WO2020054934A1 - 세라마이드 전구물질 생산용 효모, 사카로마이세스 세레비지에 변이 균주 및 이의 제조방법 - Google Patents

세라마이드 전구물질 생산용 효모, 사카로마이세스 세레비지에 변이 균주 및 이의 제조방법 Download PDF

Info

Publication number
WO2020054934A1
WO2020054934A1 PCT/KR2019/002917 KR2019002917W WO2020054934A1 WO 2020054934 A1 WO2020054934 A1 WO 2020054934A1 KR 2019002917 W KR2019002917 W KR 2019002917W WO 2020054934 A1 WO2020054934 A1 WO 2020054934A1
Authority
WO
WIPO (PCT)
Prior art keywords
strain
gene
yeast
saccharomyces cerevisiae
lcb4
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2019/002917
Other languages
English (en)
French (fr)
Inventor
최원자
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ewha Womans University
Original Assignee
Ewha Womans University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020180116596A external-priority patent/KR20200031489A/ko
Application filed by Ewha Womans University filed Critical Ewha Womans University
Publication of WO2020054934A1 publication Critical patent/WO2020054934A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds

Definitions

  • the present invention relates to a yeast variant strain for producing a new ceramide precursor and a method for producing the same, more specifically, re-analysis of the metabolic pathway for ceramide production in human-friendly yeast Saccharomyces cerevisiae
  • the present invention relates to a high-producing yeast mutant strain of sphingosine or dihydrosphingosine-ceramide produced through design, a method for producing the strain, and a method for producing sphingosine or dihydrosphingosine-ceramide using the strain.
  • Sphingolipids are a type of lipid and are known to exist in the cell membranes of almost all living organisms.
  • the sphingoid base sphingosine
  • sphinganine or phytosphingosine as the basic skeleton sphingoid base
  • fatty acids and various derivatives including head groups.
  • head groups the structure in which fatty acids are bonded to sphingosine or phytosphingosine by amide bonds is commonly referred to as ceramide, and depending on the substance bound to the polar head group, sphingomyelin, cerebroside;
  • Various compounds such as CB), ganglioside and sulfatide exist.
  • Ceramide is a very important lipid that occupies about 40% of the skin barrier lipid. It is a skin protective film that protects the skin from external stimuli and prevents evaporation of moisture from the skin. Because it is in charge, it is considered one of the essential elements of basic cosmetics. In addition to these functions, ceramide is known to play a variety of roles, such as contributing to the solubility of cholesterol, reducing the fluidity of the biomembrane, affecting skin cell differentiation and growth, and mediating signaling in the skin. . Ceramide NS (nonalcoholic spingosine-containing ceramide), which is classified into sphingosine and triglycerides, and trifatosphingosine are combined with triglycerides.
  • Ceramide NP nonalcoholic phytospingosine-containing ceramide
  • Ceramide AP Ceramide AS
  • ⁇ -hydroxyceramide combined with ⁇ -hydroxy fatty acid to each sphingoid backbone Ceramide EOP and Ceramide EOS combined with linoleic acid
  • the ceramides currently commercially available are mainly Ceramide NP and Ceramide NS.
  • Conventional ceramides are produced through two methods, one of which is direct extraction of human-friendly sphingosine-containing ceramide from brain tissues of cattle and horses, and the other, secretion when culturing Pichia ciferrii , a non-traditional yeast. It is a method to obtain phytosphingosine-containing ceramide by chemically binding fatty acids to phytosphingosine (Korea Patent Registration No. 10-0267668). In high value-added moisturizing cosmetics, these two ceramides are properly mixed, so the method of obtaining double sphingosine-containing ceramides has raised safety issues due to mad cow disease.
  • a human-friendly sphingosine-containing ceramide can be obtained by a method other than the method of extracting from the brain tissue of a cow or horse, the quality of the ceramide-based cosmetics will be increased by one level from the safety level.
  • sphingosine is made from dihydrosphingosine by the formation of a double bond of C4-C5 by ⁇ 4-desaturase. It is optimal if human-friendly yeast (Saccharomyces cerevisiae ) can obtain the same ceramide as it exists in human skin, but the yeast does not synthesize sphingosine because it does not have ⁇ 4-desaturase. However, a recently published study showed that sphingosine is produced in cells by introducing the human ⁇ 4-desaturase (hDES1) gene into the yeast strain.
  • hDES1 human ⁇ 4-desaturase
  • the present inventors have studied on the feasibility of mass production of sphingosine by applying metabolic engineering changes in S. cerevisiae as phytosphingosine mass production in P. ciferrii yeast, a ceramide production from traditional yeast S. cerevisiae A new mutant strain capable of mass-producing sphingosine and dihydrosphingosine-ceramide was produced through redesign of the metabolic pathway.
  • the present inventors redesigned the sphinglipid metabolic pathway using metabolic technology in human-friendly traditional yeast ( S. cerevisiae ) to solve the above-mentioned problems, and sphingosine or dehydrosphing A novel yeast mutant strain capable of mass-producing Kosin-ceramide was prepared, respectively, to complete the present invention.
  • the present invention is a human DES1 (sphingoid delta 4-desaturase) gene is introduced, and the transformed so that the synthesis of dihydrosphingosine (dihydrosphingosine) is enhanced, sphingosine (sphingosine) high-producing yeast mutant strain and the yeast mutant strain It is an object to provide a manufacturing method of.
  • DES1 sphingoid delta 4-desaturase
  • Another object of the present invention is to provide a method for producing sphingosine comprising culturing the yeast mutant strain.
  • another object of the present invention is to provide a transformed strain to enhance the synthesis of dihydrosphingosine-ceramide, dihydrosphingosine-ceramide, a high-producing yeast mutant strain and a method for preparing the strain. Is done.
  • Another object of the present invention is to provide a method for producing dihydrosphingosine-ceramide comprising culturing the yeast mutant strain.
  • the present invention is transformed so that the human DES1 (sphingoid delta 4-desaturase) gene is introduced, and the synthesis of dihydrosphingosine is enhanced, sphingosine (sphingosine)
  • DES1 sphingoid delta 4-desaturase
  • sphingosine sphingosine
  • a high-producing yeast mutant strain Saccharomyces cerevisiae is provided.
  • the present invention provides a method for producing sphingosine, comprising culturing the strain for strain producing high sphingosine.
  • the enhancement of the synthesis of dihydrosphingosine is sphingosine hydroxylase, L-serine / L-threonine ammonia degrading enzyme CHA1 (L-serine / L-threonine ammonia-lyase CHA1) ) And the inactivation of sphinganine kinase LCB4 (sphinganine kinase LCB4), and overexpression of 3-ketodihydrosphingosine reductase.
  • the inactivation is a substitution of the base sequence encoding SUR2 (sphinganine C4-hydroxylase), CHA1 (L-serine / L-threonine ammonia-lyase CHA1) and LCB4 (sphinganine kinase LCB4) genes, It may be by deletion or a combination thereof.
  • the mutant strain may be derived from Saccharomyces cerevisiae BY4741 strain.
  • the human DES1 gene may be multiplexed into the yeast genome via a Tau transposon.
  • the present invention provides a transformed strain to enhance the synthesis of dihydrosphingosine-ceramide, dihydrosphingosine-ceramide, a high-producing yeast mutant strain Saccharomyces cerevisiae do.
  • the present invention provides a method for producing a dihydrosphingosine-ceramide, comprising culturing the strain for producing high-yeast mutant strains.
  • the enhancement of the synthesis of dihydrosphingosine-ceramide is sphingosine hydroxylase, L-serine / L-threonine ammonia degrading enzyme CHA1 (L-serine / L-threonine ammonia- lyase CHA1), sphinganine kinase LCB4 (sphinganine kinase LCB4) and inactivation of alkaline dihydroceramidase, and over-expression of 3-ketodihydrosphingosine reductase It may be due to.
  • L-serine / L-threonine ammonia degrading enzyme CHA1 L-serine / L-threonine ammonia- lyase CHA1
  • sphinganine kinase LCB4 sphinganine kinase LCB4
  • inactivation of alkaline dihydroceramidase and over-expression of 3-ket
  • the inactivation encodes the SUR2 (sphinganine C4-hydroxylase), CHA1 (L-serine / L-threonine ammonia-lyase CHA1), LCB4 (sphinganine kinase LCB4) and YDC1 (alkaline dihydroceramidase) genes. It may be due to substitution, deletion, or a combination thereof.
  • the yeast mutant strain may be derived from Saccharomyces cerevisiae BY4741 strain.
  • the present invention provides a method for producing the above-described sphingosine (sphingosine) high-producing yeast mutant strain Saccharomyces cerevisiae .
  • Saccharomyces cerevisiae Saccharomyces cerevisiae (Saccharomyces cerevisiae ) SUR2 (sphinganine C4-hydroxylase) gene, CHA1 (L-serine / L-threonine ammonia-lyase CHA1) gene and LCB4 (sphinganine kinase LCB4) gene, respectively Disrupting;
  • the present invention provides a method for producing a high-producing yeast mutant strain Saccharomyces cerevisiae , which includes the following steps: dihydrosphingosine-ceramide.
  • the gene deletion in step (a) may be due to substitution, deletion, or a combination of nucleotide sequences encoding respective corresponding genes.
  • the introduction of the human DES1 gene in step (c) may be multiplexed through a tau transposon.
  • the traditional yeast S. cerevisiae
  • the yeast is human-friendly and human compared to the yeast ( P. ciferrii ) used in the production of conventional phytosphingosine . It has the advantage of efficiently expressing foreign genes, including strains and easily improving strains, and thus it is possible to obtain ceramides having excellent skin affinity and function with the same stereochemical structure as those present in human skin.
  • the human-friendly and chemically-synthesized sphingosine and its inducer produced from traditional yeast can be expanded to various ceramide production in the skin of the living body, thereby preventing aging. It can be widely used in products for moisturizing and rejuvenating damaged skin.
  • 1A depicts the redesigned sphingolipid metabolic pathway in the sphingosine high-producing yeast mutant strain.
  • 1B depicts the redesigned sphingolipid metabolic pathway in the dihydrosphingosine-ceramide high-producing yeast variant strain.
  • Figure 2a shows the SUR2 gene sequence.
  • Figure 2b shows a gene map of pML104-sur2-oligo, a gRNA generation vector for utilizing gene scissors to produce SUR2 gene-deficient strains in the process of producing a sphingosine high-producing mutant strain.
  • Figure 3a shows the base sequence of the CHA1 gene.
  • FIG. 3B is a map of pML104-cha1-oligo, a gRNA generation vector for deleting a CHA1 gene from a strain in which the SUR2 gene has been deleted as a process for producing a sphingosine high-producing mutant strain.
  • Figure 3c shows the base sequence of the CHA1 gene is induced early termination.
  • Figure 4a shows the nucleotide sequence of the LCB4 gene.
  • Figure 4b is a gML generation vector pML104-lcb4-oligo gene map for the deletion of the LCB4 gene in the SUR2 and CHA1 gene-deficient strains in the process of producing a high-sphingosine mutant strain.
  • Figure 4c shows the pScDAL22-LCB4-updn gene map for LCB4 gene deletion.
  • Figure 5a shows the nucleotide sequence of the TSC10 gene.
  • Figure 5b shows the pScDAL22-LCB4-updn-TSC10myc gene map for inserting the TSC10 gene into the region where the LCB4 gene is defective.
  • Figure 6a shows the nucleotide sequence of the human DES1 (HsDES1) gene.
  • Figure 6b shows the base sequence of the HuDES1 gene synthesized by optimizing the sequence of the human DES1 gene to increase the expression rate in yeast.
  • Figure 6c is a pScDAL28-tau-updn gene map produced by cloning a Tau transposon DNA fragment.
  • FIG. 6d shows a pScDAL28-tau-updn-HuDES1 gene map produced by cloning the Hudes1 sequence in the vector of FIG. 6c.
  • Figure 7a shows the nucleotide sequence of the YDC1 gene.
  • FIG. 7B shows a pML104-ydc1-oligo gene map for generating gRNA to delete the YDC1 gene in a strain in which the SUR2, CHA1, and LCB4 genes are deleted as a process for producing a high production mutant strain of dihydrosphingosine-ceramide. .
  • Figure 7c shows the nucleotide sequence of the YDC1 gene induced early termination.
  • FIG. 8A shows LCBs for each of phytosphingosine (PHS), dihydrosphingosine (DHS), and sphingosine (S) to measure the production yield of sphingosine and dihydrosphingosine of strain # 11 via HPLC. It shows the retention time of standard peaks of long chain bases.
  • PHS phytosphingosine
  • DHS dihydrosphingosine
  • S sphingosine
  • 8B is a result of measuring retention time for lipids extracted from strain # 11 samples.
  • the present inventors redesigned the sphinglipid metabolic pathway in human-friendly traditional yeast ( S. cerevisiae ) using metabolic engineering techniques, and a novel yeast variant capable of mass-producing sphingosine or dihydrosphingosine-ceramide. Each strain was prepared to complete the present invention.
  • the present invention is a human DES1 (sphingoid delta 4-desaturase) gene is introduced, and dihydrosphingosine (dihydrosphingosine) transformed to enhance synthesis, sphingosine (sphingosine) high production yeast mutant strain Saccharomyces cere Saccharomyces cerevisiae .
  • DES1 sphingoid delta 4-desaturase
  • the present invention provides a method for producing sphingosine, comprising culturing the strain for strain producing high sphingosine.
  • the present invention provides a transformed strain to enhance the synthesis of dihydrosphingosine-ceramide, dihydrosphingosine-ceramide, a high-producing yeast mutant strain Saccharomyces cerevisiae do.
  • the present invention provides a method for producing dihydrosphingosine-ceramide, comprising culturing the high-yeast mutant strain of dihydrosphingosine-ceramide.
  • the redesign of the sphingolipid metabolic pathway means that some proteins involved in the metabolic pathway are made by inactivating, overexpressing, or inducing a new pathway by gene introduction.
  • the term “enhanced synthesis of dihydrosphingosine” or “enhanced synthesis of dihydrosphingosine-ceramide” refers to dihydrosphingosine compared to wild type strains in the sphingolipid metabolic pathway of yeast strains, or This means that the metabolic pathway is concentrated towards the synthesis of dihydrosphingosine-ceramide, so that the proteins are produced at a high level, and for this purpose, the sphingolipid metabolic pathway that occurs in the wild type can be changed.
  • the enhancement of the synthesis of dihydrosphingosine is sphingosine hydroxylase, L-serine / L-threonine ammonia degrading enzyme CHA1 (L-serine / L-threonine ammonia-lyase CHA1) and sphinga It may be induced by inactivation of nin phosphatase LCB4 (sphinganine kinase LCB4), and overexpression of 3-ketodihydrosphingosine reductase.
  • dihydrosphingosine-ceramide is enhanced by sphingosine hydroxylase, L-serine / L-threonine ammonia degrading enzyme CHA1 (L-serine / L-threonine ammonia-lyase CHA1), and sphinganine phosphorylation It may be induced by inactivation of the enzymes sphinganine kinase LCB4 and alkaline dihydroceramidase, and overexpression of 3-ketodihydrosphingosine reductase.
  • sphingosine hydroxylase L-serine / L-threonine ammonia degrading enzyme CHA1 (L-serine / L-threonine ammonia-lyase CHA1)
  • sphinganine phosphorylation It may be induced by inactivation of the enzymes sphinganine kinase LCB4 and alkaline dihydroceramidase, and
  • activation refers to inhibiting protein expression by allowing a nucleotide encoding a gene to be deleted by substitution, insertion, deletion, or a combination thereof.
  • inactivation of the sphingosine hydroxylase is induced by a deletion of the SUR2 (sphinganine C4-hydroxylase) gene of the yeast strain
  • inactivation of the L-serine / L-threonine ammonia degrading enzyme CHA1 is CHA1 (L-serine / L-threonine ammonia-lyase CHA1) is induced by a deletion of the gene
  • inactivation of the sphinganine phosphatase LCB4 is induced by a deletion of the LCB4 (sphinganine kinase LCB4)
  • inactivation of the alkaline dihydroceramide degrading enzyme is It can be induced by a deletion of the YDC1 (alkaline dihydroceramidase) gene.
  • the over-expression of the 3-ketodihydrosphingosine reductase can be achieved by additional introduction of the 3-ketodihydrosphingosine reductase (TSC10) gene, more preferably one embodiment of the present invention
  • TSC10 3-ketodihydrosphingosine reductase
  • the ORF sequence of the TSC10 gene was introduced into the deleted LCB4 gene sequence.
  • the human DES1 (sphingoid delta 4-desaturase) gene is a gene involved in the synthetic pathway from human to dihydrosphingosine and sphingosine, and since the gene does not exist in yeast, it is derived from dihydrosphingosine produced in yeast. The gene can be introduced to induce synthesis into sphingosine.
  • a part of the gene sequence is changed through gene synthesis, so that the amino acid sequence is the same but the optimized sequence showing 89% nucleotide sequence identity (HuDES1 ) was prepared, and the optimized sequence was multiplexed into the genome of yeast using Tau transposon, but the method of increasing the expression efficiency of the human DES1 gene in the yeast is not limited to this.
  • the yeast mutant strain of the present invention is a mutant strain that redesigned the sphingolipid metabolic pathway using a strain of Saccharomyces cerevisiae wild type as a parent strain, more preferably BY4741 strain. If used, a strain having a sphingolipid metabolic pathway can be used as a parent strain without restriction on strain.
  • a high-yielding strain of sphingosine and a high-yielding strain of DHS-Ceramide were prepared through the above method, and the production of sphingosine and dehydrosphingosine from the high-yielding strain of sphingosine was produced.
  • As a result of measuring the yield by HPLC it was confirmed that about 6.6% of dihydrosphingosine and about 1.3% of sphingosine were extracted from the cells (see Example 4).
  • the present invention provides a method for producing the above sphingosine (sphingosine) high-producing yeast mutant strain Saccharomyces cerevisiae .
  • Saccharomyces cerevisiae Saccharomyces cerevisiae (Saccharomyces cerevisiae ) SUR2 (sphinganine C4-hydroxylase) gene, CHA1 (L-serine / L-threonine ammonia-lyase CHA1) gene and LCB4 (sphinganine kinase LCB4) gene, respectively Disrupting;
  • step (c) introducing the human DES1 (sphingoid delta 4-desaturase) gene into the strain prepared in step (b).
  • the present invention provides a method for producing the high-yeast mutant strain Saccharomyces cerevisiae , comprising the following steps: dihydrosphingosine-ceramide do.
  • the present inventors to prepare each mutant strain producing Sphingosine and Dihydrosphingosine-ceramide (DHS-ceramide) from Saccharomyces cerevisiae yeast strains , Metabolic pathways for ceramide production in yeast strains were redesigned with the strategies shown in FIGS. 1A and 1B, and the specific contents are as follows.
  • DHS Dehydrosphingosine
  • PHS phytosphingosine
  • DHS Dehydrosphingosine
  • PHS phytosphingosine
  • the present inventors used the BY4741 strain as a parent strain of yeast ( S. cerevisiae ), and first, guide RNA (gRNA) as follows to prepare a strain of the sur2 gene (SEQ ID NO: 1) having the base sequence of FIG. A production vector was constructed.
  • CTAGCTCTAAAACGCGCAACCAAGGCCAGCACA SEQ ID NO: 4
  • the sur2-hybridized oligonucleotide-S and sur2-hybridized oligonucleotide-AS prepared in the above step 2 were boiled at 100 ° C for 5 minutes and then slowly cooled to generate double-stranded sur2-hybridized oligonucleotide to the pML104 vector cut with SwaI and BclI. By inserting, pML104-sur2-oligo having the structure shown in FIG. 2B was produced.
  • the Sur2-90bp-mutated DNA-S and Sur2-90bp-mutated DNA-AS were boiled at 100 ° C for 5 minutes, and then slowly cooled to prepare a double-stranded Sur2-90bp-mutant oligonucleotide template and then Example 2-1.
  • the cells were transfected with the pML104-sur2-oligo vector prepared in -1 into the parent strain By4741 and cultured.
  • the strain contains the vector pML104-sur2-oligo with the URA gene
  • it is necessary to remove the vector so the vector from the strain obtained above
  • the pML104-sur2-oligo vector was removed by serially culturing the strain in YPD medium (Strain # 1: By4741 / sur2 ⁇ _strain # 3899).
  • the present inventors tried to delete the cha1 gene (SEQ ID NO: 10) having the nucleotide sequence of FIG. 3A additionally from the strain (By4741 / sur2 ⁇ ) in which the sur2 gene prepared in Example 2-1 was deleted.
  • a guide RNA (gRNA) production vector was prepared as follows, and the overall process was performed similarly to the method of Example 2-1.
  • cha1-hybridized oligonucleotide-S and cha1-hybridized oligonucleotide-AS prepared in the above step 2 were boiled at 100 ° C for 5 minutes and then slowly cooled to generate double-stranded cha1-hybridized oligonucleotide, and then into the pML104 vector cut with SwaI and BclI. By inserting, pML104-cha1-oligo having the structure shown in FIG. 3B was produced.
  • the cha1-90bp-mutated DNA-S and cha1-90bp-mutated DNA-AS were boiled at 100 ° C. for 5 minutes, and then slowly cooled to prepare a double-stranded cha1-90bp-mutant oligonucleotide template and then Example 2-2. It was transfected with the By4741 / sur2 ⁇ strain prepared in Example 2-1 with pML104-cha1-oligo prepared in -1 and then cultured.
  • the present inventors deleted the LCB4 gene composed of the nucleotide sequence of FIG. 4A (SEQ ID NO: 20) encoding the LCB degrading enzyme and was one of the basic LCB skeletons.
  • the TSC10 gene which encodes a protein for the synthesis of dihydrosphingosine (DHS).
  • DHS dihydrosphingosine
  • a guide RNA (gRNA) production vector was prepared as follows, and the overall process was similar to the method of Example 2-1 or 2-2.
  • lcb4-hybridized oligonucleotide-S and lcb4-hybridized oligonucleotide-AS prepared in the above step 2 were boiled at 100 ° C. for 5 minutes and then slowly cooled to generate double-stranded lcb4-hybridized oligonucleotide, and then transferred to the pML104 vector cut with SwaI and BclI. By inserting, pML104-lcb4-oligo having the structure shown in FIG. 4B was produced.
  • the lcb4-up fragment was obtained by PCR amplifying the lcb4-up fragment from genomic DNA of S. cerevisiae yeast using lcb4-up-S (SacII) and lcb4-up-AS (NotI), and then SacII, NotI of the pScDAL22 vector It was cloned into position to produce pScDAL22-lcb4-up.
  • DNA fragments obtained by amplifying in the same manner as above using lcb4-dn-S (XhoI) and lcb4-dn-AS (KpnI, SacII) were cut with KpnI, XhoI, and then the pScDAL22-lcb4-up prepared above.
  • the pScDAL22-lcb4-updn was produced by cloning at the KpnI and XhoI positions, and the final structure, pScDAL22-lcb4-updn, is as shown in FIG. 4C.
  • TSC10 linked to myc-tag was prepared.
  • TSC10 DNA sequence fragment (Tsc10 ORF (963bp), SEQ ID NO: 30) of FIG. 5A amplified from genomic DNA of yeast is BamHI / SalI.
  • pRS923-TSC10myc was prepared by cloning at the BamHI / XhoI site of the pRS923-myc vector.
  • TSC10 overexpression vector by cloning TSC10myc into a vector for lcb4 deletion, pRS923-TSC10myc prepared above was cut with BamHI and SalI to obtain a TSC10myc fragment to which TSC10 and myc-tag were bound, and then Cloning to the BamHI / SalI site of pScDAL22-LCB4-updn produced by pScDAL22-LCB4-updn-TSC10myc, a TSC10 overexpression vector, was obtained, and the structure is shown in FIG. 5B.
  • the pScDAL22-LCB4-updn-TSC10myc vector prepared above was cut with SacII to extract a DNA band of about 3.3 kb, and then the DNA and pML104-lcb4-oligo prepared in Example 2-3-1 were strain # 2 (By4741 / sur2 ⁇ , cha1 ⁇ ).
  • genomic DNA was obtained, and two identification oligos were prepared to confirm whether genomic DNA was transformed using PCR, followed by PCR.
  • the finally obtained mutant strain was continuously cultured in YPD medium to remove the pScDAL22-LCB4-updn-TSC10myc plasmid (Strain # 4: By4741 / sur2 ⁇ , cha1 ⁇ , lcb4 ⁇ : TSC10mycoe_strain # 3908).
  • the present inventors have optimized the human des1 gene base sequence (SEQ ID NO: 35) of FIG. 6A to the sequence of FIG. 6B (SEQ ID NO: 36) using gene synthesis so that the human DES1 gene (HsDES1) can be well expressed in yeast strains. It was named HuDES1.
  • the human DES1 (HsDES1) gene sequence and the synthesized HuDES1 sequence have the same amino acid sequence, but the DNA sequence shows 89% identity.
  • the present inventors obtained the amplification of tau-up fragments by PCR using the following Tau1sthalf-S (KpnI) and Tau1sthalf-AS (XhoI), and cloned them into KpnI and XhoI regions of the pScDAL28 vector to prepare pScDAL28-tau-up.
  • KpnI Tau1sthalf-S
  • XhoI Tau1sthalf-AS
  • pScDAL28-tau-updn was constructed by cloning fragments amplified by Tau2ndhalf-S (SacI) and Tau2ndhalf-AS (SacII) at the SacI and SacII regions of pScDAL28-tau-up, thereby constructing pScDAL28-tau-updn of the structure shown in FIG. 6C. .
  • Tau1sthalf-S gggggtacc-TGTTGGAACGAGAGTAATTAATAG (SEQ ID NO: 39)
  • Tau1sthalf-AS gggctcgag-CATAACATGTTCAACTAATAGGTC (SEQ ID NO: 40)
  • Tau2ndhalf-AS ggggagctc-TGTTGATAATTAGAGGTTAAAAATTAG (SEQ ID NO: 42)
  • the pScDAL28-tau-updn-Hudes1 of the structure shown in FIG. 6D was prepared by cloning the BamHI / SalI DNA fragment of -pHA-HuDES1 to the BamHI / SalI site of pScDAL28-tau-updn prepared above.
  • the present inventors in addition to the sphingosine-producing strain prepared in Example 2 (strain # 11), according to the method of Example 1-2, DHS-ceramide (dihydrosphingosine-ceramide) synthesis increased yeast strain In order to prepare, it was intended to block the YDC1 pathway in strain # 4 (By4741 / sur2 ⁇ , cha1 ⁇ , lcb4 ⁇ : TSC10mycoe) prepared in Examples 2-1 to 2-3.
  • a guide RNA (gRNA) production vector was prepared as follows in order to delete the ydc1 gene (SEQ ID NO: 43) having the sequence of FIG. 7A using gene scissors.
  • ydc1-hybridized oligonucleotide-S and ydc1-hybridized oligonucleotide-AS prepared in the above step 2 were boiled at 100 ° C for 5 minutes, slowly cooled to generate double-stranded ydc1-hybridized oligonucleotide, and then transferred to the pML104 vector cut with SwaI and BclI. By inserting, pML104-ydc1-oligo having the structure shown in FIG. 7B was produced.
  • the strain contains the vector pML104-ydc1-oligo having the URA gene
  • the pML104-ydc1-oligo vector was removed by serially culturing the strain in YPD medium (strain # 10: By4741 / sur2 ⁇ , cha1 ⁇ , lcb4 ⁇ : TSC10mycoe, ydc1 ⁇ strain_strain # 3939).
  • HPLC was performed by the following method to verify the sphingosine production yield of the sphingosine production strains (By4741 / sur2 ⁇ , cha1 ⁇ , lcb4 ⁇ : TSC10mycoe, tau: Hudes1oe) prepared in Example 2.
  • PHS phytosphingosine
  • DHS dihydrosphingosine
  • S sphingosine
  • ceramide having excellent skin affinity and function having the same structure as that present in human skin by producing sphingosine or a derivative thereof, which is a precursor of ceramide from traditional yeast ( S. cerevisiae ), This is expected to be useful in the field of product development and production for anti-aging, skin moisturizing, and regeneration of damaged skin.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Mycology (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 신규한 세라마이드 전구물질 생산용 효모 변이 균주 및 이의 제조방법에 관한 것으로, 보다 구체적으로는 인간 친화형 효모인 사카로마이세스 세레비지에(Saccharomyces cerevisiae)에서 세라마이드 생산을 위한 대사경로의 재설계를 통해 제조된 스핑고신 또는 디하이드로스핑고신-세라마이드의 고생산 효모 변이 균주, 상기 균주의 제조방법, 및 상기 균주를 이용한 스핑고신 또는 디하이드로스핑고신-세라마이드의 생산방법에 관한 것이다. 본 발명에 따르면 전통 효모(S. cerevisiae)에서 세라마이드의 전구물질인 스핑고신 또는 이의 유도물질을 대량 생산할 수 있고, 상기 효모는 기존 파이토스핑고신 제조에 이용되는 효모(P. ciferrii)에 비해 인간 친화적이며 사람을 비롯한 외래성 유전자를 효율적으로 발현하고 균주 개량이 용이한 장점이 있는바, 상기 효모로부터 인간 피부에 존재하는 것과 동일한 입체화학적 구조를 가지는 피부 친화성 및 기능이 우수한 세라마이드를 얻을 수 있다. 이에, 본 발명의 기술을 이용하여 전통 효모로부터 생산된 인간 친화적이며 화학합성을 거치지 않아 안전성이 높은 스핑고신 및 이의 유도물질은 생체 피부에 존재하는 다양한 세라마이드 생산으로의 응용 확대가 가능하여 노화방지, 보습, 손상된 피부의 재생 등을 위한 제품에 폭넓게 사용될 수 있을 것이다.

Description

세라마이드 전구물질 생산용 효모, 사카로마이세스 세레비지에 변이 균주 및 이의 제조방법
본 발명은 신규한 세라마이드 전구물질 생산용 효모 변이 균주 및 이의 제조방법에 관한 것으로, 보다 구체적으로는 인간 친화형 효모인 사카로마이세스 세레비지에(Saccharomyces cerevisiae)에서 세라마이드 생산을 위한 대사경로의 재설계를 통해 제조된 스핑고신 또는 디하이드로스핑고신-세라마이드의 고생산 효모 변이 균주, 상기 균주의 제조방법, 및 상기 균주를 이용한 스핑고신 또는 디하이드로스핑고신-세라마이드의 생산방법에 관한 것이다.
스핑고리피드(sphingolipid)는 지질의 일종으로서 거의 모든 생물의 세포막에 존재하는 것으로 알려져 있으며, 스핑고신(sphingosine), 스핑가닌(sphinganine) 또는 파이토스핑고신(phytosphingosine)을 기본 골격으로 하는 스핑고이드 베이스(sphingoid base)와 지방산, 헤드기(head group)을 포함하는 다양한 유도체를 총칭한다. 이 중 스핑고신이나 파이토스핑고신에 지방산이 아미드 결합(amide bond)으로 결합된 구조를 세라마이드(ceramide)라고 통칭하며 극성 헤드기에 결합된 물질에 따라, 스핑고마이엘린(sphingomyelin), 세레브로시드(cerebroside; CB), 강글리오시드(ganglioside)와 설파타이드(sulfatide) 등 다양한 화합물이 존재한다.
세라마이드는 피부장벽 지질의 약 40%를 차지하는 매우 중요한 지질로써 외부 자극으로부터 피부를 보호하고 피부에서 수분이 증발하는 것을 막아주는 피부보호막이며, 피부의 신속한 회복을 돕는 등 피부건강을 위한 핵심적인 기능을 담당하기 때문에 기초 화장품의 필수요소 중 하나로 손꼽힌다. 또한, 이러한 기능 이외에도 세라마이드는 콜레스테롤의 용해성에 기여하는 점, 생체막의 유동성을 줄여주는 점, 피부 세포 분화 및 성장에 영향을 미치는 점, 피부에서의 신호전달을 매개하는 등 다양한 역할을 수행한다고 알려져 있다. 피부에는 다양한 종류의 세라마이드가 존재하는데, 크게 sphingoid backbone과 여기에 결합된 지방산의 종류에 따라 구분되며 스핑고신에 중성지방산이 결합된 Ceramide NS(nonalcoholic spingosine-containing ceramide)와 파이토스핑고신에 중성지방산이 결합된 Ceramide NP(nonalcoholic phytospingosine-containing ceramide)가 가장 많이 존재하며 각 sphingoid backbone에 α-히드록시 지방산(α-hydroxy fatty acid)이 결합된 Ceramide AP, Ceramide AS, ω-히드록시세라마이드(ω-hydroxyceramide)에 리놀레산(linoleic acid)이 결합된 Ceramide EOP, Ceramide EOS가 주류를 이루고 있으며, 현재 상업적으로 판매가 되고 있는 세라마이드는 주로 Ceramide NP와 Ceramide NS이다.
종래 세라마이드는 두 가지 방법을 통해 제조되고 있는데, 하나는 소나 말의 뇌 조직으로부터 인간 친화적인 스핑고신 함유 세라마이드(sphingosine-containing ceramide)를 직접 추출하는 방법과 다른 하나는 비전통 효모인 Pichia ciferrii 배양 시 분비되는 파이토스핑고신(Phytosphingosine)에 지방산을 화학적으로 결합시켜 파이토스핑고신 함유 세라마이드(phytosphingosine-containing ceramide)를 얻는 방법이다(한국 등록특허 10-0267668). 고부가 가치 보습 화장품은 이 두 가지 세라마이드가 적당히 혼합된 것으로써 이중 스핑고신 함유 세라마이드를 얻는 방법은 광우병으로 인해 안전성에 문제가 제기되고 있다. 따라서 소나 말의 뇌 조직으로부터 추출하는 방법이 아닌 다른 방법으로 인간 친화적인 스핑고신 함유 세라마이드를 얻을 수 있다면 세라마이드 계통 화장품의 품질을 안전성 수준에서 한 단계 상승시킬 것이다.
한편, 스핑고신은 디하이드로스핑고신(dihydrosphingosine)으로부터 Δ4-desaturase에 의한 C4-C5의 이중결합 생성으로 만들어진다. 인간 친화형 효모(Saccharomyces cerevisiae)에서 인간 피부에 존재하는 것과 동일한 세라마이드를 얻을 수 있다면 최적이나, 상기 효모는 Δ4-desaturase가 존재하지 않아 스핑고신을 합성하지 못한다. 하지만 최근 발표된 연구 결과에 의하면 상기 효모 균주에 인간 Δ4-desaturase (hDES1) 유전자를 도입하여 세포 내에서 스핑고신이 만들어진다는 것을 보여주었다.
이에, 본 발명자들은 P. ciferrii 효모에서의 파이토스핑고신 대량생산처럼 S. cerevisiae에서도 대사공학적 변화를 적용하여 스핑고신을 대량생산할 수 있다는 가능성을 바탕으로 연구한 결과, 전통 효모인 S. cerevisiae에서 세라마이드 생산을 위한 대사경로의 재설계를 통해 스핑고신 및 디하이드로스핑고신-세라마이드를 대량생산할 수 있는 신규한 변이 균주를 제작하였다.
전술한 바와 같이, 본 발명자들은 상기 종래 문제점을 해결하기 위하여 인간 친화적인 전통 효모(S. cerevisiae)에서 대사공학적 기술을 이용해 스핑고지질(sphinglipid) 대사경로를 재설계하여 스핑고신 또는 디하이드로스핑고신-세라마이드를 대량생산할 수 있는 신규한 효모 변이 균주를 각각 제작하여 본 발명을 완성하였다.
이에, 본 발명은 인간 DES1(sphingoid delta 4-desaturase) 유전자가 도입되고, 디하이드로스핑고신(dihydrosphingosine) 합성이 강화되도록 형질전환된, 스핑고신(sphingosine) 고생산 효모 변이 균주 및 상기 효모 변이 균주의 제조방법을 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기 효모 변이 균주를 배양하는 단계를 포함하는 스핑고신 생산방법을 제공하는 것을 다른 목적으로 한다.
또한, 본 발명은 디하이드로스핑고신-세라마이드(dihydrosphingosine-ceramide) 합성이 강화되도록 형질전환된, 디하이드로스핑고신-세라마이드 고생산 효모 변이 균주 및 상기 균주의 제조방법을 제공하는 것을 또 다른 목적으로 한다.
또한, 본 발명은 상기 효모 변이 균주를 배양하는 단계를 포함하는 디하이드로스핑고신-세라마이드 생산방법을 제공하는 것을 또 다른 목적으로 한다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
상기와 같은 본 발명의 목적을 달성하기 위하여, 본 발명은 인간 DES1(sphingoid delta 4-desaturase) 유전자가 도입되고, 디하이드로스핑고신(dihydrosphingosine) 합성이 강화되도록 형질전환된, 스핑고신(sphingosine) 고생산 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae)를 제공한다.
또한, 본 발명은 상기 스핑고신 고생산 효모 변이 균주를 배양하는 단계를 포함하는, 스핑고신 생산방법을 제공한다.
본 발명의 일구현예로, 상기 디하이드로스핑고신 합성의 강화는 스핑고신 수산화효소(sphingosine hydroxylase), L-세린/L-트레오닌 암모니아 분해효소 CHA1(L-serine/L-threonine ammonia-lyase CHA1) 및 스핑가닌 인산화효소 LCB4(sphinganine kinase LCB4)의 불활성화, 및 3-케토디하이드로스핑고신 환원효소(3-ketodihydrosphingosine reductase)의 과발현에 의한 것일 수 있다.
본 발명의 다른 구현예로, 상기 불활성화는 SUR2(sphinganine C4-hydroxylase), CHA1(L-serine/L-threonine ammonia-lyase CHA1) 및 LCB4(sphinganine kinase LCB4) 유전자를 코딩하는 염기서열의 치환, 결실 또는 이들의 조합에 의한 것일 수 있다.
본 발명의 또 다른 구현예로, 상기 변이 균주는 사카로마이세스 세레비지에(Saccharomyces cerevisiae) BY4741 스트레인 유래일 수 있다.
본 발명의 또 다른 구현예로, 상기 인간 DES1 유전자는 타우 전이인자(Tau transposon)를 매개로 효모 유전체 내로 다중 삽입되는 것일 수 있다.
또한, 본 발명은 디하이드로스핑고신-세라마이드(dihydrosphingosine-ceramide) 합성이 강화되도록 형질전환된, 디하이드로스핑고신-세라마이드 고생산 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae)를 제공한다.
또한, 본 발명은 상기 디하이드로스핑고신-세라마이드 고생산 효모 변이 균주를 배양하는 단계를 포함하는, 디하이드로스핑고신-세라마이드 생산방법을 제공한다.
본 발명의 일구현예로, 상기 디하이드로스핑고신-세라마이드 합성의 강화는 스핑고신 수산화효소(sphingosine hydroxylase), L-세린/L-트레오닌 암모니아 분해효소 CHA1(L-serine/L-threonine ammonia-lyase CHA1), 스핑가닌 인산화효소 LCB4(sphinganine kinase LCB4) 및 알칼리성 디하이드로세라마이드 분해효소(alkaline dihydroceramidase)의 불활성화, 및 3-케토디하이드로스핑고신 환원효소(3-ketodihydrosphingosine reductase)의 과발현에 의한 것일 수 있다.
본 발명의 다른 구현예로, 상기 불활성화는 SUR2(sphinganine C4-hydroxylase), CHA1(L-serine/L-threonine ammonia-lyase CHA1), LCB4(sphinganine kinase LCB4) 및 YDC1(alkaline dihydroceramidase) 유전자를 코딩하는 염기서열의 치환, 결실 또는 이들의 조합에 의한 것일 수 있다.
본 발명의 또 다른 구현예로, 상기 효모 변이 균주는 사카로마이세스 세레비지에(Saccharomyces cerevisiae) BY4741 스트레인 유래일 수 있다.
또한, 본 발명은 하기 단계를 포함하는, 상기 스핑고신(sphingosine) 고생산 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae)의 제조방법을 제공한다.
(a) 사카로마이세스 세레비지에(Saccharomyces cerevisiae) 균주에서 SUR2(sphinganine C4-hydroxylase) 유전자, CHA1(L-serine/L-threonine ammonia-lyase CHA1) 유전자 및 LCB4(sphinganine kinase LCB4) 유전자를 각각 결손(disruption)시키는 단계;
(b) 상기 단계 (a)에서 제조된 균주에서 TSC10(3-ketodihydrosphingosine reductase) 유전자를 과발현시키는 단계; 및 (c) 상기 단계 (b)에서 제조된 균주에 인간 DES1(sphingoid delta 4-desaturase) 유전자를 도입하는 단계.
또한, 본 발명은 하기 단계를 포함하는, 디하이드로스핑고신-세라마이드(dihydrosphingosine-ceramide) 고생산 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae)의 제조방법을 제공한다.
(a) 사카로마이세스 세레비지에(Saccharomyces cerevisiae) 균주에서 SUR2(sphinganine C4-hydroxylase) 유전자, CHA1(L-serine/L-threonine ammonia-lyase CHA1) 유전자, LCB4(sphinganine kinase LCB4) 유전자 및 YDC1(alkaline dihydroceramidase) 유전자를 각각 결손(disruption)시키는 단계; 및
(b) 상기 단계 (a)에서 제조된 균주에서 TSC10(3-ketodihydrosphingosine reductase) 유전자를 과발현시키는 단계.
본 발명의 일구현예로, 상기 (a) 단계에서 유전자 결손은 각각의 해당 유전자를 코딩하는 염기서열의 치환, 결실 또는 이들의 조합에 의한 것일 수 있다.
본 발명의 다른 구현예로, 상기 (c) 단계에서 인간 DES1 유전자의 도입은 타우 전이인자(Tau transposon)를 매개로 다중 삽입되는 것일 수 있다.
본 발명에 따르면 전통 효모(S. cerevisiae)에서 세라마이드의 전구물질인 스핑고신 또는 이의 유도물질을 대량 생산할 수 있고, 상기 효모는 기존 파이토스핑고신 제조에 이용되는 효모(P. ciferrii)에 비해 인간 친화적이며 사람을 비롯한 외래성 유전자를 효율적으로 발현하고 균주 개량이 용이한 장점이 있는바, 상기 효모로부터 인간 피부에 존재하는 것과 동일한 입체화학적 구조를 가지는 피부 친화성 및 기능이 우수한 세라마이드를 얻을 수 있다.
이에, 본 발명의 기술을 이용하여 전통 효모로부터 생산된 인간 친화적이며 화학합성을 거치지 않아 안전성이 높은 스핑고신 및 이의 유도물질은 생체 피부에 존재하는 다양한 세라마이드 생산으로의 응용 확대가 가능하여 노화방지, 보습, 손상된 피부의 재생 등을 위한 제품에 폭넓게 사용될 수 있을 것이다.
도 1a는 스핑고신 고생산 효모 변이 균주에서의 재설계된 스핑고지질(sphingolipid) 대사 경로를 도시한 것이다.
도 1b는 디하이드로스핑고신-세라마이드 고생산 효모 변이 균주에서의 재설계된 스핑고지질(sphingolipid) 대사 경로를 도시한 것이다.
도 2a는 SUR2 유전자 염기서열을 도시한 것이다.
도 2b는 스핑고신 고생산 변이 균주 제작 과정으로 SUR2 유전자 결손 균주를 제조하기 위해 유전자 가위를 활용하기 위한 gRNA 생성 벡터인 pML104-sur2-oligo 유전자 지도를 나타낸 것이다.
도 3a는 CHA1 유전자의 염기서열을 도시한 것이다.
도 3b는 스핑고신 고생산 변이 균주 제작 과정으로 SUR2 유전자가 결손된 균주에서 CHA1 유전자를 결손시키기 위한 gRNA 생성 벡터인 pML104-cha1-oligo 유전자 지도이다.
도 3c는 조기 종결이 유도된 CHA1 유전자의 염기서열을 나타낸 것이다.
도 4a는 LCB4 유전자의 염기서열을 나타낸 것이다.
도 4b는 스핑고신 고생산 변이 균주 제작 과정으로 SUR2 및 CHA1 유전자가 결손된 균주에서 LCB4 유전자를 결손시키기 위한 gRNA 생성 벡터인 pML104-lcb4-oligo 유전자 지도이다.
도 4c는 LCB4 유전자 결손을 위한 pScDAL22-LCB4-updn 유전자 지도를 나타낸 것이다.
도 5a는 TSC10 유전자의 염기서열을 나타낸 것이다.
도 5b는 상기 LCB4 유전자가 결손된 부위에 TSC10 유전자를 삽입하기 위한 pScDAL22-LCB4-updn-TSC10myc 유전자 지도를 나타낸 것이다.
도 6a는 인간 DES1(HsDES1) 유전자의 염기서열을 나타낸 것이다.
도 6b는 효모에서의 발현률을 높이기 위해 인간 DES1 유전자의 서열을 최적화하여 합성된 HuDES1 유전자의 염기서열을 나타낸 것이다.
도 6c는 타우 트랜스포존 DNA 단편을 클로닝하여 제작한 pScDAL28-tau-updn 유전자 지도이다.
도 6d는 상기 도 6c의 벡터에 Hudes1 서열을 클로닝하여 제작한 pScDAL28-tau-updn-HuDES1 유전자 지도를 나타낸 것이다.
도 7a는 YDC1 유전자의 염기서열을 나타낸 것이다.
도 7b는 디하이드로스핑고신-세라마이드 고생산 변이 균주의 제작 과정으로 SUR2, CHA1, LCB4 유전자가 결손된 균주에서 YDC1 유전자를 결손시키기 위해 gRNA를 생성하는 pML104-ydc1-oligo 유전자 지도를 도시한 것이다.
도 7c는 조기 종결이 유도된 YDC1 유전자의 염기서열을 나타낸 것이다.
도 8a는 HPLC를 통해 균주 #11의 스핑고신 및 디하이드로스핑고신의 생산수율을 측정하기 위해, 파이토스핑고신(PHS), 디하이드로스핑고신(DHS), 스핑고신(S) 각각에 대한 LCBs(long chain bases) 표준 피크(standard peaks)의 retention time을 보여주는 결과이다.
도 8b는 균주 #11 샘플에서 추출된 지질에 대한 retention time을 측정한 결과이다.
본 발명자들은 인간 친화적인 전통 효모(S. cerevisiae)에서 대사공학적 기술을 이용해 스핑고지질(sphinglipid) 대사경로를 재설계하여 스핑고신 또는 디하이드로스핑고신-세라마이드를 대량생산할 수 있는 신규한 효모 변이 균주를 각각 제작하여 본 발명을 완성하였다.
이에, 본 발명은 인간 DES1(sphingoid delta 4-desaturase) 유전자가 도입되고, 디하이드로스핑고신(dihydrosphingosine) 합성이 강화되도록 형질전환된, 스핑고신(sphingosine) 고생산 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae)를 제공한다.
또한, 본 발명은 상기 스핑고신 고생산 효모 변이 균주를 배양하는 단계를 포함하는 스핑고신 생산방법을 제공한다.
또한, 본 발명은 디하이드로스핑고신-세라마이드(dihydrosphingosine-ceramide) 합성이 강화되도록 형질전환된, 디하이드로스핑고신-세라마이드 고생산 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae)를 제공한다.
또한, 본 발명은 상기 디하이드로스핑고신-세라마이드 고생산 효모 변이 균주를 배양하는 단계를 포함하는 디하이드로스핑고신-세라마이드 생산방법을 제공한다.
본 발명에 있어서 상기 스핑고지질 대사경로의 재설계는 상기 대사경로에 관여하는 일부 단백질을 불활성화, 과발현, 또는 유전자 도입에 의한 새로운 경로를 유도함으로써 이루어지는 것을 의미한다.
본 발명에서 사용되는 용어, “디하이드로스핑고신의 합성 강화” 또는 “디하이드로스핑고신-세라마이드의 합성 강화”는 효모 균주의 스핑고지질 대사경로에서 야생형 균주에 비해 디하이드로스핑고신 또는 디하이드로스핑고신-세라마이드가 합성되는 쪽으로 대사 경로가 집중되어 상기 단백질들이 높은 수준으로 생산되도록 하는 것을 의미하며, 이를 위해 야생형에서 일반적으로 일어나는 스핑고지질 대사 경로를 변화시킬 수 있다.
본 발명에 있어서, 디하이드로스핑고신 합성의 강화는 스핑고신 수산화효소(sphingosine hydroxylase), L-세린/L-트레오닌 암모니아 분해효소CHA1(L-serine/L-threonine ammonia-lyase CHA1) 및 스핑가닌 인산화효소 LCB4(sphinganine kinase LCB4)의 불활성화, 및 3-케토디하이드로스핑고신 환원효소(3-ketodihydrosphingosine reductase)의 과발현에 의해 유도되는 것일 수 있다.
또한 디하이드로스핑고신-세라마이드의 합성 강화는 스핑고신 수산화효소(sphingosine hydroxylase), L-세린/L-트레오닌 암모니아 분해효소 CHA1(L-serine/L-threonine ammonia-lyase CHA1), 스핑가닌 인산화효소 LCB4(sphinganine kinase LCB4) 및 알칼리성 디하이드로세라마이드 분해효소(alkaline dihydroceramidase)의 불활성화, 및 3-케토디하이드로스핑고신 환원효소(3-ketodihydrosphingosine reductase)의 과발현에 의해 유도되는 것일 수 있다.
본 발명에서 사용되는 용어, “불활성화”는 유전자를 코딩하는 뉴클레오타이드를 치환, 삽입, 결실 또는 이들의 조합에 의해 결손되도록 하여 단백질 발현을 억제시키는 것을 의미한다.
본원발명에 있어서, 스핑고신 수산화효소의 불활성화는 효모 균주의 SUR2(sphinganine C4-hydroxylase) 유전자 결손에 의해 유도되고, L-세린/L-트레오닌 암모니아 분해효소 CHA1의 불활성화는 CHA1(L-serine/L-threonine ammonia-lyase CHA1) 유전자의 결손에 의해 유도되며, 스핑가닌 인산화효소 LCB4의 불활성화는 LCB4(sphinganine kinase LCB4)의 결손에 의해 유도되고, 알칼리성 디하이드로세라마이드 분해효소의 불활성화는 YDC1(alkaline dihydroceramidase) 유전자의 결손에 의해 유도될 수 있다.
보다 바람직하게, 본원발명의 일실시예에서는 상기 각 유전자들을 결손시키기 위하여 유전자 가위(CRISPR-Cas 시스템) 기술을 이용해 각 유전자 내 표적 서열을 조기 종결 코돈을 포함하는 변이 서열로 치환함으로써 단백질로의 발현 억제를 유도하였다(실시예 2 및 3 참조).
본 발명에 있어서, 상기 3-케토디하이드로스핑고신 환원효소(3-ketodihydrosphingosine reductase)의 과발현은 TSC10(3-ketodihydrosphingosine reductase) 유전자의 추가적인 도입에 의해 이루어질 수 있으며, 보다 바람직하게 본 발명의 일실시예에서는 상기 TSC10 유전자의 ORF 서열을 상기 결손시킨 LCB4 유전자 서열 내에 도입하였다.
상기 인간 DES1(sphingoid delta 4-desaturase) 유전자는 인간에서 디하이드로스핑고신으로부터 스핑고신으로의 합성 경로에 관여하는 유전자이며, 효모에서는 상기 유전자가 존재하지 않으므로 효모에서 생산된 디하이드로스핑고신으로부터 스핑고신으로의 합성을 유도하기 위하여 상기 유전자를 도입할 수 있다.
본 발명의 일실시예에서는 상기 인간 DES1 유전자의 효모에서 발현 효율을 높이기 위하여, 유전자 합성을 통해 상기 유전자 서열 내 일부분을 변화시켜 아미노산 서열은 동일하나 89%의 염기서열 동일성을 나타내는 최적화된 서열(HuDES1)을 제작하였으며, 또한 상기 최적화된 서열을 타우 전이인자(Tau transposon)를 이용해 효모의 유전체 내로 다중 삽입되도록 하였으나, 상기 효모에서 인간 DES1 유전자의 발현 효율을 높일 수 있는 방법은 이것으로 제한되지 않는다.
본 발명의 효모 변이 균주는 사카로마이세스 세레비지에(Saccharomyces cerevisiae) 야생형(wild type)의 균주를 모균주로 하여 스핑고지질 대사 경로를 재설계한 변이 균주이며, 보다 바람직하게는 BY4741 스트레인을 이용하였으나 스핑고지질 대사 경로를 갖는 균주라면 스트레인에 제한 없이 모균주로 이용이 가능하다.
본 발명의 일실시예에서는 상기 방법을 통해 스핑고신 고생산 효모 변이 균주 및 DHS-세라마이드 고생산 효모 변이 균주를 제조하였으며, 상기 스핑고신 고생산 효모 변이 균주에서 스핑고신 및 디하이드로스핑고신의 생산 수율을 HPLC로 측정한 결과, 세포에서 약 6.6%의 디하이드로스핑고신 및 약 1.3%의 스핑고신이 추출된 것을 확인하였다(실시예 4 참조).
이에, 본 발명의 다른 양태로서, 본 발명은 하기 단계를 포함하는 상기 스핑고신(sphingosine) 고생산 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae)의 제조방법을 제공한다.
(a) 사카로마이세스 세레비지에(Saccharomyces cerevisiae) 균주에서 SUR2(sphinganine C4-hydroxylase) 유전자, CHA1(L-serine/L-threonine ammonia-lyase CHA1) 유전자 및 LCB4(sphinganine kinase LCB4) 유전자를 각각 결손(disruption)시키는 단계;
(b) 상기 단계 (a)에서 제조된 균주에서 TSC10(3-ketodihydrosphingosine reductase) 유전자를 과발현시키는 단계; 및
(c) 상기 단계 (b)에서 제조된 균주에 인간 DES1(sphingoid delta 4-desaturase) 유전자를 도입하는 단계.
본 발명의 또 다른 양태로서, 본 발명은 하기 단계를 포함하는 상기 디하이드로스핑고신-세라마이드(dihydrosphingosine-ceramide) 고생산 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae)의 제조방법을 제공한다.
(a) 사카로마이세스 세레비지에(Saccharomyces cerevisiae) 균주에서 SUR2(sphinganine C4-hydroxylase) 유전자, CHA1(L-serine/L-threonine ammonia-lyase CHA1) 유전자, LCB4(sphinganine kinase LCB4) 유전자 및 YDC1(alkaline dihydroceramidase) 유전자를 각각 결손(disruption)시키는 단계; 및
(b) 상기 단계 (a)에서 제조된 균주에서 TSC10(3-ketodihydrosphingosine reductase) 유전자를 과발현시키는 단계.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. 인간 친화형 세라마이드 전구물질을 생산하는 신규 효모 균주의 제조 전략
본 발명자들은 사카로마이세스 세레비지에(Saccharomyces cerevisiae) 효모 균주에서 스핑고신(sphingosine) 및 디하이드로스핑고신-세라마이드(Dihydrosphingosine-ceramide; DHS-ceramide)를 생산하는 각각의 변이 균주를 제조하기 위하여, 도 1a 및 도 1b에 도시된 바와 같은 전략으로 효모 균주에서 세라마이드 생산을 위한 대사경로를 재설계하였으며, 구체적인 내용은 하기에 나타낸 바와 같다.
1-1. 스핑고신 생산 균주 제조 전략
A. 유전자 결손(disruption)을 통한 단백질의 불활성화
1) 디하이드로스핑고신(Dihydrosphingosine; DHS)에서 파이토스핑고신(phytosphingosine; PHS)으로의 합성에 관련된 유전자인 SUR2(sphinganine C4-hydroxylase) 결손
2) 디하이드로스핑고신의 전구물질인 palmitoyl-CoA에서 피루브산(pyruvate) 생성 경로에 관련된 CHA1(L-serine/L-threonine ammonia-lyase CHA1) 유전자 결손
3) 디하이드로스핑고신에서 DHS-1-phosphate으로의 경로에 관여하는 LCB4(sphinganine kinase LCB4) 유전자 결손
B. 유전자 과발현(overexpression)
1) 디하이드로스핑고신의 상위 경로 물질인 3-케토디하이드로스핑고신(3-ketodihydrosphingosine)에서 디하이드로스핑고신으로 가는 경로에 관련된 유전자인 TSC10(3-ketodihydrosphingosine reductase)의 과발현
2) 효모에 존재하지 않는 스핑고신의 합성을 위하여 인간 DES1(sphingoid delta 4-desaturase) 유전자의 삽입을 통하여 디하이드로스핑고신에서 스핑고신으로의 합성 경로 확보
3) 타우 전이인자(Tau transposon)을 활용하여 상기 인간 DES1 유전자를 여러 카피로 삽입
1-2. DHS-세라마이드 생산 균주 제조 전략
A. 유전자 결손(disruption)을 통한 단백질의 불활성화
1) 디하이드로스핑고신(Dihydrosphingosine; DHS)에서 파이토스핑고신(phytosphingosine; PHS)으로의 합성에 관련된 유전자인 SUR2(sphinganine C4-hydroxylase) 결손
2) 디하이드로스핑고신의 전구물질인 palmitoyl-CoA에서 피루브산(pyruvate) 생성 경로에 관련된 CHA1(L-serine/L-threonine ammonia-lyase CHA1) 유전자 결손
3) 디하이드로스핑고신에서 DHS-1-phosphate으로의 경로에 관여하는 LCB4(sphinganine kinase LCB4) 유전자 결손
4) DHS-세라마이드에서 디하이드로스핑고신 경로 관련 유전자인 YDC1(alkaline dihydroceramidase) 결손
B. 유전자 과발현(overexpression)
1) 디하이드로스핑고신의 상위 경로 물질인 3-케토디하이드로스핑고신(3-ketodihydrosphingosine)에서 디하이드로스핑고신으로 가는 경로에 관련된 유전자인 TSC10(3-ketodihydrosphingosine reductase)의 과발현
실시예 2. 스핑고신 생산 균주 제작(균주 #11)
2-1. sur2(sphinganine C4-hydroxylase) 유전자 결손 균주 제작
2-1-1. 유전자 가위(CRISPR-Cas 시스템)를 활용하기 위한 gRNA 생성 벡터 제작
본 발명자들은 효모(S. cerevisiae) 모 균주로 BY4741 스트레인을 이용하였으며, 먼저 상기 균주에서 도 2a의 염기서열을 갖는 sur2 유전자 (서열번호 1) 결손 균주를 제작하기 위해 하기와 같이 Guide RNA(gRNA) 생성 벡터를 제작하였다.
① 선택된 gRNA 서열: TGTGCTGGCCTTGGTTGCGCCGG (서열번호 2)
② gRNA를 위한 올리고머(oligomer) 제작
- sur2-hybridized oligonucleotide-S:
GATCTGTGCTGGCCTTGGTTGCGCGTTTTAGAGCTAG (서열번호 3)
- sur2-hybridized oligonucleotide-AS:
CTAGCTCTAAAACGCGCAACCAAGGCCAGCACA (서열번호 4)
상기 ② 과정에서 제작한 sur2-hybridized oligonucleotide-S와 sur2-hybridized oligonucleotide-AS를 100℃ 에서 5분간 끓인 후 서서히 식혀 이중 가닥의 sur2-hybridized oligonucleotide가 생성되도록 한 후 SwaI과 BclI으로 절단된 pML104 벡터에 삽입하여 도 2b에 도시한 구조의 pML104-sur2-oligo를 제작하였다.
2-1-2. 조기 종결(early termination) 유도를 통한 sur2 결손 균주 제작
① 표적 올리고뉴클레오티드 주형 염기서열
- sur2-90bp-original DNA:
CCTTGCTGCCGGAAATGAGTGATGGTGTGCTGGCCTTGGTTGCGCCGGTTGTTGCCTACTGGGCGTTGTCTGGTATATTCCATGTAATAG (서열번호 5)
② 결손 균주 제작에 필요한 돌연변이 주형 염기서열
- sur2-90bp-mutated DNA-S:
CCTTGCTGCCGGAAATGAGTGATGGTGTGCTGGCCTTGGTTGCGTAGGTTGTTGCCTACTGGGCGTTGTCTGGTATATTCCATGTAATAG (서열번호 6)
- sur2-90bp-mutated DNA-AS:
CTATTACATGGAATATACCAGACAACGCCCAGTAGGCAACAACCTACGCAACCAAGGCCAGCACACCATCACTCATTTCCGGCAGCAAGG (서열번호 7)
상기 Sur2-90bp-mutated DNA-S와 Sur2-90bp-mutated DNA-AS를 100℃에서 5분간 끓인 후 서서히 식힘으로서 이중가닥의 Sur2-90bp-mutant 올리고뉴클레오티드 주형을 제작한 후 상기 실시예 2-1-1에서 제작한 pML104-sur2-oligo 벡터와 함께 모 균주인 By4741에 형질도입한 후 배양하였다.
다음으로 상기 방법에 따라 제조된 sur2 유전자 결손 균주를 스크리닝하기 위하여, SD(-URA) 플레이트에서 자란 2개의 콜로니를 SD(-URA) 액체 배지에서 배양한 다음 genomic DNA를 분리하고 genomic DNA의 변이 여부를 확인하기 위해 2개의 확인용 올리고를 제작한 후 PCR 수행 및 염기서열 분석을 실시하였다.
-확인용 올리고 서열
sur2-S-confirm: TAGTCCGAAGAGGGTGTATACG (서열번호 8)
sur2-AS-confirm: GAACGGGAGGTATGCAAAAGGG (서열번호 9)
서열분석 결과, 하기와 Sur2-mutated DNA 서열에서 볼 수 있는 바와 같이 상기 모 균주에 조기 종결이 일어나도록 제작한 변이서열이 도입되었으며, 그 결과 sur2 유전자가 결손 되었음을 확인하였다.
- Original seq:
CCTTGCTGCCGGAAATGAGTGATGGTGTGCTGGCCTTGGTTGCGCCGGTTGTTGCCTACTGGGCGTTGTCTGGTATATTCCATGTAATAG
- Sur2-mutated DNA:
CCTTGCTGCCGGAAATGAGTGATGGTGTGCTGGCCTTGGTTGCGTAGGTTGTTGCCTACTGGGCGTTGTCTGGTATATTCCATGTAATAG
한편, 상기 균주는 URA 유전자를 가지고 있는 벡터 pML104-sur2-oligo를 포함하고 있기 때문에 다음 실험에서 URA 유전자를 가진 pML104 벡터를 계속 사용하기 위해서는 이 벡터를 제거할 필요가 있으므로, 상기에서 얻어진 균주로부터 벡터를 제거하기 위해, 균주를 YPD 배지에서 연속 계대 배양함으로써 pML104-sur2-oligo 벡터를 제거하였다(균주 #1: By4741/sur2Δ_strain #3899).
2-2. sur2 유전자가 결손된 균주(By4741/sur2Δ)에서 cha1 유전자 결손 균주 제작
2-2-1. 유전자 가위를 활용하기 위한 gRNA 생성 벡터 제작
본 발명자들은 상기 실시예 2-1에서 제조한 sur2 유전자가 결손된 균주(By4741/sur2Δ)에서 추가적으로 도 3a의 염기서열을 갖는 cha1 유전자 (서열번호 10)를 결손 시키고자 하였다. 이를 위해, 하기와 같이 Guide RNA(gRNA) 생성 벡터를 제작하였으며, 전체적인 과정은 상기 실시예 2-1의 방법과 유사하게 진행되었다.
① 선택된 gRNA 서열: AATCAGGAACACCGGTGCCCAGG (서열번호 11)
② gRNA를 위한 올리고머(oligomer) 제작
-cha1-hybridized oligonucleotide-S:
GATCAATCAGGAACACCGGTGCCCGTTTTAGAGCTAG (서열번호 12)
-cha1-hybridized oligonucleotide-AS:
CTAGCTCTAAAACGGGCACCGGTGTTCCTGATT (서열번호 13)
상기 ② 과정에서 제작한 cha1-hybridized oligonucleotide-S와 cha1-hybridized oligonucleotide-AS를 100℃에서 5분간 끓인 후 서서히 식혀 이중 가닥의 cha1-hybridized oligonucleotide가 생성되도록 한 후 SwaI과 BclI으로 절단된 pML104 벡터에 삽입하여 도 3b에 도시한 구조의 pML104-cha1-oligo를 제작하였다.
2-2-2. 조기 종결 유도를 통한 cha1 결손 균주 제작
① 표적 올리고뉴클레오티드 주형 염기서열
-cha1-90bp-original DNA:
GACAAAGAAGAGAATGGTAGATAAAATCAGGAACACCGGTGCCCAGGTTATCGTGAGTGGTGCCTACTGGAAAGAAGCAGATACTTTTTT (서열번호 14)
② 결손 균주 제작에 필요한 돌연변이 주형 염기서열
-cha1-90bp-mutated DNA-S:
GACAAAGAAGAGAATGGTAGATAAAATCAGGAACACCGGTGCCTAAGTTATCGTGAGTGGTGCCTACTGGAAAGAAGCAGATACTTTTTT (서열번호 15)
-cha1-90bp-mutated DNA-AS:
AAAAAAGTATCTGCTTCTTTCCAGTAGGCACCACTCACGATAACTTAGGCACCGGTGTTCCTGATTTTATCTACCATTCTCTTCTTTGTC (서열번호 16)
상기 cha1-90bp-mutated DNA-S와 cha1-90bp-mutated DNA-AS를 100℃에서 5분간 끓인 후 서서히 식힘으로서 이중가닥의 cha1-90bp-mutant 올리고뉴클레오티드 주형을 제작한 후 상기 실시예 2-2-1에서 제작한 pML104-cha1-oligo와 함께 상기 실시예 2-1에서 제조한 By4741/sur2Δ 균주에 형질도입한 다음 배양하였다.
다음으로 상기 방법에 따라 제조된 cha1 유전자가 결손된 균주를 스크리닝하기 위하여, SD(-URA) 플레이트에서 자란 7개의 콜로니를 SD(-URA) 액체 배지에서 배양한 다음 genomic DNA를 분리하고 genomic DNA의 변이 여부를 확인하기 위해 2개의 확인용 올리고를 제작한 후 PCR 수행 및 염기서열 분석을 실시하였다.
-확인용 올리고 서열
cha1-S-confirm: TGCTGGATAGACAAGAGACAGGA (서열번호 17)
cha1-AS-confirm(New): GTATTAGAGGAGCCGCCACAAG (서열번호 18)
서열분석 결과, 5개의 콜로니에서 조기 종결이 일어나도록 제작한 변이서열이 도입되되어 cha1 유전자가 결손된 균주를 확인하였으며, cha1 유전자의 표적 서열에 조기종결 코돈이 삽입된 cha1 염기서열은 도 3c에 나타내었다(서열번호 19). 또한, 최종 변이 균주에서 pML104-cha1-oligo 벡터를 제거하여 다음 스크리닝 과정에 이용하였다(균주 #2: By4741/sur2Δ, cha1Δ_strain #3911).
2-3. sur2 및 cha1 유전자가 결손된 균주(By4741/sur2Δ, cha1Δ)에서 TSC10 과발현을 통한 lcb4 유전자 결손 균주 제작
2-3-1. 유전자 가위를 활용하기 위한 gRNA 생성 벡터 제작
본 발명자들은 더 많은 양의 세라마이드 또는 세라마이드 전구체를 생산할 수 있는 균주를 개발하기 위하여, LCB 분해 효소를 인코딩하는 도 4a의 염기서열 (서열번호 20)로 구성된 LCB4 유전자를 결손 시키고 기본 LCB 골격 중 하나인 DHS (dihydrosphingosine)의 합성을 위한 단백질을 인코딩하는 TSC10 유전자를 과발현시키고자 하였다. 이를 위해, 상기 실시예 2-1 및 2-2를 통해 제작한 균주 #2(By4741/sur2Δ, cha1Δ)의 lcb4 유전자 자리에 TSC10 유전자를 삽입하고 그 결과를 검증하고자 하였다.
이를 위해, 먼저 하기와 같이 Guide RNA(gRNA) 생성 벡터를 제작하였으며, 전체적인 과정은 상기 실시예 2-1 또는 2-2의 방법과 유사하게 진행되었다.
① 선택된 gRNA 서열: TCATAGTTTGAGCAATGATAAGG (서열번호 21)
② gRNA를 위한 올리고머(oligomer) 제작
- lcb4-hybridized oligonucleotide-S:
GATCTCATAGTTTGAGCAATGATAGTTTTAGAGCTAG (서열번호 22)
- lcb4-hybridized oligonucleotide-AS:
CTAGCTCTAAAACTATCATTGCTCAAACTATGA (서열번호 23)
상기 ② 과정에서 제작한 lcb4-hybridized oligonucleotide-S과 lcb4-hybridized oligonucleotide-AS를 100℃에서 5분간 끓인 후 서서히 식혀 이중 가닥의 lcb4-hybridized oligonucleotide가 생성되도록 한 후 SwaI과 BclI으로 절단된 pML104 벡터에 삽입하여 도 4b에 도시한 구조의 pML104-lcb4-oligo를 제작하였다.
2-3-2. lcb4 결손을 유도하면서 TSC10 유전자 삽입을 통한 TSC10 동시 과발현 균주 제작
① lcb 유전자 결손을 위한 pScDAL22-lcb4-updn 제조
-lcb4-up (352 bp):
CTTAGGGCTATCTTGACCGATGAAGGTGTATTGATCAAATCGCAATCACACCATATGTTCAATAAGCATGGTCAACTCAGAAGCGGAGATTCTTTATCCTTGTTGAGCTGCTTGTCCTGTCTGGATGATGGAACTTTGAGCTCTGATGGAGGTTCTTTTGATGAGGATGATTCCCTGGAACTGTTGCCTCTTAATACTACCATTCCGTTCAACAGAATTTTGAACGCAAAATATGTGAATGTCGGTCAGAAAGGCTTCAATAATGGCAAAATTTCTTCGAATCCTTTTCAAACGGAAAATCTGAGTTCTTCGTCTGAAAATGACGACGTTGAGAATCATAGTTTGAGCAATG (서열번호 24)
<PCR에 사용된 올리고머>
lcb4-up-S(SacII): agtccgcggCTTAGGGCTATCTTGACCGATG (서열번호 25)
lcb4-up-AS(NotI): agtgcggccgcCATTGCTCAAACTATGATTCTCAAC (서열번호 26)
-lcb4-dn (394 bp):
CTCCTGTAAGCGAATCACAGTCATTTCCCAAAAAAGACAAGTGGGATACAAAAACGAACACTGTGAAGGTGTCTCCCGATGATTCACAGGATAACTCACCATCTTTAGGGATAAAAGATAATCAACAGTTAATTGAGTTAACTTTTGCTGTACCCAAGGGCCATGATGTTATACCACAAAAATTAACCTTGTTAATAGATCACGTTTCTAGGAAATCGAGAGCAAATACCGGAGAGGAGAACATTTCTTCTGGTACTGTGGAAGAAATCCTGGAAAAAAGTTATGAAAATTCCAAGAGAAACAGATCGATATTAGTCATTATTAATCCCCACGGTGGTAAAGGTACTGCTAAAAATTTATTCCTGACAAAAGCAAGGCCAATACTAGTGGAAAG (서열번호 27)
<PCR에 사용된 올리고머>
lcb4-dn-S(XhoI): atcctcgagCTCCTGTAAGCGAATCACAGTC (서열번호 28)
lcb4-dn-AS(KpnI, SacII): atcggtaccgcggCTTTCCACTAGTATTGGCCTTGC (서열번호 29)
구체적으로, lcb4-up-S(SacII)과 lcb4-up-AS(NotI)를 이용하여 S. cerevisiae 효모의 genomic DNA로부터 상기 lcb4-up 단편을 PCR로 증폭시켜 얻은 후, pScDAL22 벡터의 SacII, NotI 위치에 클로닝하여 pScDAL22-lcb4-up을 제작하였다.
또한 lcb4-dn-S(XhoI)와 lcb4-dn-AS(KpnI, SacII)를 이용해 상기와 동일한 방법으로 증폭시켜 얻은 DNA 조각을 KpnI, XhoI으로 절단한 후, 상기에서 제작한 pScDAL22-lcb4-up의 KpnI, XhoI 위치에 클로닝하여 pScDAL22-lcb4-updn을 제작하였으며, 최종 구조체인 pScDAL22-lcb4-updn는 도 4c에 도시한 바와 같다.
② lcb4 유전자 결손 부위에 TSC10 유전자의 삽입을 위한 pScDAL22-lcb4-updn-TSC10myc 제조
먼저, TSC10 유전자의 발현 여부를 쉽게 확인하기 위하여 TSC10의 종결 코돈을 제거하고 myc-tag가 연결된 TSC10을 제조하였다. 구체적으로, 하기 ScTSC10-S(BamHI)와 ScTSC10-AS(SalI)를 이용하여 효모의 genomic DNA로부터 증폭된 도 5a의 TSC10 DNA 서열조각(Tsc10 ORF (963bp), 서열번호 30)을 BamHI/SalI으로 절단한 후 pRS923-myc 벡터의 BamHI/XhoI 자리에 클로닝 하여 pRS923-TSC10myc을 제조하였다.
<TSC10 증폭에 사용된 올리고머>
-ScTSC10-S(BamHI)
: ataggatccATGAAGTTTACGTTAGAAGACCAAG (서열번호 31)
-ScTSC10-AS(SalI)
: agcgtcgacGTTGGCCTTCTTGCCGTCATTTTC (서열번호 32)
다음으로, lcb4 결손을 위한 벡터에 TSC10myc을 클로닝하여 TSC10 과발현 벡터를 제조하기 위해, 상기에서 제조한 pRS923-TSC10myc을 BamHI, SalI으로 절단하여 TSC10과 myc-tag가 결합되어 있는 TSC10myc 단편을 얻은 후 상기에서 제작한 pScDAL22-LCB4-updn의 BamHI/SalI 자리에 클로닝하여 TSC10 과발현 벡터인 pScDAL22-LCB4-updn-TSC10myc을 얻었으며, 구조를 도 5b에 나타내었다.
③ 균주 #2(By4741/sur2Δ, cha1Δ)의 lcb4 좌위에 TSC10이 삽입된 균주 제작
상기에서 제조한 pScDAL22-LCB4-updn-TSC10myc 벡터를 SacII로 절단하여 약 3.3kb DNA band를 추출한 다음, 상기 DNA와 실시예 2-3-1에서 제작한 pML104-lcb4-oligo를 균주 #2 (By4741/sur2Δ, cha1Δ)에 형질도입하였다. 다음으로 배양된 3개의 콜로니를 SD(-URA) 액체 배지에서 배양한 후 genomic DNA를 얻고 PCR을 이용하여 genomic DNA의 변이 여부를 확인하기 위해 2개의 확인용 올리고를 제작한 후 PCR 수행하였다.
-확인용 올리고 서열
Confirm oligo-S: AGTACGCGAAGAATCTACTATAGA (서열번호 33)
Confirm oligo-AS: GTGTATGCAATTTCTATTTTGCAGC (서열번호 34)
그 결과, 3.3 kb의 예상 단편을 얻었고 이를 pCR2.1-TOPO 벡터에 클로닝한 후 DNA 염기서열을 분석한 결과 lcb4에는 결손이 생성되고 TSC10은 과발현되는 것을 확인하였다. 이에, 최종적으로 얻은 변이 균주를 YPD 배지에서 연속 배양하여 pScDAL22-LCB4-updn-TSC10myc 플라스미드를 제거하였다(균주 #4: By4741/sur2Δ, cha1Δ, lcb4Δ:TSC10mycoe_strain #3908).
2-4. 균주(By4741/sur2Δ, cha1Δ, lcb4Δ:TSC10mycoe)에서 Hudes1 과발현을 통한 스핑고신 생산 균주 제작
2-4-1. HuDES1 제작
본 발명자들은 인간 DES1 유전자(HsDES1)가 효모 균주에서 잘 발현 될 수 있도록 유전자 합성을 이용해 도 6a의 인간 des1 유전자 염기서열 (서열번호 35)을 도 6b의 서열 (서열번호 36)로 최적화 하였으며, 이를 HuDES1이라 명명하였다. 인간 DES1(HsDES1) 유전자 염기서열과 합성된 HuDES1 염기서열은 아미노산 서열은 동일하나 DNA 염기서열은 89%의 동일성을 나타낸다.
2-4-2. HuDES1의 다중 삽입을 통한 과발현 유도
① pScDAL28-tau-updn 제조
본 발명자들은 하기 Tau1sthalf-S(KpnI)과 Tau1sthalf-AS(XhoI)를 이용하여 tau-up 단편을 PCR로 증폭시켜 얻은 후 pScDAL28 벡터의 KpnI, XhoI 부위에 클로닝하여 pScDAL28-tau-up을 제조하였다. 다음으로, pScDAL28-tau-up의 SacI, SacII 부위에 Tau2ndhalf-S(SacI)와 Tau2ndhalf-AS(SacII)에 의해 증폭된 단편을 클로닝 함으로서 도 6c에 도시된 구조의 pScDAL28-tau-updn을 제작하였다.
-Tau-up:
TGTTGGAACGAGAGTAATTAATAGTGACATGAGTTGCTATGGTAACAATCTAATGCTTACATCGTATATTAATGTACAACTCGTATACGTTTAAGTGTGATTGCGCCTATTGCAGAAGGAATGTTAAACGAGAAGCTCAGACAATACTGAAGCTGTGTTAAAGACCTATTAGTTGAACATGTTATG (서열번호 37)
-Tau-dn:
GTAGGTACATATATGAGGAATATGAGTCGTCACATCAATGTATAGTAACTACCGGAATCACTATTATATTGGTCATAATTAATATGACCAATCGGCGTGTGTTTTATATACCTCTCTTATTTAGTATAAGAAGATCAGTACTCACTTCTTCATTAATACTAATTTTTAACCTCTAATTATCAACA (서열번호 38)
<Tau PCR 증폭에 사용된 올리고머>
Tau1sthalf-S: gggggtacc-TGTTGGAACGAGAGTAATTAATAG (서열번호 39)
Tau1sthalf-AS: gggctcgag-CATAACATGTTCAACTAATAGGTC (서열번호 40)
Tau2ndhalf-S: gggccgcgg-GTAGGTACATATATGAGGAATATG (서열번호 41)
Tau2ndhalf-AS: ggggagctc-TGTTGATAATTAGAGGTTAAAAATTAG (서열번호 42)
② pScDAL28-tau-updn-Hudes1 제조
-pHA-HuDES1의 BamHI/SalI DNA 조각을 상기에서 제조한 pScDAL28-tau-updn의 BamHI/SalI 자리에 클로닝하여 도 6d에 도시한 구조의 pScDAL28-tau-updn-Hudes1을 제조하였다.
다음으로, 상기 제조한 pScDAL28-tau-updn-Hudes1 벡터에서 KpnI 및 SacI로 절단한 조각을 상기 실시예 2-3에서 제작한 균주 #4(By4741/sur2Δ, cha1Δ, lcb4Δ:TSC10mycoe)에 도입한 후, 균주를 SD(-URA) 플레이트에서 배양하였다. 이후 배양된 20개의 콜로니에서 단백질을 얻은 후 western blot을 통하여 3개의 예비후보를 선택하였고 HPLC를 통하여 생산된 스핑고신 함량을 측정함으로써 다량의 스핑고신을 발현하는 최종11번 균주를 얻었다(균주 #11: By4741/sur2Δ, cha1Δ, lcb4Δ:TSC10mycoe, tau:Hudes1oe_strain #3943).
실시예 3. DHS-세라마이드 생산 균주 제작(균주 #10)
3-1. 균주 #4(By4741/sur2Δ, cha1Δ, lcb4Δ:TSC10mycoe)에서 ydc1 유전자 결손 균주 제작
본 발명자들은 실시예 2에서 제작한 스핑고신 생성 균주(균주 #11)에 더하여, 상기 실시예 1-2의 방법에 따라 DHS-세라마이드(디하이드로스핑고신-세라마이드) 합성이 증가된 효모 균주를 제작하기 위하여, 상기 실시예 2-1 내지 2-3에서 제조한 균주 #4(By4741/sur2Δ, cha1Δ, lcb4Δ:TSC10mycoe)에서 YDC1 경로를 차단하고자 하였다.
3-1-1. 유전자 가위를 활용하기 위한 gRNA 생성 벡터 제작
이를 위해, 먼저 유전자 가위를 활용하여 도 7a의 서열을 갖는 ydc1 유전자 (서열번호 43)를 결손시키기 위해 먼저 하기와 같이 Guide RNA(gRNA) 생성 벡터를 제작하였다.
① 선택된 gRNA 서열: GGAATGGGGTTCTCGCTGGTTGG (서열번호 44)
② gRNA를 위한 올리고머(oligomer) 제작
-ydc1-hybridized oligonucleotide-S:
GATCGGAATGGGGTTCTCGCTGGTGTTTTAGAGCTAG (서열번호 45)
-ydc1-hybridized oligonucleotide-AS:
CTAGCTCTAAAACACCAGCGAGAACCCCATTCC (서열번호 46)
상기 ② 과정에서 제작한 ydc1-hybridized oligonucleotide-S와 ydc1-hybridized oligonucleotide-AS를 100℃에서 5분간 끓인 후 서서히 식혀 이중 가닥의 ydc1-hybridized oligonucleotide가 생성되도록 한 후 SwaI과 BclI으로 절단된 pML104 벡터에 삽입하여 도 7b에 도시한 구조의 pML104-ydc1-oligo를 제작하였다.
3-1-2. 조기 종결 유도를 통한 ydc1 결손 균주 제작
① 표적 올리고뉴클레오티드 주형 염기서열
-ydc1-91bp-original DNA:
TAGAAACAAGGTATATATTGATAGGAATGGGGTTCTCGCTGGTTGGTATTGGTTCGTGGTTATTTCATATGACTTTACAGTATCGTTATCA (서열번호 47)
② 결손 균주 제작에 필요한 돌연변이 주형 염기서열
-ydc1-90bp-mutated DNA-S:
TAGAAACAAGGTATATATTGATAGGAATGGGGTTCTCGCTGGTTTGATTGGTTCGTGGTTATTTCATATGACTTTACAGTATCGTTATCA (서열번호 48)
-ydc1-90bp-mutated DNA-AS:
TGATAACGATACTGTAAAGTCATATGAAATAACCACGAACCAATCAAACCAGCGAGAACCCCATTCCTATCAATATATACCTTGTTTCTA (서열번호 49)
상기 ydc1-90bp-mutated DNA-S와 ydc1-90bp-mutated DNA-AS를 100℃에서 5분간 끓인 후 서서히 식힘으로써 이중가닥의 ydc1-90bp-mutant 올리고뉴클레오티드 주형을 제작한 후 상기 pML104-ydc1-oligo와 함께 균주 #4에 형질도입하였다.
다음으로 상기 방법에 따라 제조한 ydc1 유전자가 결손된 균주를 스크리닝하기 위하여, SD(-URA) 플레이트에서 자란 2개의 콜로니를 SD(-URA) 액체 배지에서 배양한 후 genomic DNA를 얻고 PCR을 이용하여 genomic DNA의 변이 여부를 확인하기 위해 2개의 확인을 위한 올리고를 제작한 후 PCR 수행 및 염기서열 분석을 실시하였다.
<확인용 올리고 서열>
-ydc1-S-Confirm: GCTGTTCAGCTGGCCTTATCC (서열번호 50)
-ydc1-AS-Confirm: GAAAGAACCACAACTAGAAGCG (서열번호 51)
서열분석 결과, 도 7c의 염기서열과 같이 상기 균주 #4에 조기 종결이 일어나도록 제작한 변이서열이 도입되었으며(서열번호 52), 그 결과 ydc1 유전자가 결손 되었음을 확인하였다.
한편, 상기 균주는 URA 유전자를 가지고 있는 벡터 pML104-ydc1-oligo를 포함하고 있기 때문에 균주로부터 상기 벡터를 제거하기 위해, 균주를 YPD 배지에서 연속 계대 배양함으로써 pML104-ydc1-oligo 벡터를 제거하였다(균주 #10: By4741/sur2Δ, cha1Δ, lcb4Δ:TSC10mycoe, ydc1Δ 균주_strain #3939).
실시예 4. 스핑고신 생산 균주(균주 #11)의 스핑고신 생산 수율 검증
상기 실시예 2에서 제작한 스핑고신 생산 균주(By4741/sur2Δ, cha1Δ, lcb4Δ:TSC10mycoe, tau:Hudes1oe)의 스핑고신 생산 수율을 검증하기 위하여 하기와 같은 방법으로 HPLC를 실시하였다.
먼저 도 8a에 나타낸 바와 같이 파이토스핑고신(Phytosphingosine; PHS), 디하이드로스핑고신(Dihydrosphingosine; DHS), 스핑고신(Sphingosine; S) 단일 물질을 이용해 각각 200 ppm 농도로 표준(Standard)을 만들어 retention time에 나오는 피크를 확인하였다.
다음으로, 균주 #11 샘플을 제조한 후 동일한 retention time에 나오는 디하이드로스핑고신(DHS) 및 스핑고신(S) 피크를 확인하였으며 결과를 도 8b에 나타내었다. 또한, 상기에서 얻은 피크 값을 통해 균주 #11에서 생산된 디하이드로스핑고신(DHS) 및 스핑고신(S)의 수율을 계산하고자 하였다.
4-1. 디하이드로스핑고신(DHS) 생산 수율 측정
표준과 비교하여, 200 ppm : 1348 area = x : 8938.8 area
∴ x = 1326.23 ppm
상기 계산을 통해 샘플을 10 ul 주입한 값이 1326.23 ppm이므로 샘플(600 ul)에 포함된 총 디하이드로스핑고신의 양은 79573.8 ppm임을 알 수 있었다(79573.8 ppm = 79.5738 mg/g).
나아가 약 1200 mg(=1.2 g)의 wet 효모 세포에서 지질을 추출 하였으므로, 결국 66.31 mg DHS/g cells로 계산되는바 세포에서 약 6.6%의 DHS가 추출된 것임을 알 수 있었다.
또한, 70 ml의 배양배지에서 1.2 g의 세포를 회수하였으므로, 1 L의 배지에서는 17.14 g의 세포를 회수할 수 있는바, 총 1L의 배지에서 회수된 세포로부터 1136.55 ppm의 디하이드로스핑고신을 얻을 수 있음을 확인하였다((66.31 mg DHS/g cells)*(17.14 g cells/1 L) = 1136.55 mg DHS/L).
4-2. 스핑고신(S) 생산 수율 측정
표준과 비교하여, 200 ppm : 1772.7 area = x : 2292 area
∴ x = 258.59 ppm
상기 계산을 통해 샘플을 10 ul 주입한 값이 258.59 ppm이므로 샘플(600 ul)에 포함된 총 디하이드로스핑고신의 양은 15515.4 ppm임을 알 수 있었다(79573.8 ppm = 15.5154 mg/g).
나아가 약 1200 mg(=1.2 g)의 wet 효모 세포에서 지질을 추출 하였으므로, 결국 12.93 mg S/g cells로 계산되는바 세포에서 약 1.3%의 스핑고신이 추출된 것임을 알 수 있었다.
또한, 70 ml의 배양배지에서 1.2 g의 세포를 회수하였으므로, 1 L의 배지에서는 17.14 g의 세포를 회수할 수 있는바, 총 1L의 배지에서 회수된 세포로부터 221.62 ppm의 스핑고신을 얻을 수 있다((12.93 mg S/g cells)*(17.14 g cells/1 L) = 221.62 mg S/L).
상기 진술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명에 따르면 전통 효모(S. cerevisiae)로부터 세라마이드의 전구물질인 스핑고신 또는 이의 유도물질을 생산함으로써 인간 피부에 존재하는 것과 동일한 구조를 갖는 피부 친화성 및 기능이 우수한 세라마이드를 얻을 수 있는바, 이는 노화방지, 피부 보습, 손상된 피부의 재생 등을 위한 제품 개발 및 생산 분야에서 유용하게 이용될 수 있을 것으로 기대된다.

Claims (15)

  1. 인간 DES1(sphingoid delta 4-desaturase) 유전자가 도입되고, 디하이드로스핑고신(dihydrosphingosine) 합성이 강화되도록 형질전환된, 스핑고신(sphingosine) 고생산 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae).
  2. 제1항에 있어서,
    상기 디하이드로스핑고신 합성의 강화는 스핑고신 수산화효소(sphingosine hydroxylase), L-세린/L-트레오닌 암모니아 분해효소 CHA1(L-serine/L-threonine ammonia-lyase CHA1) 및 스핑가닌 인산화효소 LCB4(sphinganine kinase LCB4)의 불활성화, 및 3-케토디하이드로스핑고신 환원효소(3-ketodihydrosphingosine reductase)의 과발현에 의한 것임을 특징으로 하는, 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae).
  3. 제2항에 있어서,
    상기 불활성화는 SUR2(sphinganine C4-hydroxylase), CHA1(L-serine/L-threonine ammonia-lyase CHA1) 및 LCB4(sphinganine kinase LCB4) 유전자를 코딩하는 염기서열의 치환, 결실 또는 이들의 조합에 의한 것을 특징으로 하는, 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae).
  4. 제1항에 있어서,
    상기 변이 균주는 사카로마이세스 세레비지에(Saccharomyces cerevisiae) BY4741 스트레인 유래인 것을 특징으로 하는, 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae).
  5. 제1항에 있어서,
    상기 인간 DES1 유전자는 타우 전이인자(Tau transposon)를 매개로 효모 유전체 내로 다중 삽입되는 것을 특징으로 하는, 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae).
  6. 디하이드로스핑고신-세라마이드(dihydrosphingosine-ceramide) 합성이 강화되도록 형질전환된, 디하이드로스핑고신-세라마이드 고생산 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae).
  7. 제6항에 있어서,
    상기 디하이드로스핑고신-세라마이드 합성의 강화는 스핑고신 수산화효소(sphingosine hydroxylase), L-세린/L-트레오닌 암모니아 분해효소 CHA1(L-serine/L-threonine ammonia-lyase CHA1), 스핑가닌 인산화효소 LCB4(sphinganine kinase LCB4) 및 알칼리성 디하이드로세라마이드 분해효소(alkaline dihydroceramidase)의 불활성화, 및 3-케토디하이드로스핑고신 환원효소(3-ketodihydrosphingosine reductase)의 과발현에 의한 것임을 특징으로 하는, 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae).
  8. 제7항에 있어서,
    상기 불활성화는 SUR2(sphinganine C4-hydroxylase), CHA1(L-serine/L-threonine ammonia-lyase CHA1), LCB4(sphinganine kinase LCB4) 및 YDC1(alkaline dihydroceramidase) 유전자를 코딩하는 염기서열의 치환, 결실 또는 이들의 조합에 의한 것을 특징으로 하는, 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae).
  9. 제6항에 있어서,
    상기 변이 균주는 사카로마이세스 세레비지에(Saccharomyces cerevisiae) BY4741 스트레인 유래인 것을 특징으로 하는, 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae).
  10. 하기 단계를 포함하는, 제1항의 스핑고신(sphingosine) 고생산 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae)의 제조방법:
    (a) 사카로마이세스 세레비지에(Saccharomyces cerevisiae) 균주에서 SUR2(sphinganine C4-hydroxylase) 유전자, CHA1(L-serine/L-threonine ammonia-lyase CHA1) 유전자 및 LCB4(sphinganine kinase LCB4) 유전자를 각각 결손(disruption)시키는 단계;
    (b) 상기 단계 (a)에서 제조된 균주에서 TSC10(3-ketodihydrosphingosine reductase) 유전자를 과발현시키는 단계; 및
    (c) 상기 단계 (b)에서 제조된 균주에 인간 DES1(sphingoid delta 4-desaturase) 유전자를 도입하는 단계.
  11. 하기 단계를 포함하는, 제6항의 디하이드로스핑고신-세라마이드(dihydrosphingosine-ceramide) 고생산 효모 변이 균주 사카로마이세스 세레비지에(Saccharomyces cerevisiae)의 제조방법:
    (a) 사카로마이세스 세레비지에(Saccharomyces cerevisiae) 균주에서 SUR2(sphinganine C4-hydroxylase) 유전자, CHA1(L-serine/L-threonine ammonia-lyase CHA1) 유전자, LCB4(sphinganine kinase LCB4) 유전자 및 YDC1(alkaline dihydroceramidase) 유전자를 각각 결손(disruption)시키는 단계; 및
    (b) 상기 단계 (a)에서 제조된 균주에서 TSC10(3-ketodihydrosphingosine reductase) 유전자를 과발현시키는 단계.
  12. 제10항 또는 제11항에 있어서,
    상기 (a) 단계에서 유전자 결손은 각각의 해당 유전자를 코딩하는 염기서열의 치환, 결실 또는 이들의 조합에 의한 것을 특징으로 하는, 제조방법.
  13. 제10항에 있어서,
    상기 (c) 단계에서 인간 DES1 유전자의 도입은 타우 전이인자(Tau transposon)를 매개로 다중 삽입되는 것을 특징으로 하는, 제조방법.
  14. 제1항 내지 제5항 중 어느 한 항의 효모 변이 균주를 배양하는 단계를 포함하는, 스핑고신(sphingosine) 생산방법.
  15. 제6항 내지 제9항 중 어느 한 항의 효모 변이 균주를 배양하는 단계를 포함하는, 디하이드로스핑고신-세라마이드(dihydrosphingosine-ceramide) 생산방법.
PCT/KR2019/002917 2018-09-14 2019-03-13 세라마이드 전구물질 생산용 효모, 사카로마이세스 세레비지에 변이 균주 및 이의 제조방법 Ceased WO2020054934A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20180110414 2018-09-14
KR10-2018-0110414 2018-09-14
KR1020180116596A KR20200031489A (ko) 2018-09-14 2018-09-28 세라마이드 전구물질 생산용 효모, 사카로마이세스 세레비지에 변이 균주 및 이의 제조방법
KR10-2018-0116596 2018-09-28

Publications (1)

Publication Number Publication Date
WO2020054934A1 true WO2020054934A1 (ko) 2020-03-19

Family

ID=69777852

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/002917 Ceased WO2020054934A1 (ko) 2018-09-14 2019-03-13 세라마이드 전구물질 생산용 효모, 사카로마이세스 세레비지에 변이 균주 및 이의 제조방법

Country Status (1)

Country Link
WO (1) WO2020054934A1 (ko)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023003350A1 (ko) * 2021-07-22 2023-01-26 중앙대학교 산학협력단 유지성 효모 야로위아 리폴리티카 sur2 변이 균주 및 이를 이용한 스핑고이드 기반 전구체, 스핑고신 및 스핑고지질의 세포 표면 분비 생산방법
KR20230016150A (ko) * 2021-07-22 2023-02-01 중앙대학교 산학협력단 유지성 효모 야로위아 리폴리티카 sur2 변이 균주 및 이를 이용한 스핑고이드 기반 전구체, 스핑고신 및 스핑고지질의 세포 표면 분비 생산방법
CN116103176A (zh) * 2023-01-10 2023-05-12 浙江工业大学 一种高产植物鞘氨醇的酿酒酵母菌株
CN117603928A (zh) * 2023-11-28 2024-02-27 杭州唯铂莱生物科技有限公司 一种酵母二氢神经鞘氨醇c4-羟化酶sur2的突变体及其应用
EP4257693A4 (en) * 2020-12-07 2025-04-16 Korea Institute of Industrial Technology MUTANT STRAINS OF SACCHAROMYCES CEREVISIAE FOR THE PRODUCTION OF SPHINGOSINE AND SPHINGOSINE-1-PHOSPHATE AND PRODUCTION METHODS THEREOF

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130078040A (ko) * 2011-12-30 2013-07-10 이화여자대학교 산학협력단 염색체 통합용 효모 발현 벡터 및 이의 용도
WO2017033464A1 (en) * 2015-08-24 2017-03-02 Ajinomoto Co., Inc. Method for producing phytosphingosine or sphinganine

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130078040A (ko) * 2011-12-30 2013-07-10 이화여자대학교 산학협력단 염색체 통합용 효모 발현 벡터 및 이의 용도
WO2017033464A1 (en) * 2015-08-24 2017-03-02 Ajinomoto Co., Inc. Method for producing phytosphingosine or sphinganine

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ARONOVA, S.: "Regulation of ceramide biosynthesis by TOR complex 2", CELL METABOLISM, February 2008 (2008-02-01), pages 14 8 - 158, XP055693985, DOI: 10.1016/j.cmet.2007.11.015 *
LESTER, R. L.: "Iron, glucose and intrinsic factors alter sphingolipid composition as yeast cells enter stationary phase", BIOCHIMICA ET BIOPHYSICA ACTA, 2013, pages 726 - 736, XP055693981, DOI: 10.1016/j.bbalip.2012.12.012 *
MATMATI, N.: "Identification of C18: 1-phytoceramide as the candidate lipid mediator for hydroxyurea resistance in yeast", JOURNAL OF BIOLOGICAL CHEMISTRY, 14 June 2013 (2013-06-14), pages 17272 - 17284, XP055693971 *
MONTEFUSCO, D. J.: "Sphingoid bases and the serine catabolic enzyme CHA1 define a novel feedforward/feedback mechanism in the response to serine availability", JOURNAL OF BIOLOGICAL CHEMISTRY, 16 March 2012 (2012-03-16), pages 9280 - 9289, XP055693977, DOI: 10.1074/jbc.M111.313445 *
MURAKAMI, S.: "Producing human ceramide-NS by metabolic engineering using yeast Saccharomyces cerevisiae", SCIENTIFIC REPORTS, 17 November 2015 (2015-11-17) *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4257693A4 (en) * 2020-12-07 2025-04-16 Korea Institute of Industrial Technology MUTANT STRAINS OF SACCHAROMYCES CEREVISIAE FOR THE PRODUCTION OF SPHINGOSINE AND SPHINGOSINE-1-PHOSPHATE AND PRODUCTION METHODS THEREOF
WO2023003350A1 (ko) * 2021-07-22 2023-01-26 중앙대학교 산학협력단 유지성 효모 야로위아 리폴리티카 sur2 변이 균주 및 이를 이용한 스핑고이드 기반 전구체, 스핑고신 및 스핑고지질의 세포 표면 분비 생산방법
KR20230016150A (ko) * 2021-07-22 2023-02-01 중앙대학교 산학협력단 유지성 효모 야로위아 리폴리티카 sur2 변이 균주 및 이를 이용한 스핑고이드 기반 전구체, 스핑고신 및 스핑고지질의 세포 표면 분비 생산방법
KR102866725B1 (ko) 2021-07-22 2025-10-02 중앙대학교 산학협력단 유지성 효모 야로위아 리폴리티카 sur2 변이 균주 및 이를 이용한 스핑고이드 기반 전구체, 스핑고신 및 스핑고지질의 세포 표면 분비 생산방법
CN116103176A (zh) * 2023-01-10 2023-05-12 浙江工业大学 一种高产植物鞘氨醇的酿酒酵母菌株
CN117603928A (zh) * 2023-11-28 2024-02-27 杭州唯铂莱生物科技有限公司 一种酵母二氢神经鞘氨醇c4-羟化酶sur2的突变体及其应用

Similar Documents

Publication Publication Date Title
WO2020054934A1 (ko) 세라마이드 전구물질 생산용 효모, 사카로마이세스 세레비지에 변이 균주 및 이의 제조방법
WO2015167282A1 (en) A novel method for glycosylation of ginsenoside using a glycosyltransferase derived from panax ginseng
WO2016076672A1 (ko) 유전체에서 유전자 가위의 비표적 위치를 검출하는 방법
WO2019147059A1 (ko) L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법
WO2009125924A2 (ko) 퓨트레신 고생성능을 가지는 변이 미생물 및 이를 이용한 퓨트레신의 제조방법
WO2019231159A1 (ko) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
WO2016208854A1 (ko) 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법
WO2015199387A2 (ko) 가용성 단백질 발현량 및 활성이 증대된 헬리코박터 파일로리 유래 α-1,3 푸코실 전달효소의 유전자와 단백질 및 α-1,3 푸코실올리고당 생산에의 응용
WO2019182370A1 (ko) Cox2 아세틸화제를 유효성분으로 포함하는 퇴행성 신경질환의 예방 또는 치료용 약학적 조성물
WO2023121426A1 (ko) 레바우디오사이드의 생산
WO2015093831A1 (ko) D(-)2,3-부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 d(-)2,3-부탄디올의 생산 방법
WO2020022847A1 (ko) 스테롤 생산능을 갖는 재조합 효모 균주, 이의 제조방법 및 용도
WO2022035011A1 (ko) 퓨트레신 생산 미생물 및 이를 이용한 퓨트레신 생산방법
WO2012134215A2 (ko) 동물세포 발현벡터
WO2021045472A1 (ko) 신규한 프로모터 및 이를 이용한 목적 물질 생산 방법
WO2018117377A1 (ko) Fad2 유전자 조작된 올레인산 강화 식물체 및 이의 제조 방법
WO2016093668A2 (ko) 일체형 유전자 치료 유도만능줄기세포 제작방법
WO2023277583A1 (ko) 신규 plk1 단백질 분해 유도 화합물
WO2021182808A1 (ko) 야로위아 속 변이체 및 이를 이용한 지방의 제조 방법
WO2021153866A1 (ko) 시트레이트 신타아제의 활성이 약화된 신규한 변이형 폴리펩티드 및 이를 이용한 l-아미노산 생산 방법
WO2024248531A1 (ko) 아커만시아 뮤시니필라 tars를 발현 및 분비하도록 설계된 프로바이오틱스 및 이의 제조를 위한 벡터
WO2024155111A1 (ko) 염기 에디터의 염기 교정 능력을 측정하는 세포외 시험법
WO2022124839A1 (ko) 온-타겟 활성이 유지되고 오프-타겟 활성이 감소된 가이드 rna 및 이의 용도
WO2020071641A1 (ko) Tsp1 단백질 억제제를 유효성분으로 함유하는 파브리 병의 예방 또는 치료용 약학적 조성물
WO2022124639A1 (ko) 스핑고신 및 스핑고신 1-인산을 생산하는 사카로마이세스 세레비제 변이 균주 및 이의 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19860498

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19860498

Country of ref document: EP

Kind code of ref document: A1