand, thereby mediating a co-stimulatory response by the T cell, such as, but not limited to, proliferation.
  • Co-stimulatory molecules include, but are not limited to an MHC class I molecule, BTLA and a Toll ligand receptor.
  • a “co-stimulatory signal”, as used herein, refers to a signal, which in combination with a primary signal, such as TCR/CD3 ligation, leads to T cell proliferation and/or upregulation or downregulation of key molecules.
  • a “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal’s health continues to deteriorate.
  • a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal’s state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal’s state of health.
  • downstreamregulation refers to the decrease or elimination of gene expression of one or more genes.
  • Effective amount or “therapeutically effective amount” are used interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result or provides a therapeutic or prophylactic benefit. Such results may include, but are not limited to an amount that when administered to a mammal, causes a detectable level of immune suppression or tolerance compared to the immune response detected in the absence of the composition of the invention. The immune response can be readily assessed by a plethora of art-recognized methods.
  • the amount of the composition administered herein varies and can be readily determined based on a number of factors such as the disease or condition being treated, the age and health and physical condition of the mammal being treated, the severity of the disease, the particular compound being administered, and the like.
  • Encoding refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom.
  • a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system.
  • Both the coding strand the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
  • endogenous refers to any material from or produced inside an organism, cell, tissue or system.
  • epitope as used herein is defined as a small chemical molecule on an antigen that can elicit an immune response, inducing B and/or T cell responses.
  • An antigen can have one or more epitopes. Most antigens have many epitopes; i.e., they are multivalent. In general, an epitope is roughly about 10 amino acids and/or sugars in size. Preferably, the epitope is about 4- 18 amino acids, more preferably about 5-16 amino acids, and even more most preferably 6-14 amino acids, more preferably about 7-12, and most preferably about 8-10 amino acids.
  • a peptide used in the present invention can be an epitope.
  • exogenous refers to any material introduced from or produced outside an organism, cell, tissue or system.
  • ex vivo refers to cells that have been removed from a living organism, (e.g., a human) and propagated outside the organism (e.g., in a culture dish, test tube, or bioreactor).
  • expression is defined as the transcription and/or translation of a particular nucleotide sequence driven by its promoter.
  • “Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed.
  • An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system.
  • Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., Sendai viruses, lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
  • Identity refers to the subunit sequence identity between two polymeric molecules particularly between two amino acid molecules, such as, between two polypeptide molecules. When two amino acid sequences have the same residues at the same positions; e.g., if a position in each of two polypeptide molecules is occupied by an arginine, then they are identical at that position. The identity or extent to which two amino acid sequences have the same residues at the same positions in an alignment is often expressed as a percentage.
  • the identity between two amino acid sequences is a direct function of the number of matching or identical positions; e.g., if half (e g., five positions in a polymer ten amino acids in length) of the positions in two sequences are identical, the two sequences are 50% identical; if 90% of the positions (e.g., 9 of 10), are matched or identical, the two amino acids sequences are 90% identical.
  • immune response is defined as a cellular response to an antigen that occurs when lymphocytes identify antigenic molecules as foreign and induce the formation of antibodies and/or activate lymphocytes to remove the antigen.
  • immunosuppressive is used herein to refer to reducing overall immune response.
  • “Insertion/deletion”, commonly abbreviated “indel,” is a type of genetic polymorphism in which a specific nucleotide sequence is present (insertion) or absent (deletion) in a genome.
  • isolated means altered or removed from the natural state.
  • a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.”
  • An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
  • a “lentivirus” as used herein refers to a genus of the Retroviridae family. Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell, so they are one of the most efficient methods of a gene delivery vector. HIV, SIV, and FIV are all examples of lentiviruses. Vectors derived from lentiviruses offer the means to achieve significant levels of gene transfer in vivo.
  • modified is meant a changed state or structure of a molecule or cell of the invention.
  • Molecules may be modified in many ways, including chemically, structurally, and functionally.
  • Cells may be modified through the introduction of nucleic acids.
  • moduleating mediating a detectable increase or decrease in the level of a response in a subject compared with the level of a response in the subject in the absence of a treatment or compound, and/or compared with the level of a response in an otherwise identical but untreated subject.
  • the term encompasses perturbing and/or affecting a native signal or response thereby mediating a beneficial therapeutic response in a subject, preferably, a human.
  • A refers to adenosine
  • C refers to cytosine
  • G refers to guanosine
  • T refers to thymidine
  • U refers to uridine.
  • oligonucleotide typically refers to short polynucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, C, G), this also includes an RNA sequence (i.e., A, U, C, G) in which “U” replaces “T.”
  • nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence.
  • the phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s).
  • parenteral administration of an immunogenic composition includes, e g., subcutaneous (s.c.), intravenous (i.v.), intramuscular (i.m.), or intrastemal injection, or infusion techniques.
  • nucleotide as used herein is defined as a chain of nucleotides.
  • nucleic acids are polymers of nucleotides.
  • nucleic acids and polynucleotides as used herein are interchangeable.
  • nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric “nucleotides.” The monomeric nucleotides can be hydrolyzed into nucleosides.
  • polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR, and the like, and by synthetic means.
  • recombinant means i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR, and the like, and by synthetic means.
  • peptide As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds.
  • a protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence.
  • Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds.
  • the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.
  • Polypeptides include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others.
  • the polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
  • an antibody which recognizes a specific antigen, but does not substantially recognize or bind other molecules in a sample.
  • an antibody that specifically binds to an antigen from one species may also bind to that antigen from one or more species. But, such cross-species reactivity does not itself alter the classification of an antibody as specific.
  • an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, such cross reactivity does not itself alter the classification of an antibody as specific.
  • the terms “specific binding” or “specifically binding,” can be used in reference to the interaction of an antibody, a protein, or a peptide with a second chemical species, to mean that the interaction is dependent upon the presence of a particular structure (e.g., an antigenic determinant or epitope) on the chemical species; for example, an antibody recognizes and binds to a specific protein structure rather than to proteins generally. If an antibody is specific for epitope “A”, the presence of a molecule containing epitope A (or free, unlabeled A), in a reaction containing labeled “A” and the antibody, will reduce the amount of labeled A bound to the antibody.
  • a particular structure e.g., an antigenic determinant or epitope
  • stimulation is meant a primary response induced by binding of a stimulatory molecule (e.g., a TCR/CD3 complex) with its cognate ligand thereby mediating a signal transduction event, such as, but not limited to, signal transduction via the TCR/CD3 complex.
  • a stimulatory molecule e.g., a TCR/CD3 complex
  • Stimulation can mediate altered expression of certain molecules, such as upregulation of interferon-gamma, and/or reorganization of cytoskeletal structures, and the like.
  • a “stimulatory molecule,” as the term is used herein, means a molecule on a T cell that specifically binds with a cognate stimulatory ligand present on an antigen presenting cell.
  • a “stimulatory ligand,” as used herein, means a ligand that when present on an antigen presenting cell (e.g., an aAPC, a dendritic cell, a B-cell, and the like) can specifically bind with a cognate binding partner (referred to herein as a “stimulatory molecule”) on a T cell, thereby mediating a primary response by the T cell, including, but not limited to, activation, initiation of an immune response, proliferation, and the like.
  • an antigen presenting cell e.g., an aAPC, a dendritic cell, a B-cell, and the like
  • a cognate binding partner referred to herein as a “stimulatory molecule”
  • Stimulatory ligands are well-known in the art and encompass, inter alia, an MHC Class I molecule loaded with a peptide, an anti-CD3 antibody, a superagonist anti-CD28 antibody, and a superagonist anti-CD2 antibody.
  • subject is intended to include living organisms in which an immune response can be elicited (e.g., mammals).
  • a “subject” or “patient,” as used therein, may be a human or non-human mammal.
  • Non-human mammals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals.
  • the subject is human.
  • target site refers to a nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule may specifically bind under conditions sufficient for binding to occur.
  • a target sequence refers to a genomic nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule may specifically bind under conditions sufficient for binding to occur.
  • T cell receptor or “TCR” refers to a complex of membrane proteins that participate in the activation of T cells in response to the presentation of antigen. The TCR is responsible for recognizing antigens bound to major histocompatibility complex molecules.
  • TCR is composed of a heterodimer of an alpha (a) and beta (0) chain, although in some cells the TCR consists of gamma and delta (y/8) chains.
  • TCRs may exist in alpha/beta and gamma/delta forms, which are structurally similar but have distinct anatomical locations and functions. Each chain is composed of two extracellular domains, a variable and constant domain.
  • the TCR may be modified on any cell comprising a TCR, including, for example, a helper T cell, a cytotoxic T cell, a memory T cell, regulatory T cell, natural killer T cell, and gamma delta T cell.
  • terapéutica as used herein means a treatment and/or prophylaxis.
  • a therapeutic effect is obtained by suppression, remission, or eradication of a disease state.
  • Transplant refers to a biocompatible lattice or a donor tissue, organ or cell, to be transplanted.
  • An example of a transplant may include but is not limited to skin cells or tissue, bone marrow, and solid organs such as heart, pancreas, kidney, lung and liver.
  • a transplant can also refer to any material that is to be administered to a host.
  • a transplant can refer to a nucleic acid or a protein.
  • transfected or “transformed” or “transduced” as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell.
  • a “transfected” or “transformed” or “transduced” cell is one which has been transfected, transformed or transduced with exogenous nucleic acid.
  • the cell includes the primary subject cell and its progeny.
  • a “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell.
  • vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses.
  • the term “vector” includes an autonomously replicating plasmid or a virus.
  • the term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like.
  • viral vectors include, but are not limited to, Sendai viral vectors, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like.
  • ranges throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
  • the present invention provides CEACAM6 specific chimeric antigen receptors (CARs; e.g., a CEACAM6 CAR) and modified cells comprising the same. Also provided are compositions and methods for utilizing CEACAM6 specific CARs to treat cancer.
  • a CEACAM6 CAR of the present invention may be suitable for treating both primary and metastatic solid tumors which express CEACAM6 such as lung cancer, stomach cancer, cervical cancer, prostate cancer, pancreatic cancer, breast cancer, ovarian cancer, liver cancer, and colon cancer, and the like.
  • CEACAM6 also called CEA cell adhesion molecule 6, carcinoembryonic antigen-related cell adhesion molecule 6, NCA-90, or CD66c, is a member of the carcinoembryonic antigen (CEA) family of genes whose members are generally glycosyl phosphatidyl inositol (GPI) anchored cell surface glycoproteins.
  • CEACAM6 cancers, especially solid cancers, overexpress CEACAM6, where it functions as an oncogene which contributes to tumor cell invasion and metastasis by acting as an inhibitor of cell differentiation and cell polarization, as well as mediating resistance to anoikis and chemotherapy.
  • Overexpression of CEACAM6 is common to many solid cancers, and is often used as a histological marker for certain carcinomas.
  • CEACAM6 is a highly glycosylated protein, and the pattern of glycosylation differs between normal and tumor tissues with tumor-expressed CEACAM6 being heavily N-glycosylated. Studies have demonstrated that the complex N-glycosylation of tumor-expressed CEACAM6 is critical for tumor cell invasion and metastasis mechanisms.
  • the unique glycosylation pattern of CEACAM6 by tumor cells versus normal tissue suggests the use of CEACAM6 as a tumor antigen, and antibodies have been raised that preferentially recognize the N-glycosylated tumor- expressed version of the gene.
  • the current invention includes CAR constructs which recognize N-glycosyl CEACAM6 and thus target tumor tissues which overexpress this gene.
  • the present invention provides compositions and methods for modified immune cells or precursor cells thereof, e.g., modified T cells, comprising a chimeric antigen receptor (CAR) having affinity for CEACAM6.
  • a subject CAR of the invention comprises an antigen binding domain (e.g., CEACAM6 binding domain), a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
  • a subject CAR of the invention may optionally comprise a hinge domain.
  • a subject CAR of the invention comprises an antigen binding domain (e.g., CEACAM6 binding domain), a hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
  • each of the domains of a subject CAR is separated by a linker.
  • the antigen binding domain may be operably linked to another domain of the CAR, such as the transmembrane domain, the costimulatoiy signaling domain or the intracellular signaling domain, each described elsewhere herein, for expression in the cell.
  • a first nucleic acid sequence encoding the antigen binding domain is operably linked to a second nucleic acid encoding a transmembrane domain, and further operably linked to a third a nucleic acid sequence encoding a costimulatory signaling domain.
  • the antigen binding domains described herein can be combined with any of the transmembrane domains, any of the costimulatory signaling domains, any of the intracellular signaling domains, or any of the other domains described herein that may be included in a CAR of the present invention.
  • the invention includes a chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6-specific antigen binding domain, optionally a hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
  • CAR chimeric antigen receptor
  • the invention includes a chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises three heavy chain complementarity determining regions, wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and wherein the VL domain comprises a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; a CD8 hinge domain; a CD8 transmembrane domain; a costimulatory signaling
  • CAR
  • the costimulatory signaling domain is a CD2 costimulatory signaling domain. In some embodiments, the costimulatory signaling domain is a 4-1BB costimulatory signaling domain. In some embodiments, the costimulatory signaling domain is a CD28 costimulatory signaling domain. In some embodiments, the costimulatory signaling domain is a CD27 costimulatory signaling domain. In some embodiments, the costimulatory signaling domain is an ICOS costimulatory signaling domain. In some embodiments, the costimulatory signaling domain is an 0X40 costimulatory signaling domain.
  • a genetically modified immune cell e.g., T cell or precursor cell thereof of the present invention comprises a chimeric antigen receptor (CAR) having affinity for CEACAM6.
  • a genetically modified immune cell e.g., T cell or precursor cell thereof of the present invention comprises a chimeric antigen receptor (CAR) having affinity for CEACAM6.
  • the genetically modified cell is a T cell.
  • a genetically modified T cell comprising a chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6 specific antigen binding domain, an optional hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
  • CAR chimeric antigen receptor
  • the invention includes a is a genetically modified T cell comprising chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises three heavy chain complementarity determining regions, wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and wherein the VL domain comprises a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; a CD8 hinge domain; a CD8 transme
  • CAR chimeric anti
  • the invention includes a genetically modified T cell comprising chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises three heavy chain complementarity determining regions, wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and wherein the VL domain comprises a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; a CD8 hinge domain; a CD8 transmembrane domain;
  • CAR chi
  • the invention includes a genetically modified T cell comprising chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises three heavy chain complementarity determining regions, wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and wherein the VL domain comprises a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; a CD8 hinge domain; a CD8 transmembrane domain;
  • CAR chi
  • the invention includes a genetically modified T cell comprising chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises three heavy chain complementarity determining regions, wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and wherein the VL domain comprises a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; a CD8 hinge domain; a CD8 transmembrane domain;
  • CAR chi
  • the invention includes a genetically modified T cell comprising chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises three heavy chain complementarity determining regions, wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and wherein the VL domain comprises a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; a CD8 hinge domain; a CD8 transmembrane domain; an chimeric antigen
  • the invention includes a genetically modified T cell comprising chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises three heavy chain complementarity determining regions, wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and wherein the VL domain comprises a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; a CD8 hinge domain; a CD8 transmembrane domain; an chimeric antigen
  • the CAR is encoded by a nucleic acid sequence comprising the nucleotide sequence of SEQ ID NOs: 24, 26, 28, 30, and 32. In certain embodiments of the invention, the CAR comprises the amino acid sequence of SEQ ID NOs: 21, 22, 23, 25, 27, 29, and 31.
  • a subject CAR may be a CAR having affinity for CEACAM6, comprising a CEACAM6 binding domain comprising the amino acid sequence set forth in SEQ ID NOs: 18 and 20.
  • a subject CEACAM6 CAR may further comprise a leader sequence set forth in SEQ ID NO: 11.
  • a subject CEACAM6 CAR may further comprise a hinge domain comprising an amino acid sequence set forth in SEQ ID NO: 13.
  • a subject CEACAM6 CAR may further comprise a transmembrane domain comprising an amino acid sequence set forth in SEQ ID NO: 14.
  • a subject CEACAM6 CAR may further comprise a costimulatory signaling domain comprising an amino acid sequence set forth in SEQ ID NO: 15.
  • a subject CEACAM6 CAR may further comprise an intracellular signaling domain comprising an amino acid sequence set forth in SEQ ID NO: 16.
  • a subject CEACAM6 CAR may comprise an amino acid sequence set forth in SEQ ID NOs: 21, 22, 23, 25, 27, 29, and 31.
  • the CEACAM6 CAR is encoded by a nucleic acid sequence comprising the nucleotide sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least
  • CEACAM6 CAR comprises an amino acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least
  • the antigen binding domain of a CAR is an extracellular region of the CAR for binding to a specific target antigen including proteins, carbohydrates, and glycolipids.
  • the CAR comprises affinity to a target antigen (e.g. a tumor associated antigen) on a target cell (e.g. a cancer cell).
  • the target antigen may include any type of protein, or epitope thereof, associated with the target cell.
  • the CAR may comprise affinity to a target antigen on a target cell that indicates a particular status of the target cell.
  • the CAR of the invention comprises an antigen binding domain that binds to CEACAM6.
  • the antigen binding domain of the invention comprises an antibody or fragment thereof, that binds to a CEACAM6 molecule.
  • the antigen binding domain is an scFv antibody that binds to CEACAM6.
  • the choice of antigen binding domain depends upon the type and number of antigens that are present on the surface of a target cell. For example, the antigen binding domain may be chosen to recognize an antigen that acts as a cell surface marker on a target cell associated with a particular status of the target cell.
  • a CAR of the present disclosure having affinity for a specific target antigen on a target cell may comprise a target-specific binding domain.
  • the target-specific binding domain is a human target-specific binding domain, e.g., the targetspecific binding domain is of human origin.
  • a CAR of the present disclosure having affinity for CEACAM6 on a target cell may comprise a CEACAM6 binding domain.
  • the CEACAM6 binding domain is a murine CEACAM6 binding domain, e.g., the CEACAM6 binding domain is of murine origin.
  • the CEACAM6 binding domain is a humanized CEACAM6 binding domain.
  • the CEACAM6 binding domain is a human CEACAM6 binding domain, e g., the CEACAM6 binding domain is of human origin.
  • the CEACAM6 binding domain is derived from the CT 109 or mAblO9 antibody disclosed in US Patent Application No. 16/489,038, the disclosure of which is incorporated herein by reference in its entirety.
  • a CAR of the present disclosure comprises a CEACAM6 binding domain derived from the variable regions of the CT 109 or mAblO9 antibody disclosed in US Patent Application No. 16/489,038.
  • the antigen binding domain can include any domain that binds to the antigen and may include, but is not limited to, a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a non-human antibody, and any fragment thereof.
  • the antigen binding domain portion comprises a mammalian antibody or a fragment thereof.
  • the antigen binding domain of the CAR is selected from the group consisting of an anti- CEACAM6 antibody or a fragment thereof.
  • the antigen binding domain is selected from the group consisting of an antibody, an antigen binding fragment (Fab), and a single-chain variable fragment (scFv).
  • a CEACAM6 binding domain of the present invention is selected from the group consisting of a CEACAM6 -specific antibody, a CEACAM6-specific Fab, and a CEACAM6-specific scFv.
  • a CEACAM6 binding domain is a CEACAM6- specific antibody.
  • a CEACAM6 binding domain is a CEACAM6-specific Fab.
  • a CEACAM6 binding domain is a CEACAM6-specific scFv.
  • single-chain variable fragment is a fusion protein of the variable regions of the heavy (VH) and light chains (VL) of an immunoglobulin (e.g., mouse or human) covalently linked to form a VH:VL heterodimer.
  • the heavy (VH) and light chains (VL) are either joined directly or joined by a peptide-encoding linker or spacer, which connects the N-terminus of the VH with the C-terminus of the VL, or the C-terminus of the VH with the N-terminus of the VL.
  • linker and “spacer” are used interchangeably herein.
  • the antigen binding domain (e g., CEACAM6 binding domain) comprises an scFv having the configuration from N-terminus to C-terminus, VH - linker - VL. In some embodiments, the antigen binding domain (e.g., CEACAM6 binding domain) comprises an scFv having the configuration from N-terminus to C-terminus, VL - linker - VH. Those of skill in the art would be able to select the appropriate configuration for use in the present invention.
  • the linker is typically rich in glycine for flexibility, as well as serine or threonine for solubility.
  • the linker can link the heavy chain variable region and the light chain variable region of the extracellular antigen-binding domain.
  • Non-limiting examples of linkers are disclosed in Shen et al., Anal. Chem. 80(6): 1910-1917 (2008) and WO 2014/087010, the contents of which are hereby incorporated by reference in their entireties.
  • GS linker sequences include, without limitation, glycine serine (GS) linkers such as (GS)n, (GSGGS)n (SEQ ID NO: 33), (GGGS)n (SEQ ID NO: 34), and (GGGGS)n(SEQ ID NO: 35), where n represents an integer of at least 1 .
  • GS glycine serine
  • Exemplary linker sequences can comprise amino acid sequences including, without limitation, GGSG (SEQ ID NO: 36), GGSGG (SEQ ID NO: 37), GSGSG (SEQ ID NO: 38), GSGGG (SEQ ID NO: 39), GGGSG (SEQ ID NO: 40), GSSSG (SEQ ID NO: 41), GGGGS (SEQ ID NO: 42), GGGGSGGGGSGGGGS (SEQ ID NO: 43) and the like.
  • GGSG SEQ ID NO: 36
  • GGSGG SEQ ID NO: 37
  • GSGSG SEQ ID NO: 38
  • GSGGG SEQ ID NO: 39
  • GGGSG SEQ ID NO: 40
  • GSSSG SEQ ID NO: 41
  • GGGGS SEQ ID NO: 42
  • GGGGSGGGGSGGGGS SEQ ID NO: 43
  • an antigen binding domain e.g., CEACAM6 binding domain
  • a heavy chain variable region VH
  • VL light chain variable region
  • the linker sequence having the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 44), which may be encoded by a nucleic acid sequence comprising the nucleotide sequence ggtggcggtggctcgggcggtggtgggtcgggtggcggcggatct (SEQ ID NO: 45).
  • Single chain Fv polypeptide antibodies can be expressed from a nucleic acid comprising VH- and VL-encoding sequences as described by Huston, et al. (Proc. Nat. Acad. Sci. USA, 85:5879-5883, 1988). See, also, U.S. Patent Nos. 5,091,513, 5,132,405 and 4,956,778; and U.S. Patent Publication Nos. 20050196754 and 20050196754.
  • Antagonistic scFvs having inhibitory activity have been described (see, e.g., Zhao et al., Hybridoma (Larchmt) 2008 27(6):455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 August 12; Shieh et al., JImunol 2009 183(4):2277-85; Giomarelli et al., Thromb Haemost 2007 97(6):955-63; Fife eta., J Clinlnvst 2006 116(8):2252-61 ; Brocks et al., Immunotechnolog' y 1997 3(3): 173-84; Moosmayer et al., Ther Immunol 1995 2(10:31-40).
  • Fab refers to a fragment of an antibody structure that binds to an antigen but is monovalent and does not have a Fc portion, for example, an antibody digested by the enzyme papain yields two Fab fragments and an Fc fragment (e.g., a heavy (H) chain constant region; Fc region that does not bind to an antigen).
  • an antibody digested by the enzyme papain yields two Fab fragments and an Fc fragment (e.g., a heavy (H) chain constant region; Fc region that does not bind to an antigen).
  • F(ab')2 refers to an antibody fragment generated by pepsin digestion of whole IgG antibodies, wherein this fragment has two antigen binding (ab’) (bivalent) regions, wherein each (ah') region comprises two separate amino acid chains, a part of a H chain and a light (L) chain linked by an S — S bond for binding an antigen and where the remaining H chain portions are linked together.
  • a “F(ab')2” fragment can be split into two individual Fab' fragments.
  • the antigen binding domain may be derived from the same species in which the CAR will ultimately be used.
  • the antigen binding domain of the CAR may comprise a human antibody as described elsewhere herein, or a fragment thereof.
  • the CEACAM6 binding domain comprises a light chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 9.
  • the light chain variable region of the CEACAM6 binding domain comprises three light chain complementaritydetermining regions (CDRs).
  • CDRs complementarity-determining regions
  • a “complementarity-determining region” or “CDR” refers to a region of the variable chain of an antigen binding molecule that binds to a specific antigen.
  • a CEACAM6 binding domain may comprise a light chain variable region that comprises an LCDR1 comprising an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprising an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprising an amino acid sequence set forth in SEQ ID NO: 6.
  • the CEACAM6 binding domain comprises a heavy chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 7.
  • a CEACAM6 binding domain may comprise a heavy chain variable region that comprises a CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 3.
  • the CEACAM6 binding domain comprises an amino acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 18 and 20.
  • the CEACAM6 binding domain is encoded by a nucleic acid sequence comprising the nucleotide sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the nucleotide sequence set forth in SEQ ID NOs: 17 and 19.
  • the antigen binding domain may be operably linked to another domain of the CAR, such as the transmembrane domain or the costimulatory signaling domain, both described elsewhere herein.
  • a nucleic acid encoding the antigen binding domain is operably linked to a nucleic acid encoding a transmembrane domain and a nucleic acid encoding a costimulatory signaling domain.
  • antigen binding domains described herein such as the antibody or fragment thereof that binds to CEACAM6 can be combined with any of the transmembrane domains described herein, any of the intracellular domains or cytoplasmic domains described herein, or any of the other domains described herein that may be included in the CAR.
  • the CAR of the present invention can be designed to comprise a transmembrane domain that connects the antigen binding domain of the CAR to the intracellular domain.
  • the transmembrane domain of a subject CAR is a region that is capable of spanning the plasma membrane of a cell (e.g., an immune cell or precursor thereof).
  • the transmembrane domain is for insertion into a cell membrane, e.g., a eukaryotic cell membrane.
  • the transmembrane domain is interposed between the antigen binding domain and the intracellular domain of a CAR.
  • the transmembrane domain is naturally associated with one or more of the domains in the CAR.
  • the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.
  • the transmembrane domain may be derived either from a natural or from a synthetic source. Where the source is natural, the domain may be derived from any membrane-bound or transmembrane protein, e.g., a Type I transmembrane protein. Where the source is synthetic, the transmembrane domain may be any artificial sequence that facilitates insertion of the CAR into a cell membrane, e.g., an artificial hydrophobic sequence.
  • transmembrane regions of particular use in this invention include, without limitation, transmembrane domains derived from (i.e., comprise at least the transmembrane region(s) of) the alpha, beta or zeta chain of the T-cell receptor, CD28, CD2, CD3 epsilon, CD45, CD4, CD5, CD7, CD8, CD9, CD 16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9.
  • TLR1 Toll-like receptor 1
  • the transmembrane domain may be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine.
  • a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.
  • transmembrane domains described herein can be combined with any of the antigen binding domains described herein, any of the costimulatory signaling domains described herein, any of the intracellular signaling domains described herein, or any of the other domains described herein that may be included in a subject CAR.
  • the transmembrane domain further comprises a hinge region.
  • a subject CAR of the present invention may also include a hinge region.
  • the hinge region of the CAR is a hydrophilic region which is located between the antigen binding domain and the transmembrane domain. In some embodiments, this domain facilitates proper protein folding for the CAR.
  • the hinge region is an optional component for the CAR.
  • the hinge region may include a domain selected from Fc fragments of antibodies, hinge regions of antibodies, CH2 regions of antibodies, CH3 regions of antibodies, artificial hinge sequences or combinations thereof.
  • hinge regions include, without limitation, a CD8a hinge, artificial hinges made of polypeptides which may be as small as, three glycines (Gly), as well as CHI and CH3 domains of IgGs (such as human IgG4).
  • a subject CAR of the present disclosure includes a hinge region that connects the antigen binding domain with the transmembrane domain, which, in turn, connects to the intracellular domain.
  • the hinge region is preferably capable of supporting the antigen binding domain to recognize and bind to the target antigen on the target cells (see, e.g., Hudecek et al., Cancer Immunol. Res. (2015) 3(2): 125-135).
  • the hinge region is a flexible domain, thus allowing the antigen binding domain to have a structure to optimally recognize the specific structure and density of the target antigens on a cell such as tumor cell. The flexibility of the hinge region permits the hinge region to adopt many different conformations.
  • the hinge region is an immunoglobulin heavy chain hinge region. In some embodiments, the hinge region is a hinge region polypeptide derived from a receptor (e.g., a CD8-derived hinge region).
  • the hinge region can have a length of from about 4 amino acids to about 50 amino acids, e.g., from about 4 amino acids to about 10 amino acids, from about 10 amino acids to about 15 amino acids, from about 15 amino acids to about 20 amino acids, from about 20 amino acids to about 25 amino acids, from about 25 amino acids to about 30 amino acids, from about 30 amino acids to about 40 amino acids, or from about 40 amino acids to about 50 amino acids.
  • Suitable hinge regions can be readily selected and can be of any of a number of suitable lengths, such as from 1 amino acid (e.g., Gly) to 20 amino acids, from 2 amino acids to 15 amino acids, from 3 amino acids to 12 amino acids, including 4 amino acids to 10 amino acids, 5 amino acids to 9 amino acids, 6 amino acids to 8 amino acids, or 7 amino acids to 8 amino acids, and can be 1, 2, 3, 4, 5, 6, or 7 amino acids.
  • 1 amino acid e.g., Gly
  • suitable lengths such as from 1 amino acid (e.g., Gly) to 20 amino acids, from 2 amino acids to 15 amino acids, from 3 amino acids to 12 amino acids, including 4 amino acids to 10 amino acids, 5 amino acids to 9 amino acids, 6 amino acids to 8 amino acids, or 7 amino acids to 8 amino acids, and can be 1, 2, 3, 4, 5, 6, or 7 amino acids.
  • hinge regions include glycine polymers (G)n, glycine-serine polymers (including, for example, (GS) n , (GSGGS)n (SEQ ID NO: 33) and (GGGS)n (SEQ ID NO: 34), where n is an integer of at least one), glycine-alanine polymers, alanine-serine polymers, and other flexible linkers known in the art.
  • Glycine and glycine-serine polymers can be used; both Gly and Ser are relatively unstructured, and therefore can serve as a neutral tether between components.
  • Glycine polymers can be used; glycine accesses significantly more phi-psi space than even alanine, and is much less restricted than residues with longer side chains (see, e.g., Scheraga, Rev. Computational. Chem. (1992) 2: 73-142).
  • Exemplary hinge regions can comprise amino acid sequences including, but not limited to, GGSG (SEQ ID NO: 36), GGSGG (SEQ ID NO: 37), GSGSG (SEQ ID NO: 38), GSGGG (SEQ ID NO: 39), GGGSG (SEQ ID NO: 40), GSSSG (SEQ ID NO: 41), and the like.
  • the hinge region is an immunoglobulin heavy chain hinge region.
  • Immunoglobulin hinge region amino acid sequences are known in the art; see, e.g., Tan et al., Proc. Natl. Acad. Sci. USA (1990) 87(1): 162-166; and Huck et al., Nucleic Acids Res. (1986) 14(4): 1779-1789.
  • an immunoglobulin hinge region can include one of the following amino acid sequences: DKTHT (SEQ ID NO: 46); CPPC (SEQ ID NO: 47); CPEPKSCDTPPPCPR (SEQ ID NO: 48) (see, e g., Glaser et al., J. Biol. Chem.
  • ELKTPLGDTTHT SEQ ID NO: 49
  • KSCDKTHTCP SEQ ID NO: 50
  • KCCVDCP SEQ ID NO: 51
  • KYGPPCP SEQ ID NO: 52
  • EPKSCDKTHTCPPCP SEQ ID NO: 53
  • ELKTPLGDTTHTCPRCP SEQ ID NO: 55
  • SPNMVPHAHHAQ SEQ ID NO: 56
  • the hinge region can comprise an amino acid sequence of a human IgGl, IgG2, IgG3, or IgG4, hinge region.
  • the hinge region can include one or more amino acid substitutions and/or insertions and/or deletions compared to a wild-type (naturally-occurring) hinge region.
  • His229 of human IgGl hinge can be substituted with Tyr, so that the hinge region comprises the sequence EPKSCDKTYTCPPCP (SEQ ID NO: 53); see, e.g., Yan et al., J. Biol. Chem. (2012) 287: 5891-5897.
  • the hinge region can comprise an amino acid sequence derived from human CD8, or a variant thereof.
  • the transmembrane domain comprises a CD8a transmembrane domain.
  • a subject CAR comprises a CD8a transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO: 14.
  • a subject CAR comprises a CD8a hinge domain and a CD8a transmembrane domain.
  • the CD8a hinge domain comprises the amino acid sequence set forth in SEQ ID NO: 13.
  • a transmembrane domain or hinge domain comprises an amino acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least
  • the transmembrane domain may be combined with any hinge domain and/or may comprise one or more transmembrane domains described herein.
  • the transmembrane domains described herein such as a transmembrane region of alpha, beta or zeta chain of the T-cell receptor, CD28, CD2, CD3 epsilon, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9, can be combined with any of the antigen binding domains described herein, any of the costimulatory signaling domains or intracellular domains or cytoplasmic domains described herein, or any of the other domains described herein that may be included in
  • the transmembrane domain may be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine.
  • a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.
  • a subject CAR may further comprise, between the extracellular domain and the transmembrane domain of the CAR, or between the intracellular domain and the transmembrane domain of the CAR, a spacer domain.
  • spacer domain generally means any oligo- or polypeptide that functions to link the transmembrane domain to, either the extracellular domain or, the intracellular domain in the polypeptide chain.
  • a spacer domain may comprise up to 300 amino acids, e.g., 10 to 100 amino acids, or 25 to 50 amino acids.
  • the spacer domain may be a short oligo- or polypeptide linker, e.g., between 2 and 10 amino acids in length.
  • glycine-serine doublet provides a particularly suitable linker between the transmembrane domain and the intracellular signaling domain of the subject CAR.
  • a subject CAR of the present disclosure may comprise any of the transmembrane domains, hinge domains, or spacer domains described herein.
  • a subject CAR of the present invention also includes an intracellular domain.
  • the intracellular domain of the CAR is responsible for activation of at least one of the effector functions of the cell in which the CAR is expressed (e.g., immune cell).
  • the intracellular domain transduces the effector function signal and directs the cell (e.g., immune cell) to perform its specialized function, e.g., harming and/or destroying a target cell.
  • the intracellular domain or otherwise the cytoplasmic domain of the CAR is responsible for activation of the cell in which the CAR is expressed.
  • an intracellular domain for use in the invention examples include, but are not limited to, the cytoplasmic portion of a surface receptor, co- stimulatory molecule, and any molecule that acts in concert to initiate signal transduction in the T cell, as well as any derivative or variant of these elements and any synthetic sequence that has the same functional capability.
  • the intracellular domain comprises a costimulatory signaling domain. In certain embodiments, the intracellular domain comprises an intracellular signaling domain. In certain embodiments, the intracellular domain comprises a costimulatory signaling domain and an intracellular signaling domain. In certain embodiments, the intracellular domain comprises CD2 and CD3 zeta. In certain embodiments, the intracellular domain comprises 4- 1BB and CD3 zeta. In certain embodiments, the intracellular domain comprises CD28 and CD3 zeta. In certain embodiments, the intracellular domain comprises CD27 and CD3 zeta. In certain embodiments, the intracellular domain comprises ICOS and CD3 zeta. In certain embodiments, the intracellular domain comprises 0X40 and CD3 zeta.
  • the costimulatory signaling domain comprises a CD2 signaling domain. In certain embodiments, the costimulatory signaling domain comprises a 4-1BB signaling domain. In certain embodiments, the costimulatory signaling domain comprises a CD27 signaling domain. In certain embodiments, the costimulatory signaling domain comprises a CD28 signaling domain. In certain embodiments, the costimulatory signaling domain comprises an ICOS signaling domain. In certain embodiments, the costimulatory signaling domain comprises an 0X40 signaling domain. In certain embodiments, the intracellular signaling domain comprises a CD3 zeta signaling domain.
  • the intracellular domain of the CAR comprises a costimulatory signaling domain which includes any portion of one or more co-stimulatory molecules, such as at least one signaling domain from CD2, CD3, CD8, CD27, CD28, 0X40, ICOS, 4-1BB, PD-1, any derivative or variant thereof, any synthetic sequence thereof that has the same functional capability, and any combination thereof.
  • a costimulatory signaling domain which includes any portion of one or more co-stimulatory molecules, such as at least one signaling domain from CD2, CD3, CD8, CD27, CD28, 0X40, ICOS, 4-1BB, PD-1, any derivative or variant thereof, any synthetic sequence thereof that has the same functional capability, and any combination thereof.
  • intracellular signaling domain examples include, without limitation, the chain of the T cell receptor complex or any of its homologs, e.g., q chain, FcsRTy and chains, MB 1 (Iga) chain, B29 (Ig) chain, etc., human CD3 zeta chain, CD3 polypeptides (A, 8 and a), syk family tyrosine kinases (Syk, ZAP 70, etc.), src family tyrosine kinases (Lek, Fyn, Lyn, etc.), and other molecules involved in T cell transduction, such as CD2, CD5 and CD28.
  • the chain of the T cell receptor complex or any of its homologs e.g., q chain, FcsRTy and chains, MB 1 (Iga) chain, B29 (Ig) chain, etc.
  • human CD3 zeta chain CD3 polypeptides (A, 8 and a)
  • CD3 polypeptides A, 8 and
  • the intracellular signaling domain may be human CD3 zeta chain, FcyRIII, FcsRI, cytoplasmic tails of Fc receptors, an immunoreceptor tyrosine-based activation motif (IT AM) bearing cytoplasmic receptors, and combinations thereof.
  • IT AM immunoreceptor tyrosine-based activation motif
  • intracellular domain examples include a fragment or domain from one or more molecules or receptors including, but are not limited to, TCR, CD3 zeta, CD3 gamma, CD3 delta, CD3 epsilon, CD86, common FcR gamma, FcR beta (Fc Epsilon Rib), CD79a, CD79b, Fc gamma R1 la, DAP10, DAP12, T cell receptor (TCR), CD8, CD27, CD28, 4-1BB (CD137), 0X9, 0X40, CD30, CD40, PD-1, ICOS, a KIR family protein, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83, CD5, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD127, CD160, CD19,
  • intracellular domains include, without limitation, intracellular signaling domains of several types of various other immune signaling receptors, including, but not limited to, first, second, and third generation T cell signaling proteins including CD3, B7 family costimulatory, and Tumor Necrosis Factor Receptor (TNFR) superfamily receptors (see, e.g., Park and Brentjens, J. Clin. Oncol. (2015) 33(6): 651-653). Additionally, intracellular signaling domains may include signaling domains used by NK and NKT cells (see, e.g., Hermanson and Kaufman, Front. Immunol.
  • NKp30 B7-H6
  • DAP 12 see, e.g., Topfer et al., J. Immunol. (2015) 194(7): 3201-3212
  • NKG2D NKp44
  • NKp46 NKp46
  • DAP10 CD3z
  • Intracellular signaling domains suitable for use in a subject CAR of the present invention include any desired signaling domain that provides a distinct and detectable signal (e.g., increased production of one or more cytokines by the cell; change in transcription of a target gene; change in activity of a protein; change in cell behavior, e.g., cell death; cellular proliferation; cellular differentiation; cell survival; modulation of cellular signaling responses; etc.) in response to activation of the CAR (i.e., activated by antigen and dimerizing agent).
  • the intracellular signaling domain includes at least one (e.g., one, two, three, four, five, six, etc.) IT AM motifs as described below.
  • the intracellular signaling domain includes DAP10/CD28 type signaling chains.
  • the intracellular signaling domain is not covalently attached to the membrane bound CAR, but is instead diffused in the cytoplasm.
  • Intracellular signaling domains suitable for use in a subject CAR of the present invention include immunoreceptor tyrosine-based activation motif (ITAM)-containing intracellular signaling polypeptides.
  • ITAM immunoreceptor tyrosine-based activation motif
  • an IT AM motif is repeated twice in an intracellular signaling domain, where the first and second instances of the ITAM motif are separated from one another by 6 to 8 amino acids.
  • the intracellular signaling domain of a subject CAR comprises 3 ITAM motifs.
  • intracellular signaling domains includes the signaling domains of human immunoglobulin receptors that contain immunoreceptor tyrosine based activation motifs (ITAMs) such as, but not limited to, Fc gamma RI, Fc gamma RIIA, Fc gamma RIIC, Fc gamma RIIIA, FcRL5 (see, e.g., Gillis et al., Front. (2014) Immunol. 5:254).
  • ITAMs immunoreceptor tyrosine based activation motifs
  • a suitable intracellular signaling domain can be an ITAM motif-containing portion that is derived from a polypeptide that contains an ITAM motif.
  • a suitable intracellular signaling domain can be an ITAM motif-containing domain from any ITAM motif-containing protein.
  • a suitable intracellular signaling domain need not contain the entire sequence of the entire protein from which it is derived.
  • ITAM motif-containing polypeptides include, but are not limited to: DAP12, FCER1G (Fc epsilon receptor I gamma chain), CD3D (CD3 delta), CD3E (CD3 epsilon), CD3G (CD3 gamma), CD3Z (CD3 zeta), and CD79A (antigen receptor complex-associated protein alpha chain).
  • the intracellular signaling domain is derived from DAP12 (also known as TYROBP; TYRO protein tyrosine kinase binding protein; KARAP; PLOSL; DNAX- activation protein 12; KAR-associated protein; TYRO protein tyrosine kinase-binding protein; killer activating receptor associated protein; killer-activating receptor-associated protein; etc.).
  • DAP12 also known as TYROBP; TYRO protein tyrosine kinase binding protein; KARAP; PLOSL; DNAX- activation protein 12; KAR-associated protein; TYRO protein tyrosine kinase-binding protein; killer activating receptor associated protein; killer-activating receptor-associated protein; etc.
  • the intracellular signaling domain is derived from FCER1G (also known as FCRG; Fc epsilon receptor I gamma chain; Fc receptor gamma-chain; fc-epsilon Rl-gamma; fcR gamma; fceRl gamma; high affinity immunoglobulin epsilon receptor subunit gamma; immunoglobulin E receptor, high affinity, gamma chain; etc.).
  • FCER1G also known as FCRG
  • Fc epsilon receptor I gamma chain Fc receptor gamma-chain
  • fcR gamma fcR gamma
  • fceRl gamma high affinity immunoglobulin epsilon receptor subunit gamma
  • immunoglobulin E receptor high affinity, gamma chain; etc.
  • the intracellular signaling domain is derived from T-cell surface glycoprotein CD3 delta chain (also known as CD3D; CD3-DELTA; T3D; CD3 antigen, delta subunit; CD3 delta; CD3d antigen, delta polypeptide (TiT3 complex); OKT3, delta chain; T-cell receptor T3 delta chain; T-cell surface glycoprotein CD3 delta chain; etc.).
  • T-cell surface glycoprotein CD3 delta chain also known as CD3D; CD3-DELTA; T3D; CD3 antigen, delta subunit; CD3 delta; CD3d antigen, delta polypeptide (TiT3 complex); OKT3, delta chain; T-cell receptor T3 delta chain; T-cell surface glycoprotein CD3 delta chain; etc.
  • the intracellular signaling domain is derived from T-cell surface glycoprotein CD3 epsilon chain (also known as CD3e, T- cell surface antigen T3/Leu-4 epsilon chain, T-cell surface glycoprotein CD3 epsilon chain, AI504783, CD3, CD3epsilon, T3e, etc.).
  • the intracellular signaling domain is derived from T-cell surface glycoprotein CD3 gamma chain (also known as CD3G, T-cell receptor T3 gamma chain, CD3-GAMMA, T3G, gamma polypeptide (TiT3 complex), etc.).
  • the intracellular signaling domain is derived from T-cell surface glycoprotein CD3 zeta chain (also known as CD3Z, T-cell receptor T3 zeta chain, CD247, CD3-ZETA, CD3H, CD3Q, T3Z, TCRZ, etc ).
  • the intracellular signaling domain is derived from CD79A (also known as B-cell antigen receptor complex-associated protein alpha chain; CD79a antigen (immunoglobulin-associated alpha); MB-1 membrane glycoprotein; Ig- alpha; membrane-bound immunoglobulin-associated protein; surface IgM-associated protein; etc.).
  • an intracellular signaling domain suitable for use in a subject CAR of the present disclosure includes a DAP10/CD28 type signaling chain. In one embodiment, an intracellular signaling domain suitable for use in a subject CAR of the present disclosure includes a ZAP70 polypeptide. In some embodiments, the intracellular signaling domain includes a cytoplasmic signaling domain of TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, or CD66d. In one embodiment, the intracellular signaling domain in the CAR includes a cytoplasmic signaling domain of human CD3 zeta.
  • intracellular signaling domain While usually the entire intracellular signaling domain can be employed, in many cases it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such truncated portion may be used in place of the intact chain as long as it transduces the effector function signal.
  • the intracellular signaling domain includes any truncated portion of the intracellular signaling domain sufficient to transduce the effector function signal.
  • the intracellular signaling domains described herein can be combined with any of the costimulatory signaling domains described herein, any of the antigen binding domains described herein, any of the transmembrane domains described herein, or any of the other domains described herein that may be included in the CAR.
  • the intracellular domain of a subject CAR comprises a CD2 costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO: 15.
  • the intracellular domain of a subject CAR comprises a CD3 zeta intracellular signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 16.
  • the intracellular domain comprises an amino acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 15 and 16.
  • the intracellular domain of a subject CAR comprises a CD2 costimulatory domain and a CD3 zeta intracellular signaling domain. In another exemplary embodiment, the intracellular domain of a subject CAR comprises a 4- IBB costimulatory domain and a CD3 zeta intracellular signaling domain. In another exemplary embodiment, the intracellular domain of a subject CAR comprises a CD27 costimulatory domain and a CD3 zeta intracellular signaling domain. In another exemplary embodiment, the intracellular domain of a subject CAR comprises a CD28 costimulatory domain and a CD3 zeta intracellular signaling domain.
  • the intracellular domain of a subject CAR comprises an ICOS costimulatory domain and a CD3 zeta intracellular signaling domain. In another exemplary embodiment, the intracellular domain of a subject CAR comprises an 0X40 costimulatory domain and a CD3 zeta intracellular signaling domain.
  • the present invention provides a modified immune cell or precursor cell thereof (e.g., a modified T cell, a modified NK cell, a modified NKT cell), comprising a subject CAR. Accordingly, such modified cells possess the specificity directed by the CAR that is expressed therein.
  • a modified cell of the present invention comprising a CEACAM6 CAR possesses specificity for CEACAM6 on a target cell.
  • Any modified cell comprising a CAR comprising any antigen binding domain, any hinge, any transmembrane domain, any intracellular costimulatory domain, and any intracellular signaling domain described herein is envisioned, and can readily be understood and made by a person of skill in the art in view of the disclosure herein.
  • the modified cell is an immune cell or precursor cell thereof. In an exemplary embodiment, the modified cell is a T cell. In an exemplary embodiment, the modified cell is an autologous cell. In an exemplary embodiment, the modified cell is an autologous immune cell or precursor cell thereof. In an exemplary embodiment, the modified cell is an autologous T cell.
  • the present invention provides a nucleic acid encoding a CAR having affinity for CEACAM6.
  • a subject CAR comprises an antigen binding domain (e.g., CEACAM6 binding domain), a transmembrane domain, and an intracellular domain.
  • the present invention provides a nucleic acid encoding an antigen binding domain (e.g., CEACAM6 binding domain), a transmembrane domain, and an intracellular domain of a subject CAR.
  • the antigen binding domain of the CEACAM6 CAR of the present invention is encoded by any one of the nucleotide sequences set forth in SEQ ID NOs: 17 and 19.
  • the CEACAM6 CAR of the present invention is encoded by any one of the nucleotide sequences set forth in SEQ ID NOs: 24, 26, 28, 30, and 32.
  • a nucleic acid of the present disclosure may be operably linked to a transcriptional control element, e.g., a promoter, and enhancer, etc. Suitable promoter and enhancer elements are known to those of skill in the art.
  • suitable promoters include, but are not limited to, lad, lacZ, T3, T7, gpt, lambda P and trc.
  • suitable promoters include, but are not limited to, light and/or heavy chain immunoglobulin gene promoter and enhancer elements; cytomegalovirus immediate early promoter; herpes simplex virus thymidine kinase promoter; early and late SV40 promoters; promoter present in long terminal repeats from a retrovirus; mouse metallothionein-I promoter; and various art-known tissue specific promoters.
  • Suitable reversible promoters including reversible inducible promoters are known in the art. Such reversible promoters may be isolated and derived from many organisms, e.g., eukaryotes and prokaryotes. Modification of reversible promoters derived from a first organism for use in a second organism, e.g., a first prokaryote and a second a eukaryote, a first eukaryote and a second a prokaryote, etc., is well known in the art.
  • Such reversible promoters, and systems based on such reversible promoters but also comprising additional control proteins include, but are not limited to, alcohol regulated promoters (e.g., alcohol dehydrogenase I (alcA) gene promoter, promoters responsive to alcohol transactivator proteins (AlcR), etc.), tetracycline regulated promoters, (e.g., promoter systems including TetActivators, TetON, TetOFF, etc.), steroid regulated promoters (e.g., rat glucocorticoid receptor promoter systems, human estrogen receptor promoter systems, retinoid promoter systems, thyroid promoter systems, ecdysone promoter systems, mifepristone promoter systems, etc.), metal regulated promoters (e.g., metallothionein promoter systems, etc.), pathogenesis-related regulated promoters (e.g., salicylic acid regulated promoters, ethylene regulated promoters
  • the promoter is a CD8 cell-specific promoter, a CD4 cell-specific promoter, a neutrophil-specific promoter, or an NK-specific promoter.
  • a CD4 gene promoter can be used; see, e.g., Salmon et al. Proc. Natl. Acad. Sci. USA (1993) 90:7739; and Marodon et al. (2003) Blood 101 :3416.
  • a CD8 gene promoter can be used.
  • NK cell-specific expression can be achieved by use of an Neri (p46) promoter; see, e.g., Eckelhart et al. Blood (2011) 117: 1565.
  • a suitable promoter is a constitutive promoter such as an ADH1 promoter, a PGK1 promoter, an ENO promoter, a PYK1 promoter and the like; or a regulatable promoter such as a GALI promoter, a GAL 10 promoter, an ADH2 promoter, a PHOS promoter, a CUP1 promoter, a GALT promoter, a MET25 promoter, a MET3 promoter, a CYC1 promoter, a HIS3 promoter, an ADH1 promoter, a PGK promoter, a GAPDH promoter, an ADC1 promoter, a TRP1 promoter, a URA3 promoter, a LEU2 promoter, an ENO promoter, a TP1 promoter, and AOX1 (e.g., for use in Pichia).
  • a constitutive promoter such as an ADH1 promoter, a PGK1 promoter, an ENO promoter,
  • Suitable promoters for use in prokaryotic host cells include, but are not limited to, a bacteriophage T7 RNA polymerase promoter; a trp promoter; a lac operon promoter; a hybrid promoter, e.g., a lac/tac hybrid promoter, a tac/trc hybrid promoter, a trp/lac promoter, a T7/lac promoter; a trc promoter; a tac promoter, and the like; an araBAD promoter; in vivo regulated promoters, such as an ssaG promoter or a related promoter (see, e.g., U.S.
  • Patent Publication No. 20040131637 discloses a pagC promoter (Pulkkinen and Miller, J. Bacteriol. (1991) 173(1): 86-93; Alpuche- Aranda et al., Proc. Natl. Acad. Sci. USA (1992) 89(21): 10079-83), a nirB promoter (Harbome et al. Mol. Micro. (1992) 6:2805-2813), and the like (see, e.g., Dunstan et al., Infect. Immim. (1999) 67:5133-5141; McKelvie et al., Vaccine (2004) 22:3243-3255; and Chatfield et al., Biotechnol.
  • sigma70 promoter e.g., a consensus sigma70 promoter (see, e.g., GenBank Accession Nos. AX798980, AX798961, and AX798183); a stationary phase promoter, e.g., a dps promoter, an spv promoter, and the like; a promoter derived from the pathogenicity island SPL2 (see, e.g., WO96/17951); an actA promoter (see, e.g., Shetron-Rama et al., Infect. Immun.
  • rpsM promoter see, e.g., Valdivia and Falkow Mol. Microbiol. (1996). 22:367)
  • a tet promoter see, e.g., Hillen, W. and Wissmann, A. (1989) In Saenger, W. and Heinemann, U. (eds), Topics in Molecular and Structural Biology, Protein— Nucleic Acid Interaction. Macmillan, London, UK, Vol. 10, pp. 143-162
  • SP6 promoter see, e.g., Melton et al., Nncl. Acids Res. (1984) 12:7035; and the like.
  • Suitable strong promoters for use in prokaryotes such as Escherichia coli include, but are not limited to Trc, Tac, T5, T7, and P Lambda.
  • operators for use in bacterial host cells include a lactose promoter operator (LacI repressor protein changes conformation when contacted with lactose, thereby preventing the Lad repressor protein from binding to the operator), a tryptophan promoter operator (when complexed with tryptophan, TrpR repressor protein has a conformation that binds the operator; in the absence of tryptophan, the TrpR repressor protein has a conformation that does not bind to the operator), and a tac promoter operator (see, e.g., deBoer et al., Proc. Natl. Acad. Set. U.S.A. (1983) 80:21-25).
  • Suitable promoters include the immediate early cytomegalovirus (CMV) promoter sequence.
  • CMV immediate early cytomegalovirus
  • This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operatively linked thereto.
  • other constitutive promoter sequences may also be used, including, but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, the EF-1 alpha promoter, as well as human gene promoters such as, but not limited to, the actin promoter, the myosin promoter, the hemoglobin promoter, and the creatine kinase promoter.
  • SV40 simian virus 40
  • inducible promoters are also contemplated as part of the invention.
  • the use of an inducible promoter provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired, or turning off the expression when expression is not desired.
  • inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter.
  • the locus or construct or transgene containing the suitable promoter is irreversibly switched through the induction of an inducible system.
  • Suitable systems for induction of an irreversible switch are well known in the art, e g., induction of an irreversible switch may make use of a Cre-lox-mediated recombination (see, e.g., Fuhrmann-Benzakein, et al., Proc. Natl. Acad. Set. USA (2000) 28:e99, the disclosure of which is incorporated herein by reference). Any suitable combination of recombinase, endonuclease, ligase, recombination sites, etc.
  • a nucleic acid of the present disclosure may be present within an expression vector and/or a cloning vector.
  • An expression vector can include a selectable marker, an origin of replication, and other features that provide for replication and/or maintenance of the vector.
  • Suitable expression vectors include, e.g., plasmids, viral vectors, and the like. Large numbers of suitable vectors and promoters are known to those of skill in the art; many are commercially available for generating a subject recombinant construct.
  • Bacterial pBs, phagescript, PsiX174, pBluescript SK, pBs KS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene, La Jolla, Calif, USA); pTrc99A, pKK223-3, pKK233-3, pDR540, and pRIT5 (Pharmacia, Uppsala, Sweden).
  • Eukaryotic pWLneo, pSV2cat, pOG44, PXR1, pSG (Stratagene) pSVK3, pBPV, pMSG and pSVL (Pharmacia).
  • Expression vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding heterologous proteins.
  • a selectable marker operative in the expression host may be present.
  • Suitable expression vectors include, but are not limited to, viral vectors (e.g. viral vectors based on vaccinia virus; poliovirus; adenovirus (see, e.g., Li et al., Invest. OpthalmoL Vis. Sei. (1994) 35: 2543-2549; Borras et al., Gene Th t. (1999) 6: 515-524; Li and Davidson, Proc. Natl. Acad. Set.
  • viral vectors e.g. viral vectors based on vaccinia virus; poliovirus; adenovirus (see, e.g., Li et al., Invest. OpthalmoL Vis. Sei. (1994) 35: 2543-2549; Borras e
  • a retroviral vector e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus; and the like.
  • Additional expression vectors suitable for use are, e.g., without limitation, a lentivirus vector, a gamma retrovirus vector, a foamy virus vector, an adeno-associated virus vector, an adenovirus vector, a pox virus vector, a herpes virus vector, an engineered hybrid virus vector, a transposon mediated vector, and the like.
  • Viral vector technology is well known in the art and is described, for example, in Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, volumes 1-4, Cold Spring Harbor Press, NY), and in other virology and molecular biology manuals.
  • Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno- associated viruses, herpes viruses, and lentiviruses.
  • a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers, (e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193).
  • an expression vector (e.g., a lentiviral vector) may be used to introduce the CAR into an immune cell or precursor thereof (e.g., a T cell).
  • an expression vector (e.g., a lentiviral vector) of the present invention may comprise a nucleic acid encoding a CAR.
  • the expression vector (e.g., lentiviral vector) will comprise additional elements that will aid in the functional expression of the CAR encoded therein.
  • an expression vector comprising a nucleic acid encoding a CAR further comprises a mammalian promoter.
  • the vector further comprises an elongation-factor- 1 -alpha promoter (EF-la promoter).
  • an EF-la promoter may increase the efficiency in expression of downstream transgenes (e.g., a CAR encoding nucleic acid sequence).
  • Physiologic promoters e.g., an EF-la promoter
  • Other physiological promoters suitable for use in a vector are known to those of skill in the art and may be incorporated into a vector of the present invention.
  • the vector e.g., a lentiviral vector
  • the vector further comprises a nonrequisite cis acting sequence that may improve titers and gene expression.
  • a non-requisite cis acting sequence is the central polypurine tract and central termination sequence (cPPT/CTS) which is important for efficient reverse transcription and nuclear import.
  • CPS central polypurine tract and central termination sequence
  • Other non-requisite cis acting sequences are known to those of skill in the art and may be incorporated into a vector (e.g., lentiviral vector) of the present invention.
  • the vector further comprises a posttranscriptional regulatory element. Posttranscriptional regulatory elements may improve RNA translation, improve transgene expression and stabilize RNA transcripts.
  • a posttranscriptional regulatory element is the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE). Accordingly, in some embodiments a vector for the present invention further comprises a WPRE sequence.
  • a vector of the present invention may further comprise additional elements such as a rev response element (RRE) for RNA transport, packaging sequences, and 5’ and 3’ long terminal repeats (LTRs).
  • RRE rev response element
  • LTRs long terminal repeats
  • LTRs generally provide functions required for the expression of retroviral genes (e.g., promotion, initiation and poly adenylation of gene transcripts) and to viral replication.
  • a vector (e.g., lentiviral vector) of the present invention includes a 3’ U3 deleted LTR.
  • a vector (e.g., lentiviral vector) of the present invention may comprise any combination of the elements described herein to enhance the efficiency of functional expression of transgenes.
  • a vector (e.g., lentiviral vector) of the present invention may comprise a WPRE sequence, cPPT sequence, RRE sequence, 5 ’LTR, 3’ U3 deleted LTR’ in addition to a nucleic acid encoding for a CAR.
  • Vectors of the present invention may be self-inactivating vectors.
  • self-inactivating vector refers to vectors in which the 3’ LTR enhancer promoter region (U3 region) has been modified (e.g., by deletion or substitution).
  • a self-inactivating vector may prevent viral transcription beyond the first round of viral replication. Consequently, a selfinactivating vector may be capable of infecting and then integrating into a host genome (e.g., a mammalian genome) only once, and cannot be passed further. Accordingly, self-inactivating vectors may greatly reduce the risk of creating a replication-competent virus.
  • a nucleic acid of the present invention may be RNA, e.g., in vitro synthesized RNA.
  • Methods for in vitro synthesis of RNA are known to those of skill in the art; any known method can be used to synthesize RNA comprising a sequence encoding a CAR of the present disclosure.
  • Methods for introducing RNA into a host cell are known in the art. See, e.g., Zhao et al. Cancer Res. (2010) 15: 9053.
  • Introducing RNA comprising a nucleotide sequence encoding a CAR of the present disclosure into a host cell can be carried out in vitro or ex vivo or in vivo.
  • a host cell e.g., an NK cell, a cytotoxic T lymphocyte, etc.
  • RNA comprising a nucleotide sequence encoding a CAR of the present disclosure.
  • the expression vector to be introduced into a cell may also contain either a selectable marker gene or a reporter gene, or both, to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors.
  • the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers include, without limitation, antibiotic-resistance genes.
  • Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences.
  • a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a polypeptide whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assessed at a suitable time after the DNA has been introduced into the recipient cells.
  • Suitable reporter genes may include, without limitation, genes encoding luciferase, betagalactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (e.g., Ui-Tei et al., 2000 FEBS Letters 479: 79-82).
  • the present invention provides methods for producing/generating a modified immune cell or precursor cell thereof (e.g., a T cell/ NK cell / NKT cell).
  • the cells are generally engineered by introducing a nucleic acid encoding a subject CAR (e.g., CEACAM6 or mAb!09 CAR).
  • a subject CAR e.g., CEACAM6 or mAb!09 CAR.
  • Methods of introducing nucleic acids into a cell include physical, biological and chemical methods.
  • Physical methods for introducing a polynucleotide, such as RNA, into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like.
  • RNA can be introduced into target cells using commercially available methods which include electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, MA) or the Gene Pulser II (BioRad, Denver, CO), Multiporator (Eppendorf, Hamburg Germany).
  • RNA can also be introduced into cells using cationic liposome mediated transfection using lipofection, using polymer encapsulation, using peptide mediated transfection, or using biolistic particle delivery systems such as “gene guns” (see, for example, Nishikawa, et al. Hum Gene Ther., 12(8):861-70 (2001).
  • Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors.
  • Viral vectors, and especially retroviral vectors have become the most widely used method for inserting genes into mammalian, e.g., human cells.
  • Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.
  • a nucleic acid encoding a subject CAR of the invention is introduced into a cell by an expression vector.
  • Expression vectors comprising a nucleic acid encoding a subject CAR (e.g., CEACAM6 or mAb!09 CAR) are provided herein.
  • Suitable expression vectors include lentivirus vectors, gamma retrovirus vectors, foamy virus vectors, adeno associated virus (AAV) vectors, adenovirus vectors, engineered hybrid viruses, naked DNA, including but not limited to transposon mediated vectors, such as Sleeping Beauty, Piggyback, and Integrases such as Phi31.
  • Some other suitable expression vectors include herpes simplex virus (HSV) and retrovirus expression vectors.
  • Adenovirus expression vectors are based on adenoviruses, which have a low capacity for integration into genomic DNA but a high efficiency for transfecting host cells.
  • Adenovirus expression vectors contain adenovirus sequences sufficient to: (a) support packaging of the expression vector and (b) to ultimately express the subject CAR in the host cell.
  • the adenovirus genome is a 36 kb, linear, double stranded DNA, where a foreign DNA sequence (e.g., a nucleic acid encoding a subject CAR) may be inserted to substitute large pieces of adenoviral DNA in order to make the expression vector of the present invention (see, e.g., Danthinne and Imperiale, Gene Therapy (2000) 7(20): 1707-1714).
  • a foreign DNA sequence e.g., a nucleic acid encoding a subject CAR
  • Another expression vector is based on an adeno associated virus, which takes advantage of the adenovirus coupled systems.
  • This AAV expression vector has a high frequency of integration into the host genome. It can infect non-dividing cells, thus making it useful for delivery of genes into mammalian cells, for example, in tissue cultures or in vivo.
  • the AAV vector has a broad host range for infectivity. Details concerning the generation and use of AAV vectors are described in U.S. Patent Nos. 5,139,941 and 4,797,368.
  • Retrovirus expression vectors are capable of integrating into the host genome, delivering a large amount of foreign genetic material, infecting a broad spectrum of species and cell types and being packaged in special cell lines.
  • the retrovirus vector is constructed by inserting a nucleic acid (e.g., a nucleic acid encoding a subject CAR) into the viral genome at certain locations to produce a virus that is replication defective.
  • a nucleic acid e.g., a nucleic acid encoding a subject CAR
  • the retrovirus vectors are able to infect a broad variety of cell types, integration and stable expression of the subject CAR, requires the division of host cells.
  • Lentivirus vectors are derived from lentiviruses, which are complex retroviruses that, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural function (see, e.g., U.S. Patent Nos. 6,013,516 and 5,994, 136).
  • Some examples of lentiviruses include the human immunodeficiency viruses (HIV-1, HIV-2) and the simian immunodeficiency virus (SIV).
  • Lentivirus vectors have been generated by multiply attenuating the HIV virulence genes, for example, the genes env, vif, vpr, vpu and nef are deleted making the vector biologically safe.
  • Lentivirus vectors are capable of infecting non-dividing cells and can be used for both in vivo and ex vivo gene transfer and expression, e.g., of a nucleic acid encoding a subject CAR (see, e.g., U.S. Patent No. 5,994,136).
  • Expression vectors including a nucleic acid of the present disclosure can be introduced into a host cell by any means known to persons skilled in the art.
  • the expression vectors may include viral sequences for transfection, if desired.
  • the expression vectors may be introduced by fusion, electroporation, biolistics, transfection, lipofection, or the like.
  • the host cell may be grown and expanded in culture before introduction of the expression vectors, followed by the appropriate treatment for introduction and integration of the vectors.
  • the host cells are then expanded and may be screened by virtue of a marker present in the vectors.
  • markers that may be used are known in the art, and may include hprt, neomycin resistance, thymidine kinase, hygromycin resistance, etc.
  • the terms “cell,” “cell line,” and “cell culture” may be used interchangeably.
  • the host cell is an immune cell or precursor thereof, e.g., a T cell, an NK cell, or an NKT cell.
  • the present invention also provides genetically engineered cells which include and stably express a subject CAR of the present disclosure.
  • the genetically engineered cells are genetically engineered T-lymphocytes (T cells), regulatory T cells (Tregs), naive T cells (TN), memory T cells (for example, central memory T cells (TCM), effector memory cells (TEM)), natural killer cells (NK cells), natural killer T cells (NKT cells) and macrophages capable of giving rise to therapeutically relevant progeny.
  • T cells T-lymphocytes
  • Tregs regulatory T cells
  • TN naive T cells
  • memory T cells for example, central memory T cells (TCM), effector memory cells (TEM)
  • NK cells natural killer T cells
  • NKT cells natural killer T cells
  • macrophages capable of giving rise to therapeutically relevant progeny.
  • the genetically engineered cells are autologous cells.
  • Modified cells may be produced by stably transfecting host cells with an expression vector including a nucleic acid of the present disclosure. Additional methods to generate a modified cell of the present disclosure include, without limitation, chemical transformation methods (e.g., using calcium phosphate, dendrimers, liposomes and/or cationic polymers), non-chemical transformation methods (e.g., electroporation, optical transformation, gene electrotransfer and/or hydrodynamic delivery) and/or particle-based methods (e.g., impalefection, using a gene gun and/or magnetofection). Transfected cells expressing a subject CAR of the present disclosure may be expanded ex vivo.
  • chemical transformation methods e.g., using calcium phosphate, dendrimers, liposomes and/or cationic polymers
  • non-chemical transformation methods e.g., electroporation, optical transformation, gene electrotransfer and/or hydrodynamic delivery
  • particle-based methods e.g., impalefection, using a gene gun and/or
  • Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • colloidal dispersion systems such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
  • Lipids suitable for use can be obtained from commercial sources.
  • DMPC dimyristyl phosphatidylcholine
  • DCP dicetyl phosphate
  • Choi cholesterol
  • DMPG dimyristyl phosphatidylglycerol
  • Stock solutions of lipids in chloroform or chloroform/methanol can be stored at about -20°C. Chloroform is used as the only solvent since it is more readily evaporated than methanol.
  • Liposome is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology' 5: 505-10).
  • compositions that have different structures in solution than the normal vesicular structure are also encompassed.
  • the lipids may assume a micellar structure or merely exist as nonuniform aggregates of lipid molecules.
  • lipofectamine- nucleic acid complexes are also contemplated.
  • assays include, for example, “molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; “biochemical” assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.
  • molecular biological assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR
  • biochemical assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.
  • nucleic acids may be introduced by any means, such as transducing the expanded T cells, transfecting the expanded T cells, and electroporating the expanded T cells.
  • One nucleic acid may be introduced by one method and another nucleic acid may be introduced into the T cell by a different method.
  • a source of immune cells Prior to expansion, a source of immune cells is obtained from a subject for ex vivo manipulation.
  • Sources of target cells for ex vivo manipulation may also include, e.g., autologous or heterologous donor blood, cord blood, or bone marrow.
  • the source of immune cells may be from the subject to be treated with the modified immune cells of the invention, e.g., the subject's blood, the subject's cord blood, or the subject’s bone marrow.
  • Non-limiting examples of subjects include humans, dogs, cats, mice, rats, and transgenic species thereof.
  • the subject is a human.
  • Immune cells can be obtained from a number of sources, including blood, peripheral blood mononuclear cells, bone marrow, lymph node tissue, spleen tissue, umbilical cord, lymph, or lymphoid organs.
  • Immune cells are cells of the immune system, such as cells of the innate or adaptive immunity, e.g., myeloid or lymphoid cells, including lymphocytes, typically T cells and/or NK cells and/or NKT cells.
  • Other exemplary cells include stem cells, such as multipotent and pluripotent stem cells, including induced pluripotent stem cells (iPSCs).
  • the cells are human cells. With reference to the subject to be treated, the cells may be allogeneic and/or autologous.
  • the cells typically are primary cells, such as those isolated directly from a subject and/or isolated from a subject and frozen.
  • the immune cell is a T cell, e.g., a CD8+ T cell (e.g., a CD8+ naive T cell, central memory T cell, or effector memory T cell), a CD4+ T cell, a natural killer T cell (NKT cells), a regulatory T cell (Treg), a stem cell memory T cell, a lymphoid progenitor cell, a hematopoietic stem cell, a natural killer cell (NK cell), a natural killer T cell (NK cell) or a dendritic cell.
  • a CD8+ T cell e.g., a CD8+ naive T cell, central memory T cell, or effector memory T cell
  • a CD4+ T cell e.g., a CD4+ T cell, a natural killer T cell (NKT cells), a regulatory T cell (Treg), a stem cell memory T cell, a lymphoid progenitor cell, a hematopoietic stem cell
  • the cells are monocytes or granulocytes, e.g., myeloid cells, macrophages, neutrophils, dendritic cells, mast cells, eosinophils, and/or basophils.
  • the target cell is an induced pluripotent stem (iPS) cell or a cell derived from an iPS cell, e.g., an iPS cell generated from a subject, manipulated to alter (e.g., induce a mutation in) or manipulate the expression of one or more target genes, and differentiated into, e.g., a T cell, e.g., a CD8+ T cell (e.g., a CD8+ naive T cell, central memory T cell, or effector memory T cell), a CD4+ T cell, a stem cell memory T cell, a lymphoid progenitor cell or a hematopoietic stem cell.
  • iPS induced pluripotent stem
  • the cells include one or more subsets of T cells or other cell types, such as whole T cell populations, CD4+ cells, CD8+ cells, and subpopulations thereof, such as those defined by function, activation state, maturity, potential for differentiation, expansion, recirculation, localization, and/or persistence capacities, antigen-specificity, type of antigen receptor, presence in a particular organ or compartment, marker or cytokine secretion profile, and/or degree of differentiation.
  • T cells or other cell types such as whole T cell populations, CD4+ cells, CD8+ cells, and subpopulations thereof, such as those defined by function, activation state, maturity, potential for differentiation, expansion, recirculation, localization, and/or persistence capacities, antigen- specificity, type of antigen receptor, presence in a particular organ or compartment, marker or cytokine secretion profile, and/or degree of differentiation.
  • TN cells naive T cells
  • TEFF effector T cells
  • memory T cells and sub-types thereof such as stem cell memory T (TSCM), central memory T (TCM), effector memory T (TEM), or terminally differentiated effector memory T cells
  • TIL tumor-infiltrating lymphocytes
  • immature T cells mature T cells
  • helper T cells cytotoxic T cells
  • mucosa- associated invariant T (MAIT) cells such as TH1 cells, TH2 cells, TH3 cells, TH17 cells, TH9 cells, TH22 cells
  • follicular helper T cells alpha/beta T cells, and delta/gamma T cells.
  • any number of T cell lines available in the art may be used.
  • the methods include isolating immune cells from the subject, preparing, processing, culturing, and/or engineering them.
  • preparation of the engineered cells includes one or more culture and/or preparation steps.
  • the cells for engineering as described may be isolated from a sample, such as a biological sample, e.g., one obtained from or derived from a subject.
  • the subject from which the cell is isolated is one having the disease or condition or in need of a cell therapy or to which cell therapy will be administered.
  • the subject in some embodiments is a human in need of a particular therapeutic intervention, such as the adoptive cell therapy for which cells are being isolated, processed, and/or engineered.
  • the cells in some embodiments are primary cells, e.g., primary human cells.
  • the samples include tissue, fluid, and other samples taken directly from the subject, as well as samples resulting from one or more processing steps, such as separation, centrifugation, genetic engineering (e.g., transduction with viral vector), washing, and/or incubation.
  • the biological sample can be a sample obtained directly from a biological source or a sample that is processed.
  • Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine and sweat, tissue and organ samples, including processed samples derived therefrom.
  • the sample from which the cells are derived or isolated is blood or a blood-derived sample, or is or is derived from an apheresis or leukapheresis product.
  • exemplary samples include whole blood, peripheral blood mononuclear cells (PBMCs), leukocytes, bone marrow, thymus, tissue biopsy, tumor, leukemia, lymphoma, lymph node, gut associated lymphoid tissue, mucosa associated lymphoid tissue, spleen, other lymphoid tissues, liver, lung, stomach, intestine, colon, kidney, pancreas, breast, bone, prostate, cervix, testes, ovaries, tonsil, or other organ, and/or cells derived therefrom.
  • Samples include, in the context of cell therapy, e.g., adoptive cell therapy, samples from autologous and allogeneic sources.
  • the cells are derived from cell lines, e.g., T cell lines.
  • the cells in some embodiments are obtained from a xenogeneic source, for example, from mouse, rat, nonhuman primate, and pig.
  • isolation of the cells includes one or more preparation and/or non-affinity-based cell separation steps.
  • cells are washed, centrifuged, and/or incubated in the presence of one or more reagents, for example, to remove unwanted components, enrich for desired components, lyse or remove cells sensitive to particular reagents.
  • cells are separated based on one or more property, such as density, adherent properties, size, sensitivity and/or resistance to particular components.
  • cells from the circulating blood of a subject are obtained, e.g., by apheresis or leukapheresis.
  • the samples contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and/or platelets, and in certain aspects contains cells other than red blood cells and platelets.
  • the blood cells collected from the subject are washed, e.g., to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing steps.
  • the cells are washed with phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • a washing step is accomplished by tangential flow fdtration (TFF) according to the manufacturer's instructions.
  • the cells are resuspended in a variety of biocompatible buffers after washing.
  • components of a blood cell sample are removed, and the cells directly resuspended in culture media.
  • the methods include density-based cell separation methods, such as the preparation of white blood cells from peripheral blood by lysing the red blood cells and centrifugation through a Percoll or Ficoll gradient.
  • immune cells are obtained from the circulating blood of an individual are obtained by apheresis or leukapheresis.
  • the apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets.
  • the cells collected by apheresis may be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media, such as phosphate buffered saline (PBS) or wash solution lacks calcium and may lack magnesium or may lack many if not all divalent cations, for subsequent processing steps.
  • PBS phosphate buffered saline
  • wash solution lacks calcium and may lack magnesium or may lack many if not all divalent cations, for subsequent processing steps.
  • a washing step may be accomplished by methods known to those in the art, such as by using a semi-automated “flow-through” centrifuge (for example, the Cobe 2991 cell processor, the Baxter CytoMate, or the Haemonetics Cell Saver 5) according to the manufacturer's instructions.
  • the cells may be resuspended in a variety of biocompatible buffers, such as, for example, Ca 2+ -free, Mg 2+ -free PBS, PlasmaLyte A, or another saline solution with or without buffer.
  • the undesirable components of the apheresis sample may be removed, and the cells directly resuspended in culture media.
  • the isolation methods include the separation of different cell types based on the expression or presence in the cell of one or more specific molecules, such as surface markers, e.g., surface proteins, intracellular markers, or nucleic acid. In some embodiments, any known method for separation based on such markers may be used. In some embodiments, the separation is affinity- or immunoaffinity-based separation.
  • the isolation in certain aspects includes separation of cells and cell populations based on the cells' expression or expression level of one or more markers, typically cell surface markers, for example, by incubation with an antibody or binding partner that specifically binds to such markers, followed generally by washing steps and separation of cells having bound the antibody or binding partner, from those cells having not bound to the antibody or binding partner.
  • Such separation steps can be based on positive selection, in which the cells having bound the reagents are retained for further use, and/or negative selection, in which the cells having not bound to the antibody or binding partner are retained. In some examples, both fractions are retained for further use.
  • negative selection can be particularly useful where no antibody is available that specifically identifies a cell type in a heterogeneous population, such that separation is best carried out based on markers expressed by cells other than the desired population. The separation need not result in 100% enrichment or removal of a particular cell population or cells expressing a particular marker.
  • positive selection of or enrichment for cells of a particular type refers to increasing the number or percentage of such cells, but need not result in a complete absence of cells not expressing the marker.
  • negative selection, removal, or depletion of cells of a particular type refers to decreasing the number or percentage of such cells, but need not result in a complete removal of all such cells.
  • multiple rounds of separation steps are carried out, where the positively or negatively selected fraction from one step is subjected to another separation step, such as a subsequent positive or negative selection.
  • a single separation step can deplete cells expressing multiple markers simultaneously, such as by incubating cells with a plurality of antibodies or binding partners, each specific for a marker targeted for negative selection.
  • multiple cell types can simultaneously be positively selected by incubating cells with a plurality of antibodies or binding partners expressed on the various cell types.
  • one or more of the T cell populations is enriched for or depleted of cells that are positive for (marker+) or express high levels (marker 111811 ) of one or more particular markers, such as surface markers, or that are negative for (marker ) or express relatively low levels (marker low ) of one or more markers.
  • specific subpopulations of T cells such as cells positive or expressing high levels of one or more surface markers, e.g., CD28+, CD62L+, CCR7+, CD27+, CD127+, CD4+, CD8+, CD45RA+, and/or CD45RO+ T cells, are isolated by positive or negative selection techniques.
  • such markers are those that are absent or expressed at relatively low levels on certain populations of T cells (such as non-memory cells) but are present or expressed at relatively higher levels on certain other populations of T cells (such as memory cells).
  • the cells such as the CD8+ cells or the T cells, e.g., CD3+ cells
  • the cells are enriched for (i.e., positively selected for) cells that are positive or expressing high surface levels of CD45RO, CCR7, CD28, CD27, CD44, CD127, and/or CD62L and/or depleted of (e.g., negatively selected for) cells that are positive for or express high surface levels of CD45RA.
  • cells are enriched for or depleted of cells positive or expressing high surface levels of CD122, CD95, CD25, CD27, and/or IL7-Ra (CD127).
  • CD8+ T cells are enriched for cells positive for CD45RO (or negative for CD45RA) and for CD62L.
  • CD3+, CD28+ T cells can be positively selected using CD3/CD28 conjugated magnetic beads (e.g., DYNABEADS® M-450 CD3/CD28 T Cell Expander).
  • T cells are separated from a PBMC sample by negative selection of markers expressed on non-T cells, such as B cells, monocytes, or other white blood cells, such as CD 14.
  • a CD4+ or CD8+ selection step is used to separate CD4+ helper and CD8+ cytotoxic T cells.
  • Such CD4+ and CD8+ populations can be further sorted into subpopulations by positive or negative selection for markers expressed or expressed to a relatively higher degree on one or more naive, memory, and/or effector T cell subpopulations.
  • CD8+ cells are further enriched for or depleted of naive, central memory, effector memory, and/or central memory stem cells, such as by positive or negative selection based on surface antigens associated with the respective subpopulation.
  • enrichment for central memory T (TCM) cells is carried out to increase efficacy, such as to improve long- term survival, expansion, and/or engraftment following administration, which in certain aspects is particularly robust in such sub-populations.
  • combining TCM-enriched CD8+ T cells and CD4+ T cells further enhances efficacy.
  • memory T cells are present in both CD62L+ and CD62L- subsets of CD8+ peripheral blood lymphocytes.
  • PBMC can be enriched for or depleted of CD62L-CD8+ and/or CD62L+CD8+ fractions, such as using anti-CD8 and anti-CD62L antibodies.
  • a CD4+ T cell population and/or a CD8+ T population is enriched for central memory (TCM) cells.
  • the enrichment for central memory T (TCM) cells is based on positive or high surface expression of CD45RO, CD62L, CCR7, CD28, CD3, and/or CD127; in certain aspects, it is based on negative selection for cells expressing or highly expressing CD45RA and/or granzyme B.
  • isolation of a CD8+ population enriched for TCM cells is carried out by depletion of cells expressing CD4, CD14, CD45RA, and positive selection or enrichment for cells expressing CD62L.
  • enrichment for central memory T (TCM) cells is carried out starting with a negative fraction of cells selected based on CD4 expression, which is subjected to a negative selection based on expression of CD 14 and CD45RA, and a positive selection based on CD62L.
  • Such selections in certain aspects are carried out simultaneously and in other aspects are carried out sequentially, in either order.
  • the same CD4 expression-based selection step used in preparing the CD8+ cell population or subpopulation also is used to generate the CD4+ cell population or subpopulation, such that both the positive and negative fractions from the CD4-based separation are retained and used in subsequent steps of the methods, optionally following one or more further positive or negative selection steps.
  • CD4+ T helper cells are sorted into naive, central memory, and effector cells by identifying cell populations that have cell surface antigens.
  • CD4+ lymphocytes can be obtained by standard methods.
  • naive CD4+ T lymphocytes are CD45RO-, CD45RA+, CD62L+, CD4+ T cells.
  • central memory CD4+ cells are CD62L+ and CD45RO+.
  • effector CD4+ cells are CD62L- and CD45RO.
  • a monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CD1 lb, CD16, HLA-DR, and CD8.
  • the antibody or binding partner is bound to a solid support or matrix, such as a magnetic bead or paramagnetic bead, to allow for separation of cells for positive and/or negative selection.
  • the cells are incubated and/or cultured prior to or in connection with genetic engineering.
  • the incubation steps can include culture, cultivation, stimulation, activation, and/or propagation.
  • the compositions or cells are incubated in the presence of stimulating conditions or a stimulatory agent. Such conditions include those designed to induce proliferation, expansion, activation, and/or survival of cells in the population, to mimic antigen exposure, and/or to prime the cells for genetic engineering, such as for the introduction of a recombinant antigen receptor.
  • the conditions can include one or more of particular media, temperature, oxygen content, carbon dioxide content, time, agents, e.g., nutrients, amino acids, antibiotics, ions, and/or stimulatory factors, such as cytokines, chemokines, antigens, binding partners, fusion proteins, recombinant soluble receptors, and any other agents designed to activate the cells.
  • the stimulating conditions or agents include one or more agent, e.g., ligand, which is capable of activating an intracellular signaling domain of a TCR complex.
  • the agent turns on or initiates TCR/CD3 intracellular signaling cascade in a T cell.
  • Such agents can include antibodies, such as those specific for a TCR component and/or costimulatory receptor, e.g., anti-CD3, anti-CD28, for example, bound to solid support such as a bead, and/or one or more cytokines.
  • the expansion method may further comprise the step of adding anti-CD3 and/or anti CD28 antibody to the culture medium (e.g., at a concentration of at least about 0.5 ng/ml).
  • the stimulating agents include IL -2 and/or IL-15, for example, an IL-2 concentration of at least about 10 units/mL.
  • T cells are isolated from peripheral blood by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLLTM gradient.
  • T cells can be isolated from an umbilical cord.
  • a specific subpopulation of T cells can be further isolated by positive or negative selection techniques.
  • the cord blood mononuclear cells so isolated can be depleted of cells expressing certain antigens, including, but not limited to, CD34, CD8, CD 14, CD 19, and CD56. Depletion of these cells can be accomplished using an isolated antibody, a biological sample comprising an antibody, such as ascites, an antibody bound to a physical support, and a cell bound antibody. Enrichment of a T cell population by negative selection can be accomplished using a combination of antibodies directed to surface markers unique to the negatively selected cells.
  • An exemplary method is cell sorting and/or selection via negative magnetic immunoadherence or flow cytometry that uses a cocktail of monoclonal antibodies directed to cell surface markers present on the cells negatively selected. For example, to enrich for CD4 + cells by negative selection, a monoclonal antibody cocktail typically includes antibodies to CD 14, CD20, CD1 lb, CD 16, HLA-DR, and CD8.
  • the concentration of cells and surface can be varied. In certain embodiments, it may be desirable to significantly decrease the volume in which beads and cells are mixed together (i.e., increase the concentration of cells), to ensure maximum contact of cells and beads. For example, in one embodiment, a concentration of 2 billion cells/ml is used. In one embodiment, a concentration of 1 billion cells/ml is used. In a further embodiment, greater than 100 million cells/ml is used. In a further embodiment, a concentration of cells of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells/ml is used.
  • a concentration of cells from 75, 80, 85, 90, 95, or 100 million cells/ml is used. In further embodiments, concentrations of 125 or 150 million cells/ml can be used. Using high concentrations can result in increased cell yield, cell activation, and cell expansion.
  • T cells can also be frozen after the washing step, which does not require the monocyteremoval step. While not wishing to be bound by theory, the freeze and subsequent thaw step provides a more uniform product by removing granulocytes and to some extent monocytes in the cell population.
  • the cells may be suspended in a freezing solution. While many freezing solutions and parameters are known in the art and will be useful in this context, in a non-limiting example, one method involves using PBS containing 20% DMSO and 8% human serum albumin, or other suitable cell freezing media. The cells are then frozen to -80°C at a rate of 1°C per minute and stored in the vapor phase of a liquid nitrogen storage tank. Other methods of controlled freezing may be used as well as uncontrolled freezing immediately at -20°C or in liquid nitrogen.
  • the population of T cells is comprised within cells such as peripheral blood mononuclear cells, cord blood cells, a purified population of T cells, and a T cell line.
  • peripheral blood mononuclear cells comprise the population of T cells.
  • purified T cells comprise the population of T cells.
  • the cells can be activated and expanded in number using methods as described, for example, in U.S. Patent Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S. Publication No. 20060121005.
  • the immune cells of the invention may be expanded by contact with a surface having attached thereto an agent that stimulates a CD3/TCR complex associated signal and a ligand that stimulates a co-stimulatory molecule on the surface of the immune cells.
  • immune cell populations may be stimulated by contact with an anti-CD3 antibody, or an antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin) in conjunction with a calcium ionophore.
  • a ligand that binds the accessory molecule is used for co-stimulation of an accessory molecule on the surface of the immune cells.
  • immune cells can be contacted with an anti-CD3 antibody and an anti-CD28 antibody, under conditions appropriate for stimulating proliferation of the immune cells.
  • an anti- CD28 antibody include 9.3, B-T3, XR-CD28 (Diaclone, Besancon, France) and these can be used in the invention, as can other methods and reagents known in the art (see, e g., ten Berge et al., Transplant Proc. (1998) 30(8): 3975-3977; Haanen et al., J. Exp. Med. (1999) 190(9): 1319- 1328; and Garland et al., J. Immunol. Methods (1999) 227(1-2): 53-63).
  • Expanding the immune cells by the methods disclosed herein can be multiplied by about 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700 fold, 800-fold, 900-fold, 1000-fold, 2000-fold, 3000- fold, 4000-fold, 5000-fold, 6000-fold, 7000-fold, 8000-fold, 9000-fold, 10,000-fold, 100,000- fold, 1,000,000-fold, 10,000,000-fold, or greater, and any and all whole or partial integers therebetween.
  • the immune cells expand in the range of about 20-fold to about 50-fold.
  • the immune cells can be incubated in cell medium in a culture apparatus for a period of time or until the cells reach confluency or high cell density for optimal passage before passing the cells to another culture apparatus.
  • the culturing apparatus can be of any culture apparatus commonly used for culturing cells in vitro.
  • the level of confluence is 70% or greater before passing the cells to another culture apparatus.
  • the level of confluence is 90% or greater.
  • a period of time can be any time suitable for the culture of cells in vitro.
  • the immune cell medium may be replaced during the culture of the immune cells at any time. In certain exemplary embodiments, the immune cell medium is replaced about every 2 to 3 days.
  • the immune cells are then harvested from the culture apparatus whereupon the immune cells can be used immediately or cryopreserved to be stored for use at a later time.
  • the invention includes cry opreserving the expanded immune cells.
  • the cryopreserved immune cells are thawed prior to introducing nucleic acids into the immune cell.
  • the method comprises isolating immune cells and expanding the immune cells.
  • the invention further comprises cryopreserving the immune cells prior to expansion.
  • the cryopreserved immune cells are thawed for electroporation with the RNA encoding the chimeric membrane protein.
  • ex vivo culture and expansion of immune cells comprises the addition to the cellular growth factors, such as those described in U.S. Pat. No. 5,199,942, or other factors, such as FLT3-L, IL-1, IL-3 and c- kit ligand.
  • expanding the immune cells comprises culturing the immune cells with a factor selected from the group consisting of FLT3-L, IL-1, IL-3 and c-kit ligand.
  • the culturing step as described herein can be very short, for example less than 24 hours such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours.
  • the culturing step as described further herein can be longer, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more days.
  • Cell culture refers generally to cells taken from a living organism and grown under controlled condition.
  • a primary cell culture is a culture of cells, tissues or organs taken directly from an organism and before the first subculture.
  • Cells are expanded in culture when they are placed in a growth medium under conditions that facilitate cell growth and/or division, resulting in a larger population of the cells.
  • the rate of cell proliferation is typically measured by the amount of time required for the cells to double in number, otherwise known as the doubling time.
  • Each round of subculturing is referred to as a passage.
  • cells When cells are subcultured, they are referred to as having been passaged.
  • a specific population of cells, or a cell line, is sometimes referred to or characterized by the number of times it has been passaged.
  • a cultured cell population that has been passaged ten times may be referred to as a PIO culture.
  • the primary culture i.e., the first culture following the isolation of cells from tissue, is designated PO.
  • the cells are described as a secondary culture (Pl or passage 1).
  • P2 or passage 2 tertiary culture
  • the number of population doublings of a culture is greater than the passage number.
  • the expansion of cells (i.e., the number of population doublings) during the period between passaging depends on many factors, including but is not limited to the seeding density, substrate, medium, and time between passaging.
  • the cells may be cultured for several hours (about 3 hours) to about 14 days or any hourly integer value in between.
  • Conditions appropriate for immune cell culture include an appropriate media (e.g., Minimal Essential Media or RPMI Media 1640 or, X-vivo 15, (Lonza)) that may contain factors necessary for proliferation and viability, including serum (e g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-gamma, IL-4, IL-7, GM- CSF, IL-10, IL-12, IL-15, TGF-beta, and TNF-a or any other additives for the growth of cells known to the skilled artisan.
  • serum e.g., fetal bovine or human serum
  • IL-2 interleukin-2
  • insulin IFN-gamma
  • IL-4 interleukin-7
  • GM- CSF GM- CSF
  • IL-10 interleukin-12
  • IL-15 IL-15
  • additives for the growth of cells include, but are not limited to, surfactant, plasmanate, and reducing agents such as N-acetyl-cysteine and 2-mercaptoethanol.
  • Media can include RPMI 1640, AIM-V, DMEM, MEM, a-MEM, F-12, X-Vivo 15, and X-Vivo 20, Optimizer, with added amino acids, sodium pyruvate, and vitamins, either serum-free or supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones, and/or an amount of cytokine(s) sufficient for the growth and expansion of immune cells.
  • Antibiotics e.g., penicillin and streptomycin
  • the target cells are maintained under conditions necessary to support growth, for example, an appropriate temperature (e.g., 37° C) and atmosphere (e.g., air plus 5% CO2).
  • the medium used to culture the immune cells may include an agent that can co-stimulate the immune cells.
  • an agent that can stimulate CD3 is an antibody to CD3
  • an agent that can stimulate CD28 is an antibody to CD28.
  • a cell isolated by the methods disclosed herein can be expanded approximately 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100- fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold, 2000-fold, 3000-fold, 4000-fold, 5000-fold, 6000-fold, 7000-fold, 8000-fold, 9000-fold, 10,000- fold, 100,000-fold, 1,000,000-fold, 10,000,000-fold, or greater.
  • the immune cells expand in the range of about 2-fold to about 50-fold, or more by culturing the electroporated population.
  • human T regulatory cells are expanded via anti- CD3 antibody coated KT64.86 artificial antigen presenting cells (aAPCs).
  • aAPCs antigen presenting cells
  • the method of expanding the immune cells can further comprise isolating the expanded immune cells for further applications.
  • the method of expanding can further comprise a subsequent electroporation of the expanded immune cells followed by culturing.
  • the subsequent electroporation may include introducing a nucleic acid encoding an agent, such as a transducing the expanded immune cells, transfecting the expanded immune cells, or electroporating the expanded immune cells with a nucleic acid, into the expanded population of immune cells, wherein the agent further stimulates the immune cell.
  • the agent may stimulate the immune cells, such as by stimulating further expansion, effector function, or another immune cell function.
  • the modified cells (e.g., T cells) described herein may be included in a composition for immunotherapy.
  • the composition may include a pharmaceutical composition and further include a pharmaceutically acceptable carrier.
  • a therapeutically effective amount of the pharmaceutical composition comprising the modified T cells may be administered.
  • the invention includes a method for adoptive cell transfer therapy comprising administering to a subject in need thereof a modified T cell of the present invention.
  • the invention includes a method of treating a disease or condition in a subject comprising administering to a subject in need thereof a population of modified T cells.
  • a method of treating a disease or condition in a subject in need thereof comprising administering to the subject a genetically edited modified cell (e.g., genetically edited modified T cell).
  • the method of treating a disease or condition in a subject in need thereof comprises administering to the subject a genetically edited modified cell comprising an exogenous CAR.
  • the cancer to be treated in a subject in need thereof is a solid cancer.
  • the invention includes a method of treating a CEACAM6-associated cancer in a subject comprising administering to a subject in need thereof a therapeutically effective population of modified immune cells of the present invention.
  • the CEACAM6-associated cancer is selected from the group consisting of lung cancer, colorectal cancer, head and neck cancer, stomach cancer, pancreatic cancer, urothelial cancer, breast cancer, cervical cancer, and prostate cancer.
  • the cell therapy e.g., adoptive T cell therapy is carried out by autologous transfer, in which the cells are isolated and/or otherwise prepared from the subject who is to receive the cell therapy, or from a sample derived from such a subject.
  • the cells are derived from a subject, e.g., patient, in need of a treatment and the cells, following isolation and processing are administered to the same subject.
  • the cell therapy e.g., adoptive T cell therapy
  • the cells are isolated and/or otherwise prepared from a subject other than a subject who is to receive or who ultimately receives the cell therapy, e.g., a first subject.
  • the cells then are administered to a different subject, e.g., a second subject of the same species.
  • the first and second subjects are genetically identical.
  • the first and second subjects are genetically similar.
  • the second subject expresses the same HLA class or supertype as the first subject.
  • the subject has been treated with a therapeutic agent targeting the disease or condition, e.g. the tumor, prior to administration of the cells or composition containing the cells.
  • the subject is refractory or non-responsive to the other therapeutic agent.
  • the subject has persistent or relapsed disease, e.g., following treatment with another therapeutic intervention, including chemotherapy, radiation, and/or hematopoietic stem cell transplantation (HSCT), e.g., allogenic HSCT.
  • the administration effectively treats the subject despite the subject having become resistant to another therapy.
  • the subject is responsive to the other therapeutic agent, and treatment with the therapeutic agent reduces disease burden.
  • the subject is initially responsive to the therapeutic agent, but exhibits a relapse of the disease or condition over time.
  • the subject has not relapsed.
  • the subject is determined to be at risk for relapse, such as at a high risk of relapse, and thus the cells are administered prophylactically, e.g., to reduce the likelihood of or prevent relapse.
  • the subject has not received prior treatment with another therapeutic agent.
  • the subject has persistent or relapsed disease, e.g., following treatment with another therapeutic intervention, including chemotherapy, radiation, and/or hematopoietic stem cell transplantation (HSCT), e.g., allogenic HSCT.
  • HSCT hematopoietic stem cell transplantation
  • the administration effectively treats the subject despite the subject having become resistant to another therapy.
  • the modified immune and modified precursor cells of the present invention can be administered to an animal, preferably a mammal, even more preferably a human, to treat a cancer.
  • the cells of the present invention can be used for the treatment of any condition related to a cancer, especially a cell-mediated immune response against a tumor cell(s), where it is desirable to treat or alleviate the disease.
  • the types of cancers to be treated with the modified cells or pharmaceutical compositions of the invention include certain solid tumors including metastatic cancers. Adult tumors/cancers and pediatric tumors/cancers are also included.
  • the cells of the invention to be administered may be autologous, with respect to the subject undergoing therapy.
  • the administration of the cells of the invention may be carried out in any convenient manner known to those of skill in the art.
  • the cells of the present invention may be administered to a subject by aerosol inhalation, injection, ingestion, transfusion, implantation or transplantation.
  • the compositions described herein may be administered to a patient transarterially, subcutaneously, intradermally, intratumorally, intranodally, intramedullary, intramuscularly, by intravenous (i.v.) injection, or intraperitoneally.
  • the cells of the invention are injected directly into a site of inflammation in the subject, a local disease site in the subject, a lymph node, an organ, a tumor, and the like.
  • the cells are administered at a desired dosage, which in some aspects includes a desired dose or number of cells or cell type(s) and/or a desired ratio of cell types.
  • the dosage of cells in some embodiments is based on a total number of cells (or number per kg body weight) and a desired ratio of the individual populations or sub-types, such as the CD4+ to CD8+ ratio.
  • the dosage of cells is based on a desired total number (or number per kg of body weight) of cells in the individual populations or of individual cell types.
  • the dosage is based on a combination of such features, such as a desired number of total cells, desired ratio, and desired total number of cells in the individual populations.
  • the cells, or individual populations of sub-types of cells are administered to the subject at a range of about one million to about 100 billion cells, such as, e.g., 1 million to about 50 billion cells (e.g., about 5 million cells, about 25 million cells, about 500 million cells, about 1 billion cells, about 5 billion cells, about 20 billion cells, about 30 billion cells, about 40 billion cells, or a range defined by any two of the foregoing values), such as about 10 million to about 100 billion cells (e.g., about 20 million cells, about 30 million cells, about 40 million cells, about 60 million cells, about 70 million cells, about 80 million cells, about 90 million cells, about 10 billion cells, about 25 billion cells, about 50 billion cells, about 75 billion cells, about 90 billion cells, or a range defined by any two of the foregoing values), and in some cases about 100 million cells to about 50 billion cells (e.g., about 120 million cells, about 250 million cells, about 350 million cells, about 450 million cells, about 650 million cells, about 800 million
  • the dose of total cells and/or dose of individual sub-populations of cells is within a range of between at or about IxlO 5 cells/kg to about IxlO 11 cells/kg 10 4 and at or about 10 11 cells/kilograms (kg) body weight, such as between 10 5 and 10 6 cells / kg body weight, for example, at or about 1 x 1CP cells/kg, 1.5 x 10 5 cells/kg, 2 x 10 5 cells/kg, or 1 x 10 6 cells/kg body weight.
  • the cells are administered at, or within a certain range of error of, between at or about 10 4 and at or about 10 9 T cells/kilograms (kg) body weight, such as between 10’ and 10 6 T cells / kg body weight, for example, at or about 1 x 10 5 T cells/kg, 1.5 x 10 5 T cells/kg, 2 x 10 5 T cells/kg, or 1 x 10 6 T cells/kg body weight.
  • a suitable dosage range of modified cells for use in a method of the present disclosure includes, without limitation, from about 1x10’ cells/kg to about IxlO 6 cells/kg, from about IxlO 6 cells/kg to about IxlO 7 cells/kg, from about IxlO 7 cells/kg about IxlO 8 cells/kg, from about IxlO 8 cells/kg about IxlO 9 cells/kg, from about IxlO 9 cells/kg about IxlO 10 cells/kg, from about IxlO 10 cells/kg about IxlO 11 cells/kg.
  • a suitable dosage for use in a method of the present disclosure is about IxlO 8 cells/kg.
  • a suitable dosage for use in a method of the present disclosure is about IxlO 7 cells/kg. In other embodiments, a suitable dosage is from about IxlO 7 total cells to about 5xl0 7 total cells. In some embodiments, a suitable dosage is from about IxlO 8 total cells to about 5xl0 8 total cells. In some embodiments, a suitable dosage is from about 1.4xl0 7 total cells to about l.lxlO 9 total cells. In an exemplary embodiment, a suitable dosage for use in a method of the present disclosure is about 7xl0 9 total cells.
  • the cells are administered at or within a certain range of error of between at or about 10 4 and at or about 10 9 CD4 + and/or CD8 + cells/kilograms (kg) body weight, such as between 10 5 and 10 6 CD4 + and/or CD8 + cells / kg body weight, for example, at or about 1 x 10 5 CD4 + and/or CD8 + cells/kg, 1.5 x 10 5 CD4 + and/or CD8 + cells/kg, 2 x 10’ CD4 + and/or CD8 + cells/kg, or 1 x 10 6 CD4 + and/or CD8 ⁇ cells/kg body weight.
  • the cells are administered at or within a certain range of error of, greater than, and/or at least about 1 x 10 6 , about 2.5 x 10 6 , about 5 x 10 6 , about 7.5 x 10 6 , or about 9 x 10 6 CD4 + cells, and/or at least about I x lO 6 , about 2.5 x 10 6 , about 5 x 10 6 , about 7.5 x 10 6 , or about 9 x 10 6 CD8+ cells, and/or at least about 1 x 10 6 , about 2.5 x 10 6 , about 5 x 10 6 , about 7.5 x 10 6 , or about 9 x 10 6 T cells.
  • the cells are administered at or within a certain range of error of between about 10 8 and 10 12 or between about IO 10 and 10 11 T cells, between about 10 8 and 10 12 or between about IO 10 and 10 11 CD4 + cells, and/or between about 10 8 and 10 12 or between about 10 10 and 10 11 CD8 + cells.
  • the cells are administered at or within a tolerated range of a desired output ratio of multiple cell populations or sub-types, such as CD4+ and CD8+ cells or sub-types.
  • the desired ratio can be a specific ratio or can be a range of ratios, for example, in some embodiments, the desired ratio (e.g., ratio of CD4 + to CD8 + cells) is between at or about 5: 1 and at or about 5: 1 (or greater than about 1 :5 and less than about 5: 1), or between at or about 1 :3 and at or about 3 : 1 (or greater than about 1:3 and less than about 3: 1), such as between at or about 2: 1 and at or about 1 :5 (or greater than about 1 :5 and less than about 2: 1, such as at or about 5: 1, 4.5: 1, 4: 1, 3.5: 1, 3: 1, 2.5: 1, 2: 1, 1.9: 1, 1.8: 1, 1.7: 1, 1.6: 1, 1.5: 1, 1.4: 1, 1.3: 1, 1.2
  • the tolerated difference is within about 1%, about 2%, about 3%, about 4% about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50% of the desired ratio, including any value in between these ranges.
  • a dose of modified cells is administered to a subject in need thereof, in a single dose or multiple doses. In some embodiments, a dose of modified cells is administered in multiple doses, e g., once a week or every 7 days, once every 2 weeks or every 14 days, once every 3 weeks or every 21 days, once every 4 weeks or every 28 days. In an exemplary embodiment, a single dose of modified cells is administered to a subject in need thereof. In an exemplary embodiment, a single dose of modified cells is administered to a subject in need thereof by rapid intravenous infusion.
  • the appropriate dosage may depend on the type of disease to be treated, the type of cells or recombinant receptors, the severity and course of the disease, whether the cells are administered for preventive or therapeutic purposes, previous therapy, the subject's clinical history and response to the cells, and the discretion of the attending physician.
  • the compositions and cells are in some embodiments suitably administered to the subject at one time or over a series of treatments.
  • the cells are administered as part of a combination treatment, such as simultaneously with or sequentially with, in any order, another therapeutic intervention, such as an antibody or engineered cell or receptor or agent, such as a cytotoxic or therapeutic agent.
  • the cells in some embodiments are co-administered with one or more additional therapeutic agents or in connection with another therapeutic intervention, either simultaneously or sequentially in any order.
  • the cells are co-administered with another therapy sufficiently close in time such that the cell populations enhance the effect of one or more additional therapeutic agents, or vice versa.
  • the cells are administered prior to the one or more additional therapeutic agents.
  • the cells are administered after the one or more additional therapeutic agents.
  • the one or more additional agents includes a cytokine, such as IL-2, for example, to enhance persistence.
  • the methods comprise administration of a chemotherapeutic agent.
  • the modified cells of the invention may be administered to a subject in combination with an immune checkpoint antibody (e.g., an anti-PDl, anti-CTLA-4, or anti-PDLl antibody).
  • an immune checkpoint antibody e.g., an anti-PDl, anti-CTLA-4, or anti-PDLl antibody
  • the modified cell may be administered in combination with an antibody or antibody fragment targeting, for example, PD-1 (programmed death 1 protein).
  • PD-1 programmeed death 1 protein
  • anti-PD-1 antibodies include, but are not limited to, pembrolizumab (KEYTRUDA®, formerly lambrolizumab, also known as MK- 3475), and nivolumab (BMS-936558, MDX-1106, ONO-4538, OPDIVA®) or an antigenbinding fragment thereof.
  • the modified cell may be administered in combination with an anti-PD-Ll antibody or antigen-binding fragment thereof.
  • anti-PD-Ll antibodies include, but are not limited to, BMS-936559, MPDL3280A (TECENTRIQ®, Atezolizumab), and MEDI4736 (Durvalumab, Imfinzi).
  • the modified cell may be administered in combination with an anti-CTLA-4 antibody or antigen-binding fragment thereof.
  • An example of an anti- CTLA-4 antibody includes, but is not limited to, Ipilimumab (trade name Yervoy).
  • Other types of immune checkpoint modulators may also be used including, but not limited to, small molecules, siRNA, miRNA, and CRISPR systems.
  • Immune checkpoint modulators may be administered before, after, or concurrently with the modified cell comprising the CAR.
  • combination treatment comprising an immune checkpoint modulator may increase the therapeutic efficacy of a therapy comprising a modified cell of the present invention.
  • the biological activity of the engineered cell populations in some embodiments is measured, e.g., by any of a number of known methods. Parameters to assess include specific binding of an engineered or natural T cell or other immune cell to antigen, in vivo, e.g., by imaging, or ex vivo, e.g., by ELISA or flow cytometry.
  • the ability of the engineered cells to destroy target cells can be measured using any suitable method known in the art, such as cytotoxicity assays described in, for example, Kochenderfer et al., J. Immunotherapy, 32(7): 689-702 (2009), and Herman et al. J. Immunological Methods, 285(1): 25-40 (2004).
  • the biological activity of the cells is measured by assaying expression and/or secretion of one or more cytokines, such as CD 107a, IFNy, IL-2, and TNF.
  • the biological activity is measured by assessing clinical outcome, such as reduction in tumor burden or load.
  • the subject is provided a secondary treatment.
  • Secondary treatments include but are not limited to chemotherapy, radiation, surgery, and medications.
  • the subject can be administered a conditioning therapy prior to CAR T cell therapy.
  • the conditioning therapy comprises administering an effective amount of cyclophosphamide to the subject.
  • the conditioning therapy comprises administering an effective amount of fludarabine to the subject.
  • the conditioning therapy comprises administering an effective amount of a combination of cyclophosphamide and fludarabine to the subject.
  • Administration of a conditioning therapy prior to CAR T cell therapy may increase the efficacy of the CAR T cell therapy.
  • a specific dosage regimen of the present disclosure includes a lymphodepletion step prior to the administration of the modified T cells.
  • the lymphodepletion step includes administration of cyclophosphamide and/or fludarabine.
  • the lymphodepletion step includes administration of cyclophosphamide at a dose of between about 200 mg/m 2 /day and about 2000 mg/m 2 /day (e.g., 200 mg/m 2 /day, 300 mg/m 2 /day, or 500 mg/m 2 /day).
  • the dose of cyclophosphamide is about 300 mg/m 2 /day.
  • the lymphodepletion step includes administration of fludarabine at a dose of between about 20 mg/m 2 /day and about 900 mg/m 2 /day (e.g., 20 mg/m 2 /day, 25 mg/m 2 /day, 30 mg/m 2 /day, or 60 mg/m 2 /day).
  • the dose of fludarabine is about 30 mg/m 2 /day.
  • the lymphodepletion step includes administration of cyclophosphamide at a dose of between about 200 mg/m 2 /day and about 2000 mg/m 2 /day (e.g., 200 mg/m 2 /day, 300 mg/m 2 /day, or 500 mg/m 2 /day), and fludarabine at a dose of between about 20 mg/m 2 /day and about 900 mg/m 2 /day (e.g., 20 mg/m 2 /day, 25 mg/m 2 /day, 30 mg/m 2 /day, or 60 mg/m 2 /day).
  • the lymphodepletion step includes administration of cyclophosphamide at a dose of about 300 mg/m 2 /day, and fludarabine at a dose of about 30 mg/m 2 /day.
  • the dosing of cyclophosphamide is 300 mg/m 2 /day over three days, and the dosing of fludarabine is 30 mg/m 2 /day over three days.
  • Dosing of lymphodepletion chemotherapy may be scheduled on Days -6 to -4 (with a -1- day window, i.e., dosing on Days -7 to -5) relative to T cell (e.g., CAR-T, TCR-T, a modified T cell, etc.) infusion on Day 0.
  • T cell e.g., CAR-T, TCR-T, a modified T cell, etc.
  • the subject receives lymphodepleting chemotherapy including 300 mg/m 2 of cyclophosphamide by intravenous infusion 3 days prior to administration of the modified T cells. In an exemplary embodiment, for a subject having cancer, the subject receives lymphodepleting chemotherapy including 300 mg/m 2 of cyclophosphamide by intravenous infusion for 3 days prior to administration of the modified T cells.
  • the subject receives lymphodepleting chemotherapy including fludarabine at a dose of between about 20 mg/m 2 /day and about 900 mg/m 2 /day (e.g., 20 mg/m 2 /day, 25 mg/m 2 /day, 30 mg/m 2 /day, or 60 mg/m 2 /day).
  • the subject receives lymphodepleting chemotherapy including fludarabine at a dose of 30 mg/m 2 for 3 days.
  • the subject receives lymphodepleting chemotherapy including cyclophosphamide at a dose of between about 200 mg/m 2 /day and about 2000 mg/m 2 /day (e.g., 200 mg/m 2 /day, 300 mg/m 2 /day, or 500 mg/m 2 /day), and fludarabine at a dose of between about 20 mg/m 2 /day and about 900 mg/m 2 /day (e.g., 20 mg/m 2 /day, 25 mg/m 2 /day, 30 mg/m 2 /day, or 60 mg/m 2 /day).
  • lymphodepleting chemotherapy including cyclophosphamide at a dose of between about 200 mg/m 2 /day and about 2000 mg/m 2 /day (e.g., 200 mg/m 2 /day, 300 mg/m 2 /day, or 500 mg/m 2 /day)
  • fludarabine at a dose of between about 20 mg/m 2 /day and about 900 mg
  • the subject receives lymphodepleting chemotherapy including cyclophosphamide at a dose of about 300 mg/m 2 /day, and fludarabine at a dose of 30 mg/m 2 for 3 days.
  • lymphodepleting chemotherapy including cyclophosphamide at a dose of about 300 mg/m 2 /day, and fludarabine at a dose of 30 mg/m 2 for 3 days.
  • Cells of the invention can be administered in dosages and routes and at times to be determined in appropriate pre-clinical and clinical experimentation and trials. Cell compositions may be administered multiple times at dosages within these ranges. Administration of the cells of the invention may be combined with other methods useful to treat the desired disease or condition as determined by those of skill in the art.
  • CRS cytokine release syndrome
  • Clinical features include: high fever, malaise, fatigue, myalgia, nausea, anorexia, tachycardia/hypotension, capillary leak, cardiac dysfunction, renal impairment, hepatic failure, and disseminated intravascular coagulation.
  • Dramatic elevations of cytokines including interferon-gamma, granulocyte macrophage colony-stimulating factor, IL- 10, and IL-6 have been shown following CAR T-cell infusion.
  • One CRS signature is elevation of cytokines including IL-6 (severe elevation), IFN-gamma, TNF-alpha (moderate), and IL -2 (mild).
  • CRS C-reactive protein
  • the invention provides for, following the diagnosis of CRS, appropriate CRS management strategies to mitigate the physiological symptoms of uncontrolled inflammation without dampening the antitumor efficacy of the engineered cells (e.g., CAR T cells).
  • CRS management strategies are known in the art.
  • systemic corticosteroids may be administered to rapidly reverse symptoms of sCRS (e.g., grade 3 CRS) without compromising initial antitumor response.
  • an anti-IL-6R antibody may be administered.
  • An example of an anti-IL-6R antibody is the Food and Drug Administration-approved monoclonal antibody tocilizumab, also known as atlizumab (marketed as Actemra, or RoActemra).
  • Tocilizumab is a humanized monoclonal antibody against the interleukin-6 receptor (IL-6R).
  • IL-6R interleukin-6 receptor
  • CRS is generally managed based on the severity of the observed syndrome and interventions are tailored as such. CRS management decisions may be based upon clinical signs and symptoms and response to interventions, not solely on laboratory values alone.
  • the first-line management of CRS may be tocilizumab, in some embodiments, at the labeled dose of 8 mg/kg IV over 60 minutes (not to exceed 800 mg/dose); tocilizumab can be repeated Q8 hours. If suboptimal response to the first dose of tocilizumab, additional doses of tocilizumab may be considered.
  • Tocilizumab can be administered alone or in combination with corticosteroid therapy.
  • CRS management guidance may be based on published standards (Lee et al. (2019) Biol Blood Marrow Transplant, doi.org/10.1016/j.bbmt.2018.12.758; Neelapu et al. (2016) Nat Rev Clin Oncology, 15:47; Teachey et al. (2016) Cancer Discov, 6(6): 664-679).
  • MAS Macrophage Activation Syndrome
  • HHLH Hemophagocytic lymphohistiocytosis
  • MAS appears to be a reaction to immune activation that occurs from the CRS, and should therefore be considered a manifestation of CRS.
  • MAS is similar to HLH (also a reaction to immune stimulation).
  • the clinical syndrome of MAS is characterized by high grade non-remitting fever, cytopenias affecting at least two of three lineages, and hepatosplenomegaly. It is associated with high serum ferritin, soluble interleukin -2 receptor, and triglycerides, and a decrease of circulating natural killer (NK) activity.
  • NK circulating natural killer
  • a source of immune cells Prior to expansion, a source of immune cells is obtained from a subject for ex vivo manipulation.
  • Sources of target cells for ex vivo manipulation may also include, e.g., autologous or heterologous donor blood, cord blood, or bone marrow.
  • the source of immune cells may be from the subject to be treated with the modified immune cells of the invention, e.g., the subject's blood, the subject's cord blood, or the subject's bone marrow.
  • Non-limiting examples of subjects include humans, dogs, cats, mice, rats, and transgenic species thereof.
  • the subject is a human.
  • Immune cells can be obtained from a number of sources, including blood, peripheral blood mononuclear cells, bone marrow, lymph node tissue, spleen tissue, umbilical cord, lymph, or lymphoid organs.
  • Immune cells are cells of the immune system, such as cells of the innate or adaptive immunity, e.g., myeloid or lymphoid cells, including lymphocytes, typically T cells and/or NK cells.
  • Other exemplary cells include stem cells, such as multipotent and pluripotent stem cells, including induced pluripotent stem cells (iPSCs).
  • the cells are human cells. With reference to the subject to be treated, the cells may be allogeneic and/or autologous.
  • the cells typically are primary cells, such as those isolated directly from a subject and/or isolated from a subject and frozen.
  • the immune cell is a T cell, e.g., a CD8+ T cell (e.g., a CD8+ naive T cell, central memory T cell, or effector memory T cell), a CD4+ T cell, a natural killer T cell (NKT cells), a regulatory T cell (Treg), a stem cell memory T cell, a lymphoid progenitor cell a hematopoietic stem cell, a natural killer cell (NK cell) or a dendritic cell.
  • a CD8+ T cell e.g., a CD8+ naive T cell, central memory T cell, or effector memory T cell
  • a CD4+ T cell e.g., a CD4+ T cell, a natural killer T cell (NKT cells), a regulatory T cell (Treg), a stem cell memory T cell, a lymphoid progenitor cell a hematopoietic stem cell, a natural killer cell (NK cell) or
  • the cells are monocytes or granulocytes, e.g., myeloid cells, macrophages, neutrophils, dendritic cells, mast cells, eosinophils, and/or basophils.
  • the target cell is an induced pluripotent stem (iPS) cell or a cell derived from an iPS cell, e.g., an iPS cell generated from a subject, manipulated to alter (e.g., induce a mutation in) or manipulate the expression of one or more target genes, and differentiated into, e.g., a T cell, e.g., a CD8+ T cell (e.g., a CD8+ naive T cell, central memory T cell, or effector memory T cell), a CD4+ T cell, a stem cell memory T cell, a lymphoid progenitor cell or a hematopoietic stem cell.
  • iPS induced pluripotent stem
  • the cells include one or more subsets of T cells or other cell types, such as whole T cell populations, CD4+ cells, CD8+ cells, and subpopulations thereof, such as those defined by function, activation state, maturity, potential for differentiation, expansion, recirculation, localization, and/or persistence capacities, antigen-specificity, type of antigen receptor, presence in a particular organ or compartment, marker or cytokine secretion profile, and/or degree of differentiation.
  • T cells or other cell types such as whole T cell populations, CD4+ cells, CD8+ cells, and subpopulations thereof, such as those defined by function, activation state, maturity, potential for differentiation, expansion, recirculation, localization, and/or persistence capacities, antigen- specificity, type of antigen receptor, presence in a particular organ or compartment, marker or cytokine secretion profile, and/or degree of differentiation.
  • TN cells naive T cells
  • TEFF effector T cells
  • memory T cells and sub-types thereof such as stem cell memory T (TSCM), central memory T (TCM), effector memory T (TEM), or terminally differentiated effector memory T cells
  • TIL tumor-infiltrating lymphocytes
  • immature T cells mature T cells
  • helper T cells cytotoxic T cells
  • mucosa- associated invariant T (MAIT) cells such as TH1 cells, TH2 cells, TH3 cells, TH17 cells, TH9 cells, TH22 cells
  • follicular helper T cells alpha/beta T cells, and delta/gamma T cells.
  • any number of T cell lines available in the art may be used.
  • the methods include isolating immune cells from the subject, preparing, processing, culturing, and/or engineering them.
  • preparation of the engineered cells includes one or more culture and/or preparation steps.
  • the cells for engineering as described may be isolated from a sample, such as a biological sample, e.g., one obtained from or derived from a subject.
  • the subject from which the cell is isolated is one having the disease or condition or in need of a cell therapy or to which cell therapy will be administered.
  • the subject in some embodiments is a human in need of a particular therapeutic intervention, such as the adoptive cell therapy for which cells are being isolated, processed, and/or engineered.
  • the cells in some embodiments are primary cells, e.g., primary human cells.
  • the samples include tissue, fluid, and other samples taken directly from the subject, as well as samples resulting from one or more processing steps, such as separation, centrifugation, genetic engineering (e.g. transduction with viral vector), washing, and/or incubation.
  • the biological sample can be a sample obtained directly from a biological source or a sample that is processed.
  • Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine and sweat, tissue and organ samples, including processed samples derived therefrom.
  • the sample from which the cells are derived or isolated is blood or a blood-derived sample, or is or is derived from an apheresis or leukapheresis product.
  • exemplary samples include whole blood, peripheral blood mononuclear cells (PBMCs), leukocytes, bone marrow, thymus, tissue biopsy, tumor, leukemia, lymphoma, lymph node, gut associated lymphoid tissue, mucosa associated lymphoid tissue, spleen, other lymphoid tissues, liver, lung, stomach, intestine, colon, kidney, pancreas, breast, bone, prostate, cervix, testes, ovaries, tonsil, or other organ, and/or cells derived therefrom.
  • Samples include, in the context of cell therapy, e.g., adoptive cell therapy, samples from autologous and allogeneic sources.
  • the cells are derived from cell lines, e.g., T cell lines.
  • the cells in some embodiments are obtained from a xenogeneic source, for example, from mouse, rat, nonhuman primate, and pig.
  • isolation of the cells includes one or more preparation and/or non-affinity based cell separation steps.
  • cells are washed, centrifuged, and/or incubated in the presence of one or more reagents, for example, to remove unwanted components, enrich for desired components, lyse or remove cells sensitive to particular reagents.
  • cells are separated based on one or more property, such as density, adherent properties, size, sensitivity and/or resistance to particular components.
  • cells from the circulating blood of a subject are obtained, e.g., by apheresis or leukapheresis.
  • the samples contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and/or platelets, and in some aspects contains cells other than red blood cells and platelets.
  • the blood cells collected from the subject are washed, e.g., to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing steps.
  • the cells are washed with phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • a washing step is accomplished by tangential flow filtration (TFF) according to the manufacturer's instructions.
  • the cells are resuspended in a variety of biocompatible buffers after washing.
  • components of a blood cell sample are removed and the cells directly resuspended in culture media.
  • the methods include density-based cell separation methods, such as the preparation of white blood cells from peripheral blood by lysing the red blood cells and centrifugation through a Percoll or Ficoll gradient.
  • immune cells are obtained cells from the circulating blood of an individual are obtained by apheresis or leukapheresis.
  • the apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets.
  • the cells collected by apheresis may be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media, such as phosphate buffered saline (PBS) or wash solution lacks calcium and may lack magnesium or may lack many if not all divalent cations, for subsequent processing steps. After washing, the cells may be resuspended in a variety of biocompatible buffers, such as, for example, Ca-free, Mg-free PBS. Alternatively, the undesirable components of the apheresis sample may be removed, and the cells directly resuspended in culture media.
  • PBS phosphate buffered saline
  • the isolation methods include the separation of different cell types based on the expression or presence in the cell of one or more specific molecules, such as surface markers, e.g., surface proteins, intracellular markers, or nucleic acid. In some embodiments, any known method for separation based on such markers may be used. In some embodiments, the separation is affinity- or immunoaffinity-based separation.
  • the isolation in some aspects includes separation of cells and cell populations based on the cells' expression or expression level of one or more markers, typically cell surface markers, for example, by incubation with an antibody or binding partner that specifically binds to such markers, followed generally by washing steps and separation of cells having bound the antibody or binding partner, from those cells having not bound to the antibody or binding partner.
  • Such separation steps can be based on positive selection, in which the cells having bound the reagents are retained for further use, and/or negative selection, in which the cells having not bound to the antibody or binding partner are retained. In some examples, both fractions are retained for further use.
  • negative selection can be particularly useful where no antibody is available that specifically identifies a cell type in a heterogeneous population, such that separation is best carried out based on markers expressed by cells other than the desired population. The separation need not result in 100% enrichment or removal of a particular cell population or cells expressing a particular marker.
  • positive selection of or enrichment for cells of a particular type refers to increasing the number or percentage of such cells, but need not result in a complete absence of cells not expressing the marker.
  • negative selection, removal, or depletion of cells of a particular type refers to decreasing the number or percentage of such cells, but need not result in a complete removal of all such cells.
  • multiple rounds of separation steps are carried out, where the positively or negatively selected fraction from one step is subjected to another separation step, such as a subsequent positive or negative selection.
  • a single separation step can deplete cells expressing multiple markers simultaneously, such as by incubating cells with a plurality of antibodies or binding partners, each specific for a marker targeted for negative selection.
  • multiple cell types can simultaneously be positively selected by incubating cells with a plurality of antibodies or binding partners expressed on the various cell types.
  • one or more of the T cell populations is enriched for or depleted of cells that are positive for (marker+) or express high levels (marker 111811 ) of one or more particular markers, such as surface markers, or that are negative for (marker -) or express relatively low levels (marker low ) of one or more markers.
  • specific subpopulations of T cells such as cells positive or expressing high levels of one or more surface markers, e.g., CD28+, CD62L+, CCR7+, CD27+, CD127+, CD4+, CD8+, CD45RA+, and/or CD45RO+ T cells, are isolated by positive or negative selection techniques.
  • such markers are those that are absent or expressed at relatively low levels on certain populations of T cells (such as non-memory cells) but are present or expressed at relatively higher levels on certain other populations of T cells (such as memory cells).
  • the cells (such as the CD8+ cells or the T cells, e g., CD3+ cells) are enriched for (i.e., positively selected for) cells that are positive or expressing high surface levels of CD45RO, CCR7, CD28, CD27, CD44, CD127, and/or CD62L and/or depleted of (e.g., negatively selected for) cells that are positive for or express high surface levels of CD45RA.
  • cells are enriched for or depleted of cells positive or expressing high surface levels of CD122, CD95, CD25, CD27, and/or IL7-Ra (CD127).
  • CD8+ T cells are enriched for cells positive for CD45RO (or negative for CD45RA) and for CD62L.
  • CD3+, CD28+ T cells can be positively selected using CD3/CD28 conjugated magnetic beads (e.g., DYNABEADS® M-450 CD3/CD28 T Cell Expander).
  • T cells are separated from a PBMC sample by negative selection of markers expressed on non-T cells, such as B cells, monocytes, or other white blood cells, such as CD 14.
  • a CD4+ or CD8+ selection step is used to separate CD4+ helper and CD8+ cytotoxic T cells.
  • Such CD4+ and CD8+ populations can be further sorted into subpopulations by positive or negative selection for markers expressed or expressed to a relatively higher degree on one or more naive, memory, and/or effector T cell subpopulations.
  • CD8+ cells are further enriched for or depleted of naive, central memory, effector memory, and/or central memory stem cells, such as by positive or negative selection based on surface antigens associated with the respective subpopulation.
  • enrichment for central memory T (TCM) cells is carried out to increase efficacy, such as to improve longterm survival, expansion, and/or engraftment following administration, which in some aspects is particularly robust in such sub-populations.
  • combining TCM-enriched CD8+ T cells and CD4+ T cells further enhances efficacy.
  • memory T cells are present in both CD62L+ and CD62L- subsets of CD8+ peripheral blood lymphocytes.
  • PBMC can be enriched for or depleted of CD62L-CD8+ and/or CD62L+CD8+ fractions, such as using anti-CD8 and anti-CD62L antibodies.
  • a CD4+ T cell population and a CD8+ T cell sub-population e.g., a subpopulation enriched for central memory (TCM) cells.
  • the enrichment for central memory T (TCM) cells is based on positive or high surface expression of CD45RO, CD62L, CCR7, CD28, CD3, and/or CD127; in some aspects, it is based on negative selection for cells expressing or highly expressing CD45RA and/or granzyme B. In some aspects, isolation of a CD8+ population enriched for TCM cells is carried out by depletion of cells expressing CD4, CD 14, CD45RA, and positive selection or enrichment for cells expressing CD62L.
  • enrichment for central memory T (TCM) cells is carried out starting with a negative fraction of cells selected based on CD4 expression, which is subjected to a negative selection based on expression of CD14 and CD45RA, and a positive selection based on CD62L.
  • Such selections in some aspects are carried out simultaneously and in other aspects are carried out sequentially, in either order.
  • the same CD4 expression-based selection step used in preparing the CD8+ cell population or subpopulation also is used to generate the CD4+ cell population or sub-population, such that both the positive and negative fractions from the CD4-based separation are retained and used in subsequent steps of the methods, optionally following one or more further positive or negative selection steps.
  • CD4+ T helper cells are sorted into naive, central memory, and effector cells by identifying cell populations that have cell surface antigens.
  • CD4+ lymphocytes can be obtained by standard methods.
  • naive CD4+ T lymphocytes are CD45RO-, CD45RA+, CD62L+, CD4+ T cells.
  • central memory CD4+ cells are CD62L+ and CD45RO+.
  • effector CD4+ cells are CD62L- and CD45RO.
  • a monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CD1 lb, CD16, HLA-DR, and CD8.
  • the antibody or binding partner is bound to a solid support or matrix, such as a magnetic bead or paramagnetic bead, to allow for separation of cells for positive and/or negative selection.
  • the cells are incubated and/or cultured prior to or in connection with genetic engineering.
  • the incubation steps can include culture, cultivation, stimulation, activation, and/or propagation.
  • the compositions or cells are incubated in the presence of stimulating conditions or a stimulatory agent. Such conditions include those designed to induce proliferation, expansion, activation, and/or survival of cells in the population, to mimic antigen exposure, and/or to prime the cells for genetic engineering, such as for the introduction of a recombinant antigen receptor.
  • the conditions can include one or more of particular media, temperature, oxygen content, carbon dioxide content, time, agents, e.g., nutrients, amino acids, antibiotics, ions, and/or stimulatory factors, such as cytokines, chemokines, antigens, binding partners, fusion proteins, recombinant soluble receptors, and any other agents designed to activate the cells.
  • the stimulating conditions or agents include one or more agent, e.g., ligand, which is capable of activating an intracellular signaling domain of a TCR complex.
  • the agent turns on or initiates TCR/CD3 intracellular signaling cascade in a T cell.
  • Such agents can include antibodies, such as those specific for a TCR component and/or costimulatory receptor, e.g., anti-CD3, anti-CD28, for example, bound to solid support such as a bead, and/or one or more cytokines.
  • the expansion method may further comprise the step of adding anti-CD3 and/or anti-CD28 antibody to the culture medium (e.g., at a concentration of at least about 0.5 ng/ml).
  • the stimulating agents include IL-2 and/or IL- 15, for example, an IL-2 concentration of at least about 10 units/mL.
  • T cells are isolated from peripheral blood by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLLTM gradient.
  • T cells can be isolated from an umbilical cord. Tn any event, a specific subpopulation of T cells can be further isolated by positive or negative selection techniques.
  • the cord blood mononuclear cells so isolated can be depleted of cells expressing certain antigens, including, but not limited to, CD34, CD8, CD 14, CD 19, and CD56. Depletion of these cells can be accomplished using an isolated antibody, a biological sample comprising an antibody, such as ascites, an antibody bound to a physical support, and a cell bound antibody.
  • Enrichment of a T cell population by negative selection can be accomplished using a combination of antibodies directed to surface markers unique to the negatively selected cells.
  • a preferred method is cell sorting and/or selection via negative magnetic immunoadherence or flow cytometry that uses a cocktail of monoclonal antibodies directed to cell surface markers present on the cells negatively selected.
  • a monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CDl lb, CD16, HLA-DR, and CD8.
  • the concentration of cells and surface can be varied. In certain embodiments, it may be desirable to significantly decrease the volume in which beads and cells are mixed together (i.e., increase the concentration of cells), to ensure maximum contact of cells and beads. For example, in one embodiment, a concentration of 2 billion cells/ml is used. In one embodiment, a concentration of 1 billion cells/ml is used. In a further embodiment, greater than 100 million cells/ml is used. In a further embodiment, a concentration of cells of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells/ml is used.
  • a concentration of cells from 75, 80, 85, 90, 95, or 100 million cells/ml is used. In further embodiments, concentrations of 125 or 150 million cells/ml can be used. Using high concentrations can result in increased cell yield, cell activation, and cell expansion.
  • T cells can also be frozen after the washing step, which does not require the monocyteremoval step. While not wishing to be bound by theory, the freeze and subsequent thaw step provides a more uniform product by removing granulocytes and to some extent monocytes in the cell population.
  • the cells may be suspended in a freezing solution. While many freezing solutions and parameters are known in the art and will be useful in this context, in a non-limiting example, one method involves using PBS containing 20% DMSO and 8% human serum albumin, or other suitable cell freezing media. The cells are then frozen to -80°C at a rate of 1°C per minute and stored in the vapor phase of a liquid nitrogen storage tank. Other methods of controlled freezing may be used as well as uncontrolled freezing immediately at -20°C or in liquid nitrogen.
  • the population of T cells is comprised within cells such as peripheral blood mononuclear cells, cord blood cells, a purified population of T cells, and a T cell line.
  • peripheral blood mononuclear cells comprise the population of T cells.
  • purified T cells comprise the population of T cells.
  • T regulatory cells can be isolated from a sample.
  • the sample can include, but is not limited to, umbilical cord blood or peripheral blood.
  • the Tregs are isolated by flow-cytometry sorting.
  • the sample can be enriched for Tregs prior to isolation by any means known in the art.
  • the isolated Tregs can be cryopreserved, and/or expanded prior to use. Methods for isolating Tregs are described in U.S. Patent Numbers: 7,754,482, 8,722,400, and 9,555,105, and U.S. Patent Application No. 13/639,927, contents of which are incorporated herein in their entirety.
  • the cells can be activated and expanded in number using methods as described, for example, in U.S. Patent Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S. Publication No. 20060121005.
  • the T cells of the invention may be expanded by contact with a surface having attached thereto an agent that stimulates a CD3/TCR complex associated signal and a ligand that stimulates a co-stimulatory molecule on the surface of the T cells.
  • T cell populations may be stimulated by contact with an anti-CD3 antibody, or antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin) in conjunction with a calcium ionophore.
  • a ligand that binds the accessory molecule is used for co-stimulation of an accessory molecule on the surface of the T cells.
  • T cells can be contacted with an anti- CD3 antibody and an anti-CD28 antibody, under conditions appropriate for stimulating proliferation of the T cells.
  • an anti-CD28 antibody include 9.3, B-T3, XR-CD28 (Diaclone, Besancon, France) and these can be used in the invention, as can other methods and reagents known in the art (see, e.g., ten Berge et al., Transplant Proc. (1998) 30(8): 3975-3977; Haanen et al., J. Exp. Med. (1999) 190(9): 1319-1328; and Garland et al., J. Immunol. Methods (1999) 227(1-2): 53-63).
  • Expanding T cells by the methods disclosed herein can be multiplied by about 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 200 fold, 300 fold, 400 fold, 500 fold, 600 fold, 700 fold, 800 fold, 900 fold, 1000 fold, 2000 fold, 3000 fold, 4000 fold, 5000 fold, 6000 fold, 7000 fold, 8000 fold, 9000 fold, 10,000 fold, 100,000 fold, 1,000,000 fold, 10,000,000 fold, or greater, and any and all whole or partial integers therebetween.
  • the T cells expand in the range of about 20 fold to about 50 fold.
  • the T cells can be incubated in cell medium in a culture apparatus for a period of time or until the cells reach confluency or high cell density for optimal passage before passing the cells to another culture apparatus.
  • the culturing apparatus can be of any culture apparatus commonly used for culturing cells in vitro.
  • the level of confluence is 70% or greater before passing the cells to another culture apparatus. More preferably, the level of confluence is 90% or greater.
  • a period of time can be any time suitable for the culture of cells in vitro.
  • the T cell medium may be replaced during the culture of the T cells at any time. Preferably, the T cell medium is replaced about every 2 to 3 days.
  • the T cells are then harvested from the culture apparatus whereupon the T cells can be used immediately or cryopreserved to be stored for use at a later time.
  • the invention includes cryopreserving the expanded T cells.
  • the cryopreserved T cells are thawed prior to introducing nucleic acids into the T cell.
  • the method comprises isolating T cells and expanding the T cells.
  • the invention further comprises cryopreserving the T cells prior to expansion.
  • the cryopreserved T cells are thawed for electroporation with the RNA encoding the chimeric membrane protein.
  • ex vivo culture and expansion of T cells comprises the addition to the cellular growth factors, such as those described in U.S. Pat. No. 5,199,942, or other factors, such as FLT3-L, IL-1, IL-3 and c-kit ligand.
  • expanding the T cells comprises culturing the T cells with a factor selected from the group consisting of FLT3-L, IL-1, IL-3 and c-kit ligand.
  • the culturing step as described herein can be very short, for example less than 24 hours such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours.
  • the culturing step as described further herein can be longer, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more days.
  • Cell culture refers generally to cells taken from a living organism and grown under controlled condition.
  • a primary cell culture is a culture of cells, tissues or organs taken directly from an organism and before the first subculture.
  • Cells are expanded in culture when they are placed in a growth medium under conditions that facilitate cell growth and/or division, resulting in a larger population of the cells.
  • the rate of cell proliferation is typically measured by the amount of time required for the cells to double in number, otherwise known as the doubling time.
  • Each round of subculturing is referred to as a passage.
  • cells When cells are subcultured, they are referred to as having been passaged.
  • a specific population of cells, or a cell line, is sometimes referred to or characterized by the number of times it has been passaged.
  • a cultured cell population that has been passaged ten times may be referred to as a PIO culture.
  • the primary culture i.e., the first culture following the isolation of cells from tissue, is designated P0.
  • the cells are described as a secondary culture (Pl or passage 1).
  • the cells After the second subculture, the cells become a tertiary culture (P2 or passage 2), and so on.
  • the number of population doublings of a culture is greater than the passage number.
  • the expansion of cells (i.e., the number of population doublings) during the period between passaging depends on many factors, including but is not limited to the seeding density, substrate, medium, and time between passaging.
  • the cells may be cultured for several hours (about 3 hours) to about 14 days or any hourly integer value in between.
  • Conditions appropriate for T cell culture include an appropriate media (e.g., Minimal Essential Media or RPMI Media 1640 or, X-vivo 15, (Lonza)) that may contain factors necessary for proliferation and viability, including serum (e.g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-gamma, IL-4, IL-7, GM-CSF, IL-10, IL-12, TL-15, TGF-beta, and TNF-a or any other additives for the growth of cells known to the skilled artisan.
  • serum e.g., fetal bovine or human serum
  • IL-2 interleukin-2
  • insulin IFN-gamma
  • IL-4 interleukin-7
  • GM-CSF GM-CSF
  • IL-10 IL-12
  • TL-15 TGF-beta
  • TNF-a
  • additives for the growth of cells include, but are not limited to, surfactant, plasmanate, and reducing agents such as N-acetyl-cysteine and 2-mercaptoethanol.
  • Media can include RPMI 1640, AIM-V, DMEM, MEM, a-MEM, F-12, X-Vivo 15, and X-Vivo 20, Optimizer, with added amino acids, sodium pyruvate, and vitamins, either serum-free or supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones, and/or an amount of cytokine(s) sufficient for the growth and expansion of T cells.
  • Antibiotics e.g., penicillin and streptomycin
  • the target cells are maintained under conditions necessary to support growth, for example, an appropriate temperature (e.g., 37°C) and atmosphere (e.g., air plus 5% CO2).
  • the medium used to culture the T cells may include an agent that can co-stimulate the T cells.
  • an agent that can stimulate CD3 is an antibody to CD3
  • an agent that can stimulate CD28 is an antibody to CD28.
  • a cell isolated by the methods disclosed herein can be expanded approximately 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 200 fold, 300 fold, 400 fold, 500 fold, 600 fold, 700 fold, 800 fold, 900 fold, 1000 fold, 2000 fold, 3000 fold, 4000 fold, 5000 fold, 6000 fold, 7000 fold, 8000 fold, 9000 fold, 10,000 fold, 100,000 fold, 1,000,000 fold, 10,000,000 fold, or greater.
  • the T cells expand in the range of about 20 fold to about 50 fold, or more.
  • human T regulatory cells are expanded via anti-CD3 antibody coated KT64.86 artificial antigen presenting cells (aAPCs).
  • aAPCs antigen presenting cells
  • the method of expanding the T cells can further comprise isolating the expanded T cells for further applications.
  • the method of expanding can further comprise a subsequent electroporation of the expanded T cells followed by culturing.
  • the subsequent electroporation may include introducing a nucleic acid encoding an agent, such as a transducing the expanded T cells, transfecting the expanded T cells, or electroporating the expanded T cells with a nucleic acid, into the expanded population of T cells, wherein the agent further stimulates the T cell.
  • the agent may stimulate the T cells, such as by stimulating further expansion, effector function, or another T cell function.
  • compositions containing such cells and/or enriched for such cells such as in which cells expressing the recombinant receptor make up at least 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more of the total cells in the composition or cells of a certain type such as T cells or CD8+ or CD4+ cells.
  • pharmaceutical compositions and formulations for administration such as for adoptive cell therapy.
  • therapeutic methods for administering the cells and compositions to subjects e.g., patients.
  • compositions including the cells for administration including pharmaceutical compositions and formulations, such as unit dose form compositions including the number of cells for administration in a given dose or fraction thereof.
  • the pharmaceutical compositions and formulations generally include one or more optional pharmaceutically acceptable carrier or excipient.
  • the composition includes at least one additional therapeutic agent.
  • pharmaceutical formulation refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered.
  • pharmaceutically acceptable carrier refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject.
  • a pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative. In some aspects, the choice of carrier is determined in part by the particular cell and/or by the method of administration. Accordingly, there are a variety of suitable formulations.
  • the pharmaceutical composition can contain preservatives.
  • Suitable preservatives may include, for example, methylparaben, propylparaben, sodium benzoate, and benzalkonium chloride. In some aspects, a mixture of two or more preservatives is used. The preservative or mixtures thereof are typically present in an amount of about 0.0001% to about 2% by weight of the total composition. Carriers are described, e.g., by Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980).
  • Pharmaceutically acceptable carriers are generally nontoxic to recipients at the dosages and concentrations employed, and include, but are not limited to: buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arg
  • Buffering agents in some aspects are included in the compositions. Suitable buffering agents include, for example, citric acid, sodium citrate, phosphoric acid, potassium phosphate, and various other acids and salts. In some aspects, a mixture of two or more buffering agents is used. The buffering agent or mixtures thereof are typically present in an amount of about 0.001% to about 4% by weight of the total composition. Methods for preparing administrable pharmaceutical compositions are known. Exemplary methods are described in more detail in, for example, Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins; 21st ed. (May 1, 2005).
  • the formulations can include aqueous solutions.
  • the formulation or composition may also contain more than one active ingredient useful for the particular indication, disease, or condition being treated with the cells, preferably those with activities complementary to the cells, where the respective activities do not adversely affect one another.
  • active ingredients are suitably present in combination in amounts that are effective for the purpose intended.
  • the pharmaceutical composition further includes other pharmaceutically active agents or drugs, such as chemotherapeutic agents, e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, and/or vincristine.
  • chemotherapeutic agents e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, and/or vincristine.
  • the pharmaceutical composition in some embodiments contains the cells in amounts effective to treat or prevent the disease or condition, such as a therapeutically effective or prophylactically effective amount.
  • Formulations include those for oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, buccal, sublingual, or suppository administration.
  • the cell populations are administered parenterally.
  • parenteral includes intravenous, intramuscular, subcutaneous, rectal, vaginal, and intraperitoneal administration.
  • the cells are administered to the subject using peripheral systemic delivery by intravenous, intraperitoneal, or subcutaneous injection.
  • compositions in some embodiments are provided as sterile liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which may in some aspects be buffered to a selected pH.
  • sterile liquid preparations e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which may in some aspects be buffered to a selected pH.
  • Liquid preparations are normally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are somewhat more convenient to administer, especially by injection. Viscous compositions, on the other hand, can be formulated within the appropriate viscosity range to provide longer contact periods with specific tissues.
  • Liquid or viscous compositions can comprise carriers, which can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyoi (for example, glycerol, propylene glycol, liquid polyethylene glycol) and suitable mixtures thereof.
  • carriers can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyoi (for example, glycerol, propylene glycol, liquid polyethylene glycol) and suitable mixtures thereof.
  • Sterile injectable solutions can be prepared by incorporating the cells in a solvent, such as in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, dextrose, or the like.
  • a suitable carrier such as a suitable carrier, diluent, or excipient
  • the compositions can contain auxiliary substances such as wetting, dispersing, or emulsifying agents (e.g., methylcellulose), pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, and/or colors, depending upon the route of administration and the preparation desired. Standard texts may in some aspects be consulted to prepare suitable preparations.
  • compositions including antimicrobial preservatives, antioxidants, chelating agents, and buffers, can be added.
  • antimicrobial preservatives for example, parabens, chlorobutanol, phenol, and sorbic acid.
  • Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • the formulations to be used for in vivo administration are generally sterile. Sterility may be readily accomplished, e.g., by filtration through sterile filtration membranes.
  • Example 1 Development of an anti-CEACAM6 CAR CEACAM6 is cell surface adhesion receptor that is highly expressed in pancreatic, lung, stomach and colon cancers among others.
  • CEACAM6 can also function as an immune checkpoint molecule which negatively-regulates T cell activation.
  • cancer In cancer, CEACAM6 overexpression is accompanied by altered glycosylation, which results in cancer-specific, N- glycoforms of the protein which may enhance tumor metastasis or growth.
  • These alternative glycoforms also present a unique target that enable cytotoxic therapies such as CAR-T cells to target tumor cells while largely avoiding normal tissues, which express typical glycoforms of CEACAM6.
  • the anti-CEACAM6 antibody CT 109 was obtained and the amino acid sequences of the heavy and light-chain variable regions were used to generate unique scFvs representing VH- VL (H2L) and VL-VH (L2H) versions.
  • the nucleic acid sequences encoding these scFvs were also codon-optimized to maximize in vivo expression.
  • These scFvs were then engineered into constructs comprising CD2, 4- IBB, CD27, CD28, ICOS, and 0X40 costimulatory signaling domains.
  • CD2 offers several advantages in the context of anti-CEACAM6 CAR constructs, including resistance to exhaustion.
  • the mAblO9-CAR constructs were then expressed in normal human T cells and tested for antigen recognition and cytotoxic function in vitro (FIG. 1).
  • mAblO9-CAR T cells were co-incubated with CEACAM6+ (CD66c) BxPC3 cells at the indicated effector-to-target ratios.
  • NTD non-transduced T cells
  • tumor cells grown in media alone (spontaneous lysis control) and exposed to the detergent Triton X-100 (maximum lysis control). Impedance of each well was measured every 15 minutes using the xCELLigence RTCA assay.
  • Example 2 Use of CEACAM6 CAR T cells in vivo
  • mice were implanted with BxPC3 tumor cells which had been engineered to express luciferase (FIG. 2). Once tumors were established, mice were treated with non-transduced T cells (NTD), mAb 109-H2L-CD2z CART cells or mAb 109-L2H-CD2z CART cells. Each mouse received 8xl0 6 total T cells which were at least 57.6% CAR + as determined by flow cytometry.
  • NTD non-transduced T cells
  • mAb 109-H2L-CD2z CART cells mAb 109-L2H-CD2z CART cells
  • Example bioluminescence images and a log cell kill graph are depicted in FIG. 4.
  • the average tumor volume for mice in each treatment group was determined at several timepoints during the course of the study as determined by serial measurements using calipers (FIG. 3).
  • the results from these studies demonstrated that both H2L and L2H versions of the mAblO9-CD2z CAR construct are able to control BxPC3 tumor growth in vivo.
  • peripheral blood was collected from mice at the conclusion of the experiment, and the number of circulating human CD4 and CD8 T cells per ml of blood was determined by flow cytometry (FIG. 5).
  • mice treated with mAb 109- CART cells demonstrate circulating peripheral blood T cells, indicative of anti-tumor responses in these animals.
  • mAb 109 CAR constructs are capable of being expressed in human T cells and are able to induce selective tumor cell death both in vitro and in vivo.
  • mice were subcutaneously implanted with le6 BXPC3 pancreatic cancer cells and treated with 5e6 CAR T cells with CD2, 4-1BB, or CD28 based costimulatory domains when tumor volume averaged 250mm 3 .
  • Tumor volume was monitored weekly by caliper measurements.
  • CD4 and CD8 T cells were measured in the peripheral blood of mice by flow cytometry (FIG. 8).
  • the CD2-based CAR maintained the greatest reduction in tumor growth as compared to the CD28 and 4-1 BB based CARs.
  • the CD28 and 4-1BB based CARs though, demonstrated similar reduced growth as compared to control.
  • Embodiment 1 provides a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEA Cell Adhesion Molecule 6 (CEACAM6), a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain comprises: i. a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid set forth in SEQ ID NO: 3; and ii.
  • CAR chimeric antigen receptor
  • a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; and wherein the antigen binding domain comprises a single-chain variable fragment (scFv), and wherein the intracellular signaling domain comprises a costimulatory domain selected from the group consisting of a CD2 costimulatory domain, a 4-1BB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain.
  • Embodiment 2 provides the CAR of any one of embodiment 1, wherein the antigen binding domain comprises a heavy chain variable region comprising an amino acid sequence having at least 95%-99% identity to the amino acid sequence set forth in SEQ ID NO: 7.
  • Embodiment 3 provides the CAR of embodiment 1, wherein the antigen binding domain comprises a heavy chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 7.
  • Embodiment 4 provides the CAR of embodiment 1, wherein the antigen binding domain comprises a heavy chain variable region consisting of an amino acid sequence set forth in SEQ ID NO: 7.
  • Embodiment 5 provides the CAR of embodiment 1, wherein the antigen binding domain comprises a light chain variable region comprising an amino acid sequence having at least 95- 99% identity to the amino acid sequence set forth in SEQ ID NO: 9.
  • Embodiment 6 provides the CAR of embodiment 1, wherein the antigen binding domain comprises a light chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 9.
  • Embodiment 7 provides the CAR of embodiment 1, wherein the antigen binding domain comprises a light chain variable region consisting of an amino acid set forth in SEQ ID NO: 9.
  • Embodiment 8 provides a chimeric antigen receptor (CAR) comprising an antigen binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7; and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9.
  • CAR chimeric antigen receptor
  • Embodiment 9 provides a chimeric antigen receptor (CAR) comprising an antigen binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain comprises any one of the amino acid sequences set forth in SEQ ID NOs: 18 and 20.
  • CAR chimeric antigen receptor
  • Embodiment 10 provides the CAR of embodiment 1, wherein the transmembrane domain is selected from the group consisting of an artificial hydrophobic sequence, and a transmembrane domain of a type I transmembrane protein, an alpha, beta, or zeta chain of a T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, 0X40 (CD134), 4-1BB (CD137), and CD154.
  • Embodiment 1 1 provides the CAR of embodiment 1, wherein the transmembrane domain comprises a transmembrane domain of CD8 comprising an amino acid sequence set forth in SEQ ID NO: 14.
  • Embodiment 12 provides the CAR of embodiment 1, further comprising a hinge domain.
  • Embodiment 13 provides the CAR of embodiment 12, wherein the hinge domain is selected from the group consisting of an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial hinge domain, a hinge comprising an amino acid sequence of a CD8 hinge, or any combination thereof.
  • Embodiment 14 provides the CAR of embodiment 13, wherein the hinge domain is a CD8 hinge comprising an amino acid sequence set forth in SEQ ID NO: 13.
  • Embodiment 15 provides the CAR of embodiment 1, wherein the CD2 costimulatory domain comprises an amino acid sequence set forth in SEQ ID NO: 15.
  • Embodiment 16 provides the CAR of any one of embodiments 1-15, wherein the intracellular signaling domain comprises an intracellular domain selected from the group consisting of cytoplasmic signaling domains of a human CD3 zeta chain (CD3Q, FcyRIII, FcsRI, a cytoplasmic tail of an Fc receptor, an immunoreceptor tyrosine-based activation motif (ITAM) bearing cytoplasmic receptor, TCR zeta, FcR gamma, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d, or a variant thereof.
  • cytoplasmic signaling domains of a human CD3 zeta chain CD3Q, FcyRIII, FcsRI, a cytoplasmic tail of an Fc receptor
  • ITAM immunoreceptor tyrosine-based activation motif bearing cytoplasmic receptor
  • TCR zeta FcR
  • Embodiment 17 provides the CAR of embodiment 16, wherein the intracellular signaling domain comprises an intracellular domain of CD3( ⁇ .
  • Embodiment 18 provides the CAR of embodiment 17, wherein the CD3( ⁇ intracellular domain comprises an amino acid sequence set forth in SEQ ID NO: 16.
  • Embodiment 19 provides a chimeric antigen receptor (CAR) comprising: i. an antigen binding domain specific for CEACAM6 comprising: a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises and amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; ii.
  • CAR chimeric antigen receptor
  • a CD8 transmembrane domain iii. a costimulatory domain; and iv. a CD3 ⁇ intracellular signaling domain; wherein the costimulatory domain is selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain.
  • Embodiment 20 provides a chimeric antigen receptor (CAR) comprising: i. an antigen binding domain specific for CEACAM6 comprising: a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7; and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9; ii. a CD8 transmembrane domain; iii. a costimulatory domain; and iv.
  • CAR chimeric antigen receptor
  • a CD3 intracellular signaling domain wherein the costimulatory domain is selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain.
  • Embodiment 21 provides a chimeric antigen receptor (CAR) comprising any one of the amino acid sequences set forth in SEQ ID NOs: 21, 22, 23, 25, 27, 29, and 31.
  • CAR chimeric antigen receptor
  • Embodiment 22 provides a chimeric antigen receptor (CAR) consisting of any one of the amino acid sequences set forth in SEQ ID NOs: 21, 22, 23, 25, 27, 29, and 31.
  • CAR chimeric antigen receptor
  • Embodiment 23 provides a nucleic acid encoding the CAR of any one of embodiments 1- 22.
  • Embodiment 24 provides a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEACAM6, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises: i. a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and ii.
  • CAR chimeric antigen receptor
  • LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4
  • LCDR2 comprises and amino acid sequence set forth in SEQ ID NO: 5
  • LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6
  • the antigen binding domain comprises a single-chain variable fragment (scFv), and iv.
  • the intracellular domain comprises a costimulatory domain selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain.
  • a costimulatory domain selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain.
  • Embodiment 25 provides a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEACAM6, a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain comprises: i. a heavy chain variable region comprising a nucleic acid sequence set forth in SEQ ID NO: 8; and ii. a light chain variable region comprising a nucleic acid sequence set forth in SEQ ID NO: 10.
  • CAR chimeric antigen receptor
  • Embodiment 26 provides a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEACAM6, a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain is encoded by any one of the nucleotide sequences set forth in SEQ ID NOs: 17 and 19.
  • CAR chimeric antigen receptor
  • Embodiment 27 provides the nucleic acid of any one of embodiments 24-26, wherein the transmembrane domain comprises a transmembrane domain of CD8.
  • Embodiment 28 provides the nucleic acid of any one of embodiments 24-27, wherein the CAR further comprises a hinge domain.
  • Embodiment 29 provides the nucleic acid of embodiment 28, wherein the hinge domain is a CD8 hinge.
  • Embodiment 30 the nucleic acid of any one of embodiments 24-29, wherein the intracellular domain comprises a costimulatory signaling domain and an intracellular signaling domain.
  • Embodiment 31 provides the nucleic acid of embodiment 30, wherein the intracellular signaling domain comprises an intracellular domain of CD3 ⁇ ,
  • Embodiment 32 provides a vector comprising the nucleic acid of any one of embodiments 24-31.
  • Embodiment 33 provides the vector of embodiment 32, wherein the vector is an expression vector.
  • Embodiment 34 provides a cell comprising the CAR of any one of embodiments 1-22, the nucleic acid of any one of embodiments 23-31, or the vector of any one of embodiments 32- 33.
  • Embodiment 35 provides the cell of embodiment 34, wherein the cell is selected from the group consisting of a T cell, a natural killer (NK) cell, a cytotoxic T lymphocyte (CTL), and a regulatory T cell.
  • a T cell a natural killer (NK) cell
  • CTL cytotoxic T lymphocyte
  • Embodiment 36 provides a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of a modified immune cell comprising the chimeric antigen receptor (CAR) of any one of embodiments 1-22.
  • CAR chimeric antigen receptor
  • Embodiment 37 provides the method of embodiment 36, wherein the modified immune cell is selected from the group consisting of a T cell, a natural killer (NK) cell, a cytotoxic T lymphocyte (CTL), and a regulatory T cell.
  • the modified immune cell is selected from the group consisting of a T cell, a natural killer (NK) cell, a cytotoxic T lymphocyte (CTL), and a regulatory T cell.
  • Embodiment 38 provides the method of embodiment 36, wherein the cancer is associated with the over-expression of CEACAM6.
  • Embodiment 39 provides the method of embodiment 36, wherein the cancer is selected from the group consisting of pancreatic cancer, lung cancer, stomach cancer, breast cancer, prostate cancer, and liver cancer.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Cell Biology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Toxicology (AREA)
  • Oncology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present disclosure provides modified immune cells or precursors thereof (e.g., gene edited modified T cells) comprising chimeric antigen receptors (CARs) specific for CEACAM6

Description

TITLE OF THE INVENTION
Anti-CEACAM6 CAR-T cells for the treatment of CEACAM6+ tumors
CROSS-REFERENCE TO RELATED APPLICATION
The present application is entitled to priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 63/380,882, fded October 25, 2022, which is hereby incorporated by reference in its entirety herein.
BACKGROUND OF THE INVENTION
Chimeric antigen receptors (CARs) are engineered transmembrane proteins that combine antigen-binding domains derived from antibodies or receptor ligands with intracellular T cell activation and co-activation domains. Upon encountering specific target antigens, CAR- expressing T cells, especially CD8+ T cells, activate and kill the target-expressing cells. Since the first FDA-approved CAR therapy was approved in 2017, this treatment strategy has demonstrated successful clinical use against an increasing number of cancers. However, existing CAR T cell based therapies against solid tumors has been found to be less effective than lymphomas and leukemias for a number of reasons including the selection of a target-antigen. CEACAM6 is a is cell surface adhesion receptor that is highly expressed in pancreatic adenocarcinoma and is associated with poor prognosis. CEACAM6 is also an immune checkpoint molecule that limits T cell activation and blunts anti-tumor immune responses. Thus there is a need for CAR-T cells that can eliminate solid tumors by targeting antigens that contribute to tumor’s aggressiveness, growth, and immunosuppressive functions, as solid tumors represent the bulk of cancer-related deaths. The present invention addresses this need.
SUMMARY OF THE INVENTION
As described herein, the present disclosure provides modified immune cells or precursors thereof (e.g., gene edited modified T cells) comprising chimeric antigen receptors (CARs) specific for CEACAM6.
In one aspect, the present disclosure includes a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEA Cell Adhesion Molecule 6 (CEACAM6), a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain comprises: i. a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid set forth in SEQ ID NO: 3; and ii. a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; and wherein the antigen binding domain comprises a single-chain variable fragment (scFv), and wherein the intracellular signaling domain comprises a costimulatory domain selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain.
In some embodiments, the antigen binding domain comprises a heavy chain variable region comprising an amino acid sequence having at least 95%-99% identity to the amino acid sequence set forth in SEQ ID NO: 7.
In some embodiments, the antigen binding domain comprises a heavy chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 7.
In some embodiments, the antigen binding domain comprises a heavy chain variable region consisting of an amino acid sequence set forth in SEQ ID NO: 7.
In some embodiments, the antigen binding domain comprises a light chain variable region comprising an amino acid sequence having at least 95-99% identity to the amino acid sequence set forth in SEQ ID NO: 9.
In some embodiments, the antigen binding domain comprises a light chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 9.
In some embodiments, the antigen binding domain comprises a light chain variable region consisting of an amino acid set forth in SEQ ID NO: 9.
In another aspect, the current disclosure provides a chimeric antigen receptor (CAR) comprising an antigen binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7; and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9.
In another aspect, the current disclosure provides a chimeric antigen receptor (CAR) comprising an antigen binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain comprises any one of the amino acid sequences set forth in SEQ ID NOs: 18 and 20.
In some embodiments, the transmembrane domain is selected from the group consisting of an artificial hydrophobic sequence, and a transmembrane domain of a type I transmembrane protein, an alpha, beta, or zeta chain of a T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, 0X40 (CD134), 4-1BB (CD137), and CD 154.
In some embodiments, the transmembrane domain comprises a transmembrane domain of CD8 comprising an amino acid sequence set forth in SEQ ID NO: 14.
In some embodiments, the CAR of the current disclsoure, further comprises a hinge domain.
In some embodiments, the hinge domain is selected from the group consisting of an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial hinge domain, a hinge comprising an amino acid sequence of a CD8 hinge, or any combination thereof.
In some embodiments, the hinge domain is a CD8 hinge comprising an amino acid sequence set forth in SEQ ID NO: 13.
In some embodiments, the costimulatory domain is a CD2 costimulatory domain comprising an amino acid sequence set forth in SEQ ID NO: 15.
In some embodiments, the intracellular signaling domain comprises an intracellular domain selected from the group consisting of cytoplasmic signaling domains of a human CD3 zeta chain (CD3Q, FcyRIII, FcsRI, a cytoplasmic tail of an Fc receptor, an immunoreceptor tyrosine-based activation motif (IT AM) bearing cytoplasmic receptor, TCR zeta, FcR gamma, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d, or a variant thereof.
In some embodiments, the intracellular signaling domain comprises an intracellular domain of CD3^. In some embodiments, the CD3^ intracellular domain comprises an amino acid sequence set forth in SEQ ID NO: 16.
In another aspect, the current disclosure provides a chimeric antigen receptor (CAR) comprising: i. an antigen binding domain specific for CEACAM6 comprising: a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises and amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; ii. a CD8 transmembrane domain; iii. a costimulatory domain; and iv. a CD3(^ intracellular signaling domain; wherein the costimulatory domain is selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain.
In another aspect, the current disclosure provides a chimeric antigen receptor (CAR) comprising: i. an antigen binding domain specific for CEACAM6 comprising: a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7; and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9; ii. a CD8 transmembrane domain; iii. a costimulatory domain; and iv. a CD3(^ intracellular signaling domain; wherein the costimulatory domain is selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain. In another aspect, the current disclosure provides a chimeric antigen receptor (CAR) comprising any one of the amino acid sequences set forth in SEQ ID NOs: 21, 22, 23, 25, 27, 29, and 31.
In another aspect, the current disclosure provides a chimeric antigen receptor (CAR) consisting of any one of the amino acid sequences set forth in SEQ ID NOs: 21, 22, 23, 25, 27, 29, and 31.
In another aspect, the current disclosure provides a nucleic acid encoding the CAR of any one of claims 1-22.
In another aspect, the current disclosure provides a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEACAM6, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises: i. a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and ii. a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises and amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; and wherein the antigen binding domain comprises a single-chain variable fragment (scFv), and wherein the intracellular domain comprises a costimulatory domain selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain.
In another aspect, the current disclosure provides a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEACAM6, a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain comprises: i. a heavy chain variable region comprising a nucleic acid sequence set forth in SEQ ID NO: 8; and ii. a light chain variable region comprising a nucleic acid sequence set forth in SEQ ID NO: 10.
In another aspect, the current disclosure provides a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEACAM6, a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain is encoded by any one of the nucleotide sequences set forth in SEQ ID NOs: 17 and 19.
In some embodiments, the transmembrane domain comprises a transmembrane domain of CD8.
In some embodiments, the CAR further comprises a hinge domain.
In some embodiments, the hinge domain is a CD8 hinge.
In some embodiments, the intracellular domain comprises a costimulatory signaling domain and an intracellular signaling domain.
In some embodiments, the intracellular signaling domain comprises an intracellular domain of CD3q,
In another aspect, the present disclosure provides a vector comprising the nucleic acid of any one of the above aspects or embodiments or any aspect or embodiment disclosed herein.
In some embodiments, the vector is an expression vector.
In another aspect, the present disclosure provides a cell comprising the CAR, the nucleic acid, and/or the vector of any one of the above aspects or embodiments or any aspect or embodiment disclosed herein.
In some embodiments, the cell is selected from the group consisting of a T cell, a natural killer (NK) cell, a cytotoxic T lymphocyte (CTL), and a regulatory T cell.
In another aspect, the current disclosure provides a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of a modified immune cell comprising the chimeric antigen receptor (CAR) of any one of the above aspects or embodiments or any aspect or embodiment disclosed herein.
In some embodiments, the modified immune cell is selected from the group consisting of a T cell, a natural killer (NK) cell, a cytotoxic T lymphocyte (CTL), and a regulatory T cell.
In some embodiments, the cancer is associated with the over-expression of CEACAM6. In some embodiments, the cancer is selected from the group consisting of pancreatic cancer, lung cancer, stomach cancer, breast cancer, prostate cancer, and liver cancer.
BRIEF DESCRIPTION OF THE DRAWINGS
The foregoing and other features and advantages of the present invention will be more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawings.
FIG. 1 illustrates that mAblO9-CAR T cells are lytic and kill BxPC3 cells in vitro.
FIG. 2 illustrates that mAb!09-CAR T cells can control BxPC3 tumor growth in vivo as measured by tumor bioluminescence.
FIG. 3 illustrates that mAblO9-CAR T cells can control BxPC3 tumor growth in vivo as measured by tumor volume.
FIG. 4 illustrates that mAb!09-CAR T cells can control BxPC3 tumor growth in vivo as assessed by determining log cell kill from bioluminescence imaging.
FIG. 5 are a series of graphs illustrating that mice treated with mAblO9-CAR T cells demonstrate levels of circulating peripheral blood T cells indicative of anti-tumor immune responses.
FIG. 6 illustrates cytokine secretion by the indicated CAR T cells stimulated by ASPC1 or BXPC3 pancreatic cancer cells for 24 hours. Culture supernatant was collected and analyzed for expression of GM-CSF, IL-10, IL -2, TNFa, and other cytokines by Luminex.
FIG. 7 illustrates chronic antigen stimulation of the indicated anti-CEACAM6 CAR T cells by BXPC3 cells for 2x3 days per week. Left panel - cytotoxicity without pre-stimulation. Middle panel - cytotoxicity after 1 week of chronic stimulation. Right panel - cytotoxicity after 3 weeks of chronic stimulation.
FIG. 8 illustrates a study in which NSG mice were subcutaneously implanted with 1 x 106 BXPC3 pancreatic cancer cells and treated with 5 x 106 CAR T cells when tumor volume averaged 250mm3. Tumor volume was monitored weekly by caliper measurements. Thirty-one days after CAR T cell treatment, CD4 and CD8 T cells were measured in the peripheral blood of mice by flow cytometry. DETAILED DESCRIPTION
The present invention provides compositions and methods of use of modified immune cells or precursors thereof (e.g., modified T cells) comprising an exogenous (e.g., recombinant, transgenic or engineered) chimeric antigen receptor (CAR) specific for CEACAM6.
It is to be understood that the methods described in this disclosure are not limited to particular methods and experimental conditions disclosed herein as such methods and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
Furthermore, the experiments described herein, unless otherwise indicated, use conventional molecular and cellular biological and immunological techniques within the skill of the art. Such techniques are well known to the skilled worker, and are explained fully in the literature. See, e.g., Ausubel, et al., ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, N.Y. (1987-2008), including all supplements, Molecular Cloning: A Laboratory Manual (Fourth Edition) by MR Green and J. Sambrook and Harlow et al., Antibodies: A Laboratory Manual, Chapter 14, Cold Spring Harbor Laboratory, Cold Spring Harbor (2013, 2nd edition).
Definitions
Unless otherwise defined, scientific and technical terms used herein have the meanings that are commonly understood by those of ordinary skill in the art. In the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. The use of “or” means “and/or” unless stated otherwise. The use of the term “including,” as well as other forms, such as “includes” and “included,” is not limiting.
Generally, nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein is well-known and commonly used in the art. The methods and techniques provided herein are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications, as commonly accomplished in the art or as described herein. The nomenclatures used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well- known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.
That the disclosure may be more readily understood, select terms are defined below.
The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
“About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
“Activation,” as used herein, refers to the state of a T cell that has been sufficiently stimulated to induce detectable cellular proliferation. Activation can also be associated with induced cytokine production, and detectable effector functions. The term “activated T cells” refers to, among other things, T cells that are undergoing cell division.
As used herein, to “alleviate” a disease means reducing the severity of one or more symptoms of the disease.
The term “antigen” as used herein is defined as a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both. The skilled artisan will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen.
Furthermore, antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an “antigen” as that term is used herein. Furthermore, one skilled in the art will understand that an antigen need not be encoded solely by a full-length nucleotide sequence of a gene. It is readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a “gene” at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid.
As used herein, the term “autologous” is meant to refer to any material derived from the same individual to which it is later to be re-introduced into the individual.
A “co-stimulatory molecule” refers to the cognate binding partner on a T cell that specifically binds with a co-stimulatory ligand, thereby mediating a co-stimulatory response by the T cell, such as, but not limited to, proliferation. Co-stimulatory molecules include, but are not limited to an MHC class I molecule, BTLA and a Toll ligand receptor.
A “co-stimulatory signal”, as used herein, refers to a signal, which in combination with a primary signal, such as TCR/CD3 ligation, leads to T cell proliferation and/or upregulation or downregulation of key molecules.
A “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal’s health continues to deteriorate. In contrast, a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal’s state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal’s state of health.
The term “downregulation” as used herein refers to the decrease or elimination of gene expression of one or more genes.
“Effective amount” or “therapeutically effective amount” are used interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result or provides a therapeutic or prophylactic benefit. Such results may include, but are not limited to an amount that when administered to a mammal, causes a detectable level of immune suppression or tolerance compared to the immune response detected in the absence of the composition of the invention. The immune response can be readily assessed by a plethora of art-recognized methods. The skilled artisan would understand that the amount of the composition administered herein varies and can be readily determined based on a number of factors such as the disease or condition being treated, the age and health and physical condition of the mammal being treated, the severity of the disease, the particular compound being administered, and the like.
“Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
As used herein “endogenous” refers to any material from or produced inside an organism, cell, tissue or system.
The term “epitope” as used herein is defined as a small chemical molecule on an antigen that can elicit an immune response, inducing B and/or T cell responses. An antigen can have one or more epitopes. Most antigens have many epitopes; i.e., they are multivalent. In general, an epitope is roughly about 10 amino acids and/or sugars in size. Preferably, the epitope is about 4- 18 amino acids, more preferably about 5-16 amino acids, and even more most preferably 6-14 amino acids, more preferably about 7-12, and most preferably about 8-10 amino acids. One skilled in the art understands that generally the overall three-dimensional structure, rather than the specific linear sequence of the molecule, is the main criterion of antigenic specificity and therefore distinguishes one epitope from another. Based on the present disclosure, a peptide used in the present invention can be an epitope.
As used herein, the term “exogenous” refers to any material introduced from or produced outside an organism, cell, tissue or system.
The term “expand” as used herein refers to increasing in number, as in an increase in the number of T cells. In one embodiment, the T cells that are expanded ex vivo increase in number relative to the number originally present in the culture. In another embodiment, the T cells that are expanded ex vivo increase in number relative to other cell types in the culture. The term "ex vivo," as used herein, refers to cells that have been removed from a living organism, (e.g., a human) and propagated outside the organism (e.g., in a culture dish, test tube, or bioreactor).
The term “expression” as used herein is defined as the transcription and/or translation of a particular nucleotide sequence driven by its promoter.
“Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., Sendai viruses, lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
“Identity” as used herein refers to the subunit sequence identity between two polymeric molecules particularly between two amino acid molecules, such as, between two polypeptide molecules. When two amino acid sequences have the same residues at the same positions; e.g., if a position in each of two polypeptide molecules is occupied by an arginine, then they are identical at that position. The identity or extent to which two amino acid sequences have the same residues at the same positions in an alignment is often expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matching or identical positions; e.g., if half (e g., five positions in a polymer ten amino acids in length) of the positions in two sequences are identical, the two sequences are 50% identical; if 90% of the positions (e.g., 9 of 10), are matched or identical, the two amino acids sequences are 90% identical.
The term “immune response” as used herein is defined as a cellular response to an antigen that occurs when lymphocytes identify antigenic molecules as foreign and induce the formation of antibodies and/or activate lymphocytes to remove the antigen.
The term “immunosuppressive” is used herein to refer to reducing overall immune response.
“Insertion/deletion”, commonly abbreviated “indel,” is a type of genetic polymorphism in which a specific nucleotide sequence is present (insertion) or absent (deletion) in a genome.
“Isolated” means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
A “lentivirus” as used herein refers to a genus of the Retroviridae family. Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell, so they are one of the most efficient methods of a gene delivery vector. HIV, SIV, and FIV are all examples of lentiviruses. Vectors derived from lentiviruses offer the means to achieve significant levels of gene transfer in vivo.
By the term “modified” as used herein, is meant a changed state or structure of a molecule or cell of the invention. Molecules may be modified in many ways, including chemically, structurally, and functionally. Cells may be modified through the introduction of nucleic acids.
By the term “modulating,” as used herein, is meant mediating a detectable increase or decrease in the level of a response in a subject compared with the level of a response in the subject in the absence of a treatment or compound, and/or compared with the level of a response in an otherwise identical but untreated subject. The term encompasses perturbing and/or affecting a native signal or response thereby mediating a beneficial therapeutic response in a subject, preferably, a human.
In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. “A” refers to adenosine, “C” refers to cytosine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.
The term “oligonucleotide” typically refers to short polynucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, C, G), this also includes an RNA sequence (i.e., A, U, C, G) in which “U” replaces “T.”
Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s). “Parenteral” administration of an immunogenic composition includes, e g., subcutaneous (s.c.), intravenous (i.v.), intramuscular (i.m.), or intrastemal injection, or infusion techniques.
The term “polynucleotide” as used herein is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric “nucleotides.” The monomeric nucleotides can be hydrolyzed into nucleosides. As used herein polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR, and the like, and by synthetic means.
As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
By the term “specifically binds,” as used herein with respect to an antibody, is meant an antibody which recognizes a specific antigen, but does not substantially recognize or bind other molecules in a sample. For example, an antibody that specifically binds to an antigen from one species may also bind to that antigen from one or more species. But, such cross-species reactivity does not itself alter the classification of an antibody as specific. In another example, an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, such cross reactivity does not itself alter the classification of an antibody as specific. In some instances, the terms “specific binding” or “specifically binding,” can be used in reference to the interaction of an antibody, a protein, or a peptide with a second chemical species, to mean that the interaction is dependent upon the presence of a particular structure (e.g., an antigenic determinant or epitope) on the chemical species; for example, an antibody recognizes and binds to a specific protein structure rather than to proteins generally. If an antibody is specific for epitope “A”, the presence of a molecule containing epitope A (or free, unlabeled A), in a reaction containing labeled “A” and the antibody, will reduce the amount of labeled A bound to the antibody.
By the term “stimulation,” is meant a primary response induced by binding of a stimulatory molecule (e.g., a TCR/CD3 complex) with its cognate ligand thereby mediating a signal transduction event, such as, but not limited to, signal transduction via the TCR/CD3 complex. Stimulation can mediate altered expression of certain molecules, such as upregulation of interferon-gamma, and/or reorganization of cytoskeletal structures, and the like.
A “stimulatory molecule,” as the term is used herein, means a molecule on a T cell that specifically binds with a cognate stimulatory ligand present on an antigen presenting cell.
A “stimulatory ligand,” as used herein, means a ligand that when present on an antigen presenting cell (e.g., an aAPC, a dendritic cell, a B-cell, and the like) can specifically bind with a cognate binding partner (referred to herein as a “stimulatory molecule”) on a T cell, thereby mediating a primary response by the T cell, including, but not limited to, activation, initiation of an immune response, proliferation, and the like. Stimulatory ligands are well-known in the art and encompass, inter alia, an MHC Class I molecule loaded with a peptide, an anti-CD3 antibody, a superagonist anti-CD28 antibody, and a superagonist anti-CD2 antibody.
The term “subject” is intended to include living organisms in which an immune response can be elicited (e.g., mammals). A “subject” or “patient,” as used therein, may be a human or non-human mammal. Non-human mammals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals. Preferably, the subject is human.
A “target site” or “target sequence” refers to a nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule may specifically bind under conditions sufficient for binding to occur. In some embodiments, a target sequence refers to a genomic nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule may specifically bind under conditions sufficient for binding to occur. As used herein, the term “T cell receptor” or “TCR” refers to a complex of membrane proteins that participate in the activation of T cells in response to the presentation of antigen. The TCR is responsible for recognizing antigens bound to major histocompatibility complex molecules. TCR is composed of a heterodimer of an alpha (a) and beta (0) chain, although in some cells the TCR consists of gamma and delta (y/8) chains. TCRs may exist in alpha/beta and gamma/delta forms, which are structurally similar but have distinct anatomical locations and functions. Each chain is composed of two extracellular domains, a variable and constant domain. In some embodiments, the TCR may be modified on any cell comprising a TCR, including, for example, a helper T cell, a cytotoxic T cell, a memory T cell, regulatory T cell, natural killer T cell, and gamma delta T cell.
The term “therapeutic” as used herein means a treatment and/or prophylaxis. A therapeutic effect is obtained by suppression, remission, or eradication of a disease state.
“Transplant” refers to a biocompatible lattice or a donor tissue, organ or cell, to be transplanted. An example of a transplant may include but is not limited to skin cells or tissue, bone marrow, and solid organs such as heart, pancreas, kidney, lung and liver. A transplant can also refer to any material that is to be administered to a host. For example, a transplant can refer to a nucleic acid or a protein.
The term “transfected” or “transformed” or “transduced” as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A “transfected” or “transformed” or “transduced” cell is one which has been transfected, transformed or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny.
To “treat” a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.
A “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term “vector” includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, Sendai viral vectors, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like.
Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
Description
The present invention provides CEACAM6 specific chimeric antigen receptors (CARs; e.g., a CEACAM6 CAR) and modified cells comprising the same. Also provided are compositions and methods for utilizing CEACAM6 specific CARs to treat cancer. In particular, a CEACAM6 CAR of the present invention may be suitable for treating both primary and metastatic solid tumors which express CEACAM6 such as lung cancer, stomach cancer, cervical cancer, prostate cancer, pancreatic cancer, breast cancer, ovarian cancer, liver cancer, and colon cancer, and the like.
CEACAM6 Protein
CEACAM6, also called CEA cell adhesion molecule 6, carcinoembryonic antigen-related cell adhesion molecule 6, NCA-90, or CD66c, is a member of the carcinoembryonic antigen (CEA) family of genes whose members are generally glycosyl phosphatidyl inositol (GPI) anchored cell surface glycoproteins. CEA family members, including CEAC AM6, play key roles in mediating cell adhesion and mediate homotypic binding with other CEA family members and heterotypic binding with integrin receptors. Cancers, especially solid cancers, overexpress CEACAM6, where it functions as an oncogene which contributes to tumor cell invasion and metastasis by acting as an inhibitor of cell differentiation and cell polarization, as well as mediating resistance to anoikis and chemotherapy. Overexpression of CEACAM6 is common to many solid cancers, and is often used as a histological marker for certain carcinomas. CEACAM6 is a highly glycosylated protein, and the pattern of glycosylation differs between normal and tumor tissues with tumor-expressed CEACAM6 being heavily N-glycosylated. Studies have demonstrated that the complex N-glycosylation of tumor-expressed CEACAM6 is critical for tumor cell invasion and metastasis mechanisms. The unique glycosylation pattern of CEACAM6 by tumor cells versus normal tissue suggests the use of CEACAM6 as a tumor antigen, and antibodies have been raised that preferentially recognize the N-glycosylated tumor- expressed version of the gene. In some embodiments, the current invention includes CAR constructs which recognize N-glycosyl CEACAM6 and thus target tumor tissues which overexpress this gene.
Chimeric Antigen Receptor (CAR)
The present invention provides compositions and methods for modified immune cells or precursor cells thereof, e.g., modified T cells, comprising a chimeric antigen receptor (CAR) having affinity for CEACAM6. A subject CAR of the invention comprises an antigen binding domain (e.g., CEACAM6 binding domain), a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain. A subject CAR of the invention may optionally comprise a hinge domain. Accordingly, a subject CAR of the invention comprises an antigen binding domain (e.g., CEACAM6 binding domain), a hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain. In some embodiments, each of the domains of a subject CAR is separated by a linker.
The antigen binding domain may be operably linked to another domain of the CAR, such as the transmembrane domain, the costimulatoiy signaling domain or the intracellular signaling domain, each described elsewhere herein, for expression in the cell. In one embodiment, a first nucleic acid sequence encoding the antigen binding domain is operably linked to a second nucleic acid encoding a transmembrane domain, and further operably linked to a third a nucleic acid sequence encoding a costimulatory signaling domain.
The antigen binding domains described herein can be combined with any of the transmembrane domains, any of the costimulatory signaling domains, any of the intracellular signaling domains, or any of the other domains described herein that may be included in a CAR of the present invention. In one aspect, the invention includes a chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6-specific antigen binding domain, optionally a hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
In one exemplary embodiment, the invention includes a chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises three heavy chain complementarity determining regions, wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and wherein the VL domain comprises a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; a CD8 hinge domain; a CD8 transmembrane domain; a costimulatory signaling domain; and a CD3 zeta intracellular signaling domain. In some embodiments, the costimulatory signaling domain is a CD2 costimulatory signaling domain. In some embodiments, the costimulatory signaling domain is a 4-1BB costimulatory signaling domain. In some embodiments, the costimulatory signaling domain is a CD28 costimulatory signaling domain. In some embodiments, the costimulatory signaling domain is a CD27 costimulatory signaling domain. In some embodiments, the costimulatory signaling domain is an ICOS costimulatory signaling domain. In some embodiments, the costimulatory signaling domain is an 0X40 costimulatory signaling domain.
In some embodiments, a genetically modified immune cell (e.g., T cell) or precursor cell thereof of the present invention comprises a chimeric antigen receptor (CAR) having affinity for CEACAM6. In some embodiments, a genetically modified immune cell (e.g., T cell) or precursor cell thereof of the present invention comprises a chimeric antigen receptor (CAR) having affinity for CEACAM6.
In certain embodiments, the genetically modified cell is a T cell.
Accordingly, in one exemplary embodiment, provided herein is a genetically modified T cell comprising a chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6 specific antigen binding domain, an optional hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
Accordingly, in one exemplary embodiment, the invention includes a is a genetically modified T cell comprising chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises three heavy chain complementarity determining regions, wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and wherein the VL domain comprises a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; a CD8 hinge domain; a CD8 transmembrane domain; a CD2 costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
In another exemplary embodiment, the invention includes a genetically modified T cell comprising chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises three heavy chain complementarity determining regions, wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and wherein the VL domain comprises a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; a CD8 hinge domain; a CD8 transmembrane domain; a 4- IBB costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
In another exemplary embodiment, the invention includes a genetically modified T cell comprising chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises three heavy chain complementarity determining regions, wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and wherein the VL domain comprises a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; a CD8 hinge domain; a CD8 transmembrane domain; a CD28 costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
In another exemplary embodiment, the invention includes a genetically modified T cell comprising chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises three heavy chain complementarity determining regions, wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and wherein the VL domain comprises a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; a CD8 hinge domain; a CD8 transmembrane domain; a CD27 costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
In another exemplary embodiment, the invention includes a genetically modified T cell comprising chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises three heavy chain complementarity determining regions, wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and wherein the VL domain comprises a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; a CD8 hinge domain; a CD8 transmembrane domain; an ICOS costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
In another exemplary embodiment, the invention includes a genetically modified T cell comprising chimeric antigen receptor (CAR) that specifically binds CEACAM6, comprising: a CEACAM6-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises three heavy chain complementarity determining regions, wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and wherein the VL domain comprises a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; a CD8 hinge domain; a CD8 transmembrane domain; an 0X40 costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
In certain embodiments of the invention, the CAR is encoded by a nucleic acid sequence comprising the nucleotide sequence of SEQ ID NOs: 24, 26, 28, 30, and 32. In certain embodiments of the invention, the CAR comprises the amino acid sequence of SEQ ID NOs: 21, 22, 23, 25, 27, 29, and 31.
Sequences of individual domains and the CARs are found in Table 1.
Accordingly, a subject CAR may be a CAR having affinity for CEACAM6, comprising a CEACAM6 binding domain comprising the amino acid sequence set forth in SEQ ID NOs: 18 and 20. A subject CEACAM6 CAR may further comprise a leader sequence set forth in SEQ ID NO: 11. A subject CEACAM6 CAR may further comprise a hinge domain comprising an amino acid sequence set forth in SEQ ID NO: 13. A subject CEACAM6 CAR may further comprise a transmembrane domain comprising an amino acid sequence set forth in SEQ ID NO: 14. A subject CEACAM6 CAR may further comprise a costimulatory signaling domain comprising an amino acid sequence set forth in SEQ ID NO: 15. A subject CEACAM6 CAR may further comprise an intracellular signaling domain comprising an amino acid sequence set forth in SEQ ID NO: 16. A subject CEACAM6 CAR may comprise an amino acid sequence set forth in SEQ ID NOs: 21, 22, 23, 25, 27, 29, and 31.
In some embodiments, the CEACAM6 CAR is encoded by a nucleic acid sequence comprising the nucleotide sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least
86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the nucleotide sequence set forth in SEQ ID NOs: 24, 26, 28, 30, and 32. Tolerable variations of the CEACAM6 CAR will be known to those of skill in the art, while maintaining specific binding to CEACAM6. For example, in some embodiments the CEACAM6 CAR comprises an amino acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least
85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least
99% sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 21, 22, 23,
25, 27, 29, and 31.
Table 1: Anti-CEACAM6 CAR Sequences
Figure imgf000025_0001
Figure imgf000026_0001
Figure imgf000027_0001
Figure imgf000028_0001
Figure imgf000029_0001
Figure imgf000030_0001
Figure imgf000031_0001
Figure imgf000032_0001
Figure imgf000033_0001
Figure imgf000034_0001
Antigen Binding Domain
The antigen binding domain of a CAR is an extracellular region of the CAR for binding to a specific target antigen including proteins, carbohydrates, and glycolipids. In some embodiments, the CAR comprises affinity to a target antigen (e.g. a tumor associated antigen) on a target cell (e.g. a cancer cell). The target antigen may include any type of protein, or epitope thereof, associated with the target cell. For example, the CAR may comprise affinity to a target antigen on a target cell that indicates a particular status of the target cell.
In certain embodiments, the CAR of the invention comprises an antigen binding domain that binds to CEACAM6. In certain embodiments, the antigen binding domain of the invention comprises an antibody or fragment thereof, that binds to a CEACAM6 molecule. In certain exemplary embodiments, the antigen binding domain is an scFv antibody that binds to CEACAM6. The choice of antigen binding domain depends upon the type and number of antigens that are present on the surface of a target cell. For example, the antigen binding domain may be chosen to recognize an antigen that acts as a cell surface marker on a target cell associated with a particular status of the target cell.
As described herein, a CAR of the present disclosure having affinity for a specific target antigen on a target cell may comprise a target-specific binding domain. In some embodiments, the target-specific binding domain is a human target-specific binding domain, e.g., the targetspecific binding domain is of human origin. In an exemplary embodiment, a CAR of the present disclosure having affinity for CEACAM6 on a target cell may comprise a CEACAM6 binding domain. In some embodiments, the CEACAM6 binding domain is a murine CEACAM6 binding domain, e.g., the CEACAM6 binding domain is of murine origin. In some embodiments, the CEACAM6 binding domain is a humanized CEACAM6 binding domain. In some embodiments, the CEACAM6 binding domain is a human CEACAM6 binding domain, e g., the CEACAM6 binding domain is of human origin.
In some embodiments, the CEACAM6 binding domain is derived from the CT 109 or mAblO9 antibody disclosed in US Patent Application No. 16/489,038, the disclosure of which is incorporated herein by reference in its entirety. Accordingly, a CAR of the present disclosure comprises a CEACAM6 binding domain derived from the variable regions of the CT 109 or mAblO9 antibody disclosed in US Patent Application No. 16/489,038. The antigen binding domain can include any domain that binds to the antigen and may include, but is not limited to, a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a non-human antibody, and any fragment thereof. Thus, in one embodiment, the antigen binding domain portion comprises a mammalian antibody or a fragment thereof. In another embodiment, the antigen binding domain of the CAR is selected from the group consisting of an anti- CEACAM6 antibody or a fragment thereof. In some embodiments, the antigen binding domain is selected from the group consisting of an antibody, an antigen binding fragment (Fab), and a single-chain variable fragment (scFv). In some embodiments, a CEACAM6 binding domain of the present invention is selected from the group consisting of a CEACAM6 -specific antibody, a CEACAM6-specific Fab, and a CEACAM6-specific scFv. In one embodiment, a CEACAM6 binding domain is a CEACAM6- specific antibody. In one embodiment, a CEACAM6 binding domain is a CEACAM6-specific Fab. In one embodiment, a CEACAM6 binding domain is a CEACAM6-specific scFv.
As used herein, the term “single-chain variable fragment” or “scFv” is a fusion protein of the variable regions of the heavy (VH) and light chains (VL) of an immunoglobulin (e.g., mouse or human) covalently linked to form a VH:VL heterodimer. The heavy (VH) and light chains (VL) are either joined directly or joined by a peptide-encoding linker or spacer, which connects the N-terminus of the VH with the C-terminus of the VL, or the C-terminus of the VH with the N-terminus of the VL. The terms “linker” and “spacer” are used interchangeably herein. In some embodiments, the antigen binding domain (e g., CEACAM6 binding domain) comprises an scFv having the configuration from N-terminus to C-terminus, VH - linker - VL. In some embodiments, the antigen binding domain (e.g., CEACAM6 binding domain) comprises an scFv having the configuration from N-terminus to C-terminus, VL - linker - VH. Those of skill in the art would be able to select the appropriate configuration for use in the present invention.
The linker is typically rich in glycine for flexibility, as well as serine or threonine for solubility. The linker can link the heavy chain variable region and the light chain variable region of the extracellular antigen-binding domain. Non-limiting examples of linkers are disclosed in Shen et al., Anal. Chem. 80(6): 1910-1917 (2008) and WO 2014/087010, the contents of which are hereby incorporated by reference in their entireties. Various linker sequences are known in the art, including, without limitation, glycine serine (GS) linkers such as (GS)n, (GSGGS)n (SEQ ID NO: 33), (GGGS)n (SEQ ID NO: 34), and (GGGGS)n(SEQ ID NO: 35), where n represents an integer of at least 1 . Exemplary linker sequences can comprise amino acid sequences including, without limitation, GGSG (SEQ ID NO: 36), GGSGG (SEQ ID NO: 37), GSGSG (SEQ ID NO: 38), GSGGG (SEQ ID NO: 39), GGGSG (SEQ ID NO: 40), GSSSG (SEQ ID NO: 41), GGGGS (SEQ ID NO: 42), GGGGSGGGGSGGGGS (SEQ ID NO: 43) and the like. Those of skill in the art would be able to select the appropriate linker sequence for use in the present invention. In one embodiment, an antigen binding domain (e.g., CEACAM6 binding domain) of the present invention comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH and VL is separated by the linker sequence having the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 44), which may be encoded by a nucleic acid sequence comprising the nucleotide sequence ggtggcggtggctcgggcggtggtgggtcgggtggcggcggatct (SEQ ID NO: 45).
Despite removal of the constant regions and the introduction of a linker, scFv proteins retain the specificity of the original immunoglobulin. Single chain Fv polypeptide antibodies can be expressed from a nucleic acid comprising VH- and VL-encoding sequences as described by Huston, et al. (Proc. Nat. Acad. Sci. USA, 85:5879-5883, 1988). See, also, U.S. Patent Nos. 5,091,513, 5,132,405 and 4,956,778; and U.S. Patent Publication Nos. 20050196754 and 20050196754. Antagonistic scFvs having inhibitory activity have been described (see, e.g., Zhao et al., Hybridoma (Larchmt) 2008 27(6):455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 August 12; Shieh et al., JImunol 2009 183(4):2277-85; Giomarelli et al., Thromb Haemost 2007 97(6):955-63; Fife eta., J Clinlnvst 2006 116(8):2252-61 ; Brocks et al., Immunotechnolog' y 1997 3(3): 173-84; Moosmayer et al., Ther Immunol 1995 2(10:31-40). Agonistic scFvs having stimulatory activity have been described (see, e.g., Peter et al., JBioi Chem 2003 25278(38):36740-7; Xie et al., Nat Biotech 1997 15(8):768-71 ; Ledbetter et al., CritRev Immunol 1997 17(5-6):427-55; Ho et al., BioChim Biophys Acta 2003 1638(3):257-66).
As used herein, “Fab” refers to a fragment of an antibody structure that binds to an antigen but is monovalent and does not have a Fc portion, for example, an antibody digested by the enzyme papain yields two Fab fragments and an Fc fragment (e.g., a heavy (H) chain constant region; Fc region that does not bind to an antigen).
As used herein, “F(ab')2” refers to an antibody fragment generated by pepsin digestion of whole IgG antibodies, wherein this fragment has two antigen binding (ab’) (bivalent) regions, wherein each (ah') region comprises two separate amino acid chains, a part of a H chain and a light (L) chain linked by an S — S bond for binding an antigen and where the remaining H chain portions are linked together. A “F(ab')2” fragment can be split into two individual Fab' fragments.
In some instances, the antigen binding domain may be derived from the same species in which the CAR will ultimately be used. For example, for use in humans, the antigen binding domain of the CAR may comprise a human antibody as described elsewhere herein, or a fragment thereof.
In one embodiment, the CEACAM6 binding domain comprises a light chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 9. The light chain variable region of the CEACAM6 binding domain comprises three light chain complementaritydetermining regions (CDRs). As used herein, a “complementarity-determining region” or “CDR” refers to a region of the variable chain of an antigen binding molecule that binds to a specific antigen. Accordingly, a CEACAM6 binding domain may comprise a light chain variable region that comprises an LCDR1 comprising an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprising an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprising an amino acid sequence set forth in SEQ ID NO: 6.
In one embodiment, the CEACAM6 binding domain comprises a heavy chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 7. A CEACAM6 binding domain may comprise a heavy chain variable region that comprises a CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 3.
Tolerable variations of the CEACAM6 binding domain will be known to those of skill in the art, while maintaining specific binding to CEACAM6. For example, in some embodiments the CEACAM6 binding domain comprises an amino acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 18 and 20. In some embodiments, the CEACAM6 binding domain is encoded by a nucleic acid sequence comprising the nucleotide sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the nucleotide sequence set forth in SEQ ID NOs: 17 and 19.
The antigen binding domain may be operably linked to another domain of the CAR, such as the transmembrane domain or the costimulatory signaling domain, both described elsewhere herein. In one embodiment, a nucleic acid encoding the antigen binding domain is operably linked to a nucleic acid encoding a transmembrane domain and a nucleic acid encoding a costimulatory signaling domain.
The antigen binding domains described herein, such as the antibody or fragment thereof that binds to CEACAM6 can be combined with any of the transmembrane domains described herein, any of the intracellular domains or cytoplasmic domains described herein, or any of the other domains described herein that may be included in the CAR.
Transmembrane Domain
With respect to the transmembrane domain, the CAR of the present invention (e.g., CEACAM6 CAR) can be designed to comprise a transmembrane domain that connects the antigen binding domain of the CAR to the intracellular domain. The transmembrane domain of a subject CAR is a region that is capable of spanning the plasma membrane of a cell (e.g., an immune cell or precursor thereof). The transmembrane domain is for insertion into a cell membrane, e.g., a eukaryotic cell membrane. In some embodiments, the transmembrane domain is interposed between the antigen binding domain and the intracellular domain of a CAR.
In one embodiment, the transmembrane domain is naturally associated with one or more of the domains in the CAR. In some instances, the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.
The transmembrane domain may be derived either from a natural or from a synthetic source. Where the source is natural, the domain may be derived from any membrane-bound or transmembrane protein, e.g., a Type I transmembrane protein. Where the source is synthetic, the transmembrane domain may be any artificial sequence that facilitates insertion of the CAR into a cell membrane, e.g., an artificial hydrophobic sequence. Examples of the transmembrane regions of particular use in this invention include, without limitation, transmembrane domains derived from (i.e., comprise at least the transmembrane region(s) of) the alpha, beta or zeta chain of the T-cell receptor, CD28, CD2, CD3 epsilon, CD45, CD4, CD5, CD7, CD8, CD9, CD 16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9. In some embodiments, the transmembrane domain may be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine. In certain exemplary embodiments, a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.
The transmembrane domains described herein can be combined with any of the antigen binding domains described herein, any of the costimulatory signaling domains described herein, any of the intracellular signaling domains described herein, or any of the other domains described herein that may be included in a subject CAR.
In some embodiments, the transmembrane domain further comprises a hinge region. A subject CAR of the present invention may also include a hinge region. The hinge region of the CAR is a hydrophilic region which is located between the antigen binding domain and the transmembrane domain. In some embodiments, this domain facilitates proper protein folding for the CAR. The hinge region is an optional component for the CAR. The hinge region may include a domain selected from Fc fragments of antibodies, hinge regions of antibodies, CH2 regions of antibodies, CH3 regions of antibodies, artificial hinge sequences or combinations thereof. Examples of hinge regions include, without limitation, a CD8a hinge, artificial hinges made of polypeptides which may be as small as, three glycines (Gly), as well as CHI and CH3 domains of IgGs (such as human IgG4).
In some embodiments, a subject CAR of the present disclosure includes a hinge region that connects the antigen binding domain with the transmembrane domain, which, in turn, connects to the intracellular domain. The hinge region is preferably capable of supporting the antigen binding domain to recognize and bind to the target antigen on the target cells (see, e.g., Hudecek et al., Cancer Immunol. Res. (2015) 3(2): 125-135). In some embodiments, the hinge region is a flexible domain, thus allowing the antigen binding domain to have a structure to optimally recognize the specific structure and density of the target antigens on a cell such as tumor cell. The flexibility of the hinge region permits the hinge region to adopt many different conformations.
In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. In some embodiments, the hinge region is a hinge region polypeptide derived from a receptor (e.g., a CD8-derived hinge region).
The hinge region can have a length of from about 4 amino acids to about 50 amino acids, e.g., from about 4 amino acids to about 10 amino acids, from about 10 amino acids to about 15 amino acids, from about 15 amino acids to about 20 amino acids, from about 20 amino acids to about 25 amino acids, from about 25 amino acids to about 30 amino acids, from about 30 amino acids to about 40 amino acids, or from about 40 amino acids to about 50 amino acids.
Suitable hinge regions can be readily selected and can be of any of a number of suitable lengths, such as from 1 amino acid (e.g., Gly) to 20 amino acids, from 2 amino acids to 15 amino acids, from 3 amino acids to 12 amino acids, including 4 amino acids to 10 amino acids, 5 amino acids to 9 amino acids, 6 amino acids to 8 amino acids, or 7 amino acids to 8 amino acids, and can be 1, 2, 3, 4, 5, 6, or 7 amino acids.
For example, hinge regions include glycine polymers (G)n, glycine-serine polymers (including, for example, (GS)n, (GSGGS)n (SEQ ID NO: 33) and (GGGS)n (SEQ ID NO: 34), where n is an integer of at least one), glycine-alanine polymers, alanine-serine polymers, and other flexible linkers known in the art. Glycine and glycine-serine polymers can be used; both Gly and Ser are relatively unstructured, and therefore can serve as a neutral tether between components. Glycine polymers can be used; glycine accesses significantly more phi-psi space than even alanine, and is much less restricted than residues with longer side chains (see, e.g., Scheraga, Rev. Computational. Chem. (1992) 2: 73-142). Exemplary hinge regions can comprise amino acid sequences including, but not limited to, GGSG (SEQ ID NO: 36), GGSGG (SEQ ID NO: 37), GSGSG (SEQ ID NO: 38), GSGGG (SEQ ID NO: 39), GGGSG (SEQ ID NO: 40), GSSSG (SEQ ID NO: 41), and the like.
In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. Immunoglobulin hinge region amino acid sequences are known in the art; see, e.g., Tan et al., Proc. Natl. Acad. Sci. USA (1990) 87(1): 162-166; and Huck et al., Nucleic Acids Res. (1986) 14(4): 1779-1789. As non-limiting examples, an immunoglobulin hinge region can include one of the following amino acid sequences: DKTHT (SEQ ID NO: 46); CPPC (SEQ ID NO: 47); CPEPKSCDTPPPCPR (SEQ ID NO: 48) (see, e g., Glaser et al., J. Biol. Chem. (2005) 280:41494-41503); ELKTPLGDTTHT (SEQ ID NO: 49); KSCDKTHTCP (SEQ ID NO: 50); KCCVDCP (SEQ ID NO: 51); KYGPPCP (SEQ ID NO: 52); EPKSCDKTHTCPPCP (SEQ ID NO: 53) (human IgGl hinge); ERKCCVECPPCP (SEQ ID NO: 54) (human IgG2 hinge); ELKTPLGDTTHTCPRCP (SEQ ID NO: 55) (human IgG3 hinge); SPNMVPHAHHAQ (SEQ ID NO: 56) (human IgG4 hinge); and the like.
The hinge region can comprise an amino acid sequence of a human IgGl, IgG2, IgG3, or IgG4, hinge region. In one embodiment, the hinge region can include one or more amino acid substitutions and/or insertions and/or deletions compared to a wild-type (naturally-occurring) hinge region. For example, His229 of human IgGl hinge can be substituted with Tyr, so that the hinge region comprises the sequence EPKSCDKTYTCPPCP (SEQ ID NO: 53); see, e.g., Yan et al., J. Biol. Chem. (2012) 287: 5891-5897. In one embodiment, the hinge region can comprise an amino acid sequence derived from human CD8, or a variant thereof.
In one embodiment, the transmembrane domain comprises a CD8a transmembrane domain. In some embodiments, a subject CAR comprises a CD8a transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO: 14.
In another embodiment, a subject CAR comprises a CD8a hinge domain and a CD8a transmembrane domain. In one embodiment, the CD8a hinge domain comprises the amino acid sequence set forth in SEQ ID NO: 13.
Tolerable variations of the transmembrane and/or hinge domain will be known to those of skill in the art, while maintaining its intended function. For example, in some embodiments a transmembrane domain or hinge domain comprises an amino acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least
83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least
90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least
97%, at least 98%, at least 99% sequence identity to any of the amino acid sequences set forth in
SEQ ID NOs: 13 and 14.
The transmembrane domain may be combined with any hinge domain and/or may comprise one or more transmembrane domains described herein. The transmembrane domains described herein, such as a transmembrane region of alpha, beta or zeta chain of the T-cell receptor, CD28, CD2, CD3 epsilon, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9, can be combined with any of the antigen binding domains described herein, any of the costimulatory signaling domains or intracellular domains or cytoplasmic domains described herein, or any of the other domains described herein that may be included in the CAR.
In one embodiment, the transmembrane domain may be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine. In exemplary embodiments, a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.
In some embodiments, a subject CAR may further comprise, between the extracellular domain and the transmembrane domain of the CAR, or between the intracellular domain and the transmembrane domain of the CAR, a spacer domain. As used herein, the term “spacer domain” generally means any oligo- or polypeptide that functions to link the transmembrane domain to, either the extracellular domain or, the intracellular domain in the polypeptide chain. A spacer domain may comprise up to 300 amino acids, e.g., 10 to 100 amino acids, or 25 to 50 amino acids. In some embodiments, the spacer domain may be a short oligo- or polypeptide linker, e.g., between 2 and 10 amino acids in length. For example, glycine-serine doublet provides a particularly suitable linker between the transmembrane domain and the intracellular signaling domain of the subject CAR.
Accordingly, a subject CAR of the present disclosure may comprise any of the transmembrane domains, hinge domains, or spacer domains described herein.
Intracellular Domain
A subject CAR of the present invention also includes an intracellular domain. The intracellular domain of the CAR is responsible for activation of at least one of the effector functions of the cell in which the CAR is expressed (e.g., immune cell). The intracellular domain transduces the effector function signal and directs the cell (e.g., immune cell) to perform its specialized function, e.g., harming and/or destroying a target cell. The intracellular domain or otherwise the cytoplasmic domain of the CAR is responsible for activation of the cell in which the CAR is expressed. Examples of an intracellular domain for use in the invention include, but are not limited to, the cytoplasmic portion of a surface receptor, co- stimulatory molecule, and any molecule that acts in concert to initiate signal transduction in the T cell, as well as any derivative or variant of these elements and any synthetic sequence that has the same functional capability.
In certain embodiments, the intracellular domain comprises a costimulatory signaling domain. In certain embodiments, the intracellular domain comprises an intracellular signaling domain. In certain embodiments, the intracellular domain comprises a costimulatory signaling domain and an intracellular signaling domain. In certain embodiments, the intracellular domain comprises CD2 and CD3 zeta. In certain embodiments, the intracellular domain comprises 4- 1BB and CD3 zeta. In certain embodiments, the intracellular domain comprises CD28 and CD3 zeta. In certain embodiments, the intracellular domain comprises CD27 and CD3 zeta. In certain embodiments, the intracellular domain comprises ICOS and CD3 zeta. In certain embodiments, the intracellular domain comprises 0X40 and CD3 zeta. In certain embodiments, the costimulatory signaling domain comprises a CD2 signaling domain. In certain embodiments, the costimulatory signaling domain comprises a 4-1BB signaling domain. In certain embodiments, the costimulatory signaling domain comprises a CD27 signaling domain. In certain embodiments, the costimulatory signaling domain comprises a CD28 signaling domain. In certain embodiments, the costimulatory signaling domain comprises an ICOS signaling domain. In certain embodiments, the costimulatory signaling domain comprises an 0X40 signaling domain. In certain embodiments, the intracellular signaling domain comprises a CD3 zeta signaling domain.
In one embodiment, the intracellular domain of the CAR comprises a costimulatory signaling domain which includes any portion of one or more co-stimulatory molecules, such as at least one signaling domain from CD2, CD3, CD8, CD27, CD28, 0X40, ICOS, 4-1BB, PD-1, any derivative or variant thereof, any synthetic sequence thereof that has the same functional capability, and any combination thereof.
Examples of the intracellular signaling domain include, without limitation, the chain of the T cell receptor complex or any of its homologs, e.g., q chain, FcsRTy and chains, MB 1 (Iga) chain, B29 (Ig) chain, etc., human CD3 zeta chain, CD3 polypeptides (A, 8 and a), syk family tyrosine kinases (Syk, ZAP 70, etc.), src family tyrosine kinases (Lek, Fyn, Lyn, etc.), and other molecules involved in T cell transduction, such as CD2, CD5 and CD28. In one embodiment, the intracellular signaling domain may be human CD3 zeta chain, FcyRIII, FcsRI, cytoplasmic tails of Fc receptors, an immunoreceptor tyrosine-based activation motif (IT AM) bearing cytoplasmic receptors, and combinations thereof.
Other examples of the intracellular domain include a fragment or domain from one or more molecules or receptors including, but are not limited to, TCR, CD3 zeta, CD3 gamma, CD3 delta, CD3 epsilon, CD86, common FcR gamma, FcR beta (Fc Epsilon Rib), CD79a, CD79b, Fc gamma R1 la, DAP10, DAP12, T cell receptor (TCR), CD8, CD27, CD28, 4-1BB (CD137), 0X9, 0X40, CD30, CD40, PD-1, ICOS, a KIR family protein, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83, CD5, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD127, CD160, CD19, CD4, CD8alpha, CD8beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD lid, ITGAE, CD 103, ITGAL, CDl la, LFA-1, ITGAM, CDl lb, ITGAX, CDl lc, ITGB1, CD29, ITGB2, CD18, LFA- 1, ITGB7, TNFR2, TRANCE/RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD 150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, LAT, GADS, SLP-76, PAG/Cbp, NKp44, NKp30, NKp46, NKG2D, Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, other co-stimulatory molecules described herein, any derivative, variant, or fragment thereof, any synthetic sequence of a co-stimulatory molecule that has the same functional capability, and any combination thereof.
Additional examples of intracellular domains include, without limitation, intracellular signaling domains of several types of various other immune signaling receptors, including, but not limited to, first, second, and third generation T cell signaling proteins including CD3, B7 family costimulatory, and Tumor Necrosis Factor Receptor (TNFR) superfamily receptors (see, e.g., Park and Brentjens, J. Clin. Oncol. (2015) 33(6): 651-653). Additionally, intracellular signaling domains may include signaling domains used by NK and NKT cells (see, e.g., Hermanson and Kaufman, Front. Immunol. (2015) 6: 195) such as signaling domains of NKp30 (B7-H6) (see, e.g., Zhang et al., J. Immunol. (2012) 189(5): 2290-2299), and DAP 12 (see, e.g., Topfer et al., J. Immunol. (2015) 194(7): 3201-3212), NKG2D, NKp44, NKp46, DAP10, and CD3z.
Intracellular signaling domains suitable for use in a subject CAR of the present invention include any desired signaling domain that provides a distinct and detectable signal (e.g., increased production of one or more cytokines by the cell; change in transcription of a target gene; change in activity of a protein; change in cell behavior, e.g., cell death; cellular proliferation; cellular differentiation; cell survival; modulation of cellular signaling responses; etc.) in response to activation of the CAR (i.e., activated by antigen and dimerizing agent). In some embodiments, the intracellular signaling domain includes at least one (e.g., one, two, three, four, five, six, etc.) IT AM motifs as described below. In some embodiments, the intracellular signaling domain includes DAP10/CD28 type signaling chains. In some embodiments, the intracellular signaling domain is not covalently attached to the membrane bound CAR, but is instead diffused in the cytoplasm.
Intracellular signaling domains suitable for use in a subject CAR of the present invention include immunoreceptor tyrosine-based activation motif (ITAM)-containing intracellular signaling polypeptides. In some embodiments, an IT AM motif is repeated twice in an intracellular signaling domain, where the first and second instances of the ITAM motif are separated from one another by 6 to 8 amino acids. In one embodiment, the intracellular signaling domain of a subject CAR comprises 3 ITAM motifs. In some embodiments, intracellular signaling domains includes the signaling domains of human immunoglobulin receptors that contain immunoreceptor tyrosine based activation motifs (ITAMs) such as, but not limited to, Fc gamma RI, Fc gamma RIIA, Fc gamma RIIC, Fc gamma RIIIA, FcRL5 (see, e.g., Gillis et al., Front. (2014) Immunol. 5:254).
A suitable intracellular signaling domain can be an ITAM motif-containing portion that is derived from a polypeptide that contains an ITAM motif. For example, a suitable intracellular signaling domain can be an ITAM motif-containing domain from any ITAM motif-containing protein. Thus, a suitable intracellular signaling domain need not contain the entire sequence of the entire protein from which it is derived. Examples of suitable ITAM motif-containing polypeptides include, but are not limited to: DAP12, FCER1G (Fc epsilon receptor I gamma chain), CD3D (CD3 delta), CD3E (CD3 epsilon), CD3G (CD3 gamma), CD3Z (CD3 zeta), and CD79A (antigen receptor complex-associated protein alpha chain). In one embodiment, the intracellular signaling domain is derived from DAP12 (also known as TYROBP; TYRO protein tyrosine kinase binding protein; KARAP; PLOSL; DNAX- activation protein 12; KAR-associated protein; TYRO protein tyrosine kinase-binding protein; killer activating receptor associated protein; killer-activating receptor-associated protein; etc.). In one embodiment, the intracellular signaling domain is derived from FCER1G (also known as FCRG; Fc epsilon receptor I gamma chain; Fc receptor gamma-chain; fc-epsilon Rl-gamma; fcR gamma; fceRl gamma; high affinity immunoglobulin epsilon receptor subunit gamma; immunoglobulin E receptor, high affinity, gamma chain; etc.). In one embodiment, the intracellular signaling domain is derived from T-cell surface glycoprotein CD3 delta chain (also known as CD3D; CD3-DELTA; T3D; CD3 antigen, delta subunit; CD3 delta; CD3d antigen, delta polypeptide (TiT3 complex); OKT3, delta chain; T-cell receptor T3 delta chain; T-cell surface glycoprotein CD3 delta chain; etc.). In one embodiment, the intracellular signaling domain is derived from T-cell surface glycoprotein CD3 epsilon chain (also known as CD3e, T- cell surface antigen T3/Leu-4 epsilon chain, T-cell surface glycoprotein CD3 epsilon chain, AI504783, CD3, CD3epsilon, T3e, etc.). In one embodiment, the intracellular signaling domain is derived from T-cell surface glycoprotein CD3 gamma chain (also known as CD3G, T-cell receptor T3 gamma chain, CD3-GAMMA, T3G, gamma polypeptide (TiT3 complex), etc.). In one embodiment, the intracellular signaling domain is derived from T-cell surface glycoprotein CD3 zeta chain (also known as CD3Z, T-cell receptor T3 zeta chain, CD247, CD3-ZETA, CD3H, CD3Q, T3Z, TCRZ, etc ). In one embodiment, the intracellular signaling domain is derived from CD79A (also known as B-cell antigen receptor complex-associated protein alpha chain; CD79a antigen (immunoglobulin-associated alpha); MB-1 membrane glycoprotein; Ig- alpha; membrane-bound immunoglobulin-associated protein; surface IgM-associated protein; etc.). In one embodiment, an intracellular signaling domain suitable for use in a subject CAR of the present disclosure includes a DAP10/CD28 type signaling chain. In one embodiment, an intracellular signaling domain suitable for use in a subject CAR of the present disclosure includes a ZAP70 polypeptide. In some embodiments, the intracellular signaling domain includes a cytoplasmic signaling domain of TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, or CD66d. In one embodiment, the intracellular signaling domain in the CAR includes a cytoplasmic signaling domain of human CD3 zeta. While usually the entire intracellular signaling domain can be employed, in many cases it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such truncated portion may be used in place of the intact chain as long as it transduces the effector function signal. The intracellular signaling domain includes any truncated portion of the intracellular signaling domain sufficient to transduce the effector function signal.
The intracellular signaling domains described herein can be combined with any of the costimulatory signaling domains described herein, any of the antigen binding domains described herein, any of the transmembrane domains described herein, or any of the other domains described herein that may be included in the CAR.
In one embodiment, the intracellular domain of a subject CAR comprises a CD2 costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO: 15.
In one embodiment, the intracellular domain of a subject CAR comprises a CD3 zeta intracellular signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 16.
Tolerable variations of the intracellular domain will be known to those of skill in the art, while maintaining specific activity. For example, in some embodiments the intracellular domain comprises an amino acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 15 and 16.
In one exemplary embodiment, the intracellular domain of a subject CAR comprises a CD2 costimulatory domain and a CD3 zeta intracellular signaling domain. In another exemplary embodiment, the intracellular domain of a subject CAR comprises a 4- IBB costimulatory domain and a CD3 zeta intracellular signaling domain. In another exemplary embodiment, the intracellular domain of a subject CAR comprises a CD27 costimulatory domain and a CD3 zeta intracellular signaling domain. In another exemplary embodiment, the intracellular domain of a subject CAR comprises a CD28 costimulatory domain and a CD3 zeta intracellular signaling domain. In another exemplary embodiment, the intracellular domain of a subject CAR comprises an ICOS costimulatory domain and a CD3 zeta intracellular signaling domain. In another exemplary embodiment, the intracellular domain of a subject CAR comprises an 0X40 costimulatory domain and a CD3 zeta intracellular signaling domain.
Modified Immune Cells
The present invention provides a modified immune cell or precursor cell thereof (e.g., a modified T cell, a modified NK cell, a modified NKT cell), comprising a subject CAR. Accordingly, such modified cells possess the specificity directed by the CAR that is expressed therein. For example, a modified cell of the present invention comprising a CEACAM6 CAR possesses specificity for CEACAM6 on a target cell.
Any modified cell comprising a CAR comprising any antigen binding domain, any hinge, any transmembrane domain, any intracellular costimulatory domain, and any intracellular signaling domain described herein is envisioned, and can readily be understood and made by a person of skill in the art in view of the disclosure herein.
In some embodiments, the modified cell is an immune cell or precursor cell thereof. In an exemplary embodiment, the modified cell is a T cell. In an exemplary embodiment, the modified cell is an autologous cell. In an exemplary embodiment, the modified cell is an autologous immune cell or precursor cell thereof. In an exemplary embodiment, the modified cell is an autologous T cell.
Nucleic Acids and Expression Vectors
The present invention provides a nucleic acid encoding a CAR having affinity for CEACAM6. As described herein, a subject CAR comprises an antigen binding domain (e.g., CEACAM6 binding domain), a transmembrane domain, and an intracellular domain. Accordingly, the present invention provides a nucleic acid encoding an antigen binding domain (e.g., CEACAM6 binding domain), a transmembrane domain, and an intracellular domain of a subject CAR.
In an exemplary embodiment, the antigen binding domain of the CEACAM6 CAR of the present invention is encoded by any one of the nucleotide sequences set forth in SEQ ID NOs: 17 and 19.
In an exemplary embodiment, the CEACAM6 CAR of the present invention is encoded by any one of the nucleotide sequences set forth in SEQ ID NOs: 24, 26, 28, 30, and 32. In some embodiments, a nucleic acid of the present disclosure may be operably linked to a transcriptional control element, e.g., a promoter, and enhancer, etc. Suitable promoter and enhancer elements are known to those of skill in the art.
For expression in a bacterial cell, suitable promoters include, but are not limited to, lad, lacZ, T3, T7, gpt, lambda P and trc. For expression in a eukaryotic cell, suitable promoters include, but are not limited to, light and/or heavy chain immunoglobulin gene promoter and enhancer elements; cytomegalovirus immediate early promoter; herpes simplex virus thymidine kinase promoter; early and late SV40 promoters; promoter present in long terminal repeats from a retrovirus; mouse metallothionein-I promoter; and various art-known tissue specific promoters. Suitable reversible promoters, including reversible inducible promoters are known in the art. Such reversible promoters may be isolated and derived from many organisms, e.g., eukaryotes and prokaryotes. Modification of reversible promoters derived from a first organism for use in a second organism, e.g., a first prokaryote and a second a eukaryote, a first eukaryote and a second a prokaryote, etc., is well known in the art. Such reversible promoters, and systems based on such reversible promoters but also comprising additional control proteins, include, but are not limited to, alcohol regulated promoters (e.g., alcohol dehydrogenase I (alcA) gene promoter, promoters responsive to alcohol transactivator proteins (AlcR), etc.), tetracycline regulated promoters, (e.g., promoter systems including TetActivators, TetON, TetOFF, etc.), steroid regulated promoters (e.g., rat glucocorticoid receptor promoter systems, human estrogen receptor promoter systems, retinoid promoter systems, thyroid promoter systems, ecdysone promoter systems, mifepristone promoter systems, etc.), metal regulated promoters (e.g., metallothionein promoter systems, etc.), pathogenesis-related regulated promoters (e.g., salicylic acid regulated promoters, ethylene regulated promoters, benzothiadiazole regulated promoters, etc.), temperature regulated promoters (e.g., heat shock inducible promoters (e.g., HSP-70, HSP-90, soybean heat shock promoter, etc.), light regulated promoters, synthetic inducible promoters, and the like.
In some embodiments, the promoter is a CD8 cell-specific promoter, a CD4 cell-specific promoter, a neutrophil-specific promoter, or an NK-specific promoter. For example, a CD4 gene promoter can be used; see, e.g., Salmon et al. Proc. Natl. Acad. Sci. USA (1993) 90:7739; and Marodon et al. (2003) Blood 101 :3416. As another example, a CD8 gene promoter can be used. NK cell-specific expression can be achieved by use of an Neri (p46) promoter; see, e.g., Eckelhart et al. Blood (2011) 117: 1565.
For expression in a yeast cell, a suitable promoter is a constitutive promoter such as an ADH1 promoter, a PGK1 promoter, an ENO promoter, a PYK1 promoter and the like; or a regulatable promoter such as a GALI promoter, a GAL 10 promoter, an ADH2 promoter, a PHOS promoter, a CUP1 promoter, a GALT promoter, a MET25 promoter, a MET3 promoter, a CYC1 promoter, a HIS3 promoter, an ADH1 promoter, a PGK promoter, a GAPDH promoter, an ADC1 promoter, a TRP1 promoter, a URA3 promoter, a LEU2 promoter, an ENO promoter, a TP1 promoter, and AOX1 (e.g., for use in Pichia). Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art. Suitable promoters for use in prokaryotic host cells include, but are not limited to, a bacteriophage T7 RNA polymerase promoter; a trp promoter; a lac operon promoter; a hybrid promoter, e.g., a lac/tac hybrid promoter, a tac/trc hybrid promoter, a trp/lac promoter, a T7/lac promoter; a trc promoter; a tac promoter, and the like; an araBAD promoter; in vivo regulated promoters, such as an ssaG promoter or a related promoter (see, e.g., U.S. Patent Publication No. 20040131637), a pagC promoter (Pulkkinen and Miller, J. Bacteriol. (1991) 173(1): 86-93; Alpuche- Aranda et al., Proc. Natl. Acad. Sci. USA (1992) 89(21): 10079-83), a nirB promoter (Harbome et al. Mol. Micro. (1992) 6:2805-2813), and the like (see, e.g., Dunstan et al., Infect. Immim. (1999) 67:5133-5141; McKelvie et al., Vaccine (2004) 22:3243-3255; and Chatfield et al., Biotechnol. (1992) 10:888- 892); a sigma70 promoter, e.g., a consensus sigma70 promoter (see, e.g., GenBank Accession Nos. AX798980, AX798961, and AX798183); a stationary phase promoter, e.g., a dps promoter, an spv promoter, and the like; a promoter derived from the pathogenicity island SPL2 (see, e.g., WO96/17951); an actA promoter (see, e.g., Shetron-Rama et al., Infect. Immun. (2002) 70: 1087- 1096); an rpsM promoter (see, e.g., Valdivia and Falkow Mol. Microbiol. (1996). 22:367); a tet promoter (see, e.g., Hillen, W. and Wissmann, A. (1989) In Saenger, W. and Heinemann, U. (eds), Topics in Molecular and Structural Biology, Protein— Nucleic Acid Interaction. Macmillan, London, UK, Vol. 10, pp. 143-162); an SP6 promoter (see, e.g., Melton et al., Nncl. Acids Res. (1984) 12:7035); and the like. Suitable strong promoters for use in prokaryotes such as Escherichia coli include, but are not limited to Trc, Tac, T5, T7, and P Lambda. Non-limiting examples of operators for use in bacterial host cells include a lactose promoter operator (LacI repressor protein changes conformation when contacted with lactose, thereby preventing the Lad repressor protein from binding to the operator), a tryptophan promoter operator (when complexed with tryptophan, TrpR repressor protein has a conformation that binds the operator; in the absence of tryptophan, the TrpR repressor protein has a conformation that does not bind to the operator), and a tac promoter operator (see, e.g., deBoer et al., Proc. Natl. Acad. Set. U.S.A. (1983) 80:21-25).
Other examples of suitable promoters include the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operatively linked thereto. However, other constitutive promoter sequences may also be used, including, but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, the EF-1 alpha promoter, as well as human gene promoters such as, but not limited to, the actin promoter, the myosin promoter, the hemoglobin promoter, and the creatine kinase promoter. Further, the invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the invention. The use of an inducible promoter provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired, or turning off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter.
In some embodiments, the locus or construct or transgene containing the suitable promoter is irreversibly switched through the induction of an inducible system. Suitable systems for induction of an irreversible switch are well known in the art, e g., induction of an irreversible switch may make use of a Cre-lox-mediated recombination (see, e.g., Fuhrmann-Benzakein, et al., Proc. Natl. Acad. Set. USA (2000) 28:e99, the disclosure of which is incorporated herein by reference). Any suitable combination of recombinase, endonuclease, ligase, recombination sites, etc. known to the art may be used in generating an irreversibly switchable promoter. Methods, mechanisms, and requirements for performing site-specific recombination, described elsewhere herein, find use in generating irreversibly switched promoters and are well known in the art, see, e.g., Grindley et al. Annual Review of Biochemistry (2006) 567-605; and Tropp, Molecular Biology (2012) (Jones & Bartlett Publishers, Sudbury, MA), the disclosures of which are incorporated herein by reference.
A nucleic acid of the present disclosure may be present within an expression vector and/or a cloning vector. An expression vector can include a selectable marker, an origin of replication, and other features that provide for replication and/or maintenance of the vector. Suitable expression vectors include, e.g., plasmids, viral vectors, and the like. Large numbers of suitable vectors and promoters are known to those of skill in the art; many are commercially available for generating a subject recombinant construct. The following vectors are provided by way of example, and should not be construed in any way as limiting: Bacterial: pBs, phagescript, PsiX174, pBluescript SK, pBs KS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene, La Jolla, Calif, USA); pTrc99A, pKK223-3, pKK233-3, pDR540, and pRIT5 (Pharmacia, Uppsala, Sweden). Eukaryotic: pWLneo, pSV2cat, pOG44, PXR1, pSG (Stratagene) pSVK3, pBPV, pMSG and pSVL (Pharmacia).
Expression vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding heterologous proteins. A selectable marker operative in the expression host may be present. Suitable expression vectors include, but are not limited to, viral vectors (e.g. viral vectors based on vaccinia virus; poliovirus; adenovirus (see, e.g., Li et al., Invest. OpthalmoL Vis. Sei. (1994) 35: 2543-2549; Borras et al., Gene Th t. (1999) 6: 515-524; Li and Davidson, Proc. Natl. Acad. Set. USA (1995) 92: 7700-7704; Sakamoto et al., H. Gene Ther. (1999) 5: 1088-1097; WO 94/12649, WO 93/03769; WO 93/19191; WO 94/28938; WO 95/11984 and WO 95/00655); adeno-associated virus (see, e.g., Ali et al., Hum. Gene Ther. (1998) 9: 81-86, Flannery et al., Proc. Natl. Acad. Set. USA (1997) 94: 6916-6921; Bennett et al., Invest. OpthalmoL Vis. Set. (1997) 38: 2857- 2863; Jomary et al., Gene Ther. (1997) 4:683 690, Rolling et al., Hum. Gene Ther. (1999) 10: 641-648; Ali et al., Hum. Mol. Genet. (1996) 5: 591-594; Srivastava in WO 93/09239, Samulski et al., J. Vir. (1989) 63: 3822-3828; Mendelson et al., Virol. (1988) 166: 154-165; and Flotte et al., Proc. Natl. Acad. Sci. USA (1993) 90: 10613-10617); SV40; herpes simplex virus; human immunodeficiency virus (see, e.g., Miyoshi et al., Proc. Natl. Acad. Sci. USA (1997) 94: 10319- 23; Takahashi et al., J. Virol. (1999) 73: 7812-7816); a retroviral vector (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus); and the like.
Additional expression vectors suitable for use are, e.g., without limitation, a lentivirus vector, a gamma retrovirus vector, a foamy virus vector, an adeno-associated virus vector, an adenovirus vector, a pox virus vector, a herpes virus vector, an engineered hybrid virus vector, a transposon mediated vector, and the like. Viral vector technology is well known in the art and is described, for example, in Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, volumes 1-4, Cold Spring Harbor Press, NY), and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno- associated viruses, herpes viruses, and lentiviruses.
In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers, (e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193).
In some embodiments, an expression vector (e.g., a lentiviral vector) may be used to introduce the CAR into an immune cell or precursor thereof (e.g., a T cell). Accordingly, an expression vector (e g., a lentiviral vector) of the present invention may comprise a nucleic acid encoding a CAR. In some embodiments, the expression vector (e.g., lentiviral vector) will comprise additional elements that will aid in the functional expression of the CAR encoded therein. In some embodiments, an expression vector comprising a nucleic acid encoding a CAR further comprises a mammalian promoter. In one embodiment, the vector further comprises an elongation-factor- 1 -alpha promoter (EF-la promoter). Use of an EF-la promoter may increase the efficiency in expression of downstream transgenes (e.g., a CAR encoding nucleic acid sequence). Physiologic promoters (e.g., an EF-la promoter) may be less likely to induce integration mediated genotoxicity, and may abrogate the ability of the retroviral vector to transform stem cells. Other physiological promoters suitable for use in a vector (e.g., a lentiviral vector) are known to those of skill in the art and may be incorporated into a vector of the present invention. In some embodiments, the vector (e.g., a lentiviral vector) further comprises a nonrequisite cis acting sequence that may improve titers and gene expression. One non-limiting example of a non-requisite cis acting sequence is the central polypurine tract and central termination sequence (cPPT/CTS) which is important for efficient reverse transcription and nuclear import. Other non-requisite cis acting sequences are known to those of skill in the art and may be incorporated into a vector (e.g., lentiviral vector) of the present invention. In some embodiments, the vector further comprises a posttranscriptional regulatory element. Posttranscriptional regulatory elements may improve RNA translation, improve transgene expression and stabilize RNA transcripts. One example of a posttranscriptional regulatory element is the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE). Accordingly, in some embodiments a vector for the present invention further comprises a WPRE sequence. Various posttranscriptional regulator elements are known to those of skill in the art and may be incorporated into a vector (e.g., a lentiviral vector) of the present invention. A vector of the present invention may further comprise additional elements such as a rev response element (RRE) for RNA transport, packaging sequences, and 5’ and 3’ long terminal repeats (LTRs). The term “long terminal repeat” or “LTR” refers to domains of base pairs located at the ends of retroviral DNAs which comprise U3, R and U5 regions. LTRs generally provide functions required for the expression of retroviral genes (e.g., promotion, initiation and poly adenylation of gene transcripts) and to viral replication. In one embodiment, a vector (e.g., lentiviral vector) of the present invention includes a 3’ U3 deleted LTR. Accordingly, a vector (e.g., lentiviral vector) of the present invention may comprise any combination of the elements described herein to enhance the efficiency of functional expression of transgenes. For example, a vector (e.g., lentiviral vector) of the present invention may comprise a WPRE sequence, cPPT sequence, RRE sequence, 5 ’LTR, 3’ U3 deleted LTR’ in addition to a nucleic acid encoding for a CAR.
Vectors of the present invention may be self-inactivating vectors. As used herein, the term “self-inactivating vector” refers to vectors in which the 3’ LTR enhancer promoter region (U3 region) has been modified (e.g., by deletion or substitution). A self-inactivating vector may prevent viral transcription beyond the first round of viral replication. Consequently, a selfinactivating vector may be capable of infecting and then integrating into a host genome (e.g., a mammalian genome) only once, and cannot be passed further. Accordingly, self-inactivating vectors may greatly reduce the risk of creating a replication-competent virus.
In some embodiments, a nucleic acid of the present invention may be RNA, e.g., in vitro synthesized RNA. Methods for in vitro synthesis of RNA are known to those of skill in the art; any known method can be used to synthesize RNA comprising a sequence encoding a CAR of the present disclosure. Methods for introducing RNA into a host cell are known in the art. See, e.g., Zhao et al. Cancer Res. (2010) 15: 9053. Introducing RNA comprising a nucleotide sequence encoding a CAR of the present disclosure into a host cell can be carried out in vitro or ex vivo or in vivo. For example, a host cell (e.g., an NK cell, a cytotoxic T lymphocyte, etc.) can be electroporated in vitro or ex vivo with RNA comprising a nucleotide sequence encoding a CAR of the present disclosure.
In order to assess the expression of a polypeptide or portions thereof, the expression vector to be introduced into a cell may also contain either a selectable marker gene or a reporter gene, or both, to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors. In some embodiments, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers include, without limitation, antibiotic-resistance genes.
Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. In general, a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a polypeptide whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assessed at a suitable time after the DNA has been introduced into the recipient cells. Suitable reporter genes may include, without limitation, genes encoding luciferase, betagalactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (e.g., Ui-Tei et al., 2000 FEBS Letters 479: 79-82).
Methods of Generating Modified Immune Cells
The present invention provides methods for producing/generating a modified immune cell or precursor cell thereof (e.g., a T cell/ NK cell / NKT cell). The cells are generally engineered by introducing a nucleic acid encoding a subject CAR (e.g., CEACAM6 or mAb!09 CAR).
Methods of introducing nucleic acids into a cell include physical, biological and chemical methods. Physical methods for introducing a polynucleotide, such as RNA, into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. RNA can be introduced into target cells using commercially available methods which include electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, MA) or the Gene Pulser II (BioRad, Denver, CO), Multiporator (Eppendorf, Hamburg Germany). RNA can also be introduced into cells using cationic liposome mediated transfection using lipofection, using polymer encapsulation, using peptide mediated transfection, or using biolistic particle delivery systems such as “gene guns” (see, for example, Nishikawa, et al. Hum Gene Ther., 12(8):861-70 (2001).
Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.
In some embodiments, a nucleic acid encoding a subject CAR of the invention is introduced into a cell by an expression vector. Expression vectors comprising a nucleic acid encoding a subject CAR (e.g., CEACAM6 or mAb!09 CAR) are provided herein. Suitable expression vectors include lentivirus vectors, gamma retrovirus vectors, foamy virus vectors, adeno associated virus (AAV) vectors, adenovirus vectors, engineered hybrid viruses, naked DNA, including but not limited to transposon mediated vectors, such as Sleeping Beauty, Piggyback, and Integrases such as Phi31. Some other suitable expression vectors include herpes simplex virus (HSV) and retrovirus expression vectors.
Adenovirus expression vectors are based on adenoviruses, which have a low capacity for integration into genomic DNA but a high efficiency for transfecting host cells. Adenovirus expression vectors contain adenovirus sequences sufficient to: (a) support packaging of the expression vector and (b) to ultimately express the subject CAR in the host cell. In some embodiments, the adenovirus genome is a 36 kb, linear, double stranded DNA, where a foreign DNA sequence (e.g., a nucleic acid encoding a subject CAR) may be inserted to substitute large pieces of adenoviral DNA in order to make the expression vector of the present invention (see, e.g., Danthinne and Imperiale, Gene Therapy (2000) 7(20): 1707-1714).
Another expression vector is based on an adeno associated virus, which takes advantage of the adenovirus coupled systems. This AAV expression vector has a high frequency of integration into the host genome. It can infect non-dividing cells, thus making it useful for delivery of genes into mammalian cells, for example, in tissue cultures or in vivo. The AAV vector has a broad host range for infectivity. Details concerning the generation and use of AAV vectors are described in U.S. Patent Nos. 5,139,941 and 4,797,368.
Retrovirus expression vectors are capable of integrating into the host genome, delivering a large amount of foreign genetic material, infecting a broad spectrum of species and cell types and being packaged in special cell lines. The retrovirus vector is constructed by inserting a nucleic acid (e.g., a nucleic acid encoding a subject CAR) into the viral genome at certain locations to produce a virus that is replication defective. Though the retrovirus vectors are able to infect a broad variety of cell types, integration and stable expression of the subject CAR, requires the division of host cells.
Lentivirus vectors are derived from lentiviruses, which are complex retroviruses that, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural function (see, e.g., U.S. Patent Nos. 6,013,516 and 5,994, 136). Some examples of lentiviruses include the human immunodeficiency viruses (HIV-1, HIV-2) and the simian immunodeficiency virus (SIV). Lentivirus vectors have been generated by multiply attenuating the HIV virulence genes, for example, the genes env, vif, vpr, vpu and nef are deleted making the vector biologically safe. Lentivirus vectors are capable of infecting non-dividing cells and can be used for both in vivo and ex vivo gene transfer and expression, e.g., of a nucleic acid encoding a subject CAR (see, e.g., U.S. Patent No. 5,994,136).
Expression vectors including a nucleic acid of the present disclosure can be introduced into a host cell by any means known to persons skilled in the art. The expression vectors may include viral sequences for transfection, if desired. Alternatively, the expression vectors may be introduced by fusion, electroporation, biolistics, transfection, lipofection, or the like. The host cell may be grown and expanded in culture before introduction of the expression vectors, followed by the appropriate treatment for introduction and integration of the vectors. The host cells are then expanded and may be screened by virtue of a marker present in the vectors. Various markers that may be used are known in the art, and may include hprt, neomycin resistance, thymidine kinase, hygromycin resistance, etc. As used herein, the terms “cell,” “cell line,” and “cell culture” may be used interchangeably. In some embodiments, the host cell is an immune cell or precursor thereof, e.g., a T cell, an NK cell, or an NKT cell.
The present invention also provides genetically engineered cells which include and stably express a subject CAR of the present disclosure. In some embodiments, the genetically engineered cells are genetically engineered T-lymphocytes (T cells), regulatory T cells (Tregs), naive T cells (TN), memory T cells (for example, central memory T cells (TCM), effector memory cells (TEM)), natural killer cells (NK cells), natural killer T cells (NKT cells) and macrophages capable of giving rise to therapeutically relevant progeny. In one embodiment, the genetically engineered cells are autologous cells.
Modified cells (e.g., comprising a subject CAR) may be produced by stably transfecting host cells with an expression vector including a nucleic acid of the present disclosure. Additional methods to generate a modified cell of the present disclosure include, without limitation, chemical transformation methods (e.g., using calcium phosphate, dendrimers, liposomes and/or cationic polymers), non-chemical transformation methods (e.g., electroporation, optical transformation, gene electrotransfer and/or hydrodynamic delivery) and/or particle-based methods (e.g., impalefection, using a gene gun and/or magnetofection). Transfected cells expressing a subject CAR of the present disclosure may be expanded ex vivo.
Physical methods for introducing an expression vector into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells including vectors and/or exogenous nucleic acids are well- known in the art. See, e.g., Sambrook et al. (2001), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York.
Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine (“DMPC”) can be obtained from Sigma, St. Louis, MO; dicetyl phosphate (“DCP”) can be obtained from K & K Laboratories (Plainview, NY); cholesterol (“Choi”) can be obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol (“DMPG”) and other lipids may be obtained from Avanti Polar Lipids, Inc. (Birmingham, AL). Stock solutions of lipids in chloroform or chloroform/methanol can be stored at about -20°C. Chloroform is used as the only solvent since it is more readily evaporated than methanol. “Liposome” is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology' 5: 505-10). However, compositions that have different structures in solution than the normal vesicular structure are also encompassed. For example, the lipids may assume a micellar structure or merely exist as nonuniform aggregates of lipid molecules. Also contemplated are lipofectamine- nucleic acid complexes.
Regardless of the method used to introduce exogenous nucleic acids into a host cell or otherwise expose a cell to the inhibitor of the present invention, in order to confirm the presence of the nucleic acids in the host cell, a variety of assays may be performed. Such assays include, for example, “molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; “biochemical” assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.
Moreover, the nucleic acids may be introduced by any means, such as transducing the expanded T cells, transfecting the expanded T cells, and electroporating the expanded T cells. One nucleic acid may be introduced by one method and another nucleic acid may be introduced into the T cell by a different method.
Sources of Immune Cells
Prior to expansion, a source of immune cells is obtained from a subject for ex vivo manipulation. Sources of target cells for ex vivo manipulation may also include, e.g., autologous or heterologous donor blood, cord blood, or bone marrow. For example, the source of immune cells may be from the subject to be treated with the modified immune cells of the invention, e.g., the subject's blood, the subject's cord blood, or the subject’s bone marrow. Non-limiting examples of subjects include humans, dogs, cats, mice, rats, and transgenic species thereof. In certain exemplary embodiments, the subject is a human. Immune cells can be obtained from a number of sources, including blood, peripheral blood mononuclear cells, bone marrow, lymph node tissue, spleen tissue, umbilical cord, lymph, or lymphoid organs. Immune cells are cells of the immune system, such as cells of the innate or adaptive immunity, e.g., myeloid or lymphoid cells, including lymphocytes, typically T cells and/or NK cells and/or NKT cells. Other exemplary cells include stem cells, such as multipotent and pluripotent stem cells, including induced pluripotent stem cells (iPSCs). In certain aspects, the cells are human cells. With reference to the subject to be treated, the cells may be allogeneic and/or autologous. The cells typically are primary cells, such as those isolated directly from a subject and/or isolated from a subject and frozen.
In certain embodiments, the immune cell is a T cell, e.g., a CD8+ T cell (e.g., a CD8+ naive T cell, central memory T cell, or effector memory T cell), a CD4+ T cell, a natural killer T cell (NKT cells), a regulatory T cell (Treg), a stem cell memory T cell, a lymphoid progenitor cell, a hematopoietic stem cell, a natural killer cell (NK cell), a natural killer T cell (NK cell) or a dendritic cell. In some embodiments, the cells are monocytes or granulocytes, e.g., myeloid cells, macrophages, neutrophils, dendritic cells, mast cells, eosinophils, and/or basophils. In an embodiment, the target cell is an induced pluripotent stem (iPS) cell or a cell derived from an iPS cell, e.g., an iPS cell generated from a subject, manipulated to alter (e.g., induce a mutation in) or manipulate the expression of one or more target genes, and differentiated into, e.g., a T cell, e.g., a CD8+ T cell (e.g., a CD8+ naive T cell, central memory T cell, or effector memory T cell), a CD4+ T cell, a stem cell memory T cell, a lymphoid progenitor cell or a hematopoietic stem cell.
In some embodiments, the cells include one or more subsets of T cells or other cell types, such as whole T cell populations, CD4+ cells, CD8+ cells, and subpopulations thereof, such as those defined by function, activation state, maturity, potential for differentiation, expansion, recirculation, localization, and/or persistence capacities, antigen- specificity, type of antigen receptor, presence in a particular organ or compartment, marker or cytokine secretion profile, and/or degree of differentiation. Among the sub-types and subpopulations of T cells and/or of CD4+ and/or of CD8+ T cells are naive T (TN) cells, effector T cells (TEFF), memory T cells and sub-types thereof, such as stem cell memory T (TSCM), central memory T (TCM), effector memory T (TEM), or terminally differentiated effector memory T cells, tumor-infiltrating lymphocytes (TIL), immature T cells, mature T cells, helper T cells, cytotoxic T cells, mucosa- associated invariant T (MAIT) cells, naturally occurring and adaptive regulatory T (Treg) cells, helper T cells, such as TH1 cells, TH2 cells, TH3 cells, TH17 cells, TH9 cells, TH22 cells, follicular helper T cells, alpha/beta T cells, and delta/gamma T cells. In certain embodiments, any number of T cell lines available in the art, may be used.
In some embodiments, the methods include isolating immune cells from the subject, preparing, processing, culturing, and/or engineering them. In some embodiments, preparation of the engineered cells includes one or more culture and/or preparation steps. The cells for engineering as described may be isolated from a sample, such as a biological sample, e.g., one obtained from or derived from a subject. In some embodiments, the subject from which the cell is isolated is one having the disease or condition or in need of a cell therapy or to which cell therapy will be administered. The subject in some embodiments is a human in need of a particular therapeutic intervention, such as the adoptive cell therapy for which cells are being isolated, processed, and/or engineered. Accordingly, the cells in some embodiments are primary cells, e.g., primary human cells. The samples include tissue, fluid, and other samples taken directly from the subject, as well as samples resulting from one or more processing steps, such as separation, centrifugation, genetic engineering (e.g., transduction with viral vector), washing, and/or incubation. The biological sample can be a sample obtained directly from a biological source or a sample that is processed. Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine and sweat, tissue and organ samples, including processed samples derived therefrom.
In certain aspects, the sample from which the cells are derived or isolated is blood or a blood-derived sample, or is or is derived from an apheresis or leukapheresis product. Exemplary samples include whole blood, peripheral blood mononuclear cells (PBMCs), leukocytes, bone marrow, thymus, tissue biopsy, tumor, leukemia, lymphoma, lymph node, gut associated lymphoid tissue, mucosa associated lymphoid tissue, spleen, other lymphoid tissues, liver, lung, stomach, intestine, colon, kidney, pancreas, breast, bone, prostate, cervix, testes, ovaries, tonsil, or other organ, and/or cells derived therefrom. Samples include, in the context of cell therapy, e.g., adoptive cell therapy, samples from autologous and allogeneic sources.
In some embodiments, the cells are derived from cell lines, e.g., T cell lines. The cells in some embodiments are obtained from a xenogeneic source, for example, from mouse, rat, nonhuman primate, and pig. In some embodiments, isolation of the cells includes one or more preparation and/or non-affinity-based cell separation steps. In some examples, cells are washed, centrifuged, and/or incubated in the presence of one or more reagents, for example, to remove unwanted components, enrich for desired components, lyse or remove cells sensitive to particular reagents. In some examples, cells are separated based on one or more property, such as density, adherent properties, size, sensitivity and/or resistance to particular components.
In some examples, cells from the circulating blood of a subject are obtained, e.g., by apheresis or leukapheresis. The samples, in certain aspects, contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and/or platelets, and in certain aspects contains cells other than red blood cells and platelets. In some embodiments, the blood cells collected from the subject are washed, e.g., to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing steps. In some embodiments, the cells are washed with phosphate buffered saline (PBS). In some embodiments, a washing step is accomplished by tangential flow fdtration (TFF) according to the manufacturer's instructions. In certain embodiments, the cells are resuspended in a variety of biocompatible buffers after washing. In certain embodiments, components of a blood cell sample are removed, and the cells directly resuspended in culture media. In some embodiments, the methods include density-based cell separation methods, such as the preparation of white blood cells from peripheral blood by lysing the red blood cells and centrifugation through a Percoll or Ficoll gradient.
In one embodiment, immune cells are obtained from the circulating blood of an individual are obtained by apheresis or leukapheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. The cells collected by apheresis may be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media, such as phosphate buffered saline (PBS) or wash solution lacks calcium and may lack magnesium or may lack many if not all divalent cations, for subsequent processing steps. As those of ordinary skill in the art would readily appreciate a washing step may be accomplished by methods known to those in the art, such as by using a semi-automated “flow-through” centrifuge (for example, the Cobe 2991 cell processor, the Baxter CytoMate, or the Haemonetics Cell Saver 5) according to the manufacturer's instructions. After washing, the cells may be resuspended in a variety of biocompatible buffers, such as, for example, Ca2+-free, Mg2+-free PBS, PlasmaLyte A, or another saline solution with or without buffer. In some embodiments, the undesirable components of the apheresis sample may be removed, and the cells directly resuspended in culture media.
In some embodiments, the isolation methods include the separation of different cell types based on the expression or presence in the cell of one or more specific molecules, such as surface markers, e.g., surface proteins, intracellular markers, or nucleic acid. In some embodiments, any known method for separation based on such markers may be used. In some embodiments, the separation is affinity- or immunoaffinity-based separation. For example, the isolation in certain aspects includes separation of cells and cell populations based on the cells' expression or expression level of one or more markers, typically cell surface markers, for example, by incubation with an antibody or binding partner that specifically binds to such markers, followed generally by washing steps and separation of cells having bound the antibody or binding partner, from those cells having not bound to the antibody or binding partner. Such separation steps can be based on positive selection, in which the cells having bound the reagents are retained for further use, and/or negative selection, in which the cells having not bound to the antibody or binding partner are retained. In some examples, both fractions are retained for further use. In certain aspects, negative selection can be particularly useful where no antibody is available that specifically identifies a cell type in a heterogeneous population, such that separation is best carried out based on markers expressed by cells other than the desired population. The separation need not result in 100% enrichment or removal of a particular cell population or cells expressing a particular marker. For example, positive selection of or enrichment for cells of a particular type, such as those expressing a marker, refers to increasing the number or percentage of such cells, but need not result in a complete absence of cells not expressing the marker. Likewise, negative selection, removal, or depletion of cells of a particular type, such as those expressing a marker, refers to decreasing the number or percentage of such cells, but need not result in a complete removal of all such cells.
In certain exemplary embodiments, multiple rounds of separation steps are carried out, where the positively or negatively selected fraction from one step is subjected to another separation step, such as a subsequent positive or negative selection. In certain exemplary embodiments, a single separation step can deplete cells expressing multiple markers simultaneously, such as by incubating cells with a plurality of antibodies or binding partners, each specific for a marker targeted for negative selection. Likewise, multiple cell types can simultaneously be positively selected by incubating cells with a plurality of antibodies or binding partners expressed on the various cell types.
In some embodiments, one or more of the T cell populations is enriched for or depleted of cells that are positive for (marker+) or express high levels (marker111811) of one or more particular markers, such as surface markers, or that are negative for (marker ) or express relatively low levels (markerlow) of one or more markers. For example, in certain aspects, specific subpopulations of T cells, such as cells positive or expressing high levels of one or more surface markers, e.g., CD28+, CD62L+, CCR7+, CD27+, CD127+, CD4+, CD8+, CD45RA+, and/or CD45RO+ T cells, are isolated by positive or negative selection techniques. In some cases, such markers are those that are absent or expressed at relatively low levels on certain populations of T cells (such as non-memory cells) but are present or expressed at relatively higher levels on certain other populations of T cells (such as memory cells). In one embodiment, the cells (such as the CD8+ cells or the T cells, e.g., CD3+ cells) are enriched for (i.e., positively selected for) cells that are positive or expressing high surface levels of CD45RO, CCR7, CD28, CD27, CD44, CD127, and/or CD62L and/or depleted of (e.g., negatively selected for) cells that are positive for or express high surface levels of CD45RA. In some embodiments, cells are enriched for or depleted of cells positive or expressing high surface levels of CD122, CD95, CD25, CD27, and/or IL7-Ra (CD127). In certain exemplary embodiments, CD8+ T cells are enriched for cells positive for CD45RO (or negative for CD45RA) and for CD62L. For example, CD3+, CD28+ T cells can be positively selected using CD3/CD28 conjugated magnetic beads (e.g., DYNABEADS® M-450 CD3/CD28 T Cell Expander).
In some embodiments, T cells are separated from a PBMC sample by negative selection of markers expressed on non-T cells, such as B cells, monocytes, or other white blood cells, such as CD 14. In certain aspects, a CD4+ or CD8+ selection step is used to separate CD4+ helper and CD8+ cytotoxic T cells. Such CD4+ and CD8+ populations can be further sorted into subpopulations by positive or negative selection for markers expressed or expressed to a relatively higher degree on one or more naive, memory, and/or effector T cell subpopulations. In some embodiments, CD8+ cells are further enriched for or depleted of naive, central memory, effector memory, and/or central memory stem cells, such as by positive or negative selection based on surface antigens associated with the respective subpopulation. In some embodiments, enrichment for central memory T (TCM) cells is carried out to increase efficacy, such as to improve long- term survival, expansion, and/or engraftment following administration, which in certain aspects is particularly robust in such sub-populations. In some embodiments, combining TCM-enriched CD8+ T cells and CD4+ T cells further enhances efficacy.
In some embodiments, memory T cells are present in both CD62L+ and CD62L- subsets of CD8+ peripheral blood lymphocytes. PBMC can be enriched for or depleted of CD62L-CD8+ and/or CD62L+CD8+ fractions, such as using anti-CD8 and anti-CD62L antibodies. In some embodiments, a CD4+ T cell population and/or a CD8+ T population is enriched for central memory (TCM) cells. In some embodiments, the enrichment for central memory T (TCM) cells is based on positive or high surface expression of CD45RO, CD62L, CCR7, CD28, CD3, and/or CD127; in certain aspects, it is based on negative selection for cells expressing or highly expressing CD45RA and/or granzyme B. In certain aspects, isolation of a CD8+ population enriched for TCM cells is carried out by depletion of cells expressing CD4, CD14, CD45RA, and positive selection or enrichment for cells expressing CD62L. In one aspect, enrichment for central memory T (TCM) cells is carried out starting with a negative fraction of cells selected based on CD4 expression, which is subjected to a negative selection based on expression of CD 14 and CD45RA, and a positive selection based on CD62L. Such selections in certain aspects are carried out simultaneously and in other aspects are carried out sequentially, in either order. In some embodiments, the same CD4 expression-based selection step used in preparing the CD8+ cell population or subpopulation, also is used to generate the CD4+ cell population or subpopulation, such that both the positive and negative fractions from the CD4-based separation are retained and used in subsequent steps of the methods, optionally following one or more further positive or negative selection steps.
CD4+ T helper cells are sorted into naive, central memory, and effector cells by identifying cell populations that have cell surface antigens. CD4+ lymphocytes can be obtained by standard methods. In some embodiments, naive CD4+ T lymphocytes are CD45RO-, CD45RA+, CD62L+, CD4+ T cells. In some embodiments, central memory CD4+ cells are CD62L+ and CD45RO+. In some embodiments, effector CD4+ cells are CD62L- and CD45RO. In one example, to enrich for CD4+ cells by negative selection, a monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CD1 lb, CD16, HLA-DR, and CD8. In some embodiments, the antibody or binding partner is bound to a solid support or matrix, such as a magnetic bead or paramagnetic bead, to allow for separation of cells for positive and/or negative selection.
In some embodiments, the cells are incubated and/or cultured prior to or in connection with genetic engineering. The incubation steps can include culture, cultivation, stimulation, activation, and/or propagation. In some embodiments, the compositions or cells are incubated in the presence of stimulating conditions or a stimulatory agent. Such conditions include those designed to induce proliferation, expansion, activation, and/or survival of cells in the population, to mimic antigen exposure, and/or to prime the cells for genetic engineering, such as for the introduction of a recombinant antigen receptor. The conditions can include one or more of particular media, temperature, oxygen content, carbon dioxide content, time, agents, e.g., nutrients, amino acids, antibiotics, ions, and/or stimulatory factors, such as cytokines, chemokines, antigens, binding partners, fusion proteins, recombinant soluble receptors, and any other agents designed to activate the cells. In some embodiments, the stimulating conditions or agents include one or more agent, e.g., ligand, which is capable of activating an intracellular signaling domain of a TCR complex. In certain aspects, the agent turns on or initiates TCR/CD3 intracellular signaling cascade in a T cell. Such agents can include antibodies, such as those specific for a TCR component and/or costimulatory receptor, e.g., anti-CD3, anti-CD28, for example, bound to solid support such as a bead, and/or one or more cytokines. Optionally, the expansion method may further comprise the step of adding anti-CD3 and/or anti CD28 antibody to the culture medium (e.g., at a concentration of at least about 0.5 ng/ml). In some embodiments, the stimulating agents include IL -2 and/or IL-15, for example, an IL-2 concentration of at least about 10 units/mL.
In another embodiment, T cells are isolated from peripheral blood by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLL™ gradient. Alternatively, T cells can be isolated from an umbilical cord. In any event, a specific subpopulation of T cells can be further isolated by positive or negative selection techniques.
The cord blood mononuclear cells so isolated can be depleted of cells expressing certain antigens, including, but not limited to, CD34, CD8, CD 14, CD 19, and CD56. Depletion of these cells can be accomplished using an isolated antibody, a biological sample comprising an antibody, such as ascites, an antibody bound to a physical support, and a cell bound antibody. Enrichment of a T cell population by negative selection can be accomplished using a combination of antibodies directed to surface markers unique to the negatively selected cells. An exemplary method is cell sorting and/or selection via negative magnetic immunoadherence or flow cytometry that uses a cocktail of monoclonal antibodies directed to cell surface markers present on the cells negatively selected. For example, to enrich for CD4+ cells by negative selection, a monoclonal antibody cocktail typically includes antibodies to CD 14, CD20, CD1 lb, CD 16, HLA-DR, and CD8.
For isolation of a desired population of cells by positive or negative selection, the concentration of cells and surface (e.g., particles such as beads) can be varied. In certain embodiments, it may be desirable to significantly decrease the volume in which beads and cells are mixed together (i.e., increase the concentration of cells), to ensure maximum contact of cells and beads. For example, in one embodiment, a concentration of 2 billion cells/ml is used. In one embodiment, a concentration of 1 billion cells/ml is used. In a further embodiment, greater than 100 million cells/ml is used. In a further embodiment, a concentration of cells of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells/ml is used. In yet another embodiment, a concentration of cells from 75, 80, 85, 90, 95, or 100 million cells/ml is used. In further embodiments, concentrations of 125 or 150 million cells/ml can be used. Using high concentrations can result in increased cell yield, cell activation, and cell expansion.
T cells can also be frozen after the washing step, which does not require the monocyteremoval step. While not wishing to be bound by theory, the freeze and subsequent thaw step provides a more uniform product by removing granulocytes and to some extent monocytes in the cell population. After the washing step that removes plasma and platelets, the cells may be suspended in a freezing solution. While many freezing solutions and parameters are known in the art and will be useful in this context, in a non-limiting example, one method involves using PBS containing 20% DMSO and 8% human serum albumin, or other suitable cell freezing media. The cells are then frozen to -80°C at a rate of 1°C per minute and stored in the vapor phase of a liquid nitrogen storage tank. Other methods of controlled freezing may be used as well as uncontrolled freezing immediately at -20°C or in liquid nitrogen.
In one embodiment, the population of T cells is comprised within cells such as peripheral blood mononuclear cells, cord blood cells, a purified population of T cells, and a T cell line. In another embodiment, peripheral blood mononuclear cells comprise the population of T cells. In yet another embodiment, purified T cells comprise the population of T cells.
Expansion of Immune Cells
Whether prior to or after modification of cells to express a subject CAR, the cells can be activated and expanded in number using methods as described, for example, in U.S. Patent Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S. Publication No. 20060121005. For example, the immune cells of the invention may be expanded by contact with a surface having attached thereto an agent that stimulates a CD3/TCR complex associated signal and a ligand that stimulates a co-stimulatory molecule on the surface of the immune cells. In particular, immune cell populations may be stimulated by contact with an anti-CD3 antibody, or an antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin) in conjunction with a calcium ionophore. For co-stimulation of an accessory molecule on the surface of the immune cells, a ligand that binds the accessory molecule is used. For example, immune cells can be contacted with an anti-CD3 antibody and an anti-CD28 antibody, under conditions appropriate for stimulating proliferation of the immune cells. Examples of an anti- CD28 antibody include 9.3, B-T3, XR-CD28 (Diaclone, Besancon, France) and these can be used in the invention, as can other methods and reagents known in the art (see, e g., ten Berge et al., Transplant Proc. (1998) 30(8): 3975-3977; Haanen et al., J. Exp. Med. (1999) 190(9): 1319- 1328; and Garland et al., J. Immunol. Methods (1999) 227(1-2): 53-63).
Expanding the immune cells by the methods disclosed herein can be multiplied by about 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700 fold, 800-fold, 900-fold, 1000-fold, 2000-fold, 3000- fold, 4000-fold, 5000-fold, 6000-fold, 7000-fold, 8000-fold, 9000-fold, 10,000-fold, 100,000- fold, 1,000,000-fold, 10,000,000-fold, or greater, and any and all whole or partial integers therebetween. In one embodiment, the immune cells expand in the range of about 20-fold to about 50-fold.
Following culturing, the immune cells can be incubated in cell medium in a culture apparatus for a period of time or until the cells reach confluency or high cell density for optimal passage before passing the cells to another culture apparatus. The culturing apparatus can be of any culture apparatus commonly used for culturing cells in vitro. In certain exemplary embodiments, the level of confluence is 70% or greater before passing the cells to another culture apparatus. In particularly exemplary embodiments, the level of confluence is 90% or greater. A period of time can be any time suitable for the culture of cells in vitro. The immune cell medium may be replaced during the culture of the immune cells at any time. In certain exemplary embodiments, the immune cell medium is replaced about every 2 to 3 days. The immune cells are then harvested from the culture apparatus whereupon the immune cells can be used immediately or cryopreserved to be stored for use at a later time. In one embodiment, the invention includes cry opreserving the expanded immune cells. The cryopreserved immune cells are thawed prior to introducing nucleic acids into the immune cell.
In another embodiment, the method comprises isolating immune cells and expanding the immune cells. In another embodiment, the invention further comprises cryopreserving the immune cells prior to expansion. In yet another embodiment, the cryopreserved immune cells are thawed for electroporation with the RNA encoding the chimeric membrane protein.
Another procedure for ex vivo expansion cells is described in U.S. Pat. No. 5,199,942 (incorporated herein by reference). Expansion, such as described in U.S. Pat. No. 5,199,942 can be an alternative or in addition to other methods of expansion described herein. Briefly, ex vivo culture and expansion of immune cells comprises the addition to the cellular growth factors, such as those described in U.S. Pat. No. 5,199,942, or other factors, such as FLT3-L, IL-1, IL-3 and c- kit ligand. In one embodiment, expanding the immune cells comprises culturing the immune cells with a factor selected from the group consisting of FLT3-L, IL-1, IL-3 and c-kit ligand.
The culturing step as described herein (contact with agents as described herein or after electroporation) can be very short, for example less than 24 hours such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours. The culturing step as described further herein (contact with agents as described herein) can be longer, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more days.
Various terms are used to describe cells in culture. Cell culture refers generally to cells taken from a living organism and grown under controlled condition. A primary cell culture is a culture of cells, tissues or organs taken directly from an organism and before the first subculture. Cells are expanded in culture when they are placed in a growth medium under conditions that facilitate cell growth and/or division, resulting in a larger population of the cells. When cells are expanded in culture, the rate of cell proliferation is typically measured by the amount of time required for the cells to double in number, otherwise known as the doubling time.
Each round of subculturing is referred to as a passage. When cells are subcultured, they are referred to as having been passaged. A specific population of cells, or a cell line, is sometimes referred to or characterized by the number of times it has been passaged. For example, a cultured cell population that has been passaged ten times may be referred to as a PIO culture. The primary culture, i.e., the first culture following the isolation of cells from tissue, is designated PO. Following the first subculture, the cells are described as a secondary culture (Pl or passage 1). After the second subculture, the cells become a tertiary culture (P2 or passage 2), and so on. It will be understood by those of skill in the art that there may be many population doublings during the period of passaging. Therefore the number of population doublings of a culture is greater than the passage number. The expansion of cells (i.e., the number of population doublings) during the period between passaging depends on many factors, including but is not limited to the seeding density, substrate, medium, and time between passaging.
In one embodiment, the cells may be cultured for several hours (about 3 hours) to about 14 days or any hourly integer value in between. Conditions appropriate for immune cell culture include an appropriate media (e.g., Minimal Essential Media or RPMI Media 1640 or, X-vivo 15, (Lonza)) that may contain factors necessary for proliferation and viability, including serum (e g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-gamma, IL-4, IL-7, GM- CSF, IL-10, IL-12, IL-15, TGF-beta, and TNF-a or any other additives for the growth of cells known to the skilled artisan. Other additives for the growth of cells include, but are not limited to, surfactant, plasmanate, and reducing agents such as N-acetyl-cysteine and 2-mercaptoethanol. Media can include RPMI 1640, AIM-V, DMEM, MEM, a-MEM, F-12, X-Vivo 15, and X-Vivo 20, Optimizer, with added amino acids, sodium pyruvate, and vitamins, either serum-free or supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones, and/or an amount of cytokine(s) sufficient for the growth and expansion of immune cells. Antibiotics, e.g., penicillin and streptomycin, are included only in experimental cultures, not in cultures of cells that are to be infused into a subject. The target cells are maintained under conditions necessary to support growth, for example, an appropriate temperature (e.g., 37° C) and atmosphere (e.g., air plus 5% CO2). The medium used to culture the immune cells may include an agent that can co-stimulate the immune cells. For example, an agent that can stimulate CD3 is an antibody to CD3, and an agent that can stimulate CD28 is an antibody to CD28. This is because, as demonstrated by the data disclosed herein, a cell isolated by the methods disclosed herein can be expanded approximately 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100- fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold, 2000-fold, 3000-fold, 4000-fold, 5000-fold, 6000-fold, 7000-fold, 8000-fold, 9000-fold, 10,000- fold, 100,000-fold, 1,000,000-fold, 10,000,000-fold, or greater. In one embodiment, the immune cells expand in the range of about 2-fold to about 50-fold, or more by culturing the electroporated population. In one embodiment, human T regulatory cells are expanded via anti- CD3 antibody coated KT64.86 artificial antigen presenting cells (aAPCs). Methods for expanding and activating immune cells can be found in U.S. Patent Numbers 7,754,482, 8,722,400, and 9,555,105, the contents of which are incorporated herein in their entirety.
In one embodiment, the method of expanding the immune cells can further comprise isolating the expanded immune cells for further applications. In another embodiment, the method of expanding can further comprise a subsequent electroporation of the expanded immune cells followed by culturing. The subsequent electroporation may include introducing a nucleic acid encoding an agent, such as a transducing the expanded immune cells, transfecting the expanded immune cells, or electroporating the expanded immune cells with a nucleic acid, into the expanded population of immune cells, wherein the agent further stimulates the immune cell. The agent may stimulate the immune cells, such as by stimulating further expansion, effector function, or another immune cell function.
Methods of Treatment
The modified cells (e.g., T cells) described herein may be included in a composition for immunotherapy. The composition may include a pharmaceutical composition and further include a pharmaceutically acceptable carrier. A therapeutically effective amount of the pharmaceutical composition comprising the modified T cells may be administered.
In one aspect, the invention includes a method for adoptive cell transfer therapy comprising administering to a subject in need thereof a modified T cell of the present invention. In another aspect, the invention includes a method of treating a disease or condition in a subject comprising administering to a subject in need thereof a population of modified T cells.
Also included is a method of treating a disease or condition in a subject in need thereof comprising administering to the subject a genetically edited modified cell (e.g., genetically edited modified T cell). In one embodiment, the method of treating a disease or condition in a subject in need thereof comprises administering to the subject a genetically edited modified cell comprising an exogenous CAR.
In certain embodiments, the cancer to be treated in a subject in need thereof is a solid cancer. As such, in certain embodiments, the invention includes a method of treating a CEACAM6-associated cancer in a subject comprising administering to a subject in need thereof a therapeutically effective population of modified immune cells of the present invention. In some embodiments, the CEACAM6-associated cancer is selected from the group consisting of lung cancer, colorectal cancer, head and neck cancer, stomach cancer, pancreatic cancer, urothelial cancer, breast cancer, cervical cancer, and prostate cancer.
Methods for administration of modified immune cells for adoptive cell therapy are known and may be used in connection with the provided methods and compositions. For example, adoptive T cell therapy methods are described, e.g., in US Patent Application Publication No. 2003/0170238 to Gruenberg et al; US Patent No. 4,690,915 to Rosenberg; Rosenberg (2011) Nat Rev Clin Oncol. 8(10):577-85). See, e.g., Themeli et al. (2013) Nat Biotechnol. 31(10): 928-933; Tsukahara et al. (2013) Biochem Biophys Res Commun 438(1): 84-9; Davila et al. (2013) PLoS ONE 8(4): e61338. In some embodiments, the cell therapy, e.g., adoptive T cell therapy is carried out by autologous transfer, in which the cells are isolated and/or otherwise prepared from the subject who is to receive the cell therapy, or from a sample derived from such a subject. Thus, in some aspects, the cells are derived from a subject, e.g., patient, in need of a treatment and the cells, following isolation and processing are administered to the same subject.
In some embodiments, the cell therapy, e.g., adoptive T cell therapy, is carried out by allogeneic transfer, in which the cells are isolated and/or otherwise prepared from a subject other than a subject who is to receive or who ultimately receives the cell therapy, e.g., a first subject. In such embodiments, the cells then are administered to a different subject, e.g., a second subject of the same species. In some embodiments, the first and second subjects are genetically identical. In some embodiments, the first and second subjects are genetically similar. In some embodiments, the second subject expresses the same HLA class or supertype as the first subject.
In some embodiments, the subject has been treated with a therapeutic agent targeting the disease or condition, e.g. the tumor, prior to administration of the cells or composition containing the cells. In some aspects, the subject is refractory or non-responsive to the other therapeutic agent. In some embodiments, the subject has persistent or relapsed disease, e.g., following treatment with another therapeutic intervention, including chemotherapy, radiation, and/or hematopoietic stem cell transplantation (HSCT), e.g., allogenic HSCT. In some embodiments, the administration effectively treats the subject despite the subject having become resistant to another therapy.
In certain embodiments, the subject is responsive to the other therapeutic agent, and treatment with the therapeutic agent reduces disease burden. In some aspects, the subject is initially responsive to the therapeutic agent, but exhibits a relapse of the disease or condition over time. In some embodiments, the subject has not relapsed. In some such embodiments, the subject is determined to be at risk for relapse, such as at a high risk of relapse, and thus the cells are administered prophylactically, e.g., to reduce the likelihood of or prevent relapse. In some aspects, the subject has not received prior treatment with another therapeutic agent.
In certain embodiments, the subject has persistent or relapsed disease, e.g., following treatment with another therapeutic intervention, including chemotherapy, radiation, and/or hematopoietic stem cell transplantation (HSCT), e.g., allogenic HSCT. In some embodiments, the administration effectively treats the subject despite the subject having become resistant to another therapy.
The modified immune and modified precursor cells of the present invention can be administered to an animal, preferably a mammal, even more preferably a human, to treat a cancer. In addition, the cells of the present invention can be used for the treatment of any condition related to a cancer, especially a cell-mediated immune response against a tumor cell(s), where it is desirable to treat or alleviate the disease. The types of cancers to be treated with the modified cells or pharmaceutical compositions of the invention include certain solid tumors including metastatic cancers. Adult tumors/cancers and pediatric tumors/cancers are also included. The cells of the invention to be administered may be autologous, with respect to the subject undergoing therapy.
The administration of the cells of the invention may be carried out in any convenient manner known to those of skill in the art. The cells of the present invention may be administered to a subject by aerosol inhalation, injection, ingestion, transfusion, implantation or transplantation. The compositions described herein may be administered to a patient transarterially, subcutaneously, intradermally, intratumorally, intranodally, intramedullary, intramuscularly, by intravenous (i.v.) injection, or intraperitoneally. In other instances, the cells of the invention are injected directly into a site of inflammation in the subject, a local disease site in the subject, a lymph node, an organ, a tumor, and the like.
In some embodiments, the cells are administered at a desired dosage, which in some aspects includes a desired dose or number of cells or cell type(s) and/or a desired ratio of cell types. Thus, the dosage of cells in some embodiments is based on a total number of cells (or number per kg body weight) and a desired ratio of the individual populations or sub-types, such as the CD4+ to CD8+ ratio. In some embodiments, the dosage of cells is based on a desired total number (or number per kg of body weight) of cells in the individual populations or of individual cell types. In some embodiments, the dosage is based on a combination of such features, such as a desired number of total cells, desired ratio, and desired total number of cells in the individual populations.
In certain embodiments, the cells, or individual populations of sub-types of cells, are administered to the subject at a range of about one million to about 100 billion cells, such as, e.g., 1 million to about 50 billion cells (e.g., about 5 million cells, about 25 million cells, about 500 million cells, about 1 billion cells, about 5 billion cells, about 20 billion cells, about 30 billion cells, about 40 billion cells, or a range defined by any two of the foregoing values), such as about 10 million to about 100 billion cells (e.g., about 20 million cells, about 30 million cells, about 40 million cells, about 60 million cells, about 70 million cells, about 80 million cells, about 90 million cells, about 10 billion cells, about 25 billion cells, about 50 billion cells, about 75 billion cells, about 90 billion cells, or a range defined by any two of the foregoing values), and in some cases about 100 million cells to about 50 billion cells (e.g., about 120 million cells, about 250 million cells, about 350 million cells, about 450 million cells, about 650 million cells, about 800 million cells, about 900 million cells, about 3 billion cells, about 30 billion cells, about 45 billion cells) or any value in between these ranges.
In some embodiments, the dose of total cells and/or dose of individual sub-populations of cells is within a range of between at or about IxlO5 cells/kg to about IxlO11 cells/kg 104 and at or about 1011 cells/kilograms (kg) body weight, such as between 105 and 106 cells / kg body weight, for example, at or about 1 x 1CP cells/kg, 1.5 x 105 cells/kg, 2 x 105 cells/kg, or 1 x 106 cells/kg body weight. For example, in some embodiments, the cells are administered at, or within a certain range of error of, between at or about 104 and at or about 109 T cells/kilograms (kg) body weight, such as between 10’ and 106 T cells / kg body weight, for example, at or about 1 x 105 T cells/kg, 1.5 x 105 T cells/kg, 2 x 105 T cells/kg, or 1 x 106 T cells/kg body weight. In other exemplary embodiments, a suitable dosage range of modified cells for use in a method of the present disclosure includes, without limitation, from about 1x10’ cells/kg to about IxlO6 cells/kg, from about IxlO6 cells/kg to about IxlO7 cells/kg, from about IxlO7 cells/kg about IxlO8 cells/kg, from about IxlO8 cells/kg about IxlO9 cells/kg, from about IxlO9 cells/kg about IxlO10 cells/kg, from about IxlO10 cells/kg about IxlO11 cells/kg. In an exemplary embodiment, a suitable dosage for use in a method of the present disclosure is about IxlO8 cells/kg. In an exemplary embodiment, a suitable dosage for use in a method of the present disclosure is about IxlO7 cells/kg. In other embodiments, a suitable dosage is from about IxlO7 total cells to about 5xl07 total cells. In some embodiments, a suitable dosage is from about IxlO8 total cells to about 5xl08 total cells. In some embodiments, a suitable dosage is from about 1.4xl07 total cells to about l.lxlO9 total cells. In an exemplary embodiment, a suitable dosage for use in a method of the present disclosure is about 7xl09 total cells.
In some embodiments, the cells are administered at or within a certain range of error of between at or about 104 and at or about 109 CD4+ and/or CD8+ cells/kilograms (kg) body weight, such as between 105 and 106 CD4+ and/or CD8+cells / kg body weight, for example, at or about 1 x 105 CD4+ and/or CD8+ cells/kg, 1.5 x 105 CD4+ and/or CD8+ cells/kg, 2 x 10’ CD4+ and/or CD8+ cells/kg, or 1 x 106 CD4+ and/or CD8~ cells/kg body weight. In some embodiments, the cells are administered at or within a certain range of error of, greater than, and/or at least about 1 x 106, about 2.5 x 106, about 5 x 106, about 7.5 x 106, or about 9 x 106 CD4+ cells, and/or at least about I x lO6, about 2.5 x 106, about 5 x 106, about 7.5 x 106, or about 9 x 106 CD8+ cells, and/or at least about 1 x 106, about 2.5 x 106, about 5 x 106, about 7.5 x 106, or about 9 x 106 T cells. In some embodiments, the cells are administered at or within a certain range of error of between about 108 and 1012 or between about IO10 and 1011 T cells, between about 108 and 1012 or between about IO10 and 1011 CD4+ cells, and/or between about 108 and 1012 or between about 1010 and 1011 CD8+ cells.
In some embodiments, the cells are administered at or within a tolerated range of a desired output ratio of multiple cell populations or sub-types, such as CD4+ and CD8+ cells or sub-types. In some aspects, the desired ratio can be a specific ratio or can be a range of ratios, for example, in some embodiments, the desired ratio (e.g., ratio of CD4+ to CD8+ cells) is between at or about 5: 1 and at or about 5: 1 (or greater than about 1 :5 and less than about 5: 1), or between at or about 1 :3 and at or about 3 : 1 (or greater than about 1:3 and less than about 3: 1), such as between at or about 2: 1 and at or about 1 :5 (or greater than about 1 :5 and less than about 2: 1, such as at or about 5: 1, 4.5: 1, 4: 1, 3.5: 1, 3: 1, 2.5: 1, 2: 1, 1.9: 1, 1.8: 1, 1.7: 1, 1.6: 1, 1.5: 1, 1.4: 1, 1.3: 1, 1.2: 1, 1.1: 1, 1 : 1, 1 : 1.1, 1 : 1.2, 1: 1.3, 1: 1.4, 1 : 1.5, 1 : 1.6, 1: 1.7, 1 : 1.8, 1 : 1.9: 1 :2, 1 :2.5, 1 :3, 1 :3.5, 1 :4, 1 :4.5, or 1 :5. In some aspects, the tolerated difference is within about 1%, about 2%, about 3%, about 4% about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50% of the desired ratio, including any value in between these ranges.
In some embodiments, a dose of modified cells is administered to a subject in need thereof, in a single dose or multiple doses. In some embodiments, a dose of modified cells is administered in multiple doses, e g., once a week or every 7 days, once every 2 weeks or every 14 days, once every 3 weeks or every 21 days, once every 4 weeks or every 28 days. In an exemplary embodiment, a single dose of modified cells is administered to a subject in need thereof. In an exemplary embodiment, a single dose of modified cells is administered to a subject in need thereof by rapid intravenous infusion.
For the prevention or treatment of disease, the appropriate dosage may depend on the type of disease to be treated, the type of cells or recombinant receptors, the severity and course of the disease, whether the cells are administered for preventive or therapeutic purposes, previous therapy, the subject's clinical history and response to the cells, and the discretion of the attending physician. The compositions and cells are in some embodiments suitably administered to the subject at one time or over a series of treatments. In some embodiments, the cells are administered as part of a combination treatment, such as simultaneously with or sequentially with, in any order, another therapeutic intervention, such as an antibody or engineered cell or receptor or agent, such as a cytotoxic or therapeutic agent. The cells in some embodiments are co-administered with one or more additional therapeutic agents or in connection with another therapeutic intervention, either simultaneously or sequentially in any order. In some contexts, the cells are co-administered with another therapy sufficiently close in time such that the cell populations enhance the effect of one or more additional therapeutic agents, or vice versa. In some embodiments, the cells are administered prior to the one or more additional therapeutic agents. In some embodiments, the cells are administered after the one or more additional therapeutic agents. In some embodiments, the one or more additional agents includes a cytokine, such as IL-2, for example, to enhance persistence. In some embodiments, the methods comprise administration of a chemotherapeutic agent.
In certain embodiments, the modified cells of the invention (e.g., a modified cell comprising a CAR) may be administered to a subject in combination with an immune checkpoint antibody (e.g., an anti-PDl, anti-CTLA-4, or anti-PDLl antibody). For example, the modified cell may be administered in combination with an antibody or antibody fragment targeting, for example, PD-1 (programmed death 1 protein). Examples of anti-PD-1 antibodies include, but are not limited to, pembrolizumab (KEYTRUDA®, formerly lambrolizumab, also known as MK- 3475), and nivolumab (BMS-936558, MDX-1106, ONO-4538, OPDIVA®) or an antigenbinding fragment thereof. In certain embodiments, the modified cell may be administered in combination with an anti-PD-Ll antibody or antigen-binding fragment thereof. Examples of anti-PD-Ll antibodies include, but are not limited to, BMS-936559, MPDL3280A (TECENTRIQ®, Atezolizumab), and MEDI4736 (Durvalumab, Imfinzi). In certain embodiments, the modified cell may be administered in combination with an anti-CTLA-4 antibody or antigen-binding fragment thereof. An example of an anti- CTLA-4 antibody includes, but is not limited to, Ipilimumab (trade name Yervoy). Other types of immune checkpoint modulators may also be used including, but not limited to, small molecules, siRNA, miRNA, and CRISPR systems. Immune checkpoint modulators may be administered before, after, or concurrently with the modified cell comprising the CAR. In certain embodiments, combination treatment comprising an immune checkpoint modulator may increase the therapeutic efficacy of a therapy comprising a modified cell of the present invention. Following administration of the cells, the biological activity of the engineered cell populations in some embodiments is measured, e.g., by any of a number of known methods. Parameters to assess include specific binding of an engineered or natural T cell or other immune cell to antigen, in vivo, e.g., by imaging, or ex vivo, e.g., by ELISA or flow cytometry. In certain embodiments, the ability of the engineered cells to destroy target cells can be measured using any suitable method known in the art, such as cytotoxicity assays described in, for example, Kochenderfer et al., J. Immunotherapy, 32(7): 689-702 (2009), and Herman et al. J. Immunological Methods, 285(1): 25-40 (2004). In certain embodiments, the biological activity of the cells is measured by assaying expression and/or secretion of one or more cytokines, such as CD 107a, IFNy, IL-2, and TNF. In some aspects the biological activity is measured by assessing clinical outcome, such as reduction in tumor burden or load.
In certain embodiments, the subject is provided a secondary treatment. Secondary treatments include but are not limited to chemotherapy, radiation, surgery, and medications.
In some embodiments, the subject can be administered a conditioning therapy prior to CAR T cell therapy. In some embodiments, the conditioning therapy comprises administering an effective amount of cyclophosphamide to the subject. In some embodiments, the conditioning therapy comprises administering an effective amount of fludarabine to the subject. In preferred embodiments, the conditioning therapy comprises administering an effective amount of a combination of cyclophosphamide and fludarabine to the subject. Administration of a conditioning therapy prior to CAR T cell therapy may increase the efficacy of the CAR T cell therapy. Methods of conditioning patients for T cell therapy are described in U.S. Patent No. 9,855,298, which is incorporated herein by reference in its entirety.
In some embodiments, a specific dosage regimen of the present disclosure includes a lymphodepletion step prior to the administration of the modified T cells. In an exemplary embodiment, the lymphodepletion step includes administration of cyclophosphamide and/or fludarabine.
In some embodiments, the lymphodepletion step includes administration of cyclophosphamide at a dose of between about 200 mg/m2/day and about 2000 mg/m2/day (e.g., 200 mg/m2/day, 300 mg/m2/day, or 500 mg/m2/day). In an exemplary embodiment, the dose of cyclophosphamide is about 300 mg/m2/day. In some embodiments, the lymphodepletion step includes administration of fludarabine at a dose of between about 20 mg/m2/day and about 900 mg/m2/day (e.g., 20 mg/m2/day, 25 mg/m2/day, 30 mg/m2/day, or 60 mg/m2/day). In an exemplary embodiment, the dose of fludarabine is about 30 mg/m2/day.
In some embodiment, the lymphodepletion step includes administration of cyclophosphamide at a dose of between about 200 mg/m2/day and about 2000 mg/m2/day (e.g., 200 mg/m2/day, 300 mg/m2/day, or 500 mg/m2/day), and fludarabine at a dose of between about 20 mg/m2/day and about 900 mg/m2/day (e.g., 20 mg/m2/day, 25 mg/m2/day, 30 mg/m2/day, or 60 mg/m2/day). In an exemplary embodiment, the lymphodepletion step includes administration of cyclophosphamide at a dose of about 300 mg/m2/day, and fludarabine at a dose of about 30 mg/m2/day.
In an exemplary embodiment, the dosing of cyclophosphamide is 300 mg/m2/day over three days, and the dosing of fludarabine is 30 mg/m2/day over three days.
Dosing of lymphodepletion chemotherapy may be scheduled on Days -6 to -4 (with a -1- day window, i.e., dosing on Days -7 to -5) relative to T cell (e.g., CAR-T, TCR-T, a modified T cell, etc.) infusion on Day 0.
In an exemplary embodiment, for a subject having cancer, the subject receives lymphodepleting chemotherapy including 300 mg/m2 of cyclophosphamide by intravenous infusion 3 days prior to administration of the modified T cells. In an exemplary embodiment, for a subject having cancer, the subject receives lymphodepleting chemotherapy including 300 mg/m2 of cyclophosphamide by intravenous infusion for 3 days prior to administration of the modified T cells.
In an exemplary embodiment, for a subject having cancer, the subject receives lymphodepleting chemotherapy including fludarabine at a dose of between about 20 mg/m2/day and about 900 mg/m2/day (e.g., 20 mg/m2/day, 25 mg/m2/day, 30 mg/m2/day, or 60 mg/m2/day). In an exemplary embodiment, for a subject having cancer, the subject receives lymphodepleting chemotherapy including fludarabine at a dose of 30 mg/m2 for 3 days.
In an exemplary embodiment, for a subject having cancer, the subject receives lymphodepleting chemotherapy including cyclophosphamide at a dose of between about 200 mg/m2/day and about 2000 mg/m2/day (e.g., 200 mg/m2/day, 300 mg/m2/day, or 500 mg/m2/day), and fludarabine at a dose of between about 20 mg/m2/day and about 900 mg/m2/day (e.g., 20 mg/m2/day, 25 mg/m2/day, 30 mg/m2/day, or 60 mg/m2/day). In an exemplary embodiment, for a subject having cancer, the subject receives lymphodepleting chemotherapy including cyclophosphamide at a dose of about 300 mg/m2/day, and fludarabine at a dose of 30 mg/m2 for 3 days.
Cells of the invention can be administered in dosages and routes and at times to be determined in appropriate pre-clinical and clinical experimentation and trials. Cell compositions may be administered multiple times at dosages within these ranges. Administration of the cells of the invention may be combined with other methods useful to treat the desired disease or condition as determined by those of skill in the art.
It is known in the art that one of the adverse effects following infusion of CAR T cells is the onset of immune activation, known as cytokine release syndrome (CRS). CRS is immune activation resulting in elevated inflammatory cytokines. CRS is a known on-target toxicity, development of which likely correlates with efficacy. Clinical and laboratory measures range from mild CRS (constitutional symptoms and/or grade-2 organ toxicity) to severe CRS (sCRS; grade >3 organ toxicity, aggressive clinical intervention, and/or potentially life threatening). Clinical features include: high fever, malaise, fatigue, myalgia, nausea, anorexia, tachycardia/hypotension, capillary leak, cardiac dysfunction, renal impairment, hepatic failure, and disseminated intravascular coagulation. Dramatic elevations of cytokines including interferon-gamma, granulocyte macrophage colony-stimulating factor, IL- 10, and IL-6 have been shown following CAR T-cell infusion. One CRS signature is elevation of cytokines including IL-6 (severe elevation), IFN-gamma, TNF-alpha (moderate), and IL -2 (mild). Elevations in clinically available markers of inflammation including ferritin and C-reactive protein (CRP) have also been observed to correlate with the CRS syndrome. The presence of CRS generally correlates with expansion and progressive immune activation of adoptively transferred cells. It has been demonstrated that the degree of CRS severity is dictated by disease burden at the time of infusion as patients with high tumor burden experience a more sCRS.
Accordingly, the invention provides for, following the diagnosis of CRS, appropriate CRS management strategies to mitigate the physiological symptoms of uncontrolled inflammation without dampening the antitumor efficacy of the engineered cells (e.g., CAR T cells). CRS management strategies are known in the art. For example, systemic corticosteroids may be administered to rapidly reverse symptoms of sCRS (e.g., grade 3 CRS) without compromising initial antitumor response. In some embodiments, an anti-IL-6R antibody may be administered. An example of an anti-IL-6R antibody is the Food and Drug Administration-approved monoclonal antibody tocilizumab, also known as atlizumab (marketed as Actemra, or RoActemra). Tocilizumab is a humanized monoclonal antibody against the interleukin-6 receptor (IL-6R). Administration of tocilizumab has demonstrated near-immediate reversal of CRS.
CRS is generally managed based on the severity of the observed syndrome and interventions are tailored as such. CRS management decisions may be based upon clinical signs and symptoms and response to interventions, not solely on laboratory values alone.
Mild to moderate cases generally are treated with symptom management with fluid therapy, non-steroidal anti-inflammatory drug (NSAID) and antihistamines as needed for adequate symptom relief. More severe cases include patients with any degree of hemodynamic instability; with any hemodynamic instability, the administration of tocilizumab is recommended. The first-line management of CRS may be tocilizumab, in some embodiments, at the labeled dose of 8 mg/kg IV over 60 minutes (not to exceed 800 mg/dose); tocilizumab can be repeated Q8 hours. If suboptimal response to the first dose of tocilizumab, additional doses of tocilizumab may be considered. Tocilizumab can be administered alone or in combination with corticosteroid therapy. Patients with continued or progressive CRS symptoms, inadequate clinical improvement in 12-18 hours or poor response to tocilizumab, may be treated with high- dose corticosteroid therapy, generally hydrocortisone 100 mg IV or methylprednisolone 1-2 mg/kg. In patients with more severe hemodynamic instability or more severe respiratory symptoms, patients may be administered high-dose corticosteroid therapy early in the course of the CRS. CRS management guidance may be based on published standards (Lee et al. (2019) Biol Blood Marrow Transplant, doi.org/10.1016/j.bbmt.2018.12.758; Neelapu et al. (2018) Nat Rev Clin Oncology, 15:47; Teachey et al. (2016) Cancer Discov, 6(6): 664-679).
Features consistent with Macrophage Activation Syndrome (MAS) or Hemophagocytic lymphohistiocytosis (HLH) have been observed in patients treated with CAR-T therapy (Henter, 2007), coincident with clinical manifestations of the CRS. MAS appears to be a reaction to immune activation that occurs from the CRS, and should therefore be considered a manifestation of CRS. MAS is similar to HLH (also a reaction to immune stimulation). The clinical syndrome of MAS is characterized by high grade non-remitting fever, cytopenias affecting at least two of three lineages, and hepatosplenomegaly. It is associated with high serum ferritin, soluble interleukin -2 receptor, and triglycerides, and a decrease of circulating natural killer (NK) activity.
Sources of Immune Cells
Prior to expansion, a source of immune cells is obtained from a subject for ex vivo manipulation. Sources of target cells for ex vivo manipulation may also include, e.g., autologous or heterologous donor blood, cord blood, or bone marrow. For example the source of immune cells may be from the subject to be treated with the modified immune cells of the invention, e.g., the subject's blood, the subject's cord blood, or the subject's bone marrow. Non-limiting examples of subjects include humans, dogs, cats, mice, rats, and transgenic species thereof. Preferably, the subject is a human.
Immune cells can be obtained from a number of sources, including blood, peripheral blood mononuclear cells, bone marrow, lymph node tissue, spleen tissue, umbilical cord, lymph, or lymphoid organs. Immune cells are cells of the immune system, such as cells of the innate or adaptive immunity, e.g., myeloid or lymphoid cells, including lymphocytes, typically T cells and/or NK cells. Other exemplary cells include stem cells, such as multipotent and pluripotent stem cells, including induced pluripotent stem cells (iPSCs). In some aspects, the cells are human cells. With reference to the subject to be treated, the cells may be allogeneic and/or autologous. The cells typically are primary cells, such as those isolated directly from a subject and/or isolated from a subject and frozen.
In certain embodiments, the immune cell is a T cell, e.g., a CD8+ T cell (e.g., a CD8+ naive T cell, central memory T cell, or effector memory T cell), a CD4+ T cell, a natural killer T cell (NKT cells), a regulatory T cell (Treg), a stem cell memory T cell, a lymphoid progenitor cell a hematopoietic stem cell, a natural killer cell (NK cell) or a dendritic cell. In some embodiments, the cells are monocytes or granulocytes, e.g., myeloid cells, macrophages, neutrophils, dendritic cells, mast cells, eosinophils, and/or basophils. In an embodiment, the target cell is an induced pluripotent stem (iPS) cell or a cell derived from an iPS cell, e.g., an iPS cell generated from a subject, manipulated to alter (e.g., induce a mutation in) or manipulate the expression of one or more target genes, and differentiated into, e.g., a T cell, e.g., a CD8+ T cell (e.g., a CD8+ naive T cell, central memory T cell, or effector memory T cell), a CD4+ T cell, a stem cell memory T cell, a lymphoid progenitor cell or a hematopoietic stem cell. In some embodiments, the cells include one or more subsets of T cells or other cell types, such as whole T cell populations, CD4+ cells, CD8+ cells, and subpopulations thereof, such as those defined by function, activation state, maturity, potential for differentiation, expansion, recirculation, localization, and/or persistence capacities, antigen- specificity, type of antigen receptor, presence in a particular organ or compartment, marker or cytokine secretion profile, and/or degree of differentiation. Among the sub-types and subpopulations of T cells and/or of CD4+ and/or of CD8+ T cells are naive T (TN) cells, effector T cells (TEFF), memory T cells and sub-types thereof, such as stem cell memory T (TSCM), central memory T (TCM), effector memory T (TEM), or terminally differentiated effector memory T cells, tumor-infiltrating lymphocytes (TIL), immature T cells, mature T cells, helper T cells, cytotoxic T cells, mucosa- associated invariant T (MAIT) cells, naturally occurring and adaptive regulatory T (Treg) cells, helper T cells, such as TH1 cells, TH2 cells, TH3 cells, TH17 cells, TH9 cells, TH22 cells, follicular helper T cells, alpha/beta T cells, and delta/gamma T cells. In certain embodiments, any number of T cell lines available in the art, may be used.
In some embodiments, the methods include isolating immune cells from the subject, preparing, processing, culturing, and/or engineering them. In some embodiments, preparation of the engineered cells includes one or more culture and/or preparation steps. The cells for engineering as described may be isolated from a sample, such as a biological sample, e.g., one obtained from or derived from a subject. In some embodiments, the subject from which the cell is isolated is one having the disease or condition or in need of a cell therapy or to which cell therapy will be administered. The subject in some embodiments is a human in need of a particular therapeutic intervention, such as the adoptive cell therapy for which cells are being isolated, processed, and/or engineered. Accordingly, the cells in some embodiments are primary cells, e.g., primary human cells. The samples include tissue, fluid, and other samples taken directly from the subject, as well as samples resulting from one or more processing steps, such as separation, centrifugation, genetic engineering (e.g. transduction with viral vector), washing, and/or incubation. The biological sample can be a sample obtained directly from a biological source or a sample that is processed. Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine and sweat, tissue and organ samples, including processed samples derived therefrom. In some aspects, the sample from which the cells are derived or isolated is blood or a blood-derived sample, or is or is derived from an apheresis or leukapheresis product. Exemplary samples include whole blood, peripheral blood mononuclear cells (PBMCs), leukocytes, bone marrow, thymus, tissue biopsy, tumor, leukemia, lymphoma, lymph node, gut associated lymphoid tissue, mucosa associated lymphoid tissue, spleen, other lymphoid tissues, liver, lung, stomach, intestine, colon, kidney, pancreas, breast, bone, prostate, cervix, testes, ovaries, tonsil, or other organ, and/or cells derived therefrom. Samples include, in the context of cell therapy, e.g., adoptive cell therapy, samples from autologous and allogeneic sources.
In some embodiments, the cells are derived from cell lines, e.g., T cell lines. The cells in some embodiments are obtained from a xenogeneic source, for example, from mouse, rat, nonhuman primate, and pig. In some embodiments, isolation of the cells includes one or more preparation and/or non-affinity based cell separation steps. In some examples, cells are washed, centrifuged, and/or incubated in the presence of one or more reagents, for example, to remove unwanted components, enrich for desired components, lyse or remove cells sensitive to particular reagents. In some examples, cells are separated based on one or more property, such as density, adherent properties, size, sensitivity and/or resistance to particular components.
In some examples, cells from the circulating blood of a subject are obtained, e.g., by apheresis or leukapheresis. The samples, in some aspects, contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and/or platelets, and in some aspects contains cells other than red blood cells and platelets. In some embodiments, the blood cells collected from the subject are washed, e.g., to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing steps. In some embodiments, the cells are washed with phosphate buffered saline (PBS). In some aspects, a washing step is accomplished by tangential flow filtration (TFF) according to the manufacturer's instructions. In some embodiments, the cells are resuspended in a variety of biocompatible buffers after washing. In certain embodiments, components of a blood cell sample are removed and the cells directly resuspended in culture media. In some embodiments, the methods include density-based cell separation methods, such as the preparation of white blood cells from peripheral blood by lysing the red blood cells and centrifugation through a Percoll or Ficoll gradient. In one embodiment, immune cells are obtained cells from the circulating blood of an individual are obtained by apheresis or leukapheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. The cells collected by apheresis may be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media, such as phosphate buffered saline (PBS) or wash solution lacks calcium and may lack magnesium or may lack many if not all divalent cations, for subsequent processing steps. After washing, the cells may be resuspended in a variety of biocompatible buffers, such as, for example, Ca-free, Mg-free PBS. Alternatively, the undesirable components of the apheresis sample may be removed, and the cells directly resuspended in culture media.
In some embodiments, the isolation methods include the separation of different cell types based on the expression or presence in the cell of one or more specific molecules, such as surface markers, e.g., surface proteins, intracellular markers, or nucleic acid. In some embodiments, any known method for separation based on such markers may be used. In some embodiments, the separation is affinity- or immunoaffinity-based separation. For example, the isolation in some aspects includes separation of cells and cell populations based on the cells' expression or expression level of one or more markers, typically cell surface markers, for example, by incubation with an antibody or binding partner that specifically binds to such markers, followed generally by washing steps and separation of cells having bound the antibody or binding partner, from those cells having not bound to the antibody or binding partner.
Such separation steps can be based on positive selection, in which the cells having bound the reagents are retained for further use, and/or negative selection, in which the cells having not bound to the antibody or binding partner are retained. In some examples, both fractions are retained for further use. In some aspects, negative selection can be particularly useful where no antibody is available that specifically identifies a cell type in a heterogeneous population, such that separation is best carried out based on markers expressed by cells other than the desired population. The separation need not result in 100% enrichment or removal of a particular cell population or cells expressing a particular marker. For example, positive selection of or enrichment for cells of a particular type, such as those expressing a marker, refers to increasing the number or percentage of such cells, but need not result in a complete absence of cells not expressing the marker. Likewise, negative selection, removal, or depletion of cells of a particular type, such as those expressing a marker, refers to decreasing the number or percentage of such cells, but need not result in a complete removal of all such cells.
In some examples, multiple rounds of separation steps are carried out, where the positively or negatively selected fraction from one step is subjected to another separation step, such as a subsequent positive or negative selection. In some examples, a single separation step can deplete cells expressing multiple markers simultaneously, such as by incubating cells with a plurality of antibodies or binding partners, each specific for a marker targeted for negative selection. Likewise, multiple cell types can simultaneously be positively selected by incubating cells with a plurality of antibodies or binding partners expressed on the various cell types.
In some embodiments, one or more of the T cell populations is enriched for or depleted of cells that are positive for (marker+) or express high levels (marker111811) of one or more particular markers, such as surface markers, or that are negative for (marker -) or express relatively low levels (markerlow) of one or more markers. For example, in some aspects, specific subpopulations of T cells, such as cells positive or expressing high levels of one or more surface markers, e.g., CD28+, CD62L+, CCR7+, CD27+, CD127+, CD4+, CD8+, CD45RA+, and/or CD45RO+ T cells, are isolated by positive or negative selection techniques. In some cases, such markers are those that are absent or expressed at relatively low levels on certain populations of T cells (such as non-memory cells) but are present or expressed at relatively higher levels on certain other populations of T cells (such as memory cells). In one embodiment, the cells (such as the CD8+ cells or the T cells, e g., CD3+ cells) are enriched for (i.e., positively selected for) cells that are positive or expressing high surface levels of CD45RO, CCR7, CD28, CD27, CD44, CD127, and/or CD62L and/or depleted of (e.g., negatively selected for) cells that are positive for or express high surface levels of CD45RA. In some embodiments, cells are enriched for or depleted of cells positive or expressing high surface levels of CD122, CD95, CD25, CD27, and/or IL7-Ra (CD127). In some examples, CD8+ T cells are enriched for cells positive for CD45RO (or negative for CD45RA) and for CD62L. For example, CD3+, CD28+ T cells can be positively selected using CD3/CD28 conjugated magnetic beads (e.g., DYNABEADS® M-450 CD3/CD28 T Cell Expander).
In some embodiments, T cells are separated from a PBMC sample by negative selection of markers expressed on non-T cells, such as B cells, monocytes, or other white blood cells, such as CD 14. In some aspects, a CD4+ or CD8+ selection step is used to separate CD4+ helper and CD8+ cytotoxic T cells. Such CD4+ and CD8+ populations can be further sorted into subpopulations by positive or negative selection for markers expressed or expressed to a relatively higher degree on one or more naive, memory, and/or effector T cell subpopulations. In some embodiments, CD8+ cells are further enriched for or depleted of naive, central memory, effector memory, and/or central memory stem cells, such as by positive or negative selection based on surface antigens associated with the respective subpopulation. In some embodiments, enrichment for central memory T (TCM) cells is carried out to increase efficacy, such as to improve longterm survival, expansion, and/or engraftment following administration, which in some aspects is particularly robust in such sub-populations. In some embodiments, combining TCM-enriched CD8+ T cells and CD4+ T cells further enhances efficacy.
In some embodiments, memory T cells are present in both CD62L+ and CD62L- subsets of CD8+ peripheral blood lymphocytes. PBMC can be enriched for or depleted of CD62L-CD8+ and/or CD62L+CD8+ fractions, such as using anti-CD8 and anti-CD62L antibodies. In some embodiments, a CD4+ T cell population and a CD8+ T cell sub-population, e.g., a subpopulation enriched for central memory (TCM) cells. In some embodiments, the enrichment for central memory T (TCM) cells is based on positive or high surface expression of CD45RO, CD62L, CCR7, CD28, CD3, and/or CD127; in some aspects, it is based on negative selection for cells expressing or highly expressing CD45RA and/or granzyme B. In some aspects, isolation of a CD8+ population enriched for TCM cells is carried out by depletion of cells expressing CD4, CD 14, CD45RA, and positive selection or enrichment for cells expressing CD62L. In one aspect, enrichment for central memory T (TCM) cells is carried out starting with a negative fraction of cells selected based on CD4 expression, which is subjected to a negative selection based on expression of CD14 and CD45RA, and a positive selection based on CD62L. Such selections in some aspects are carried out simultaneously and in other aspects are carried out sequentially, in either order. In some aspects, the same CD4 expression-based selection step used in preparing the CD8+ cell population or subpopulation, also is used to generate the CD4+ cell population or sub-population, such that both the positive and negative fractions from the CD4-based separation are retained and used in subsequent steps of the methods, optionally following one or more further positive or negative selection steps.
CD4+ T helper cells are sorted into naive, central memory, and effector cells by identifying cell populations that have cell surface antigens. CD4+ lymphocytes can be obtained by standard methods. In some embodiments, naive CD4+ T lymphocytes are CD45RO-, CD45RA+, CD62L+, CD4+ T cells. In some embodiments, central memory CD4+ cells are CD62L+ and CD45RO+. In some embodiments, effector CD4+ cells are CD62L- and CD45RO. In one example, to enrich for CD4+ cells by negative selection, a monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CD1 lb, CD16, HLA-DR, and CD8. In some embodiments, the antibody or binding partner is bound to a solid support or matrix, such as a magnetic bead or paramagnetic bead, to allow for separation of cells for positive and/or negative selection.
In some embodiments, the cells are incubated and/or cultured prior to or in connection with genetic engineering. The incubation steps can include culture, cultivation, stimulation, activation, and/or propagation. In some embodiments, the compositions or cells are incubated in the presence of stimulating conditions or a stimulatory agent. Such conditions include those designed to induce proliferation, expansion, activation, and/or survival of cells in the population, to mimic antigen exposure, and/or to prime the cells for genetic engineering, such as for the introduction of a recombinant antigen receptor. The conditions can include one or more of particular media, temperature, oxygen content, carbon dioxide content, time, agents, e.g., nutrients, amino acids, antibiotics, ions, and/or stimulatory factors, such as cytokines, chemokines, antigens, binding partners, fusion proteins, recombinant soluble receptors, and any other agents designed to activate the cells. In some embodiments, the stimulating conditions or agents include one or more agent, e.g., ligand, which is capable of activating an intracellular signaling domain of a TCR complex. In some aspects, the agent turns on or initiates TCR/CD3 intracellular signaling cascade in a T cell. Such agents can include antibodies, such as those specific for a TCR component and/or costimulatory receptor, e.g., anti-CD3, anti-CD28, for example, bound to solid support such as a bead, and/or one or more cytokines. Optionally, the expansion method may further comprise the step of adding anti-CD3 and/or anti-CD28 antibody to the culture medium (e.g., at a concentration of at least about 0.5 ng/ml). In some embodiments, the stimulating agents include IL-2 and/or IL- 15, for example, an IL-2 concentration of at least about 10 units/mL.
In another embodiment, T cells are isolated from peripheral blood by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLL™ gradient. Alternatively, T cells can be isolated from an umbilical cord. Tn any event, a specific subpopulation of T cells can be further isolated by positive or negative selection techniques.
The cord blood mononuclear cells so isolated can be depleted of cells expressing certain antigens, including, but not limited to, CD34, CD8, CD 14, CD 19, and CD56. Depletion of these cells can be accomplished using an isolated antibody, a biological sample comprising an antibody, such as ascites, an antibody bound to a physical support, and a cell bound antibody.
Enrichment of a T cell population by negative selection can be accomplished using a combination of antibodies directed to surface markers unique to the negatively selected cells. A preferred method is cell sorting and/or selection via negative magnetic immunoadherence or flow cytometry that uses a cocktail of monoclonal antibodies directed to cell surface markers present on the cells negatively selected. For example, to enrich for CD4+ cells by negative selection, a monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CDl lb, CD16, HLA-DR, and CD8.
For isolation of a desired population of cells by positive or negative selection, the concentration of cells and surface (e.g., particles such as beads) can be varied. In certain embodiments, it may be desirable to significantly decrease the volume in which beads and cells are mixed together (i.e., increase the concentration of cells), to ensure maximum contact of cells and beads. For example, in one embodiment, a concentration of 2 billion cells/ml is used. In one embodiment, a concentration of 1 billion cells/ml is used. In a further embodiment, greater than 100 million cells/ml is used. In a further embodiment, a concentration of cells of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells/ml is used. In yet another embodiment, a concentration of cells from 75, 80, 85, 90, 95, or 100 million cells/ml is used. In further embodiments, concentrations of 125 or 150 million cells/ml can be used. Using high concentrations can result in increased cell yield, cell activation, and cell expansion.
T cells can also be frozen after the washing step, which does not require the monocyteremoval step. While not wishing to be bound by theory, the freeze and subsequent thaw step provides a more uniform product by removing granulocytes and to some extent monocytes in the cell population. After the washing step that removes plasma and platelets, the cells may be suspended in a freezing solution. While many freezing solutions and parameters are known in the art and will be useful in this context, in a non-limiting example, one method involves using PBS containing 20% DMSO and 8% human serum albumin, or other suitable cell freezing media. The cells are then frozen to -80°C at a rate of 1°C per minute and stored in the vapor phase of a liquid nitrogen storage tank. Other methods of controlled freezing may be used as well as uncontrolled freezing immediately at -20°C or in liquid nitrogen.
In one embodiment, the population of T cells is comprised within cells such as peripheral blood mononuclear cells, cord blood cells, a purified population of T cells, and a T cell line. In another embodiment, peripheral blood mononuclear cells comprise the population of T cells. In yet another embodiment, purified T cells comprise the population of T cells.
In certain embodiments, T regulatory cells (Tregs) can be isolated from a sample. The sample can include, but is not limited to, umbilical cord blood or peripheral blood. In certain embodiments, the Tregs are isolated by flow-cytometry sorting. The sample can be enriched for Tregs prior to isolation by any means known in the art. The isolated Tregs can be cryopreserved, and/or expanded prior to use. Methods for isolating Tregs are described in U.S. Patent Numbers: 7,754,482, 8,722,400, and 9,555,105, and U.S. Patent Application No. 13/639,927, contents of which are incorporated herein in their entirety.
Expansion of Immune Cells
Whether prior to or after modification of cells to express a CAR, the cells can be activated and expanded in number using methods as described, for example, in U.S. Patent Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S. Publication No. 20060121005. For example, the T cells of the invention may be expanded by contact with a surface having attached thereto an agent that stimulates a CD3/TCR complex associated signal and a ligand that stimulates a co-stimulatory molecule on the surface of the T cells. In particular, T cell populations may be stimulated by contact with an anti-CD3 antibody, or antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin) in conjunction with a calcium ionophore. For co-stimulation of an accessory molecule on the surface of the T cells, a ligand that binds the accessory molecule is used. For example, T cells can be contacted with an anti- CD3 antibody and an anti-CD28 antibody, under conditions appropriate for stimulating proliferation of the T cells. Examples of an anti-CD28 antibody include 9.3, B-T3, XR-CD28 (Diaclone, Besancon, France) and these can be used in the invention, as can other methods and reagents known in the art (see, e.g., ten Berge et al., Transplant Proc. (1998) 30(8): 3975-3977; Haanen et al., J. Exp. Med. (1999) 190(9): 1319-1328; and Garland et al., J. Immunol. Methods (1999) 227(1-2): 53-63).
Expanding T cells by the methods disclosed herein can be multiplied by about 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 200 fold, 300 fold, 400 fold, 500 fold, 600 fold, 700 fold, 800 fold, 900 fold, 1000 fold, 2000 fold, 3000 fold, 4000 fold, 5000 fold, 6000 fold, 7000 fold, 8000 fold, 9000 fold, 10,000 fold, 100,000 fold, 1,000,000 fold, 10,000,000 fold, or greater, and any and all whole or partial integers therebetween. In one embodiment, the T cells expand in the range of about 20 fold to about 50 fold.
Following culturing, the T cells can be incubated in cell medium in a culture apparatus for a period of time or until the cells reach confluency or high cell density for optimal passage before passing the cells to another culture apparatus. The culturing apparatus can be of any culture apparatus commonly used for culturing cells in vitro. Preferably, the level of confluence is 70% or greater before passing the cells to another culture apparatus. More preferably, the level of confluence is 90% or greater. A period of time can be any time suitable for the culture of cells in vitro. The T cell medium may be replaced during the culture of the T cells at any time. Preferably, the T cell medium is replaced about every 2 to 3 days. The T cells are then harvested from the culture apparatus whereupon the T cells can be used immediately or cryopreserved to be stored for use at a later time. In one embodiment, the invention includes cryopreserving the expanded T cells. The cryopreserved T cells are thawed prior to introducing nucleic acids into the T cell.
In another embodiment, the method comprises isolating T cells and expanding the T cells. In another embodiment, the invention further comprises cryopreserving the T cells prior to expansion. In yet another embodiment, the cryopreserved T cells are thawed for electroporation with the RNA encoding the chimeric membrane protein.
Another procedure for ex vivo expansion cells is described in U.S. Pat. No. 5,199,942 (incorporated herein by reference). Expansion, such as described in U.S. Pat. No. 5,199,942 can be an alternative or in addition to other methods of expansion described herein. Briefly, ex vivo culture and expansion of T cells comprises the addition to the cellular growth factors, such as those described in U.S. Pat. No. 5,199,942, or other factors, such as FLT3-L, IL-1, IL-3 and c-kit ligand. In one embodiment, expanding the T cells comprises culturing the T cells with a factor selected from the group consisting of FLT3-L, IL-1, IL-3 and c-kit ligand.
The culturing step as described herein (contact with agents as described herein or after electroporation) can be very short, for example less than 24 hours such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours. The culturing step as described further herein (contact with agents as described herein) can be longer, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more days.
Various terms are used to describe cells in culture. Cell culture refers generally to cells taken from a living organism and grown under controlled condition. A primary cell culture is a culture of cells, tissues or organs taken directly from an organism and before the first subculture. Cells are expanded in culture when they are placed in a growth medium under conditions that facilitate cell growth and/or division, resulting in a larger population of the cells. When cells are expanded in culture, the rate of cell proliferation is typically measured by the amount of time required for the cells to double in number, otherwise known as the doubling time.
Each round of subculturing is referred to as a passage. When cells are subcultured, they are referred to as having been passaged. A specific population of cells, or a cell line, is sometimes referred to or characterized by the number of times it has been passaged. For example, a cultured cell population that has been passaged ten times may be referred to as a PIO culture. The primary culture, i.e., the first culture following the isolation of cells from tissue, is designated P0. Following the first subculture, the cells are described as a secondary culture (Pl or passage 1). After the second subculture, the cells become a tertiary culture (P2 or passage 2), and so on. It will be understood by those of skill in the art that there may be many population doublings during the period of passaging; therefore the number of population doublings of a culture is greater than the passage number. The expansion of cells (i.e., the number of population doublings) during the period between passaging depends on many factors, including but is not limited to the seeding density, substrate, medium, and time between passaging.
In one embodiment, the cells may be cultured for several hours (about 3 hours) to about 14 days or any hourly integer value in between. Conditions appropriate for T cell culture include an appropriate media (e.g., Minimal Essential Media or RPMI Media 1640 or, X-vivo 15, (Lonza)) that may contain factors necessary for proliferation and viability, including serum (e.g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-gamma, IL-4, IL-7, GM-CSF, IL-10, IL-12, TL-15, TGF-beta, and TNF-a or any other additives for the growth of cells known to the skilled artisan. Other additives for the growth of cells include, but are not limited to, surfactant, plasmanate, and reducing agents such as N-acetyl-cysteine and 2-mercaptoethanol. Media can include RPMI 1640, AIM-V, DMEM, MEM, a-MEM, F-12, X-Vivo 15, and X-Vivo 20, Optimizer, with added amino acids, sodium pyruvate, and vitamins, either serum-free or supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones, and/or an amount of cytokine(s) sufficient for the growth and expansion of T cells. Antibiotics, e.g., penicillin and streptomycin, are included only in experimental cultures, not in cultures of cells that are to be infused into a subject. The target cells are maintained under conditions necessary to support growth, for example, an appropriate temperature (e.g., 37°C) and atmosphere (e.g., air plus 5% CO2).
The medium used to culture the T cells may include an agent that can co-stimulate the T cells. For example, an agent that can stimulate CD3 is an antibody to CD3, and an agent that can stimulate CD28 is an antibody to CD28. A cell isolated by the methods disclosed herein can be expanded approximately 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 200 fold, 300 fold, 400 fold, 500 fold, 600 fold, 700 fold, 800 fold, 900 fold, 1000 fold, 2000 fold, 3000 fold, 4000 fold, 5000 fold, 6000 fold, 7000 fold, 8000 fold, 9000 fold, 10,000 fold, 100,000 fold, 1,000,000 fold, 10,000,000 fold, or greater. In one embodiment, the T cells expand in the range of about 20 fold to about 50 fold, or more. In one embodiment, human T regulatory cells are expanded via anti-CD3 antibody coated KT64.86 artificial antigen presenting cells (aAPCs). Methods for expanding and activating T cells can be found in U.S. Patent Numbers: 7,754,482, 8,722,400, and 9,555, 105, contents of which are incorporated herein in their entirety.
In one embodiment, the method of expanding the T cells can further comprise isolating the expanded T cells for further applications. In another embodiment, the method of expanding can further comprise a subsequent electroporation of the expanded T cells followed by culturing. The subsequent electroporation may include introducing a nucleic acid encoding an agent, such as a transducing the expanded T cells, transfecting the expanded T cells, or electroporating the expanded T cells with a nucleic acid, into the expanded population of T cells, wherein the agent further stimulates the T cell. The agent may stimulate the T cells, such as by stimulating further expansion, effector function, or another T cell function. Pharmaceutical compositions and Formulations
Also provided are populations of immune cells of the invention, compositions containing such cells and/or enriched for such cells, such as in which cells expressing the recombinant receptor make up at least 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more of the total cells in the composition or cells of a certain type such as T cells or CD8+ or CD4+ cells. Among the compositions are pharmaceutical compositions and formulations for administration, such as for adoptive cell therapy. Also provided are therapeutic methods for administering the cells and compositions to subjects, e.g., patients.
Also provided are compositions including the cells for administration, including pharmaceutical compositions and formulations, such as unit dose form compositions including the number of cells for administration in a given dose or fraction thereof. The pharmaceutical compositions and formulations generally include one or more optional pharmaceutically acceptable carrier or excipient. In some embodiments, the composition includes at least one additional therapeutic agent.
The term "pharmaceutical formulation" refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered. A "pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject. A pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative. In some aspects, the choice of carrier is determined in part by the particular cell and/or by the method of administration. Accordingly, there are a variety of suitable formulations. For example, the pharmaceutical composition can contain preservatives. Suitable preservatives may include, for example, methylparaben, propylparaben, sodium benzoate, and benzalkonium chloride. In some aspects, a mixture of two or more preservatives is used. The preservative or mixtures thereof are typically present in an amount of about 0.0001% to about 2% by weight of the total composition. Carriers are described, e.g., by Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980). Pharmaceutically acceptable carriers are generally nontoxic to recipients at the dosages and concentrations employed, and include, but are not limited to: buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g. Zn-protein complexes); and/or non-ionic surfactants such as polyethylene glycol (PEG).
Buffering agents in some aspects are included in the compositions. Suitable buffering agents include, for example, citric acid, sodium citrate, phosphoric acid, potassium phosphate, and various other acids and salts. In some aspects, a mixture of two or more buffering agents is used. The buffering agent or mixtures thereof are typically present in an amount of about 0.001% to about 4% by weight of the total composition. Methods for preparing administrable pharmaceutical compositions are known. Exemplary methods are described in more detail in, for example, Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins; 21st ed. (May 1, 2005).
The formulations can include aqueous solutions. The formulation or composition may also contain more than one active ingredient useful for the particular indication, disease, or condition being treated with the cells, preferably those with activities complementary to the cells, where the respective activities do not adversely affect one another. Such active ingredients are suitably present in combination in amounts that are effective for the purpose intended. Thus, in some embodiments, the pharmaceutical composition further includes other pharmaceutically active agents or drugs, such as chemotherapeutic agents, e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, and/or vincristine. The pharmaceutical composition in some embodiments contains the cells in amounts effective to treat or prevent the disease or condition, such as a therapeutically effective or prophylactically effective amount. Therapeutic or prophylactic efficacy in some embodiments is monitored by periodic assessment of treated subjects. The desired dosage can be delivered by a single bolus administration of the cells, by multiple bolus administrations of the cells, or by continuous infusion administration of the cells.
Formulations include those for oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, buccal, sublingual, or suppository administration. In some embodiments, the cell populations are administered parenterally. The term "parenteral," as used herein, includes intravenous, intramuscular, subcutaneous, rectal, vaginal, and intraperitoneal administration. In some embodiments, the cells are administered to the subject using peripheral systemic delivery by intravenous, intraperitoneal, or subcutaneous injection. Compositions in some embodiments are provided as sterile liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which may in some aspects be buffered to a selected pH. Liquid preparations are normally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are somewhat more convenient to administer, especially by injection. Viscous compositions, on the other hand, can be formulated within the appropriate viscosity range to provide longer contact periods with specific tissues. Liquid or viscous compositions can comprise carriers, which can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyoi (for example, glycerol, propylene glycol, liquid polyethylene glycol) and suitable mixtures thereof.
Sterile injectable solutions can be prepared by incorporating the cells in a solvent, such as in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, dextrose, or the like. The compositions can contain auxiliary substances such as wetting, dispersing, or emulsifying agents (e.g., methylcellulose), pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, and/or colors, depending upon the route of administration and the preparation desired. Standard texts may in some aspects be consulted to prepare suitable preparations.
Various additives which enhance the stability and sterility of the compositions, including antimicrobial preservatives, antioxidants, chelating agents, and buffers, can be added. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, and sorbic acid. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.
The formulations to be used for in vivo administration are generally sterile. Sterility may be readily accomplished, e.g., by filtration through sterile filtration membranes.
The contents of the articles, patents, and patent applications, and all other documents and electronically available information mentioned or cited herein, are hereby incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. Applicants reserve the right to physically incorporate into this application any and all materials and information from any such articles, patents, patent applications, or other physical and electronic documents.
While the present invention has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made, and equivalents may be substituted without departing from the true spirit and scope of the invention. It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods described herein may be made using suitable equivalents without departing from the scope of the embodiments disclosed herein. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the claims appended hereto. Having now described certain embodiments in detail, the same will be more clearly understood by reference to the following examples, which are included for purposes of illustration only and are not intended to be limiting.
EXPERIMENTAL EXAMPLES
The invention is now described with reference to the following Examples. These Examples are provided for the purpose of illustration only, and the invention is not limited to these Examples, but rather encompasses all variations that are evident as a result of the teachings provided herein.
Example 1 : Development of an anti-CEACAM6 CAR CEACAM6 is cell surface adhesion receptor that is highly expressed in pancreatic, lung, stomach and colon cancers among others. CEACAM6 can also function as an immune checkpoint molecule which negatively-regulates T cell activation. In cancer, CEACAM6 overexpression is accompanied by altered glycosylation, which results in cancer-specific, N- glycoforms of the protein which may enhance tumor metastasis or growth. These alternative glycoforms also present a unique target that enable cytotoxic therapies such as CAR-T cells to target tumor cells while largely avoiding normal tissues, which express typical glycoforms of CEACAM6. In order to develop a CAR construct that targets the N-glycosyl version of CEACAM6, the anti-CEACAM6 antibody CT 109 was obtained and the amino acid sequences of the heavy and light-chain variable regions were used to generate unique scFvs representing VH- VL (H2L) and VL-VH (L2H) versions. The nucleic acid sequences encoding these scFvs were also codon-optimized to maximize in vivo expression. These scFvs were then engineered into constructs comprising CD2, 4- IBB, CD27, CD28, ICOS, and 0X40 costimulatory signaling domains. Compared to other commonly-used CAR costimulatory domains such as CD28 and 4- 1BB, CD2 offers several advantages in the context of anti-CEACAM6 CAR constructs, including resistance to exhaustion. The mAblO9-CAR constructs were then expressed in normal human T cells and tested for antigen recognition and cytotoxic function in vitro (FIG. 1). Here mAblO9-CAR T cells were co-incubated with CEACAM6+ (CD66c) BxPC3 cells at the indicated effector-to-target ratios. NTD (non-transduced T cells) were used as negative controls, as well as tumor cells grown in media alone (spontaneous lysis control) and exposed to the detergent Triton X-100 (maximum lysis control). Impedance of each well was measured every 15 minutes using the xCELLigence RTCA assay. These data demonstrated that mAblO9-CAR T cells are capable of recognizing and selectively lysing BxPC3 cells in vitro. Similar assays were subsequently carried out with T cells expressing the various CAR constructs stimulated by ASPC1 or BXPC3 pancreatic cancer cells for 24 hours. Culture supernatant was then collected and analyzed for expression of GM-CSF, IL-10, IL-2, TNFa, and other cytokines by Luminex (FIG. 6). These results demonstrated that while every CEACAM6 CAR construct was able to activate T cells, the CD2z construct resulted in a modest reduction in TNFa production as compared to the other constructs. In vitro studies were then carried out to observe the effect of chronic antigen stimulation on the 4-1BB, CD2, and CD28 based CAR constructs. Anti- CEACAM6 CAR T cells were stimulated by BXPC3 cells for 2x3 days per week. Cytotoxicity was determined without pre-stimulation, after 1 week of chronic stimulation, and after 3 weeks of chronic stimulation. Results demonstrated that all three constructs were cytotoxic without chronic stimulation, but only the 4- IBB and CD2 based constructs maintained maximal cytotoxicity after both 1 and 3 weeks of chronic stimulation, while the CD28 based CAR lost some cytotoxic function (FIG. 7).
Example 2: Use of CEACAM6 CAR T cells in vivo
Having demonstrated the in vivo functionality of mAblO9-CAR expressing T cells, a series of studies were then undertaken to verify the capability of these cells to lyse and arrest tumor growth in vivo. For these studies, immunodeficient NSG (NOD Scid ZL-2Ry knockout) mice were implanted with BxPC3 tumor cells which had been engineered to express luciferase (FIG. 2). Once tumors were established, mice were treated with non-transduced T cells (NTD), mAb 109-H2L-CD2z CART cells or mAb 109-L2H-CD2z CART cells. Each mouse received 8xl06 total T cells which were at least 57.6% CAR+ as determined by flow cytometry. Example bioluminescence images and a log cell kill graph are depicted in FIG. 4. As a separate measure of tumor growth delay, the average tumor volume for mice in each treatment group was determined at several timepoints during the course of the study as determined by serial measurements using calipers (FIG. 3). The results from these studies demonstrated that both H2L and L2H versions of the mAblO9-CD2z CAR construct are able to control BxPC3 tumor growth in vivo. Lastly, peripheral blood was collected from mice at the conclusion of the experiment, and the number of circulating human CD4 and CD8 T cells per ml of blood was determined by flow cytometry (FIG. 5). These results revealed that mice treated with mAb 109- CART cells demonstrate circulating peripheral blood T cells, indicative of anti-tumor responses in these animals. In total, and without wishing to be bound by theory, these studies suggested that mAb 109 CAR constructs are capable of being expressed in human T cells and are able to induce selective tumor cell death both in vitro and in vivo.
In a subsequent study, NSG mice were subcutaneously implanted with le6 BXPC3 pancreatic cancer cells and treated with 5e6 CAR T cells with CD2, 4-1BB, or CD28 based costimulatory domains when tumor volume averaged 250mm3. Tumor volume was monitored weekly by caliper measurements. At 31 days after CAR T cell treatment, CD4 and CD8 T cells were measured in the peripheral blood of mice by flow cytometry (FIG. 8). Here the CD2-based CAR maintained the greatest reduction in tumor growth as compared to the CD28 and 4-1 BB based CARs. The CD28 and 4-1BB based CARs, though, demonstrated similar reduced growth as compared to control. All three CAR constructs demonstrated robust engraftment at 31 -days, with only the CD28 CAR being slightly reduced as compared to the other constructs. In total, and without wishing to be bound by theory, these results demonstrated that all anti-CEACAM6 CARs disclosed herein are capable of recognizing and controlling CEACAM6-expressing tumors in vivo.
Enumerated Embodiments
The following enumerated embodiments are provided, the numbering of which is not to be construed as designating levels of importance.
Embodiment 1 provides a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEA Cell Adhesion Molecule 6 (CEACAM6), a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain comprises: i. a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid set forth in SEQ ID NO: 3; and ii. a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; and wherein the antigen binding domain comprises a single-chain variable fragment (scFv), and wherein the intracellular signaling domain comprises a costimulatory domain selected from the group consisting of a CD2 costimulatory domain, a 4-1BB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain. Embodiment 2 provides the CAR of any one of embodiment 1, wherein the antigen binding domain comprises a heavy chain variable region comprising an amino acid sequence having at least 95%-99% identity to the amino acid sequence set forth in SEQ ID NO: 7.
Embodiment 3 provides the CAR of embodiment 1, wherein the antigen binding domain comprises a heavy chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 7.
Embodiment 4 provides the CAR of embodiment 1, wherein the antigen binding domain comprises a heavy chain variable region consisting of an amino acid sequence set forth in SEQ ID NO: 7.
Embodiment 5 provides the CAR of embodiment 1, wherein the antigen binding domain comprises a light chain variable region comprising an amino acid sequence having at least 95- 99% identity to the amino acid sequence set forth in SEQ ID NO: 9.
Embodiment 6 provides the CAR of embodiment 1, wherein the antigen binding domain comprises a light chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 9.
Embodiment 7 provides the CAR of embodiment 1, wherein the antigen binding domain comprises a light chain variable region consisting of an amino acid set forth in SEQ ID NO: 9.
Embodiment 8 provides a chimeric antigen receptor (CAR) comprising an antigen binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7; and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9.
Embodiment 9 provides a chimeric antigen receptor (CAR) comprising an antigen binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain comprises any one of the amino acid sequences set forth in SEQ ID NOs: 18 and 20.
Embodiment 10 provides the CAR of embodiment 1, wherein the transmembrane domain is selected from the group consisting of an artificial hydrophobic sequence, and a transmembrane domain of a type I transmembrane protein, an alpha, beta, or zeta chain of a T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, 0X40 (CD134), 4-1BB (CD137), and CD154. Embodiment 1 1 provides the CAR of embodiment 1, wherein the transmembrane domain comprises a transmembrane domain of CD8 comprising an amino acid sequence set forth in SEQ ID NO: 14.
Embodiment 12 provides the CAR of embodiment 1, further comprising a hinge domain. Embodiment 13 provides the CAR of embodiment 12, wherein the hinge domain is selected from the group consisting of an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial hinge domain, a hinge comprising an amino acid sequence of a CD8 hinge, or any combination thereof.
Embodiment 14 provides the CAR of embodiment 13, wherein the hinge domain is a CD8 hinge comprising an amino acid sequence set forth in SEQ ID NO: 13.
Embodiment 15 provides the CAR of embodiment 1, wherein the CD2 costimulatory domain comprises an amino acid sequence set forth in SEQ ID NO: 15.
Embodiment 16 provides the CAR of any one of embodiments 1-15, wherein the intracellular signaling domain comprises an intracellular domain selected from the group consisting of cytoplasmic signaling domains of a human CD3 zeta chain (CD3Q, FcyRIII, FcsRI, a cytoplasmic tail of an Fc receptor, an immunoreceptor tyrosine-based activation motif (ITAM) bearing cytoplasmic receptor, TCR zeta, FcR gamma, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d, or a variant thereof.
Embodiment 17 provides the CAR of embodiment 16, wherein the intracellular signaling domain comprises an intracellular domain of CD3(^.
Embodiment 18 provides the CAR of embodiment 17, wherein the CD3(^ intracellular domain comprises an amino acid sequence set forth in SEQ ID NO: 16.
Embodiment 19 provides a chimeric antigen receptor (CAR) comprising: i. an antigen binding domain specific for CEACAM6 comprising: a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises and amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; ii. a CD8 transmembrane domain; iii. a costimulatory domain; and iv. a CD3^ intracellular signaling domain; wherein the costimulatory domain is selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain.
Embodiment 20 provides a chimeric antigen receptor (CAR) comprising: i. an antigen binding domain specific for CEACAM6 comprising: a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7; and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9; ii. a CD8 transmembrane domain; iii. a costimulatory domain; and iv. a CD3 intracellular signaling domain; wherein the costimulatory domain is selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain.
Embodiment 21 provides a chimeric antigen receptor (CAR) comprising any one of the amino acid sequences set forth in SEQ ID NOs: 21, 22, 23, 25, 27, 29, and 31.
Embodiment 22 provides a chimeric antigen receptor (CAR) consisting of any one of the amino acid sequences set forth in SEQ ID NOs: 21, 22, 23, 25, 27, 29, and 31.
Embodiment 23 provides a nucleic acid encoding the CAR of any one of embodiments 1- 22.
Embodiment 24 provides a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEACAM6, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises: i. a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and ii. a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises and amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; and iii. wherein the antigen binding domain comprises a single-chain variable fragment (scFv), and iv. wherein the intracellular domain comprises a costimulatory domain selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain.
Embodiment 25 provides a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEACAM6, a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain comprises: i. a heavy chain variable region comprising a nucleic acid sequence set forth in SEQ ID NO: 8; and ii. a light chain variable region comprising a nucleic acid sequence set forth in SEQ ID NO: 10.
Embodiment 26 provides a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEACAM6, a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain is encoded by any one of the nucleotide sequences set forth in SEQ ID NOs: 17 and 19.
Embodiment 27 provides the nucleic acid of any one of embodiments 24-26, wherein the transmembrane domain comprises a transmembrane domain of CD8.
Embodiment 28 provides the nucleic acid of any one of embodiments 24-27, wherein the CAR further comprises a hinge domain.
Embodiment 29 provides the nucleic acid of embodiment 28, wherein the hinge domain is a CD8 hinge. Embodiment 30 the nucleic acid of any one of embodiments 24-29, wherein the intracellular domain comprises a costimulatory signaling domain and an intracellular signaling domain.
Embodiment 31 provides the nucleic acid of embodiment 30, wherein the intracellular signaling domain comprises an intracellular domain of CD3^,
Embodiment 32 provides a vector comprising the nucleic acid of any one of embodiments 24-31.
Embodiment 33 provides the vector of embodiment 32, wherein the vector is an expression vector.
Embodiment 34 provides a cell comprising the CAR of any one of embodiments 1-22, the nucleic acid of any one of embodiments 23-31, or the vector of any one of embodiments 32- 33.
Embodiment 35 provides the cell of embodiment 34, wherein the cell is selected from the group consisting of a T cell, a natural killer (NK) cell, a cytotoxic T lymphocyte (CTL), and a regulatory T cell.
Embodiment 36 provides a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of a modified immune cell comprising the chimeric antigen receptor (CAR) of any one of embodiments 1-22.
Embodiment 37 provides the method of embodiment 36, wherein the modified immune cell is selected from the group consisting of a T cell, a natural killer (NK) cell, a cytotoxic T lymphocyte (CTL), and a regulatory T cell.
Embodiment 38 provides the method of embodiment 36, wherein the cancer is associated with the over-expression of CEACAM6.
Embodiment 39 provides the method of embodiment 36, wherein the cancer is selected from the group consisting of pancreatic cancer, lung cancer, stomach cancer, breast cancer, prostate cancer, and liver cancer.
Other Embodiments
The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this disclosure has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this disclosure may be devised by others skilled in the art without departing from the true spirit and scope of the disclosure. The appended claims are intended to be construed to include all such embodiments and equivalent variations.

Claims

CLAIMS What is claimed:
1. A chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEA Cell Adhesion Molecule 6 (CEACAM6), a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain comprises: i. a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid set forth in SEQ ID NO: 3; and ii. a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; and wherein the antigen binding domain comprises a single-chain variable fragment (scFv), and wherein the intracellular signaling domain comprises a costimulatory domain selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain.
2. The CAR of any one of claim 1, wherein the antigen binding domain comprises a heavy chain variable region comprising an amino acid sequence having at least 95%-99% identity to the amino acid sequence set forth in SEQ ID NO: 7.
3. The CAR of claim 1, wherein the antigen binding domain comprises a heavy chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 7. The CAR of claim 1, wherein the antigen binding domain comprises a heavy chain variable region consisting of an amino acid sequence set forth in SEQ ID NO: 7. The CAR of claim 1, wherein the antigen binding domain comprises a light chain variable region comprising an amino acid sequence having at least 95-99% identity to the amino acid sequence set forth in SEQ ID NO: 9. The CAR of claim 1, wherein the antigen binding domain comprises a light chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 9. The CAR of claim 1, wherein the antigen binding domain comprises a light chain variable region consisting of an amino acid set forth in SEQ ID NO: 9. A chimeric antigen receptor (CAR) comprising an antigen binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7; and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9. A chimeric antigen receptor (CAR) comprising an antigen binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain comprises any one of the amino acid sequences set forth in SEQ ID NOs: 18 and 20. The CAR of claim 1, wherein the transmembrane domain is selected from the group consisting of an artificial hydrophobic sequence, and a transmembrane domain of a type I transmembrane protein, an alpha, beta, or zeta chain of a T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, 0X40 (CD134), 4-1BB (CD137), and CD154. The CAR of claim 1 , wherein the transmembrane domain comprises a transmembrane domain of CD8 comprising an amino acid sequence set forth in SEQ ID NO: 14. The CAR of claim 1, further comprising a hinge domain. The CAR of claim 12, wherein the hinge domain is selected from the group consisting of an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial hinge domain, a hinge comprising an amino acid sequence of a CD8 hinge, or any combination thereof. The CAR of claim 13, wherein the hinge domain is a CD8 hinge comprising an amino acid sequence set forth in SEQ ID NO: 13. The CAR of claim 1, wherein the costimulatory domain is a CD2 costimulatory domain comprising an amino acid sequence set forth in SEQ ID NO: 15. The CAR of any one of claims 1-15, wherein the intracellular signaling domain comprises an intracellular domain selected from the group consisting of cytoplasmic signaling domains of a human CD3 zeta chain (CD3Q, FcyRIII, FcsRI, a cytoplasmic tail of an Fc receptor, an immunoreceptor tyrosine-based activation motif (IT AM) bearing cytoplasmic receptor, TCR zeta, FcR gamma, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d, or a variant thereof. The CAR of claim 16, wherein the intracellular signaling domain comprises an intracellular domain of CD3q. The CAR of claim 17, wherein the CD3(^ intracellular domain comprises an amino acid sequence set forth in SEQ ID NO: 16. A chimeric antigen receptor (CAR) comprising: i. an antigen binding domain specific for CEACAM6 comprising: a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises and amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; ii. a CD8 transmembrane domain; iii. a costimulatory domain; and iv. a CD3(^ intracellular signaling domain; wherein the costimulatory domain is selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain. A chimeric antigen receptor (CAR) comprising: i. an antigen binding domain specific for CEACAM6 comprising: a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7; and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9; ii. a CD8 transmembrane domain; iii. a costimulatory domain; and iv. a CD3 intracellular signaling domain; wherein the costimulatory domain is selected from the group consisting of a CD2 costimulatory domain, a 4- IBB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain. A chimeric antigen receptor (CAR) comprising any one of the amino acid sequences set forth in SEQ ID NOs: 21, 22, 23, 25, 27, 29, and 31. A chimeric antigen receptor (CAR) consisting of any one of the amino acid sequences set forth in SEQ ID NOs: 21, 22, 23, 25, 27, 29, and 31. A nucleic acid encoding the CAR of any one of claims 1-22. A nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEACAM6, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises: i. a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 1, HCDDR2 comprises an amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises and amino acid sequence set forth in SEQ ID NO: 3; and ii. a light chain variable region that comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises and amino acid sequence set forth in SEQ ID NO: 5, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO: 6; and wherein the antigen binding domain comprises a single-chain variable fragment (scFv), and wherein the intracellular domain comprises a costimulatory domain selected from the group consisting of a CD2 costimulatory domain, a 4-1BB costimulatory domain, a CD27 costimulatory domain, a CD28 costimulatory domain, an ICOS costimulatory domain, and an 0X40 costimulatory domain. A nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEACAM6, a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain comprises: i. a heavy chain variable region comprising a nucleic acid sequence set forth in SEQ ID NO: 8; and ii. a light chain variable region comprising a nucleic acid sequence set forth in SEQ ID NO: 10. A nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for CEACAM6, a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain is encoded by any one of the nucleotide sequences set forth in SEQ ID NOs: 17 and 19. The nucleic acid of any one of claims 24-26, wherein the transmembrane domain comprises a transmembrane domain of CD8. The nucleic acid of any one of claims 24-27, wherein the CAR further comprises a hinge domain. The nucleic acid of claim 28, wherein the hinge domain is a CD8 hinge. The nucleic acid of any one of claims 24-29, wherein the intracellular domain comprises a costimulatory signaling domain and an intracellular signaling domain. The nucleic acid of claim 30, wherein the intracellular signaling domain comprises an intracellular domain of CD3(^, A vector comprising the nucleic acid of any one of claims 24-31. The vector of claim 32, wherein the vector is an expression vector. A cell comprising the CAR of any one of claims 1-22, the nucleic acid of any one of claims 23-31, or the vector of any one of claims 32-33. The cell of claim 34, wherein the cell is selected from the group consisting of a T cell, a natural killer (NK) cell, a cytotoxic T lymphocyte (CTL), and a regulatory T cell.
I l l A method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of a modified immune cell comprising the chimeric antigen receptor (CAR) of any one of claims 1-22. The method of claim 36, wherein the modified immune cell is selected from the group consisting of a T cell, a natural killer (NK) cell, a cytotoxic T lymphocyte (CTL), and a regulatory T cell. The method of claim 36, wherein the cancer is associated with the over-expression of CEACAM6. The method of claim 36, wherein the cancer is selected from the group consisting of pancreatic cancer, lung cancer, stomach cancer, breast cancer, prostate cancer, and liver cancer.
PCT/US2023/077423 2022-10-25 2023-10-20 Anti-ceacam6 car-t cells for the treatment of ceacam6+ tumors WO2024091848A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263380882P 2022-10-25 2022-10-25
US63/380,882 2022-10-25

Publications (2)

Publication Number Publication Date
WO2024091848A2 true WO2024091848A2 (en) 2024-05-02
WO2024091848A3 WO2024091848A3 (en) 2024-07-18

Family

ID=90831841

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/077423 WO2024091848A2 (en) 2022-10-25 2023-10-20 Anti-ceacam6 car-t cells for the treatment of ceacam6+ tumors

Country Status (1)

Country Link
WO (1) WO2024091848A2 (en)

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3585819A4 (en) * 2017-02-27 2020-10-14 Caerus Therapeutics, Inc. Antibody constructs and methods of treating cancer
US20200115443A1 (en) * 2018-10-12 2020-04-16 Trican Biotechnology Co., Ltd Bi-functional fusion proteins and uses thereof
US11090336B2 (en) * 2019-03-27 2021-08-17 The Trustees Of The University Of Pennsylvania Tn-MUC1 chimeric antigen receptor (CAR) T cell therapy
MX2022009827A (en) * 2020-02-14 2022-09-05 Univ Leland Stanford Junior Chimeric antigen receptors with cd2 activation.

Also Published As

Publication number Publication date
WO2024091848A3 (en) 2024-07-18

Similar Documents

Publication Publication Date Title
US20210128617A1 (en) SYNTHETIC CARS TO TREAT IL13R-alpha-2 POSITIVE HUMAN AND CANINE TUMORS
EP4034554A1 (en) Disrupting tumor tissues by targeting fibroblast activation protein (fap)
WO2022192346A1 (en) Selective stimulation of t cells in solid tumors using oncolytic viral delivery of orthogonal il-2
US20240041921A1 (en) Compositions and Methods Comprising Prostate Stem Cell Antigen (PSCA) Chimeric Antigen Receptors (CARs)
US20210060070A1 (en) Adoptive cell therapy and methods of dosing thereof
EP4433512A2 (en) Engineered pan-leukocyte antigen cd45 to facilitate car t cell therapy
US20220380447A1 (en) Fibronectin targeting chimeric antigen receptors (cars)
WO2024091848A2 (en) Anti-ceacam6 car-t cells for the treatment of ceacam6+ tumors
US20230085834A1 (en) Chimeric Antigen Receptors Comprising Interleukin-9 Receptor Signaling Domain
US20240285757A1 (en) Compositions and methods for enhancing car t cell efficacy through the engineered secretion of c. perfringens neuraminidase
US20220213205A1 (en) Müllerian inhibiting substance type 2 receptor (misiir)-specific car t cells for the treatment of ovarian cancer and other gynecologic malignancies
US20230364238A1 (en) Methods and Compositions Comprising Orthogonal Cytokine Responsive Immune Cells
WO2023147293A2 (en) Compositions and methods comprising anti-cd38 chimeric antigen receptors (cars)
WO2023004300A2 (en) Chimeric antigen receptor (car)-t signaling optimization for tuning antigen activation threshold
WO2023158978A2 (en) Boosting chimeric antigen receptor cells in the blood
WO2023122727A2 (en) Delivery of multi-cytokine signals by overexpression of wild-type or mutant signal transduction molecules
WO2024192156A2 (en) Generation of car modifiers for tumor treatment
JP2024534417A (en) Chimeric antigen receptor containing an interleukin-9 receptor signaling domain - Patents.com
JP2024534471A (en) Interleukin-9 signaling in chimeric antigen receptor (CAR) immune cells
WO2022173950A1 (en) Ccr4-targeting chimeric antigen receptor cell therapy
WO2020112970A1 (en) Bw6 specific car designed to protect transplanted tissue from rejection

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23883581

Country of ref document: EP

Kind code of ref document: A2