WO2020026167A1 - New myokines and uses thereof - Google Patents
New myokines and uses thereof Download PDFInfo
- Publication number
- WO2020026167A1 WO2020026167A1 PCT/IB2019/056537 IB2019056537W WO2020026167A1 WO 2020026167 A1 WO2020026167 A1 WO 2020026167A1 IB 2019056537 W IB2019056537 W IB 2019056537W WO 2020026167 A1 WO2020026167 A1 WO 2020026167A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- amino acid
- acid sequence
- seq
- muscle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
- A61P21/06—Anabolic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4725—Proteoglycans, e.g. aggreccan
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention relates to chromosome 1 open reading frame 54 (C1 orf54) polypeptides and variants thereof.
- the invention provides human chromosome 1 open reading frame 54 (C1 orf54) polypeptides and variants thereof with myokine activity.
- the invention provides human chromosome 1 open reading frame 54 (C1 orf54) polypeptides and variants thereof for use in therapy.
- the invention provides C1 orf54 polypeptides and variants thereof with myokine activity for treating, ameliorating or preventing muscle-related disorders.
- Musculoskeletal impairments are common in men and women of all ages across all socio-demographic strata of our modern society and affect hundreds of millions of people globally. The prevalence of musculoskeletal impairments increases markedly with age, and many are additionally affected by prevailing lifestyle factors such as a low physical activity. Therefore, these conditions represent large, unmet medical and socioeconomic needs. Current treatments are often restricted to the management of symptoms, rather than targeting prevention or cure.
- Skeletal muscle is a tissue with high plasticity and high responsiveness to exercise. Satellite cells (muscle precursor cells) are typically activated upon exercise and injuries and play a key role in the remodeling of muscle tissue.
- Exercise is a highly efficacious therapy inter alia for psychiatric diseases, neurological diseases, metabolic diseases, cardiovascular diseases, pulmonary diseases, musculoskeletal disorders, and cancer (Pedersen and Saltin (2015) Scand J Med Sci Sports 25 Suppl 3, 1-72). It is believed that muscle-derived secreted factors are involved in the mediation of beneficial effects of exercise (Giudice and Taylor (2017) Curr Opin Pharmacol 34, 49-55).
- Such factors include a variety of cytokines and peptides, which can exert autocrine, paracrine or endocrine effects, and are collectively referred to as 'myokines' (Pedersen and Febbraio (2012) Nat Rev Endocrinol 8, 457-465).
- 'myokines' Pedersen and Febbraio (2012) Nat Rev Endocrinol 8, 457-465.
- Analyses of the skeletal muscle secretome revealed hundreds of myokines that are secreted in response to exercise or contraction. However, not all myokines have a positive effect on muscle growth.
- the myokine myostatin for instance, inhibits myogenesis and is a negative muscle regulator (Elkina et al. (201 1 ) J Cachexia Sarcopenia Muscle 2, 143-151). Furthermore, for affected patients it is generally difficult to exert strenuous physical activities.
- anabolic agents can result in variety of undesired side effects: steroid use has been associated with high blood pressure (Urhausen A, Albers T, Kindermann W. Heart Br Card Soc. 2004;90(5):496-501 ), decreased function of the heart’s ventricles (Pope HG, Kanayama G, Athey A, Ryan E, Hudson Jl, Baggish A. Am J Addict Am Acad Psychiatr Alcohol Addict. 2014;23(4):371 -377), cardiovascular diseases such as heart attacks (Vanberg P, Atar D. Handb Exp Pharmacol.
- polypeptide consisting of an amino acid sequence having at least 95% amino acid sequence identity to an amino acid sequence selected from the group of SEQ ID NO:3 or SEQ ID NO:4, and wherein the polypeptide has myokine activity.
- polypeptide of aspect 1 wherein the polypeptide consists of an amino acid sequence of any one of SEQ ID NO:3 or SEQ ID NO:4.
- a C1 orf54 polypeptide or variant thereof for use as a medicament 5.
- a a polypeptide consisting of amino acid sequence SEQ ID NO:2, 3, or 4; b. a polypeptide comprising an amino acid sequence of SEQ ID NO:2, 3, or 4; c. a polypeptide consisting of an amino acid sequence having at least 95% amino acid sequence identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising an amino acid sequence having at least 95% amino acid sequence identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising or consisting of an amino acid sequence, wherein one, two, three, four or five amino acids have been modified, deleted, added and/or substituted within the sequence of any one of SEQ ID NOs:2, 3, or 4, for use as a medicament.
- a a polypeptide consisting of amino acid sequence SEQ ID NO:2, 3, or 4; b. a polypeptide comprising an amino acid sequence of SEQ ID NO:2, 3, or 4; c. a polypeptide consisting of an amino acid sequence having at least 95% amino acid sequence identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising an amino acid sequence having at least 95% amino acid sequence identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising or consisting of an amino acid sequence, wherein one, two, three, four or five amino acids have been modified, deleted, added and/or substituted within the sequence of any one of SEQ ID NOs:2, 3, or 4, for use in the manufacture of a medicament.
- polypeptide according to any of aspects 4-8 for use in the manufacture of a medicament for the treatment of a muscle-related disorder in a subject.
- a polypeptide for use in treating a muscle-related disorder in a subject comprising administering to the subject an effective amount of a polypeptide selected from: a. a polypeptide consisting of amino acid sequence SEQ ID NO:2, 3, or 4;
- a polypeptide comprising an amino acid sequence of SEQ ID NO:2, 3, or 4;
- a polypeptide consisting of an amino acid sequence having at least 95% amino acid sequence identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising an amino acid sequence having at least 95% amino acid sequence identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising or consisting of an amino acid sequence, wherein one, two, three, four or five amino acids have been modified, deleted, added and/or substituted within the sequence of any one of SEQ ID NOs:2, 3, or 4; and wherein said polypeptide has myokine activity.
- a pharmaceutical composition comprising a. a pharmaceutically effective amount of at least one polypeptide selected from: i) a polypeptide consisting of amino acid sequence SEQ ID NO:2, 3, or 4; ii) a polypeptide comprising an amino acid sequence of SEQ ID NO:2, 3, or 4;
- a polypeptide consisting of an amino acid sequence having at least 95% amino acid sequence identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising an amino acid sequence having at least 95% amino acid sequence identity to SEQ ID NOs:2, 3, or 4; and v) a polypeptide comprising or consisting of an amino acid sequence, wherein one, two, three, four or five amino acids have been modified, deleted, added and/or substituted within the sequence of any one of SEQ ID NOs:2, 3, or 4; and wherein said polypeptide has myokine activity; and b. at least one pharmaceutically acceptable carrier, diluent or excipient.
- composition of aspect 1 1 for use in the treatment of a muscle-related disorder.
- a method of treating a muscle-related disorder in a subject comprising administering to the subject an effective amount of a polypeptide selected from:
- a a polypeptide consisting of amino acid sequence SEQ ID NO:2, 3, or 4;
- a polypeptide comprising an amino acid sequence of SEQ ID NO:2, 3, or 4 b. a polypeptide comprising an amino acid sequence of SEQ ID NO:2, 3, or 4; c. a polypeptide consisting of an amino acid sequence having at least 95% amino acid sequence identity to SEQ ID NOs:2, 3, or 4; d. a polypeptide comprising an amino acid sequence having at least 95% amino acid sequence identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising or consisting of an amino acid sequence, wherein one, two, three, four or five amino acids have been modified, deleted, added and/or substituted within the sequence of any one of SEQ ID NOs:2, 3, or 4, wherein said polypeptide has myokine activity.
- muscle-related disorder is a disorder selected from or caused by muscle atrophy, orthopedic injury, muscle injury, muscle weakness, heart failure, chemotherapy, post-stroke, secondary muscle loss, sarcopenia, obesity or metabolic syndrome.
- muscle-related disorder is a disorder selected from or caused by muscle atrophy, orthopedic injury, muscle injury, muscle weakness, heart failure, chemotherapy, post-stroke, secondary muscle loss, sarcopenia, obesity or metabolic syndrome.
- said muscle-related disorder is a disorder selected from or caused by muscle atrophy, orthopedic injury, muscle injury, muscle weakness, heart failure, chemotherapy, post-stroke, secondary muscle loss, sarcopenia, obesity or metabolic syndrome.
- polypeptide or the pharmaceutical composition for use in the treatment of a muscle-related disorder in a subject wherein the polypeptide is administered according to an intermittent dosing schedule comprising at least two cycles, each cycle comprising (a) a dosing period during which said C1 orf54 polypeptide or variants thereof is administered to the subject and (b) a resting period.
- a method of treating a muscle-related disorder in a subject comprises administering to the subject an effective amount of a C1 orf54 polypeptide or variant thereof, wherein the polypeptide is administered according to an intermittent dosing schedule comprising at least two cycles, wherein each cycle comprises (a) a dosing period during which said C1 orf54 polypeptide or variants thereof is administered to the subject and (b) a resting period.
- a method of treating a muscle-related disorder in a subject comprising administering to the subject an effective amount of a polypeptide selected from:
- a a polypeptide consisting of amino acid sequence SEQ ID NO:2, 3, or 4; b. a polypeptide comprising an amino acid sequence of SEQ ID NO:2, 3, or 4; c. a polypeptide consisting of an amino acid sequence having at least 95% amino acid sequence identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising an amino acid sequence having at least 95% amino acid sequence identity to SEQ ID NOs:2, 3, or 4; and e. a polypeptide comprising or consisting of an amino acid sequence, wherein one, two, three, four or five amino acids have been modified, deleted, added and/or substituted within the sequence of any one of SEQ ID NOs:2, 3, or 4; and
- said polypeptide has myokine activity, and wherein the effective amount of said polypeptides is administered according to an intermittent dosing schedule comprising at least two cycles, wherein each cycle comprises (a) a dosing period during which a therapeutically effective amount of said C1 orf54 polypeptide or variants thereof is administered to a patient and thereafter (b) a resting period.
- Figure 1 Alignment of human C1 orf54 (UniProt ID Q8WWF1) (SEQ ID NO:1) with homologous proteins (SEQ ID NOs:46-68, respectively, in order of appearance). Sequences were retrieved from www.uniprot.org (The UniProt Consortium (2017), Nucleic Acids Research, 45(D1):D158-D169 ) or www.ensembl.org (Zerbino et al. (2016) Nucleic Acids Research, 46(D1 ):D754-D761), respectively, on August 18, 2015 and aligned in Jalview (Waterhouse et al. (2009) Bioinformatics, 25(9) :1189-1191) using the MUSCLE algorithm (Edgar (2004) Nucleic Acids Research, 32(5) :1792-1797).
- FIG. 2 Increase in C1orf54 mRNA levels in quadriceps of exercised compared to sedentary mice.
- C1orf54 mRNA levels were elevated immediately after exercise and remained elevated at 30, 60 and 180 minutes after cessation of exercise.
- n 7-8 mice/group. All values are expressed as mean ⁇ SEM. Differential analysis was performed on counts per million reads using limma-voom Bioconductor package. All p-values were adjusted using Benjamini and Hochberg multiple testing correction. Statistically significant differences from the sedentary group are indicated as follows: **p ⁇ 0.01 , ***p ⁇ 0.001 .
- FPKM Fragments per kilobase of transcript per million mapped reads.
- FPKM Fragments per kilobase of transcript per million mapped reads
- HUT high-intensity aerobic interval training
- RT resistance training
- CT combined exercise training.
- Figure 6A Increase in absolute muscle force in response to treatment with vehicle or 1 mg/kg C1 orf54 isolated protein comprising amino acid sequence SEQ ID NO:25.
- Figure6B Increase in specific force in response to treatment with vehicle or 1 mg/kg C1 orf54 isolated protein comprising amino acid sequence SEQ ID NO:25.
- composition “comprising” means “including” as well as “consisting” e.g. a composition “comprising” X may consist exclusively of X or may include something additional e.g. X + Y.
- the present invention includes C1 orf54 polypeptides and variants thereof with biological activity.
- chromosome 1 open reading frame 54 (C1 orf54) polypeptide refers to polypeptides encoded by chromosome 1 open reading frame 54 (C1 orf54) genes, particularly preferred is the human chromosome 1 open reading frame 54 (C1 orf54) (UniGene ID:141426, UniGene Hs.91283, NM_024579.3, NP_078855.2, Uniprot accession no.
- Q8WWF1 with SEQ ID NO:1 which herein refers to C1 orf54 polypeptide comprising a signal peptide), preferably having an amino acid sequence as set out in SEQ ID NO:2, which herein refers to C1 orf54 polypeptide without signal peptide.
- C1 orf54 polypeptide also includes variants of the C1 orf54 polypeptides disclosed herein (e.g. C1 orf54 polypeptides comprising amino acid SEQ ID NO:3 or SEQ ID NO:4 or other truncated, fusion or mutated C1 orf54 polypeptides).
- the terms also refer to each of the polypeptides individually as well as jointly. For example, description of the preparation of, purification of, derivation of, administration of, compositions containing, treatment of a disease with etc., pertain to each polypeptide individually or jointly.
- a C1 orf54 polypeptide variant is a protein that differs by at least one amino acid (e.g.
- wild-type sequence refers to a polypeptide or gene sequence available in at least one naturally occurring organism or a polypeptide or gene sequence that has not been changed, mutated, or otherwise manipulated by man.
- wild-type sequences can be isolated from nature or can be produced by recombinant or synthetic means.
- the C1 orf54 polypeptides described herein may be isolated from a variety of sources, such as from human tissues types, or prepared by recombinant or synthetic methods.
- polypeptide As used herein, the terms “polypeptide”, “peptide” and “protein” are used interchangeably to describe a polymer of amino acid residues.
- polypeptides can mean, but is in no way limited to, recombinant full length, pro- and/or mature polypeptide forms as well as fragments or splice variants with biological activity, or recombinantly made truncations with biological activity derived from the full-length polypeptide.
- Recombinant forms of the polypeptides can be produced according to standard methods and protocols, which are well known to those of skill in the art, including for example, expression of recombinant proteins in prokaryotic and/or eukaryotic cells followed by one or more isolation and purification steps, and/or chemically synthesizing polypeptides or portions thereof using a peptide synthesizer.
- polypeptide applies to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers.
- isolated polypeptide is intended to refer to a polypeptide that is removed from its original or native environment (e.g. the natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated by human intervention from some or all of the co-existing materials in the natural system, is isolated.
- Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of the environment in which it is found in nature.
- conservatively modified variants refers to individual substitutions, deletions or additions to a peptide, polypeptide, or protein sequence which alters, adds, substitutes and/or deletes a single amino acid or a small percentage of amino acids in the encoded sequence where the alteration results in the substitution of an amino acid with a chemically similar amino acid.
- Conservative substitution tables providing functionally similar amino acids are known in the art.
- conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g.
- lysine, arginine, histidine acidic side chains (e.g. aspartic acid, glutamic acid), uncharged polar side chains (e.g. glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g. alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g. threonine, valine, isoleucine) and aromatic side chains (e.g. tyrosine, phenylalanine, tryptophan, histidine).
- acidic side chains e.g. aspartic acid, glutamic acid
- uncharged polar side chains e.g. glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan
- sequence similarity means that amino acids at the same position of the best sequence alignment are identical or similar, preferably identical. "Similar amino acids” possess similar characteristics, such as polarity, solubility, hydrophilicity, hydrophobicity, charge, or size.
- percent (%) amino acid sequence identity with respect to the C1 orf54 polypeptide and variant sequences as described herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific C1 orf54 polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as EMBOSS Needle, BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software.
- Percent (%) amino acid sequence similarity is determined by the same calculation used to determine % amino acid sequence identity, but including conservative amino acid substitutions in addition to identical amino acids in the computation.
- nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that have the same sequences.
- Analogous positions in two or more polypeptides can be determined by aligning the polypeptide sequences based on amino acid sequence or structural similarities.
- alignment tools can be, for example, obtained on the World Wide Web, e.g. ClustalW (www.ebi.ac.uk/clustalw) or Align (http://www.ebi.ac.uk/emboss/align/index.html) using standard settings, preferably for Align EMBOSS needle, Matrix:Blosum62, Gap Open 10.0, Gap Extend 0.5.
- ClustalW www.ebi.ac.uk/clustalw
- Align http://www.ebi.ac.uk/emboss/align/index.html
- Align EMBOSS needle Matrix:Blosum62
- Gap Open 10.0 Gap Extend 0.5.
- Residues in two or more C1 orf54 polypeptides or variants thereof are said to "correspond” if the residues are aligned in the best sequence alignment.
- the "best sequence alignment" between two polypeptides is defined as the alignment that produces the largest number of aligned identical residues.
- the invention concerns an isolated C1 orf54 polypeptide, preferably a human C1 orf54 polypeptide, consisting of an amino acid sequence having at least about 80% amino acid sequence similarity, alternatively at least about 81 % amino acid sequence similarity, alternatively at least about 82% amino acid sequence similarity, alternatively at least about 83% amino acid sequence similarity, alternatively at least about 84% amino acid sequence similarity, alternatively at least about 85% amino acid sequence similarity, alternatively at least about 86% amino acid sequence similarity, alternatively at least about 87% amino acid sequence similarity, alternatively at least about 88% amino acid sequence similarity, alternatively at least about 89% amino acid sequence similarity, alternatively at least about 90% amino acid sequence similarity, alternatively at least about 91 % amino acid sequence similarity, alternatively at least about 92% amino acid sequence similarity, alternatively at least about 93% amino acid sequence similarity, alternatively at least about 94% amino acid sequence similarity, alternatively at least about 95% amino acid sequence similarity, alternatively at least about
- C1 orf54 polypeptide variant or“C1 orf54 variant” means a biologically active C1 orf54 polypeptide as defined herein having at least 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% amino acid sequence similarity, preferably 100% sequence identity, over the entire length of the protein using the best sequence alignment and/or over the region of the best sequence alignment, wherein the best sequence alignment is obtainable with art known tools, e.g.
- a C1 orf54 variant is also the C1 orf54 precursor protein comprising a signal peptide sequence, e.g. a polypeptide comprising amino acid SEQ ID NO:1 .
- a C1 orf54 variant is also a fusion protein comprising a C1 orf54 protein, e.g.
- a protein comprising a C1 orf54 protein fused to another, heterologous polypeptide or amino acid sequence, e.g. an immunoglobulin Fc region, human serum albumin (HSA) polypeptides, or conjugated to another moiety, e.g. polyethylene glycol (PEG), for example to increase the biological (e.g. serum) half-life of the C1 orf54 polypeptide or variant thereof.
- a C1 orf54 variant comprises a fusion of C1 orf54 polypeptide or variant thereof with a tag polypeptide.
- the tag is generally placed at the amino- or carboxyl terminus of the C1 orf54 polypeptide.
- a C1 orf54 variant is also a truncation of the full-length C1 orf54 polypeptide or of the C1 orf54 variant, wherein the truncation can be at the N- terminal of the polypeptide or at the C-terminal of the polypeptide or both at N-terminal of the polypeptide and at the C-terminal of the polypeptide.
- polypeptides with SEQ ID NO:3 and SEQ ID NO:4 are such truncated variants of the full-length C1 orf54 polypeptide as set forth in SEQ ID NO:2.
- a variant also includes polypeptides with biological activity containing amino acid substitutions, modifications, additions and/or deletions at 1 , 2, 3, 4, 5 or more amino acid positions, and have at least 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence similarity, preferably 100% sequence identity, over the entire length of the fragment using the best sequence alignment and/or over the region of the best sequence alignment, wherein the best sequence alignment is obtainable with tools known in the art, e.g.
- a C1 orf54 variant as described herein retains its biological activity in the sense that such a protein can be considered as a functional equivalent of the full-length C1 orf54 protein as set forth in SEQ ID NO:2, i.e. a variant retains the biological activity, e.g. of increasing muscle function as described herein, or a variant exceeds at least one of the biological activities observed for the full-length C1 orf54 polypeptide as set forth in SEQ ID NO: 2, as assessed in a suitable biological system, e.g. in vitro or in vivo, as described herein.
- a C1 orf54 variant is also the isolated polypeptide comprising any of the amino acid sequence SEQ ID NO:5-9 or SEQ ID NO:10-14.
- C1 orf54 polypeptides are understood as C1 orf54 polypeptides or variants thereof comprising at least one natural or artificial mutation. Mutations can be insertions, deletions or substitutions of one or more amino acids that do not diminish the biological activity of the C1 orf54 polypeptide.
- sequence identity or sequence similarity shall be defined only on the basis of the C1 orf54 part of such a fusion protein, i.e. additional amino acids not derived from C1 orf54 polypeptide or variants thereof will not be considered in such an alignment, i.e. are excluded from the calculation of the alignment score.
- sequence identity or sequence similarity shall be defined only on the basis of the truncated C1 orf54 polypeptide or variant thereof.
- Variants may exhibit amino acid sequences that are at least 80%, 81 %, 82%, 83%, 84%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the fused or truncated C1 orf54 polypeptide variant, e.g. to C1 orf54 polypeptide variant with SEQ ID NO:3 or SEQ ID NO:4.
- Optimal alignment of sequences for comparison can be conducted, e.g. by the local homology algorithm of Smith and Waterman (1970) Adv. Appl. Math. 2:482c, by the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443, by the search for similarity method of Pearson and Lipman (1988) Proc. Nat’l. Acad. Sci. USA 85:2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wl), or by manual alignment and visual inspection (see, e.g. Ausubel et al., Current Protocols in Molecular Biology (1995 supplement)).
- a preferred algorithm for sequence comparison is EMBOSS needle, which reads two input sequences and writes their optimal global sequence alignment to file.
- the program uses the Needleman-Wunsch alignment algorithm to find the optimum alignment (including gaps) of two sequences along their entire length.
- the standard settings for EMBOSS needle are BLOSUM62 scoring matrix with penalties of 10.0 for Gap Open 10.0 and 0.5 for Gap Extend.
- C1 orf54 polypeptide is part of a complex system that muscle cells use in order to communicate with their physiologic environment and it is therefore classed as a myokine.
- myokine refers to cytokines, peptides or polypeptides, proteoglycan peptides, bioactive lipids, second messengers, etc. produced, expressed, and released by muscle cells.
- myokine activity refers to autocrine, paracrine and/or endocrine effects produced by a myokine, or myokine signal, on a subject, cell, ortissue, e.g. adipose tissue, brain, pancreas, gut, liver, immune cells, bone, liver and tumor cells.
- Myokine activity may be inhibitory or stimulatory.
- Such "myokine activity” may result in muscle hypertrophy, increased muscle regeneration, increased muscle strength (force generating capacity), proliferation of primary human skeletal muscle cells, increased muscle innervation, effects on extracellular matrix remodeling, modulation of bone metabolism (e.g.
- adipose metabolism e.g. increased lipolysis, decreased lipoprotein lipase activity, increased browning of adipose tissue, increased thermogenesis, decreased adipose tissue mass, increased fatty acid oxidation, decreased levels of circulating and/or hepatic triglycerides, decreased total body fat, decreased visceral fat
- modulation of immune cell responses regulation of immunomodulatory processes, modulation of inflammatory processes, modulation of responses of immune cells, reduced inflammation, stimulation of energy expenditure, modulation of whole-body metabolism, modulation of whole-body insulin sensitivity, regulation of glucose metabolism (e.g.
- said myokine activity preferably leads to an increase in muscle function.
- the term“increase in muscle function” or“increased muscle function” or “muscle function increasing activity” is intended to refer to an activity that leads at least one or more of i) an increase in muscle strength, ii) an increase in muscle precursor cell proliferation, iii) improved muscle regeneration activity or iv) increased muscle fatigability resistance.
- the terms“increase(d)” or“improved” refer to a condition under which a parameter to be measured in vivo or in vitro (e.g. muscle strength, muscle precursor cell proliferation, muscle regeneration activity, satellite cell proliferation assay or muscle fatigability resistance) is greater at a second point in time compared to a first point in time.
- Said parameters can be assessed using a suitable in vitro and/or in vivo assay, e.g. as described herein, e.g. human myoblast in vitro proliferation assay or mouse satellite cell proliferation in vivo or methods to evaluate muscle strength.
- a suitable in vitro and/or in vivo assay e.g. as described herein, e.g. human myoblast in vitro proliferation assay or mouse satellite cell proliferation in vivo or methods to evaluate muscle strength.
- muscle strength refers to the maximum amount of force a muscle, or muscle groups in sum, can generate. Muscle strength may be evaluated by a variety of methods such as grip strength, one repetition maximum strength test, time-dependent tests of muscle endurance, time-dependent tests of muscle fatigue, or time-dependent tests of muscle endurance and fatigue, and so forth. Muscle strength may be assessed by dynamic (e.g. 30 second chair stand test, stair climb test, knee flexion/extension) or static (e.g. hand grip dynamometry, isometric knee extension/flexion) movements across single or multiple joints and respiratory and other muscles (e.g. pulmonary function tests).
- dynamic e.g. 30 second chair stand test, stair climb test, knee flexion/extension
- static e.g. hand grip dynamometry, isometric knee extension/flexion
- the term“increased muscle strength” (and the like) in a subject is also intended to refer to an increase in muscle strength and/or physical performance compared to before treatment, and as measured after at least 2 weeks, at least 4 weeks, after at least 8 weeks, after at least 12 weeks, after at least 16 weeks, after at least 20 weeks, after at least 24 weeks, after at least 28 weeks, after at least 32 weeks, after at least 36 weeks, after at least 40 weeks, after at least 44 weeks, after at least 48 weeks, after at least 52 weeks or more of treatment.
- Physical performance may be assessed by Short Physical Performance Battery (SPPB), gait speed measurement, timed get-up-and-go test (TGUG), stair climb power test (SCPT) 400 m walk test and/or 6-minute walk test for distance (6MWD).
- SPPB Short Physical Performance Battery
- TGUG timed get-up-and-go test
- SCPT stair climb power test
- 6MWD 6-minute walk test for distance
- the term“regulate” is used to describe that the level or activity of a function is greater than, equal to or less than that observed in the absence of an agent provided by the invention.
- subject or“patient” as used herein is intended to include humans and animals, which are capable of suffering from or afflicted with a muscle-related disorder or disease or would otherwise benefit from increase in muscle function.
- subjects include mammals, e.g. humans, dogs, cows, horses, pigs, sheep, goats, cats, and transgenic nonhuman animals.
- the subject is a human, e.g. a human suffering from, at risk of suffering from, or potentially capable of suffering from muscle-related disorder.
- the subject is a human subject, e.g. a human patient having a muscle-related disorder.
- the subject is an animal, e.g. a cow or pig which is treated in accordance with the herein disclosed method (e.g. administration of C1 orf54) in order to increase lean body mass or the muscle function of said animal.
- a subject is“in need of a treatment if such subject (patient) would benefit biologically, medically or in quality of life from such treatment.
- muscle mass refers to the amount or size of muscle or muscle groups, as expressed by muscle weight, mass, area, or volume. Muscle mass may also be expressed as total lean body mass, lean body mass of a body compartment such as the leg, or cross-sectional area of a leg or arm compartment.
- the volume or mass of the muscle can be determined using any known or otherwise effective technique that provides muscle area, volume, or mass, such as Dual energy X-ray absorptiometry (DXA), Bioimpedance analysis (BIA), computed tomography (CT) scan, ultrasound, magnetic resonance imaging (MRI) or total or partial body potassium per fat-free soft tissue (TBK or PBK).
- DXA Dual energy X-ray absorptiometry
- BIOA Bioimpedance analysis
- CT computed tomography
- ultrasound ultrasound
- magnetic resonance imaging MRI
- TK or PBK total or partial body potassium per fat-free soft tissue
- the term“satellite cells” is intended to refer to small mononuclear stem cells that are naturally located underneath the basal lamina of the myofiber, and that are capable of self-renewal and of forming new skeletal muscle cells (i.e. myogenic).
- the most definitive marker of satellite cells is Pax7, which is present in all satellite cells of post-natal muscles and expressed in proliferating myoblasts until they begin to differentiate.
- the terms“regenerative capacity of muscle”,“muscle regeneration activity” or“muscle regeneration improving activity” is intended to refer to the process of re-growth or repair of muscle cells in order to increase, recover or maintain the total number of viable or functional myocytes and provide replacement of compromised muscle fibers in response to damage such as tissue loss following disease or injury in response to this damage, satellite ceils are activated and become committed myoblasts, which then begin to proliferate to expand the population of progenitor for repair (see e.g. Kuang and Rudnicki (2008) Trends Mol Med 14, 82-91) Finally, proliferating myoblasts withdraw from the ceil cycle and undergo terminal differentiation.
- regenerative capacity of muscle or“muscle regeneration activity” (and the like) also include the process of satellite cell-mediated growth (re-enter the cell cycle, proliferate and fuse into existing muscle fibres or form new muscle fibre), syncytial myofiber growth or myoblast-dependent de novo myofiber differentiation, whereby myofiber growth may also be myoblast- dependent and de novo myofiber differentiation may be satellite cell-dependent, whereby myofibres fuse into existing muscle fibres and/or increase the size of regenerating myofibers and/or form new muscle fibres, thereby promoting skeletal muscle regeneration.
- muscle-related disorder is intended to refer to a disease or disorder resulting in muscle dysfunction (e.g. reduced muscle strength or power, reduced regenerative capacity and/or reduced endurance), such that the muscle is unable to perform its function at a level needed for a person to maintain normal daily independence.
- muscle dysfunction e.g. reduced muscle strength or power, reduced regenerative capacity and/or reduced endurance
- a subject may be impaired to perform their physiological tasks adequately.
- Such muscle dysfunction may result in physical disability, impaired mobility, loss of functional independence, frequent falling, fear of falling, injurious falling, muscle wasting, impaired and unsteady gait, adverse gait mechanics, scoliosis, trouble running and jumping, difficulty lifting objects, myotonia, drooping eyelids, muscle hypertrophy, muscle hypotrophy or atrophy, respiratory difficulty, inability to walk, learning disabilities, poor balance, difficulty getting up from a lying or sitting position, use of the Gower's maneuver to stand, and/or reduced endurance.
- muscle loss is intended to refer to a condition of deterioration of muscle quantity and quality.
- Non-limiting symptoms of muscle loss can be loss or reduction of muscle mass, loss or reduction of lean muscle, loss or reduction of muscle weight, loss or reduction of muscle circumference, loss or reduction of muscle function, loss or reduction of muscle strength, loss or reduction of mobility, or any combination thereof.
- muscle loss can be caused by aging, disease (for example cancer and liver diseases), inactivity, injury (for example liver transplantation), or any combination thereof.
- the term “muscle loss” encompasses the natural process of muscle ageing, as well as congenital pathologies and acquired pathologies.
- Muscle ageing results in progressive skeletal muscle loss, and it includes, without limitation, sarcopenia.
- the term “muscle loss” also encompasses any congenital or acquired muscular degeneration, weakness, dysfunction and/or loss affecting the skeletal muscle(s).
- Congenital pathologies include myopathies (e.g. Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, Congenital muscular dystrophy, Limb Girdle muscular dystrophy (LGMD), facioscapulohumeral muscular dystrophy, myotonic muscular dystrophy, oculopharyngeal muscular dystrophy, distal muscular dystrophy, and Emery-Dreifuss muscular dystrophy).
- acquired pathologies affecting the skeletal muscle(s) are not inherited and can be induced by inflammation (e.g. inflammatory myopathies), drugs (e.g. drug-induced myopathy), trauma or injury (e.g. trauma-induced myopathy or surgery-induced myopathy), connective tissue and muscle ischemia (e.g. Buerger disease), cancer (e.g. cancer-induced sarcopenia) or even diet (e.g. diet-induced myopathy).
- the disclosed compositions, uses, kits, methods and compounds reduce, arrest or reverse muscle loss in a patient.
- the term“secondary muscle loss”, is intended to refer to a condition of deterioration of muscle quantity and quality resulting from injury, illness or trauma. These include, but are not limited to, stroke, motor vehicle accidents, severe burns, combat injuries, chronic obstructive pulmonary disease (COPD), diabetes, cancer, activities associated with surgery, inability to move muscles and joints for an extended period of time (e.g. bedrest, casting) and other conditions that create a negative nitrogen balance in the body. Disuse of greater than 10 days bedrest has long been recognized to result in loss of skeletal muscle, strength and patient function, but it is now also understood that considerable muscle loss and atrophy occurs already after short-term disuse (less than 10 days) (Dirks et al.
- the term “secondary muscle loss” encompasses muscle loss occurring after short-term disuse as well as long-term disuse.
- the disclosed compositions, uses, kits, methods and compounds reduce, arrest or reverse secondary muscle loss in a patient.
- sarcopenia refers to a syndrome characterized by progressive and generalized loss of skeletal muscle mass, strength and impaired functional capacity seen in older adults as defined in Sarcopenia: European consensus on definition and diagnosis (Cruz-Jentoft et al. (2010) Age Ageing 39, 412-423) and by the International Working Group on Sarcopenia (Fielding et al. (201 1 ) J Am Med Dir Assoc 12, 249-256).
- sarcopenia is used to describe the loss of skeletal muscle mass and function associated with diseases, surgery and other conditions (cancer (Collins et al (2014) BMJ Open;4:e003697. doi:10.
- sarcopenia requires the presence of low muscle mass and at least one of low muscle strength and low physical performance.
- sarcopenia includes primary sarcopenia (age-related sarcopenia) and secondary sarcopenia where the muscle and functional loss are a consequence of another condition (including activity-related sarcopenia, such as resulting from bed rest, inactivity, sedentary lifestyle, and deconditioning; disease-related sarcopenia associated with advanced organ failure of heart, lung, liver, kidney and/or brain, inflammatory disease, malignancy or endocrine disease and nutrition-related sarcopenia resulting from inadequate dietary intake of energy and/or protein, such as with malabsorption, gastrointestinal disorders or use of medications that cause anorexia).
- the disclosed compositions, uses, kits, methods and compounds reduce, arrest or reverse sarcopenia in a patient.
- the term“cachexia” refers to wasting that is characterized by progressive weight loss, muscle wasting/loss and fatigue, due to the loss of skeletal muscle with or without loss of adipose tissue as defined by Special Interest Groups (SIG) “cachexia- anorexia in chronic wasting diseases” and“nutrition in geriatrics” ( Muscaritoli et al. (2010) Clin Nutr 29, 154-159).
- SIG Special Interest Groups
- Cachexia is frequently associated with inflammation, insulin resistance, anorexia and increased breakdown of muscle proteins due to severe chronic illness, such as cancer, chronic heart failure, chronic cardiomyopathy, chronic renal failure, end-stage renal disease, chronic obstructive pulmonary disease (COPD), liver failure, liver cirrhosis, acquired immunodeficiency syndrome (AIDS), severe burn injury and rheumatoid arthritis.
- COPD chronic obstructive pulmonary disease
- AIDS acquired immunodeficiency syndrome
- severe burn injury and rheumatoid arthritis severe chronic illness
- the disclosed compositions, uses, kits, methods and compounds reduce, arrest or reverse cachexia in a patient.
- muscle weakness includes the loss of muscle strength seen following a trauma such as surgery and acute or long-term injury, disuse, e.g. following a stroke, or high levels of inflammation or other conditions resulting in a decrease in force around a joint caused by the lower force generating capacity of individual or groups of muscles regardless of the contraction intensity.
- Post-surgical muscle weakness refers to a reduction in the strength of one or more muscles following surgical procedure. Weakness may be generalized (i.e. total body weakness) or localized to a specific area, side of the body, limb, or muscle.
- Post-traumatic muscle weakness is characterized by a reduction in the strength of one or more muscles following a traumatic episode (e.g. bodily injury, surgery or stroke).
- the disclosed compositions, uses, kits, methods and compounds reduce, arrest or reverse muscle weakness in a patient.
- administering is intended to referto a method of giving a dosage of a pharmaceutically active ingredient, e.g. a C1 orf54 polypeptide or variant thereof as described herein, to a subject in need thereof.
- a pharmaceutically active ingredient e.g. a C1 orf54 polypeptide or variant thereof as described herein
- pharmaceutically acceptable refers to those compounds, materials, compositions and/or dosage forms, which are, within the scope of sound medical judgment, suitable for contact with the tissues of a subject, e.g. a mammal or human, without excessive toxicity, irritation, allergic response and other problems or complications commensurate with a reasonable benefit/risk ratio.
- the term "pharmaceutically acceptable carrier, diluent or excipient” or “carrier, diluent or excipient” refers to a substance useful in the preparation or use of a pharmaceutical composition, which enhance or stabilize the composition, or can be used to facilitate the preparation of the composition.
- Pharmaceutically acceptable carriers include solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, and includes, for example, suitable diluents, surfactants, antioxidants, preservatives, buffering agents, bulking agents, cryoprotectants, lyoprotectants, salts, drug stabilizers, binders, excipients, disintegration agents, lubricants, wetting agents, sweetening agents, flavoring agents, dyes, and combinations thereof, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible and that do not produce an adverse, allergic or other untoward reaction when administered to an animal, or a human, as appropriate (see, for example, Remington The Science and Practice of Pharmacy, 22 nd Ed. Pharmaceutical Press, 2013, pp. 1049-1070). Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions
- pharmaceutical composition refers to a C1 orf54 polypeptide or variant thereof together with at least one pharmaceutically acceptable carrier, diluent or excipient in a form suitable for administration to the physical location most suitable for their desired activity, e.g. systemic administration. It is intended that the term“pharmaceutical composition” refers to a mixture or solution containing at least one therapeutic agent, preferably an C1 orf54 polypeptide or variant thereof, to be administered to a subject, e.g. a mammal or human, in order or treat a particular disease or condition affecting the subject.
- each dosage form need not in itself constitute an effective amount since the necessary effective amount may be reached by administration of a plurality of dosage units.
- the amount of active agent which can be combined with a carrier material to produce a single dosage form will vary depending upon the subject being treated, and the particular mode of administration.
- the amount of active agent which can be combined with a carrier material to produce a single dosage form will generally be that amount of the composition which produces a therapeutic effect.
- this amount may range from about 0.01 per cent to about ninety-nine percent of active agent, from about 0.1 per cent to about 70 per cent, or from about 1 percent to about 30 percent of active agent in combination with a pharmaceutically acceptable carrier.
- compositions of the invention may include a“therapeutically effective amount” or“effective amount” of a C1 orf54 polypeptide or variant thereof described herein.
- the terms“effective amount”,“effective dose”,“pharmaceutically effective amount”, “pharmaceutically effective dose”, “therapeutically effective amount” or “therapeutically effective dose” are used interchangeably and are intended to refer to an amount/dose of the C1 orf54 polypeptide or variant thereof described herein, which is sufficient, at dosages and for periods of time necessary, to provide an observable or clinically significant improvement over the baseline of clinically observable signs and symptoms of muscle-related disease or disorder and/or to prevent, inhibit the occurrence, ameliorate, delay, alleviate, arrest, reverse or treat one or more symptoms associated with a muscle-related disease or disorder.
- the effective amount depends on the type of disease, the composition used, the route of administration, the type of mammal being treated, the physical characteristics of the specific mammal under consideration, concurrent medication, and other factors such as the disease state, age, sex, and weight of the individual which those skilled in the medical arts will recognize.
- a therapeutically effective amount is also one in which any toxic or detrimental effects of the therapeutic agents are outweighed by therapeutically beneficial effects. Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g. for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population).
- the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50.
- Compounds that exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
- the data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
- the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
- the therapeutically effective dose can be estimated initially from cell culture assays.
- a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e. the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture.
- IC50 i.e. the concentration of the test compound which achieves a half-maximal inhibition of symptoms
- levels in plasma may be measured, for example, by high performance liquid chromatography.
- a therapeutically effective amount refers to the amount of the C1 orf54 polypeptide or variant thereof of the present invention that, when administered to a cell, or a tissue, or a non-cellular biological material, or a medium, is effective to at least partially act as a myokine on the cell, tissue or non-cellular biological material.
- the term“prevent”,“preventing” or “prevention” in connection to a disease or disorder refers to the prophylactic treatment of a subject who is at risk of developing a condition (e.g. a specific disease or disorder or clinical symptom thereof) resulting in a decrease in the probability that the subject will develop the condition.
- a condition e.g. a specific disease or disorder or clinical symptom thereof
- the disclosed compositions, uses, kits, methods and compounds are used in prophylactic treatment in a patient.
- the term“treat”,“treating” or“treatment” in connection to a muscle-related disorder refers in one embodiment, to ameliorating the disease or disorder (i.e., slowing or arresting or reducing the development of the disease or at least one of the clinical symptoms thereof).
- “treat”, “treating” or “treatment” refers to alleviating or ameliorating at least one physical parameter including those which may not be discernible by the patient.
- “treat”, “treating” or “treatment” refers to modulating the disease or disorder, either physically, (e.g. stabilization of a discernible symptom), physiologically, (e.g. stabilization of a physical parameter), or both.
- “treat”,“treating” or“treatment” refers to delaying the onset or development or progression of the muscle-related disorder.
- the present invention is based, in part, on the finding that C1 orf54 polypeptide or variants thereof have myokine activity. It has been discovered that the levels of expression of C10RF54 mRNA are increased in skeletal muscle in response to exercise in subjects.
- the present invention provides C1 orf54 variants thereof having myokine activity.
- the present invention also provides C1 orf54 polypeptide or variants thereof for use as a medicament.
- the present invention also provides C1 orf54 polypeptide or variants thereof for use in therapy or for the use in the preparation of a medicament.
- the present invention also provides pharmaceutical compositions comprising C1 orf54 polypeptide or variants thereof for use in the treatment, prevention or amelioration of a muscle-related disorder. Consequently, highly desirable C1 orf54 polypeptides and variants thereof having myokine activity and novel therapeutic approaches are provided by the present invention.
- kits comprising a C1 orf54 polypeptide or variants thereof (e.g. in liquid or lyophilized form) as described herein or a pharmaceutical composition comprising the C1 orf54 polypeptide or variants thereof as described herein.
- the invention further provides methods of treating, preventing, or ameliorating muscle- related disorders, comprising administering to a subject in need thereof an effective amount of an isolated C1 orf54 polypeptide or variants thereof having myokine activity.
- the present invention provides a polynucleotide molecule encoding an amino acid sequence having at least 90% or at least 95% sequence identity to an amino acid sequence selected from SEQ ID NO:3 or SEQ ID NO:4, wherein said amino acid sequence is encoding a C1 orf54 variant with myokine activity.
- vectors comprising a polynucleotide selected from SEQ ID NO:16, 17, or 18 encoding the C1 orf54 polypeptides and variants thereof produced, e.g. C1 orf54 polypeptides and variants thereof comprising amino acid SEQ ID NO:2, 3, or 4, as described in the method above operably linked to a heterologous promoter.
- an isolated host cell comprising one or more of said vectors.
- a process for producing a C1 orf 54 polypeptide or variant thereof according to the method above comprising (a) culturing the host cell comprising one or more of said vectors; and (b) recovering said C1 orf54 polypeptide or variant thereof.
- a method of producing a recombinant polypeptide whose amino acid sequence is at least 80%, 85%, 90%, 95%, 97%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO:10-14; or an amino acid sequence encoded by a nucleic acid having at least 80%, 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to the polynucleotide sequence of SEQ ID NO:19-23, comprising: a) providing a nucleic acid sequence operatively linked to a heterologous regulatory sequence; and b) expressing the nucleic acid of (a) under conditions that allow expression of the polypeptide, thereby producing a recombinant polypeptide.
- vectors comprising a polynucleotide selected from SEQ ID NO:19-23 encoding the C1 orf54 polypeptides and variants thereof produced, e.g. C1 orf54 polypeptides and variants thereof comprising amino acid SEQ ID NO:10-14, as described operably linked to a heterologous promoter.
- an isolated host cell comprising one or more of said vectors.
- a process for producing a C1 orf 54 polypeptide or variant thereof according to the method above comprising (a) culturing the host cell comprising one or more of said vectors; and (b) recovering said C1 orf54 polypeptide or variant thereof.
- C1 orf54 polypeptides and variants thereof can be used according to the present invention.
- the present invention contemplates use of various C1 orf54 polypeptides and variants thereof having myokine activity.
- the invention provides for use of full-length C1 orf54 polypeptide amino acid sequences or variants thereof.
- the invention provides for C1 orf54 polypeptides comprising a portion (not the full-length sequence) of the C1 orf54 sequence, or a variant thereof, that retains myokine activity.
- the C1 orf54 polypeptides of the invention comprise at least a fragment (e.g.
- the C1 orf54 proteins of the invention comprise at least a fragment (e.g. at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 105, at least 1 10 contiguous amino acids) of the human (e.g. SEQ ID NO:2) C1 orf54 protein sequence, having myokine activity.
- the C1 orf54 proteins of the invention comprise at least a fragment (e.g. at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 105, at least 1 10 contiguous amino acids) of the native mouse (e.g. SEQ ID NO: 24), canine (e.g. SEQ ID NO:32), bovine (e.g. SEQ ID NO:33) or equine (e.g. SEQ ID NO:31) C1 orf54 polypeptide sequence.
- the invention provides C1 orf54 polypeptide variants (including but not limited to any of SEQ ID NOs:1 -14) lacking at least a portion of the C-terminal sequence, e.g. lacking at least 10, 20, 30, 40, 50 amino acids from the C-terminus, e.g. 10, 20, 30, 40, 50 amino acids.
- the invention provides C1 orf54 polypeptide variants (including but not limited to any of SEQ ID NOs:1 -14) lacking at least a portion of the N-terminal sequence, e.g. lacking at least 10, 20, 30, 40, 50 amino acids from the N-terminus, e.g. 10, 20, 30, 40, 50 amino acids.
- the C1 orf54 polypeptides of the invention encompass variants and truncations of naturally-occurring C1 orf54 polypeptides as well as variants and truncations of C1 orf54 polypeptide variants described herein having myokine activity.
- the invention encompasses the use of C1 orf54 polypeptides variants and truncations of naturally- occurring C1 orf54 polypeptides having myokine activity in methods of the invention.
- Active variants having myokine activity can be identified in any number of ways known to those of skill in the art, e.g. as described herein. In some embodiments, amino acid alignments of active proteins can be established to identify those positions that are invariant or that are include conserved amino acid changes.
- one aspect of the invention provides an isolated polypeptide consisting of an amino acid sequence having at least 95%, at least 97% or at least 99% amino acid sequence identity to an amino acid sequence of SEQ ID NO:3, wherein the polypeptide has myokine activity.
- Another aspect of the invention provides an isolated polypeptide consisting of an amino acid sequence having at least 95%, at least 97% or at least 99% amino acid sequence identity to an amino acid sequence of SEQ ID NO:4, wherein the polypeptide has myokine activity.
- an isolated polypeptide comprising or consisting of an amino acid sequence selected from the group of SEQ ID NO:3 and SEQ ID NO:4, and wherein one, two, three, four or five amino acids have been modified, deleted or substituted within the sequence of any one of SEQ ID NO:3 or SEQ ID NO:4 and wherein the polypeptide has myokine activity.
- the invention provides an isolated polypeptide consisting of an amino acid sequence of SEQ ID NO:3 and wherein the polypeptide has myokine activity.
- the invention provides an isolated polypeptide consisting of an amino acid sequence of SEQ ID NO:4 and wherein the polypeptide has myokine activity.
- the C1 orf54 polypeptides of the invention can include also non-native C1 orf54 protein flanking sequences.
- a portion of the C1 orf54 polypeptide with myokine activity can be fused to one or more heterologous amino acids to form a fusion protein.
- Fusion partner sequences can include, but are not limited to, amino acid tags, non-L (e.g. D-) amino acids or other amino acid mimetics to extend in vivo half-life and/or protease resistance, targeting sequences or other sequences, e.g. the human immunoglobulin Fc fragment.
- the invention provides a C1 orf54 polypeptide fused to one or more heterologous amino acids, a peptide or protein, wherein the heterologous amino acids, peptide or fusion protein partner can include amino acid tags, in vivo half-life extenders, targeting sequences, a human immunoglobulin Fc fragment.
- the isolated C1 orf 54 polypeptide according to the invention e.g. an isolated C1 orf54 polypeptide consisting of an amino acid sequence selected from the group of SEQ ID NO:3 and SEQ ID NO:4, has myokine activity, wherein said myokine activity comprises muscle function increasing activity.
- the isolated C1 orf54 polypeptide according to the invention e.g. an isolated C1 orf54 polypeptide consisting of an amino acid sequence selected from the group of SEQ ID NO:3 and SEQ ID NO:4, has myokine activity, wherein said myokine activity comprises muscle strength increasing activity.
- the isolated polypeptide according to the invention e.g. an isolated C1 orf54 polypeptide consisting of an amino acid sequence selected from the group of SEQ ID NO:3 and SEQ ID NO:4, has myokine activity, wherein said myokine activity comprises muscle regeneration improving activity.
- compositions comprising an isolated C1 orf54 polypeptide or variants thereof having myokine activity, e.g. C1 orf54 polypeptide or variants thereof comprising an amino acid sequence of SEQ ID NO:2, 3, or 4, formulated together with a pharmaceutically acceptable carrier, excipient or diluent.
- the compositions can additionally contain one or more other therapeutic agents that are suitable for treating a medical condition.
- a pharmaceutical composition described herein can be administered by a variety of methods known in the art. The route and/or mode of administration can vary depending upon the desired results.
- the C1 orf54 polypeptides or variants thereof having myokine activity may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the compound.
- a composition e.g. a pharmaceutical composition, containing the C1 orf54 polypeptides or variants thereof disclosed herein and at least one pharmaceutically acceptable carrier, diluent or excipient.
- composition comprising a pharmaceutically effective amount of at least one polypeptide selected from:
- polypeptide consisting of amino acid sequence SEQ ID NO:2, 3, or 4;
- polypeptide comprising an amino acid sequence of SEQ ID NO:2, 3, or 4;
- polypeptide consisting of an amino acid sequence having at least 95% identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising an amino acid sequence having at least 95% identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising or consisting of an amino acid sequence, wherein one, two, three, four or five amino acids have been modified, deleted, added and/or substituted within the sequence of any one of SEQ ID NOs:2, 3, or 4;
- polypeptide has myokine activity; and at least one pharmaceutically acceptable carrier, diluent or excipient.
- composition comprising at least one polypeptide selected from:
- polypeptide consisting of amino acid sequence SEQ ID NO:2, 3, or 4;
- polypeptide comprising an amino acid sequence of SEQ ID NO:2, 3, or 4;
- iii a polypeptide consisting of an amino acid sequence having at least 95% identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising an amino acid sequence having at least 95% identity to SEQ ID NOs:2, 3, or 4;
- v.a polypeptide comprising or consisting of an amino acid sequence, wherein one, two, three, four or five amino acids have been modified, deleted, added and/or substituted within the sequence of any one of SEQ ID NOs:2, 3, or 4; and wherein said polypeptide has myokine activity; and at least one pharmaceutically acceptable carrier, diluent or excipient.
- said pharmaceutical composition is for use in the treatment of a muscle-related disorder.
- said myokine activity comprises muscle function increasing activity.
- said muscle function increasing activity is determined by the assays described herein.
- said myokine activity may comprise muscle strength increasing activity.
- said muscle strength increasing activity is determined by the assay described herein.
- said myokine activity may comprise muscle regeneration improving activity.
- said muscle regeneration improving activity is determined by the assays described herein.
- said myokine activity may comprise muscle strength increasing activity and muscle regeneration improving activity.
- the pharmaceutical compositions provided herein are for use in the treatment of a muscle-related disorder.
- the pharmaceutical compositions provided herein are for use in the treatment of a muscle-related disorder selected from or caused by muscle atrophy, orthopedic injury, muscle injury, muscle weakness, heart failure, chemotherapy, and poststroke, secondary muscle loss, sarcopenia, cachexia, obesity or metabolic syndrome.
- composition is formulated together with a pharmaceutically acceptable carrier, excipient or diluent.
- Dosage regimens are adjusted to provide the optimum desired response (e.g. a therapeutic response). For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation.
- Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subjects to be treated; each unit contains a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
- the specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals.
- a therapeutically effective amount of C1 orf54 polypeptides or variants thereof or pharmaceutical composition comprising said C1 orf54 polypeptides or variants thereof ranges from about 0.001 to 150 mg/kg, or 0.01 to 30 mg/kg, and more usually 0.1 to 10 mg/kg of the host body weight.
- a suitable effective dose which will vary depending on the route of administration (e.g. intravenously or subcutaneously). In some methods of systemic administration, dosage is adjusted to achieve a plasma concentration of C1 orf54 polypeptides or variants thereof of 1-1000 pg/ml and in some methods 25-500 pg/ml.
- the composition can be a sustained release formulation, in which case less frequent administration is required.
- Dosage and frequency vary depending on the half- life of the C1 orf54 polypeptide or variant thereof in the patient.
- the dosage and frequency of administration can vary depending on whether the treatment is prophylactic or therapeutic.
- a relatively low dosage is administered at relatively infrequent intervals over a long period of time.
- a relatively high dosage at relatively short intervals is sometimes required until progression of the disease is reduced or terminated or until the patient shows partial or complete amelioration of symptoms of disease. Thereafter, the patient can be administered a prophylactic regimen.
- Actual dosage levels of the active agents in the pharmaceutical compositions provided herein may be varied so as to obtain an amount of the active agent which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
- the selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular compositions of the present invention employed, or the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors known in the medical arts.
- An exemplary treatment regime entails administration at least once per day, at least once per week, at least once every two weeks, at least once every three weeks, at least once every four weeks, at least once a month, at least once every 3 months or at least once every three to 6 months.
- Administration of a therapeutically effective dose of C1 orf54 polypeptides or variants thereof comprised in the compositions of the invention can result in a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom-free periods, or a prevention of impairment or disability due to the disease affliction, i.e. an increase muscle strength and/or regenerative capacity of the muscle.
- C1 orf54 polypeptide or variant thereof Patients will receive an effective amount of the C1 orf54 polypeptide or variant thereof, i.e. an amount that is sufficient to treat, ameliorate, or prevent the muscle-related disorder in question.
- Therapeutic effects may also include reduction in physical symptoms. Therapeutic effects may mimic effects of exercise.
- Dosage can be by a single dose schedule or a multiple dose schedule. Dosage can be intermittently. During intermittent dosing a therapeutically effective dose of C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g.
- an intermittent dosing schedule comprises at least two cycles, each cycle comprising (a) a dosing period during which a therapeutically effective amount of C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, as described herein is administered to a patient and thereafter (b) a resting period.
- a composition of the present invention can be administered by one or more routes of administration using one or more of a variety of methods known in the art. As will be appreciated by the skilled artisan, the route and/or mode of administration will vary depending upon the desired results. Routes of administration for the therapeutic proteins of the invention include intravenous, intramuscular, intradermal, intraperitoneal, subcutaneous, local delivery, spinal or other parenteral routes of administration, for example by injection or infusion. In one embodiment the C1 orf54 polypeptides or variant thereof or composition comprising said C1 orf54 polypeptide or variant thereof are administered intravenously. In another embodiment the C1 orf54 polypeptides or variant thereof or composition comprising said C1 orf54 polypeptide or variant thereof are administered subcutaneously. In another embodiment the C1 orf54 polypeptides or variant thereof or composition comprising said C1 orf54 polypeptide or variant thereof are administered intramuscularly.
- the C1 orf54 polypeptides or variants thereof e.g. as disclosed herein or compositions comprising said C1 orf54 polypeptides or variants thereof have therapeutic utilities.
- these molecules can be administered to a subject and may be used in the treatment of a disease, prophylaxis and/or for delaying the onset of disease symptoms.
- the invention provides the C1 orf54 polypeptides or variants thereof, e.g. as disclosed herein, or compositions comprising said C1 orf54 polypeptides or variants thereof for use in therapy or as a medicament.
- the invention further provides the C1 orf54 polypeptides or variants thereof, e.g.
- the invention further provides use of the C1 orf54 polypeptides or variants thereof, e.g. as disclosed herein, or compositions comprising said C1 orf54 polypeptides or variants thereof in the manufacture of a medicament for the treatment of a pathological disorder, e.g. a muscle-related disorder.
- the invention relates to the C1 orf54 polypeptides or variants thereof, e.g. as disclosed herein, or compositions comprising said C1 orf54 polypeptides or variants thereof for use in increasing muscle function.
- said muscle function comprises increased muscle strength.
- the invention relates to the C1 orf54 polypeptides or variants thereof, e.g. as disclosed herein, or compositions comprising said C1 orf54 polypeptides or variants thereof for use in increasing muscle strength in a patient in need thereof.
- the need to increase muscle strength can result from one of the conditions mentioned herein, particularly as a consequence of a muscle-related disorder or it can result from a condition, e.g. a pathological condition, not mentioned herein, which nonetheless benefits from increased muscle function.
- said muscle function comprises improved muscle regeneration.
- said muscle function comprises increased muscle strength and improved muscle regeneration.
- the invention provides C1 orf54 polypeptides or variants thereof as described herein for use in therapy. Accordingly, the invention provides a polypeptide selected from: a. a polypeptide consisting of amino acid sequence SEQ ID NO:2, 3, or 4;
- polypeptide comprising an amino acid sequence of SEQ ID NO:2, 3, or 4;
- polypeptide consisting of an amino acid sequence having at least 95% identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising an amino acid sequence having at least 95% identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising or consisting of an amino acid sequence, wherein one, two, three, four or five amino acids have been modified, deleted, added and/or substituted within the sequence of any one of SEQ ID NOs:2, 3, or 4,
- the C1 orf54 polypeptides or variants thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4 have myokine activity.
- the C1 orf54 polypeptides or variants thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4 are for use in the treatment of a muscle-related disorder in a subject.
- the invention provides C1 orf54 polypeptides or variants thereof as described herein for use in the manufacture of a medicament.
- the invention provides a polypeptide selected from: a. a polypeptide consisting of amino acid sequence SEQ ID NO:2, 3, or 4;
- polypeptide comprising an amino acid sequence of SEQ ID NO:2, 3, or 4;
- polypeptide consisting of an amino acid sequence having at least 95% identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising an amino acid sequence having at least 95% identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising or consisting of an amino acid sequence, wherein one, two, three, four or five amino acids have been modified, deleted, added and/or substituted within the sequence of any one of SEQ ID NOs:2, 3, or 4,
- the C1 orf54 polypeptides or variants thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4 for use in the manufacture of a medicament have myokine activity.
- the C1 orf54 polypeptides or variants thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4 are for use in the manufacture of a medicament for the treatment of a muscle-related disorder in a subject.
- the invention provides a polypeptide or variant thereof for use in treating a muscle-related disorder in a subject, wherein the treatment comprises administering to the subject a polypeptide selected from:
- a a polypeptide consisting of amino acid sequence SEQ ID NO:2, 3, or 4;
- polypeptide comprising an amino acid sequence of SEQ ID NO:2, 3, or 4;
- polypeptide consisting of an amino acid sequence having at least 95% identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising an amino acid sequence having at least 95% identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising or consisting of an amino acid sequence, wherein one, two, three, four or five amino acids have been modified, deleted, added and/or substituted within the sequence of any one of SEQ ID NOs:2, 3, or 4;
- the invention provides a polypeptide or variant thereof for use in treating a muscle-related disorder in a subject, wherein the treatment comprises administering to the subject an effective amount of a polypeptide selected from: f. a polypeptide consisting of amino acid sequence SEQ ID NO:2, 3, or 4; g. a polypeptide comprising an amino acid sequence of SEQ ID NO:2, 3, or 4;
- polypeptide consisting of an amino acid sequence having at least 95% identity to SEQ ID NOs:2, 3, or 4; or
- polypeptide comprising an amino acid sequence having at least 95% identity to SEQ ID NOs:2, 3, or 4; wherein said polypeptide has myokine activity.
- the invention further provides a method of treating a patient suffering from a pathological disorder, e.g. a muscle-related disorder, comprising administering a therapeutically effective amount of a C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs: 2, 3, or 4, or pharmaceutical composition comprising said C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs: 2, 3, or 4, to said patient.
- a pathological disorder e.g. a muscle-related disorder
- a therapeutically effective amount of a C1 orf54 polypeptide or variant thereof e.g.
- a polypeptide with SEQ ID NO:2, 3 or 4 e.g. comprised in a pharmaceutical composition, having myokine activity as described herein, whereby said myokine activity comprises muscle function increasing activity.
- Said muscle function comprises muscle strength and/or muscle regeneration.
- the invention relates to a method for increasing muscle strength.
- said muscle function comprises improved muscle regeneration.
- said muscle function comprises increased muscle strength and improved muscle regeneration.
- the need to increase muscle strength can result from one of the conditions mentioned herein, particularly as a consequence of a muscle-related disorder or it can result from a condition, e.g. a pathological condition, not mentioned herein, which nonetheless benefits from increased muscle function.
- the invention provides a method of treating a muscle-related disorder comprising administering C1 orf54 polypeptides or variants thereof as described herein.
- the invention provides a method of treating a muscle-related disorder in a subject, wherein said method comprises administering to the subject a therapeutically effective amount of a polypeptide selected from: a. a polypeptide consisting of amino acid sequence SEQ ID NO:2, 3, or 4;
- polypeptide comprising an amino acid sequence of SEQ ID NO:2, 3, or 4;
- a polypeptide consisting of an amino acid sequence having at least 95% identity to SEQ ID NOs:2, 3, or 4;
- a polypeptide comprising an amino acid sequence having at least 95% identity to SEQ ID NOs:2, 3, or 4;
- polypeptide comprising or consisting of an amino acid sequence, wherein one, two, three, four or five amino acids have been modified, deleted, added and/or substituted within the sequence of any one of SEQ ID NOs:2, 3, or 4;
- the isolated C1 orf54 polypeptides or variants thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs: 2, 3, or 4, e.g. comprised in pharmaceutical compositions, of the present invention exhibit myokine activity, e.g. as indicated in vitro and in vivo tests as provided herein, e.g. as described by the modes for carrying out the invention, and are therefore indicated for therapy or for use in vivo or in vitro.
- diseases and disorders that benefit from an increase in muscle function such as muscle strength and/or from improved muscle regeneration.
- the present invention provides C1 orf54 polypeptides and variants thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs: 2, 3, or 4, e.g. comprised in pharmaceutical compositions, as described herein for use in increasing muscle strength.
- the present invention also provides C1 orf54 polypeptides and variants thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs: 2, 3, or 4, e.g. comprised in pharmaceutical compositions, as described herein for use as a medicament for increasing muscle strength.
- the present invention provides a method for increasing muscle strength in a subject in need thereof comprising administering an effective amount of a C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs: 2, 3, or 4, e.g. comprised in pharmaceutical compositions, as described herein.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs: 2, 3, or 4, e.g. comprised in pharmaceutical compositions, as described herein.
- Skeletal muscle is a tissue with high plasticity and high responsiveness to exercise. Satellite cells (muscle precursor cells) are typically activated upon exercise and injuries and play a key role in the remodeling of muscle tissue.
- MyoD is a key transcriptional factor that determines the fate of satellite cells, mainly by driving satellite cells into differentiation. Muscle precursor cells lacking MyoD resume a more stem-cell like phenotype and after injection into injured muscle, engraft with significantly higher efficiency compared to wild- type cells.
- satellite cells lacking MyoD can be detected underneath the basal lamina of muscle fibers and show increased proliferation and survival after engraftment (Asakura et al. (2007) Proc Natl Acad Sci USA 104, 16552-16557). It is therefore desirable to decrease MyoD transiently.
- the C1 orf54 polypeptides of the present invention decrease the levels of MyoD in vitro (example 5, figure 5) or in vivo (example 4, figure 4).
- C1 orf54 polypeptides or variants thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, having myokine activity for use in increasing muscle function in a subject in need thereof, comprising administering to the subject such polypeptides or pharmaceutical compositions, wherein administration of said polypeptides or pharmaceutical compositions decreases the levels of MyoD thereby promoting an increase in muscle function, suitably an increase in muscle strength and/or improved muscle regeneration, in the subject.
- a method of treating a muscle-related disorder comprising administering a therapeutically effective amount of a C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, wherein administration of said polypeptide decreases the levels of MyoD thereby promoting an increase in muscle function, suitably an increase in muscle strength and/or improved muscle regeneration, in the subject.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, wherein administration of said polypeptide decreases the levels of MyoD thereby promoting an increase in muscle function, suitably an increase in muscle strength and/or improved muscle regeneration, in the subject.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, as described herein is for use in stimulating the proliferation of myoblasts and/or for increasing the frequency or number of satellite cells.
- Said use may be an in vivo or an in vitro use, preferably an in vivo use.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, having myokine activity for use in increasing muscle function in a subject in need thereof, comprising administering to the subject said polypeptide or pharmaceutical composition, wherein administration of said polypeptide or pharmaceutical composition stimulates the proliferation of myoblasts, thereby promoting an increase in muscle function, suitably an increase in muscle strength and/or improved muscle regeneration, in the subject.
- the present invention also provides a C1 orf54 polypeptide or variant thereof, e.g.
- a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, having myokine activity for use in increasing muscle function in a subject in need thereof, comprising administering to the subject said polypeptide or pharmaceutical composition, wherein administration of the polypeptide or pharmaceutical composition increases the frequency or number of the subject's skeletal muscle stem cells or satellite cells, thereby promoting an increase in muscle function, suitably an increase in muscle strength and/or improved muscle regeneration, in the subject.
- the invention provides a method of treating a muscle-related disorder comprising administering a therapeutically effective amount of a C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, wherein administration of said polypeptide stimulates the proliferation of myoblasts, thereby promoting an increase in muscle function, suitably an increase in muscle strength and/or improved muscle regeneration, in the subject.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, wherein administration of said polypeptide stimulates the proliferation of myoblasts, thereby promoting an increase in muscle function, suitably an increase in muscle strength and/or improved muscle regeneration, in the subject.
- the invention provides a method of treating a muscle-related disorder comprising administering a therapeutically effective amount of a C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, wherein administration of said polypeptide increases the frequency or number of the subject's skeletal muscle stem cells or satellite cells, thereby promoting an increase in muscle function, suitably an increase in muscle strength and/or improved muscle regeneration, in the subject.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, wherein administration of said polypeptide increases the frequency or number of the subject's skeletal muscle stem cells or satellite cells, thereby promoting an increase in muscle function, suitably an increase in muscle strength and/or improved muscle regeneration, in the subject.
- the present invention also provides in one embodiment an in vitro method for promoting satellite cells self-renewal and/or differentiation, comprising the step of administering an effective amount of an isolated C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, to an isolated biological sample comprising satellite cells.
- a method for stimulating the proliferation and/or differentiation of satellite cells into myoblasts comprising contacting said cells with an amount of a C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g.
- the invention also provides the in vitro use of a C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, for promoting myoblast growth.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, for promoting myoblast growth.
- an in vitro method for promoting myoblast growth comprising administering an effective amount of a C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, as described herein to an isolated biological sample comprising myoblasts.
- Said biological sample can be human skeletal muscle-derived cells (hSkMDC).
- the invention provides an in vitro screening method for identifying an agent or combination of agents promoting satellite cells self-renewal and/or differentiation, comprising the steps of: a) contacting isolated satellite cells with a candidate agent or combination of candidate agents;
- step b) comparing the cell phenotype in step b) to the phenotype of satellite cells in the absence of said agent or combination of agents, and/or to the phenotype of satellite cells contacted with an isolated C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions.
- an isolated C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions.
- the C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4 is for use in a subject affected with a muscle-related disorder.
- the invention provides pharmaceutical compositions comprising a C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, for use in a subject affected with a muscle-related disorder.
- a method of treating a subject with a muscle-related disorder comprising administering a therapeutically effective dose of a C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, as described herein.
- muscle-related disorders include, but are not limited to, one or more musculoskeletal disease or disorder, such as muscle atrophy from all causes, myopathy including inherited or recessive myopathies (e.g. muscular dystrophies) and drug-induced myopathy (e.g. resulting from treatment with glucocorticoids), muscle-wasting diseases (such as cachexia that may be the result from underlying illnesses such as acquired immunodeficiency diseases [AIDS], congestive heart failure, rheumatoid arthritis, cancer, chronic obstructive pulmonary disease [COPD], liver failure or liver cirrhosis, burns, sepsis), protracted disuse (e.g.
- AIDS acquired immunodeficiency diseases
- COPD chronic obstructive pulmonary disease
- liver failure or liver cirrhosis burns, sepsis
- protracted disuse e.g.
- the invention provides compounds and pharmaceutical compositions in a method or for use in the treatment of muscle-related disorders including, but not limited to, muscle atrophy from any cause, myopathy, muscle-wasting diseases, protracted disuse, orthopedic injury, muscle injury, muscle weakness, chemotherapy, post-stroke, chronic heart failure, rhabdomyolysis, age-related conditions, e.g. sarcopenia, secondary muscle loss, obesity and/or metabolic syndrome.
- Such use or method comprises administering to a subject in need thereof an effective amount of a C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, having myokine activity.
- the muscle-related disorder is muscle wasting.
- Muscle wasting is a general term used to describe a condition marked by the involuntary loss of skeletal muscle tissue resulting from a variety of diseases, disorders, other conditions, or events. There are many causes of muscle wasting, including myopathy, drug-induced myopathy, denervation due to nerve trauma or a result of degenerative, metabolic, or inflammatory neuropathy and age-related condition of muscle atrophy or attenuation.
- the muscle atrophy results from myopathy, such as myotonia; a congential myopathy, including nemalene myopathy, multi/minicore myopathy and myotubular (centronuclear) myopathy, benign congenital hypotonia, central core disease (also known as central core myopathy); mitochondrial myopathy (e.g. Kearns-Sayre syndrome); familial periodic paralysis; inflammatory myopathy; metabolic myopathy, such as caused by a glycogen or lipid storage disease; dermatomyositisis; polymyositis; inclusion body myositis (e.g.
- the myopathy may be caused by a muscular dystrophy syndrome, such as Duchenne muscular dystrophy, Becker muscular dystrophy, myotonic muscular dystrophy, fascioscapulohumeral muscular dystrophy, Emery-Dreifuss muscular dystrophy, oculopharyngeal muscular dystrophy, limb-girdle muscular dystrophy, congenital muscular dystrophy (e.g.
- Merosin-deficient congenital muscular dystrophy Bethlem myopathy, Ullrich congenital muscular dystrophy, Fukuyama congenital muscular dystrophy), spinal muscular dystrophy, rigid spine muscular dystrophy, distal muscular dystrophy, sarcoglycanopathies or hereditary distal myopathy.
- the muscle atrophy is drug-induced myopathy, e.g. as a result of treatment with glucocorticoids such as cortisol, dexamethasone, betamethasone, prednisone, methylprednisolone, or prednisolone.
- glucocorticoids such as cortisol, dexamethasone, betamethasone, prednisone, methylprednisolone, or prednisolone.
- muscle atrophy is the result of a denervation due to nerve trauma or a result of degenerative, metabolic, or inflammatory neuropathy, including neuromuscular disease, disorder or injury (e.g. a motor neuron disease such as amyotrophic lateral sclerosis, infantile spinal muscular atrophy, juvenile spinal muscular atrophy, autoimmune motor neuropathy with multifocal conductor block), Parkinson's disease, Huntington's disease, myasthenia gravis, centronuclear myopathy (e.g. X-linked myotubular myopathy), autoimmune neurodegenerative diseases (e.g. Guillain Barre syndrome, chronic inflammatory demyelinating polyneuropathy, Lambert-Eaton myasthenia syndrome), C re utzfeldt- Jakob disease, and paralysis due to stroke or spinal cord injury.
- a motor neuron disease such as amyotrophic lateral sclerosis, infantile spinal muscular atrophy, juvenile spinal muscular atrophy, autoimmune motor neuropathy with multifocal conductor block
- the muscle atrophy is an age-related condition of muscle atrophy or attenuation that benefit from an increase in muscle function.
- muscle-related disorders include those associated with aging/senescence including, but are not limited to, sarcopenia, skin atrophy, muscle wasting, disuse muscular atrophy, atherosclerosis, arteriosclerosis, pulmonary emphysema, osteoporosis, osteoarthritis, immunologic incompetence, high blood pressure, dementia, Huntington’s disease, Alzheimer’s disease, cataracts, age-related macular degeneration, cancer, stroke, frailty, impaired kidney function, and age-related hearing loss.
- the muscle-related disorder results from skeletal immobilization (e.g. due to trauma, bed rest, voluntary inactivity, involuntary inactivity, injury), nutritional insufficiency (e.g. fasting or starvation), cardiomyopathy, myocardial infarction, angina, cancer, HIV wasting syndrome, or an endocrine disorder such as a thyroid gland or adrenal gland or pituitary gland disorder.
- the muscle-related disorder is a metabolic disorder, including Type II Diabetes, diabetes-associated muscle atrophy, metabolic Syndrome/Syndrome X/insulin resistance syndrome, hyperglycemia, obesity and obesity-associated sarcopenia.
- the muscle-related disorder is an acute muscle wasting disease such as seen in severe and moderate burn injury, including adult and pediatric burn injury suffering from loss of lean body mass and/or muscle wasting or patients suffering from sepsis and intensive-care unit (ICU) acquired weakness.
- ICU intensive-care unit
- the muscle-related disorder is cachexia that may be the result from underlying illnesses such as acquired immunodeficiency diseases [AIDS], congestive heart failure, rheumatoid arthritis, cancer, chronic obstructive pulmonary disease [COPD]) cirrhosis, burns, sepsis, multiple sclerosis, tuberculosis, human immunodeficiency virus, malnutrition, Parkinson's disease, emphysema, heart failure, motor neuron disease, cystic fibrosis, dementia, sarcopenia, chronic obstructive pulmonary disease (COPD), kidney disease, and kidney failure.
- AIDS acquired immunodeficiency diseases
- COPD chronic obstructive pulmonary disease
- the muscle-related disorder is a fracture of a limb (i.e. leg or arm), skull, spine, pelvis or joint (i.e. knee or hip).
- the muscle-related disorder is an injury or fracture to one or more of humerus, radius, ulnar, carpal bone, metacarpal bone, clavicle, scapula, femur, os coxae, patella, tibia, fibula, talus, calcaneus, tarsal bone, metatarsal bone, ischium or ileum.
- the muscle-related disorder is surgery on one or more of the following joints: knee, hip, ankle, shoulder, elbow, wrist.
- Such surgery includes replacement of one or more of hip, knee, shoulder or other joint(s).
- the present invention also provides a C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, in ameliorating the muscle wasting effects of enforced inactivity, e.g. resulting from surgery, e.g. hip or knee replacement surgery, comprising administering to the subject a polypeptide or pharmaceutical composition of the invention, wherein said polypeptide or pharmaceutical composition has myokine activity.
- a patient may be pre-treated with a C1 orf54 polypeptide or variant thereof, e.g.
- a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, prior to an anticipated period of enforced rest/inactivity. Such a period may occur when a patient is admitted to hospital, for example for surgery.
- the inactivity may be localized, such as by casting of a broken limb or joint, or by administration of a paralytic agent, or after surgery to the hip or leg or after joint replacement.
- Treatment according to the methods and uses described herein may result in reduced muscle wasting in a subject with muscle-related disorder or at risk of a muscle-related disorder. It may also result in delayed muscle wasting in a subject with muscle-related disorder or at risk of a muscle-related disorder. It may also result in suppression of muscle wasting in a subject with muscle-related disorder or at risk of a muscle-related disorder. It may also result in maintaining muscle function in a subject with muscle-related disorder or at risk of a muscle-related disorder. It may also enhance functional recovery in a subject with muscle-related disorder or at risk of a muscle-related disorder.
- a C1 orf54 polypeptide or variant thereof e.g.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, for decreasing the time until functional recovery has been achieved in a patient post-stroke.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID Nos:2, 3, or 4, e.g. comprised in pharmaceutical compositions, for enhancement of functional recovery in a subject of greater than 70 years of age.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, for enhancement of functional recovery in a subject with ICU myopathy.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, for enhancement of functional recovery in a subject with peripheral nerve injury.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, for enhancement of functional recovery in a subject with orthopedic injury with immobilization.
- a C1 orf54 polypeptide or variant thereof e.g.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, for enhancement of functional recovery in a subject with muscle weakness and/or dysfunction associated with heart failure.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, for enhancement of functional recovery in a subject with muscle weakness and/or dysfunction associated with acute kidney injury (AKI).
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, for enhancement of functional recovery in a subject with muscle weakness and/or dysfunction associated with chronic kidney injury (CKI).
- CKI chronic kidney injury
- the present invention also provides a C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, for enhancing muscle function, e.g. increased muscle strength and/or improved muscle regeneration and/or an increase in muscle fatigability resistance in a healthy subject.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, for enhancing muscle function, e.g. increased muscle strength and/or improved muscle regeneration and/or an increase in muscle fatigability resistance in a healthy subject.
- a C1 orf54 polypeptide or variant thereof e.g. a polypeptide comprising an amino acid sequence of SEQ ID NOs:2, 3, or 4, e.g. comprised in pharmaceutical compositions, preventing temporary or permanent disability in a subject immediately after injury to prevent secondary muscle loss.
- treatment with the methods and uses in accordance with the present invention will improve the subject’s physical performance.
- Physical performance may be assessed by a variety of tests, including but not limited to, Short Physical Performance Battery (SPPB), gait speed measurement, timed get-up-and-go test (TGUG), stair climb power test (SCPT), 400 m walk test and/or 6-minute walk test for distance (6MWD).
- SPPB Short Physical Performance Battery
- TGUG timed get-up-and-go test
- SCPT stair climb power test
- 6MWD 6-minute walk test for distance
- the 6-minute walk test for distance (6MWD) refers to the standard physical exercise test performed in accordance with the current clinical practice, e.g. as defined in the current practical guidelines provided by medical societies, e.g. the American Thoracic Society, e.g. as described in ATS Statement: Guidelines for the Six-Minute Walk Test, Am J Respir Crit Care Med Vol 166. pp 1 1 1 -1 17, 2002.
- SPPB Short Physical Performance Battery
- the Short Physical Performance Battery refers to the standard physical exercise test performed to assess lower extremity physical performance status by measures of three separate tests (standing balance, time to walk 8 feet (2.44 meters), and time to rise from a chair and return to the seated position 5 times) (PMID: 8126356). These three separate tests are then combined into a summary performance score on a scale from 0 to 12 SPPB points.
- the gait speed measurement as mentioned herein refers to the standard physical exercise test performed to assess the subject’s ability to walk a defined distance of between 8 feet (2.44 meters) and 6 meter walking distance. In a preferred embodiment, gait speed is assessed over a walking distance of 4 meters. Walking requires strength, coordination and balance, thereby placing demands on different organ systems, including the cardiovascular, respiratory, nervous, and musculoskeletal systems.
- the timed get-up-and-go test refers to a standard physical exercise test performed to assess a subject’s mobility. It measures the time that a person takes to rise from a chair, walk three meters, turn around, walk back to the chair, and sit down again and requires both static and dynamic strength.
- the test is performed in accordance with the recommendations by medical societies, e.g. the American Geriatrics Society/British Geriatrics Society (201 1) (J Am Geriatr Soc 59, 148-157).
- the stair climb power test refers to a functional test for assessing a subject’s lower-extremity strength, power, and balance.
- a number of test variations have been developed for different patient populations, such as knee or hip replacement (arthroplasty).
- Test variations include the number of steps, the height of the individual step (e.g. 18 cm or 20 cm), the task requirement (ascent only or ascent/decent combined), or whether the test is timed over a pre-determined number of steps or the step count is recorded for a given period of time, e.g. 9-step ascend/descend, 5-step ascend/descend 4-step ascend/descend, 30-second test, 6-step fast and self-paced.
- Muscle strength may be assessed by dynamic (e.g. 30 second chair stand test, stair climb test, knee flexion/extension) or static (e.g. hand grip dynamometry, isometric knee extension/flexion) movements across single or multiple joints and respiratory and other muscles (e.g. pulmonary function tests).
- dynamic tests e.g. 30 second chair stand test, stair climb test, knee flexion/extension
- static e.g. hand grip dynamometry, isometric knee extension/flexion
- Other commonly used tests for assessing muscle strength include bicycle ergometry, rapid dynamic contractions on resistance training machines and maximal vertical jumps
- the 30 second chair stand test (Jones et at. (1999) Res Q Exerc Sport 70, 1 13-119) as mentioned herein refers to a standard physical exercise test performed to assess a subject’s lower extremity strength and endurance. It measures the number of times a subject rises from a sitting position, coming to a full standing position and sitting down again in 30 seconds. It requires both lower extremity strength as well as endurance.
- the handgrip test as mentioned herein refers to a standard physical exercise test performed to assess a subject’s grip strength. Grip strength can be assessed with a hand dynamometer, e.g. a Jamar hand dynamometer (Lafayette Instrument Company, USA).
- a hand dynamometer e.g. a Jamar hand dynamometer (Lafayette Instrument Company, USA).
- the knee flexion/extension test refers to a standard physical exercise test performed to assess a subject’s strength of the quadriceps (knee extension) and/or hamstrings (knee flexion). Isometric, isotonic or isokinetic strength can be assessed.
- kits for treating muscle-related disorders comprise an C1 orf54 polypeptide or variant thereof, e.g. C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising SEQ ID NO:2, 3 or 4, (e.g. in liquid or lyophilized form) or a pharmaceutical composition comprising the C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising SEQ ID NO:2, 3 or 4 as described herein.
- kits may comprise means for administering the C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising SEQ ID NO:2, 3 or 4 (e.g.
- kits may contain additional therapeutic agents for treating a muscle related disorder, e.g. for delivery in combination with the enclosed C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising SEQ ID NO:2, 3 or 4.
- kits may also comprise instructions for administration of the C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising SEQ ID NO:2, 3 or 4 to treat the patient with muscle-related disorder.
- Such instructions may provide the dose, route of administration, and dosing regimen for use with the enclosed C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising SEQ ID NO:2, 3 or 4.
- kits for use treating a patient having a muscle-related disorder, comprising an C1 orf54 polypeptide or variant thereof, e.g.
- kits comprising C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising SEQ ID NO:2, 3 or 4 or a pharmaceutical composition comprising C1 orf54 polypeptide or variant thereof, e.g.
- kits additionally comprises instructions for use and means for administering said C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising SEQ ID NO:2, 3 or 4 or said pharmaceutical composition comprising said C1 orf54 polypeptide or variant thereof, e.g. a polypeptide comprising SEQ ID NO:2, 3 or 4, to a subject in need thereof.
- Construct 4 comprises residues D67 to M131 (SEQ ID NO:4), lacking the highly conserved and negatively charged N-terminal region, whereas construct 5 comprises residues Q17 to P1 16 (SEQ ID NO:3), lacking the C-terminal hydrophobic region. Both, construct 4 and 5, were fused to an N-terminal MRGSHHHHHHENLYFQSG tag (SEQ ID NO:34) containing a TEV cleavage site.
- the DNA sequence of mouse C10rf54 was purchased from GeneArt (ThermoFisher) including the optimization for expression in E. coli.
- MRGS-His6-TEV-G- mC10rf54 (aa17-148) (construct 1 )
- the insert was amplified by PCR from the GeneArt construct adding MRGS-His6-TEV-G at the N-terminus using forward primer: 5’- G AAG GAG AT AT AC AT ATGCGTGGT AG CC AT CAT C ATC ATC AC CAT G AAAAT CTGTAT TTTCAGAGCGGCCAAGAATATGATCACGAAGAAC-3’ (SEQ ID NO:36) and reverse primer:5’- GTGGTGGTGGTGCTCGAGTGCGGCCGCTTATCACATAAAATGAA CACCACCTTGC-3’ (SEQ ID NO:37).
- the PCR product was digested by Ndel/Notl and ligated into the pET26b(+) expression vector treated with the same restriction enzymes.
- the MG-mC10rf54 (aa17-148) insert was amplified by PCR from the same template using forward primer:
- the DNA fragment was cloned into a pET26b(+) backbone already containing GSS-Avi- His6 (and treated with the appropriate restriction enzymes Ndel/BamHI) via the In-Fusion technology.
- construct 6 MG-hsCI Orf (aa17-131)-GSS-Avi-His6) at GeneArt including the Ndel restriction site at the 5’ end and 2 stop codons as well as the Notl restriction site at the 3’ end.
- the DNA fragment was digested by Nde/Notl for subsequent ligation into the Ndel/Notl treated pET26b(+) expression vector.
- Constructs 3-5 and 7 were amplified from the previous construct 6 by PCR using the primers listed in Table 2. All 4 inserts were digested with Ndel/Notl and cloned in the same backbone used for the generation of construct #6.
- the ligation product was transfected into competent DH5a E. coli cells. Several colonies growing on LB/Kanamycin plates were selected and a plasmid DNA preparation was carried out. Positive clones were identified afterwards by sequence
- Expression plasmids were transformed into Escherichia coli strain BL21 -Gold (DE3) (Agilent). For all constructs, 1 -liter Terrific Broth media was inoculated with an over-night pre-culture. Fermentation was performed in a DASGIP bioreactor system (Eppendorf). Cultures were grown at 37°C until the trigger point of pH 7.01 was reached. At this point, expression was induced by the addition of 1 mM IPTG. For constructs 1 , 2, 4, and 7 cultivation continued at 37°C for 5 hours. For constructs 3, 5, and 6 temperature was lowered to 20°C and cultivation continued for 14 hours. At the end of the cultivation phase, cultures were harvested by centrifugation. Cell pellets were stored at -20°C and delivered to purification for further downstream processing.
- E. coli cells containing either of these constructs were suspended in 0.1 M Tris/HCI, 0.1 M NaCI, 1 mM EDTA, 3 mM L-methionine, pH 7.0, using 10 ml buffer for 1 g of wet cell pellet, and supplemented with 1 completeTM protease inhibitor cocktail tablet (Roche) per 100 ml. 0.1 mg/ml of chicken egg white lysozyme were added and the suspension gently stirred at 4°C.
- the pellet was washed 1x with 1 volume of 50 mM Tris/HCI, 20 mM EDTA, 0.6 M NaCI, 3 mM L-methionine, pH 7.0, and 3x with 1 volume 50 mM Tris/HCI, 0.3 M NaCI, pH 7.0, at 4°C, and centrifuged for 30 min at l O’OOOx g and 4°C after each washing step. Inclusion body pellets were stored at -20°C before further processing.
- IBs IBs
- 20 ml 6 M GdmCI 10 mM Tris, 100 mM monobasic phosphate, adjusted with NaOH to pH 8.0 (buffer A1 ), with 5 mM DTT, overnight at ambient temperature.
- the resulting denatured protein solution was clarified by centrifugation for 30 min at >10’000x g at ambient temperature and sterile-filtered afterwards.
- the solution was loaded on a 5 ml HisTrap excelTM IMAC column (GE Healthcare) equilibrated with buffer A1 , incl. 5 mM DTT, at 7°C.
- the column was washed with 100ml 10 mM Tris/HCI, 30 % isopropanol, pH 8.0, followed by 100 ml buffer A1 .
- Bound protein was eluted with 6 M GdmCI, 10 mM Tris, 100 mM monobasic phosphate, adjusted with HCI to pH 4.5 (buffer A2) in a single step. 1 .8 ml fractions were collected and analyzed by SDS-PAGE. Fractions containing the protein of interest were pooled.
- the pool was then mixed in a 1 :1 ratio with 2 M L-Arg-HCI, supplemented with 5 mM DTT and dialyzed overnight against PBS, pH 7.3, containing 1 mM DTT.
- the dialyzed sample was concentrated to the desired concentration using PEG 35,000 (Brooks et al. (1962) Trans, 2(4) :216-264) and sterile-filtered.
- Constructs 2 and 6, containing a C- terminal tag, were polished either by gel filtration or, directly after the denaturing IMAC, by RP-HPLC as described for the enzymatically cleaved constructs below.
- Construct 5 was expressed soluble in the cytosol of E.
- coli cells containing this construct were suspended in 50 mM monobasic phosphate, 500 mM NaCI, 20 mM imidazole, adjusted with NaOH to pH 8 (buffer A2), supplemented with 1 completeTM protease inhibitor cocktail tablet (Roche) per 50 ml, 30 U/ml Benzonase® (Merck), and 10 mM MgCI 2 , using 10 ml buffer for 1 g of wet cell pellet.
- Cells were lyzed by high pressure (2 passages at 800 bar and ambient temperature) using an APV 2000 laboratory homogenizer (SPX Flow). The lysate was centrifuged for 30 min at l O’OOOx g and 4 °C.
- the supernatant was filtered (0.22 urn) and loaded overnight on a 5 ml HisTrap excelTM IMAC column (GE Healthcare) equilibrated with buffer A2. After washing to A280 baseline signal, the protein was eluted by a liner gradient from 20 to 500 mM imidazole in buffer A2 over 10 column volumes. 1 .8 ml fractions were collected and analyzed by SDS-PAGE. Fractions containing the protein of interest were pooled and dialyzed overnight against PBS, pH 7.3, 1 mM DTT for enzymatic cleavage of the tag.
- the N-terminal tag was enzymatically cleaved off by addition of AcTEVTM protease (Thermo Fisher Scientific) to the respective sample (200 U/mg) followed by incubation for 3 h at 30 °C. Enzymatic cleavage was confirmed by MS. To facilitate separation of cleaved from remaining uncleaved protein and protease, the sample was dialyzed against buffer A1 with 5 mM DTT. The dialyzed protein was filtered and loaded on a 5 ml_ HisTrap excelTM IMAC column (GE Healthcare) equilibrated with buffer A1 , incl. 5 mM DTT, and the flow-through was collected.
- AcTEVTM protease Thermo Fisher Scientific
- the fractions containing the cleaved protein were pooled and either dialyzed overnight against PBS, pH 7.3, 1 mM DTT, followed by concentration using PEG 35,000, or loaded on a POROSTM 20 R1 (Thermo Fisher Scientific), 95x15 mm (17 ml) or 250x20 mm (78 ml),RP-HPLC column equilibrated with 25 mM ammonium bicarbonate at 8 ml/min and 50°C, and, after washing to A280 baseline signal with equilibration buffer, eluted at 8 ml/min and 50°C with a linear gradient from 0 to 75 % ethanol in 20 column volumes or with a step gradient to 75 % ethanol.
- Fractions containing the protein of interest were pooled and dialyzed for >24 h against PBS, pH 7.3 at 4 degrees, and finally sterile-filtered.
- Inclusion bodies of construct 7 were solubilized in 6 M urea, 20 mM Tris/HCI, 5 mM EDTA, pH 8 (buffer A3), incl. 0.2 M sodium sulfite. The solution was centrifuged for 30 min at 10,000x g, sterile-filtered, purified by RP-HPLC as described above, dialyzed against PBS, and sterile-filtered.
- mice at the age of 7-8 weeks were purchased from Charles River Laboratories. Mice were acclimatized to the research facility for seven days. They were housed at 25°C with a 12:12 h light-dark cycle and were fed a standard laboratory diet containing 18.2% protein and 3.0% fat with an energy content of 15.8 MJ/kg (Nafag, product # 3890, Kliba, Basel, Switzerland). Food and water were provided ad libitum. Sedentary control animals were housed in groups of two. Animals subjected to exercise were singly housed and had continuous access to running wheels (Low-Profile Wireless Running Wheel for Mouse, Med Associates Inc, Product #: ENV-047) for seven days.
- mice from the groups with access to running wheels were additionally subjected to a single bout of exercise on a treadmill (Panlab, Harvard Apparatus) for 25 minutes and were then euthanized with 0O 2 at specific time points, i.e. immediately, 30, 60 or 180 minutes post-treadmill exercise.
- Animals from the sedentary control group were euthanized on the same day.
- Quadriceps muscles were rapidly dissected and snap-frozen in liquid nitrogen.
- Total RNA was extracted from quadriceps muscle using standard procedures (TRIzol reagent (Invitrogen) and the QIAcube technology (Qiagen)).
- RNA quality and amount were measured with a Bioanalyzer (Bioanalyzer 2100 Agilent).
- Libraries were generated using a ribosome RNA depletion protocol. Sequencing was performed using lllumina HiSeq2500 stranded paired end sequencing. Reads were mapped using star onto the mouse reference genome version mm10 and counts were generated using feature counts using gene level parameters. Reported counts are FPKM (Fragment per Kb per million).
- Example 3 Muscle C10RF54 mRNA is increased in humans following exercise Method: A publically available dataset (GSE97084) with transcriptomics data from vastus lateralis biopsies from humans undergoing various types of exercise (Robinson et al. (2017) Cell Metab 25, 581-592) was re-analyzed for expression levels of C10RF54. Reported counts are FPKM (Fragment per Kb per million).
- Example 4 C1orf54 regulates the transcription of Myodl in vivo
- mice at the age of 7-8 weeks were purchased from Charles River Laboratories. Mice were acclimatized to the research facility for seven days. They were housed at 25°C with a 12:12 h light-dark cycle and were fed a standard laboratory diet containing 18.2% protein and 3.0% fat with an energy content of 15.8 MJ/kg (Nafag, product # 3890, Kliba, Basel, Switzerland). Food and water were provided ad libitum.
- mice received a single intraperitoneal injection of vehicle (PBS) or isolated polypeptide with amino acid sequence of SEQ ID NO:25 formulated in vehicle. 60 minutes after the injection, mice were euthanized with C0 2 and gastrocnemius muscles were excised and snap-frozen in liquid nitrogen. Total RNA was extracted from gastrocnemius muscles using TRIzol reagent (Invitrogen) according to manufacturer’s instructions. Reverse transcription was performed with random hexamers on 1 pg of total RNA using a high-capacity reverse transcription kit (Applied Biosystems).
- Real-time PCR was performed in duplicates in 384- well plates on a C1000 Thermal cycler (CFX384 Real-Time system, Bio-Rad) using specific TaqMan probes for myogenic differentiation 1 (Myodl, Mm00440387_m1 , Applied Biosystems) and two housekeeping genes ( Tbp , Mm00446971_m1 , Applied Biosystems and ( Hprt , Mm03024075_m2, Applied Biosystems). Automatic settings were applied to determine the CT. The comparative method using 2 ⁇ DDet was used to determine the relative expression. Two housekeeping genes were used for normalization (Tbp, Mm00446971_m1 , Applied Biosystems and Hprt, Mm03024075_m2, Applied Biosystems). All results are expressed as fold changes over vehicle.
- C1 orf54 reduces the mRNA levels of Myodl in gastrocnemius 60 minutes after a single intraperitoneal injection of 0.5 or 1 mg/kg of isolated polypeptide with amino acid sequence of SEQ ID NO:25 as compared to vehicle ( Figure 4).
- MyoD1 is a key transcriptional factor that determines the fate of satellite cells, mainly by driving satellite cells into differentiation. Satellite cells are involved in muscle growth, maintenance, repair and regeneration (Wang and Rudnicki (201 1) Nat Rev Mol Cell Biol 13, 127-133). Muscle precursor cells lacking MyoD1 resume a more stem-cell like phenotype and after injection into injured muscle, engraft with significantly higher efficiency and show increased survival compared to wild-type cells.
- MyoD1 negative myoblast-derived satellite cells can be detected underneath the basal lamina of muscle fibers after engraftment, indicating self-renewal properties of MyoD1 negative myoblasts (Asakura et al. (2007) Proc Natl Acad Sci USA 104, 16552-16557).
- the activity of C1 orf54 therefore, affects myogenic differentiation by downregulating MyoD1 , thereby promoting a stem-cell like phenotype.
- C1 orf54 therefore comprises muscle function improving activity.
- Example 5 C1orf54 inhibits the transcription of MYOD1 in human muscle cells in vitro
- cells were treated with 125, 250, 500, 1000 ng/ml_ recombinant tag-free human C1 orf54 protein aa 17-131 (SEQ ID NO:2; Mybiosource, MBS 1284901 lot 03095), solvent control (33 pM Tris-HCI, 3.3 pM EDTA and 0.07% glycerol) or were not treated for 6h at 37°C. Subsequently, cells were lysed and total RNA extracted using Direct-zol kit according to manufacturer’s instructions (Zymo research).
- cDNA was synthesized using High-Capacity cDNA archive kit (Applied Biosystems 4368813) and MYOD1 gene expression was determined by quantitative PCR using TaqMan gene expression master mix (Applied Biosystems #4369016), TaqMan assay (Hs00159528_m1 , Applied Biosystems) and a ABI PRISM 7000 sequence detection system (Applied Biosystems). The comparative method using 2 ⁇ DDet was used to determine the relative expression. Gene expression was normalized to the three housekeeping genes GAPDH (4310884E, Applied Biosystems), TBP (Hs00427620_m1 , Applied Biosystems) and HPRT (Hs01003268_g1 , Applied Biosystems).
- Example 6 C1orf54 increases muscle force in vivo
- mice at the age of 12 weeks were purchased from Charles River Laboratories. Mice were acclimatized to the research facility for seven days, housed at 25°C with a 12:12 h light-dark cycle and fed a standard laboratory diet containing 18.2% protein and 3.0% fat with an energy content of 15.8 MJ/kg (Nafag, product # 3890, Kliba, Basel, Switzerland). Food and water were provided ad libitum.
- mice were randomized by body weight and treated by intraperitoneal injections of vehicle (PBS) or 1 mg/kg of isolated polypeptide with amino acid sequence of SEQ ID NO:25 formulated in vehicle every third day. Each mouse received three injections in total (on day 1 , 4 and 7, where day 1 is defined as the first day an animal receives an injection). On day 9 evoked muscle force was assessed noninvasively. To this end, the animals were anesthetized, the leg shaved and muscle contraction was evoked via electrical stimulation of the hind leg through transcutaneous electrodes. The electrodes were affixed to the quadriceps and the foot.
- mice treated with C1 orf54 display approximately 15% higher absolute muscle force compared to vehicle treated animals.
- Specific force is assessed by normalizing absolute muscle force for the weight of the gastrocnemius muscle, which mainly contributes to the contraction monitored.
- Specific evoked force at higher stimulation frequencies is approximately 13% higher in C1 orf54 compared to vehicle treated animals ( Figure 6B). This demonstrates that intermittent administration of C1 orf54 polypeptide increases muscle strength.
- Example 7 C1orf54 increases the number of Pax7 positive satellite cells in vivo Method: Male C57BL/6 mice at the age of 12 weeks were purchased from Charles River Laboratories. Mice were acclimatized to the research facility for seven days, housed at 25°C with a 12:12 h light-dark cycle and fed a standard laboratory diet containing 18.2% protein and 3.0% fat with an energy content of 15.8 MJ/kg (Nafag, product # 3890, Kliba, Basel, Switzerland). Food and water were provided ad libitum.
- mice were randomized by body weight and treated with intraperitoneal injections of vehicle (PBS) or 1 mg/kg of isolated polypeptide with amino acid sequence of SEQ ID NO: 25 formulated in vehicle every third day. Each mouse received four injections in total (on day 1 , 4, 7 and 10, where day 1 is defined as the first day an animal receives an injection). On day 1 1 , animals were euthanized with C0 2 and the gastrocnemius muscle was rapidly dissected out, embedded in OCT (Tissue-Tek) and frozen in liquid nitrogen-cooled isopentane.
- OCT tissue-Tek
- Frozen muscles were cut into 8 pm cross-sections, which were dried at room temperature for ⁇ 2 hour and stored at -20°C in a plastic box tightly sealed in a bag. On the day of the staining, slides were taken out of the freezer, dried at room temperature for 30 minutes and fixed with 3% paraformaldehyde for 10 min. Sections were then blocked with Vector M.O.M blocking reagent (Vector Laboratories, Cat. #MKB-2213, diluted 1/100) and 10% goat serum in PBTX (PBS containing 0.2% Triton X100) for 30 minutes.
- Vector M.O.M blocking reagent Vector Laboratories, Cat. #MKB-2213, diluted 1/100
- PBTX PBS containing 0.2% Triton X100
- the sections were incubated overnight with a primary antibody against Pax7 (Developmental Studies Hybridoma Bank (DSHB)) in blocking buffer at 4°C.
- Pax7 Developmental Studies Hybridoma Bank (DSHB)
- the Pax7 hybridoma developed by A. Kawakami at the Tokyo Institute of Technology was obtained from the DSHB, created by the NICHD of the NIH and maintained at The University of Iowa, Department of Biology, Iowa City, IA 52242.
- the mouse antibody was purified at Novartis from hybridoma and detects the antigen amino acids 352-523 of chicken Pax7).
- PBTX a bridging antibody
- Example 8 C1orf54 promotes proliferation of human myoblasts in vitro
- cells were treated with 1000 ng/mL recombinant tag-free human C1 orf54 protein aa 17-131 (SEQ ID NO:2; Mybiosource, MBS 1284901 lot 03095), C1 orf54 MBS solvent control (53 pM Tris-HCI, 5.3 pM EDTA and 0.26% glycerol) or 1 % PBS control.
- Cell growth as percent (%) confluence was measured by life cell imaging (2 images per well every 4h) using an IncuCyte FL Live-Cell analysis system (Essen BioScience, Ltd.).
- Recombinant human C1 orf54 protein (SEQ ID NO:2; aa17-131) enhanced the growth of human myoblasts clearly and persistently starting 2 days after treatment until the end of the experiment at day 6 compared to control cells treated with C1 orf54 protein solvent (Figure 8). Cells continuously grew under all conditions, but with different speeds. These data demonstrate that C1 orf54 stimulates the growth of muscle precursor cells.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Toxicology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Physical Education & Sports Medicine (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Neurology (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Marine Sciences & Fisheries (AREA)
- Endocrinology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3106518A CA3106518A1 (en) | 2018-08-02 | 2019-07-31 | New myokines and uses thereof |
| KR1020217005407A KR20210041580A (ko) | 2018-08-02 | 2019-07-31 | 새로운 마이오카인 및 이의 용도 |
| EP19769570.3A EP3829620B1 (en) | 2018-08-02 | 2019-07-31 | New myokines and uses thereof |
| AU2019313506A AU2019313506A1 (en) | 2018-08-02 | 2019-07-31 | New myokines and uses thereof |
| JP2021505195A JP2021533113A (ja) | 2018-08-02 | 2019-07-31 | 新規なマイオカイン及びその使用 |
| US17/264,156 US20220144908A1 (en) | 2018-08-02 | 2019-07-31 | New myokines and uses thereof |
| CN201980049908.2A CN112512553A (zh) | 2018-08-02 | 2019-07-31 | 新的肌肉因子及其用途 |
| IL280369A IL280369A (en) | 2018-08-02 | 2021-01-24 | Myokines and their uses |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP18187131.0 | 2018-08-02 | ||
| EP18187131 | 2018-08-02 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020026167A1 true WO2020026167A1 (en) | 2020-02-06 |
Family
ID=63144838
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2019/056537 Ceased WO2020026167A1 (en) | 2018-08-02 | 2019-07-31 | New myokines and uses thereof |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US20220144908A1 (https=) |
| EP (1) | EP3829620B1 (https=) |
| JP (1) | JP2021533113A (https=) |
| KR (1) | KR20210041580A (https=) |
| CN (1) | CN112512553A (https=) |
| AU (1) | AU2019313506A1 (https=) |
| CA (1) | CA3106518A1 (https=) |
| IL (1) | IL280369A (https=) |
| TW (1) | TW202019457A (https=) |
| WO (1) | WO2020026167A1 (https=) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113424794B (zh) * | 2021-04-16 | 2022-07-26 | 安徽农业大学 | 一种优质抗病型地方鸡新品系选育方法 |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998042738A1 (en) | 1997-03-21 | 1998-10-01 | Human Genome Sciences, Inc. | 87 human secreted proteins |
| WO1999018127A1 (en) | 1997-10-02 | 1999-04-15 | Genetics Institute, Inc. | Secreted proteins and polynucleotides encoding them |
| EP1104808A1 (en) | 1999-08-05 | 2001-06-06 | Genset | ESTs and encoded human proteins |
| WO2003004532A2 (en) * | 2001-07-05 | 2003-01-16 | Geneprot, Inc. | Q9ul33/q9nzz4 and q9h5p3 splice variants |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2004313167A (ja) * | 2003-02-24 | 2004-11-11 | Joji Inasawa | 薬剤耐性マーカーおよびその利用 |
-
2019
- 2019-07-31 US US17/264,156 patent/US20220144908A1/en not_active Abandoned
- 2019-07-31 AU AU2019313506A patent/AU2019313506A1/en not_active Abandoned
- 2019-07-31 EP EP19769570.3A patent/EP3829620B1/en active Active
- 2019-07-31 KR KR1020217005407A patent/KR20210041580A/ko not_active Ceased
- 2019-07-31 CA CA3106518A patent/CA3106518A1/en active Pending
- 2019-07-31 TW TW108127274A patent/TW202019457A/zh unknown
- 2019-07-31 WO PCT/IB2019/056537 patent/WO2020026167A1/en not_active Ceased
- 2019-07-31 JP JP2021505195A patent/JP2021533113A/ja active Pending
- 2019-07-31 CN CN201980049908.2A patent/CN112512553A/zh active Pending
-
2021
- 2021-01-24 IL IL280369A patent/IL280369A/en unknown
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998042738A1 (en) | 1997-03-21 | 1998-10-01 | Human Genome Sciences, Inc. | 87 human secreted proteins |
| WO1999018127A1 (en) | 1997-10-02 | 1999-04-15 | Genetics Institute, Inc. | Secreted proteins and polynucleotides encoding them |
| EP1104808A1 (en) | 1999-08-05 | 2001-06-06 | Genset | ESTs and encoded human proteins |
| WO2003004532A2 (en) * | 2001-07-05 | 2003-01-16 | Geneprot, Inc. | Q9ul33/q9nzz4 and q9h5p3 splice variants |
Non-Patent Citations (44)
| Title |
|---|
| "ATS Statement: Guidelines for the Six-Minute Walk Test", AM J RESPIR CRIT CARE MED, vol. 166, 2002, pages 111 - 117 |
| "Remington The Science and Practice of Pharmacy", 2013, PHARMACEUTICAL PRESS, pages: 1049 - 1070 |
| "The UniProt Consortium", NUCLEIC ACIDS RESEARCH, vol. 45, no. D1, 2017, pages D 158 - D169 |
| "UniProt", Database accession no. Q8R2K8 |
| ADDISON ET AL., ARCH PHYS MED REHABIL., vol. 99, no. 4, 2018, pages 623 - 628 |
| ASAKURA ET AL., PROC NATL ACAD SCI USA, vol. 104, 2007, pages 16552 - 16557 |
| AUSUBEL ET AL., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, 1995 |
| BROOKS ET AL., TRANS, vol. 2, no. 4, 1962, pages 216 - 264 |
| COLLINS ET AL., BMJ OPEN, vol. 4, 2014, pages e003697 |
| CRUZ-JENTOFT ET AL., AGE AGEING, vol. 39, 2010, pages 412 - 423 |
| DIRKS ET AL., DIABETES, vol. 65, 2016, pages 2862 - 2875 |
| EDGAR, NUCLEIC ACIDS RESEARCH, vol. 32, no. 5, 2004, pages 1792 - 1797 |
| EL SCHEICH TWEBER A-AKLEE DSCHWEIGER DMAYATEPEK EKARENFORT M, J PEDIATR ENDOCRINOL METAB JPEM., vol. 26, no. 1 - 2, 2013, pages 161 - 165 |
| ELKINA ET AL., J CACHEXIA SARCOPENIA MUSCLE, vol. 2, 2011, pages 143 - 151 |
| FIELDING ET AL., J AM MED DIR ASSOC, vol. 12, 2011, pages 249 - 256 |
| GEORGIOU ET AL., CLIN NUTRESPEN, vol. 24, 2018, pages 185 - 186 |
| GIUDICETAYLOR, CURR OPIN PHARMACOL, vol. 34, 2017, pages 49 - 55 |
| GREGORY ET AL., NATURE, vol. 441, 2006, pages 315 - 321 |
| HARTLEY, GENOME RES, vol. 10, 2000, pages 1788 - 1795 |
| HAYASHIDA ITANIMOTO YTAKAHASHI YKUSABIRAKI TTAMAKI J, PLOS ONE, vol. 9, no. 11, 3 November 2014 (2014-11-03), pages e111810 |
| JONES ET AL., THORAX., vol. 70, 2015, pages 213 - 8 |
| JONES, RES Q EXERC SPORT, vol. 70, 1999, pages 113 - 119 |
| KUANGRUDNICKI, TRENDS MOL MED, vol. 14, 2008, pages 82 - 91 |
| LANDI ET AL., OSTEOPOROS INT., vol. 28, 2017, pages 1569 - 1576 |
| MEEKMADILL, CLIN NUTR ESPEN., vol. 22, 2017, pages 76 - 80 |
| MUSCARITOLI ET AL., CLIN NUTR, vol. 29, 2010, pages 154 - 159 |
| NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 |
| PEARSONLIPMAN, PROC. NAT'L. ACAD. SCI. USA, vol. 85, 1988, pages 2444 |
| PEDERSENFEBBRAIO, NAT REV ENDOCRINOL, vol. 8, 2012, pages 457 - 465 |
| PEDERSENSALTIN, SCAND J MED SCI SPORTS, vol. 25, no. 3, 2015, pages 1 - 72 |
| POPE HGKANAYAMA GATHEY ARYAN EHUDSON JIBAGGISH A, AM J ADDICT AM ACAD PSYCHIATR ALCOHOL ADDICT., vol. 23, no. 4, 2014, pages 371 - 377 |
| ROBINSON ET AL., CELL METAB, vol. 25, 2017, pages 581 - 592 |
| RYAN, ARCH PHYS MED REHABIL., vol. 98, no. 3, 2017, pages 495 - 499 |
| SABOURIN ET AL., J CELL BIOL, vol. 144, 1999, pages 631 - 643 |
| SAITOH ET AL., EXPERT REV CARDIOVASC THER., vol. 16, no. 2, 2018, pages 133 - 142 |
| SILBERBERG, AMANDA BETH; WADDELL, THOMAS K.: "Evaluating the Impact of Novel Bone Marrow Cell-secreted Factors, C19orf10 and C1orf54 , on Immunomodulation, Lung Cell Proliferation, and Resistance to Injury (Masters thesis)", 2017, PROQUEST LLC, Ann Arbor Michigan, ISBN: 978-1-369-68175-8, XP002788439 * |
| SMITHWATERMAN, ADV. APPL. MATH., vol. 2, 1970, pages 482c |
| STRAUSBERG, PROC NATL ACAD SCI U S A, vol. 99, 2002, pages 16899 - 16903 |
| URHAUSEN AALBERS TKINDERMANN W, HEART BR CARD SOC., vol. 90, no. 5, 2004, pages 496 - 501 |
| VANBERG PATAR D, HANDB EXP PHARMACOL., vol. 195, 2010, pages 411 - 457 |
| WALL ET AL., AGEING RES REV, vol. 12, 2013, pages 898 - 906 |
| WANGRUDNICKI, NAT REV MOL CELL BIOL, vol. 13, 2011, pages 127 - 133 |
| WATERHOUSE, BIOINFORMATICS, vol. 25, no. 9, 2009, pages 1189 - 1191 |
| ZERBINO ET AL., NUCLEIC ACIDS RESEARCH, vol. 46, no. D1, 2018, pages D754 - D761 |
Also Published As
| Publication number | Publication date |
|---|---|
| US20220144908A1 (en) | 2022-05-12 |
| AU2019313506A1 (en) | 2021-01-14 |
| JP2021533113A (ja) | 2021-12-02 |
| CA3106518A1 (en) | 2020-02-06 |
| IL280369A (en) | 2021-03-01 |
| TW202019457A (zh) | 2020-06-01 |
| CN112512553A (zh) | 2021-03-16 |
| KR20210041580A (ko) | 2021-04-15 |
| EP3829620A1 (en) | 2021-06-09 |
| EP3829620B1 (en) | 2024-05-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7829511B2 (ja) | Larファミリーホスファターゼの活性を阻害する組成物及び方法 | |
| JP6786544B2 (ja) | 成長ホルモン断片の使用 | |
| TWI427084B (zh) | 穩定化之類胰島素生長因子多肽 | |
| RU2764197C1 (ru) | Аналоги инсулина с пониженной аффинностью к рецептору инсулина и их применение | |
| EA035158B1 (ru) | Пептиды и композиции для лечения повреждений суставов | |
| Zhu et al. | Potential of food protein-derived bioactive peptides against sarcopenia: a comprehensive review | |
| CA3149188A1 (en) | Materials and methods for treating friedreich's ataxia | |
| JP2023116739A (ja) | Apoc-ii模倣ペプチド | |
| CN101610783A (zh) | 脊髓损伤治疗剂 | |
| EP1294866B1 (en) | Use of acrp30 globular head to promote increases in muscle mass and muscle differentiation | |
| EP3829620B1 (en) | New myokines and uses thereof | |
| AU754982B2 (en) | Compositions for promoting nerve regeneration | |
| EP2864353B1 (en) | Selective cartilage therapy | |
| EP2862577B1 (en) | Use of obestatin for muscle regeneration | |
| JP2019525931A (ja) | ヒト成長ホルモンアナログによる成人成長ホルモン欠乏症の処置 | |
| KR20230142502A (ko) | 골관절염 통증 치료를 위한 link-tsg6의 용도 | |
| EA042134B1 (ru) | МИМЕТИЧЕСКИЕ ПЕПТИДЫ apoC-II | |
| HK40005790A (en) | Insulin analog having reduced binding force to insulin receptor, and use thereof | |
| HK40005790B (en) | Insulin analog having reduced binding force to insulin receptor, and use thereof | |
| HK1133822A (en) | Stabilized insulin-like growth factor polypeptides | |
| AU2006203279A1 (en) | Use of ACRP30 globular head to promote increases in muscle mass and muscle differentiation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19769570 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2019313506 Country of ref document: AU Date of ref document: 20190731 Kind code of ref document: A Ref document number: 3106518 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2021505195 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20217005407 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2019769570 Country of ref document: EP Effective date: 20210302 |