WO2019235876A1 - C-src의 발현 또는 활성 억제제를 포함하는 시누클레인병증의 예방 또는 치료용 약학 조성물 - Google Patents

C-src의 발현 또는 활성 억제제를 포함하는 시누클레인병증의 예방 또는 치료용 약학 조성물 Download PDF

Info

Publication number
WO2019235876A1
WO2019235876A1 PCT/KR2019/006870 KR2019006870W WO2019235876A1 WO 2019235876 A1 WO2019235876 A1 WO 2019235876A1 KR 2019006870 W KR2019006870 W KR 2019006870W WO 2019235876 A1 WO2019235876 A1 WO 2019235876A1
Authority
WO
WIPO (PCT)
Prior art keywords
src
syn
synuclein
expression
activity
Prior art date
Application number
PCT/KR2019/006870
Other languages
English (en)
French (fr)
Inventor
박상면
최유리
김재봉
Original Assignee
아주대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 아주대학교산학협력단 filed Critical 아주대학교산학협력단
Priority to CN201980046255.2A priority Critical patent/CN112384248A/zh
Publication of WO2019235876A1 publication Critical patent/WO2019235876A1/ko
Priority to US17/113,630 priority patent/US20210101966A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16—Anti-Parkinson drugs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5058—Neurological cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/28—Neurological disorders
    • G01N2800/2835—Movement disorders, e.g. Parkinson, Huntington, Tourette

Definitions

  • the present invention relates to a composition for inhibiting the aggregation and / or metastasis of alpha-synuclein ( ⁇ -Synuclein; ⁇ -Syn), more specifically, the aggregation of alpha-synuclein including inhibitors of c-src expression or activity and It relates to a pharmaceutical composition for preventing or treating synucleinopathy comprising a composition for inhibiting metastasis and an inhibitor for expression or activity of c-src.
  • Parkinson's disease is the second most common degenerative brain disease after Alzheimer's disease, and the most common degenerative motor disease.
  • the number of patients with the disease is estimated to be more than 1% of elderly people over 60 years old. In Korea, the number of patients is increasing from 40,000 in 2004 to 66,000 in 2008 and 93,000 in 2012. The number of patients is expected to increase more rapidly in the future.
  • Parkinson's disease The exact cause of Parkinson's disease is not yet known, but hereditary Parkinson's disease is known to be caused by various genetic variations such as alpha-synuclein, parkin, PINK1, DJ-1, and LRRK2. .
  • hereditary Parkinson's disease is known to be caused by various genetic variations such as alpha-synuclein, parkin, PINK1, DJ-1, and LRRK2.
  • the cause of oxidative stress, abnormality of mitochondria, and problems of intracellular protein removal function (Lees, AJ, et al, Lancet , 373: 2055-66, 2009)
  • the disease is caused by environmental influences.
  • the incidence of Parkinson's disease is based on clinical symptoms, and the treatment is also conservative treatment to alleviate the symptoms rather than solve the causes. Therefore, it is urgent to identify the etiology and find a suitable treatment method accordingly. Is emerging.
  • Alpha-synuclein is a major constituent protein of Lewy body in the cytoplasm found in Parkinson's disease, distributed mainly at the presynapse ends of neurons, and the overall brain It is known that large amounts are expressed in tissues.
  • Alpha-synuclein is involved not only in Parkinson's disease but also in the pathogenesis of other degenerative diseases such as Dementia with Lewy bodies and Multiple system atrophy, which are associated with abnormal deposition of alpha-synuclein.
  • the diseases are collectively referred to as synucleinopathy, and research on alpha-synuclein as a common therapeutic target of these diseases is being actively conducted.
  • alpha-synuclein has the property of forming agglomerates, and it has been suggested that the denatured process of monomer alpha-synuclein agglutination may be a major cause of Parkinson's disease (Eschbach, J., Danzer, KM, Neurodegener Dis , 14: 1-17, 2013), and thereafter, duplications and triplicates of the gene have been found in familial Parkinson's disease, leading to efforts to find the function of alpha-synuclein. It is progressing more actively.
  • Parkinson's disease treatment comprising a long oak extract as an active ingredient, which can significantly protect dopamine neurons from neurotoxicity caused by the aggregation of alpha-synuclein
  • Pharmaceutical compositions have been developed (Korean Patent No.1189191). However, the specific receptors on which alpha-synuclein works and the mechanisms thereof are still unknown.
  • the denaturation process by which monomers of protein are aggregated is not only alpha-synuclein of Parkinson's disease, but also amyloid beta (A ⁇ ), tau, and mutated huntingtin of Huntington's disease of Alzheimer's disease, It is a phenomenon that occurs in the prion of the prion disease, and this degeneration process is considered to be a common cause of many degenerative brain diseases, and researches to treat the degenerative brain disease by suppressing it are being actively conducted.
  • receptors or structures that are involved in intracellular signaling by alpha-synuclein located outside the cells may be important clues to elucidate the pathogenesis of many types of degenerative brain diseases.
  • alpha-synuclein located outside the cells
  • the present inventors have made intensive studies to determine the mechanism of action of alpha-synuclein to transfer to adjacent cells. As a result, the inventors confirmed that c-src activation is involved in the formation and transfer of alpha-synuclein aggregates.
  • synucleinopathy caused by alpha-synuclein specifically degenerative brain diseases such as Parkinson's disease, dementia with Lewy bodies (DLB), or multiple system atrophy (Multiple system atrophy; MSA) It was confirmed that it can prevent and treat, the present invention was completed.
  • An object of the present invention is to inhibit the expression or activity of c-src protein that can inhibit the transfer of alpha-synuclein ( ⁇ -Syn) to adjacent cells and the degeneration of monomer ⁇ -syn into aggregates. It is to provide a composition for inhibiting aggregation and / or metastasis of alpha-synuclein ( ⁇ -Synuclein; ⁇ -Syn) comprising.
  • Another object of the present invention to provide a pharmaceutical composition for the prevention or treatment of synucleinopathy (synucleinopathy) comprising an inhibitor of the expression or activity of c-src.
  • It is another object of the present invention to provide a method for screening a synucleinopathy therapeutic agent comprising the step of measuring the level of expression or activity of c-src protein in a cell treated with a candidate drug for synuclein disease.
  • Still another object of the present invention is a composition for diagnosing synuclein disease comprising a substance capable of measuring the activity level of c-src, a kit for diagnosing synuclein disease comprising the diagnostic composition and c- using the composition or the kit. It is to provide an information providing method for diagnosing Synuclein disease comprising measuring the activity level of the src.
  • the present invention provides a composition for inhibiting the aggregation and / or metastasis of alpha-synuclein comprising an inhibitor of the expression or activity of c-src protein.
  • the present invention provides a method for inhibiting aggregation and / or metastasis of alpha-synuclein, comprising administering to the subject an inhibitor of expression or activity of c-src protein.
  • the present invention also provides a pharmaceutical composition for preventing or treating synuclein, including c-src expression or activity inhibitors.
  • the present invention also provides a method for treating synuclein disease, comprising administering an inhibitor of expression or activity of c-src.
  • the present invention also provides the use of an inhibitor of the expression or activity of c-src for the treatment of synuclein, and the use of the inhibitor of the expression or activity of the c-src for the preparation of a medicament for the treatment of synuclein.
  • the present invention also comprises the steps of: (i) treating a neuronal derived cell with a candidate substance for a synuclein disease treatment agent; (ii) measuring the level of expression or activity of c-src protein in said cells; And (iii) selecting a candidate substance whose expression or activity level of the c-src protein is decreased compared to a control group not treated with the candidate substance.
  • the present invention also provides a composition for diagnosing synuclein disease comprising a substance capable of measuring the activity level of c-src.
  • the present invention also provides a kit for diagnosing Synuclein disease comprising the diagnostic composition.
  • the present invention also provides information for diagnosing synuclein disease comprising measuring the activity level of c-src in a biological sample isolated from a subject suspected of synuclein disease using the composition or the kit.
  • a method and a method for diagnosing synuclein disease are provided.
  • Figure 2 confirms the inhibition of c-src activity by ⁇ -syn aggregated in SHSY5Y cell line treated with inhibitors of SHP-1 / 2, SHP-1, SHP-2. ** P ⁇ 0.01 shows the result compared with PBS.
  • Figure 3 confirms the inhibition of c-src activity by the ⁇ -syn aggregated in SHSY5Y cell line suppressed SHP-1 or SHP-2 expression. ** P ⁇ 0.01 shows the result compared with control (NT).
  • c-src acts on the inter-cell metastasis of ⁇ -syn.
  • the metastasis of ⁇ -syn is treated by treatment of c-src inhibitor saracatinib or SKI (Src kinase inhibitor) to SHSY5Y cell line. The decrease was confirmed.
  • Scale bars represent 20 ⁇ m and ** P ⁇ 0.01 represents the results compared to PBS.
  • Figure 6 shows that c-src affects the process of transforming the overexpressed monomer A53T ⁇ -syn into aggregates by treating saracatinib or SKI in the SHSY5Y cell line overexpressing the monomer A53T ⁇ -syn.
  • Scale bars represent 20 ⁇ m and ** P ⁇ 0.01 is a graph compared to PBS.
  • Figure 7 compares the SHSY5Y cell line overexpressing the monomer A53T ⁇ -syn inhibited c-src expression with the control. Scale bar represents 20 micrometers, and ** P ⁇ 0.01 is the graph compared with the comparative group NT.
  • Figure 9 compares the extracellular secretion of A53T ⁇ -syn in the SHSY5Y cell line overexpressing the monomer A53T ⁇ -syn inhibited c-src expression compared to the control.
  • Scale bar represents 20 micrometers
  • ** P ⁇ 0.01 is the graph compared with the comparative group NT.
  • FIG. 10 shows that DA-staining of Lewy bodies in brain tissues after administration of saracatinib to mutant mice injected with ⁇ -syn aggregated in A53T ⁇ -syn mutant mouse brain (scale bar is 50 ⁇ m) ) And (B) show the color distribution of the Lewy bodies in color, and (C) shows the numerical values by dividing the Lewy bodies into sections of brain tissue. ** P ⁇ 0.01 is a graph compared with the comparative group (PBS).
  • Figure 12 shows the transition of ⁇ -syn according to the activity of c-src.
  • the present inventors came to pay attention to alpha-synuclein ( ⁇ -syn) while conducting various studies to establish a new effective treatment strategy by revealing the pathogenesis of degenerative brain disease. Based on the possibility that alpha-synuclein secreted by neurons is involved in neuronal damage by acting on and activating adjacent neurons, it is involved in the aggregation of extracellular aggregated alpha-synuclein into adjacent cells. Protein c-src was identified. In addition, it was confirmed that the c-src is also involved in agglutination of ⁇ -syn, which may be a major cause of Parkinson's disease.
  • the present inventors confirmed that the activation of c-src is increased by the aggregated ⁇ -syn.
  • the expression of SHP-1 or SHP-2 is inhibited, the increase of the activation of c-src by ⁇ -syn is inhibited.
  • the expression of c-src was suppressed, it was confirmed that the intercellular metastasis of ⁇ -syn was reduced, and that c-src played an important role in the transfer of aggregated ⁇ -syn.
  • c-src is involved in the process of denaturation with the aggregate ⁇ -syn. Therefore, the inhibition of the degeneration of the ⁇ -syn, which acts as a major cause of synucleinosis, through the inhibition of c-src activity is prevented.
  • the present invention relates to a composition for inhibiting aggregation and / or metastasis of alpha-synuclein ( ⁇ -Syn) including an inhibitor of c-src protein expression or activity.
  • ⁇ -Syn alpha-synuclein
  • the present invention relates to a method for inhibiting aggregation and / or metastasis of alpha-synuclein, comprising administering to a subject an inhibitor of expression or activity of c-src protein.
  • C-src of the present invention is also known as proto-oncogene tyrosine-protein kinase Src or proto-oncogene c-src, and is a non-receptor tyrosine kinase protein encoded by the src gene.
  • the c-src phosphorylates certain tyrosine residues of other proteins.
  • c-src stands for cellular Src kinase.
  • Increased activity levels of c-src tyrosine kinases are known to be associated with cancer progression by promoting different signals. This oncogenic gene can also play a role in the regulation of embryonic development and cell growth.
  • c-src includes the SH2 domain, the SH3 domain and the tyrosine kinase domain.
  • the gene sequence of the c-src protein can be obtained from a known database such as GenBank of NCBI.
  • GenBank of NCBI.
  • it may be a gene represented by GenBank Accession AAC29427.1.
  • c-src activation means phosphorylation of c-src, and for the purposes of the present invention, may be achieved by aggregated alpha-synuclein ( ⁇ -syn), and c-src activation may be involved in the phenomenon of increasing the metastasis of ⁇ -syn.
  • alpha-synuclein refers to a protein known as a major component of Lewy body in the cytoplasm, but is not limited thereto. It may be a protein molecule involved in the pathogenesis of degenerative brain disease.
  • the base sequence of the ⁇ -syn gene may be obtained from a known database such as GenBank of NCBI.
  • the ⁇ -syn gene may be a gene represented by GenBank Accession NP — 0010359161.
  • the term "transition of alpha-synuclein” refers to a phenomenon in which alpha-synuclein migrates from a cell secreting alpha-synuclein to another cell located adjacent to it. Although not limited thereto, for the purposes of the present invention, it may be a phenomenon in which direct toxicity is transmitted to adjacent cells or cytotoxicity is transmitted to adjacent cells, and alpha synuclein is activated by the activation of c-src. Can be. That is, when aggregated alpha-synuclein exists outside the cell, activation of src is increased, and alpha-synuclein existing outside the cell enters the cell.
  • SHP-1 / -2 refers to Src homology region 2 domain-containing phosphatase-1 / -2, which is PTPN6 (Tyrosine). Also known as -protein phosphatase non-receptor type 6), it refers to a kind of protein tyrosine phosphatase.
  • the SHP-1 / -2 includes an Src homolog (SH2) domain that acts as a protein phosphorylation-tyrosine binding domain at the N-terminal, and is in various cells such as cell growth, differentiation and mitosis cycles. It is known as a signaling molecule that regulates the process.
  • SH2 Src homolog
  • the gene sequence of the SHP-1 / -2 protein may be obtained from a known database such as GenBank of NCBI.
  • GenBank of NCBI.
  • the SHP-1 / -2 protein may be a gene represented by GenBank Accession AAC360091, AAC360081, or the like.
  • the term "agent capable of inhibiting the expression or activity of c-src" or “inhibitor of the expression or activity of c-src” means a direct or indirect binding to a gene, mRNA or protein encoding c-src. Means a substance capable of inhibiting the expression or activity of c-src.
  • an agent capable of inhibiting the expression or activity of c-src may be used in the same sense as an inhibitor of c-src or an inhibitor of c-src.
  • the agent capable of inhibiting the expression or activity of the c-src may be an active ingredient of a pharmaceutical composition exhibiting an effect of preventing or treating synuclein disease by inhibiting the expression or activity of the c-src.
  • the agent is not particularly limited thereto, but specific examples of the agent capable of inhibiting the expression of c-src include miRNA, siRNA, shRNA, antisense oligonucleotide, and combinations thereof, which complementarily bind to mRNA of c-src gene.
  • the agent capable of inhibiting the activity of the c-src is an antibody, aptamer, small molecules that can complementarily bind to the protein of c-src (small molecules) And it may be characterized in that it is selected from the group consisting of a combination thereof.
  • siRNA, siRNA or shRNA refers to a nucleic acid molecule that binds to mRNA transcribed from a gene of interest mainly to mediate RNA interference or gene silencing, thereby inhibiting the translation of the mRNA. Since siRNA or shRNA can inhibit expression of a target gene at a translation level, it can be used for efficient gene knockdown method or gene therapy method, and for the purpose of the present invention, it can be used to inhibit the expression of c-src. Can be.
  • the shRNA may be represented by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, but is not limited thereto.
  • antisense oligonucleotide refers to DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to a sequence of a particular mRNA, which binds to a complementary sequence in the mRNA and inhibits translation of the mRNA into a protein. It can be used to inhibit the expression of c-src for the purposes of the present invention.
  • antibody refers to a proteinaceous molecule capable of specifically binding to an antigenic site of a protein or peptide molecule. Such an antibody may be prepared by cloning each gene into an expression vector according to a conventional method. The protein encoded by the marker gene can be obtained and prepared by conventional methods from the obtained protein.
  • the antibody may be interpreted as a means capable of inhibiting the activity of the protein by binding to an activated c-src protein of an individual suspected of developing a degenerative brain disease.
  • a polyclonal antibody, a monoclonal antibody or antigen-binding that can specifically bind to c-src may be included in the antibody of the present invention, and a part thereof may include all immunoglobulin antibodies. It may also contain special antibodies such as humanized antibodies.
  • the antibody may be in a form comprising a functional fragment of an antibody molecule as well as a complete form having two full length light chains and two full length heavy chains.
  • a functional fragment of an antibody molecule means a fragment having at least antigen binding function and may be Fab, F (ab '), F (ab') 2 and Fv.
  • aptamer refers to a nucleic acid molecule having binding activity to a given target molecule.
  • the aptamers may be RNA, DNA, modified nucleic acids, or mixtures thereof, and may be linear or cyclic.
  • the shorter the sequence of nucleotides constituting the aptamer the more chemical synthesis and mass production. It is known to be easier, cost-effective, easy to modify chemical formula, excellent in vivo stability and low toxicity.
  • the aptamer may be interpreted as a means capable of inhibiting the activity of the protein by binding to the activated c-src protein.
  • small molecules refers to a molecule having a low molecular weight, which is bound to a biopolymer such as a protein and modulates its function. It may be naturally derived or artificially synthesized, and may inhibit, but is not limited to, inhibiting protein function or protein-protein interactions.
  • the small molecule compound includes, without limitation, any molecule that inhibits the activity of the activated c-src protein, and specifically, means a molecule that inhibits the activity by binding to the activated c-src, but is not limited thereto. .
  • the present invention relates to a pharmaceutical composition for preventing or treating synucleinopathy, including c-src expression or activity inhibitor.
  • synucleinopathy refers to a neurodegenerative disorder characterized by abnormal accumulation of ⁇ -syn aggregates in neurons, nerve fibers or glial cells.
  • the synuclein disease may be characterized in that Parkinson's disease (PD), dementia with Lewy bodies (DLB) or multiple system atrophy (MSA), but It is not limited.
  • PD Parkinson's disease
  • DLB dementia with Lewy bodies
  • MSA multiple system atrophy
  • degenerative neurological disease refers to a disease caused by damage to nerve cells, and it is assumed that the onset is caused by aging, genetic variation, stress, problems of intracellular protein removal function, etc. The exact cause is not known.
  • prevention of the present invention is to inhibit the development of neurodegenerative diseases such as synuclein by administering a pharmaceutical composition comprising as an active ingredient an agent capable of inhibiting the expression or activity of c-src of the present invention. Means any action that delays or delays.
  • treatment of the present invention refers to any action by which administration of the pharmaceutical composition improves or advantageously alters the symptoms of a suspicious neurodegenerative disease such as synuclein's disease and the onset individual.
  • the therapeutic effect of synucleinopathy of the expression or activity inhibitor of c-src protein according to the present invention may be characterized by aggregation of alpha-synuclein ( ⁇ -Synuclein ( ⁇ -Syn)) and / or inhibitor of c-src protein expression or activity. It can be achieved through the metastasis suppression function.
  • the pharmaceutical composition of the present invention may be prepared in the form of a pharmaceutical composition for treating synuclein, further comprising a suitable carrier, excipient or diluent commonly used in the manufacture of the pharmaceutical composition, the carrier being unnatural It may include a carrier (non-naturally occuring carrier).
  • the pharmaceutical composition may be formulated in the form of oral dosage forms, external preparations, suppositories, and sterile injectable solutions, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, respectively, according to conventional methods. Can be.
  • Carriers, excipients and diluents that may be included in the pharmaceutical compositions of the present invention include, by way of example, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate , Calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil and the like.
  • diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. which are commonly used.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, which may comprise at least one excipient such as starch, calcium carbonate, It may be prepared by mixing sucrose or lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium styrate and talc may also be used.
  • Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups, and various excipients such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin, may be used. have.
  • Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, suppositories, and the like.
  • non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used.
  • witepsol macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • the content of the agent capable of inhibiting the expression or activity of the c-src contained in the pharmaceutical composition of the present invention is not particularly limited, but is 0.0001 to 50% by weight, more specifically 0.01 to 20 based on the total weight of the final composition It may be included in an amount of weight percent.
  • the pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount
  • Sufficient amount means an effective dose level means the severity of the disease, the activity of the drug, the age, weight, health, sex, sensitivity of the patient to the drug, the time of administration of the composition of the invention used, the route of administration and the rate of excretion treatment Period of time, factors including drugs used in combination or coincidental with the compositions of the invention used, and other factors well known in the medical arts.
  • the pharmaceutical composition of the present invention may be administered alone or in combination with known immunotherapeutic agents. It is important to take into consideration all of the above factors to administer an amount that can achieve the maximum effect in a minimum amount without side effects.
  • the dosage of the pharmaceutical composition of the present invention can be determined by those skilled in the art in consideration of the purpose of use, the degree of addiction of the disease, the age, weight, sex, history, or type of substance used as an active ingredient of the patient.
  • the pharmaceutical composition of the present invention may be administered at about 0.1 ng / kg to about 100 mg / kg, specifically about 1 ng / kg to about 10 mg / kg, per adult, and administration of the composition of the present invention.
  • the frequency is not particularly limited, but may be administered once daily or divided into several doses.
  • the dosage does not limit the scope of the invention in any aspect.
  • the present invention relates to a method for the prevention or treatment of synuclein, characterized in that the c-src expression or activity inhibitor is administered to a subject.
  • the term "individual” of the present invention may include, without limitation, mammals, farmed fish, and the like, including, but not limited to, rats, livestock, humans, and the like, which may develop or develop synuclein.
  • the route of administration of the pharmaceutical composition for preventing or treating synucleosis of the present invention may be administered through any general route as long as it can reach the target tissue.
  • the pharmaceutical composition of the present invention is not particularly limited to this, but as desired, routes of intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, intranasal administration, pulmonary administration, rectal administration, etc. It can be administered through.
  • oral administration may denature the agent that can inhibit the expression or activity of the c-src by gastric acid
  • oral compositions may be formulated to coat the active agent or to protect it from degradation in the stomach.
  • the composition may be administered by any device in which the active substance may migrate to the target cell.
  • the present invention relates to the use of an inhibitor of expression or activity of c-src for the treatment of synuclein.
  • the present invention relates to the use of a c-src expression or activity inhibitor for the preparation of a medicament for the treatment of synuclein.
  • the present invention provides a method for treating neuronal disease, comprising: (i) treating a neural tissue-derived cell with a candidate substance for a synuclein disease; (ii) measuring the level of expression or activity of c-src protein in said cells; And (iii) selecting a candidate substance whose expression or activity level of the c-src protein is decreased compared to a control group not treated with the candidate substance.
  • Measuring the expression or activity level of the c-src protein of step (ii) may be used without limitation the conventional expression level measuring method used in the art, as described above, but is not limited thereto, and specific examples Immunofluorescence, enzyme immunoassay (ELISA), Western blot, flow cytometry (FACS), immunohistochemistry, immunoprecipitation, radioimmunoassay (RIA) and RT-PCR It can be characterized by measuring with one.
  • the neural tissue-derived cells to which the candidate substance for the treatment of synuclein disease is treated are not particularly limited, but may be, for example, neurons or glial cells, and as another example, microglia, astrocytes (astrocyte), oligodendrocyte, (ependymal cell), Schwann (Schwann) cells, satellite cells (satellite cells) such as glial cells, preferably the neural tissue-derived cells are dopamine It may be characterized by the sexual neuronal cell line SHSY5Y.
  • a candidate substance for treating synuclein disease is a substance which is expected to be able to treat synuclein disease, and is used without limitation as long as it is a substance that is expected to improve or improve synuclein disease directly or indirectly. Possible and include all therapeutic probables such as compounds, genes or proteins.
  • the screening method of the present invention measures the activation of c-src before and after the administration of the candidate, and when the activation of the c-src is inhibited after administration compared to the administration of the candidate, the candidate is a therapeutic agent for synuclein disease.
  • the present invention relates to a composition for diagnosing synucleinopathy comprising a substance capable of measuring the activity level of c-src.
  • a substance capable of measuring the activity level of c-src refers to an agent capable of measuring the phosphorylation of c-src, and for the purposes of the present invention, aggregated ⁇ to cells
  • a substance that can be used to evaluate the effect of -syn is not particularly limited thereto, but may be, for example, an antibody or an aptamer capable of specifically binding to activated c-src.
  • antibody refers to a proteinaceous molecule capable of specifically binding to an antigenic site of a protein or peptide molecule. Such an antibody may be prepared by cloning each gene into an expression vector according to a conventional method. The protein encoded by the marker gene can be obtained and prepared by conventional methods from the obtained protein.
  • the antibody may be interpreted as a means for measuring the activation of the protein by binding to c-src protein activated by aggregated ⁇ -syn of an individual suspected of developing synuclein disease.
  • a polyclonal antibody, a monoclonal antibody or antigen-binding that can specifically bind to c-src may be included in the antibody of the present invention, and a part thereof may include all immunoglobulin antibodies. It may also contain special antibodies such as humanized antibodies.
  • the antibody may be in a form comprising a functional fragment of an antibody molecule as well as a complete form having two full length light chains and two full length heavy chains.
  • a functional fragment of an antibody molecule means a fragment having at least antigen binding function and may be Fab, F (ab '), F (ab') 2 and Fv.
  • aptamer refers to a nucleic acid molecule having binding activity to a given target molecule.
  • the aptamers may be RNA, DNA, modified nucleic acids, or mixtures thereof, and may be linear or cyclic.
  • the shorter the sequence of nucleotides constituting the aptamer the more chemical synthesis and mass production. It is known to be easier, cost-effective, easy to modify chemical formula, excellent in vivo stability and low toxicity.
  • the aptamer may be interpreted as a means for measuring the activation of the protein by binding to the c-src protein.
  • diagnosis of the present invention refers to confirming the presence or characteristics of a pathological state, and for the purposes of the present invention, not only confirms the development of degenerative neurological diseases such as synuclein, but also after treatment of degenerative neurological diseases. Determining the course of an individual's recurrence, metastasis, drug reactivity, resistance, and the like.
  • the term "individual" of the present invention includes, without limitation, horses, dogs, cats, pigs, goats, rabbits, hamsters, monkeys, guinea pigs, rats, mice, lizards, snakes, sheep, cattle, fish and birds. And means any animal (eg, a human). More broadly, the cell line of the animal may be included without limitation.
  • the present invention relates to a kit for diagnosing synucleinopathy comprising the composition.
  • the kit for diagnosing synuclein disease of the present invention directly measures the metastasis of alpha-synuclein, a marker for diagnosing synuclein, to the adjacent cells, or the activation of c-src activated by alpha-synuclein.
  • Primers, probes or antibodies that selectively recognize the protein to measure activity, as well as one or more other component compositions, solutions, or devices suitable for the assay method may be included.
  • the kit of the present invention may include a substrate, an appropriate buffer solution, a secondary antibody labeled with a coloring enzyme or a fluorescent substance, and a coloring substrate for the immunological detection of the antibody.
  • a substrate a nitrocellulose membrane, a 96-well plate synthesized with a polyvinyl resin, a 96-well plate synthesized with a polystyrene resin, a slide glass made of glass, and the like may be used.
  • the chromophore may be a peroxidase, Alkaline phosphatase (alkaline phosphatase) and the like can be used, the fluorescent material may be used FITC, RITC and the like, the color substrate is ABTS (2,2'-azino-bis- (3-ethylbenzothiazoline-6) -Sulfonic acid)) or OPD (o-phenylenediamine), TMB (tetramethyl benzidine) may be used, but is not limited thereto.
  • the present invention provides a method for synuclein, comprising measuring the activity level of c-src in a biological sample isolated from a subject suspected of synuclein using the diagnostic composition or the kit ( synucleinopathy).
  • the present invention provides a method for diagnosing synuclein, comprising measuring the activity level of c-src in a biological sample isolated from a subject suspected of synuclein using the composition or the kit. It is about.
  • the c-src activity level when the c-src activity level is increased compared to the control group can be characterized as judging that the development of synuclein.
  • sample of the present invention is not particularly limited as long as it indicates a difference in the activation of c-src, which is an indicator of diagnosis of synuclein, but is not limited to neural tissue-derived cells, whole blood, serum, blood, plasma, saliva, urine, It may be any one or more samples selected from the group consisting of sputum, lymph, cerebrospinal fluid and interstitial fluid, but is not limited thereto.
  • a method for measuring the activation of the c-src includes Western blot, Co-Immunoprecipitation assay, Enzyme Linked Immunosorbent Assay (ELISA), real-time RT-PCR , Electrophoresis, tissue immunostaining (immunostaining) and FACS (Fluorescence activated cell sorter), but is not limited thereto.
  • ⁇ -Synuclein ⁇ -Synuclein
  • ⁇ -Syn aggregated ⁇ -syn
  • Recombinant ⁇ -Syn was overexpressed in E. coli BL21 (DE3) and the recombinant protein was purified by known methods (Lee, SB, et al, Biochem Biophys Res Commun 381, 39-43, 2009). Purified ⁇ -Syn protein was stored at ⁇ 80 ° C. until used as monomer ⁇ -Syn.
  • SHP-1 expression knockdown (KD) cell lines and SHP-2 expression knockdown (KD) cell lines were prepared as follows.
  • SHP-1 / 2 expression inhibitory SHSY5Y was prepared by a known method using a lentiviral construct expressing SHP-1 / 2 shRNA (Sigma, St. Louis, MO) (Yoon, S., et al., Cell Death Dis . 5: e1494, 2014), was selected using puromycin.
  • C57BL6 mice were isolated from cerebral cortices of 1 day old and cultured as described in the literature (CHA, SH, et al., Mol neurodegener . 10:63, 2015) to obtain primary neurons in mice.
  • Brains were obtained as described in previous literature (Lee, HJ, et al, Exp Neurobiol 20: 181-8, 2011) from 9 month old C57BL6 A53T ⁇ -syn heterologous transgenic mice and control C57BL6 mice. Brain hemispheres were homogenized in 600 ⁇ l of cold RIPA buffer containing protein inhibitor and phosphatase inhibitor cocktails. Lysates were incubated at 4 ° C. for 30 minutes and the lysates were centrifuged at 14,000 rpm for 30 minutes at 4 ° C. Supernatant was obtained and western blot was performed.
  • the SHSY5Y cell line and mouse primary neurons were incubated for 10 minutes using 1 ⁇ M of aggregated ⁇ -syn, respectively, and then lysed to perform Western blot (FIGS. 1A and 1B).
  • A53T TG mice were compared by Western blot with total brain lysates of wild type WT (wild type) C57BL6 mice (FIG. 1C).
  • Western blot was used to express protein cells (2 mM phenylmethylsulfonyl fluoride, 100 ⁇ g / ml leupeptin, 10 ⁇ g / ml pepstatin, 1 ⁇ g / ml aprotinin and 2 mM EDTA) and phosphatase inhibitor cocktails (GenDEPOT, Baker, TX). It was dissolved in cold RIPA buffer (50 mM Tris-HCl, pH 74, 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mM NaCl). After lysing the cells via sonication, the lysates were centrifuged at 14,000 rpm for 30 minutes at 4 ° C.
  • Protein concentration was measured using the BCA Protein Assay Kit. Proteins were separated using SDS-PAGE, transferred to nitrocellulose membrane, and then visualized using a chemiluminescence (ECL) system (Thermo, Waltham, Mass.).
  • ECL chemiluminescence
  • SHSY5Y cell line was pretreated for 30 minutes with 20 ⁇ M NSC87877, SHP-1 / 2 inhibitor, 10 ⁇ M SSG, SHP-1 inhibitor, or 1 ⁇ M PHPS-1, SHP-2 inhibitor, and then 1 ⁇ M aggregated ⁇ - Incubated for 10 minutes using syn, and then dissolved to perform Western blot (FIG. 2).
  • SHSY5Y cell line with suppressed SHP-1 expression and the SHSY5Y cell line with suppressed SHP-2 expression prepared in Example 2 were treated with 1 ⁇ M of aggregated ⁇ -syn, incubated for 10 minutes, and then lysed by Western blot. Was performed (FIG. 3).
  • the dopaminergic neuronal cell line overexpressing SHSY5Y cell lines (KD # 1 and KD # 2) and ⁇ -syn, which have suppressed c-src expression using shRNAs of SEQ ID NO: 1 and SEQ ID NO: 2 (using letivirus) SHSY5Y was co-cultured for 12 hours using two chambers.
  • SHSY5Y cells were dispensed on 12-well cover glass at a concentration of 4 ⁇ 10 4 cells per well. After each day of incubation, the transwells in which SHSY5Y cells overexpressed ⁇ -syn were transferred to 12-well coverglasses in which SHSY5Y cells suppressed src expression were co-cultured for 12 hours.
  • Immunostaining ( ⁇ -syn: red, nucleus: blue) was observed by confocal microscopy.
  • the SHSY5Y cell line overexpressed with A53T ⁇ -syn labeled with eGPF and A53T ⁇ -syn labeled with mcherry was prepared using lentivirus, respectively. Co-cultures were then performed by mixing SHSY5Y cell lines overexpressed with A53T ⁇ -syn labeled with eGPF and SHSY5Y cell lines overexpressed with mcherry labeled A53T ⁇ -syn.
  • confocal microscopy confirmed the distribution of eGFP and mcherry in the cells of eGFP-labeled A53T ⁇ -syn, and mcherry in m53-labeled A53T ⁇ -syn cells. The distribution map of and and eGFP were also confirmed respectively.
  • Figure 6 is a result of treatment of c-src inhibitor SKI and saracatinib to the co-cultured cells of the SHSY5Y cell line prepared above.
  • Figure 7 was confirmed after co-culture of A53T ⁇ -syn eGFP and A53T ⁇ -syn mcherry inhibited c-src expression using shRNA of SEQ ID NO: 1 and SEQ ID NO: 2.
  • A53T eGFP overexpressed SHSY5Y was treated with 10 ⁇ M of SKI (c-src kinase inhibitor I) and 0.5 ⁇ M of saracatinib, respectively, and differentiated into 50 ⁇ M of RA (retioid acid) to identify aggregated ⁇ -syn by confocal microscopy. As a result, it was confirmed that the amount of aggregated ⁇ -syn is reduced when src activity is inhibited (FIG. 8B).
  • Models overexpressing A53T one of the mutations of ⁇ -Synuclein ( ⁇ -Syn) expressed in humans in transgenic mice (B6; C3-Tg (Prnp-SNCA * A53T) 83Vle / J, M83; , Jackson Laboratory) 8-12 weeks old mouse was administered anesthetized with a dose of 200 ⁇ l per 20g body weight with Avertin, and then fixed in a stereotaxic surgical instrument, the mouse parietal (Bregma) ), The aggregated ⁇ -syn was injected into the mouse striatum at a dose of 10 ⁇ g using a Hamilton syringe at a coordinate of 1.0 mm forward, 1.8 mm right, and 3.0 mm deep. 10).
  • mice were anesthetized with a dose of 200 ⁇ l per 20 g of body weight with urethane, and the incision was made by cutting the thoracic cavity and flowing perfusion fluid through the left ventricle of the heart for 3 minutes to remove the right atrium, and then removing the blood.
  • Formaldehyde was fixed by flowing 4% formaldehyde for 5 minutes.
  • the brains were extracted and soaked in 4% formaldehyde fixative for 1 day, followed by dehydration until it sank to the bottom in 30% sugar water.
  • Brain sections were stored in tissue storage solution.
  • brain sections were harvested and washed three times with PBS for 10 minutes (hereinafter, after washing unconditionally three times), followed by removal of peroxidase in tissues with 3% hydrogen peroxide for 5 minutes. .
  • the transgenic mice of the ⁇ -Syn mutant A53T were injected with PBS and 10 ⁇ g of aggregated ⁇ -syn each for 4 weeks, the group injected with aggregated ⁇ -syn and injected with saracatinib daily at 10 mg / kg.
  • Brain tissues were obtained by the above method, and then stained with leusosomes by DAB staining to confirm ⁇ -syn transfer at each site.
  • the results are shown in FIG. 10 (B) and (C) show a graph and a graph showing the degree of ⁇ -syn metastasis by region of brain tissue.
  • Example 9 Confirmation of ⁇ -syn Metastasis Reduction by Inhibiting c-src Expression or Inhibiting Activity
  • Cortex was isolated from rat TP18 (18 days pregnant) and cultured primary neuron in neural basal media for 14 days. On day 14, lentivirus (using NT and src KD # 1 virus) was used to inhibit src expression.
  • Example 10 Effect of c-src activation degree on ⁇ -syn metastasis
  • Inhibitors of the expression or activity of the c-src protein of the present invention can inhibit the signaling caused by alpha-synuclein ( ⁇ -Syn) metastasis to adjacent cells, thereby inhibiting the cells of ⁇ -syn to adjacent cells. It can reduce the toxic effect and can inhibit the degeneration to aggregate ⁇ -syn, which can be a major cause of synuclein disease, and thus can be usefully used as a therapeutic agent for synuclein disease.
  • ⁇ -Syn alpha-synuclein

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Mycology (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Psychology (AREA)

Abstract

본 발명은 알파-시누클레인(α-Synuclein; α-Syn)의 응집 및/또는 전이 억제용 조성물에 관한 것으로, 더욱 자세하게는 c-src의 발현 또는 활성 억제제를 포함하는 알파-시누클레인의 응집 및/또는 전이 억제용 조성물 및 c-src의 발현 또는 활성 억제제를 포함하는 시누클레인병증(synucleinopathy) 예방 또는 치료용 약학 조성물에 관한 것이다. 본 발명의 c-src 단백질의 발현 또는 활성 억제제는 알파-시누클레인이 인접한 세포로 전이하여 야기하는 신호전달을 억제할 수 있어서 인접한 세포에 대한 α-syn의 세포독성 영향을 감소시키며, 단량체 α-syn가 시누클레인병증의 주요 원인이 될 수 있는 응집체 α-syn로의 변성을 억제할 수 있으므로, 시누클레인병증의 치료제로 유용하게 사용될 수 있다.

Description

C-SRC의 발현 또는 활성 억제제를 포함하는 시누클레인병증의 예방 또는 치료용 약학 조성물
본 발명은 알파-시누클레인(α-Synuclein; α-Syn)의 응집 및/또는 전이 억제용 조성물에 관한 것으로, 더욱 자세하게는 c-src의 발현 또는 활성 억제제를 포함하는 알파-시누클레인의 응집 및/또는 전이 억제용 조성물 및 c-src의 발현 또는 활성 억제제를 포함하는 시누클레인병증(synucleinopathy) 예방 또는 치료용 약학 조성물에 관한 것이다.
고령화가 가속화됨에 따라 파킨슨병, 알츠하이머병 등의 퇴행성 뇌질환을 앓고 있는 환자의 수가 급격하게 증가하고 있으며, 이를 해결하기 위한 의료비용 역시 급격히 증가하고 있다. 퇴행성 뇌질환 중 파킨슨병은 알츠하이머병 다음으로 흔한 퇴행성 뇌질환이며, 퇴행성 운동질환 중에서는 가장 흔한 질환으로서, 상기 질환을 앓고 있는 환자의 수는 전 세계적으로 60세 이상 노인의 1% 이상일 것으로 추정되며, 우리나라의 경우도 2004년 4만 여명에서 2008년 6만 6000명, 2012년에는 9만 3000여 명 정도로 계속 증가하고 있어, 향후 환자의 수는 더욱 급격히 증가할 전망이다.
파킨슨병의 정확한 발병원인은 아직 밝혀지지 않은 상태이지만, 유전성 파킨슨병은 알파-시누클레인(α-synuclein), parkin, PINK1, DJ-1, LRRK2 등의 여러 가지의 유전자 변이가 원인이 된다고 알려져 있다. 또한, 지금까지 알려진 바로는 산화스트레스, 미토콘드리아의 이상 및 세포 내 단백질 제거 기능의 문제가 원인이 될 것으로 추측되고 있으며(Lees, A J, et al, Lancet, 373:2055-66, 2009), 유전적인 원인과 더불어 환경적인 영향에 의해 발병되는 질환으로 추정하고 있다. 이러한 파킨슨병의 발병 여부는 임상적인 증상을 토대로 이루어지고 있으며, 치료 또한 원인을 해결하기보다는 증상을 완화하는 보존적 치료에 그치고 있어, 병인을 정확히 파악하여 그에 상응하는 적합한 치료방법을 찾는 것이 시급한 문제로 대두되고 있다.
알파-시누클레인(α-synuclein; α-syn)은 파킨슨병에서 발견되는 세포질 내 루이소체(Lewy body)의 주 구성성분 단백질로서, 신경세포의 전시냅스(presynapse) 말단에 주로 분포하며, 전반적인 뇌조직에서 많은 양이 발현된다고 알려져 있다. 알파-시누클레인은 파킨슨병뿐만 아니라, 루이소체 치매(Dementia with Lewy bodies), 다계통위측증(Multiple system atrophy) 등의 다른 퇴행성 질환의 병인에도 관여하는데, 알파-시누클레인의 비정상적인 침착과 관련된 상기 질환들은 모두 시누클레인병증(synucleinopathy)으로 통칭하며, 상기 질환들의 공통된 치료 표적으로서의 알파-시누클레인에 대한 연구가 활발히 이루어지고 있다.
또한, 알파-시누클레인은 응집체를 형성할 수 있는 특성을 보이는데, 단량체 알파-시누클레인이 응집체가 되는 변성과정이 파킨슨병의 주원인이 될 수 있을 것이라는 가능성이 대두 되었고(Eschbach, J., Danzer, K M, Neurodegener Dis, 14:1-17, 2013), 그 후, 상기 유전자의 이중중복(duplication) 및 삼중중복(triplication)이 가족성 파킨슨병에서 발견됨으로써 알파-시누클레인의 기능을 찾고자 하는 노력이 더욱 활발히 진행되고 있다. 이에 따른 응집된 알파-시누클레인을 타겟으로 한 약학 조성물로서, 알파-시누클레인의 응집에 의한 신경 독성으로부터 도파민 신경세포를 유의하게 보호할 수 있는, 용안욱 추출물을 유효성분으로 포함하는 파킨슨병 치료용 약학 조성물이 개발되었다(한국등록특허 제1189191호). 그러나, 알파-시누클레인이 작용하는 구체적인 수용체와 그에 관한 메커니즘에 대하여는 아직도 규명되지 않고 있는 실정이다.
한편, 단백질의 단량체가 응집체로 되는 변성과정은 파킨슨병의 알파-시누클레인 뿐만 아니라, 알츠하이머병의 아밀로이드 베타(Amyloid beta; Aβ), 타우(tau), 헌팅턴병의 변이된 헌팅틴(mutated huntingtin), 프라이온병의 프라이온(prion) 등에서도 일어나는 현상이며, 이러한 변성과정은 많은 퇴행성 뇌질환의 공통적인 원인으로 여겨지고 있으며, 이를 억제하여 퇴행성 뇌질환을 치료하고자 하는 연구가 활발히 진행되고 있다.
이후로, 알파-시누클레인의 세포내 전달 가능성에 대해 관심이 급격히 높아졌으며, 프라이온병에서 프라이온이 정상신경세포에 발현된 정상적인 프라이온과 결합하여 응집체를 형성하는 것처럼, 응집된 알파-시누클레인도 인접세포로 들어가 인접세포의 루이소체 생성 및 세포사멸에 관여할 수 있다는 가능성이 점점 밝혀지고 있다(Costanzo, M, Zurzolo, C, Biochem J 452:1-17, 2013; Goedert, M, et al, Trends Neurosci 33:317-25, 2010; Lee, S J, et al, Nat Rev Neurol 6:702-6, 2010). 이러한 내용을 통해 세포 밖에 위치한 알파-시누클레인에 의한 파킨슨병 관련 병인 기전을 유추해 보면, 세포에서 분비된 다양한 형태의 알파-시누클레인이 인접해 있는 신경교세포에 작용하여 활성화시킴으로써 신경세포 독성에 관여하게 되고, 상기 독성은 인접 신경세포로의 전이를 통해 직접적인 독성을 나타내거나 루이소체의 발생을 유도하여 일련의 세포독성을 보인다고 추측된다.
따라서, 세포 밖에 위치하는 알파-시누클레인에 의해 세포 내 신호전달과정에 관여하게 되는 수용체 혹은 구조물들은 많은 종류의 퇴행성 뇌질환의 병인기전을 밝혀낼 수 있는 중요한 단서가 될 수 있다. 더불어, 지금까지와는 다른 새로운 치료전략을 세울 수 있다는 점에서 매우 큰 관심을 가질만한 일이지만, 그에 관련한 연구는 많이 수행되지 않은 실정이다.
이에, 본 발명자들은 알파-시누클레인이 인접 세포로 전이되는 작용기전을 규명하고자 예의 연구 노력한 결과, c-src의 활성화가 알파-시누클레인의 응집체 형성 및 전이에 관여한다는 것을 확인하였으며, 상기 c-src의 발현 또는 활성을 억제할 경우, 알파-시누클레인에 의해 유발되는 시누클레인병증(synucleinopathy), 구체적으로는 파킨슨병과 같은 퇴행성 뇌질환, 루이소체 치매(dementia with Lewy bodies; DLB) 또는 다계통위축(multiple system atrophy; MSA) 등을 예방 및 치료할 수 있음을 확인하고, 본 발명을 완성하게 되었다.
본 배경기술 부분에 기재된 상기 정보는 오직 본 발명의 배경에 대한 이해를 향상시키기 위한 것이며, 이에 본 발명이 속하는 기술분야에서 통상의 지식을 가지는 자에게 있어 이미 알려진 선행기술을 형성하는 정보를 포함하지 않을 수 있다.
발명의 요약
본 발명의 목적은 알파-시누클레인(α-Synuclein; α-Syn)의 인접 세포로의 전이 억제 및 단량체 α-syn의 응집체로의 변성을 억제할 수 있는 c-src 단백질의 발현 또는 활성 억제제를 포함하는 알파-시누클레인(α-Synuclein; α-Syn)의 응집 및/또는 전이 억제용 조성물을 제공하는 데 있다.
본 발명의 다른 목적은 c-src의 발현 또는 활성 억제제를 포함하는 시누클레인병증(synucleinopathy) 예방 또는 치료용 약학 조성물을 제공하는 데 있다.
본 발명의 또 다른 목적은 시누클레인병증 치료제의 후보물질을 처리한 세포에서 c-src 단백질의 발현 또는 활성 정도를 측정하는 단계를 포함하는 시누클레인병증(synucleinopathy) 치료제의 스크리닝 방법을 제공하는 데 있다.
본 발명의 또 다른 목적은 c-src의 활성 수준을 측정할 수 있는 물질을 포함하는 시누클레인병증 진단용 조성물, 상기 진단용 조성물을 포함하는 시누클레인병증 진단용 키트 및 상기 조성물 또는 상기 키트를 이용하여 c-src의 활성 수준을 측정하는 단계를 포함하는 시누클레인병증 진단을 위한 정보제공 방법을 제공하는 데 있다.
상기 목적을 달성하기 위하여, 본 발명은 c-src 단백질의 발현 또는 활성 억제제를 포함하는 알파-시누클레인의 응집 및/또는 전이 억제용 조성물을 제공한다.
상기 목적을 달성하기 위하여, 본 발명은 c-src 단백질의 발현 또는 활성 억제제를 대상에 투여하는 단계를 포함하는 알파-시누클레인의 응집 및/또는 전이 억제 방법을 제공한다.
본 발명은 또한, c-src의 발현 또는 활성 억제제를 포함하는 시누클레인병증 예방 또는 치료용 약학 조성물을 제공한다.
본 발명은 또한, c-src의 발현 또는 활성 억제제를 투여하는 것을 특징으로 하는 시누클레인병증 치료방법을 제공한다.
본 발명은 또한, 시누클레인병증 치료를 위한 c-src의 발현 또는 활성 억제제의 용도 및 시누클레인병증 치료용 약제 제조를 위한 c-src의 발현 또는 활성 억제제의 사용을 제공한다.
본 발명은 또한, (i) 신경조직 유래 세포에 시누클레인병증 치료제의 후보물질을 처리하는 단계; (ii) 상기 세포에서 c-src 단백질의 발현 또는 활성 정도를 측정하는 단계; 및 (iii) 상기 c-src 단백질의 발현 또는 활성 정도가 후보물질을 처리하지 않은 대조군에 비해 감소한 후보물질을 선별하는 단계를 포함하는 시누클레인병증 치료제의 스크리닝 방법을 제공한다.
본 발명은 또한, c-src의 활성 수준을 측정할 수 있는 물질을 포함하는 시누클레인병증 진단용 조성물을 제공한다.
본 발명은 또한, 상기 진단용 조성물을 포함하는 시누클레인병증 진단용 키트를 제공한다.
본 발명은 또한, 상기 조성물 또는 상기 키트를 이용하여 시누클레인병증이 의심되는 대상체(subject)로부터 분리된 생물학적 시료에서 c-src의 활성 수준을 측정하는 단계를 포함하는 시누클레인병증 진단을 위한 정보제공 방법 및 시누클레인병증 진단방법을 제공한다.
도 1은 응집된 α-syn에 의해서 c-src의 활성이 증가하는 것을 보여주는 것으로, (A) SHSY5Y 세포주 및 (B) 마우스 일차신경세포에서 확인한 것이다. ** P < 0.01는 PBS와 비교한 결과를 나타낸다. (C)는 야생형 마우스 및 A53T TG 마우스의 전체 뇌 용해물에서 확인한 것이다. ** P < 0.01는 야생형 마우스(WT)와 비교한 결과를 나타낸다.
도 2는 SHP-1/2, SHP-1, SHP-2의 저해제를 처리한 SHSY5Y 세포주에서 응집된 α-syn에 의해서 c-src의 활성 억제를 확인한 것이다. ** P < 0.01은 PBS와 비교한 결과를 나타낸다.
도 3은 SHP-1 또는 SHP-2의 발현이 억제된 SHSY5Y 세포주에서 응집된 α-syn에 의해서 c-src의 활성 억제를 확인한 것이다. ** P < 0.01는 대조군(NT)과 비교한 결과를 나타낸다.
도 4는 α-syn의 세포간의 전이현상에 c-src가 작용한다는 것을 보여주는 것으로, SHSY5Y 세포주에 c-src의 저해제인 사라카티닙 또는 SKI(Src kinase inhibitor)를 처리하여 α-syn의 전이가 감소를 확인한 것이다. 스케일바는 20μm을 나타내고, ** P < 0.01는 PBS와 비교한 결과를 나타낸다.
도 5는 α-syn의 세포간의 전이현상에 c-src가 작용한다는 것을 보여주는 것으로, SHSY5Y, c-src의 발현이 억제된 SHSY5Y 세포를 밑에 깔고 α-syn이 과발현된 SHSY5Y 세포를 위에 깔아서 c-src이 발현이 억제된 SHSY5Y세포에서 전이현상을 현미경으로 확인한 것이다. 스케일바는 20μm을 나타내고, ** P < 0.01는 대조군(NT)과 비교한 결과를 나타낸다.
도 6은 단량체 A53T α-syn이 과발현된 SHSY5Y 세포주에 사라카티닙 또는 SKI를 처리하여 과발현된 단량체 A53T α-syn이 응집체로 변형되는 과정에 c-src가 영향을 주는지 확인한 것이다. 스케일바는 20μm을 나타내고, ** P < 0.01는 PBS와 비교한 그래프이다.
도 7은 c-src의 발현이 억제된 단량체 A53T α-syn이 과발현된 SHSY5Y 세포주를 대조군과 비교한 것이다. 스케일바는 20μm을 나타내고, ** P < 0.01는 비교군(NT)과 비교한 그래프이다.
도 8은 c-src의 발현과 활성이 α-syn의 응집체 형성에 영향을 미치는 것을 확인한 것으로, (A) src 의 발현이 억제된 경우, (B) src의 활성을 억제시킨 경우, A53T eGFP가 과발현되었을 때 응집되는 α-syn의 양이 감소되는 것을 확인한 결과이다. 스케일바는 20μm을 나타낸다.
도 9는 c-src의 발현이 억제된 단량체 A53T α-syn이 과발현된 SHSY5Y 세포주에서 A53T α-syn의 세포외 분비를 대조군과 비교한 것이다. 스케일바는 20μm을 나타내고, ** P < 0.01는 비교군(NT)과 비교한 그래프이다.
도 10의 (A)는 A53T α-syn 돌연변이 마우스 뇌에 응집된 α-syn을 주입한 돌연변이 마우스에 사라카티닙을 투여한후, 뇌조직에서 루이소체를 DAB 염색으로 확인한 것이며(스케일바는 50μm), (B)는 루이소체의 분포정도를 색으로 표시한 그림이고, (C)는 루이소체를 뇌조직의 구역별로 나눠서 수치화한 그래프를 나타낸 것이다. ** P < 0.01는 비교군(PBS)과 비교한 그래프이다.
도 11의 (A)는 primary neuron에서 c-src의 발현을 억제시킨 경우 α-syn의 전이를 나타낸 것이며, (B)는 primary neuron에서 c-src inhibitor를 처리한 경우 α-syn의 전이를 나타낸 것이다.
도 12는 c-src의 활성 정도에 따른 α-syn의 전이를 나타낸 것이다.
발명의 상세한 설명 및 바람직한 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명자들은 퇴행성 뇌질환의 병인기전을 밝힘으로써 보다 효과적인 새로운 치료전략을 세우기 위하여 다양한 연구를 수행하던 중, 알파-시누클레인(α-synuclein; α-syn)에 주목하게 되었다. 신경세포에서 분비된 알파-시누클레인이 인접해 있는 신경세포들에 작용하여 상기 세포를 활성화시킴으로써 신경세포의 손상에 관여한다는 가능성을 바탕으로, 세포 밖의 응집된 알파-시누클레인이 인접한 세포 내로 들어가는데 관여하는 단백질 c-src를 밝혀내었다. 또한, 상기 c-src는 파킨슨 병의 주요 원인이 될 가능성이 있는 α-syn의 응집체 변성에도 관여함을 확인하였다.
본 발명자들은 응집된 α-syn에 의해서 c-src의 활성화가 증가된다는 것을 확인하였으며, SHP-1 또는 SHP-2의 발현이 억제되면 α-syn에 의한 c-src의 활성화 증가가 억제됨을 확인하였다. 나아가, c-src의 발현이 억제됨에 따라 α-syn의 세포 간 전이현상이 감소함을 확인하고, 응집된 α-syn의 전이에 c-src가 중요한 역할을 하는 것을 알 수 있었다. 또한, 이러한 응집체 α-syn으로 변성 과정에 c-src가 관여함을 확인하였으므로, c-src의 활성 억제를 통해 시누클레인병증의 주요 원인으로 작용하는 α-syn의 응집체로의 변성을 억제하는 것을 알 수 있었다.
이처럼 시누클레인병증의 발병원인을 밝혀낼 수 있는 중요한 단서인 응집된 α-syn의 인접 세포로의 전이 메커니즘 및 단량체 α-syn의 응집체로의 변성 메커니즘은 종래에 전혀 공지되지 않았고, 본 발명자에 의하여 최초로 규명되었다.
따라서, 본 발명은 일 관점에서, c-src 단백질의 발현 또는 활성 억제제를 포함하는 알파-시누클레인(α-Synuclein; α-Syn)의 응집 및/또는 전이 억제용 조성물에 관한 것이다.
본 발명은 다른 관점에서, c-src 단백질의 발현 또는 활성 억제제를 대상에 투여하는 단계를 포함하는 알파-시누클레인의 응집 및/또는 전이 억제 방법에 관한 것이다.
본 발명의 "c-src"란 proto-oncogene tyrosine-protein kinase Src 또는 proto-oncogene c-src로도 알려져 있으며, src 유전자에 의해 코딩되는 non-receptor tyrosine kinase protein이다. 상기 c-src는 다른 단백질의 특정 타이로신 잔기를 인산화시킨다. "c-src"는 cellular Src kinase의 약자이다. c-src 티로신 키나아제의 증가 된 활성 수준은 다른 신호를 촉진함으로써 암의 진행과 관련이있는 것으로 알려져 있다. 이 발암 유전자는 배아 발달 및 세포 성장의 조절에도 역할을 할 수 있다. c-src는 SH2 도메인, SH3 도메인 및 티로신 키나아제 도메인을 포함한다.
본 발명에 있어서, 상기 c-src 단백질의 유전자 서열은 NCBI의 GenBank 등 공지의 데이터베이스에서 얻을 수 있는데, 그 예로서, GenBank Accession AAC29427.1로 표시되는 유전자일 수 있다.
본 발명의 용어 "c-src 활성화"란 c-src의 인산화를 의미하고, 본 발명의 목적상, 응집된 알파-시누클레인(α-synuclein; α-syn)에 의해 달성되는 것일 수 있으며, 상기 c-src 활성화는 α-syn의 전이를 증가시키는 현상에 관여할 수 있다.
본 발명의 용어 "알파-시누클레인(α-synuclein; α-syn)"이란, 세포질 내 루이소체(Lewy body)의 주 구성성분으로 알려진 단백질을 의미하며, 이에 제한되지 않지만, 본 발명의 목적상 퇴행성 뇌질환의 병인에 관여하는 단백질 분자일 수 있다. 상기 α-syn 유전자의 염기서열은 NCBI의 GenBank 등 공지의 데이터베이스에서 얻을 수 있는데, 그 예로서, GenBank Accession NP_0010359161 등으로 표시되는 유전자일 수 있다.
본 발명의 용어 "알파-시누클레인의 전이"란, 알파-시누클레인이 알파-시누클레인을 분비하는 세포로부터 인접한 곳에 위치한 다른 세포로 이동하는 현상을 의미한다. 이에 제한되지 않지만, 본 발명의 목적상 인접한 세포에 직접적인 독성을 나타내거나, 인접한 세포 내로 세포독성을 나타내는 신호를 전달하는 현상일 수 있으며, 상기 c-src의 활성화에 의해서 알파 시누클레인이 전이가 활성화될 수 있다. 즉, 응집된 알파 시누클레인이 세포밖에 존재하면, src의 활성화가 증가가 되어서 세포밖에 존재하는 알파 시누클레인이 세포 안으로 들어간다.
본 발명의 용어 "SHP-1/-2"이란, Src 상동성영역 2 도메인-포함 포스파타아제-1/-2(Src homology region 2 domain-containing phosphatase-1/-2)로서, PTPN6(Tyrosine-protein phosphatase non-receptor type 6)으로도 알려져 있으며, 일종의 단백질 티로신(tyrosine) 포스파타아제를 의미한다. 상기 SHP-1/-2는 N-말단(Nterminal)에 단백질 인산화-티로신 결합 도메인으로서 작용하는 Src 상동(Src homolog; SH2) 도메인을 포함하며, 세포 성장, 분화 및 유사분열 주기 등의 다양한 세포 내 과정을 조절하는 신호전달분자로 알려져 있다. 상기 SHP-1/-2 단백질의 유전자서열은 NCBI의 GenBank 등 공지의 데이터베이스에서 얻을 수 있는데, 그 예로서, GenBank Accession AAC360091, AAC360081 등으로 표시되는 유전자일 수 있다.
본 발명의 용어 "c-src의 발현 또는 활성을 억제할 수 있는 제제" 또는 "c-src의 발현 또는 활성 억제제"란, c-src를 코딩하는 유전자, mRNA 또는 단백질에 직접 또는 간접적으로 결합하여 c-src의 발현 또는 활성을 억제할 수 있는 물질을 의미한다. 본 명세서에서, 상기 c-src의 발현 또는 활성을 억제할 수 있는 제제는 c-src의 저해제 또는 c-src의 억제제와 동일한 의미로 사용될 수 있다.
본 발명에 있어서, 상기 c-src의 발현 또는 활성을 억제할 수 있는 제제는 c-src의 발현 또는 활성을 억제함으로써 시누클레인병증을 예방 또는 치료하는 효과를 나타내는 약학 조성물의 유효성분인 것일 수 있는데, 상기 제제는 특별히 이에 제한되지 않으나, 구체적인 예로, c-src의 발현을 억제할 수 있는 제제는 c-src 유전자의 mRNA에 상보적으로 결합하는 miRNA, siRNA, shRNA, 안티센스 올리고뉴클레오티드 및 이들의 조합으로 구성된 군으로부터 선택되는 것을 특징으로 할 수 있으며, 상기 c-src의 활성을 억제할 수 있는 제제는 c-src의 단백질에 상보적으로 결합할 수 있는 항체, 앱타머, 소분자 화합물(small molecules) 및 이들의 조합으로 구성된 군으로부터 선택되는 것을 특징으로 할 수 있다.
본 발명의 용어 "miRNA, siRNA 또는 shRNA"란, RNA 방해 또는 유전자 사일런싱(silencing)을 매개하기 위하여 주로 목적 유전자로부터 전사된 mRNA에 결합하여, 상기 mRNA의 해독을 저해하는 핵산 분자를 의미한다 상기 siRNA 또는 shRNA는 표적 유전자의 발현을 해독수준에서 억제할 수 있기 때문에, 효율적인 유전자 녹다운(knockdown) 방법 또는 유전자치료 방법에 사용될 수 있으며, 본 발명의 목적상, c-src의 발현을 억제을 억제하는데 사용될 수 있다.
본 발명에 있어서, 상기 shRNA는 서열번호 1 또는 서열번호 2의 염기서열로 표시되는 것을 특징으로 할 수 있으나, 이에 제한되는 것은 아니다.
shRNA(c-src KD #1):
CCGGGCTCGGCTCATTGAAGACAATCTCGAGATTGTCTTCAATGAGCCGAGCTTTTTG (서열번호 1)
shRNA(c-src KD #2):
CCGGGACAGACCTGTCCTTCAAGAACTCGAGTTCTTGAAGGACAGGTCTGTCTTTTTG (서열번호 2)
본 발명의 용어 "안티센스 올리고뉴클레오티드"란 특정 mRNA의 서열에 상보적인 핵산 서열을 함유하고 있는 DNA 또는 RNA 또는 이들의 유도체를 의미하는데, mRNA 내의 상보적인 서열에 결합하여 mRNA의 단백질로의 번역을 저해하는 효과를 나타내며, 본 발명의 목적상, c-src의 발현을 억제하는데 사용될 수 있다.
본 발명의 용어 "항체"란, 단백질 또는 펩티드 분자의 항원성 부위에 특이적으로 결합할 수 있는 단백질성 분자를 의미하는데, 이러한 항체는, 각 유전자를 통상적인 방법에 따라 발현벡터에 클로닝하여 상기 마커 유전자에 의해 코딩되는 단백질을 얻고, 얻어진 단백질로부터 통상적인 방법에 의해 제조될 수 있다.
본 발명에 있어서, 상기 항체는 퇴행성 뇌질환의 발병이 의심되는 개체의 활성화된 c-src 단백질에 결합함으로써, 상기 단백질의 활성을 억제할 수 있는 수단으로 해석될 수 있다. 구체적인 예로, c-src에 특이적으로 결합될 수 있는 폴리클로날 항체, 모노클로날 항체 또는 항원 결합성을 갖는 것이면 그것의 일부도 본 발명의 항체에 포함되고, 모든 면역 글로불린 항체가 포함될 수 있을 뿐만 아니라 인간화 항체 등의 특수 항체를 포함할 수도 있다. 아울러, 상기 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 완전한 형태뿐만 아니라 항체 분자의 기능적인 단편을 포함하는 형태가 될 수도 있다. 항체 분자의 기능적인 단편이란 적어도 항원 결합 기능을 보유하고 있는 단편을 의미하며 Fab, F(ab'), F(ab') 2 및 Fv 등이 될 수 있다.
본 발명의 용어 "앱타머(aptamer)"란 소정의 표적 분자에 대한 결합 활성을 갖는 핵산 분자를 의미한다. 상기 앱타머는 RNA, DNA, 수식(modified) 핵산 또는 이들의 혼합물일 수 있으며, 직쇄상 또는 환상의 형태일 수 있는데, 대체로, 상기 앱타머를 구성하는 뉴클레오티드의 서열이 짧을수록 화학합성 및 대량 생산이 보다 용이하고, 비용면에서의 장점이 우수하며, 화학수식이 용이하고, 생체 내 안정성이 우수하며, 독성이 낮다고 알려져 있다.
본 발명에 있어서, 상기 앱타머는 활성화된 c-src 단백질에 결합함으로써, 상기 단백질의 활성을 억제할 수 있는 수단으로 해석될 수 있다.
본 발명의 용어 "소분자 화합물(small molecules)"이란, 분자량이 작은 유기 화합물로, 단백질 등의 생체 고분자에 결합하여 그 기능을 조절하는 분자를 의미한다. 천연유래이거나 인공적으로 합성될 수 있으며, 단백질의 기능을 저해하거나 단백질-단백질 상호작용을 방해할 수도 있으나, 이에 제한되지 않는다.
본 발명의 목적상 상기 소분자 화합물은 활성화된 c-src 단백질의 활성을 억제하는 분자라면 제한 없이 포함하며, 구체적인 예로 활성화된 c-src에 결합하여 활성을 억제하는 분자를 의미하나, 이에 제한되지 않는다.
본 발명은 또 다른 관점에서, c-src의 발현 또는 활성 억제제를 포함하는 시누클레인병증(synucleinopathy) 예방 또는 치료용 약학 조성물에 관한 것이다.
본 발명의 용어 “시누클레인병증(synucleinopathy)”이란, 뉴런, 신경 섬유 또는 신경 교세포에서 α-syn 응집체의 비정상적인 축적을 특징으로 하는 퇴행성 신경질환을 의미한다.
본 발명에 있어서, 상기 시누클레인병증은 파킨슨병(Parkinson’s disease; PD), 루이소체 치매(dementia with Lewy bodies; DLB) 또는 다계통위축(multiple system atrophy; MSA)인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 용어 "퇴행성 신경질환"이란, 신경세포의 손상에 의해 야기되는 질환을 의미하며, 노화, 유전적 변이, 스트레스, 세포 내 단백질 제거 기능의 문제 등이 발병 원인이 될 것으로 추측되고 있지만, 정확한 원인은 밝혀지지 않았다.
본 발명의 용어 "예방"이란 본 발명의 c-src의 발현 또는 활성을 억제할 수 있는 제제를 유효성분으로 포함하는 약학적 조성물의 투여에 의해 시누클레인병증과 같은 퇴행성 신경질환의 발병을 억제시키거나 또는 지연시키는 모든 행위를 의미한다.
본 발명의 용어 "치료"란 상기 약학적 조성물의 투여에 의해 시누클레인병증과 같은 퇴행성 신경질환의 의심 및 발병 개체의 증상이 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
본 발명에 따른 c-src 단백질의 발현 또는 활성 억제제의 시누클레인병증(synucleinopathy) 치료효과는 c-src 단백질의 발현 또는 활성 억제제의 알파-시누클레인(α-Synuclein; α-Syn) 응집 및/또는 전이 억제 기능을 통해 달성될 수 있음을 특징으로 한다.
상기 본 발명의 약학적 조성물은, 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 또는 희석제를 추가로 포함하는 시누클레인병증 치료용 약학 조성물의 형태로 제조될 수 있는데, 상기 담체는 비자연적 담체(non-naturally occuring carrier)를 포함할 수 있다. 구체적으로, 상기 약학 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.
본 발명의 약학 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 구체적인 예로, 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트, 광물유 등을 들 수 있다.
제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다.
경구투여를 위한 고형 제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형 제제는 상기 추출물과 이의 분획물들에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘 카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제될 수 있다. 또한, 단순한 부형제 이외에 마그네슘 스티레이트, 탈크 같은 윤활제들도 사용될 수 있다.
경구투여를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.
비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제 등이 포함될 수 있다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다.
좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 약학 조성물에 포함된 상기 c-src의 발현 또는 활성을 억제할 수 있는 제제의 함량은 특별히 이에 제한되지 않으나, 최종 조성물 총 중량을 기준으로 0.0001 내지 50 중량%, 보다 구체적으로 0.01 내지 20 중량%의 함량으로 포함될 수 있다.
상기 본 발명의 약학 조성물은 약제학적으로 유효한 양으로 투여될 수 있는데, 본 발명의 용어 "약제학적으로 유효한 양"이란 의학적 치료 또는 예방에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료 또는 예방하기에 충분한 양을 의미하며, 유효 용량 수준은 질환의 중증도, 약물의 활성, 환자의 연령, 체중, 건강, 성별, 환자의 약물에 대한 민감도, 사용된 본 발명 조성물의 투여 시간, 투여 경로 및 배출 비율 치료기간, 사용된 본 발명의 조성물과 배합 또는 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 약학 조성물은 단독으로 투여하거나 공지된 면역치료제와 병용하여 투여될 수 있다 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하다.
본 발명의 약학 조성물의 투여량은 사용목적, 질환의 중독도, 환자의 연령, 체중, 성별, 기왕력, 또는 유효성분으로서 사용되는 물질의 종류 등을 고려하여 당업자가 결정할 수 있다. 예를 들어, 본 발명의 약학 조성물은 성인 1인당 약 0.1 ng/㎏ 내지 약 100 ㎎/㎏, 구체적으로 약 1 ng/㎏ 내지 약 10 ㎎/㎏로 투여할 수 있고, 본 발명의 조성물의 투여빈도는 특별히 이에 제한되지 않으나, 1일 1회 투여하거나 또는 용량을 분할하여 수회 투여할 수 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명은 또 다른 관점에서, c-src의 발현 또는 활성 억제제를 개체에 투여하는 것을 특징으로 하는 시누클레인병증의 예방 또는 치료방법에 관한 것이다.
본 발명의 용어 "개체"란 시누클레인병증이 발병될 가능성이 있거나 또는 발병된 쥐, 가축, 인간 등을 포함하는 포유동물, 양식어류 등을 제한 없이 포함할 수 있다.
본 발명의 시누클레인병증 예방 또는 치료용 약학 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여도 투여될 수 있다. 본 발명의 약학 조성물은 특별히 이에 제한되지 않으나, 목적하는 바에 따라 복강내 투여, 정맥내 투여, 근육내 투여, 피하 투여, 피내 투여, 경구 투여, 비내 투여, 폐내 투여, 직장내 투여 등의 경로를 통해 투여될 수 있다. 다만, 경구 투여 시에는 위산에 의하여 상기 c-src의 발현 또는 활성을 억제할 수 있는 제제가 변성될 수 있기 때문에 경구용 조성물은 활성 약제를 코팅하거나 위에서의 분해로부터 보호되도록 제형화 될 수 있다. 또한, 상기 조성물은 활성 물질이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다.
본 발명은 또 다른 관점에서, 시누클레인병증 치료를 위한 c-src의 발현 또는 활성 억제제의 용도에 관한 것이다.
본 발명은 또 다른 관점에서, 시누클레인병증 치료용 약제 제조를 위한 c-src의 발현 또는 활성 억제제의 사용에 관한 것이다.
본 발명은 또 다른 관점에서, (i) 신경조직 유래 세포에 시누클레인병증 치료제의 후보물질을 처리하는 단계; (ii) 상기 세포에서 c-src 단백질의 발현 또는 활성 정도를 측정하는 단계; 및 (iii) 상기 c-src 단백질의 발현 또는 활성 정도가 후보물질을 처리하지 않은 대조군에 비해 감소한 후보물질을 선별하는 단계를 포함하는 시누클레인병증(synucleinopathy) 치료제의 스크리닝 방법에 관한 것이다.
상기 (ii) 단계의 c-src 단백질의 발현 또는 활성 정도를 측정하는 단계는 상기 기술한 바와 같이 당업계에서 이용되는 통상의 발현 수준 측정 방법이 제한 없이 사용될 수 있으며, 이에 제한되지 않지만, 구체적인 예로 면역형광법, 효소면역분석법(ELISA), 웨스턴 블롯(Western Blot), 유세포 분석법(FACS), 면역조직화학, 면역침강법(immunoprecipitation), 방사능면역분석법(RIA) 및 RT-PCR로 구성된 군으로부터 선택된 어느 하나로 측정하는 것을 특징으로 할 수 있다.
또한, 시누클레인병증 치료제의 후보물질이 처리되는 상기 신경조직 유래 세포는 특별히 이에 제한되지 않으나 일 예로서, 신경세포 또는 신경교세포가 될 수 있고, 다른 예로서, 미세아교세포(microglia), 성상교세포(astrocyte), 희돌기교세포(oligodendrocyte), 상의세포(ependymal cell), 슈반세포(Schwann cell), 위성세포(satellite cell) 등의 신경교세포가 될 수 있으며, 바람직하게는 상기 신경조직 유래 세포는 도파민성 신경세포주 SHSY5Y인 것을 특징으로 할 수 있다.
본 발명의 용어 "시누클레인병증 치료제의 후보물질"이란, 시누클레인병증을 치료할 수 있을 것으로 예상되는 물질로, 직접 또는 간접적으로 시누클레인병증을 호전 또는 개선 시킬 수 있을 것으로 예상되는 물질이면 제한 없이 사용 가능하며, 화합물, 유전자 또는 단백질 등의 모든 치료가능 예상물질을 포함한다.
본 발명의 스크리닝 방법은 상기 후보물질 투여 전후에 c-src의 활성화 여부를 측정하는 한편, 상기 c-src의 활성화가 후보물질 투여 전에 비해 투여 후에 억제된 경우, 해당 후보물질을 시누클레인병증의 치료제로서 결정할 수 있다.
본 발명은 또 다른 관점에서, c-src의 활성 수준을 측정할 수 있는 물질을 포함하는 시누클레인병증(synucleinopathy) 진단용 조성물에 관한 것이다.
본 발명에 있어서, "c-src의 활성 수준을 측정할 수 있는 물질"이란, "c-src의 인산화 여부를 측정할 수 있는 제제를 의미하며, 본 발명의 목적상, 세포에 대한 응집된 α-syn의 영향을 평가하는데 이용될 수 있는 물질을 의미한다. 상기 물질은 특별히 이에 제한되지 않으나, 구체적인 예로, 활성화된 c-src에 특이적으로 결합할 수 있는 항체 또는 앱타머일 수 있다.
본 발명의 용어 "항체"란, 단백질 또는 펩티드 분자의 항원성 부위에 특이적으로 결합할 수 있는 단백질성 분자를 의미하는데, 이러한 항체는, 각 유전자를 통상적인 방법에 따라 발현벡터에 클로닝하여 상기 마커 유전자에 의해 코딩되는 단백질을 얻고, 얻어진 단백질로부터 통상적인 방법에 의해 제조될 수 있다.
본 발명의 목적상 상기 항체는 시누클레인병증의 발병이 의심되는 개체의 응집된 α-syn에 의해 활성화된 c-src 단백질에 결합함으로써, 상기 단백질의 활성화 여부를 측정할 수 있는 수단으로 해석될 수 있다. 구체적인 예로, c-src에 특이적으로 결합될 수 있는 폴리클로날 항체, 모노클로날 항체 또는 항원 결합성을 갖는 것이면 그것의 일부도 본 발명의 항체에 포함되고, 모든 면역 글로불린 항체가 포함될 수 있을 뿐만 아니라 인간화 항체 등의 특수 항체를 포함할 수도 있다.
아울러, 상기 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 완전한 형태뿐만 아니라 항체 분자의 기능적인 단편을 포함하는 형태가 될 수도 있다. 항체 분자의 기능적인 단편이란 적어도 항원 결합 기능을 보유하고 있는 단편을 의미하며 Fab, F(ab'), F(ab') 2 및 Fv 등이 될 수 있다.
본 발명의 용어 "앱타머(aptamer)"란 소정의 표적 분자에 대한 결합 활성을 갖는 핵산 분자를 의미한다. 상기 앱타머는 RNA, DNA, 수식(modified) 핵산 또는 이들의 혼합물일 수 있으며, 직쇄상 또는 환상의 형태일 수 있는데, 대체로, 상기 앱타머를 구성하는 뉴클레오티드의 서열이 짧을수록 화학합성 및 대량 생산이 보다 용이하고, 비용면에서의 장점이 우수하며, 화학수식이 용이하고, 생체 내 안정성이 우수하며, 독성이 낮다고 알려져 있다.
본 발명의 목적상 상기 앱타머는 c-src 단백질에 결합함으로써, 상기 단백질의 활성화 여부를 측정할 수 있는 수단으로 해석될 수 있다.
본 발명의 용어 "진단"이란, 병리 상태의 존재 또는 특징을 확인하는 것으로서, 본 발명의 목적상, 시누클레인병증과 같은 퇴행성 신경질환의 발병 여부를 확인하는 것뿐만 아니라 퇴행성 신경질환의 치료 후 해당 개체의 재발, 전이, 약물 반응성, 내성 등과 같은 경과를 판단하는 것을 포함할 수 있다.
본 발명의 용어 "개체"란, 말, 개, 고양이, 돼지, 염소, 토끼, 햄스터, 원숭이, 기니피그(guinea pigs), 래트, 마우스, 도마뱀, 뱀, 양, 소, 물고기 및 새를 제한 없이 포함하며, 임의의 동물(예컨대, 인간)을 의미한다 보다 넓게는 상기 동물의 세포주까지 제한 없이 포함할 수 있다.
본 발명은 또 다른 관점에서, 상기 조성물을 포함하는 시누클레인병증(synucleinopathy) 진단용 키트에 관한 것이다.
본 발명의 시누클레인병증 진단용 키트는 시누클레인병증을 진단하는 표지자인 알파-시누클레인(α-Synuclein)의 인접세포로의 전이를 직접 측정하거나, 또는 알파-시누클레인에 의해 활성화된 c-src의 활성을 측정하기 위한 프라이머, 프로브 또는 상기 단백질을 선택적으로 인지하는 항체뿐만 아니라 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성성분 조성물, 용액, 또는 장치가 포함될 수 있다.
또한, 상기 본 발명의 키트는 항체의 면역학적 검출을 위하여 기질, 적당한 완충용액, 발색 효소 또는 형광물질로 표지된 2차 항체, 및 발색 기질 등을 포함할 수 있다. 상기에서 기질은 니트로셀룰로오스 막, 폴리비닐 수지로 합성된 96-웰 플레이트, 폴리스틸렌 수지로 합성된 96-웰 플레이트 및 유리로 된 슬라이드 글라스 등이 이용될 수 있고, 발색효소는 퍼옥시다아제(peroxidase), 알칼라인 포스파타아제(alkaline phosphatase) 등이 사용될 수 있고, 형광물질은 FITC, RITC 등이 사용될 수 있고, 발색기질액은 ABTS(2,2'-아지노-비스-(3-에틸벤조티아졸린-6-설폰산)) 또는 OPD(o-페닐렌디아민), TMB(테트라메틸 벤지딘)가 사용될 수 있지만, 이에 제한되지 않는다. 더불어, 단백질 수준을 분석하기 위하여, 웨스턴블롯(Western blot), ELISA(Enzyme Linked Immunosorbent Assay), 방사선면역분석(otA: badioimmunoassay), 방사 면역 확산법, 오우크테로니 면역 확산법, 로케트 면역 전기영동, 조직면역 염색, 면역침전 분석법, 보체 고정 분석법, FACS 및 단백질 칩 등의 방법을 포함할 수 있지만, 이에 제한되지 않는다.
본 발명은 또 다른 관점에서, 상기 진단용 조성물 또는 상기 키트를 이용하여 시누클레인병증이 의심되는 대상체(subject)로부터 분리된 생물학적 시료에서 c-src의 활성 수준을 측정하는 단계를 포함하는 시누클레인병증(synucleinopathy) 진단을 위한 정보제공 방법에 관한 것이다.
본 발명은 또 다른 관점에서, 상기 조성물 또는 상기 키트를 이용하여 시누클레인병증이 의심되는 대상체(subject)로부터 분리된 생물학적 시료에서 c-src의 활성 수준을 측정하는 단계를 포함하는 시누클레인병증 진단방법에 관한 것이다.
본 발명에 있어서, 상기 c-src가 활성 수준이 대조군에 비해 증가한 경우 시누클레인병증이 발병한 것으로 판단하는 것을 특징으로 할 수 있다.
본 발명의 용어, "시료"는 시누클레인병증 진단의 지표인 c-src의 활성화 여부에 차이를 나타내는 한 특별히 이에 제한되지 않으나, 신경조직 유래 세포, 전혈, 혈청, 혈액, 혈장, 타액, 뇨, 객담, 림프액, 뇌척수액 및 세포간질액으로 구성된 군으로부터 선택되는 어느 하나 이상의 시료일 수 있으며, 이에 제한되지 않는다.
본 발명에서, 상기 c-src의 활성화 여부를 측정하기 위한 방법으로는 웨스턴블롯(Western blot), 공동-면역침전 어세이(Co-Immunoprecipitation assay), ELISA(Enzyme Linked Immunosorbent Assay), 실시간 RT-PCR, 전기영동, 조직 면역염색(immunostaining) 및 FACS(Fluorescence activated cell sorter) 등이 있으나, 이에 제한되지 않는다.
[실시예]
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1: 재조합 α-시누클레인(α-Synuclein; α-Syn) 및 응집된 α-syn 제조
재조합 α-시누클레인(α-Synuclein; α-Syn) 및 응집된 α-syn을 준비하였다(KR 10-1838802). 재조합 α-Syn을 대장균주 BL21(DE3)에서 과발현시키고, 상기 재조합 단백질을 공지된 방법으로 정제하였다(Lee, S B, et al, Biochem Biophys Res Commun 381, 39-43, 2009). 정제한 α-Syn 단백질을 단량체 α-Syn로서 사용하기 전까지 -80℃에서 보관하였다. 2 ㎎/㎖의 단량체 α-syn을 37℃에서 250 rpm으로 연속적인 교반을 하면서 2주 동안 배양하였고, 간단하게 초음파 처리하여 분해한 후, 응집된 α-syn로서 사용하기 전까지 -80℃에서 보관하였다. 본 발명의 모든 실시예에서 상기 제조한, 응집된 α-syn을 사용하였다.
실시예 2: SHP-1 발현이 억제된 SHSY5Y 세포주 및 SHP-2 발현이 억제된 SHSY5Y 세포주의 제조
SHP-1 발현억제(knockdown; KD) 세포주 및 SHP-2 발현억제(knockdown; KD) 세포주는 다음과 같은 방법으로 제작하였다.
SHP-1/2의 shRNA를 발현하는 렌티바이러스 구성체(Sigma, St. Louis, MO)를 이용하여 공지된 방법으로 SHP-1/2 발현억제 SHSY5Y 제조하였고(Yoon, S., et al., Cell Death Dis. 5:e1494, 2014), 퓨로마이신(puromycin)을 이용하여 선발하였다.
그 다음, 상기 제조한 SHP-1/2 발현억제 SHSY5Y 세포주에서 SHP-1/2의 발현양을 SHP-1/2 항체를 이용하여 웨스턴블롯을 통해 조사하였고, 그 결과, 제조한 SHP-1/2 발현억제 SHSY5Y 세포주에서 SHP-1/2의 발현이 효율적으로 감소함을 확인하였다.
실시예 3: 마우스 일차신경세포 및 A53T 이형접합 형질전환 마우스의 뇌 용해물 준비
C57BL6 마우스 1일령의 대뇌겉질(cerebral cortices)에서 분리하여 기존 문헌(CHA, S. H., et al., Mol neurodegener. 10:63, 2015)에 기재된 바에 따라 배양해서 마우스의 일차신경세포를 수득하였다.
다음으로, 인간에서 발현하는 α-시누클레인(α-Synuclein; α-Syn)의 돌연변이 중 하나인 A53T를 유전자 변형 마우스에서 과발현시킨 모델(B6;C3-Tg(Prnp-SNCA*A53T)83Vle/J, M83;, Jackson Laboratory)의 마우스인 A53T 이형접합 형질전환 마우스의 뇌 용해물은 다음과 같은 방법으로 수득하였다.
9개월령 된 C57BL6 A53T α-syn 이형 형질전환 마우스 및 대조군 C57BL6 마우스로부터 기존 문헌(Lee, H J, et al, Exp Neurobiol 20:181-8, 2011)에 기재된 바에 따라 뇌를 획득하였다. 두뇌 반구를 단백질 억제제 및 포스파타아제 억제제 칵테일이 포함된 600㎕의 차가운 RIPA 버퍼 안에 넣고 균질화하였다. 용해물을 4℃에서 30분 동안 배양하였고, 상기 용해물을 4℃에서 30분 동안 14,000 rpm으로 원심분리하였다. 상층액을 획득하여 웨스턴블롯을 수행하였다.
실시예 4: 응집된 α-syn에 의한 c-src의 활성화 증가
도파민성 신경세포주인 SHSY5Y 세포주, 실시예 3의 마우스 일차신경세포 및 실시예 3의 마우스 뇌 용해물을 이용하여 응집된 α-syn에 의한 c-src의 활성화를 조사하였다.
상기 SHSY5Y 세포주 및 마우스 일차신경세포는 모두 각각 1 μM의 응집된 α-syn을 이용하여 10분 동안 배양한 후, 용해하여 웨스턴 블롯을 수행하였다(도 1A 및 1B). 또한, A53T TG 마우스는 야생형 WT(wild type) C57BL6 마우스의 전체 뇌 용해물과 웨스턴 블롯으로 비교하였다(도 1C).
웨스턴블롯은 각 세포를 단백질 억제제(2 mM phenylmethylsulfonyl fluoride, 100 ㎍/ml leupeptin, 10 ㎍/ml pepstatin, 1 ㎍/ml aprotinin 및 2 mM EDTA) 및 포스파타아제 억제제 칵테일(GenDEPOT, Baker, TX)이 포함된 차가운 RIPA 버퍼(50 mM Tris-HCl, pH 74, 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mM NaCl)로 용해하였다. 초음파처리를 통해 세포를 용해한 후, 용해물을 4℃에서 30분 동안 14,000 rpm으로 원심분리하였고, 상층액을 수득하였다. 단백질 농도를 BCA 단백질 어세이 키트를 이용하여 측정하였다. 단백질들을 SDS-PAGE를 이용하여 분리하였고, 니트로셀룰로오스 막(nitrocellulose membrane)으로 전이시킨 후, ECL(chemiluminescence) 시스템(Thermo, Waltham, MA)을 이용하여 상기 단백질을 가시화하였다.
그 결과, 응집된 α-syn에 의해 c-src의 활성이 증가하는 것을 확인하였다.
실시예 5: SHP-1 또는 SHP-2 억제에 의한 응집된 α-syn 매개 c-src 활성 억제
SHSY5Y 세포주를 SHP-1/2 저해제인 20 μM의 NSC87877, SHP-1 저해제인 10 μM SSG 또는 SHP-2 저해제인 1 μM PHPS-1로 30분 동안 미리 처리한 후, 1 μM의 응집된 α-syn을 이용하여 10분 동안 배양한 다음, 용해하여 웨스턴 블롯을 수행하였다(도 2).
또한, 실시예 2에서 제조한 SHP-1발현이 억제된 SHSY5Y 세포주 및 SHP-2 발현이 억제된 SHSY5Y 세포주에 1 μM의 응집된 α-syn을 처리하여 10분 동안 배양한 후, 용해하여 웨스턴 블롯을 수행하였다(도 3).
그 결과, SHP-1 또는 SHP-2가 억제되면 응집된 α-syn 매개 src 활성이 감소하는 것을 확인하였다.
실시예 6: α-syn 전이에 대한 c-src의 영향
Two chamber 시스템을 이용해서 12웰 플레이트에 알파시누클레인이 과발현한 SHSY5Y cell을 인서트웰(insert well)에 4 x 104으로 깔고 커버글라스에는 SHSY5Y세포주를 4 x 104으로 깔은뒤 그 다음날 인서트웰을 12웰 커버글라스가 있는 곳으로 옮겨서 12h동안 공동배양하는 동안에 SHSY5Y 세포주에 c-src 저해제인 0.1μM 사라카티닙과 10μM SKI(c-src kinase inhibitor I)을 처리한 다음, 커버글라스에 있는 SHSY5Y에서 알파시누클레인을 면역염색법을 이용해서 알파시누클레인이 과발현된 SHSY5Y에서 알파시누클레인이 과발현이 되지 않은 SHSY5Y로 이동한 것을 확인한 것을 면역염색(α-syn: 붉은색, 핵: 푸른색)하여 공초점 현미경으로 관찰하였다.
그 결과, PBS 대조군에서는 α-syn의 전이가 관찰되지만, 사라카티닙과 SKI를 처리하면 α-syn의 전이가 감소되는 것을 확인할 수 있었다(도 4).
다음으로, 서열번호 1 및 서열번호 2의 shRNA를 이용(letivirus를 이용)해서 만든 c-src 발현이 억제된 SHSY5Y 세포주(KD #1 및 KD #2)와 α-syn이 과발현된 도파민성 신경세포주 SHSY5Y를 Two chamber를 이용하여 12시간 동안 공동배양(Co-culture)을 수행하였다. 상기 공동배양을 간략히 정리하면, SHSY5Y 세포를 12-웰 커버글라스(cover glass)위에 웰당 4 x 104 세포의 농도로 분주하였다. 각각 하루 동안 배양한 이후, α-syn이 과발현된 SHSY5Y 세포가 분주되어 있는 트렌스웰을 src 발현이 억제된 SHSY5Y 세포가 분주된 12-웰 커버글라스로 옮겨 12시간 동안 공동배양을 수행하였고, 그 이후, 면역염색(α-syn: 붉은색, 핵: 푸른색)하여 공초점현미경으로 관찰하였다.
정상 대조군(NT; non-targeting) SHSY5Y 세포주와 c-src의 발현이 억제된 SHSY5Y에서 α-syn의 전이를 확인한 결과, c-src의 발현이 억제됨에 따라 α-syn의 전이현상이 감소된다는 것을 알 수 있었다(도 5).
실시예 7: 단량체 α-syn의 응집체 변성에 대한 c-src의 영향
단량체 α-syn이 응집체가 되는 변성과정이 파킨슨의 주된 원인이 될 수 있는 가능성이 있다. 따라서, SHSY5Y 세포주에서 단량체 A53T α-syn을 과발현시키고, 이 과발현된 단량체 A53T α-syn이 응집체로 변형되는 과정에 c-src가 관여하는 지를 확인하였다.
실시예 2의 방법으로 eGPF로 표지된 A53T α-syn 및 mcherry로 표지된 A53T α-syn이 과발현된 SHSY5Y 세포주를 lentivirus을 이용하여 각각 제작하였다. 그 다음, eGPF로 표지된 A53T α-syn이 과발현된 SHSY5Y 세포주 및 mcherry로 표지된 A53T α-syn이 과발현된 SHSY5Y 세포주를 섞어서 공동배양(Co-culture)을 수행하였다. 공동배양을 진행한 5일째에 공초점 현미경을 이용해서 eGFP로 표지된 A53T α-syn의 세포 안에서의 eGFP와 mcherry가 합쳐진 분포도를 확인하였으며, 또한 mch로 표지된 A53T α-syn의 세포 안에서의 mcherry와 eGFP가 합쳐진 분포도도 각각 확인였다.
도 6은 상기 제조된 SHSY5Y 세포주의 공배양 세포에 c-src 저해제인 SKI와 사라카티닙을 처리한 결과이다. 또한, 도 7은 서열번호 1 및 서열번호 2의 shRNA를 이용하여 c-src 발현을 억제시킨 A53T α-syn eGFP 및 A53T α-syn mcherry를 공배양한 후 확인하였다.
Src KD SHSY5Y(서열번호 1 및 서열번호 2의 shRNA를 이용)에서 A53T eGFP을 과발현시켜 FACS로 eGFP 신호를 띄는 것을 선별하여 배양한 뒤, retinoid acid 50μM을 처리하고 5일동안 분화시킨 후 공초점현미경을 이용해서 사진을 찍었다. 그 결과, src의 발현이 억제된 세포에서 응집된 α-syn의 양이 감소되는 것을 확인하였다(도 8A).
또한, A53T eGFP의 과발현된 SHSY5Y에서 각각 SKI(c-src kinase inhibitor I) 10μM, 사라카티닙 0.5μM을 처리하고, RA(retioid acid) 50μM로 분화시켜서 응집된 α-syn을 공초점현미경으로 확인한 결과, src의 활성을 억제시켰을 때 응집된 α-syn의 양이 감소됨을 확인하였다(도 8B).
마지막으로, 정상 대조군(NT; non-targeting)와 비교하여 c-src 발현이 억제된 SHSY5Y 세포주는 A53T α-syn eGFP가 세포 밖으로의 이동이 감소된 것을 확인하였다(도 9).
실시예 8: α-Syn 돌연변이 A53T의 유전자 변형 마우스에서 α-syn의 전이 확인
응집된 α-syn에 의해 돌연변이 생쥐에서 α-syn의 전이가 일어난다는 것을 확인하였다.
인간에서 발현하는 α-시누클레인(α-Synuclein; α-Syn)의 돌연변이 중 하나인 A53T를 유전자 변형 마우스에서 과발현시킨 모델(B6;C3-Tg(Prnp-SNCA*A53T)83Vle/J, M83;, Jackson Laboratory)의 마우스 8주~12주령을 에버틴(Avertin)으로 체중 20g당, 200μl의 용량으로 투여하여 마취시킨 후, 스테레오택식(Stereotaxic) 수술 기구에 고정을 시키고, 생쥐의 정수리점(Bregma)을 기준으로 전방 1.0mm, 우측 1.8mm, 깊이 3.0mm의 좌표로, 해밀턴 실린지(Hamilton syringe)를 사용하여, 응집된 α-syn을 10μg의 용량으로 생쥐의 선조체(Striatum)에 주입하였다(도 10).
그 다음, 3일 정도 간호 후에 사라카티닙을 10mg/kg의 농도로 매일 1회씩, 총 4주 동안 구강투여 하였다. 그 후, 생쥐를 우레탄(Urethane)으로 체중 20g당, 200μl의 용량으로 투여하여 마취시킨 후, 흉부를 절개하여 심장의 좌심실을 통해서 3분간 관류액을 흘려보내서 우심방을 절단 후, 혈액을 제거하고 3분간 4%의 포름알데히드를 흘려보내 생쥐의 조직을 고정(fixation) 시켰다. 그 다음, 뇌를 추출해서 4% 포름알데히드 고정액에 하루 담근 후 30% 설탕물에서 바닥까지 가라앉을 때까지 탈수과정을 진행하였다. 이후 바닥에 가라앉은 것이 확인되면, 고정판에 뇌를 올려놓고, 오씨티 컴파운드(O.C.T Compound)로 -20℃에서 컴파운드를 얼린 후, 다시 -80℃에서 30분간 냉동하여 35μm의 두께로 뇌절편을 만들었다. 뇌절편은 조직보관액에 보관하였다.
뇌절편을 조직면역염색에 사용 시, 건져내어 PBS로 10분씩 3회 세척 후(이하 각 특정 용액에 반응 후, 무조건 3회 세척)에, 3% 과산화수소수로 5분간 조직 내의 과산화 효소를 제거하였다. 세척 후에 블로킹 용액(1% BSA, 0.2% Triton X-100)으로 1시간 동안 블로킹 후, 응집된 α-syn을 표적으로 하는 pSyn#64 1차 항체(wako #01525191)를 1:5,000의 농도 및 2차 항체를 1:5,000의 농도로 반응시키고, 조직에 반응하여 붙어있는 항체들을 ABC 콤플렉스로 반응하고, 3’3-Diaminobenzidine으로 발색반응을 시켰다. 이후 조직을 마이크로 글래스에 붙여서 건조시켜 100%, 70%, 20% 에탄올로 수화시킨 후, 헤마톡실린(Hematoxylin)으로 핵을 염색하고 70% 에탄올을 시작으로 80, 90, 100% 에탄올에 순차적으로 탈수반응을 진행시켰다. 이후 자일렌(Xylene)에 하루 정도 반응 후, 이를 꺼내서 글래스 위에 마운트 용액을 올린 후 커버 글래스로 덮고, 해부현미경을 사용해서 배율 400x로 분석하였다.
상기 α-Syn 돌연변이 A53T의 유전자 변형 마우스에 4주 동안 PBS, 10μg의 응집된 α-syn 각각을 주입한 군, 응집된 α-syn을 주입하고 사라카티닙을 10mg/kg로 매일 주사한 군의 뇌조직을 상기 방법으로 수득한 다음, DAB 염색법으로 루이소체를 염색하여, 각 부위에서 α-syn 전이 여부를 확인한 결과를 도 10의 (A)에 나타내었다. 도 10의 (B) 및 (C)는 α-syn 전이된 정도를 뇌조직의 구역별로 표시한 그림 및 그래프를 나타낸 것이다.
실시예 9: c-src 발현 억제 또는 활성 억제에 따른 α-syn 전이 감소 현상 확인
Rat TP18(임신 18일째 새끼)에서 cortex를 분리하여 14일동안 neural basal media에서 primary neuron을 배양하였다. 14일째에 lentivirus(NT와 src KD #1 virus 이용)를 이용하여 src의 발현을 억제시켰다.
c-src 발현 억제의 α-syn 전이에 대한 효과를 확인하기 위하여, A53T eGFP가 과발현된 SHSY5Y을 5일동안 50μM RA(Retinoid acid)로 분화시킨 후 dual chamber assay를 수행하였다. c-src 활성 억제의 α-syn 전이에 대한 효과를 확인하기 위하여, 14일째 primary neuron에서 10μM SKI, 0.5μM Sara을 처리하고 dual chamber assay를 수행하였다.
그 결과, primary neuron culture에서 lentivirus을 이용하여 c-src의 발현을 억제시킨 경우, α-syn의 전이 감소를 확인하였다(도 11(A)). 또한, c-src inhibitor를 처리한 경우, α-syn의 전이 감소를 확인하였다(도 11(B)).
실시예 10: α-syn 전이에 대한 c-src 활성화 정도의 영향
SHSY5Y에 mock, WT c-src GFP, CA(Y527F, kinase active mutant form) c-src GFP 또는 DA(K295F, kinase death mutant forom) c-src GFP를 과발현시킨 후, α-syn이 이동하는 정도를 확인하였다.
그 결과, 과발현되지 않은 세포에 비해서 WT와 CA가 과발현된 세포에서 α-syn의 전이 정도가 증가됨을 확인하였다(도 12). 즉, c-src의 활성화 정도에 따라 α-syn의 전이가 증가됨을 확인하였다.
본 발명의 c-src 단백질의 발현 또는 활성 억제제는 알파-시누클레인(α-Synuclein; α-Syn)이 인접한 세포로 전이하여 야기하는 신호전달을 억제할 수 있어서 인접한 세포에 대한 α-syn의 세포독성 영향을 감소시키며, 단량체 α-syn가 시누클레인병증의 주요 원인이 될 수 있는 응집체 α-syn로의 변성을 억제할 수 있으므로, 시누클레인병증의 치료제로 유용하게 사용될 수 있다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
전자파일 첨부하였음.

Claims (15)

  1. c-src 단백질의 발현 또는 활성 억제제를 포함하는 알파-시누클레인(α-Synuclein; α-Syn)의 응집 및/또는 전이 억제용 조성물.
  2. 제1항에 있어서, 상기 c-src 단백질의 발현 억제제는 c-src 유전자의 mRNA에 상보적으로 결합하는 miRNA, siRNA, shRNA, 안티센스 올리고뉴클레오티드 및 이들의 조합으로 구성된 군으로부터 선택되는 것을 특징으로 하는 조성물.
  3. 제2항에 있어서, 상기 shRNA는 서열번호 1 또는 서열번호 2의 염기서열로 표시되는 것을 특징으로 하는 조성물.
  4. 제1항에 있어서, 상기 c-src의 활성 억제제는 c-src의 단백질에 상보적으로 결합할 수 있는 항체, 앱타머, 소분자 화합물 및 이들의 조합으로 구성된 군으로부터 선택되는 것을 특징으로 하는 조성물.
  5. c-src 단백질의 발현 또는 활성 억제제를 포함하는 시누클레인병증(synucleinopathy) 예방 또는 치료용 약학 조성물.
  6. 제5항에 있어서, 상기 시누클레인병증은 파킨슨병(Parkinson’s disease; PD), 루이소체 치매(dementia with Lewy bodies; DLB) 또는 다계통위축(multiple system atrophy; MSA)인 것을 특징으로 하는 시누클레인병증 예방 또는 치료용 약학 조성물.
  7. 다음 단계를 포함하는 시누클레인병증(synucleinopathy) 치료제의 스크리닝 방법:
    (i) 신경조직 유래 세포에 시누클레인병증 치료제의 후보물질을 처리하는 단계;
    (ii) 상기 세포에서 c-src 단백질의 발현 또는 활성 정도를 측정하는 단계; 및
    (iii) 상기 c-src 단백질의 발현 또는 활성 정도가 후보물질을 처리하지 않은 대조군에 비해 감소한 후보물질을 선별하는 단계.
  8. 제7항에 있어서, 상기 신경조직 유래 세포는 도파민성 신경세포주 SHSY5Y인 것을 특징으로 하는 시누클레인병증 치료제의 스크리닝 방법.
  9. 제7항에 있어서, 상기 (ii) 단계의 c-src의 발현 또는 활성 정도는 면역형광법, 효소면역분석법(ELISA), 웨스턴 블롯(Western Blot), 유세포 분석법 (FACS), 면역조직화학, 면역침강법(immunoprecipitation), 방사능면역분석법(RIA) 및 RT-PCR로 구성된 군으로부터 선택된 어느 하나로 측정하는 것을 특징으로 하는 시누클레인병증 치료제의 스크리닝 방법.
  10. c-src의 활성 수준을 측정할 수 있는 물질을 포함하는 시누클레인병증(synucleinopathy) 진단용 조성물.
  11. 제10항에 있어서, 상기 c-src의 활성 수준을 측정할 수 있는 물질은 활성화된 c-src에 특이적으로 결합할 수 있는 항체 또는 앱타머인 것을 특징으로 하는 시누클레인병증 진단용 조성물.
  12. 제10항의 조성물을 포함하는 시누클레인병증(synucleinopathy) 진단용 키트.
  13. 제10항의 조성물 또는 제12항의 키트를 이용하여 시누클레인병증이 의심되는 대상체(subject)로부터 분리된 생물학적 시료에서 c-src의 활성 수준을 측정하는 단계를 포함하는 시누클레인병증(synucleinopathy) 진단을 위한 정보제공 방법.
  14. 제13항에 있어서, 상기 c-src가 활성 수준이 대조군에 비해 증가한 경우 시누클레인병증이 발병한 것으로 판단하는 것을 특징으로 하는 시누클레인병증 진단을 위한 정보제공 방법.
  15. 제13항에 있어서, 상기 생물학적 시료는 신경조직 유래 세포, 전혈, 혈청, 혈액, 혈장, 타액, 뇨, 객담, 림프액, 뇌척수액 및 세포간질액으로 구성된 군으로부터 선택된 어느 하나 이상인 것을 특징으로 하는 시누클레인병증 진단을 위한 정보제공 방법.
PCT/KR2019/006870 2018-06-08 2019-06-07 C-src의 발현 또는 활성 억제제를 포함하는 시누클레인병증의 예방 또는 치료용 약학 조성물 WO2019235876A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201980046255.2A CN112384248A (zh) 2018-06-08 2019-06-07 预防或治疗突触核蛋白病的包含c-src的表达或活性抑制剂的药物组合物
US17/113,630 US20210101966A1 (en) 2018-06-08 2020-12-07 Pharmaceutical composition comprising expression or activity inhibitor of c-src for preventing or treating synucleinopathy

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2018-0066005 2018-06-08
KR20180066005 2018-06-08

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/113,630 Continuation-In-Part US20210101966A1 (en) 2018-06-08 2020-12-07 Pharmaceutical composition comprising expression or activity inhibitor of c-src for preventing or treating synucleinopathy

Publications (1)

Publication Number Publication Date
WO2019235876A1 true WO2019235876A1 (ko) 2019-12-12

Family

ID=68769167

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/006870 WO2019235876A1 (ko) 2018-06-08 2019-06-07 C-src의 발현 또는 활성 억제제를 포함하는 시누클레인병증의 예방 또는 치료용 약학 조성물

Country Status (4)

Country Link
US (1) US20210101966A1 (ko)
KR (1) KR102261005B1 (ko)
CN (1) CN112384248A (ko)
WO (1) WO2019235876A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102663668B1 (ko) * 2020-10-08 2024-05-08 상지대학교산학협력단 Trdn을 포함하거나 조절하는 파킨슨병용 약제학적 조성물 및 그 치료제
CN113827729B (zh) * 2021-11-08 2022-12-06 复旦大学附属中山医院 Pd-1/pd-l1拮抗剂在抗癫痫上的应用

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0715809D0 (en) * 2007-08-14 2007-09-26 Univ Leuven Kath Alpha synuclein toxicity
US8618063B2 (en) * 2008-04-09 2013-12-31 The Board Of Trustees Of The University Of Illinois Method for treating a synucleinopathy
US10660957B2 (en) * 2013-06-13 2020-05-26 Yale University Compositions and methods for treating an Aβ-modulated disease or disorder or improving cognition in a subject
US10085976B2 (en) * 2015-07-15 2018-10-02 Ajou University Industry-Academic Cooperation Foundation Pharmaceutical composition for preventing or treating neurodegenerative diseases
US20230017675A1 (en) * 2019-12-19 2023-01-19 Standigm Inc. Composition for treating synucleinopathies
KR20210079213A (ko) * 2019-12-19 2021-06-29 주식회사 스탠다임 시누클레인병증 치료용 조성물

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ELLIS, C. E. ET AL: "a-Synuclein is phosphorylated by members of the Src family of protein-tyrosine kinases", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 276, no. 6, 9 February 2001 (2001-02-09), pages 3879 - 3884, XP002983968, ISSN: 0021-9258, DOI: 10.1074/jbc.M010316200 *
EMAMZADEH, F. N.: "Alpha-synuclein structure, functions, and interactions", JOURNAL OF RESEARCH IN MEDICAL SCIENCES, 1 January 2016 (2016-01-01), pages 1 - 9, XP055662376, ISSN: 1735-1995, DOI: 10.4103/1735-1995.181989 *
KANG, S. S.: "a-Synuclein binds and sequesters PIKE-L into Lewy bodies , triggering dopaminergic cell death via AMPK hyperactivation", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 114, no. 5, 17 January 2017 (2017-01-17), pages 1183 - 1188, XP055662370, ISSN: 0027-8424, DOI: 10.1073/pnas.1618627114 *
KHANNA, S.: "Regulation of c-Src activity in glutamate-induced neurodegeneration", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 282, no. 32, 10 August 2007 (2007-08-10), pages 23482 - 23490, XP055662366, ISSN: 0021-9258, DOI: 10.1074/jbc.M611269200 *
NAKAMURA, T. ET AL: "Activation of Pyk2/RAFTK induces tyrosine phosphorylation of a-synuclein via Src-family kinases", FEBS LETTERS, vol. 521, no. 1-3, 19 June 2002 (2002-06-19), pages 190 - 194, XP004629955, ISSN: 0014-5793, DOI: 10.1016/S0014-5793(02)02861-2 *

Also Published As

Publication number Publication date
CN112384248A (zh) 2021-02-19
US20210101966A1 (en) 2021-04-08
KR20190139780A (ko) 2019-12-18
KR102261005B1 (ko) 2021-06-04

Similar Documents

Publication Publication Date Title
Webster et al. O-GlcNAc modifications regulate cell survival and epiboly during zebrafish development
WO2019235876A1 (ko) C-src의 발현 또는 활성 억제제를 포함하는 시누클레인병증의 예방 또는 치료용 약학 조성물
WO2019194586A1 (en) Novel target for anti-cancer and immune-enhancing
US20230003714A1 (en) Use of pak4 and crtc1 for treatment or diagnosis of brain degenerative disease
WO2014178653A1 (ko) 지방세포 분화 과정에서 인간 작은 류신 지퍼 단백질의 용도
Cui et al. Mechanism of TREM2/DAP12 complex affecting β-amyloid plaque deposition in Alzheimer's disease modeled mice through mediating inflammatory response
KR101838802B1 (ko) Shp-1/-2의 발현 또는 활성을 억제할 수 있는 제제를 포함하는 퇴행성 뇌질환의 예방 또는 치료용 약학 조성물
WO2020213982A1 (ko) Cd9을 이용한 퇴행성 신경질환의 예방 또는 치료용 조성물과 퇴행성 신경질환 치료제 스크리닝 방법
WO2018212503A1 (ko) 조혈모세포의 항상성 유지에 관여하는 cotl1 단백질 및 이의 용도
WO2021177518A1 (ko) 혈중 콜레스테롤 저하용, 심혈관 대사질환의 예방 또는 치료용 및 항염용 약학적 조성물
WO2013176503A1 (ko) 타우 단백질 매개 신경 퇴행성 질환 치료제
WO2023075400A1 (ko) 타우병증 관련 질환 치료용 약학적 조성물
WO2010137770A1 (ko) 신규한 ｇｐｃｒ 단백질 및 이의 용도
WO2016159575A9 (ko) 만성 골수성 백혈병 암 줄기세포의 성장 또는 증식 억제용 조성물 및 이의 스크리닝 방법
WO2017061828A1 (ko) Plrg1 (pleiotropic regulator 1) 억제제를 유효성분으로 포함하는 암의 예방 또는 치료용 약학 조성물
WO2010021516A9 (ko) 뇌 손상 치료를 위한 리포칼린 2의 신규한 용도
WO2018174506A1 (ko) Sulf2 유전자를 이용한 소라페닙 치료에 대한 감수성 예측방법 및 sulf2 저해제를 포함하는 암 치료용 조성물
WO2018074770A1 (ko) Rnf20의 신장암 또는 간암 진단, 치료 및 치료제 스크리닝 용도
WO2019245269A1 (ko) Flt3 억제제를 유효성분으로 포함하는 만성 골수성 백혈병 약물 내성 억제용 조성물
WO2017023001A1 (ko) 비알콜성 지방간 조절인자 14-3-3 단백질
WO2017023002A1 (ko) 비알콜성 지방간 조절인자 14-3-3 단백질
US20170143686A1 (en) Pharmaceutical composition for preventing or treating neurodegenerative diseases
Cotellessa et al. Defective jagged-1 signaling affects GnRH development and contributes to congenital hypogonadotropic hypogonadism
WO2020080656A1 (ko) Fgf2 또는 api5 유래 펩타이드 및 그의 용도
WO2024214933A1 (ko) 인산화된 igfbp5의 과도한 생성을 차단하여 암을 예방 또는 치료하는 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19815373

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19815373

Country of ref document: EP

Kind code of ref document: A1