WO2020091635A2 - Гуманизированные антитела против участка бета цепи 9-го семейства trbv9 ткр человека, и способы их применения - Google Patents
Гуманизированные антитела против участка бета цепи 9-го семейства trbv9 ткр человека, и способы их применения Download PDFInfo
- Publication number
- WO2020091635A2 WO2020091635A2 PCT/RU2019/050258 RU2019050258W WO2020091635A2 WO 2020091635 A2 WO2020091635 A2 WO 2020091635A2 RU 2019050258 W RU2019050258 W RU 2019050258W WO 2020091635 A2 WO2020091635 A2 WO 2020091635A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antibody
- ser
- amino acid
- antibodies
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2809—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39591—Stabilisation, fragmentation
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/14—Prodigestives, e.g. acids, enzymes, appetite stimulants, antidyspeptics, tonics, antiflatulents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/10—Cells modified by introduction of foreign genetic material
- C12N5/12—Fused cells, e.g. hybridomas
- C12N5/16—Animal cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/51—Complete heavy chain or Fd fragment, i.e. VH + CH1
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/515—Complete light chain, i.e. VL + CL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
Definitions
- the invention relates to the field of biotechnology and biomedicine, namely to antibodies or their antigen-binding fragments, as well as their use. More specifically, the present invention relates to a monoclonal humanized antibody that specifically binds to the human T cell receptor family. The invention also relates to a nucleic acid encoding a given antibody or antigen binding fragment thereof, an expression vector, a method for producing an antibody and the use of an antibody for the treatment of diseases or disorders associated with the human T-cell receptor family.
- T lymphocytes Autoimmune diseases are caused by autoreactive T lymphocytes (Haroon N et al., Arthritis Rheum. 2013 Oct; 65 (10): 2645-54., Duarte J. et al., PloS One 2010 May 10; 5 (5): el0558 ; Konig M. et al., Front Immunol 2016 Jan 25; 7: 11).
- TCR T cell receptor
- Subunits of T-cell receptors are structurally related to the superfamily of immunoglobulins and are formed from several gene segments. Variable sites of TCR form the antigen-binding center of TCR. This means that they are clone-specific, i.e. differ in T lymphocytes that respond to different antigens.
- T-cell receptors According to the amino acid homology of the variable (V) gene segments that make up the variable domain of TCR, T-cell receptors are divided into different families. According to the IMGT nomenclature, 26 different families are distinguished for the beta chain and 41 families for the alpha chain (Turner SJ et al, Nature Reviews Immunology 2006, V.6, 883-894). To determine the TCR chain family, multiple alignment of the tested amino acid sequence with known TCR chain sequences is used, the information on which is summarized in the IMGT database (“The international ImMunoGeneTics information system”, Lefranc MP, Nucl Acids Res 2001; 29: 207-209 ), available on the Internet at http://www.imgt.org. Multiple alignment and determination of the TCR chain family can be done using the IgBlast software package.
- Monoclonal antibodies W112 and 2D1 to beta-chain regions of the human T-receptor variable domains of the TRBV5-3 family of TRBV8-1 (W09006758), proposed as a tool for the diagnosis and treatment of rheumatoid arthritis, are described. These monoclonal antibodies recognize 0.3–5% of peripheral T lymphocytes carrying TRBV5-3 and 0.5–13% of peripheral T lymphocytes bearing TRBV8-1, respectively.
- the basis for the use of monoclonal antibodies specific for sites of beta chains of T-receptors was the results of many studies demonstrating the involvement of T lymphocytes in the pathogenesis of rheumatoid arthritis. In particular, the article data FM Brennan et al., Clin Exp Immunol.
- Monoclonal antibodies that specifically recognize the beta chain of the 13th rat TRC family are also described.
- VB13 + T cells T cells whose T receptor contains the VB13 beta chain
- this procedure protects against the development of type I diabetes in rats predisposed to this disease line, and also significantly reduces the risk of developing virus-induced diabetes (Zhijun Liu et al., Diabetes. 2012 May; 61 (5): 1160-1168.).
- the removal of T cells whose T receptor contains another family of beta chains (VB16) does not differ in result from the control groups. It is important to note that the very first administration of a monoclonal antibody against VB13 leads to a 60% reduction in the number of VB13 + T cells in the rat spleen.
- a consensus variant of autoimmune TCR with ankylosing spondylitis is described, it is shown that it is presented in patients with AS in synovial fluid and peripheral blood and is absent at the same depth of analysis in healthy donors, regardless of the status of the HLA * B27 allele (Faham M . et al., Arthritis Rheumatol. 2017; 69 (4): 774-784; Komech E et al. 12th EJI-EFIS Tatra Immunology Conference; 2016 Sep 3-7; Strbske Pleso, Slovakia. Abstract book p. 39).
- the indicated TCRs belong to the TRB V9 family (according to the IMGT nomenclature).
- T-cell receptors carrying beta chains of the TRBV9 family are also involved in the development of an autoimmune disease such as celiac disease (Petersen J et al., J Immunol. 2015; 194 (12): 6112-22). They are also found on the surface of T cells susceptible to magnetization in the case of T-cell lymphomas and T-cell leukemia, including T-cell lymphoma caused by Epstein-Barr virus (EBV) (Toyabe S et al., Clin Exp Immunol. 2003 ; 134 (1): 92-97).
- EBV Epstein-Barr virus
- chimeric monoclonal antibodies with the ability to specifically bind to the beta region of the human TRBV9 T-receptor family, which can be used in the treatment of autoimmune and oncological diseases, in the pathogenesis of which TKRs belonging to the TRBV9 family, for example, AS, celiac disease and some T -cellular lymphomas and T-cell leukemias (application for the invention of the Russian Federation 2017145662).
- the above parental monoclonal antibody includes:
- VH variable domain of their heavy chain
- HCDR1 (according to Kabat nomenclature) has the amino acid sequence of SEQ ID NO: 1,
- HCDR2 has the amino acid sequence of SEQ ID NO: 2
- HCDR3 has the amino acid sequence of SEQ ID NO: 3;
- VL variable domain of their light chain (VL), which contains 3 hypervariable region LCDR1, LCDR2 and LCDR3, in which:
- LCDR1 has the amino acid sequence of SEQ ID NO: 4,
- LCDR2 has the amino acid sequence of SEQ ID NO: 5,
- LCDR3 has the amino acid sequence of SEQ ID NO: 6.
- the above parental monoclonal antibody includes the variable domains of the heavy and light chains that have the amino acid sequences shown in SEQ ID NO: 8 and 10.
- the above parental monoclonal antibody includes a light chain that has the amino acid sequence shown in SEQ ID NO: 12 and an antibody heavy chain that has the amino acid sequence of SEQ ID NO: 14.
- nucleotide sequences encoding the indicated amino acid sequences of the heavy and light chains of the aforementioned parent antibody are given in SEQ ID NOs: 13 and 11.
- the invention is directed to the creation of a monoclonal antibody that can be used to eliminate T cells carrying TKR of the TRBV9 family, in particular for the treatment of AS, celiac disease and malignant blood diseases, in the pathogenesis of which TKR of the TRBV9 family is involved, and which is characterized by a high degree of humanization. Humanization at the same time often leads to a critical decrease in the affinity and / or solubility of antibodies. Thus, obtaining humanized functional antibodies is an urgent task.
- the present invention relates to a humanized monoclonal antibody and its antigen binding fragment, which have the ability to specifically bind specifically to the beta region of the human TRBV9 T-receptor family.
- the antibody according to the invention can be used as a medicament for the treatment of autoimmune and oncological diseases, in the pathogenesis of which the TKRs belonging to the TRBV9 family are involved, for example, AS, celiac disease and some T-cell lymphomas and T-cell leukemias.
- the antibody of the present invention contains a heavy chain variable domain (VH) with three hypervariable regions:
- HCDR 1 (according to Kabat nomenclature) has the amino acid sequence of SEQ ID NO: 1,
- HCDR 2 has the amino acid sequence of SEQ ID NO: 2
- HCDR 3 has the amino acid sequence of SEQ ID NO: 3;
- variable domain of the light chain (VL) with three hypervariable regions LCDR1, LCDR2 and LCDR3, in which:
- LCDR 1 has the amino acid sequence of SEQ ID NO: 4,
- LCDR 2 has the amino acid sequence of SEQ ID NO: 5,
- LCDR 3 has the amino acid sequence of SEQ ID NO: 6.
- variable domains of the heavy and light chains of the antibody contain amino acid substitutions in FR fragments of the variable domains of the heavy and light chains, which increase the degree of humanization of the antibody compared to the parent antibody.
- the antibody heavy chain variable domain of the present invention contains at least 10 humanizing amino acid substitutions compared to the parental antibody heavy chain variable domain, the amino acid sequence of which is shown in SEQ ID NO: 8.
- the antibody heavy chain variable domain of the present invention has the sequence shown in SEQ ID NO: 16.
- the antibody heavy chain variable domain of the invention comprises additional amino acid substitutions that do not affect antibody specificity.
- the light chain variable domain of an antibody of the present invention contains at least 10 humanizing amino acid substitutions compared to the light chain variable domain of a parent antibody, the amino acid sequence of which is shown in SEQ ID NO: 10.
- the light chain variable domain of an antibody of the present invention has the sequence shown in SEQ ID NO: 18.
- variable domain of the light chain of an antibody of the present invention contains additional amino acid substitutions that do not affect the specificity of the antibody.
- the monoclonal antibodies of the invention are full length human IgG antibodies, for example, IgGl or IgG2 or IgG3 or IgG4.
- an antibody of the invention comprises a heavy chain, the amino acid sequence of which is at least 85% identical, or at least 90% identical, or at least 91% identical, or at least at least 92%, or identical, at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98% or at least 99% or 100% identical to the amino acid sequence of SEQ ID NO: 20.
- an antibody of the invention comprises a light chain whose amino acid sequence is at least 85% identical, or at least 90% identical, or at least 91% identical, or at least at least 92%, or identical, at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98% or at least 99% or 100% identical to the amino acid sequence of SEQ ID NO: 22.
- the antibody has a light chain, the amino acid sequence of which is shown in SEQ ID NO: 22, and a heavy chain, the amino acid sequence of which is shown in SEQ ID NO: 20.
- nucleic acids that encode the variable domains of the heavy and light chains of the antibodies of the invention, nucleic acids encoding the heavy and light chains of the antibodies of the invention, and functional fragments of antibodies.
- expression cassettes and expression vectors comprising the nucleic acid of the present invention and the regulatory elements necessary for expression of the nucleic acid in the selected host cell.
- the expression vector or cassette can be located in the host cell as an extrachromosomal element or integrated into the cell genome as a result of the introduction (by transfection) of the specified expression cassette or vector into the cell.
- cells and stable cell lines including nucleic acids, vectors or expression cassettes of the present invention, and methods for their preparation.
- the method comprises the subsequent isolation and purification of the resulting antibody.
- a pharmaceutical composition is also provided for the prophylaxis or treatment of a disease or disorder mediated by a beta region of the human TRBV9 T-family of the T receptor containing the aforementioned antibody or antigen binding fragment thereof in combination with one or more pharmaceutically acceptable excipients.
- the pharmaceutical composition is intended to prevent or treat a disease or disorder selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma.
- a pharmaceutical combination is also provided for the prophylaxis or treatment of a disease or disorder mediated by a human T-cell receptor bearing a beta chain of the TRBV9 family containing the above antibody or antigen-binding fragment thereof and at least one other therapeutically active compound.
- the pharmaceutical combination is intended to prevent or treat a disease or disorder selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma.
- the pharmaceutical combination or composition comprises another therapeutically active compound that is selected from a small molecule, an antibody, or steroid hormones, such as corticosteroids.
- the disease or disorder is selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma.
- the disease is selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma.
- the technical result of the present invention is to obtain antibodies with a high degree of humanization, which specifically with high affinity bind to TKR, the beta chain of which belongs to the TRBV9 family and can be used to treat autoimmune and oncological diseases, in the pathogenesis of which TKR, the beta chain of which belongs to the TRBV9 family.
- the antibody heavy chain variable fragment is characterized by a degree of humanization of 87%. In preferred embodiments, the variable fragment of the light chain of the antibody is characterized by a degree of humanization of 85%.
- Figure 1 shows the result of sorting T lymphocytes using antibody MA-042 antibodies.
- Figure 2 shows the result of flow cytometry of T lymphocytes after a test for cytotoxic activity in the presence of antibody MA-042 at a concentration of 1 ng / ml (right) and 1 ⁇ g / ml (left).
- the rectangle shows the population of CD45 + CD3 + TRBV9 +.
- Figure 3 shows a graph of the dependence of the number of dead T lymphocytes on the concentration of MA-042 to determine the half-effective concentration of MA-042 (EC50) in the cytotoxic test.
- the present invention relates to isolated monoclonal antibodies and their functional fragments having the ability to specifically bind to the beta chain region of the human TRBV9 T receptor family with an increased degree of humanization relative to analogues. Also provided are nucleic acids encoding the antibodies and fragments thereof of the invention, expression cassettes and expression vectors comprising the nucleic acid of the present invention and regulatory elements necessary for expression of the nucleic acid in the selected host cell. In addition, cells and stable cell lines are provided, including nucleic acids, vectors, or expression cassettes of the present invention.
- T-cell receptor also referred to as “TPK”, “T-receptor” or “TCR” of a person, is a heterodimeric protein complex located on the surface of a T lymphocyte.
- the T receptor is present only on T lymphocytes.
- the main function of TCR is the specific recognition of processed antigens associated with molecules of the major histocompatibility complex (HLA).
- HLA major histocompatibility complex
- Human TCR consists of two subunits, a and b, or g and d chains, interconnected by a disulfide bond and fixed in the cell membrane.
- Each of the TCR chains has an N-terminal variable (V) domain, a connecting domain and a constant (C) domain connected to a transmembrane domain that secures the receptor in the plasma membrane of the T-lymphocyte.
- the length of the constant domain of alpha and beta chains is 91 and 129 amino acid residues, respectively.
- the length of the connecting and transmembrane domain of the alpha chain is 30 and 17 amino acid residues (a.a.), and that of the beta chain is 21 and 22 a.o.
- the length of the variable domains of T-receptors varies from 104 to 125 a.o.
- T lymphocytes A small fraction of T lymphocytes has g / d type T receptors. In their structure, they are similar to a / b receptors, but differ in their primary structure and have a number of functional features. Their variability is much lower (limited clone specificity), they recognize antigens in combination with "non-classical” (not MHC) antigen-presenting molecules or even free antigens.
- the T receptor interacts with the MHC-antigen complex in six regions that determine its complementarity (CDR): three regions of the alpha chain and three beta chains. These CDRs are hypervariable regions, loops of the variable domains of the T-cell receptor - Ualfa and Ubeta.
- TRBV9 or "TRBV9 family” refer to the ninth family of beta chains of T-cell receptors isolated according to the IMGT nomenclature, which is characterized by the fact that the amino acid sequence of their variable domain includes unique motifs CDR1 (amino acid sequence - SGDLS) and CDR2 (sequence amino acids - YYNGEE).
- TCR of the TRBV9 family refers to a T cell receptor whose beta chain belongs to the TRBV9 family.
- T-lymphocytes or TCR means that this TCR or T-lymphocyte bearing it is associated with a disease or pathology and / or is the cause of the disease and / or contribute to the development of the disease.
- autoimmune in relation to TCR means that this TCR is involved in the development of an autoimmune disease.
- antibody as used herein is intended to define an immunoglobulin molecule consisting of four polypeptide chains (two heavy (H) chains and two light (L) chains) linked by disulfide bonds.
- Light chains are classified as kappa or lambda.
- Heavy chains are classified as gamma, mu, alpha, delta or epsilon, and they determine the isotype of an antibody, such as IgG, IgM, IgA, IgD and IgE, respectively, and several of them can be further divided into subclasses (isotypes), for example, IgGl, IgG2, IgG3, IgG4, IgAl and IgA2.
- Each type of heavy chain is characterized by a specific constant region.
- Each heavy chain contains a variable region of the heavy chain (abbreviated here as HCVR or VH) and a constant region of the heavy chain.
- the heavy chain constant region contains three CHI, CH2, and CH3 domains.
- Each light chain contains a variable region of the light chain (abbreviated here as LCVR or VL) and a constant region of the light chain.
- the light chain constant region contains one CL domain.
- the VH and VL regions can be further subdivided into hypervariability regions called complementarity determining regions (CDRs) surrounded by regions that are more conservative called skeletal regions (FR).
- CDRs complementarity determining regions
- FR skeletal regions
- Each of VH and VL consists of three CDRs and four FR sites located from the amino to the carboxyl end in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
- CDRs of the heavy chains are designated as “HCDR1, HCDR2 and HCDR3”, and 3 CDRs of the light chain are designated as “LCDR1, LCDR2 and LCDR3”.
- CDRs contain most residues that form specific interactions with the antigen.
- the numbering and positioning of CDR amino acid residues within the HCVR and LCVR regions of the antibodies of this invention is carried out with the well-known Kabat nomenclature, unless otherwise indicated. In this application, unless otherwise indicated, the generally accepted letter designations of amino acids.
- anti-TRBV9 antibody refers to an antibody that specifically binds to the beta chain epitope of the TRBV9 family of the human T cell receptor.
- the "monoclonal antibody” as used in this application may be a single-chain Fv fragment, which may be obtained by linking DNA encoding LCVR and HCVR to a linker sequence (see Pluckthun, The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, p. 269-315, 1994). It is understood that, regardless of whether fragments or parts are indicated, the term “antibody” as used herein includes such fragments or parts, as well as single chain forms. As long as the protein retains the ability to specifically or preferentially bind to its target (eg, epitope or antigen), it refers to the term “antibody”. Antibodies may or may not be glycosylated, and are within the scope of the invention.
- antibody and “monoclonal antibody” for the needs of this application refer to a monoclonal antibody against TCR of the TRBV9 family.
- a “monoclonal antibody” refers to a rodent, primate or Camelidae family antibody, preferably a mouse, macaque, camel or llama antibody, a chimeric antibody, a humanized antibody, or a fully human antibody, unless otherwise indicated.
- a "monoclonal antibody” population refers to a homogeneous or substantially homogeneous antibody population (i.e., at least about 85, 90, 91, 92, 93, 94, 95, 96%, more preferably at least about 97 or 98% or even more preferably at least 99% of the antibodies in the population will compete in the ELISA for the same antigen or epitope, or more preferably the antibodies are identical in amino acid sequence).
- Antibodies may or may not be glycolized and still fall within the scope of the invention.
- Monoclonal antibodies can be homogeneous if they have the same amino acid sequence, although they may differ in post-translational modification, for example, the glycolization pattern.
- the variable regions of each of the light / heavy chain pairs form antigen-binding sites of the antibody.
- the “antigen binding portion”, or the “antigen binding site”, or the “antigen binding domain” or “antigen binding center” refers, interchangeably, to that part of the antibody molecule that contains amino acid residues that interact with the antigen and give the antibody its specificity and affinity for the antigen. This part of the antibody includes the "frame" amino acid residues necessary to maintain the proper conformation of antigen binding residues.
- human antibody as used herein means an antibody in which the sequences of the variable and constant domains are derived from human sequences.
- Human antibodies of the invention may include amino acid residues that are not characteristic of humans (for example, mutations introduced by undirected or site-specific mutagenesis in vitro or somatic mutation in vivo), for example, in CDR and especially in CDR3.
- humanized with respect to antibodies is used to refer to antibodies that are characterized by the presence of human constant regions and structural components, but have complementarity determining regions (CDRs) that are characteristic of immunoglobulins of a different origin or corresponding fragments of modified antibodies.
- CDRs complementarity determining regions
- a “parent” antibody in this application is an antibody encoded by the amino acid sequence that is used to produce the variant.
- the parent antibody may be from a rodent, llama, chimeric, humanized, or human antibody.
- the term "degree of humanization” in relation to antibodies is used to denote the percentage of sequence identity frame plot humanized antibodies relative to the primary human acceptor skeleton plot that was used to create a humanized antibody and which is available from a human library.
- the antibody of the invention contains a frame region with an identity of at least 80%, usually at least 82%, more often at least 83%, for example at least 84%, or at least 85%, or at least 86%, or at least 87% identity in relation to the frame portion obtained from the human library.
- humanizing substitutions refers to amino acid substitutions that increase the degree of humanization of an antibody or fragment thereof.
- chimeric in relation to the antibodies of the present invention is used to refer to antibodies that are characterized by the presence of human constant regions, but have variable domains of a different origin.
- variable domains of light and / or heavy chains of non-human origin for example, taken from rats
- non-human origin for example, taken from rats
- operatively linked refers to polypeptide sequences that are in physical (covalent, unless otherwise indicated) and functional connection with each other. In the most preferred embodiments, the functions of the polypeptide components of the chimeric molecule are not changed compared to the functional properties of the isolated polypeptide components.
- operatively linked or the like when describing nucleic acids means that nucleic acids are covalently linked in such a way that there are no “failures” in the reading frame and stop codons at their junctions.
- nucleotide sequences encoding a chimeric protein including “operably linked” components (proteins, polypeptides, linker sequences, protein domains, etc.), consist of fragments encoding these components, where these fragments are covalently linked so that during translation and transcription of the nucleotide sequence a full-sized chimeric protein is produced, for example, a chimeric antibody according to the invention.
- isolated and “isolated” mean a molecule or cell that is in an environment other than the environment in which the molecule or cell is in vivo.
- the antibodies of the present invention are recombinant, that is, obtained using the recombinant DNA technique.
- recombinant antibody includes all antibodies that are obtained, expressed, created or isolated by recombinant means, such as antibodies expressed using a recombinant expression vector introduced into a host cell, antibodies isolated from a set of known recombinant human combinatorial antibodies, antibodies isolated from an animal that is transgenic for human immunoglobulin genes (see, for example, Taylor LD et al. (1992) Nucl. Acids Res. 20: 6287-6295).
- the recombinant human antibodies are subjected to in vitro mutagenesis (or, if an animal transgenic to human Ig sequences is used, somatic mutagenesis in vivo) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences which, because they isolated from germline VH sequences and human VL and are close to them, cannot exist in vivo in the germinal set of human antibodies in vivo.
- the term “specifically binds,” as used herein, refers to a situation in which one member of a specific binding pair does not significantly bind molecules other than its specific binding partner (s).
- the term is also applicable when, for example, the antigen binding domain of an antibody of the invention is specific for a particular epitope that is carried by a number of antigens, in which case a specific antibody having an antigen binding domain will be capable of specific binding of various antigens bearing the epitope.
- the monoclonal antibody of the invention specifically binds the epitope of the T chain beta receptor of a human cell receptor belonging to the TRBV9 family, while it does not specifically bind the TCR beta chains of other families and the TCR alpha chain.
- epitope refers to that part of a molecule that is capable of being recognized and bound to an antibody in one or more antigen-binding regions of an antibody. Epitopes often consist of chemically active surface groups of molecules, such as amino acids or sugar side chains, and have specific three-dimensional structural characteristics, as well as specific charge characteristics.
- epitope also refers to a portion of a polypeptide that has antigenic and / or immunogenic activity in an animal, preferably a mammal, for example, a mouse, rat, or human.
- antigenic epitope is defined as the part of a polypeptide to which an antibody can specifically bind, as determined by any method well known in the art, for example, using a conventional immune analysis. Antigenic epitopes need not be immunogenic, but may also be immunogenic.
- An “immunogenic epitope”, as used herein, is defined as part of a polypeptide that elicits an antibody response in an animal, as established by any method known in the art.
- a “non-linear epitope” or “conformational epitope” contains non-contiguous polypeptides (or amino acids) within the antigenic protein with which the antibody specific for the epitope binds.
- biological property or “biological characteristic” or the terms “activity” or “bioactivity with respect to the antibody and its functional fragments according to the invention are used interchangeably in this application and include, but are not limited to, epitope / antigenic affinity and specificity, ability inhibit or be an antagonist of TCR activity, which includes the beta chain belonging to the TRBV9 family.
- Other biological properties or characteristics of the antibody identified by the prior art include, for example, cross-reactivity (i.e., with non-human homologs of the target peptide or with other proteins or targets, in general), and the ability to maintain high levels of protein expression in mammalian cells.
- the above properties or characteristics may be observed, measured or evaluated using methods recognized in the art, including, but not limited to, ELISA analysis, competitive ELISA analysis, BIACORE or KINEXA surface plasmon resonance analysis, in vitro or in vivo inhibition assays restrictions, receptor binding, production and / or secretion of a cytokine or growth factor, signal transduction and immunohistochemistry of tissue sections, obtained from various sources, including humans, primates, or any other source.
- inhibitor or “neutralize”, as used herein, with respect to the activity of an antibody of the invention, mean the ability to significantly counteract, inhibit, prevent, limit, slow down, interrupt, destroy, terminate, reduce, for example, development or the severity of what is inhibited, including but not limited to the biological activity of an antibody or property, disease or condition.
- mutant refers to an antibody disclosed in the present invention in which one or more amino acids are added and / or substituted and / or deleted (delegated) and / or inserted (inserted) at the N-terminus and / or C-terminus and / or within the native amino acid sequences of the antibodies of the present invention or fragments thereof.
- mutant also refers to a nucleic acid molecule that encodes a mutant protein.
- mutant refers to any variant that is shorter or longer than a protein or nucleic acid.
- homology is used to describe the relationship of nucleotide or amino acid sequences to other nucleotide or amino acid sequences, which is determined by the degree of identity and / or similarity between the indicated compared sequences.
- an amino acid or nucleotide sequence is “substantially similar” or “substantially the same” as a reference sequence if the amino acid or nucleotide sequence has at least 85% identity with the specified sequence within the region selected for comparison.
- substantially similar sequences include those that have, for example, at least 90% identity, or at least 91% identity, or at least 92% identity, or at least 93% identity, or at least 94 % identity, whether at least 95% identity, or at least 96% identity, or at least 97% identity, or at least 98% identity, or at least 99% identity.
- Two sequences that are identical to one another are also essentially similar.
- the identity of the sequences is determined based on the reference sequence.
- Algorithms for sequence analysis are known in the art, such as IgBLAST described in Ye et al. Nucleic Acids Res. 2013, W34-40.
- IgBLAST described in Ye et al. Nucleic Acids Res. 2013, W34-40.
- To calculate the percentage of identity the full length of the reference sequence, for example, a variable region, is used.
- nucleotide sequence of the "coding" polypeptide means that the polypeptide is produced from the nucleotide sequence during translation and transcription of mRNA. In this case, both a coding strand identical to mRNA and usually used in the list of sequences can be indicated, as well as a complementary strand that is used as a template for transcription. As is obvious to any person skilled in the art, the term also includes any degenerate nucleotide sequences encoding the same amino acid sequence. Nucleotide sequences encoding a polypeptide include sequences containing nitrons.
- the present invention relates to isolated monoclonal humanized antibodies and their functional fragments having the ability to specifically bind to the beta region of the human TRBV9 T receptor family.
- Antibodies according to the invention can be chimeric, humanized or human antibodies, or antigen-binding fragments thereof, and can be used as a medicine for the treatment of AS and other diseases in the pathogenesis of which the TKRs belonging to the TRBV9 family, for example, celiac disease or T-cell lymphoma, are involved.
- the antibody of the invention is monoclonal.
- Monoclonal antibodies of the invention can be prepared using, for example, hybridoma techniques well known in the art, as well as recombinant technologies, phage display technologies, synthetic technologies, or combinations of such technologies or other technologies well known in the art.
- the term "monoclonal antibody”, as used in this application, refers to an antibody obtained from a single copy or clone, including, for example, any eukaryotic, prokaryotic or phage clone, and not to a method for its preparation.
- Humanized and chimeric antibodies can be prepared by peptide synthesis or using recombinant DNA techniques as described below in the Nucleic Acids section.
- the antibodies of the present invention are chimeric and are characterized in that they have variable domains of light and heavy chains of non-human origin (e.g., rat or mouse), and constant domains are characteristic of humans.
- An antibody of the present invention contains a heavy chain variable domain (VH) with three hypervariable regions
- HCDR1 (according to Kabat nomenclature) has the amino acid sequence of SEQ ID NO: 1,
- HCDR2 has the amino acid sequence of SEQ ID NO: 2,
- HCDR3 has the amino acid sequence of SEQ ID NO: 3;
- variable domain of the light chain (VL) with three hypervariable regions LCDR1, LCDR2 and LCDR3, in which:
- LCDR 1 has the amino acid sequence of SEQ ID NO: 4,
- LCDR 2 has the amino acid sequence of SEQ ID NO: 5,
- LCDR 3 has the amino acid sequence of SEQ ID NO: 6.
- the light and heavy chain variable domains of the antibody of the present invention are humanized and different from the parent and light chain variable domains of the parent antibody by humanizing amino acid substitutions, wherein the antibody heavy and light chain variable domains contain amino acid substitutions in FR fragments of the heavy and light chain variable domains, increasing the degree of humanization of the antibody compared to the parent antibody.
- the antibody heavy chain variable domain of the present invention contains at least 10 humanizing amino acid substitutions compared to the parent antibody heavy chain variable domain, the amino acid sequence of which is shown in SEQ ID NO: 8. In preferred embodiments, the antibody heavy chain variable domain of the present invention has the amino acid sequence shown in SEQ ID NO: 16.
- the antibody heavy chain variable domain of the invention comprises additional amino acid substitutions that do not affect antibody specificity.
- the light chain variable domain of an antibody of the present invention contains at least 10 humanizing amino acid substitutions as compared to the light chain variable domain of a parent antibody, the amino acid sequence of which is shown in SEQ ID NO: 10.
- variable domain of the light chain of the antibody of the present invention contains amino acid substitutions and has the sequence shown in SEQ ID NO: 18.
- variable domain of the light chain of an antibody of the present invention contains additional amino acid substitutions that do not affect the specificity of the antibody.
- the monoclonal antibodies of the invention are full length human IgG antibodies, for example, IgGl or IgG2 or IgG3 or IgG4.
- an antibody of the invention comprises a heavy chain, the amino acid sequence of which is at least 85% identical, or at least 90% identical, or at least 91% identical, or at least at least 92%, or identical, at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98% or at least 99% or 100% identical to the amino acid sequence of SEQ ID NO: 20.
- an antibody of the invention comprises a light chain whose amino acid sequence is at least 85% identical, or at least 90% identical, or at least 91% identical, or at least at least 92%, or identical, at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98% or at least 99% or 100% identical to the amino acid sequence of SEQ ID NO: 22.
- the antibody has a light chain, the amino acid sequence of which is shown in SEQ ID NO: 22, and a heavy chain, the amino acid sequence of which is shown in SEQ ID NO: 20.
- Antibodies of the present invention may also contain additional mutations that do not result in a loss of the ability of the antibody to bind the TKP beta chain of the TRBV9 family, but can lead to a decrease in antibody-dependent cell-mediated cytotoxicity or an increase in the affinity or other biological properties of the antibodies.
- conservative amino acid substitutions can be made in an antibody sequence.
- conservative substitution in the context of the application is meant a substitution in which the amino acid residue is replaced by another amino acid residue having a close side chain.
- Families of amino acid residues having close side chains are defined in the prior art, including main side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g. glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g. alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), b-branched side chains (e.g. threonine, valine, isoleucine) and aromatic side chains (e.g.
- main side chains e.g., lysine, arginine, histidine
- acidic side chains e.g., aspartic acid, glutamic acid
- uncharged polar side chains e.g. glycine,
- conservative amino acid substitutions are made in the CDR3 regions in the VL and / or VH domains, most often no more than three conservative substitutions.
- conservative substitutions are not made at amino acid positions that are critical for the binding of the beta chain epitope of the TRBV9 family.
- variants (mutants) of antibodies according to the invention can be obtained by peptide synthesis or using recombinant DNA techniques as described below in the section “Nucleic Acids”.
- the antibody comprises a constant region of a heavy chain, such as a constant region of IgGl, IgG2, IgGS, IgG4, IgA, IgE, IgM, human IgD.
- the heavy chain constant region is a human IgGl heavy region constant region.
- an antibody may comprise either a constant light chain region or a kappa constant light chain region or a lambda constant light chain region.
- the antibody comprises a kappa constant region of the light chain.
- the antibody heavy chain variable fragment is characterized by a degree of humanization of 87%. In preferred embodiments, the variable fragment of the light chain of the antibody is characterized by a degree of humanization of 85%.
- Antigen binding fragments of the antibodies of the present invention are also provided.
- binding fragments encompassed by the term “antigen binding fragment” of an antibody include (a) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL, and CH1 domains; (b) a F (ab ′) 2 fragment, a bivalent fragment containing two Fab fragments linked by a disulfide bridge in the loop region; (c) a Fd fragment consisting of the VH and CH1 domains; (d) an Fv fragment consisting of the VL and VH domains of one arm of an antibody; (d) a dAb fragment (Ward et al.
- single chain antibodies are also encompassed by the term “antigen binding fragment” of an antibody.
- Antibody fragments such as Fab and F (ab ') 2
- Fab and F (ab ') 2 can be obtained from whole antibodies using accepted methods, such as degradation by papain or pepsin, respectively, of whole antibodies.
- antibodies, antibody fragments and immunoadhesion molecules can be obtained using standard methods using recombinant DNA.
- An antibody or antigen binding fragment thereof may be part of larger immunoadhesion molecules formed by covalent or non-covalent binding of an antibody or antibody fragment to one or more protein or peptide.
- immunoadhesion molecules include the use of a streptavidin core region to produce a tetrameric scFv molecule (Kipriyanov SM et al. (1995) Human Antibodies and Hybridomas 6: 93-101) and the use of a cysteine residue, marker peptide and C-terminal polyhistidine tag to obtain bivalent and reduced scFv biomolecules (Kipriyanov SM et al. (1994) Mol. Immunol., 31: 1047-1058).
- Other chemical binding fragments of antibodies are also well known in the art.
- Antibodies and their functional fragments according to the invention are in isolated form, that is, this means that this protein is essentially free from the presence of other proteins or other natural biological molecules, such as oligosaccharides, nucleic acids and their fragment and the like, where the term “Substantially free” in this case means that less than 70%, usually less than 60% and more often less than 50% of said composition containing the isolated protein is another naturally occurring biological molecule.
- said proteins are present in substantially purified form, where the term “substantially purified form” means a purity of at least 95%, usually equal to at least 97%, and more often equal to at least 99%.
- purification can be carried out by chromatography (for example, ion exchange, affinity, especially affinity for specific antigens - protein A or protein G, and column size chromatography), centrifugation, differential solubility, or any other standard method for protein purification.
- chromatography for example, ion exchange, affinity, especially affinity for specific antigens - protein A or protein G, and column size chromatography
- centrifugation differential solubility
- differential solubility differential solubility
- antibodies of the technology of the invention or fragments thereof can be fused to heterologous polypeptide sequences (e.g., a histidine tag) to facilitate purification.
- KD dissociation constant
- Preferred antibodies are those that bind a human antigen with a KD value of not more than about 1 c 10 7 M; preferably not more than about 1 c 10 8 M; more often not more than about 1 x 10 -9 M; more preferably not more than about 1 x 10 -10 M, and most preferably not more than about 1 c 10 11 M, for example, not more than about 1 c 10 12 M.
- Preferred antibodies include the MA-042 antibody described in detail in the experimental part below.
- Antibodies and fragments thereof that can be used in the present compositions and methods are biologically active antibodies and fragments, that is, they are capable of binding the desired antigenic epitopes and exhibiting a biological effect directly or indirectly.
- Antibodies and their functional fragments according to the invention are able to specifically bind the epitope (region) of the beta chain of the TRBV9 family.
- inhibition of TCR activity involving said beta chain occurs.
- the inhibition is preferably at least about 20, or 30, or 40, or 50, or 60, or 70, or 80, or 90, or 95% or higher.
- an anti-beta chain antibody of the TRBV9 family of the invention can eliminate T cells carrying TKR containing a beta chain of the TRBV9 family.
- an antibody or fragment thereof according to the invention can provide at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or about 100% elimination of T lymphocytes.
- the antibody is an MA-042 antibody.
- Antibody MA-042 includes the variable domains of the heavy and light chains that have the amino acid sequences shown in SEQ ID NO: 16 and 18.
- Antibody MA-042 includes heavy and light chains that have the amino acid sequences shown in SEQ ID NO: 20 and 22, respectively.
- the present invention provides nucleic acid molecules encoding the heavy and light chains of the antibodies of the present invention, their functional fragments and variable domains, which can be used to obtain chimeric antibodies, including variable domains of the invention operatively fused to known constant domains of human antibodies.
- the nucleic acid of the invention encodes an antibody heavy chain, the variable domain of which comprises 3 hypervariable regions of HCDR1, HCDR2 and HCDR3, where
- HCDR1 (according to Rabat nomenclature) has the amino acid sequence of SEQ ID NO: 1;
- HCDR2 has the amino acid sequence of SEQ ID NO: 2;
- HCDR3 has the amino acid sequence of SEQ ID NO: 3.
- the nucleic acid of the invention encodes an antibody light chain, the variable domain of which contains 3 hypervariable regions LCDR1, LCDR2 and LCDR3, in which:
- LCDR1 has the amino acid sequence of SEQ ID NO: 4;
- LCDR2 has the amino acid sequence of SEQ ID NO: 5;
- LCDR3 has the amino acid sequence of SEQ ID NO: 6.
- the nucleic acid of the invention encodes the variable domains of the heavy and light chains of an antibody that contain amino acid substitutions in FR fragments of the variable domains of the heavy and light chains that increase the degree of humanization of the antibody compared to the parent antibody.
- nucleic acid molecules encoding homologues and mutants of these antibody chains, their functional fragments and domains are also within the scope of the present invention.
- the nucleic acid encodes an antibody heavy chain variable domain of the present invention that contains at least 10 humanizing amino acid substitutions compared to the parent antibody heavy chain variable domain, the amino acid sequence of which is shown in SEQ ID NO: 8. In some embodiments, the nucleic acid encodes a heavy chain of an antibody whose variable domain has the amino acid sequence of SEQ ID NO: 16.
- the nucleic acid encodes a light chain of an antibody whose variable domain contains at least 10 humanizing amino acid substitutions compared to the light chain variable domain of a parent antibody, the amino acid sequence of which is shown in SEQ ID NO: 10.
- the nucleic acid encodes a light chain of an antibody whose variable domain has the amino acid sequence of SEQ ID NO: 18.
- the nucleic acid encodes a heavy chain of an antibody whose amino acid sequence is at least 85% identical, at least 90% identical, or at least 91% identical, or at least at least 92%, or identical, at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98% or at least 99% or 100% identical to the amino acid sequence of SEQ ID NO: 20.
- the nucleic acid encodes a light chain of an antibody whose amino acid sequence is at least 85% identical, at least 90% identical, or at least 91% identical, or at least at least 92%, or identical, at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98% or at least 99% or 100% identical to the amino acid sequence of SEQ ID NO: 22.
- nucleic acids encoding the light and heavy chains of the invention are shown in SEQ ID NOs: 19 and 21.
- Nucleic acids encoding the variable domains of the light and heavy chains of antibodies are also of interest.
- Nucleic acids encoding the variable domains of the heavy and light chains of antibodies can be used for rapid fusion with nucleic acids encoding the corresponding constant domains of antibodies.
- the nucleic acid encodes an antibody heavy chain variable domain, the amino acid sequence of which is shown in SEQ ID NO: 16.
- the nucleic acid encodes an antibody light chain variable domain, the amino acid sequence of which is shown in SEQ ID NO: 18.
- nucleic acids encoding the variable domains of the heavy and light chains of the antibodies shown in SEQ ID NO: 15 and 17.
- nucleic acid molecule or “nucleic acid” is a DNA molecule, such as a genomic DNA or DNA molecule, or an RNA molecule, such as an mRNA molecule.
- the nucleic acid molecule of the present invention is a DNA (or to DNA) molecule containing an open reading frame that encodes an antibody or antibody fragment of the present invention and is capable of being used under appropriate conditions (e.g., physiological intracellular conditions) for expression in heterologous expression system.
- the nucleic acid molecule of the present invention is obtained by genetic engineering.
- Methods for producing nucleic acids are well known in the art.
- the availability of amino acid sequence information or nucleotide sequence information enables the production of isolated nucleic acid molecules of the present invention using oligonucleotide synthesis.
- several nucleic acids can be synthesized that differ from each other due to the degeneracy of the genetic code.
- Methods for selecting codon variants for a desired host are well known in the art.
- Synthetic oligonucleotides can be prepared using the phosphoramidite method, and the resulting constructs can be purified using methods well known in the art, such as high performance liquid chromatography (HPLC) or other methods as described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., (1989) Cold Spring Harbor Press, Cold Spring Harbor, NY, and no instructions described in, for example, United States Dept of HHS, National Institute of Health (NIH) Guidelines for Recombinant DNA Research.
- HPLC high performance liquid chromatography
- the long double-stranded DNA molecules of the present invention can be synthesized as follows: several smaller fragments with the necessary complementarity can be synthesized, which contain suitable ends capable of cohesion with the adjacent fragment. Adjacent fragments can be stttt using DNA ligase or a PCR based method.
- nucleic acid molecules of the present invention can also be cloned from biological sources.
- the present invention also encompasses nucleic acids that are homologous, substantially similar, identical, or derived from nucleic acids encoding the polypeptides of the present invention.
- the nucleic acids of the invention are located in a medium different from the environment in which they are found under natural conditions, for example, they are isolated, present in an increased amount, are or are expressed in vitro systems or in cells or organisms other than those in which they are located in vivo.
- Changes or differences in the nucleotide sequence between highly similar nucleotide sequences can represent nucleotide substitutions in the sequence that occur during normal replication or duplication. Other substitutions can be specifically calculated and inserted into the sequence for specific purposes, such as changing the codons of certain amino acids or the nucleotide sequence of a regulatory region.
- Such special substitutions can be made in vitro using various mutagenesis technologies or obtained in host organisms under specific breeding conditions that induce or select these changes. Such specially prepared sequence variants may be called “mutants” or “derivatives” of the original sequence.
- Mutant or derivative nucleic acids or nucleic acid variants can be obtained on a matrix nucleic acid selected from the above nucleic acids by modifying, deleting or adding one or more nucleotides in a matrix sequence or combination thereof, to obtain a variant of the template nucleic acid. Modifications, additions or deletions can be performed by any method known in the art (see, for example, Gustin et al, Biotechniques (1993) 14: 22; Barany, Gene (1985) 37: 111-123; and Colicelli et al. , Mol. Gen. Genet. (1985) 199: 537-539, Sambrook et al., Molecular Cloning: A Laboratory Manual, (1989), CSH Press, pp.
- error-prone PCR error-prone PCR
- shuffling oligonucleotide-directed mutagenesis
- assembly PCR pairwise PCR mutagenesis
- in vivo mutagenesis cassette mutagenesis
- recursive multiple mutagenesis exponential multiple mutagenesis
- site-specific mutagenesis random mutagenesis
- gene eassemblirovanie gene reassembly
- gene site-saturation mutagenesis GSSM
- SLR artificial ligation reconstruction
- Modifications, additions or deletions can also be performed by a method including recombination, recursive recombination of sequences, phosphotioate-modified DNA mutagenesis, mutation on a uracil-containing matrix, double-pass mutagenesis, point-blank mutagenesis reduction, strain mutagenesis, recovery-deficient mutagenesis, radioactive mutagenesis, deletion mutagenesis, restriction-selective mutagenesis, restriction mutagenesis with purification, synthesis of artificial g new, multiple mutagenesis, creation of multiple chimeric nucleic acids, and combinations thereof.
- Degenerate nucleic acid variants that encode the proteins of the present invention are also provided.
- Degenerate nucleic acid variants include substitutions of nucleic acid codons with other codons encoding the same amino acids.
- degenerate nucleic acid variants are created to increase expression in the host cell.
- nucleic acid codons that are not preferred or less preferred in the genes of the host cell are replaced by codons that are abundantly represented in the coding sequences of the genes in the host cell, where said replaced codons encode the same amino acid.
- modifications do not essentially change the properties of antibodies and their functional fragments, but can facilitate protein folding in the host cell, reduce the ability to aggregate, or modulate other biochemical properties of proteins, for example, half-life. In some embodiments, these modifications do not alter the biochemical properties of the protein. In some embodiments, these modifications lead to a decrease in the immunogenicity of antibodies. All types of modifications and mutations mentioned above are carried out at the nucleic acid level.
- the claimed nucleic acids can be isolated and obtained essentially in purified form.
- Essentially purified form means that the nucleic acids are at least about 50% pure, usually at least about 90% pure and usually are "recombinant", that is, flanked by one or more nucleotides with which it is usually not linked on the chromosome found naturally in its natural host organism.
- nucleic acids that encode fusion proteins comprising the protein of the present invention, or fragments thereof, which are discussed in more detail below.
- Nucleic acids encoding the variable domains of the invention can be operatively fused to nucleic acids encoding the corresponding constant domains of the light and heavy chains of an antibody.
- Nucleic acids encoding the light and heavy chains of an antibody can be operatively fused to nucleic acids encoding a leader peptide that facilitates transport of expression products from the host cell. The leader peptide is subsequently cleaved during maturation of the polypeptide.
- a vector and other nucleic acid constructs containing the claimed nucleic acids are also provided.
- the term “vector” includes a nucleic acid molecule capable of transporting another nucleic acid with which it is operatively linked. Certain vectors are capable of autonomous replication in the host cell into which they are introduced, while the remaining vectors can be integrated into the genome of the host cell and, thus, replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes with which they are operatively linked. Such vectors are referred to in this application as “recombinant expression vectors” (or, simply, “expression vectors” or “expression vectors”), and illustrative burial vectors are known in the art.
- Suitable vectors include viral and non-viral vectors, plasmids, cosmids, phages, etc., preferably plasmids, and are used for cloning, amplification, expression, transfer, etc., of the nucleic acid sequence of the present invention in a suitable host.
- the selection of a suitable vector is understandable for a qualified specialist in this field.
- a full-length nucleic acid or part thereof is typically inserted into a vector by attachment of a DNA ligase to a restriction enzyme cleaved site in a vector.
- the desired nucleotide sequence can be inserted by in vivo homologous recombination, typically by attaching homologous regions to a vector on the flanks of the desired nucleotide sequence. Homologous regions are added by ligation of oligonucleotides or by polymerase chain reaction using primers including, for example, both homologous regions and part of the desired nucleotide sequence.
- a vector as a rule, has an origin of replication, which ensures its reproduction in host cells as a result of its introduction into the cell as an extrachromosomal element.
- the vector may also contain regulatory elements that provide expression of the nucleic acid in the host cell and obtain the target polypeptide.
- said nucleic acid is operably linked to a regulatory sequence, which may include promoters, enhancers, terminators, operators, repressors and inducers, as well as a start codon of the polypeptide.
- a regulatory sequence which may include promoters, enhancers, terminators, operators, repressors and inducers, as well as a start codon of the polypeptide.
- the nucleic acid of According to the invention is also operatively linked to a leader peptide, which ensures the isolation of the expression product from the host cell into the extracellular space.
- expression cassettes or systems used inter alia to produce the claimed polypeptides (e.g., light and heavy chains of an antibody of the invention or variable domains of light and heavy chains of an antibody of the invention) based on them or to replicate the claimed nucleic acid molecules.
- the expression cassette may exist as an extrachromosomal element or may be incorporated into the genome of a cell as a result of introducing said expression cassette into the cell.
- the protein product encoded by the nucleic acid of the invention is expressed in any convenient expression system, including, for example, bacterial systems, yeast, plants, insects, amphibians, or mammalian cells.
- the target nucleic acid operatively binds to regulatory sequences, which may include promoters, enhancers, termination sequences, operators, repressors and inducers, as well as a start codon of the polypeptide.
- regulatory sequences which may include promoters, enhancers, termination sequences, operators, repressors and inducers, as well as a start codon of the polypeptide.
- the nucleic acid of the invention is also operably linked to a leader peptide that isolates the expression product from the host cell into the extracellular space.
- the above expression systems can be used in prokaryotic or eukaryotic hosts.
- host cells such as E. coli, B. subtilis, S. cerevisiae, insect cells in combination with baculovirus vectors, or cells can be used higher organism, such as yeast cells, plant cells, vertebrate cells, mammalian cells, human cells, e.g. CHO cells (e.g. ATCC CRL-9096), NS0 cells, SP2 / 0 cells, HEK293 cells, COS cells (e.g. ATCC CRL-1650, CRL-1651) and HeLa (e.g. ATCC CCL-2).
- the above host cell does not apply to the host cell obtained using human embryos.
- the aforementioned host cell does not apply to a host cell obtained by modifying the genetic integrity of human germline cells.
- a host cell is transformed with an expression vector comprising a nucleic acid encoding an antibody light chain and an expression vector comprising a nucleic acid encoding an antibody heavy chain.
- an expression vector comprising a nucleic acid encoding an antibody light chain and an expression vector comprising a nucleic acid encoding an antibody heavy chain.
- a single expression vector is used in which nucleic acids encoding both the light and heavy chains of an antibody are inserted.
- the expression vector (s) encoding the heavy and light chains are transformed (co-transformed) into a host cell such that the light and heavy chains are expressed in the host cell and are preferably excreted into the medium, which host cells are cultured from, antibodies can be isolated from this medium.
- transformation are intended to include a wide range of methods commonly used for the introduction of exogenous DNA into a prokaryotic or eukaryotic host cell, for example, electroporation, precipitation with calcium phosphate, transfection with DEAE-dextran, etc., as described by Sambrook, Fritsch and Maniatis (eds) Molecular Cloning; A Laboratory Manual, Second Edition, Cold Spring Harbor, NY (1989; Ausubel FM et al. (Eds.) Current Protocols in Molecular Biology, Green Publishing Associates (1989).
- the antibodies When recombinant expression vectors containing nucleic acids of an antibody are introduced into the host cells, the antibodies are formed by culturing the host cells for a period of time sufficient to express the antibody in the host cell, or (more preferably) secreting the antibody into the culture medium, which host cells are grown.
- Antibodies can be isolated from the culture medium using standard protein purification methods. The culture conditions of various cells are well known to those skilled in the art and are described, for example, in Current Protocols in Cell Biology, ed. Bonifacino J.S., Dasso M., Harford J.B., Lippincott-Schwartz J. and Yamada K.M., John Wiley & Sons, Inc., 2000.
- the resulting replicated nucleic acid, expressed protein or polypeptide is within the scope of the invention as a product of the host cell or organism.
- the product may be isolated by a suitable method known in the art.
- Cell lines that stably express the proteins of the present invention can be selected by methods known in the art (e.g., co-transfection with a selectable marker, such as dhfr, gpt, neomycin, hygromycin, which makes it possible to identify and isolate transfected cells that contain gene included in the genome).
- a selectable marker such as dhfr, gpt, neomycin, hygromycin
- the nucleic acid molecules of the present invention can also be used to determine gene expression in a biological sample.
- a suitable carrier for example, nitrocellulose, nylon, etc.
- oligonucleotide crosslinking assays such as in situ hybridization, and hybridization with DNA probes immobilized on a solid chip. Detection of mRNA hybridizing with the claimed sequence indicates gene expression in the sample.
- the antibody or its active fragment of the present invention is used in the treatment of disorders that are associated with the activity of pathological T-lymphocytes bearing on the surface of the TKR family of TRBV9, for example, the activity of autoimmune T-lymphocytes in AS, celiac disease, T-cell lymphomas.
- the term "patient” in this application refers to a mammal, including, but not limited to, mice, monkeys, humans, mammals, farm animals, mammals, sports animals and mammals of domestic animals; preferably, the term refers to people.
- the patient is further characterized by a disease or disorder, or condition, mediated by the presence in his body of TCR, the beta chain of which belongs to the TRBV9 family.
- TCR whose beta chain belongs to the TRBV9 family, associated with AS and celiac disease.
- TCR, whose beta chain belongs to the TRBV9 family can be associated with the development of a number of blood diseases, such as T cell lymphoma caused by the Epstein-Barr virus.
- co-administration refers to or include:
- an antibody of the invention may be administered without additional therapeutic treatment, i.e. as an independent therapy.
- the antibody treatment of this invention may include at least one additional therapeutic treatment (combination therapy).
- the antibody can be co-administered or formulated with another medication / drug for an autoimmune or oncological disease in the pathogenesis of which TCRs containing the TRBV9 beta chain are involved, for example, AC, celiac disease, T-cell lymphoma, T-cell leukemia.
- the antibody of this invention will be administered in an amount effective to treat the condition in question, i.e. in doses and for periods of time necessary to achieve the desired result.
- the therapeutically effective amount may vary depending on factors such as the particular condition being treated, the patient’s age, gender and weight, and whether the administration of the antibody is an independent treatment or if it is combined with one or more additional immunosuppressive or anti-inflammatory methods treatment.
- Drug regimens can be adjusted to provide the optimum desired response. For example, a single bolus may be administered, several divided doses may be administered over time, or the dose may be proportionally reduced or increased depending on the severity of the therapeutic situation. Especially useful is the manufacture of parenteral compositions in unit dosage form for ease of administration and uniformity of dosage.
- the unit dosage form refers to physically discrete units suitable as unit doses for patients / subjects to be treated; each unit contains a predetermined amount of active compound, calculated to obtain the desired therapeutic effect in combination with the desired pharmaceutical carrier.
- unit dosage forms of the present invention is generally dictated and depends directly on (a) the unique characteristics of the chemotherapeutic agent and the particular therapeutic or prophylactic effect to be achieved, and (b) the limitations inherent in the compounding technique of such an active compound for treatment of sensitivity in subjects.
- the dose and dosage regimen are adjusted in accordance with methods well known in the therapeutic field.
- the maximum tolerated dose can be easily set and an effective amount can also be determined that provides a detectable therapeutic effect for the patient, as well as the time requirements for the administration of each agent to achieve a visible therapeutic effect for the patient.
- some dosages and regimen regimens are given as examples herein, these examples do not in any way limit the dosages and regimens that may be necessary for the patient to practice the present invention.
- dosage values may vary, depending on the type and severity of the condition, which should be alleviated, and may include one or more doses.
- specific administration schedules should be adjusted after some time according to individual needs and at the discretion of the medical professional who administers or controls the administration of the compositions, and that the concentration ranges given in this description are given only as an example and are not intended to limit the scope or practice of the claimed compositions.
- the dosage regimen with the compositions of this invention can be based on various factors, including the type of disease, age, weight, gender, health status of the patient, severity of the condition, route of administration, and the particular antibody used. Thus, the dosage regimen can vary widely, but can be determined regularly using standard methods.
- doses may be adjusted based on pharmacokinetic and pharmacodynamic parameters, which may include clinical effects, such as toxic effects or laboratory values.
- pharmacokinetic and pharmacodynamic parameters which may include clinical effects, such as toxic effects or laboratory values.
- the present invention covers an individual dose increase, which is determined by a qualified specialist. Determination of the required dose and modes are well known in the relevant field of technology and will be clear to a person skilled in the art after familiarization with the ideas disclosed herein.
- a suitable dose of an antibody of the invention will be in the range of 0.1-200 mg / kg, preferably 0.1-100 mg / kg, including about 0.5-50 mg / kg, for example, about 1 - 20 mg / kg.
- An antibody can be administered, for example, at a dose of at least 0.25 mg / kg, for example at least 0.5 mg / kg, including at least 1 mg / kg, for example at least 1, 5 mg / kg, for example, as well as at least 2 mg / kg, for example at least 3 mg / kg, including at least 4 mg / kg, for example at least 5 mg / kg; and, for example, up to a maximum of 50 mg / kg, including up to a maximum 30 mg / kg, for example, up to a maximum of 20 mg / kg, including up to a maximum of 15 mg / kg.
- the administration will usually be repeated at suitable intervals, for example, once a week, once every two weeks, once every three weeks, or once every four weeks, and for as long as it is deemed appropriate by the responsible physician, who may in some cases increase or reduce the dose if necessary.
- An antibody of the invention may be included in a pharmaceutical composition suitable for administration to a patient.
- Antibodies of the invention may be administered alone or in combination with a pharmaceutically acceptable carrier, diluent and / or excipient in single or multiple doses.
- the pharmaceutical compositions for administration are designed to suit the chosen mode of administration, and pharmaceutically acceptable diluents, carriers and / or excipients such as dispersing agents, buffers, surfactants, preservatives, solubilizing agents, isotonic agents, stabilizers, etc. . used properly.
- compositions have been developed in accordance with traditional methods described in, for example, Remington, The Science and Practice of Pharmacy, 19th Edition, Gennaro, Ed., Mack Publishing Co., Easton, PA 1995, which describes various methods for preparing the compositions, generally known to specialists.
- “Medicinal product (preparation)” a substance or mixture of substances in the form of a pharmaceutical composition in the form of tablets, capsules, powders, lyophilisates, injections, infusions, ointments and other finished forms, intended to restore, correct or change physiological functions in humans and animals as well as for the treatment and prevention of diseases, diagnostics, anesthesia, contraception, cosmetology and other things. Any method of administering peptides, proteins or antibodies adopted in this field can be suitably used for the antibodies of this invention.
- pharmaceutically acceptable means one or more compatible liquid or solid components that are suitable for administration to a mammal, preferably a human.
- excipient or “excipient” is used herein to describe any component other than previously described in this invention. These are substances of inorganic or organic origin, used in the production process, the manufacture of drugs to give them the necessary physical and chemical properties.
- buffer By the term “buffer”, “buffer composition”, “buffer agent” is meant a solution capable of maintaining a pH value due to the interaction of the acid and alkaline components included in its composition, which allows the antibody preparation to be resistant to pH changes. In general, pH values of the pharmaceutical composition of 4.0 to 8.0 are preferred.
- buffering agents for example, acetate, phosphate, citrate, histidine, succinate and the like can be used. buffer solutions, but not limited to them.
- tonic agent refers to an excipient that can apply the osmotic pressure of a liquid antibody preparation.
- An “isotonic” drug is a drug that has an osmotic pressure equivalent to that of human blood. Isotonic preparations typically have an osmotic pressure of about 250 to 350 mOsm / kg.
- isotonic agents polyols, mono- and disaccharides, amino acids, metal salts, for example, sodium chloride, and the like, can be used, but not limited to.
- stabilizeizer is meant an auxiliary substance or a mixture of two or more auxiliary substances that provide the physical and / or chemical stability of the active agent.
- amino acids can be used, for example, arginine, histidine, glycine, lysine, glutamine, proline, but not limited to; surfactants, e.g. polysorbate 20 (trade name Tween 20), polysorbate 80 (trade name Tween 80), polyethylene-polypropylene glycol and its copolymers (trade names Poloxamer, Pluronic), sodium dodecyl sulfate (SDS ), but not limited to them; antioxidants, for example, methionine, acetylcysteine, ascorbic acid, monothioglycerol, salts of seric acids, and the like, but not limited to; chelating agents, for example, but not limited to ethylenediaminetetraacetic acid (EDTA), diethylene triamine pentaacetic acid (DTPA), sodium citrate and the like.
- surfactants e.g. polysorbate 20 (trade name Tween 20), polysorbate 80 (trade name Tween 80),
- the pharmaceutical composition is “stable” if the active agent retains its physical stability and / or chemical stability and / or biological activity during the stated shelf life at a storage temperature, for example, at 2-8 ° C.
- the active agent retains both physical and chemical stability as well as biological activity.
- the storage period is selected based on the results of stability studies during accelerated and natural storage.
- a pharmaceutical composition comprising a monoclonal antibody of the invention can be administered to a patient having a pathology as described herein using standard administration methods, including oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, buccal, sublingual or using suppositories.
- the pharmaceutical composition of the invention preferably contains or is a “therapeutically effective amount” of an antibody of the invention.
- a “therapeutically effective amount” refers to an amount effective at dosages and for periods of time necessary to achieve the desired therapeutic result.
- a therapeutically effective amount of an antibody may vary depending on factors such as the condition of the disease, the age, gender and weight of the individual, and the ability of the antibody or part of the antibody to elicit the desired response in the individual.
- a therapeutically effective amount is also an amount in which the therapeutically beneficial effect of the antibody prevails over the toxic or harmful effect.
- a “prophylactically effective amount” refers to an amount effective at dosages and for periods of time necessary to achieve the desired prophylactic result. Since a prophylactic dose is used for individuals before or at an early stage of the disease, typically a prophylactically effective amount may be less than a therapeutically effective amount.
- a therapeutically effective or prophylactically effective amount is at least the minimum dose, but less than the toxic dose of the active agent, necessary to provide therapeutic benefits to the patient.
- a therapeutically effective amount of an antibody of the invention is an amount that, in mammals, preferably humans, reduces the biological activity of autoimmune clones, for example, by binding to TCR, the beta chain of which belongs to the TRBV9 family, where the presence of these clones causes or contributes to undesirable pathological effects, or a decrease in TCR levels, whose beta chain belongs to the family TRBV9, causes a favorable therapeutic effect in a mammal, preferably a human.
- the route of administration of the antibodies of the invention may be oral, parenteral, by inhalation, or topical.
- the antibodies of the invention may be included in a pharmaceutical composition suitable for parenteral administration.
- parenteral as used in this application includes intravenous, intramuscular, subcutaneous, rectal, vaginal or intraperitoneal administration.
- Advantageous is the introduction by intravenous or intraperitoneal, or subcutaneous injection. Suitable carriers for such injections are directly known in the art.
- compositions must be sterile and stable under the conditions of manufacture and storage in a container that is provided, including, for example, a hermetically sealed vial (ampoule) or syringe. Therefore, pharmaceutical compositions can be sterile filtered after preparation, or otherwise made microbiologically suitable.
- a typical composition for intravenous infusion may have a volume of 250-1000 ml of liquid, such as sterile Ringer's solution, physiological saline, dextrose solution and Hank's solution, and a therapeutically effective dose (for example, 1-100 mg / ml or more) of antibody concentration. The dose may vary depending on the type and severity of the disease.
- the dosages for any patient depend on many factors, including patient size, body surface area, age, specific compound to be administered, gender, time and route of administration, general health and other medications that are administered simultaneously.
- a typical dose may be, for example, in the range of 0.001 -1000 ⁇ g; however, doses below or above this are foreseen illustrative range, especially considering the above factors.
- the dosage regimen of daily parenteral administration may be from 0.1 ⁇ g / kg to 100 mg / kg of the total body weight, preferably from 0.3 ⁇ g / kg to 10 mg / kg, and more preferably from 1 ⁇ g / kg to 1 mg / kg , even more preferably 0.5 to 10 mg / kg body weight per day.
- the treatment process can be monitored by periodically evaluating the patient's condition. For repeated administration over several days or longer, depending on the condition of the patient, the treatment is repeated until the desired response or suppression of the symptoms of the disease is achieved.
- other dosage regimens that are not described in this application may also be used.
- the desired dosage may be administered by single-pole administration, multiple bolus administrations, or by continuous infusion of an antibody, depending on the pharmacokinetic decay sample that the practitioner wants to achieve.
- the therapeutic agents of the invention can be frozen or lyophilized and reconstituted before use in a suitable sterile vehicle. Lyophilization and recovery can lead to varying degrees of loss of antibody activity. Dosages may be adjusted to compensate for this loss. In general, pH values of the pharmaceutical composition of 6 to 8 are preferred.
- a further embodiment of the invention is a product that contains products used to treat autoimmune diseases and related conditions and malignant blood diseases, in the pathogenesis of which are involved TKRs carrying the beta chain of the TRBV9 family.
- diseases include, for example, AS, celiac disease, T-cell leukemia, T-cell lymphoma and others.
- the product is a container with a label and a leaflet, which can be placed in a blister and / or pack.
- Suitable containers are, for example, vials, ampoules, syringes, etc.
- Containers can be made of various materials, such as glass or polymeric materials.
- the container contains a composition effective to treat a particular condition and may have a sterile inlet channel).
- At least one active ingredient in the composition is an antibody of the invention.
- the label and package insert indicate that the drug is used to treat a specific condition.
- the label and / or package leaflet must additionally contain instructions for administering the antibody composition to the patient, including information about the indications, use, dose, route of administration, contraindications and / or precautions regarding the use of such therapeutic products.
- the package insert indicates that the composition is used for treatment to indicate what.
- the product may include other products necessary from a commercial point of view and from the point of view of the consumer, for example, but not limited to solvents, diluents, filters, needles and syringes.
- the invention also relates to kits that can be used for various purposes, for example, to assess the ability to destroy T cells carrying TKR family TRBV9, for purification or immunoprecipitation of the TRBV9 receptor from cells.
- the kit may contain an antibody bound to granules (e.g., sepharose granules).
- the kit contains a container and a label and a package leaflet.
- the antibodies of the present invention are also used for diagnostic purposes (e.g., in vitro, ex vivo).
- an antibody can be used to detect or measure the level of T-lymphocytes containing TRBV9 TCR family in samples obtained from a patient, for example, a tissue sample or a sample of body fluid, such as inflammatory exudate, blood, intestinal fluid, saliva or urine.
- Suitable detection and measurement methods include immunological methods such as flow cytometry, enzyme-linked immunosorbent assay (ELISA), chemiluminescent analysis, radioimmunoassay and immunohistology.
- the invention further includes kits, for example, diagnostic kits containing the antibodies described herein.
- variable domains of the heavy and light chains of the antibody aHTn-TRBV9-2 As the parent (reference) sequences of the variable domains of the heavy and light chains of the antibody aHTn-TRBV9-2, the amino acid sequences of which are shown in SEQ ID Nos: 8 and 10 were used.
- variable domains of the heavy and light chains were compared with a pool of germline sequences of the variable domains of human immunoglobulins, germline sequences of the variable domains of rat immunoglobulins, sequences of mature human and rat antibodies obtained both from open sources and from a donor library provided by Biocad ( Russia). For analysis, we used the Ylab software package (Biocad, Russia).
- variable domains of the analyzed antibodies were established that are most characteristic of animals and not characteristic of humans. At the same time, combinations of amino acids were found that are most often represented in human antibodies in these positions. Based on the obtained data, the design of artificial sequences of variable domains containing substitutions that increase the degree of humanization of the antibody was carried out.
- Codon optimization of nucleotide sequences encoding the proposed amino acid variants was also carried out to express humanized antibodies in the CHO cell line.
- Humanized nucleotide sequences the heavy and light chain variable domains (SEQ ID Nos: 15 and 17) were synthesized de novo and cloned into pEE-HC, pEE-SK vectors, IgGl format (Xu et al. Front. Chem. Sci. Eng. 2015, 9 ( 3): 376-380) at the restriction sites Sall / Nhel and Sall / BsiWI, respectively.
- the nucleic acid sequences of the light and heavy chains obtained were verified by Senger sequencing.
- the MA-042 antibody was selected whose amino acid and nucleotide sequences of the light and heavy chains are shown in SEQ ID Nos: 19-22.
- Antibody MA-042 includes the variable domains of the heavy and light chains that have the amino acid sequences shown in SEQ ID NO: 16 and 18.
- the degree of humanization of the variable domain of the heavy chain of the MA 042 antibody was 87%, and the degree of humanization of the variable domain of the light chain was 85% (Table 1).
- the constant domain of the heavy chain is represented by the IgGl allotype Gm3 format.
- Example 2 Obtaining a recombinant antibody and determining its affinity
- Vectors containing nucleic acids encoding the light and heavy chains of the MA-042 antibody, obtained as described in Example 1, were obtained in E. coli cells and purified using a plasmid DNA purification reagent kit manufactured by Qiagen (Germany) and used for transfection of the CHO-Fut8 cell line using linear polyethyleneimine (PEI "MAX", "Polysciences", USA) according to the manufacturer's instructions.
- the resulting reaction mixtures were incubated at 37 ° C on a rocking chair. 9 days after transfection, the culture fluid was separated from the cells by filtration through a filter with a pore size of 0.5 / 0.22 ⁇ m.
- the culture fluid was used to isolate antibodies using affinity chromatography on 0.2 ml PreDictor RoboColumn Mab Select SuRe columns (GE Healthcare, USA), balanced with phosphate-buffered saline (FSB, pH 7.4). Then the column was washed with 5 volumes of FSB. The carrier-bound protein was eluted using 0.1 M pH 3 glycine buffer. The main peak containing protein was collected and the pH was neutralized with 1 M Tris buffer (pH 7.5). All stages were carried out at a flow rate of PO cm / h. Next, the protein was transferred to PBS (pH 7.4) using dialysis, filtered through a 0.22 ⁇ m filter, transferred to new sterile tubes.
- PBS pH 7.4
- the quality of the release was evaluated using 12% PAGE-electrophoresis under denaturing conditions. Quantification was carried out using measurements on a NanoDrop2000 microspectrophotometer at 280A. The isolated protein was stored at -70 ° C.
- Example 3 Obtaining a cell line stably producing antibody e IgGl format, and the production of antibodies.
- the heavy and light chain sequences of the MA-042 antibody were obtained as described in Example 1 and cloned into pSX vectors at the Hindlll, Xbal restriction sites.
- the obtained plasmids were obtained in E. coli cells and isolated using a BenchPro 2000 device (Life Technology, USA) in the amount of 600-700 ⁇ g according to the manufacturer's instructions. Plasmids were linearized overnight using Pvul endonuclease, then ethanol precipitated, the precipitate was dissolved in water, the concentration in the final volume was 900-1100 ng / ⁇ l.
- the CHO-K1-S cell line was cultured in Ham’s F12 Gibco medium (Thermo, USA). Transfection with genetic constructs containing MA-042 coding sequences was performed using electroporation on a Nucleofector TM instrument (Lonza, Switzerland) according to the manufacturer's protocol.
- antibiotic selection of transfected cells was carried out for 24 days, adding puromycin (final concentration 7.2 ⁇ g / ml) and hygromycin B (final concentration of 640 ⁇ g / ml). Then, homogeneous in structure antibiotic-resistant cell clones expressing at a high level of MA-042 were selected.
- the preclinical monoclonal antibody MA-042 was produced in a 50 L HyClone single-use bioreactor fermenter (Thermo Fisher Scientific). Removal of producer cells from the culture fluid was performed using a Millistak C0HC depth filter (Merck-Millipore, USA). The primary purification of the antibody from the clarified culture fluid was carried out on an affinity sorbent with protein A. Specific elution of the target protein was carried out under acidic conditions of pH3.3-3.8 in glycine buffer. The resulting eluate was kept at an acidic pH for 30-60 minutes for viral inactivation, and then neutralized with a 1M Tris-HCl solution to a pH of 6.5-7.0.
- the final chromatographic purification in slip mode was performed on a CaptoAdhere sorbent (GE Healthcare LifeSciences, USA). For this, the protein solution was passed through a prepared sorbent balanced with tris- buffer with pH 6, 5-7.0 at a low conductivity value ( ⁇ 3 mS / cm 2 ).
- the purified protein was subjected to antiviral filtration using a Viresolve PRO filter kit (Millipore, USA), concentration and diafiltration against a final buffer containing acetate buffer (pH 5, 0-5, 5) and trehalose.
- Example 4 The use of antibodies for specific binding to TCR of the TRBV9 family.
- Antibodies were labeled with fluorescein using the fluorescein isothiocyanate reagent (Sigma, USA) according to the manufacturer's protocol.
- the number of fluorophores that reacted with antibody molecules was controlled by the absorption spectrum ratio at wavelengths of 495/280 nm.
- T lymphocytes were obtained from the peripheral blood of a healthy donor. Blood was collected in Vacuette tubes with EDTA (2x9 ml each), the mononuclear fraction according to the standard method described in (Kovalchuk L.V. et al. Immunology: Workshop - 2010. - 176 p.). After isolation, cells were transferred to phosphate buffered saline (PBS) containing 0.5% bovine serum albumin (BSA) and 2 mM EDTA. The total number of cells and their viability was determined by the method of staining with trypan blue as described by Lang N.R.
- PBS phosphate buffered saline
- BSA bovine serum albumin
- Monoclonal antibody MA-042 was obtained as described in Example 3.
- a mononuclear fraction of human blood was obtained as described in Example 4.
- the cytotoxic activity of MA-042 was determined using the cytofluometric method.
- An aliquot of cells from the mononuclear fraction was used to calculate the total number of cells, viability was determined by the ability to stain with trypan blue.
- 3-4 x 10 6 cells were incubated in PBS buffer for an hour with MA-042 antibody at a concentration of: 20 ng / ml 40 ng / ml 100 ng / ml 200 ng / ml 500 ng / ml and 1 ⁇ g / ml, as a "zero control" was performed incubation without the addition of antibodies.
- the cells were washed twice with PBS, transferred to RPMI medium containing 10% human serum and incubated for 72 hours in a C0 2 incubator. Then the cells were centrifuged and stained with antibodies CD4-PE, CD3-eFluor405 (eBioscience, USA) and MA-042-FITC.
- the EC50 value was obtained (gulumakey effective concentration means the concentration of the antibody, which causes an effect equal to half the maximum possible for this antibody after a certain period of time) for MA-042 antibody it was 100 ng / ml (Fig. 3 )
- Monoclonal antibody MA-042 was obtained as described in Example 3.
- a single intravenous administration of MA-042 rhesus monkeys (Masas mulatto) was performed. The experiment was carried out on sexually mature male rhesus monkeys weighing 4-10 kg, provided by the Federal State Budget Scientific Institution Scientific Research Institute of Medical Primatology. After receipt, the animals were kept in quarantine for 30 days.
- the selected animals were kept in individual metal cages equipped with feed bins, label holders, the number of animals in one cage - 1 pc.
- the diet consisted of full feed, fruits, vegetables according to average feed consumption standards. Animals received water from a central water supply.
- mice were divided into three groups of 4 in each, including the control.
- the control group of animals received intravenous human immunoglobulin (Immunovenin, Microgen, Russia).
- Immunovenin intravenous human immunoglobulin
- MA-042 intravenous human immunoglobulin
- the MA-042 preparation was diluted with Dulbecco's phosphate-buffered saline (DPBS) without calcium and magnesium.
- DPBS Dulbecco's phosphate-buffered saline
- the drugs were administered in a volume not exceeding 5 ml per injection into the ulnar vein of the right forelimb.
- the observation period was 42 days. Blood samples were taken as indicated in Table 3. Immunophenotyping and analysis of the samples was performed as described above.
- Example 8 Obtaining a pharmaceutical composition containing an antibody according to the invention
- the pharmaceutical composition was prepared by standard methods known in the art.
- Example 9 A kit containing a pharmaceutical composition with antibodies
- kits with a dosage form containing a composition with an MA-042 antibody the pharmaceutical composition prepared according to Example 5 is sealed in 1 ml ampoules or syringes under sterile conditions, labeled and packaged in containers made of plastic or cardboard material.
- Lys Ala Ser Lys Ser lie Asn Lys Tyr Leu Ala
- Gly Trp lie Asn Thr Tyr Thr Gly Thr Pro Thr Tyr Ala Asp Asp Phe 50 53 60
- caggtgcaac ttgttcagtc ggggagcgaa cttaagasge caggggaaag tgtaaagtg 60 agetgcaaag cctcaggcta cacgtttacc gattatcttg tgeatfgggt tagacaggct 120 ccaggtcaag gactggaatg gatgggatgg atcaatscct atacagggac acccacatat 280 gccgatgact ttgagggacg gtttgtcttc tcacttgata ccagtgtttc cactgctaac 240 ctctagataa gcagcctgaa ggcagaggac accgccgttt atttetgcgc ccgatcatgg 300 sggagagget igcga
- Gly Trp lie Asn Thr Tyr Thr Gly Thr Pro Thr Tyr Ala Asp Asp Phe
- caggtgcaac ttgttcagtc ggggagcgaa cttaagaagc caggggaaag tgtaaagtg 60 agetgcssag cctcaggcta cacgtttacc gattatcttg tgcattgggt tagacaggct 128 ccaggtcaag gactggaatg gatgggatgg atcaatacct atacagggac acecacatat 188 gccgatgact ttgagggacg gtttgtcttc tcacttgata ccagtgtttc cactgctaac 248 ctccagataa geagcctgsa ggcagaggac accgccgttt atttctgcgcgcgatcatgg 380 aggagaggcc tacgaggagg
- 325 330 335 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Oncology (AREA)
- General Engineering & Computer Science (AREA)
- Hematology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Nutrition Science (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020217023541A KR102788029B1 (ko) | 2018-12-25 | 2019-12-24 | 인간 trbv9의 베타 쇄 영역에 대한 단일클론 항체 |
| CN201980092905.7A CN113646333B (zh) | 2018-12-25 | 2019-12-24 | 针对人TRBV9的β链区域的单克隆抗体 |
| PH1/2021/551775A PH12021551775A1 (en) | 2018-12-25 | 2019-12-24 | Monoclonal antibodies that specifically bind to the beta region of the TRBV-9 family of the human T-cell receptor, and methods for their use |
| CA3127767A CA3127767A1 (en) | 2018-12-25 | 2019-12-24 | Monoclonal antibodies that specifically bind to the beta region of the trbv-9 family of the human t-cell receptor, and methods for their use |
| CONC2021/0009689A CO2021009689A2 (es) | 2018-12-25 | 2021-07-23 | Anticuerpos monoclonales que se unen específicamente a la región beta de la familia trbv-9 del receptor de células t humano, y los métodos para su uso. |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2018146031 | 2018-12-25 | ||
| RU2018146031A RU2712251C1 (ru) | 2018-12-25 | 2018-12-25 | Гуманизированные антитела против участка бета цепи 9-го семейства TRBV9 TKP человека, и способы их применения |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2020091635A2 true WO2020091635A2 (ru) | 2020-05-07 |
| WO2020091635A3 WO2020091635A3 (ru) | 2020-10-22 |
Family
ID=69184123
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/RU2019/050258 Ceased WO2020091635A2 (ru) | 2018-12-25 | 2019-12-24 | Гуманизированные антитела против участка бета цепи 9-го семейства trbv9 ткр человека, и способы их применения |
| PCT/RU2020/050024 Ceased WO2020139175A2 (ru) | 2018-12-25 | 2020-02-20 | Гуманизированные антитела против участка бета цепи 9-го семейства trbv9 ткр человека, и способы их применения |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/RU2020/050024 Ceased WO2020139175A2 (ru) | 2018-12-25 | 2020-02-20 | Гуманизированные антитела против участка бета цепи 9-го семейства trbv9 ткр человека, и способы их применения |
Country Status (25)
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2023551535A (ja) * | 2020-12-01 | 2023-12-08 | ザ・ジョンズ・ホプキンス・ユニバーシティー | T細胞がんを治療するための方法および材料 |
| US11845797B2 (en) | 2018-07-03 | 2023-12-19 | Marengo Therapeutics, Inc. | Anti-TCR antibody molecules and uses thereof |
| US12152073B2 (en) | 2018-03-14 | 2024-11-26 | Marengo Therapeutics, Inc. | Multifunctional molecules that bind to calreticulin and uses thereof |
| US12247060B2 (en) | 2018-01-09 | 2025-03-11 | Marengo Therapeutics, Inc. | Calreticulin binding constructs and engineered T cells for the treatment of diseases |
| US12358982B2 (en) | 2019-02-21 | 2025-07-15 | Marengo Therapeutics, Inc. | Multifunctional molecules that bind to T cell related cancer cells and uses thereof |
| US12384842B2 (en) | 2019-02-21 | 2025-08-12 | Marengo Therapeutics, Inc. | Antibody molecules that bind to NKP30 and uses thereof |
| US12486326B2 (en) | 2020-01-03 | 2025-12-02 | Marengo Therapeutics, Inc. | Anti-TCR antibody molecules and uses thereof |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2694412C9 (ru) | 2017-12-25 | 2019-09-18 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Российский национальный исследовательский медицинский университет им. Н.И. Пирогова" Министерства здравоохранения Российской Федерации (ФГБОУ ВО РНИМУ им. Н.И. Пирогова Минздрава России) | Моноклональные антитела и способы их применения |
| RU2712251C1 (ru) * | 2018-12-25 | 2020-01-27 | Федеральное государственное автономное образовательное учреждение высшего образования "Российский национальный исследовательский медицинский университет имени Н.И. Пирогова" Министерства здравоохранения Российской Федерации (ФГАОУ ВО РНИМУ им. Н.И. Пирогова Минздрава России) | Гуманизированные антитела против участка бета цепи 9-го семейства TRBV9 TKP человека, и способы их применения |
| CN116510006A (zh) * | 2022-01-31 | 2023-08-01 | 拜奥卡德联合股份公司 | 抗trbv9抗体的药物组合物及其用途 |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5766947A (en) | 1988-12-14 | 1998-06-16 | Astra Ab | Monoclonal antibodies reactive with an epitope of a Vβ3.1 variable region of a T cell receptor |
| US5223426A (en) * | 1988-12-15 | 1993-06-29 | T Cell Sciences, Inc. | Monoclonal antibodies reactive with defined regions of the t-cell antigen receptor |
| WO2010151416A1 (en) | 2009-06-25 | 2010-12-29 | Fred Hutchinson Cancer Research Center | Method of measuring adaptive immunity |
| EP3202784A1 (en) * | 2016-02-08 | 2017-08-09 | Polybiocept AB | T-cell receptor sequences for active immunotherapy |
| RU2694412C9 (ru) | 2017-12-25 | 2019-09-18 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Российский национальный исследовательский медицинский университет им. Н.И. Пирогова" Министерства здравоохранения Российской Федерации (ФГБОУ ВО РНИМУ им. Н.И. Пирогова Минздрава России) | Моноклональные антитела и способы их применения |
| RU2712251C1 (ru) * | 2018-12-25 | 2020-01-27 | Федеральное государственное автономное образовательное учреждение высшего образования "Российский национальный исследовательский медицинский университет имени Н.И. Пирогова" Министерства здравоохранения Российской Федерации (ФГАОУ ВО РНИМУ им. Н.И. Пирогова Минздрава России) | Гуманизированные антитела против участка бета цепи 9-го семейства TRBV9 TKP человека, и способы их применения |
-
2018
- 2018-12-25 RU RU2018146031A patent/RU2712251C1/ru active
-
2019
- 2019-12-23 AR ARP190103840A patent/AR117734A1/es unknown
- 2019-12-24 PH PH1/2021/551775A patent/PH12021551775A1/en unknown
- 2019-12-24 KR KR1020217023541A patent/KR102788029B1/ko active Active
- 2019-12-24 CN CN201980092905.7A patent/CN113646333B/zh active Active
- 2019-12-24 WO PCT/RU2019/050258 patent/WO2020091635A2/ru not_active Ceased
- 2019-12-24 CA CA3127767A patent/CA3127767A1/en active Pending
-
2020
- 2020-02-20 MY MYPI2021003585A patent/MY205967A/en unknown
- 2020-02-20 BR BR112021012555-8A patent/BR112021012555A2/pt unknown
- 2020-02-20 AU AU2020204492A patent/AU2020204492A1/en active Pending
- 2020-02-20 EA EA202191813A patent/EA202191813A1/ru unknown
- 2020-02-20 MX MX2021007719A patent/MX2021007719A/es unknown
- 2020-02-20 PE PE2021001081A patent/PE20220217A1/es unknown
- 2020-02-20 KR KR1020217023568A patent/KR20220131489A/ko active Pending
- 2020-02-20 US US17/417,686 patent/US12227572B2/en active Active
- 2020-02-20 CN CN202080016346.4A patent/CN114144432A/zh active Pending
- 2020-02-20 CR CR20210354A patent/CR20210354A/es unknown
- 2020-02-20 WO PCT/RU2020/050024 patent/WO2020139175A2/ru not_active Ceased
- 2020-02-20 CA CA3124813A patent/CA3124813A1/en active Pending
- 2020-02-20 SG SG11202106975VA patent/SG11202106975VA/en unknown
- 2020-02-20 JP JP2021537707A patent/JP2022532274A/ja active Pending
- 2020-02-20 MA MA53689A patent/MA53689B1/fr unknown
- 2020-02-20 EP EP20734640.4A patent/EP3907239A4/en active Pending
-
2021
- 2021-06-23 CO CONC2021/0008218A patent/CO2021008218A2/es unknown
- 2021-06-24 JO JOJO/P/2021/0169A patent/JOP20210169B1/ar active
- 2021-06-24 IL IL284370A patent/IL284370A/en unknown
- 2021-06-24 CL CL2021001705A patent/CL2021001705A1/es unknown
- 2021-06-24 EC ECSENADI202146333A patent/ECSP21046333A/es unknown
- 2021-06-24 ZA ZA2021/04357A patent/ZA202104357B/en unknown
- 2021-06-25 PH PH12021551532A patent/PH12021551532A1/en unknown
- 2021-07-23 CO CONC2021/0009689A patent/CO2021009689A2/es unknown
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12247060B2 (en) | 2018-01-09 | 2025-03-11 | Marengo Therapeutics, Inc. | Calreticulin binding constructs and engineered T cells for the treatment of diseases |
| US12152073B2 (en) | 2018-03-14 | 2024-11-26 | Marengo Therapeutics, Inc. | Multifunctional molecules that bind to calreticulin and uses thereof |
| US11845797B2 (en) | 2018-07-03 | 2023-12-19 | Marengo Therapeutics, Inc. | Anti-TCR antibody molecules and uses thereof |
| US11965025B2 (en) | 2018-07-03 | 2024-04-23 | Marengo Therapeutics, Inc. | Method of treating solid cancers with bispecific interleukin-anti-TCRß molecules |
| US12286477B2 (en) | 2018-07-03 | 2025-04-29 | Marengo Therapeutics, Inc. | Anti-TCR antibody molecules and uses thereof |
| US12351632B2 (en) | 2018-07-03 | 2025-07-08 | Marengo Therapeutics, Inc. | Anti-TCR antibody molecules and uses thereof |
| US12358982B2 (en) | 2019-02-21 | 2025-07-15 | Marengo Therapeutics, Inc. | Multifunctional molecules that bind to T cell related cancer cells and uses thereof |
| US12384842B2 (en) | 2019-02-21 | 2025-08-12 | Marengo Therapeutics, Inc. | Antibody molecules that bind to NKP30 and uses thereof |
| US12486326B2 (en) | 2020-01-03 | 2025-12-02 | Marengo Therapeutics, Inc. | Anti-TCR antibody molecules and uses thereof |
| JP2023551535A (ja) * | 2020-12-01 | 2023-12-08 | ザ・ジョンズ・ホプキンス・ユニバーシティー | T細胞がんを治療するための方法および材料 |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113646333B (zh) | 针对人TRBV9的β链区域的单克隆抗体 | |
| CN113692412B (zh) | 特异性地结合人trbv9的单克隆抗体 | |
| KR102867660B1 (ko) | 단일클론 항체 및 그 이용 방법 | |
| EA041932B1 (ru) | Моноклональные антитела, которые специфически связываются с участком бета цепи семейства trbv-9 т-клеточного рецептора человека, и способы их применения | |
| HK40063875A (en) | Monoclonal antibodies against the beta chain region of human trbv9 | |
| HK40064423A (en) | Monoclonal antibodies that bind specifically to human trbv9 | |
| HK40070180A (en) | Monoclonal antibodies against the beta chain region of human trbv9 | |
| HK40064423B (zh) | 特异性地结合人trbv9的单克隆抗体 | |
| HK40063875B (zh) | 针对人TRBV9的β链区域的单克隆抗体 | |
| HK40039968A (en) | Monoclonal antibodies and methods for using same | |
| EA041880B1 (ru) | Моноклональные антитела и способы их применения | |
| HK40039968B (zh) | 单克隆抗体及其使用方法 | |
| EA042982B1 (ru) | Моноклональные антитела против участка бета-цепи trbv9 человека |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 3127767 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: NC2021/0009689 Country of ref document: CO |
|
| WWE | Wipo information: entry into national phase |
Ref document number: DZP2021000451 Country of ref document: DZ |
|
| WWP | Wipo information: published in national office |
Ref document number: NC2021/0009689 Country of ref document: CO |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 19879428 Country of ref document: EP Kind code of ref document: A2 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 201980092905.7 Country of ref document: CN |
|
| WWG | Wipo information: grant in national office |
Ref document number: NC2021/0009689 Country of ref document: CO |