WO2019165067A1 - Camk2d antisense oligonucleotides and uses thereof - Google Patents

Camk2d antisense oligonucleotides and uses thereof Download PDF

Info

Publication number
WO2019165067A1
WO2019165067A1 PCT/US2019/018947 US2019018947W WO2019165067A1 WO 2019165067 A1 WO2019165067 A1 WO 2019165067A1 US 2019018947 W US2019018947 W US 2019018947W WO 2019165067 A1 WO2019165067 A1 WO 2019165067A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
aso
camk2d
nucleotides
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/018947
Other languages
English (en)
French (fr)
Inventor
Richard E. Olson
Brian R. Anderson
Peter Hagedorn
Marianne Lerbech Jensen
Ivar M. Mcdonald
Stephen E. Mercer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Roche Innovation Center Copenhagen AS
Bristol Myers Squibb Co
Original Assignee
Roche Innovation Center Copenhagen AS
Bristol Myers Squibb Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Roche Innovation Center Copenhagen AS, Bristol Myers Squibb Co filed Critical Roche Innovation Center Copenhagen AS
Priority to KR1020207026765A priority Critical patent/KR20200140805A/ko
Priority to EP19710527.3A priority patent/EP3755800A1/en
Priority to BR112020016347-3A priority patent/BR112020016347A2/pt
Priority to AU2019226001A priority patent/AU2019226001B2/en
Priority to MX2020008581A priority patent/MX2020008581A/es
Priority to IL276549A priority patent/IL276549B2/en
Priority to JP2020544270A priority patent/JP7500426B2/ja
Priority to EA202091970A priority patent/EA202091970A1/ru
Priority to CA3091789A priority patent/CA3091789A1/en
Priority to SG11202007652UA priority patent/SG11202007652UA/en
Priority to CN201980025466.8A priority patent/CN112020559A/zh
Priority to IL320427A priority patent/IL320427A/en
Publication of WO2019165067A1 publication Critical patent/WO2019165067A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39541Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against normal tissues, cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61BDIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B1/00Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor
    • A61B1/32Devices for opening or enlarging the visual field, e.g. of a tube of the body
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61BDIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B17/00Surgical instruments, devices or methods
    • A61B17/02Surgical instruments, devices or methods for holding wounds open, e.g. retractors; Tractors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61BDIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B17/00Surgical instruments, devices or methods
    • A61B17/02Surgical instruments, devices or methods for holding wounds open, e.g. retractors; Tractors
    • A61B17/0206Surgical instruments, devices or methods for holding wounds open, e.g. retractors; Tractors with antagonistic arms as supports for retractor elements
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61FFILTERS IMPLANTABLE INTO BLOOD VESSELS; PROSTHESES; DEVICES PROVIDING PATENCY TO, OR PREVENTING COLLAPSING OF, TUBULAR STRUCTURES OF THE BODY, e.g. STENTS; ORTHOPAEDIC, NURSING OR CONTRACEPTIVE DEVICES; FOMENTATION; TREATMENT OR PROTECTION OF EYES OR EARS; BANDAGES, DRESSINGS OR ABSORBENT PADS; FIRST-AID KITS
    • A61F2/00Filters implantable into blood vessels; Prostheses, i.e. artificial substitutes or replacements for parts of the body; Appliances for connecting them with the body; Devices providing patency to, or preventing collapsing of, tubular structures of the body, e.g. stents
    • A61F2/02Prostheses implantable into the body
    • A61F2/30Joints
    • A61F2/44Joints for the spine, e.g. vertebrae, spinal discs
    • A61F2/4455Joints for the spine, e.g. vertebrae, spinal discs for the fusion of spinal bodies, e.g. intervertebral fusion of adjacent spinal bodies, e.g. fusion cages
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/542Carboxylic acids, e.g. a fatty acid or an amino acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549Sugars, nucleosides, nucleotides or nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0014Skin, i.e. galenical aspects of topical compositions
    • A61K9/0017Non-human animal skin, e.g. pour-on, spot-on
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/04Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/12Antihypertensives
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/40Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0607Non-embryonic pluripotent stem cells, e.g. MASC
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0652Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0657Cardiomyocytes; Heart cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61BDIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B17/00Surgical instruments, devices or methods
    • A61B2017/00477Coupling
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61BDIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B90/00Instruments, implements or accessories specially adapted for surgery or diagnosis and not covered by any of the groups A61B1/00 - A61B50/00, e.g. for luxation treatment or for protecting wound edges
    • A61B90/50Supports for surgical instruments, e.g. articulated arms
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3525MOE, methoxyethoxy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/11Protein-serine/threonine kinases (2.7.11)
    • C12Y207/11017Ca2+/Calmodulin-dependent protein kinase (2.7.11.17)

Definitions

  • the present disclosure relates to antisense oligomeric compounds (ASOs) that target calcium/calmodulin-dependent protein kinase type II delta (CAMK2D ) transcript in a cell, leading to reduced expression of CAMK2D protein.
  • ASOs antisense oligomeric compounds
  • CAMK2D calcium/calmodulin-dependent protein kinase type II delta
  • Reduction of CAMK2D protein expression can be beneficial for a range of medical disorders, such as cardiovascular-related diseases or disorders.
  • CaMKs Calcium/calmodulin (Ca 2+ /CaM)-dependent serine/threonine kinases (CaMKs) constitute a family of 81 proteins in the human proteasome that play a central role in cellular signaling by transmitting Ca 2+ signals.
  • CaMKII isozymes a, b, g, and d
  • splice variants are expressed in humans. Braun, A.P., et al ., Annual Review of Physiology 57:417-445 (1995).
  • CAMK2D CaMKIK
  • ECC excitation- contraction coupling
  • CAMK2D activity has also been described as being important in the recovery process after certain heart related injury (e.g. , ischemia-reperfusion injury). Said M., et al. , Am J Physiol Heart Circ Physiol 285 :Hl 198-205 (2003).
  • the present disclosure is directed to an antisense oligonucleotide (ASO) comprising, consisting essentially of, or consisting of the contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary, such as fully complementary, to a nucleic acid sequence within a calcium/calmodulin-dependent protein kinase type II delta (CAMK2D) transcript.
  • ASO antisense oligonucleotide
  • the ASO of the present disclosure, or contiguous nucleotide sequence thereof is at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% complementary to the nucleic acid sequence within the CAMK2D transcript.
  • the CAMK2D transcript is selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.
  • the ASO described herein is capable of reducing CAMK2D protein expression in a human cell (e.g . , HEK293 cell) which is expressing the CAMK2D protein.
  • the CAMK2D protein expression is reduced by at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to CAMK2D protein expression in a human cell that is not exposed to the ASO.
  • the ASO is capable of reducing CAMK2D transcript (e.g., mRNA) expression in a human cell (e.g, HEK293 cell), which is expressing the CAMK2D transcript.
  • the CAMK2D transcript expression is reduced by at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to CAMK2D transcript expression in a human cell that is not exposed to the ASO.
  • the ASO disclosed herein is a gapmer.
  • the ASO has a design of LLLD n LLL, LLLLD n LLLL, or LLLLLD n LLLLL, wherein the L is a nucleoside analog, the D is DNA, and n can be any integer between 4 and 24. In some embodiments, n can be any integer between 6 and 14. In some embodiments, n can be any integer between 8 and 12.
  • the nucleoside analog of the ASO disclosed herein comprises a 2'-0-alkyl-RNA; 2'-0-methyl RNA (2'-OMe); 2'-alkoxy-RNA; 2'-0- methoxyethyl-RNA (2'-MOE); 2'-amino-DNA; 2'-fluro-RNA; 2'-fluoro-DNA; arabino nucleic acid (ANA); 2'-fluoro-ANA; or bicyclic nucleoside analog (LNA).
  • one or more of the nucleoside analog of the ASO is a sugar modified nucleoside.
  • the sugar modified nucleoside is an affinity enhancing 2' sugar modified nucleoside.
  • one or more of the nucleoside analog comprises a nucleoside comprising a bicyclic sugar.
  • the affinity enhancing 2' sugar modified nucleoside is an LNA.
  • the LNA is selected from the group consisting of constrained ethyl nucleoside (cEt), 2', 4'- constrained 2'-0-methoxyethyl (cMOE), a-L-LNA, b-D-LNA, 2'-0,4'-C-ethylene- bridged nucleic acids (ENA), amino-LNA, oxy-LNA, thio-LNA, or any combination thereof.
  • the ASO comprises one or more 5'-methyl-cytosine nucleobases.
  • the ASO described herein is capable of (i) reducing an mRNA level encoding CAMK2D inhuman Inducible Pluripotent Stem Cell-Derived Cardiomyocytes (hiPSC-CM); (ii) reducing a protein level of CAMK2D in hiPSC-CM; (iii) reducing, ameliorating, or treating one or more symptoms of a cardiovascular disease or disorder, and (iv) any combination thereof.
  • the contiguous nucleotide sequence of the ASO is complementary to a nucleic acid sequence comprising (i) nucleotides 625 - 842 of SEQ ID NO: 1; (ii) nucleotides 1,398 - 59,755 of SEQ ID NO: 1; (iii) nucleotides 61,817 - 104,725 of SEQ ID NO: 1; (iv) nucleotides 112,162 - 118,021 of SEQ ID NO: 1; (v) nucleotides 119,440 - 135,219 of SEQ ID NO: 1; (vi) nucleotides 137,587 - 157,856 of SEQ ID NO: 1; (vii) nucleotides 159,191 - 266,174 of SEQ ID NO: 1; or (viii) nucleotides 272,788 - 310,949 of SEQ ID NO: 1.
  • the contiguous nucleotide sequence of the ASO is complementary to a nucleic acid sequence comprising (i) nucleotides 675 - 792 of SEQ ID NO: 1; (ii) nucleotides 1,448 - 59,705 of SEQ ID NO: 1; (iii) nucleotides 61,867 - 104,675 of SEQ ID NO: 1; (iv) nucleotides 112,212 - 117,971 of SEQ ID NO: 1; (v) nucleotides 119,490 - 135,169 of SEQ ID NO: 1; (vi) nucleotides 137,637 - 157,806 of SEQ ID NO: 1; (vii) nucleotides 159,241 - 266,124 of SEQ ID NO: 1; or (viii) nucleotides 272,838 - 310,899 of SEQ ID NO: 1.
  • the contiguous nucleotide sequence of the ASO is complementary to a nucleic acid sequence comprising (i) nucleotides 725 - 742 of SEQ ID NO: 1; (ii) nucleotides 1,498 - 59,655 of SEQ ID NO: 1; (iii) nucleotides 61,917 - 104,625 of SEQ ID NO: 1; (iv) nucleotides 112,262 - 117,921 of SEQ ID NO: 1; (v) nucleotides 119,540 - 135,119 of SEQ ID NO: 1; (vi) nucleotides 137,687 - 157,756 of SEQ ID NO: 1; (vii) 159,291 - 266,074 of SEQ ID NO: 1; or (viii) nucleotides 272,888 - 310,849 of SEQ ID NO: 1.
  • the contiguous nucleotide sequence of the ASO comprises SEQ ID NO: 4 to SEQ ID NO: 1713 with one or two mismatches. In some embodiments, the contiguous nucleotide sequence of the ASO comprises the nucleotide sequence selected from the sequences in FIGs. 1A and 1B (SEQ ID NO: 4 to SEQ ID NO: 1713).
  • the contiguous nucleotide sequence of the ASO comprises SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 114, SEQ ID NO: 158, SEQ ID NO: 190, SEQ ID NO: 327, SEQ ID NO: 463, SEQ ID NO: 513, SEQ ID NO: 516, SEQ ID NO: 519, SEQ ID NO: 657, SEQ ID NO: 659, SEQ ID NO: 827, SEQ ID NO: 1249, SEQ ID NO: 1326, SEQ ID NO: 1409, SEQ ID NO: 1524, SEQ ID NO: 1530, SEQ ID NO: 1662, or SEQ ID NO: 1676.
  • the contiguous nucleotide sequence of the ASO comprises SEQ ID NO: 55, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 71, SEQ ID NO: 75, SEQ ID NO: 79, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 92, SEQ ID NO: 102, SEQ ID NO: 105, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 133, SEQ ID NO: 138, SEQ ID NO: 161, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 186, SEQ ID NO: 195, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 234, SEQ ID NO: 264, SEQ ID NO: 387, SEQ ID NO: 390, SEQ ID NO: 396, SEQ ID NO: 441, SEQ ID NO: 446, SEQ ID NO: 457, SEQ ID NO:
  • the ASO of the present disclosure has a design selected from the group consisting of the designs in FIG. 3, wherein the upper letter is a sugar modified nucleoside and the lower case letter is DNA.
  • the ASO disclosed herein is capable of reducing expression of CAMK2D protein in a hiPSC-CM cell which is expressing the CAMK2D protein.
  • the expression of CAMK2D protein is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% compared to a cell not exposed to the ASO.
  • the ASO is capable of reducing expression of CAMK2D transcript (e.g., mRNA) in a hiPSC-CM cell which is expressing the CAMK2D transcript.
  • CAMK2D transcript e.g., mRNA
  • the expression of CAMK2D transcript is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% compared to a cell not exposed to the ASO.
  • the ASO has from 14 to 20 nucleotides in length.
  • the nucleotide sequence of the ASO comprises one or more modified internucleoside linkage. In some embodiments, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of intemucleoside linkages are modified.
  • each of the internucleotide linkages in the ASO of the present disclosure is a phosphorothioate linkage.
  • the present disclosure also provides a conjugate comprising the ASO as disclosed herein, wherein the ASO is covalently attached to at least one non-nucleotide or non polynucleotide moiety.
  • the non-nucleotide or non-polynucleotide moiety comprises a protein, a fatty acid chain, a sugar residue, a glycoprotein, a polymer, or any combinations thereof.
  • a pharmaceutical composition comprising the ASO or the conjugate as disclosed herein and a pharmaceutically acceptable diluent, carrier, salt, or adjuvant.
  • a pharmaceutically acceptable salt comprises a sodium salt, a potassium salt, or an ammonium salt.
  • the pharmaceutical composition further comprises at least one further therapeutic agent.
  • the further therapeutic agent is a CAMK2D antagonist.
  • the CAMK2D antagonist is an anti-CAMK2d antibody or fragment thereof.
  • the present disclosure further provides a kit comprising the ASO, the conjugate, or the pharmaceutical composition as disclosed herein, and instructions for use. Also disclosed is a diagnostic kit comprising the ASO, the conjugate, or the pharmaceutical composition of the present disclosure, and instructions for use. [0019] The present disclosure is also directed method of inhibiting or reducing CAMK2D protein expression in a cell, comprising administering the ASO, the conjugate, or the pharmaceutical composition disclosed herein to the cell expressing CAMK2D protein, wherein the CAMK2D protein expression in the cell is inhibited or reduced after the administration.
  • the present disclosure is directed to an in vitro method of inhibiting or reducing CAMK2D protein expression in a cell, comprising contacting the ASO, the conjugate, or the pharmaceutical composition disclosed herein to the cell expressing CAMK2D protein, wherein the CAMK2D protein expression in the cell is inhibited or reduced after the contacting.
  • the ASO inhibits or reduces expression of CAMK2D transcript (e.g, mRNA) in the cell after the administration.
  • the expression of CAMK2D transcript (e.g, mRNA) is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% after the administration compared to a cell not exposed to the ASO.
  • the expression of CAMK2D protein is reduced by at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% after the administration compared to a cell not exposed to the ASO.
  • the cell is a cardiac cell, e.g, hiPSC-CM.
  • a method of reducing, ameliorating, or treating one or more symptoms of a cardiovascular disease or disorder in a subject in need thereof comprising administering an effective amount of the ASO, the conjugate, or the pharmaceutical composition of the present disclosure to the subject.
  • the present disclosure also provides the use of the ASO, the conjugate, or the pharmaceutical composition disclosed herein for the manufacture of a medicament.
  • the medicament is for the treatment of a cardiovascular disease or disorder in a subject in need thereof.
  • the ASO, the conjugate, or the pharmaceutical composition of the present disclosure is for use in therapy.
  • the ASO, the conjugate, or the pharmaceutical composition disclosed herein is for use in therapy of a cardiovascular disease or disorder in a subject in need thereof.
  • the cardiovascular disease or disorder comprises a coronary artery disease, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, heart arrhythmia, congenital heart disease, valvular heart disease carditis, aortic aneurysms, peripheral artery disease, thromboembolic disease, venous thrombosis, or any combination thereof.
  • the cardiovascular disease or disorder is a heart failure.
  • the heart failure comprises a left- sided heart failure, a right-sided heart failure, a congestive heart failure, a heart failure with reduced ejection fraction (HFrEF), a heart failure with preserved ejection fraction (HFpEF), a heart failure with mid-range ejection fraction (HFmrEF), a hypertrophic cardiomyopathy (HCM), a hypertensive heart disease (HHD), or hypertensive hypertrophic cardiomyopathy.
  • HFrEF heart failure with reduced ejection fraction
  • HFpEF heart failure with preserved ejection fraction
  • HmrEF mid-range ejection fraction
  • HCM hypertrophic cardiomyopathy
  • HHD hypertensive heart disease
  • the subject is a human.
  • the ASO, the conjugate, or the pharmaceutical composition of the present disclosure is administered intracardially, orally, parenterally, intrathecally, intra-cerebroventricularly, pulmorarily, topically, or intraventricularly.
  • FIGs. 1A and 1B show exemplary ASOs targeting the CAMK2D pre-mRNA.
  • FIG. 1A and 1B show exemplary ASOs targeting the CAMK2D pre-mRNA.
  • FIG. 1A shows the ASOs targeting a single site within the CAMK2D pre-mRNA.
  • FIG. 1B shows the ASOs targeting multiple sites (i.e., two or three) within the CAMK2D pre- mRNA.
  • Each column of FIGs. 1A and 1B show the SEQ ID number designated for the sequence only of the ASO, the target start and end positions on the CAMK2D pre-mRNA sequence (for FIG. 1B, the multiple target sites are identified as #1, #2, or #3), the ASO sequence without any particular design or chemical structure, the ASO number (ASO No.), and the ASO sequence with a chemical structure.
  • FIG. 2 shows both the percent reduction of CAMK2D mRNA expression in HEK293 cells (y-axis) and the relative position of the ASOs on the CAMK2D transcript (x-axis). Each circle represents an individual ASO. As further described in Example 2, the HEK293 cells were treated with 25 mM of ASO and the CAMK2D mRNA expression (normalized to GAPDH) is shown as a percent of the control.
  • FIG. 3 shows certain exemplary ASOs with their design.
  • Each column of FIG. 3 shows the SEQ ID NO for the ASO sequence only, the target start and end positions on the CAMK2D pre-mRNA sequence (where the ASO binds to multiple sites (see FIG. 1B), exemplary target start and end positions are provided), the ASO design number (DES No.), the ASO sequence with a design, and the ASO number (ASO No.).
  • FIG. 4 shows the percent reduction of CAMK2D mRNA expression in both HEK293 cells and human inducible pluripotent stem cell-derived cardiomyocytes (hiPSC-CM) after in vitro culture with various ASOs as described in Examples 2 and 3.
  • the cells were treated with 25 mM (HEK293) or 500 nM (hiPSC-CM) of ASO and the CAMK2D mRNA expression (normalized to GAPDH) is shown as a percent of the control. Where no value is provided, the particular ASO was not tested under the particular conditions.
  • FIG. 5 shows the potency of exemplary ASOs on CAMK2D mRNA expression level in C57BL/6JBom mice one week after subcutaneous administration.
  • CAMK2D mRNA expression level was normalized to GAPDH and then shown relative to the control group (i.e., saline treated samples).
  • a or “an” entity refers to one or more of that entity; for example, “a nucleotide sequence,” is understood to represent one or more nucleotide sequences.
  • the terms “a” (or “an”), “one or more,” and “at least one” can be used interchangeably herein.
  • nucleotide sequences are written left to right in 5' to 3' orientation.
  • Amino acid sequences are written left to right in amino to carboxy orientation.
  • the term "about” is used herein to mean approximately, roughly, around, or in the regions of. When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term “about” can modify a numerical value above and below the stated value by a variance of, e.g., 10 percent, up or down (higher or lower). For example, if it is stated that “the ASO reduces expression of CAMK2d protein in a cell following administration of the ASO by at least about 60%, " it is implied that the CAMK2D levels are reduced by a range of 50% to 70%.
  • nucleic acids or “nucleotides” is intended to encompass plural nucleic acids.
  • the term “nucleic acids” or “nucleotides” refers to a target sequence, e.g., pre-mRNAs, mRNAs, or DNAs in vivo or in vitro.
  • the nucleic acids or nucleotides can be naturally occurring sequences within a cell.
  • “nucleic acids” or “nucleotides” refer to a sequence in the ASOs of the disclosure.
  • nucleic acids or nucleotides are not naturally occurring, i.e., chemically synthesized, enzymatically produced, recombinantly produced, or any combination thereof.
  • the nucleic acids or nucleotides in the ASOs are produced synthetically or recombinantly, but are not a naturally occurring sequence or a fragment thereof.
  • the nucleic acids or nucleotides in the ASOs are not naturally occurring because they contain at least one nucleotide analog that is not naturally occurring in nature.
  • nucleic acid or nucleoside refers to a single nucleic acid segment, e.g.
  • nucleic acid or “nucleoside” includes naturally occurring nucleic acids or non-naturally occurring nucleic acids.
  • nucleotide or “unit” and “monomer” are used interchangeably. It will be recognized that when referring to a sequence of nucleotides or monomers, what is referred to is the sequence of bases, such as A, T, G, C or U, and analogs thereof.
  • nucleotide refers to a glycoside comprising a sugar moiety, a base moiety and a covalently linked group (linkage group), such as a phosphate or phosphorothioate intemucleotide linkage group, and covers both naturally occurring nucleotides, such as DNA or RNA, and non-naturally occurring nucleotides comprising modified sugar and/or base moieties, which are also referred to as "nucleotide analogs" herein.
  • a single nucleotide (unit) can also be referred to as a monomer or nucleic acid unit.
  • nucleotide analogs refers to nucleotides having modified sugar moieties.
  • nucleotides having modified sugar moieties e.g LNA
  • nucleotide analogs refers to nucleotides having modified nucleobase moieties.
  • nucleotides having modified nucleobase moieties include, but are not limited to, 5-methyl-cytosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5- propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6- aminopurine.
  • nucleoside as used herein is used to refer to a glycoside comprising a sugar moiety and a base moiety, and can therefore be used when referring to the nucleotide units, which are covalently linked by the intemucleotide linkages between the nucleotides of the ASO.
  • nucleotide is often used to refer to a nucleic acid monomer or unit.
  • nucleotide can refer to the base alone, i.e., a nucleobase sequence comprising cytosine (DNA and RNA), guanine (DNA and RNA), adenine (DNA and RNA), thymine (DNA) and uracil (RNA), in which the presence of the sugar backbone and intemucleotide linkages are implicit.
  • nucleotide can refer to a "nucleoside.”
  • nucleoside can be used, even when specifying the presence or nature of the linkages between the nucleosides.
  • nucleotide length means the total number of the nucleotides (monomers) in a given sequence.
  • sequence of tacatatattatattactcctc SEQ ID NO: 1528 has 20 nucleotides; thus the nucleotide length of the sequence is 20.
  • the term “nucleotide length” is therefore used herein interchangeably with “nucleotide number.”
  • the 5' terminal nucleotide of an oligonucleotide does not comprise a 5' internucleotide linkage group, although it can comprise a 5' terminal group.
  • alkyl signifies a straight-chain or branched-chain alkyl group with 1 to 8 carbon atoms, particularly a straight or branched-chain alkyl group with 1 to 6 carbon atoms and more particularly a straight or branched-chain alkyl group with 1 to 4 carbon atoms.
  • Ci-C 8 alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, the isomeric pentyls, the isomeric hexyls, the isomeric heptyls and the isomeric octyls, particularly methyl, ethyl, propyl, butyl and pentyl.
  • Particular examples of alkyl are methyl.
  • Further examples of alkyl are mono, di or trifluoro methyl, ethyl or propyl, such as cyclopropyl (cPr), or mono, di or tri fluoro cycloproyl.
  • alkoxy signifies a group of the formula alkyl- O- in which the term “alkyl” has the previously given significance, such as methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec.butoxy and tert.butoxy. Particular "alkoxy” are methoxy.
  • alkenyl signifies a straight-chain or branched hydrocarbon residue comprising an olefmic bond and up to 8, preferably up to 6, particularly preferred up to 4 carbon atoms.
  • alkenyl groups are ethenyl, 1- propenyl, 2-propenyl, isopropenyl, l-butenyl, 2-butenyl, 3-butenyl and isobutenyl.
  • alkynyl alone or in combination, signifies a straight-chain or branched hydrocarbon residue comprising a triple bond and up to 8, preferably up to 6, particularly preferred up to 4 carbon atoms.
  • halogen or ""halo"
  • halogen in combination with another group, denotes the substitution of said group with at least one halogen, particularly substituted with one to five halogens, particularly one to four halogens, i.e., one, two, three or four halogens.
  • hydroxyl and "hydroxy”, alone or in combination, signify the -OH group.
  • amino alone or in combination, signifies the primary amino group (- NH2), the secondary amino group (-NH-), or the tertiary amino group (-N-).
  • alkylamino alone or in combination, signifies an amino group as defined above substituted with one or two alkyl groups as defined above.
  • aminocarbonyl alone or in combination, signifies the -C(0)-NH2 group.
  • sulfonyl alone or in combination, means the -S02 group.
  • aryl denotes a monovalent aromatic carbocyclic mono- or bicyclic ring system comprising 6 to 10 carbon ring atoms, optionally substituted with 1 to 3 substituents independently selected from halogen, hydroxyl, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxy carbonyl, alkylcarbonyl and formyl.
  • substituents independently selected from halogen, hydroxyl, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxy carbonyl, alkylcarbonyl and formyl.
  • Examples of aryl include phenyl and naphthyl in particular phenyl.
  • heteroaryl denotes a monovalent aromatic heterocyclic mono- or bicyclic ring system of 5 to 12 ring atoms, comprising 1, 2, 3 or 4 heteroatoms selected from N, O and S, the remaining ring atoms being carbon, optionally substituted with 1 to 3 substituents independently selected from halogen, hydroxyl, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl and formyl.
  • heteroaryl examples include pyrrolyl, furanyl, thienyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, thiadiazolyl, tetrazolyl, pyridinyl, pyrazinyl, pyrazolyl, pyridazinyl, pyrimidinyl, triazinyl, azepinyl, diazepinyl, isoxazolyl, benzofuranyl, isothiazolyl, benzothienyl, indolyl, isoindolyl, isobenzofuranyl, benzimidazolyl, benzoxazolyl, benzoisoxazolyl, benzothiazolyl, benzoisothiazolyl, benzooxadiazolyl, benzothiadiazolyl, benzotriazolyl, purinyl, quinolinyl, isoquinoliny
  • heterocycle denotes a monovalent non aromatic heterocyclic mono- or bicyclic ring system of 5 to 12 ring atoms, comprising 1, 2, 3 or 4 heteroatoms selected from N, O and S, the remaining ring atoms being carbon, optionally substituted with 1 to 3 substituents independently selected from halogen, hydroxyl, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxy carbonyl, alkylcarbonyl and formyl.
  • protecting group signifies a group which selectively blocks a reactive site in a multifunctional compound such that a chemical reaction can be carried out selectively at another unprotected reactive site.
  • Protecting groups can be removed.
  • Exemplary protecting groups are amino-protecting groups, carboxy-protecting groups or hydroxy-protecting groups.
  • one of the starting materials or compounds of the invention contain one or more functional groups which are not stable or are reactive under the reaction conditions of one or more reaction steps
  • appropriate protecting groups as described e.g ., in "Protective Groups in Organic Chemistry” by T. W. Greene and P. G. M. Wuts, 3rd Ed., 1999, Wiley, New York
  • Such protecting groups can be removed at a later stage of the synthesis using standard methods described in the literature.
  • protecting groups are tert- butoxycarbonyl (Boc), 9-fluorenylmethyl carbamate (Fmoc), 2-trimethylsilylethyl carbamate (Teoc), carbobenzyloxy (Cbz) and p-methoxybenzyloxycarbonyl (Moz).
  • the compounds described herein can contain several asymmetric centers and can be present in the form of optically pure enantiomers, mixtures of enantiomers such as, for example, racemates, mixtures of diastereoisomers, diastereoisomeric racemates or mixtures of diastereoisomeric racemates.
  • asymmetric carbon atom means a carbon atom with four different substituents. According to the Cahn-Ingold-Prelog Convention an asymmetric carbon atom can be of the "R” or "S" configuration.
  • bicyclic sugar refers to a modified sugar moiety comprising a 4 to 7 membered ring comprising a bridge connecting two atoms of the 4 to 7 membered ring to form a second ring, resulting in a bicyclic structure.
  • the bridge connects the C2' and C4' of the ribose sugar ring of a nucleoside (i.e., 2'-4' bridge), as observed in LNA nucleosides.
  • a "coding region” or “coding sequence” is a portion of polynucleotide which consists of codons translatable into amino acids.
  • a “stop codon” (TAG, TGA, or TAA) is typically not translated into an amino acid, it can be considered to be part of a coding region, but any flanking sequences, for example promoters, ribosome binding sites, transcriptional terminators, introns, untranslated regions (“UTRs”), and the like, are not part of a coding region.
  • a coding region typically determined by a start codon at the 5' terminus, encoding the amino terminus of the resultant polypeptide, and a translation stop codon at the 3' terminus, encoding the carboxyl terminus of the resulting polypeptide.
  • non-coding region means a nucleotide sequence that is not a coding region.
  • non-coding regions include, but are not limited to, promoters, ribosome binding sites, transcriptional terminators, introns, untranslated regions ("UTRs"), non-coding exons and the like. Some of the exons can be wholly or part of the 5' untranslated region (5' UTR) or the 3' untranslated region (3' UTR) of each transcript.
  • the untranslated regions are important for efficient translation of the transcript and for controlling the rate of translation and half-life of the transcript.
  • region when used in the context of a nucleotide sequence refers to a section of that sequence.
  • region within a nucleotide sequence or region within the complement of a nucleotide sequence refers to a sequence shorter than the nucleotide sequence, but longer than at least 10 nucleotides located within the particular nucleotide sequence or the complement of the nucleotides sequence, respectively.
  • sequence or “subsequence” can also refer to a region of a nucleotide sequence.
  • downstream when referring to a nucleotide sequence, means that a nucleic acid or a nucleotide sequence is located 3' to a reference nucleotide sequence.
  • downstream nucleotide sequences relate to sequences that follow the starting point of transcription. For example, the translation initiation codon of a gene is located downstream of the start site of transcription.
  • upstream refers to a nucleotide sequence that is located 5' to a reference nucleotide sequence.
  • regulatory region refers to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding region, and which influence the transcription, RNA processing, stability, or translation of the associated coding region. Regulatory regions can include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, UTRs, and stem-loop structures. If a coding region is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.
  • transcript can refer to a primary transcript that is synthesized by transcription of DNA and becomes a messenger RNA (mRNA) after processing, i.e., a precursor messenger RNA (pre-mRNA), and the processed mRNA itself.
  • mRNA messenger RNA
  • pre-mRNA precursor messenger RNA
  • mRNA messenger RNA
  • mRNA messenger RNA
  • mRNA messenger RNA
  • pre-mRNA precursor messenger RNA
  • mRNA messenger RNA
  • mRNA messenger RNA
  • mRNA messenger RNA
  • mRNA messenger RNA
  • pre-mRNA precursor messenger RNA
  • RNA messenger RNA
  • expression produces a "gene product.”
  • a gene product can be either a nucleic acid, e.g ., a messenger RNA produced by transcription of a gene, or a polypeptide which is translated from a transcript.
  • Gene products described herein further include nucleic acids with post transcriptional modifications, e.g.
  • polyadenylation or splicing or polypeptides with post translational modifications, e.g. , methylation, glycosylation, the addition of lipids, association with other protein subunits, or proteolytic cleavage.
  • nucleic acids refer to two or more sequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity.
  • percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software are known in the art that can be used to obtain alignments of amino acid or nucleotide sequences.
  • sequence alignment algorithm is the algorithm described in Karlin et al ., 1990, Proc. Natl. Acad. Sci., 87:2264-2268, as modified in Karlin et al. , 1993, Proc. Natl. Acad. Sci., 90:5873-5877, and incorporated into the NBLAST and XBLAST programs (Altschul et al, 1991, Nucleic Acids Res., 25:3389- 3402).
  • Gapped BLAST can be used as described in Altschul et al, 1997, Nucleic Acids Res. 25:3389-3402.
  • BLAST-2 Altschul et al, 1996, Methods in Enzymology, 266:460-480
  • ALIGN ALIGN-2
  • Megalign Megalign
  • the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (e.g ., using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 90 and a length weight of 1, 2, 3, 4, 5, or 6).
  • the GAP program in the GCG software package which incorporates the algorithm of Needleman and Wunsch (J. Mol. Biol. (48):444-453 (1970)) can be used to determine the percent identity between two amino acid sequences (e.g., using either a BLOSUM 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5).
  • the percent identity between nucleotide or amino acid sequences is determined using the algorithm of Myers and Miller (CABIOS, 4: 11-17 (1989)).
  • the percent identity can be determined using the ALIGN program (version 2.0) and using a PAM120 with residue table, a gap length penalty of 12 and a gap penalty of 4.
  • ALIGN program version 2.0
  • PAM120 with residue table residue table
  • gap length penalty 12
  • gap penalty 4
  • One skilled in the art can determine appropriate parameters for maximal alignment by particular alignment software.
  • the default parameters of the alignment software are used.
  • the percentage identity "X" of a first nucleotide sequence to a second nucleotide sequence is calculated as 100 x (Y/Z), where Y is the number of amino acid residues scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of a first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence.
  • Different regions within a single polynucleotide target sequence that align with a polynucleotide reference sequence can each have their own percent sequence identity. It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It also is noted that the length value will always be an integer.
  • naturally occurring variant thereof refers to variants of the CAMK2D polypeptide sequence or CAMK2D nucleic acid sequence (e.g, transcript) which exist naturally within the defined taxonomic group, such as mammalian, such as mouse, monkey, and human.
  • CAMK2D polypeptide sequence or CAMK2D nucleic acid sequence e.g, transcript
  • the term also can encompass any allelic variant of the CAMK2D-e ncoding genomic DNA which is found at Chromosomal position 4q26 (i.e., residues 113,451,032 to 113,761,927 of GenBank Accession No.
  • RNA such as mRNA derived therefrom.
  • “Naturally occurring variants” can also include variants derived from alternative splicing of the CAMK2D mRNA.
  • the term also includes naturally occurring forms of the protein, which can therefore be processed, e.g., by co- or post-translational modifications, such as signal peptide cleavage, proteolytic cleavage, glycosylation, etc.
  • the degree of "complementarity" is expressed as the percentage identity (or percentage homology) between the sequence of the ASO (or region thereof) and the sequence of the target region (or the reverse complement of the target region) that best aligns therewith. The percentage is calculated by counting the number of aligned bases that are identical between the two sequences, dividing by the total number of contiguous monomers in the ASO, and multiplying by 100. In such a comparison, if gaps exist, it is preferable that such gaps are merely mismatches rather than areas where the number of monomers within the gap differs between the ASO of the disclosure and the target region.
  • complement indicates a sequence that is complementary to a reference sequence. It is well known that complementarity is the base principle of DNA replication and transcription as it is a property shared between two DNA or RNA sequences, such that when they are aligned antiparallel to each other, the nucleotide bases at each position in the sequences will be complementary, much like looking in the mirror and seeing the reverse of things.
  • the complement of a sequence of 5"'ATGC"3' can be written as 3"'TACG"5' or 5'"GCAT"3 ⁇
  • the terms "reverse complement”, “reverse complementary”, and “reverse complementarity” as used herein are interchangeable with the terms “complement”, “complementary”, and “complementarity.”
  • the term “complementary” refers to 100% match or complementarity (; i.e ., fully complementary) to a contiguous nucleic acid sequence within a CAMK2D transcript.
  • the term "complementary" refers to at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% match or complementarity to a contiguous nucleic acid sequence within a CAMK2D transcript.
  • nucleotide sequences when referencing two separate nucleic acid or nucleotide sequences can be used to clarify regions of the sequences that correspond or are similar to each other based on homology and/or functionality, although the nucleotides of the specific sequences can be numbered differently. For example, different isoforms of a gene transcript can have similar or conserved portions of nucleotide sequences whose numbering can differ in the respective isoforms based on alternative splicing and/or other modifications.
  • nucleic acid or nucleotide sequence e.g ., a gene transcript and whether to begin numbering the sequence from the translation start codon or to include the 5'UTR.
  • nucleic acid or nucleotide sequence of different variants of a gene or gene transcript can vary. As used herein, however, the regions of the variants that share nucleic acid or nucleotide sequence homology and/or functionality are deemed to "correspond" to one another.
  • a nucleotide sequence of a CAMK2D transcript corresponding to nucleotides X to Y of SEQ ID NO: 1 refers to an CAMK2d transcript sequence (e.g., CAMK2D pre-mRNA or mRNA) that has an identical sequence or a similar sequence to nucleotides X to Y of SEQ ID NO: 1, wherein X is the start site and Y is the end site (as shown in FIGs. 1 A and 1B).
  • a person of ordinary skill in the art can identify the corresponding X and Y residues in the CAMK2D transcript sequence by aligning the CAMK2D transcript sequence with SEQ ID NO: 1.
  • nucleotide analog and “corresponding nucleotide” are intended to indicate that the nucleobase in the nucleotide analog and the naturally occurring nucleotide have the same pairing, or hybridizing, ability.
  • the “corresponding nucleotide analog” contains a pentose unit (different from 2-deoxyribose) linked to an adenine.
  • DES Number refers to a unique number given to a nucleotide sequence having a specific pattern of nucleosides (e.g, DNA) and nucleoside analogs (e.g LNA).
  • nucleosides e.g, DNA
  • nucleoside analogs e.g LNA
  • design of an ASO is shown by a combination of upper case letters and lower case letters.
  • DES-0231 refers to an ASO sequence of tacatattatattactcctc (SEQ ID NO: 158) with an ASO design of LLLDDDDDDDDDDDDDDLLL (i.e., TACatattatattactcCTC), wherein the L (i.e., upper case letter) indicates a nucleoside analog (e.g., LNA) and the D (i.e., lower case letter) indicates a nucleoside (e.g, DNA).
  • L i.e., upper case letter
  • the D i.e., lower case letter
  • Beta-D-oxy LNA nucleotides are designated by OxyB where B designates a nucleotide base such as thymine (T), uridine (Li), cytosine (C), 5-methylcytosine (MC), adenine (A) or guanine (G), and thus include OxyA, OxyT, OxyMC, OxyC and OxyG.
  • DNA nucleotides are designated by DNAb, where the lower case b designates a nucleotide base such as thymine (T), uridine (Li), cytosine (C), 5-methylcytosine (Me), adenine (A) or guanine (G), and thus include DNAa, DNAt, DNA and DNAg.
  • T thymine
  • Li uridine
  • C cytosine
  • Me 5-methylcytosine
  • A adenine
  • G guanine
  • ASO Number refers to a unique number given to a nucleotide sequence having the detailed chemical structure of the components, e.g, nucleosides (e.g, DNA), nucleoside analogs (e.g, beta-D-oxy-LNA), nucleobase (e.g, A, T, G, C, Li, or MC), and backbone structure (e.g, phosphorothioate or phosphorodiester).
  • nucleosides e.g, DNA
  • nucleoside analogs e.g, beta-D-oxy-LNA
  • nucleobase e.g, A, T, G, C, Li, or MC
  • backbone structure e.g, phosphorothioate or phosphorodiester
  • ASO-0231 can refer to OxyTs OxyAs OxyMCs DNAas DNAts DNAas DNAts DNAts DNAas DNAts DNAts DNAas DNAcs DNAts DNAcs OxyMCs OxyTs OxyMC.
  • IC 50 is the median inhibitory concentration of a therapeutic molecule.
  • EC 50 is the median effective concentration of a therapeutic molecule relative to a vehicle or control (e.g, saline).
  • IC 50 is the concentration of a therapeutic molecule that reduces a biological response, e.g, transcription of mRNA or protein expression, by 50% of the biological response that is achieved by the therapeutic molecule.
  • EC 5O is the concentration of a therapeutic molecule that produces 50% of the biological response, e.g, transcription of mRNA or protein expression.
  • IC 50 or EC 50 can be calculated by any number of means known in the art.
  • the term “inhibiting,” e.g, the expression of CAMK2D gene transcript and/or CAMK2D protein refers to the ASO reducing the expression of the CAMK2D gene transcript and/or CAMK2D protein in a cell or a tissue. In some embodiments, the term “inhibiting” refers to complete inhibition (100% inhibition or non- detectable level) of CAMK2D gene transcript or CAMK2D protein.
  • the term "inhibiting” refers to at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% inhibition of CAMK2D gene transcript and/or CAMK2D protein expression in a cell or a tissue.
  • subject or “individual” or “animal” or “patient” or “mammal,” is meant any subject, particularly a mammalian subject, for whom diagnosis, prognosis, or therapy is desired.
  • Mammalian subjects include humans, domestic animals, farm animals, sports animals, and zoo animals including, e.g., humans, non-human primates, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, bears, and so on.
  • composition refers to a preparation which is in such form as to permit the biological activity of the active ingredient to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the composition would be administered.
  • Such composition can be sterile.
  • an “effective amount” of an ASO as disclosed herein is an amount sufficient to carry out a specifically stated purpose.
  • An “effective amount” can be determined empirically and in a routine manner, in relation to the stated purpose.
  • Terms such as “treating” or “treatment” or “to treat” or “alleviating” or “to alleviate” refer to both (1) therapeutic measures that cure, slow down, lessen symptoms of, and/or halt progression of a diagnosed pathologic condition or disorder and (2) prophylactic or preventative measures that prevent and/or slow the development of a targeted pathologic condition or disorder.
  • those in need of treatment include those already with the disorder; those prone to have the disorder; and those in whom the disorder is to be prevented.
  • a subject is successfully "treated” for a disease or condition disclosed elsewhere herein according to the methods provided herein if the patient shows, e.g. , total, partial, or transient alleviation or elimination of symptoms associated with the disease or disorder.
  • the present disclosure employs antisense oligonucleotides (ASOs) for use in modulating the function of nucleic acid molecules encoding mammalian CAMK2D, such as the CAMK2D nucleic acid, e.g., CAMK2D transcript, including CAMK2D pre-mRNA, and CAMK2D mRNA, or naturally occurring variants of such nucleic acid molecules encoding mammalian CAMK2D.
  • ASO in the context of the present disclosure, refers to a molecule formed by covalent linkage of two or more nucleotides (i.e ., an oligonucleotide).
  • the ASO comprises a contiguous nucleotide sequence of from about 10 to about 30, such as 10-20, 14-20, 16-20, or 15-25, nucleotides in length.
  • the terms "antisense ASO,” “antisense oligonucleotide,” and “oligomer” as used herein are interchangeable with the term “ASO.”
  • a reference to a SEQ ID number includes a particular nucleobase sequence, but does not include any design or full chemical structure.
  • the ASOs disclosed in the figures herein show a representative design, but are not limited to the specific design shown in the Figures unless otherwise indicated.
  • a single nucleotide (unit) can also be referred to as a monomer or unit.
  • the reference includes the sequence, the specific ASO design, and the chemical structure.
  • the reference includes the sequence and the specific ASO design.
  • a claim refers to SEQ ID NO: 158, it includes the nucleotide sequence of tacatattatattactcctc only.
  • a claim refers to DES-0231, it includes the nucleotide sequence of tacatattatattactcctc with the ASO design of TACatattatattactcCTC.
  • the design of ASO-0231 can also be written as SEQ ID NO: 158, wherein each of the first nucleotide, the second nucleotide, the third nucleotide, the 18 th nucleotide, the 19* 11 nucleotide, and the 20 th nucleotide from the 5' end is a modified nucleotide, e.g., LNA, and each of the other nucleotides is a non-modified nucleotide (e.g, DNA).
  • the ASO number includes the sequence and the ASO design, as well as the specific details of the ASO.
  • ASO-0231 referred to in this application indicates OxyTs OxyAs OxyMCs DNAas DNAts DNAas DNAts DNAts DNAas DNAts DNAas DNAts DNAts DNAas DNAcs DNAts DNAcs OxyMCs OxyTs OxyMC, wherein "s" indicates phosphorothioate linkage.
  • the ASO of the disclosure does not comprise RNA (units).
  • the ASO comprises one or more DNA units.
  • the ASO according to the disclosure is a linear molecule or is synthesized as a linear molecule.
  • the ASO is a single stranded molecule, and does not comprise short regions of, for example, at least 3, 4 or 5 contiguous nucleotides, which are complementary to equivalent regions within the same ASO (i.e. duplexes) - in this regard, the ASO is not (essentially) double stranded.
  • the ASO is essentially not double stranded.
  • the ASO is not a siRNA.
  • the ASO of the disclosure can consist entirely of the contiguous nucleotide region. Thus, in some embodiments the ASO is not substantially self- complementary.
  • the present disclosure includes fragments of ASOs.
  • the disclosure includes at least one nucleotide, at least two contiguous nucleotides, at least three contiguous nucleotides, at least four contiguous nucleotides, at least five contiguous nucleotides, at least six contiguous nucleotides, at least seven contiguous nucleotides, at least eight contiguous nucleotides, or at least nine contiguous nucleotides of the ASOs disclosed herein. Fragments of any of the sequences disclosed herein are contemplated as part of the disclosure.
  • the ASO of the disclosure is capable of down-regulating (e.g reducing or removing) expression of the CAMK2D mRNA or protein.
  • the ASO of the disclosure can affect indirect inhibition of CAMK2D protein through the reduction in CAMK2D mRNA levels, typically in a mammalian cell, such as a human cell, such as a cardiocyte.
  • the present disclosure is directed to ASOs that target one or more regions of the CAMK2D pre-mRNA (e.g., intron regions, exon regions, and/or exon-intron junction regions).
  • CAMK2D can refer to CAMK2D from one or more species (e.g, humans, non-human primates, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, and bears).
  • species e.g, humans, non-human primates, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, and bears.
  • CAMK2D Calcium/calmodulin-dependent protein kinase type II delta
  • CaM kinase II subunit delta and CamK-II subunit delta.
  • Synonyms of CAMK2D are known and include CaMKIId or CAMKD.
  • the sequence for the human CAMK2D gene can be found under publicly available GenBank Accession Number NC_000004. l2.
  • the sequence for the human CAMK2D pre-mRNA transcript (SEQ ID NO: 1) corresponds to the reverse complement of residues 113,451,032 - 113,761,927 of NC_000004. l2.
  • the CAMK2D mRNA sequence (GenBank Accession No.
  • NM 001221.3 is provided in SEQ ID NO: 2, except that the nucleotide "t” in SEQ ID NO: 2 is shown as “u” in the mRNA.
  • the sequence for human CAMK2D protein can be found under publicly available Accession Numbers: Q13557 (canonical sequence, SEQ ID NO: 3), A8MVS8, Q52PK4, Q59G21, Q8N553, Q9UGH6, Q9UQE9, each of which is incorporated by reference herein in its entirety.
  • Natural variants of the human CAMK2D gene product are known.
  • natural variants of human CAMK2D protein can contain one or more amino acid substitutions selected from: D167E, Q463E, and T493I, and any combinations thereof.
  • Additional variants of human CAMK2D protein resulting from alternative splicing are also known in the art.
  • CAMK2D Isoform Delta 3 (identifier: Q13557-3 at ETniProt) differs from the canonical sequence (SEQ ID NO: 3) as follows: 328-328: K KKRKSSSSVQMM.
  • the sequence of CAMK2D Isoform Delta 4 differs from the canonical sequence (SEQ ID NO: 3) as follows: 328-328: K KINNK ANVVT SPKENIPTP AL .
  • the sequence of CAMK2D Isoform Delta 6 differs from the canonical sequence (SEQ ID NO: 3) as follows: 479-499: Missing.
  • the sequence of CAMK2D Isoform Delta 7 (identifier: Q13557-9) differs from the canonical sequence (SEQ ID NO: 3) as follows: 328-328: K KKRKSSSSVQMM and 479-499: Missing.
  • sequence of CAMK2D Isoform Delta 8 differs from the canonical sequence (SEQ ID NO: 3) as follows: 328-328: K KINNK ANVVT SPKENIPTP AL and 479-499: Missing.
  • sequence of CAMK2D Isoform Delta 9 differs from the canonical sequence (SEQ ID NO: 3) as follows: 329-329: E EPQTTVIHNPDGNKE.
  • the sequence of CAMK2D Isoform Delta 10 differs from the canonical sequence (SEQ ID NO: 3) as follows: 329-329: E EPQTTVIHNPDGNKE and 479-499: Missing.
  • the sequence of CAMK2D Isoform Delta 11 differs from the canonical sequence (SEQ ID NO: 3) as follows: 328-328: K KKRKSSSSVQMMEPQTTVIHNPDGNK.
  • the sequence of CAMK2D Isoform Delta 12 differs from the canonical sequence (SEQ ID NO: 3) as follows: 478-478: K N and 479-499: Missing. Therefore, the ASOs of the present disclosure can be designed to reduce or inhibit expression of the natural variants of the CAMK2D protein.
  • a target nucleic acid sequence of the ASOs is CAMK2D pre-mRNA.
  • SEQ ID NO: 1 represents a human CAMK2D genomic sequence (i.e., reverse complement of nucleotides 113,451,032 to 113,761,927 of GenBank Accession No. NC_000004. l2).
  • SEQ ID NO: 1 is identical to a CAMK2D pre-mRNA sequence except that nucleotide "t" in SEQ ID NO: 1 is shown as "u” in pre-mRNA.
  • the "target nucleic acid” comprises an intron of a CAMK2D protein- encoding nucleic acids or naturally occurring variants thereof, and RNA nucleic acids derived therefrom, e.g ., pre-mRNA.
  • the target nucleic acid comprises an exon region of a CAMK2D protein-encoding nucleic acids or naturally occurring variants thereof, and RNA nucleic acids derived therefrom, e.g. , pre-mRNA.
  • the target nucleic acid comprises an exon-intron junction of a CAMK2D protein-encoding nucleic acids or naturally occurring variants thereof, and RNA nucleic acids derived therefrom, e.g. , pre-mRNA.
  • the "target nucleic acid” can be a cDNA or a synthetic oligonucleotide derived from the above DNA or RNA nucleic acid targets.
  • the human CAMK2D protein sequence encoded by the CAMK2D pre-mRNA is shown as SEQ ID NO: 3.
  • the target nucleic acid comprises an untranslated region of a CAMK2D protein-encoding nucleic acids or naturally occurring variants thereof, e.g. , 5' UTR, 3' UTR, or both.
  • an ASO of the disclosure hybridizes to a region within the introns of a CAMK2D transcript, e.g., SEQ ID NO: 1. In certain embodiments, an ASO of the disclosure hybridizes to a region within the exons of a CAMK2D transcript, e.g., SEQ ID NO: 1. In other embodiments, an ASO of the disclosure hybridizes to a region within the exon-intron junction of a CAMK2D transcript, e.g., SEQ ID NO: 1.
  • an ASO of the disclosure hybridizes to a region within a CAMK2D transcript (e.g, an intron, exon, or exon-intron junction), e.g., SEQ ID NO: 1, wherein the ASO has a design according to formula: 5' A-B-C 3' as described elsewhere herein (e.g, Section II. G).
  • the ASO targets a mRNA encoding a particular isoform of CAMK2D protein (e.g, Isoform Delta 3-12). In some embodiments, the ASO targets all isoforms of CAMK2D protein. In other embodiments, the ASO targets two isoforms (e.g, Isoform Delta 3 and Isoform Delta 7, Isoform Delta 4 and Isoform Delta 8, and Isoform Delta 9 and Isoform Delta 10) of CAMK2D protein.
  • a mRNA encoding a particular isoform of CAMK2D protein e.g, Isoform Delta 3-12. In some embodiments, the ASO targets all isoforms of CAMK2D protein. In other embodiments, the ASO targets two isoforms (e.g, Isoform Delta 3 and Isoform Delta 7, Isoform Delta 4 and Isoform Delta 8, and Isoform Delta 9 and Isoform Delta 10) of CAMK2D protein.
  • the ASO comprises a contiguous nucleotide sequence (e.g, 10 to 30 nucleotides in length) that are complementary to a nucleic acid sequence within a CAMK2D transcript, e.g, a region corresponding to SEQ ID NO: 1.
  • the ASO comprises a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence, or a region within the sequence, of a CAMK2D transcript ("target region"), wherein the nucleic acid sequence corresponds to nucleotides (i) nucleotides nucleotides 61,817 - 104,725 of SEQ ID NO: 1; (iv) nucleotides 112,162 - 118,021 of SEQ ID NO: 1; (v) nucleotides 119,440 - 135,219 of SEQ ID NO: 1; (vi) nucleotides 137,587 - 157,856 of SEQ ID NO: 1; (vii) nucleotides 159,191 - 266,174 of SEQ ID NO: 1; and (viii) nucleotides 272,788 - 310,949 of SEQ ID NO: 1, and wherein, optionally, the ASO has one of the designs
  • the target region corresponds to nucleotides 725 - 742 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 1,498 - 59,655 of SEQ ID NO: 1. In certain embodiments, the target region corresponds to nucleotides 61,917 - 104,625 of SEQ ID NO: 1. In some embodiments, the target region corresponds to nucleotides 112,262 - 117,921 of SEQ ID NO: 1. In some embodiments, the target region corresponds to nucleotides 119,540 - 135,119 of SEQ ID NO: 1.
  • the target region corresponds to nucleotides 137,687 - 157,756 of SEQ ID NO: 1. In certain embodiments, the target region corresponds to nucleotides 159,291 - 266,074 of SEQ ID NO: 1. In some embodiments, the target region corresponds to nucleotides 272,888 - 310,849 of SEQ ID NO: 1.
  • the target region corresponds to nucleotides 725 - 742 of SEQ ID NO: 1 ⁇ 10, ⁇ 20, ⁇ 30, ⁇ 40, ⁇ 50, ⁇ 60, ⁇ 70, ⁇ 80, or ⁇ 90 nucleotides at the 3' end and/or the 5' end.
  • the target region corresponds to nucleotides 1,498 - 59,655 of SEQ ID NO: 1 ⁇ 10, ⁇ 20, ⁇ 30, ⁇ 40, ⁇ 50, ⁇ 60, ⁇ 70, ⁇ 80, or ⁇ 90 nucleotides at the 3' end and/or the 5' end.
  • the target region corresponds to nucleotides 61,917 - 104,625 of SEQ ID NO: 1 ⁇ 10, ⁇ 20, ⁇ 30, ⁇ 40, ⁇ 50, ⁇ 60, ⁇ 70, ⁇ 80, or ⁇ 90 nucleotides at the 3' end and/or the 5' end.
  • the target region corresponds to nucleotides 112,262 - 117,921 of SEQ ID NO: 1 ⁇ 10, ⁇ 20, ⁇ 30, ⁇ 40, ⁇ 50, ⁇ 60, ⁇ 70, ⁇ 80, or ⁇ 90 nucleotides at the 3' end and/or the 5' end.
  • the target region corresponds to nucleotides 119,540 - 135,119 of SEQ ID NO: 1 ⁇ 10, ⁇ 20, ⁇ 30, ⁇ 40, ⁇ 50, ⁇ 60, ⁇ 70, ⁇ 80, or ⁇ 90 nucleotides at the 3' end and/or the 5' end.
  • the target region corresponds to nucleotides 137,687 - 157,756 of SEQ ID NO: 1 ⁇ 10, ⁇ 20, ⁇ 30, ⁇ 40, ⁇ 50, ⁇ 60, ⁇ 70, ⁇ 80, or ⁇ 90 nucleotides at the 3' end and/or the 5' end.
  • the target region corresponds to nucleotides 159,291 - 266,074 of SEQ ID NO: 1 ⁇ 10, ⁇ 20, ⁇ 30, ⁇ 40, ⁇ 50, ⁇ 60, ⁇ 70, ⁇ 80, or ⁇ 90 nucleotides at the 3' end and/or the 5' end.
  • the target region corresponds to nucleotides 272,888 - 310,849 of SEQ ID NO: 1 ⁇ 10, ⁇ 20, ⁇ 30, ⁇ 40, ⁇ 50, ⁇ 60, ⁇ 70, ⁇ 80, or ⁇ 90 nucleotides at the 3' end and/or the 5' end.
  • the ASO of the present disclosure hybridizes to multiple target regions within the CAMK2D transcript (e.g, pre-mRNA, SEQ ID NO: 1). In some embodiments, the ASO hybridizes to two different target regions within the CAMK2D transcript. In some embodiments, the ASO hybridizes to three different target regions within the CAMK2D transcript.
  • the sequences of exemplary ASOs that hybridizes to multiple target regions, and the start/end sites of the different target regions are provided in FIG. 1B.
  • the ASOs that hybridizes to multiple regions within the CAMK2D transcript are more potent (e.g, having lower EC50) at reducing CAMK2D expression compared to ASOs that hybridizes to a single region within the CAMK2D transcript (e.g, pre-mRNA, SEQ ID NO: 1).
  • the ASO of the disclosure is capable of hybridizing to the target nucleic acid (e.g, CAMK2D transcript) under physiological condition, i.e., in vivo condition. In some embodiments, the ASO of the disclosure is capable of hybridizing to the target nucleic acid (e.g, CAMK2D transcript) in vitro. In some embodiments, the ASO of the disclosure is capable of hybridizing to the target nucleic acid (e.g, CAMK2D transcript) in vitro under stringent conditions.
  • the target nucleic acid e.g, CAMK2D transcript
  • Stringency conditions for hybridization in vitro are dependent on, inter alia, productive cell uptake, RNA accessibility, temperature, free energy of association, salt concentration, and time (see, e.g, Stanley T Crooke, Antisense Drug Technology: Principles, Strategies and Applications, 2 nd Edition, CRC Press (2007)). Generally, conditions of high to moderate stringency are used for in vitro hybridization to enable hybridization between substantially similar nucleic acids, but not between dissimilar nucleic acids.
  • An example of stringent hybridization conditions includes hybridization in 5X saline-sodium citrate (SSC) buffer (0.75 M sodium chloride/0.075 M sodium citrate) for 1 hour at 40°C, followed by washing the sample 10 times in IX SSC at 40°C and 5 times in IX SSC buffer at room temperature.
  • SSC 5X saline-sodium citrate
  • In vivo hybridization conditions consist of intracellular conditions (e.g, physiological pH and intracellular ionic conditions) that govern the hybridization of antisense oligonucleotides with target sequences.
  • In vivo conditions can be mimicked in vitro by relatively low stringency conditions.
  • hybridization can be carried out in vitro in 2X SSC (0.3 M sodium chloride/0.03 M sodium citrate), 0.1% SDS at 37°C.
  • the ASO of the present disclosure is capable of targeting a CAMK2D transcript from one or more species (e.g, humans, non-human primates, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, and bears).
  • the ASO disclosed herein is capable of targeting both human and rodent (e.g, mice or rats) CAMK2D transcript.
  • the ASO is capable of down-regulating (e.g, reducing or removing) expression of the CAMK2D mRNA or protein both in humans and in rodents (e.g, mice or rats).
  • mouse CAMK2D transcript sequences of mouse CAMK2D transcript are known in the art. For instance, the sequence for the mouse CAMK2D gene can be found under publicly available GenBank Accession Number NC_000069.6. The sequence for the mouse CAMK2D pre-mRNA transcript corresponds to residues 126,596,354 - 126,846,326 of NC_000069.6. The sequences for mouse CAMK2D mRNA transcript (both canonical and variants) are known and available as Accession Numbers NM_00l025438.2 (canonical sequence),
  • CM_017319417.1 CM_017319418.1
  • XM_017319420.1 NM_001293666.1
  • mouse CAMK2D protein can be found under publicly available Accession Numbers: Q6PHZ2 (canonical sequence), Q3ETF87,
  • the sequence of CAMK2D Isoform Delta 6 differs from the canonical sequence as follows: 478-478: K N and 479-499: Missing.
  • the sequence of CAMK2D Isoform Delta 10 differs from the canonical as follows: 329-329: E EPQTTVIHNPDGNKE; 478-478: K N; and 479-499: Missing.
  • the sequence of CAMK2D Isoform Delta 5 differs from the canonical sequence (as follows: 328-328: K
  • rat CAMK2D transcript sequences of rat CAMK2D transcript are also known in the art.
  • the rat CAMK2D gene can be found under publicly available GenBank Accession Number NC 005101.4.
  • the sequence for the rat CAMK2D pre-mRNA transcript corresponds to residues 230,900,907 - 231,132,207 of NC_005l0l.4.
  • the sequences for rat CAMK2D mRNA transcript (both canonical and variants) are known and available as Accession Number NM_012519.2 (canonical sequence), BC107562.1, XM_017590621.1, XM_017590605.1,
  • the sequence of rat CAMK2D protein can be found under publicly available Accession Numbers: P 15791 (canonical sequence),
  • CAMK2D Isoform Delta 2 differs from the canonical sequence as follows: 329-362: Missing.
  • the sequence of CAMK2D Isoform Delta 3 differs from the canonical sequence as follows: 329-335: INNKANV KRKSSSV; 337- 359: Missing; and 360-362: GNK QMM.
  • the sequence of CAMK2D Isoform Delta 4 differs from the canonical sequence as follows: 349-362: Missing.
  • the sequence of CAMK2D Isoform Delta 5 differs from the canonical sequence as follows: 329-362: Missing and 512-533: KPPC IPN GKENF S GGT SL W QNI N.
  • the sequence of CAMK2D Isoform Delta 6 differs from the canonical sequence as follows: 512-533: KPP CIPN GKENF S GGT SL W QNI N.
  • the sequence of CAMK2D Isoform Delta 7 differs from the canonical sequence as follows: 349-362: Missing and 512-533: KPP CIPN GKENF S GGT SL W QNI N.
  • the ASOs of the disclosure comprise a contiguous nucleotide sequence which corresponds to the complement of a region of CAMK2D transcript, e.g. , a nucleotide sequence corresponding to SEQ ID NO: 1.
  • the disclosure provides an ASO from 10 - 30, such as 10 - 15 nucleotides, 10 - 20 nucleotides, or 10 - 25 nucleotides in length, wherein the contiguous nucleotide sequence has at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to a region within the complement of a CAMK2D transcript, such as SEQ ID NO: 1 or naturally occurring variant thereof.
  • the ASO hybridizes to a single stranded nucleic acid molecule having the sequence of SEQ ID NO: 1 or a portion thereof.
  • the ASO can comprise a contiguous nucleotide sequence which is fully complementary (perfectly complementary) to the equivalent region of a nucleic acid which encodes a mammalian CAMK2D protein (e.g ., SEQ ID NO: 1).
  • the ASO can comprise a contiguous nucleotide sequence which is fully complementary (perfectly complementary) to a nucleic acid sequence, or a region within the sequence, corresponding to nucleotides X-Y of SEQ ID NO: 1, wherein X and Y are the start site and the end site, respectively, as shown in FIGs. 1A and 1B.
  • the nucleotide sequence of the ASOs of the disclosure or the contiguous nucleotide sequence has at least about 80% sequence identity to a sequence selected from SEQ ID NOs: 4 to 1713 ( i.e ., the sequences in FIGs. 1A and 1B), such as at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, such as about 100% sequence identity (homologous).
  • the ASO has a design described elsewhere herein (e.g., Section II. G) or a chemical structure shown elsewhere herein (e.g, FIGs. 1A and IB).
  • the ASO (or contiguous nucleotide portion thereof) is selected from, or comprises, one of the sequences selected from the group consisting of SEQ ID NOs: 4 to 1713 or a region of at least 10 contiguous nucleotides thereof, wherein the ASO (or contiguous nucleotide portion thereof) can optionally comprise one, two, three, or four mismatches when compared to the corresponding CAMK2D transcript.
  • the ASO comprises a sequence selected from the group consisting of SEQ ID NO: 254, SEQ ID NO: 27, SEQ ID NO: 114, SEQ ID NO: 158, SEQ ID NO: 190, SEQ ID NO: 327, SEQ ID NO: 463, SEQ ID NO: 513, SEQ ID NO: 516, SEQ ID NO: 519, SEQ ID NO: 657, SEQ ID NO: 659, SEQ ID NO: 827, SEQ ID NO: 1249, SEQ ID NO: 1326, SEQ ID NO: 1409, SEQ ID NO: 1524, SEQ ID NO: 1530, SEQ ID NO: 1662, and SEQ ID NO: 1676.
  • the ASO comprises a sequence selected from the group consisting of SEQ ID NO: 55, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 71, SEQ ID NO: 75, SEQ ID NO: 79, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 92, SEQ ID NO: 102, SEQ ID NO: 105, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 133, SEQ ID NO: 138, SEQ ID NO: 161, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 186, SEQ ID NO: 195, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 234, SEQ ID NO: 264, SEQ ID NO: 387, SEQ ID NO: 390, SEQ ID NO: 396, SEQ ID NO: 441, SEQ ID NO: 446, SEQ ID NO: 457, SEQ
  • the ASOs of the disclosure bind to the target nucleic acid sequence (e.g ., CAMK2D transcript) and are capable of inhibiting or reducing expression of the CAMK2D transcript by at least 10% or 20% compared to the normal (i.e., control) expression level in the cell, e.g. , at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% compared to the normal expression level (e.g., expression level in cells that have not been exposed to the ASO).
  • the normal expression level e.g., expression level in cells that have not been exposed to the ASO.
  • the ASOs of the disclosure are capable of reducing expression of CAMK2D mRNA in vitro by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% in HEK293 cells when the cells are in contact with 25 mM of the ASO compared to HEK293 cells that are not in contact with the ASO (e.g, contact with saline).
  • the ASOs of the disclosure are capable of reducing expression of CAMK2D mRNA in vitro by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% in human inducible pluripotent stem cell- derived cardiomyocytes (hiPSC-CM) cells when the cells are in contact with 500 nM of the ASO compared to hiPSC-CM cells that are not in contact with the ASO (e.g, contact with saline).
  • hiPSC-CM human inducible pluripotent stem cell- derived cardiomyocytes
  • the ASO of the disclosure has at least one property selected from the group consisting of: (i) reducing an mRNA level encoding CAMK2D in Inducible Pluripotent Stem Cell-Derived Cardiomyocytes (hiPSC-CM); (ii) reducing a protein level of CAMK2D in hiPSC-CM; (iii) reducing, ameliorating, or treating one or more symptoms of a cardiovascular disease or disorder, and (iv) any combination thereof.
  • the ASO can tolerate 1, 2, 3, or 4 (or more) mismatches, when hybridizing to the target sequence and still sufficiently bind to the target to show the desired effect, i.e., down-regulation of the target mRNA and/or protein.
  • Mismatches can, for example, be compensated by increased length of the ASO nucleotide sequence and/or an increased number of nucleotide analogs, which are disclosed elsewhere herein.
  • the ASO of the disclosure comprises no more than 3 mismatches when hybridizing to the target sequence. In other embodiments, the contiguous nucleotide sequence comprises no more than 2 mismatches when hybridizing to the target sequence. In other embodiments, the contiguous nucleotide sequence comprises no more than 1 mismatch when hybridizing to the target sequence.
  • the ASOs can comprise a contiguous nucleotide sequence of a total of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides in length. It should be understood that when a range is given for an ASO, or contiguous nucleotide sequence length, the range includes the lower and upper lengths provided in the range, for example from (or between) 10-30, includes both 10 and 30.
  • the ASOs comprise a contiguous nucleotide sequence of a total of about 14-20, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides in length.
  • the ASOs comprise one or more non-naturally occurring nucleoside analogs.
  • Nucleoside analogs as used herein are variants of natural nucleosides, such as DNA or RNA nucleosides, by virtue of modifications in the sugar and/or base moieties. Analogs could in principle be merely "silent” or “equivalent” to the natural nucleosides in the context of the oligonucleotide, i.e. have no functional effect on the way the oligonucleotide works to inhibit target gene expression.
  • Such "equivalent" analogs can nevertheless be useful if, for example, they are easier or cheaper to manufacture, or are more stable to storage or manufacturing conditions, or represent a tag or label. In some embodiments, however, the analogs will have a functional effect on the way in which the ASO works to inhibit expression; for example by producing increased binding affinity to the target and/or increased resistance to intracellular nucleases and/or increased ease of transport into the cell.
  • nucleoside analogs are described by e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and in Scheme 1.
  • the ASOs of the present disclosure can contain more than one, more than two, more than three, more than four, more than five, more than six, more than seven, more than eight, more than nine, more than 10, more than 11, more than 12, more than 13, more than 14, more than 15, more than 16, more than 18, more than 19, or more than 20 nucleoside analogs.
  • the nucleoside analogs in the ASOs are the same. In other embodiments, the nucleoside analogs in the ASOs are different.
  • the nucleotide analogs in the ASOs can be any one of or combination of the following nucleoside analogs.
  • nucleobase includes the purine (e.g, adenine and guanine) and pyrimidine (e.g, uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization.
  • nucleobase also encompasses modified nucleobases which may differ from naturally occurring nucleobases, but are functional during nucleic acid hybridization.
  • the nucleobase moiety is modified by modifying or replacing the nucleobase.
  • nucleobase refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are for example described in Hirao et al, (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.
  • the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methyl-cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5- propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6- aminopurine.
  • a nucleobase selected from isocytosine, pseudoisocytosine, 5-methyl-cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5- propynyl-uracil, 5-brom
  • the nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g, A, T, G, C, or U, wherein each letter may optionally include modified nucleobases of equivalent function.
  • the nucleobase moieties are selected from A, T, G, C, and 5-methyl-cytosine.
  • 5-methyl-cytosine LNA nucleosides may be used.
  • the ASO of the disclosure can comprise one or more nucleosides which have a modified sugar moiety, i.e. a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA.
  • a modified sugar moiety i.e. a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA.
  • Numerous nucleosides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and/or nuclease resistance.
  • Such modifications include those where the ribose ring structure is modified, e.g. by replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradical bridge between the C2' and C4' carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the C2' and C3' carbons (e.g, UNA).
  • HNA hexose ring
  • LNA ribose ring
  • UPA unlinked ribose ring which typically lacks a bond between the C2' and C3' carbons
  • Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids (WO2011/017521) or tricyclic nucleic acids (WO2013/154798). Modified nucleosides also include nucleosides where the sugar moiety is replaced with a non-sugar moiety,
  • Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2'-OH group naturally found in RNA nucleosides. Substituents may, for example be introduced at the 2', 3', 4', or 5' positions.
  • Nucleosides with modified sugar moieties also include 2' modified nucleosides, such as 2' substituted nucleosides. Indeed, much focus has been spent on developing 2' substituted nucleosides, and numerous 2' substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides, such as enhanced nucleoside resistance and enhanced affinity.
  • a 2' sugar modified nucleoside is a nucleoside which has a substituent other than H or -OH at the 2' position (2' substituted nucleoside) or comprises a 2' linked biradical, and includes 2' substituted nucleosides and LNA (2' - 4' biradical bridged) nucleosides.
  • the 2' modified sugar may provide enhanced binding affinity (e.g, affinity enhancing 2' sugar modified nucleoside) and/or increased nuclease resistance to the oligonucleotide.
  • 2' substituted modified nucleosides are 2'-0-alkyl-RNA, 2'- O-methyl-RNA, 2'-alkoxy-RNA, 2'-0-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'- Fluoro-RNA, 2'-Fluro-DNA, arabino nucleic acids (ANA), and 2'-Fluoro-ANA nucleoside.
  • MOE 2-methoxyethyl-RNA
  • 2'-amino-DNA 2'- Fluoro-RNA
  • 2'-Fluro-DNA arabino nucleic acids
  • ANA arabino nucleic acids
  • 2'-Fluoro-ANA nucleoside for further examples, please see, e.g. , Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443; Uhlmann, Curr. Opinion in Drug Development, 2000, 3(2), 293- 213; and Delea
  • LNA Locked Nucleic Acid Nucleosides
  • LNA nucleosides are 2'-sugar modified nucleosides which comprise a linker group (referred to as a biradical or a bridge) between C2' and C4' of the ribose sugar ring of a nucleoside (i.e., 2'-4' bridge), which restricts or locks the conformation of the ribose ring.
  • These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature.
  • BNA bicyclic nucleic acid
  • the locking of the conformation of the ribose is associated with an enhanced affinity of hybridization (duplex stabilization) when the LNA is incorporated into an oligonucleotide for a complementary RNA or DNA molecule. This can be routinely determined by measuring the melting temperature of the oligonucleotide/complement duplex.
  • Non limiting, exemplary LNA nucleosides are disclosed in WO 99/014226, WO 00/66604, WO 98/039352 , WO 2004/046160, WO 00/047599, WO 2007/134181, WO 2010/077578, WO 2010/036698, WO 2007/090071, WO 2009/006478, WO 2011/156202, WO 2008/154401, WO 2009/067647, WO 2008/150729, Morita et al, Bioorganic & Med.Chem. Lett. 12, 73-76, Seth et al, J. Org. Chem. 2010, Vol 75(5) pp.
  • the 2'-4' bridge comprises 1 to 4 bridging atoms and is in particular of formula -X- Y- wherein
  • X is oxygen, sulfur, -CR a R b
  • R a and R b are independently selected from hydrogen, halogen, hydroxyl, cyano, thiohydroxyl, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, aryl, heterocycle, amino, alkylamino, carbamoyl, alkylaminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, alkylcarbonylamino, carbamido, alkanoyloxy, sulfone alkylsulfonyloxy, nitro, azido, thiolsulfidealkylsulfanyl, aryloxycarbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxycarbonyl, heteroaryl
  • X a is oxygen, sulfur or -NRc
  • R c , R d , and R e are independently hydrogen or alkyl
  • n 1, 2 or 3.
  • Y is -CR a R b -, -CR a R b -CR a R b - or -CR a R b -CR a R b -CR a R b -, particularly -CH 2 -CHCH 3 -, -CHCH 3 -CH 2 -, CH 2 -CH 2 - or -CH 2 -CH 2 -CH 2 -. ,
  • R a and R b are independently selected from the group consisting of hydrogen, halogen, hydroxyl, alkyl and alkoxyalkyl, in particular, hydrogen, alkyl and alkoxyalkyl.
  • R a and R b are independently selected from the group consisting of hydrogen, halogen, such as fluoro, hydroxyl, methyl and -CH 2 -0-CH 3 , in particular, hydrogen, methyl and -CH 2 -0-CH 3.
  • R a is hydrogen or alkyl, in particular, hydrogen or methyl.
  • R b is hydrogen or alkyl, in particular hydrogen or methyl.
  • R a and R b are hydrogen. In certain embodiments, only one of R a and R b is hydrogen. In some embodiments, one of R a and R b is methyl and the other one is hydrogen. In other embodiments, R a and R b are both methyl at the same time.
  • -X-Y- is -0-CR a R b - wherein R a and R b are independently selected from the group consisting of hydrogen, alkyl and alkoxyalkyl, in particular, hydrogen, methyl and -CH 2 -0-CH 3.
  • -X-Y- is -0-CH 2 - or -0-CH(CH 3 )-, particularly -0-CH 2 -.
  • the 2'- 4' bridge can be positioned either below the plane of the ribose ring (beta-D- configuration), or above the plane of the ring (alpha-L- configuration), as illustrated in formula (A) and formula (B) respectively.
  • the modified nucleoside or the LNA nucleosides of the ASO of the disclosure has a general structure of the formula II or III:
  • W is selected from -0-, -S-, -N(R a )-, -C(R a R b )-, in particular -0-;
  • B is a nucleobase or a modified nucleobase moiety
  • Z is an internucleoside linkage to an adjacent nucleoside or a 5'-terminal group
  • Z* is an internucleoside linkage to an adjacent nucleoside or a 3'-terminal group
  • R 1 , R 2 , R 3 , R 5 and R 5* are independently selected from hydrogen, halogen, alkyl, alkenyl, alkynyl, hydroxy, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, azide, heterocycle and aryl; and
  • X, Y, R a and R b are as defined herein.
  • -X-Y-, R a is hydrogen or alkyl, in particular hydrogen or methyl.
  • R b is hydrogen or alkyl, in particular hydrogen or methyl.
  • one or both of R a and R b are hydrogen.
  • only one of R a and R b is hydrogen.
  • one of R a and R b is methyl and the other one is hydrogen.
  • R a and R b are both methyl at the same time.
  • -X-, R a is hydrogen or alkyl, in particular hydrogen or methyl.
  • R b is hydrogen or alkyl, in particular hydrogen or methyl.
  • one or both of R a and R b are hydrogen.
  • only one of R a and R b is hydrogen.
  • one of R a and R b is methyl and the other one is hydrogen.
  • R a and R b are both methyl at the same time.
  • -Y-, R a is hydrogen or alkyl, in particular hydrogen or methyl.
  • R b is hydrogen or alkyl, in particular hydrogen or methyl.
  • one or both of R a and R b are hydrogen.
  • only one of R a and R b is hydrogen.
  • one of R a and R b is methyl and the other one is hydrogen.
  • R a and R b are both methyl at the same time.
  • R 1 , R 2 , R 3 , R 5 and R 5* are independently selected from hydrogen and alkyl, in particular hydrogen and methyl.
  • R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time.
  • R 1 , R 2 , R 3 are all hydrogen at the same time, one of R 5 and
  • R 5* is hydrogen and the other one is as defined above, in particular alkyl, more particularly methyl.
  • R 1 , R 2 , R 3 are all hydrogen at the same time, one of R 5 and R 5* is hydrogen and the other one is azide..
  • -X-Y- is -0-CH 2 -
  • W is oxygen
  • R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time.
  • LNA nucleosides are disclosed in WO 99/014226, WO 00/66604, WO 98/039352 and WO 2004/046160, which are all hereby incorporated by reference, and include what are commonly known in the art as beta-D- oxy LNA and alpha-L-oxy LNA nucleosides.
  • -X-Y- is -S-CH 2 -
  • W is oxygen
  • R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time.
  • -X-Y- is -NH-CH 2 -
  • W is oxygen
  • R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time.
  • amino LNA nucleosides are disclosed in WO 99/014226 and WO 2004/046160, which are hereby incorporated by reference.
  • -X-Y- is -0-CH 2 CH 2 - or -OCH 2 CH 2 CH 2 -
  • W is oxygen
  • R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time.
  • LNA nucleosides are disclosed in WO 00/047599 and Morita et al ., Bioorganic & Med. ( "hem. Lett. 12, 73-76, which are hereby incorporated by reference, and include what are commonly known in the art as 2'-0-4'C-ethylene bridged nucleic acids (ENA).
  • -X-Y- is -0-CH 2 -
  • W is oxygen
  • R 1 , R 2 , R 3 are all hydrogen at the same time
  • one of R 5 and R 5* is hydrogen and the other one is not hydrogen, such as alkyl, for example methyl.
  • R 5 and R 5* is hydrogen and the other one is not hydrogen, such as alkyl, for example methyl.
  • -X-Y- is -0-CR a R b -, wherein one or both of R a and R b are not hydrogen, in particular alkyl such as methyl, W is oxygen, R 1 , R 2 , R 3 are all hydrogen at the same time, one of R 5 and R 5* is hydrogen and the other one is not hydrogen, in particular alkyl, for example methyl.
  • R a and R b are not hydrogen, in particular alkyl such as methyl
  • W is oxygen
  • R 1 , R 2 , R 3 are all hydrogen at the same time
  • one of R 5 and R 5* is hydrogen and the other one is not hydrogen, in particular alkyl, for example methyl.
  • Such bis modified LNA nucleosides are disclosed in WO 2010/077578, which is hereby incorporated by reference.
  • -X-Y- is -0-CH(CH 2 -0-CH 3 )- ("2' O-methoxyethyl bicyclic nucleic acid", Seth et al, J. Org. Chem. 2010, Vol 75(5) pp. 1569-81).
  • -X-Y- is -0-CHR a -
  • W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time.
  • R a is in particular C1-C6 alkyl, such as methyl.
  • -X-Y- is -0-CH(CH 2 -0-CH 3 )-
  • W is oxygen
  • R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time.
  • LNA nucleosides are also known in the art as cyclic MOEs (cMOE) and are disclosed in WO 2007/090071.
  • -X-Y- is -0-CH(CH 3 )-.
  • -X-Y- is -0-CH 2- 0-CH 2 - (Seth et al ., ./. Org. Chem 2010 op. cit.)
  • -X-Y- is -0-CH(CH 3 )-
  • W is oxygen
  • R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time.
  • 6'-methyl LNA nucleosides are also known in the art as cET nucleosides, and may be either (S)-cET or (R)-cET diastereoisomers, as disclosed in WO 2007/090071 (beta-D) and WO 2010/036698 (alpha-L) which are both hereby incorporated by reference.
  • -X-Y- is -0-CR a R b -, wherein neither R a nor R b is hydrogen,
  • W is oxygen
  • R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time.
  • R a and R b are both alkyl at the same time, in particular both methyl at the same time.
  • Such 6'-di-substituted LNA nucleosides are disclosed in WO 2009/006478 which is hereby incorporated by reference.
  • -X-Y- is -S-CHR a -
  • W is oxygen
  • R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time.
  • R a is alkyl, in particular methyl.
  • vinyl carbo LNA nucleosides are disclosed in WO 2008/154401 and WO 2009/067647, which are both hereby incorporated by reference.
  • -X-Y- is -N(OR a )-CH 2 -
  • W is oxygen
  • R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time.
  • R a is alkyl such as methyl.
  • LNA nucleosides are also known as N substituted LNAs and are disclosed in WO 2008/150729, which is hereby incorporated by reference.
  • -X-Y- is -0-NCH 3 - (Seth et al., ./. Org. Chem 2010 op. cit.).
  • -X-Y- is ON(R a )- -N(R a )-0-,-NR a -CR a R b -CR a R b -, or -NR a -
  • R a is alkyl, such as methyl.
  • R 5 and R 5* are both hydrogen at the same time.
  • one of R 5 and R 5* is hydrogen and the other one is alkyl, such as methyl.
  • R 1 , R 2 and R 3 can be in particular hydrogen and -X-Y- can be in particular -0-CH 2 - or -0-CHC(R a ) 3 -, such as -0-CH(CH 3 )-.
  • -X-Y- is -CR a R b -0-CR a R b -, such as -CH 2 -0-CH 2 -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time.
  • R a can be in particular alkyl such as methyl.
  • LNA nucleosides are also known as conformationally restricted nucleotides (CRNs) and are disclosed in WO 2013/036868, which is hereby incorporated by reference.
  • -X-Y- is -0-CR a R b -0-CR a R b -, such as -0-CH 2 -0-CH 2 -
  • W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time.
  • R a can be in particular alkyl such as methyl.
  • LNA nucleosides are also known as COC nucleotides and are disclosed in Mitsuoka et al ., Nucleic Acids Research 2009, 37(4), 1225-1238, which is hereby incorporated by reference.
  • the LNA nucleosides may be in the beta-D or alpha-L stereoisoform.
  • the LNA nucleosides in the oligonucleotides are beta-D-oxy-LNA nucleosides.
  • Nuclease mediated degradation refers to an oligonucleotide capable of mediating degradation of a complementary nucleotide sequence when forming a duplex with such a sequence.
  • the oligonucleotide may function via nuclease mediated degradation of the target nucleic acid, where the oligonucleotides of the disclosure are capable of recruiting a nuclease, particularly and endonuclease, preferably endoribonuclease (RNase), such as RNase H.
  • RNase endoribonuclease
  • oligonucleotide designs which operate via nuclease mediated mechanisms are oligonucleotides which typically comprise a region of at least 5 or 6 DNA nucleosides and are flanked on one side or both sides by affinity enhancing nucleosides, for example gapmers, headmers and tailmers.
  • the RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a duplex with a complementary RNA molecule and induce degradation of the complementary RNA molecule.
  • WO01/23613 provides in vitro methods for determining RNaseH activity, which may be used to determine the ability to recruit RNaseH.
  • an oligonucleotide is deemed capable of recruiting RNase H if, when provided with a complementary target nucleic acid sequence, it has an initial rate, as measured in pmol/l/min, of at least 5%, such as at least 10% or more than 20% of the of the initial rate determined when using a oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers, with phosphorothioate linkages between all monomers in the oligonucleotide, and using the methodology provided by Example 91 - 95 of WO01/23613.
  • an oligonucleotide is deemed essentially incapable of recruiting RNaseH if, when provided with the complementary target nucleic acid, the RNaseH initial rate, as measured in pmol/l/min, is less than 20%, such as less than 10%, such as less than 5% of the initial rate determined when using a oligonucleotide having the same base sequence as the oligonucleotide being tested, but containing only DNA monomers, with no 2' substitutions, with phosphorothioate linkages between all monomers in the oligonucleotide, and using the methodology provided by Example 91 - 95 of WO01/23613.
  • the ASO of the disclosure can comprise a nucleotide sequence which comprises both nucleosides and nucleoside analogs, and can be in the form of a gapmer, blockmer, mixmer, headmer, tailmer, or totalmer. Examples of configurations of a gapmer, blockmer, mixmer, headmer, tailmer, or totalmer that can be used with the ASO of the disclosure are described in ET.S. Patent Appl. Publ. No. 2012/0322851.
  • gapmer refers to an antisense oligonucleotide which comprises a region of RNase H recruiting oligonucleotides (gap) which is flanked 5' and 3' by one or more affinity enhancing modified nucleosides (flanks).
  • headmers and tailmers are oligonucleotides capable of recruiting RNase H where one of the flanks is missing, i.e., only one of the ends of the oligonucleotide comprises affinity enhancing modified nucleosides.
  • LNA gapmer is a gapmer oligonucleotide wherein at least one of the affinity enhancing modified nucleosides is an LNA nucleoside.
  • flank regions comprise at least one LNA nucleoside and at least one DNA nucleoside or non-LNA modified nucleoside, such as at least one 2' substituted modified nucleoside, such as, for example, 2'-0-alkyl-RNA, 2'-0-methyl-RNA, 2'- alkoxy-RNA, 2'-0-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-Fluoro-RNA, 2'-Fluro- DNA, arabino nucleic acid (ANA), and 2'-Fluoro-ANA nucleoside(s).
  • chimeric ASOs consist of an alternating composition of (i) DNA monomers or nucleoside analog monomers recognizable and cleavable by RNase, and (ii) non-RNase recruiting nucleoside analog monomers.
  • a “totalmer” is a single stranded ASO which only comprises non-naturally occurring nucleotides or nucleotide analogs.
  • some nucleoside analogs in addition to enhancing affinity of the ASO for the target region, some nucleoside analogs also mediate RNase ⁇ e.g., RNaseH) binding and cleavage. Since a-L-LNA monomers recruit RNaseH activity to a certain extent, in some embodiments, gap regions ⁇ e.g, region B as referred to herein) of ASOs containing a-L- LNA monomers consist of fewer monomers recognizable and cleavable by the RNaseH, and more flexibility in the mixmer construction is introduced.
  • the ASO of the disclosure is a gapmer and comprises a contiguous stretch of nucleotides ⁇ e.g, one or more DNA) which is capable of recruiting an RNase, such as RNaseH, referred to herein in as region B (B), wherein region B is flanked at both 5' and 3' by regions of nucleoside analogs 5' and 3' to the contiguous stretch of nucleotides of region B- these regions are referred to as regions A (A) and C (C), respectively.
  • the nucleoside analogs are sugar modified nucleosides ⁇ e.g, high affinity sugar modified nucleosides).
  • the sugar modified nucleosides of regions A and C enhance the affinity of the ASO for the target nucleic acid ⁇ i.e., affinity enhancing 2' sugar modified nucleosides).
  • the sugar modified nucleosides are 2' sugar modified nucleosides, such as high affinity 2' sugar modifications, such as LNA or 2'-MOE.
  • the 5' and 3' most nucleosides of region B are DNA nucleosides, and are positioned adjacent to nucleoside analogs (e.g ., high affinity sugar modified nucleosides) of regions A and C, respectively.
  • regions A and C can be further defined by having nucleoside analogs at the end most distant from region B (i.e., at the 5' end of region A and at the 3' end of region C).
  • the ASOs of the present disclosure comprise a nucleotide sequence of formula (5' to 3') A-B-C, wherein: (A) (5' region or a first wing sequence) comprises at least one nucleoside analog (e.g., 3-5 LNA units); (B) comprises at least four consecutive nucleosides (e.g, 4-24 DNA units), which are capable of recruiting RNase (when formed in a duplex with a complementary RNA molecule, such as the pre-mRNA or mRNA target); and (C) (3' region or a second wing sequence) comprises at least one nucleoside analog (e.g, 3-5 LNA units).
  • region A comprises 3-5 nucleotide analogs, such as LNA
  • region B consists of 6-24 (e.g, 6, 7, 8, 9, 10, 11, 12, 13, or 14) DNA units
  • region C consists of 3 or 4 nucleotide analogs, such as LNA.
  • Such designs include (A-B-C) 3-14-3, 3-11-3, 3-12-3, 3-13-3, 4-9-4, 4-10-4, 4-11-4, 4-12-4, and 5-10-5 .
  • the ASO has a design of LLLD n LLL, LLLLD n LLLL, or LLLLLD n LLLLL, wherein the L is a nucleoside analog, the D is DNA, and n can be any integer between 4 and 24. In some embodiments, n can be any integer between 6 and 14. In some embodiments, n can be any integer between 8 and 12.
  • each monomer is linked to the 3' adjacent monomer via a linkage group.
  • the 5' monomer at the end of an ASO does not comprise a 5' linkage group, although it may or may not comprise a 5' terminal group.
  • linkage group or "internucleoside linkage” are intended to mean a group capable of covalently coupling together two nucleosides. Specific and preferred examples include phosphate groups and phosphorothioate groups.
  • the nucleosides of the ASO of the disclosure or contiguous nucleosides sequence thereof are coupled together via linkage groups. Suitably each nucleoside is linked to the 3' adjacent nucleoside via a linkage group.
  • the internucleoside linkage is modified from its normal phosphodiester to one that is more resistant to nuclease attack, such as phosphorothioate, which is cleavable by RNaseH, also allows that route of antisense inhibition in reducing the expression of the target gene.
  • nuclease attack such as phosphorothioate
  • conjugate refers to an ASO which is covalently linked to a non-nucleotide moiety (conjugate moiety or region C or third region).
  • Conjugation of the ASO of the disclosure to one or more non-nucleotide moieties may improve the pharmacology of the ASO, e.g ., by affecting the activity, cellular distribution, cellular uptake, or stability of the ASO.
  • the non nucleotide moieties modify or enhance the pharmacokinetic properties of the ASO by improving cellular distribution, bioavailability, metabolism, excretion, permeability, and/or cellular uptake of the ASO.
  • the non-nucleotide moieties may target the ASO to a specific organ, tissue, or cell type and thereby enhance the effectiveness of the ASO in that organ, tissue, or cell type.
  • the non-nucleotide moieties reduce the activity of the ASO in non-target cell types, tissues, or organs, e.g, off target activity or activity in non-target cell types, tissues, or organs.
  • WO 93/07883 and W02013/033230 provides suitable conjugate moieties.
  • Further suitable conjugate moieties are those capable of binding to the asialoglycoprotein receptor (ASGPr).
  • ASGPr asialoglycoprotein receptor
  • tri-valent N-acetylgalactosamine conjugate moieties are suitable for binding to the ASGPr, see, e.g , WO 2014/076196, WO 2014/207232, and WO 2014/179620, each of which are hereby incorporated by reference.
  • the non-nucleotide moiety is selected from the group consisting of carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g, bacterial toxins), vitamins, viral proteins (e.g, capsids), and combinations thereof.
  • conjugate moiety is selected from the group consisting of carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g, bacterial toxins), vitamins, viral proteins (e.g, capsids), and combinations thereof.
  • activate ASO refers to an ASO that is covalently linked (i.e., functionalized) to at least one functional moiety that permits covalent linkage of the ASO to one or more conjugated moieties, i.e., moieties that are not themselves nucleic acids or monomers, to form the conjugates herein described.
  • a functional moiety will comprise a chemical group that is capable of covalently bonding to the ASO via, e.g., a 3 '-hydroxyl group or the exocyclic NH 2 group of the adenine base, a spacer that can be hydrophilic and a terminal group that is capable of binding to a conjugated moiety (e.g, an amino, sulfhydryl or hydroxyl group).
  • this terminal group is not protected, e.g, is an NH 2 group.
  • the terminal group is protected, for example, by any suitable protecting group such as those described in "Protective Groups in Organic Synthesis” by Theodora W Greene and Peter G M Wuts, 3rd edition (John Wiley & Sons, 1999), which is hereby incorporated by reference.
  • ASOs of the disclosure are functionalized at the 5' end in order to allow covalent attachment of the conjugated moiety to the 5' end of the ASO.
  • ASOs of the disclosure can be functionalized at the 3' end.
  • ASOs of the disclosure can be functionalized along the backbone or on the heterocyclic base moiety.
  • ASOs of the disclosure can be functionalized at more than one position independently selected from the 5' end, the 3' end, the backbone and the base.
  • activated ASOs of the disclosure are synthesized by incorporating during the synthesis one or more monomers that is covalently attached to a functional moiety. In other embodiments, activated ASOs of the disclosure are synthesized with monomers that have not been functionalized, and the ASO is functionalized upon completion of synthesis.
  • the ASO of the disclosure can be used in pharmaceutical formulations and compositions.
  • such compositions comprise a pharmaceutically acceptable diluent, carrier, salt, or adjuvant.
  • a pharmaceutically acceptable salt comprises a sodium salt, a potassium salt, or an ammonium salt
  • the ASO of the disclosure can be included in a unit formulation such as in a pharmaceutically acceptable carrier or diluent in an amount sufficient to deliver to a patient a therapeutically effective amount without causing serious side effects in the treated patient. However, in some forms of therapy, serious side effects may be acceptable in terms of ensuring a positive outcome to the therapeutic treatment.
  • the formulated drug may comprise pharmaceutically acceptable binding agents and adjuvants.
  • Capsules, tablets, or pills can contain for example the following compounds: microcrystalline cellulose, gum or gelatin as binders; starch or lactose as excipients; stearates as lubricants; various sweetening or flavoring agents.
  • the dosage unit can contain a liquid carrier like fatty oils.
  • coatings of sugar or enteric agents can be part of the dosage unit.
  • the ASO formulations can also be emulsions of the active pharmaceutical ingredients and a lipid forming a micellular emulsion.
  • compositions of the present disclosure can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated.
  • Administration can be (a) oral; (b) pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, (c) topical including epidermal, transdermal, ophthalmic and to mucous membranes including vaginal and rectal delivery; or (d) parenteral including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g, intrathecal, intra-cerebroventricular, or intraventricular, administration.
  • the ASO is administered intravenously, intraperitoneally, orally, topically, or as a bolus injection or administered directly in to the target organ. In some embodiments, the ASO is administered intracardially or intraventricularly as a bolus injection. In some embodiments, the ASO is administered subcutaneously. In some embodiments, the ASO is administered orally.
  • compositions and formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, sprays, suppositories, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
  • topical formulations include those in which the ASO of the disclosure are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
  • compositions and formulations for oral administration include but are not limited to powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets.
  • Compositions and formulations for parenteral, intrathecal, intra- cerebroventricular, or intraventricular administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
  • compositions of the present disclosure include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids. Delivery of drug to the target tissue can be enhanced by carrier-mediated delivery including, but not limited to, cationic liposomes, cyclodextrins, porphyrin derivatives, branched chain dendrimers, polyethylenimine polymers, nanoparticles and microspheres (Dass CR. J Pharm Pharmacol 2002; 54(l):3-27).
  • compositions of the present disclosure can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
  • the formulation can include a sterile diluent, buffers, regulators of tonicity and antibacterials.
  • the active ASOs can be prepared with carriers that protect against degradation or immediate elimination from the body, including implants or microcapsules with controlled release properties.
  • the carriers can be physiological saline or phosphate buffered saline.
  • cardiovascular diseases e.g., a heart failure.
  • cardiovascular diseases include, but are not limited to, coronary artery disease, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, heart arrhythmia, congenital heart disease, valvular heart disease carditis, aortic aneurysms, peripheral artery disease, thromboembolic disease, and venous thrombosis.
  • heart failure comprises a left-sided heart failure, a right-sided heart failure, a congestive heart failure, a heart failure with reduced ejection fraction (HFrEF), a heart failure with preserved ejection fraction (HFpEF), a heart failure with mid-range ejection fraction (HFmrEF), a hypertrophic cardiomyopathy (HCM), a hypertensive heart disease (HHD), or hypertensive hypertrophic cardiomyopathy.
  • HFrEF heart failure with reduced ejection fraction
  • HFpEF heart failure with preserved ejection fraction
  • HmrEF hypertrophic cardiomyopathy
  • HHD hypertensive heart disease
  • the ASOs of the disclosure can be used to measure expression of CAMK2D transcript in a tissue or body fluid from an individual and comparing the measured expression level with a standard CAMK2D transcript expression level in normal tissue or body fluid, whereby an increase in the expression level compared to the standard is indicative of a disorder treatable by an ASO of the disclosure.
  • the ASOs of the disclosure can be used to assay CAMK2D transcript levels in a biological sample using any methods known to those of skill in the art. (Touboul et. al ., Anticancer Res. (2002) 22 (6A): 3349-56; Verjout et. al. , Mutat. Res. (2000) 640: 127- 38); Stowe et. al., J. Virol. Methods (1998) 75 (1): 93-91).
  • biological sample refers to any biological sample obtained from an individual, cell line, tissue culture, or other source of cells potentially expressing CAMK2D transcript. Methods for obtaining such a biological sample from mammals are well known in the art.
  • kits that comprise an ASO of the disclosure described herein and that can be used to perform the methods described herein.
  • a kit comprises at least one ASO in one or more containers.
  • the kits contain all of the components necessary and/or sufficient to perform a detection assay, including all controls, directions for performing assays, and any necessary software for analysis and presentation of results.
  • the disclosed ASO can be readily incorporated into one of the established kit formats which are well known in the art. VI. Methods of Using
  • the ASOs of the disclosure can be utilized as research reagents for, for example, diagnostics, therapeutics, and prophylaxis.
  • ASOs can be used to specifically inhibit the synthesis of CAMK2D protein (typically by degrading or inhibiting the mRNA and thereby prevent protein formation) in cells and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention.
  • methods of down-regulating the expression of CAMK2D mRNA and/or CAMK2D protein in cells or tissues comprising contacting the cells or tissues, in vitro or in vivo , with an effective amount of one or more of the ASOs, conjugates or compositions of the disclosure.
  • the ASOs can be used to detect and quantitate CAMK2D transcript expression in cell and tissues by northern blotting, in-situ hybridization, or similar techniques.
  • an animal or a human, suspected of having a disease or disorder, which can be treated by modulating the expression of CAMK2D transcript and/or CAMK2D protein is treated by administering ASOs in accordance with this disclosure.
  • ASOs in accordance with this disclosure.
  • methods of treating a mammal, such as treating a human, suspected of having or being prone to a disease or condition, associated with increased expression of CAMK2D transcript and/or CAMK2D protein by administering a therapeutically or prophylactically effective amount of one or more of the ASOs or compositions of the disclosure.
  • the ASO, a conjugate, or a pharmaceutical composition according to the disclosure is typically administered in an effective amount.
  • the ASO or conjugate of the disclosure is used in therapy.
  • the disclosure further provides for an ASO according to the disclosure, for use for the treatment of one or more of the cardiovascular diseases referred to herein, such as a disease selected from a coronary artery disease, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, heart arrhythmia, congenital heart disease, valvular heart disease carditis, aortic aneurysms, peripheral artery disease, thromboembolic disease, and venous thrombosis.
  • a disease selected from a coronary artery disease, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, heart arrhythmia, congenital heart disease, valvular heart disease carditis, aortic aneurysms, peripheral artery disease, thromboembolic disease, and venous thrombosis.
  • the disease, disorder, or condition is associated with overexpression of CAMK2D gene transcript and/or CAMK2D protein.
  • the disclosure also provides for methods of inhibiting (e.g ., by reducing) the expression of CAMK2D gene transcript and/or CAMK2D protein in a cell or a tissue, the method comprising contacting the cell or tissue, in vitro or in vivo , with an effective amount of one or more ASOs, conjugates, or pharmaceutical compositions thereof, of the disclosure to affect degradation of expression of CAMK2D gene transcript thereby reducing CAMK2D protein.
  • the disclosure also provides for the use of the ASO or conjugate of the disclosure as described for the manufacture of a medicament for the treatment of a disorder as referred to herein, or for a method of the treatment of as a disorder as referred to herein.
  • the disclosure further provides for a method for inhibiting or reducing CAMK2D protein in a cell which is expressing CAMK2D comprising administering an ASO or a conjugate according to the disclosure to the cell so as to affect the inhibition or reduction of CAMK2D protein in the cell.
  • the disclosure includes a method of reducing, ameliorating, preventing, or treating hyperexcitability of motor neurons (e.g., such as those found in cardiomyocytes) in a subject in need thereof comprising administering an ASO or a conjugate according to the disclosure.
  • motor neurons e.g., such as those found in cardiomyocytes
  • the disclosure also provides for a method for treating a disorder as referred to herein the method comprising administering an ASO or a conjugate according to the disclosure as herein described and/or a pharmaceutical composition according to the disclosure to a patient in need thereof.
  • compositions according to the disclosure can be used for the treatment of conditions associated with over expression of CAMK2D protein.
  • one aspect of the disclosure is directed to a method of treating a mammal suffering from or susceptible to conditions associated with abnormal levels of CAMK2D, comprising administering to the mammal and therapeutically effective amount of an ASO targeted to CAMK2D transcript that comprises one or more LNA units.
  • the ASO, a conjugate, or a pharmaceutical composition according to the disclosure is typically administered in an effective amount.
  • An interesting aspect of the disclosure is directed to the use of an ASO (compound) as defined herein or a conjugate as defined herein for the preparation of a medicament for the treatment of a disease, disorder or condition as referred to herein.
  • cardiovascular diseases can include a coronary artery disease, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, heart arrhythmia, congenital heart disease, valvular heart disease carditis, aortic aneurysms, peripheral artery disease, thromboembolic disease, and venous thrombosis.
  • the cardiovascular disease is a heart failure, which can include a left-sided heart failure, a right-sided heart failure, congestive heart failure, a heart failure with reduced ejection fraction (HFrEF), a heart failure with preserved ejection fraction (HFpEF), a heart failure with mid-range ejection fraction (HFmrEF), a hypertrophic cardiomyopathy (HCM), a hypertensive heart disease (HHD), or hypertensive hypertrophic cardiomyopathy.
  • HFrEF heart failure with reduced ejection fraction
  • HFpEF heart failure with preserved ejection fraction
  • HmrEF hypertrophic cardiomyopathy
  • HHD hypertensive heart disease
  • the disclosure is furthermore directed to a method for treating abnormal levels of CAMK2D protein, the method comprising administering a ASO of the disclosure, or a conjugate of the disclosure or a pharmaceutical composition of the disclosure to a patient in need thereof.
  • the disclosure also relates to an ASO, a composition or a conjugate as defined herein for use as a medicament.
  • the disclosure further relates to use of a compound, composition, or a conjugate as defined herein for the manufacture of a medicament for the treatment of abnormal levels of CAMK2D protein or expression of mutant forms of CAMK2D protein (such as allelic variants, wherein the allelic variants are associated with one of the diseases referred to herein).
  • a patient who is in need of treatment is a patient suffering from or likely to suffer from the disease or disorder.
  • Antisense oligonucleotides described herein were designed to target various regions in the CAMK2D pre-mRNA (SEQ ID NO: 1).
  • SEQ ID NO: 1 shows the genomic CAMK2D sequence, which corresponds to the reverse complement of residues 113,451,032 to 113,761,927 of GenBank Accession No. NC_000004.l2.
  • the ASOs were constructed to target the regions denoted using the start and end sites of SEQ ID NO: 1, as shown in FIGs. 1A and 1B.
  • the exemplary sequences of the ASOs of the present disclosure are provided in FIGs. 1A and 1B.
  • the ASOs were designed to be gapmers as shown in FIG. 3.
  • the disclosed gapmers were constructed to contain locked nucleic acids - LNAs (upper case letters).
  • a gapmer can have beta-deoxy LNA at the 5' end and the 3' end and have a phosphorothioate backbone.
  • the LNA can also be substituted with any other nucleoside analogs and the backbone can be other types of backbones ( e.g ., phosphodiester linkage, a phosphotriester linkage, a methylphosphonate linkage, a phosphoroamidate linkage, or any combinations thereof).
  • the ASOs were synthesized using methods well known in the art.
  • Example 2 qPCR assay to measure reduction of CAMK2D mRNA in HEK293 cells
  • the ASOs of the present disclosure were tested for their ability to reduce CAMK2D mRNA expression in human embryonic kidney cells (HEK293) (European Collection of Authenticated Cell Cultures (ECACC), catalog no. 85120602).
  • HEK293 cells were grown in cell culture media (DMEM AQ D0819, 10% FBS, and Pen/Strep). Every 5 days, cells were trypsinized by washing with Phosphate Buffered Saline (PBS), followed by addition of 0.25% Trypsin-EDTA solution, 2-3 minutes incubation at 37°C, and trituration before cell seeding. Cells were maintained in culture for up to 15 passages.
  • qPCR-mix (qScriptTMXLE l-step RT-qPCR TOEiGHMIX ® Low ROX from QauntaBio) was mixed with two Taqman probes at a ratio 10: 1 : 1 (qPCR mix: probe l :probe2) to generate the mastermix.
  • Taqman probes were acquired from LifeTechnologies: CAMK2D_ Hs009943538_ml; GAPDH 4325792.
  • the mastermix (6 pL) and RNA (4pL, 1-2 ng/pL) were then mixed in a qPCR plate (MICROAMP ® optical 384 well, catalog no. 4309849).
  • the plate was given a quick spin, lOOOg for 1 minute at RT, and transferred to a ViiaTM 7 system (Applied Biosystems, Thermo)., The following PCR conditions were used: 50°C for 15 minutes; 95°C for 3 minutes; 40 cycles of: 95°C for 5 sec, followed by a temperature decrease of 1.6 °C/sec, followed by 60 °C for 45 sec. The data was analyzed using the QuantStudioTM Real time PCR Software. The percent inhibition for the ASO treated samples was calculated relative to the control treated samples. Results are shown in FIGs. 2 and 4.
  • Example 3 QU ANTIGENE ® Analysis (96-well assay) to Measure CAMK2D mRNA Reduction in Human Inducible Pluripotent Stem Cell-Derived Cardiomyocytes (hiPSC-CM)
  • hiPSC-CMs Human inducible pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) from Cellular Dynamics International (“iCell 2 ”) cells were thawed, plated, and cultured per the manufacturer's instructions. These cardiomyocytes are derived from human induced pluripotent stem cells, which were first successfully differentiated into functional cardiomyocytes back in 2009. Zhang et al, Circ Res 104(4):230-41 (2009). Since then, hiPSC-CMs have been used to study various aspects of the human heart and related diseases.
  • Cells were seeded at 30,000 cells/well in 100 pL of the manufacturer's Plating Media and then incubated at 37°C and 5% C0 2 for 4 hours. Then the Plating Media was aspirated and replaced with 100 pL of the manufacturer's Maintenance Media. Cells were incubated at 37°C and 5% C0 2 with media exchange every other day. The ASOs were diluted in water and added to cells at DIV08 (i.e., 8 days post plating). The cells were then incubated at 37°C and 5% C0 2 for 3 days following ASO addition to achieve steady state reduction of mRNA.
  • Working cell lysis buffer was made by adding 1 part proteinase K to 99 parts of QEIANTIGENE ® 3x lysis buffer and then diluting 1 :3 in dH20.
  • the working lysis buffer was added to the plates at 220 uL/well. After adding lysis buffer, the plate was shaken on a plate shaker for 10 minutes are medium speed (i.e., speed 5-6 out of 10). The plates were then incubated at 55°C for 30 minute. Following this incubation, the lysates were either frozen at -80°C or assayed immediately.
  • Measurement of lysate mRNA was performed using the QUANTIGENE ® 2.0 Reagent System (AFFYMETRIX ® ), which quantifies RNA using a branched DNA signal amplification method reliant on the specifically-designed target RNA capture probe set.
  • AFFYMETRIX ® QUANTIGENE ® 2.0 Reagent System
  • Assay Each well of the capture plate (96-well polystyrene plate coated with capture probes) was loaded with 20 uL of working probe set.
  • Working probe set reagents were generated by combining nuclease-free water (12.05 pL), lysis mixture (6.65 pL), blocking reagent (1 pL), and specific 2.0 probe set (0.3 pL) (human CAMK2D catalogue #SA-3000428 or human POLR2A catalogue #SA- 10004) per manufacturer's instructions (QUANTIGENE ® 2.0 AFFYMETRIX ® ).
  • the cell lysates (or lx lysis buffer for use in background control blank wells) were then added to the capture plates at a volume of 80 pL/well, giving 100 uL of total fluid per well.
  • the plates were sealed using the QUANTIGENE ® foil seal in combination with a hand crank sealer. Plates were centrifuged at 240g for 60 seconds and then incubated for 16-20 hours at 55°C to hybridize (target RNA capture).
  • the 2.0 Amplifier hybridization reagent was then added (100 pL/well), incubated for 1 hour at 55°C, and then the wash, aspiration, and drying steps were repeated as described above.
  • the 2.0 Label Probe hybridization reagent was added next (100 pL/well), incubated for 1 hour at 50°C, and then the wash, aspiration, and drying steps were repeated as described previously. Then the 2.0 Substrate was added (100 pL/well) to the plates. Plates were incubated for 5 minutes at room temperature and then imaged on a PerkinElmer Envision multilabel plate reader in luminometer mode within 15 minutes. [0257] Data determination: For the gene of interest, the average assay background signal was subtracted from the average signal of each technical replicate.
  • mice were subcutaneously administered with one of the ASOs shown in FIG. 5.
  • the ASOs were administered at a dose of 30 mg/kg/day for three consecutive days (day 1, 2, and 3). The mice were observed with regards to behavioral and body weight changes. Mice were sacrificed on day 8 and cardiac tissue was harvested for RNA isolation and analysis as described below.
  • MagNA Pure tissue lysis buffer (Roche) was added to the cardaic tissue section and homogenized using stainless steel beads until a uniform lysate was obtained. Incubation for 30 minutes at room temperature completed lysis. RNA was isolated using the MagNA Pure96 (Roche) with the Cellular RNA Large Volume Kit.
  • RNA concentration was normalized to 5 ng/m ⁇ and one-step qPCR was performed using 20 ng RNA, qPCR Taqman Mastermix, and the following Taqman probes: CAMK2D (Thermo Mm00499266_ml) and GAPDH (Thermo 4352339E).
  • PCR conditions were as follows: 50°C for 15 minutes; 95°C for 3 minutes; 40 cycles of: 95°C for 5 sec.
  • the data was analyzed using the QETANTSTETDIOTM Real-time PCR Software. The percent inhibition for the ASO treated samples was calculated relative to saline treated samples.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Surgery (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medical Informatics (AREA)
  • Cell Biology (AREA)
  • Dermatology (AREA)
  • Virology (AREA)
  • Immunology (AREA)
  • Neurology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Oral & Maxillofacial Surgery (AREA)
PCT/US2019/018947 2018-02-21 2019-02-21 Camk2d antisense oligonucleotides and uses thereof Ceased WO2019165067A1 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
KR1020207026765A KR20200140805A (ko) 2018-02-21 2019-02-21 Camk2d 안티센스 올리고뉴클레오티드 및 그의 용도
EP19710527.3A EP3755800A1 (en) 2018-02-21 2019-02-21 Camk2d antisense oligonucleotides and uses thereof
BR112020016347-3A BR112020016347A2 (pt) 2018-02-21 2019-02-21 Oligonucleotídeos antisense de camk2d e seus usos
AU2019226001A AU2019226001B2 (en) 2018-02-21 2019-02-21 CAMK2D antisense oligonucleotides and uses thereof
MX2020008581A MX2020008581A (es) 2018-02-21 2019-02-21 Oligonucleotidos antisentido de la proteina cinasa del tipo ii delta dependiente del calcio/calmodulina (camk2d) y sus usos.
IL276549A IL276549B2 (en) 2018-02-21 2019-02-21 CAMK2D antisense oligonucleotides and their uses
JP2020544270A JP7500426B2 (ja) 2018-02-21 2019-02-21 Camk2dアンチセンスオリゴヌクレオチドおよびその使用
EA202091970A EA202091970A1 (ru) 2018-12-12 2019-02-21 Антисмысловые олигонуклеотиды camk2d и их применение
CA3091789A CA3091789A1 (en) 2018-02-21 2019-02-21 Camk2d antisense oligonucleotides and uses thereof
SG11202007652UA SG11202007652UA (en) 2018-02-21 2019-02-21 Camk2d antisense oligonucleotides and uses thereof
CN201980025466.8A CN112020559A (zh) 2018-02-21 2019-02-21 Camk2d反义寡核苷酸及其用途
IL320427A IL320427A (en) 2018-02-21 2019-02-21 CAMK2D antisense oligonucleotides and their uses

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US201862633502P 2018-02-21 2018-02-21
US62/633,502 2018-02-21
US201862635954P 2018-02-27 2018-02-27
US62/635,954 2018-02-27
US201862665998P 2018-05-02 2018-05-02
US62/665,998 2018-05-02
US201862778679P 2018-12-12 2018-12-12
US62/778,679 2018-12-12

Publications (1)

Publication Number Publication Date
WO2019165067A1 true WO2019165067A1 (en) 2019-08-29

Family

ID=65729436

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/018947 Ceased WO2019165067A1 (en) 2018-02-21 2019-02-21 Camk2d antisense oligonucleotides and uses thereof

Country Status (12)

Country Link
US (2) US11083444B2 (https=)
EP (1) EP3755800A1 (https=)
JP (1) JP7500426B2 (https=)
KR (1) KR20200140805A (https=)
CN (1) CN112020559A (https=)
AU (1) AU2019226001B2 (https=)
BR (1) BR112020016347A2 (https=)
CA (1) CA3091789A1 (https=)
IL (2) IL320427A (https=)
MX (1) MX2020008581A (https=)
SG (1) SG11202007652UA (https=)
WO (1) WO2019165067A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11058767B2 (en) 2018-02-21 2021-07-13 Bristol-Myers Squibb Company CAMK2D antisense oligonucleotides and uses thereof
WO2021158810A1 (en) 2020-02-05 2021-08-12 Bristol-Myers Squibb Company Oligonucleotides for splice modulation of camk2d

Families Citing this family (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE524121T1 (de) 2004-11-24 2011-09-15 Abdou Samy Vorrichtungen zur platzierung eines orthopädischen intervertebralen implantats
US8764806B2 (en) 2009-12-07 2014-07-01 Samy Abdou Devices and methods for minimally invasive spinal stabilization and instrumentation
US11998184B2 (en) * 2010-03-11 2024-06-04 Globus Medical, Inc Tissue retractor and methods of use
US8845728B1 (en) 2011-09-23 2014-09-30 Samy Abdou Spinal fixation devices and methods of use
US20130226240A1 (en) 2012-02-22 2013-08-29 Samy Abdou Spinous process fixation devices and methods of use
US9198767B2 (en) 2012-08-28 2015-12-01 Samy Abdou Devices and methods for spinal stabilization and instrumentation
US9320617B2 (en) 2012-10-22 2016-04-26 Cogent Spine, LLC Devices and methods for spinal stabilization and instrumentation
US10857003B1 (en) 2015-10-14 2020-12-08 Samy Abdou Devices and methods for vertebral stabilization
US10898175B2 (en) 2016-10-04 2021-01-26 Jgmg Bengochea, Llc Retractor extension clip systems
US10744000B1 (en) 2016-10-25 2020-08-18 Samy Abdou Devices and methods for vertebral bone realignment
US10973648B1 (en) 2016-10-25 2021-04-13 Samy Abdou Devices and methods for vertebral bone realignment
US11806250B2 (en) 2018-02-22 2023-11-07 Warsaw Orthopedic, Inc. Expandable spinal implant system and method of using same
US11179248B2 (en) 2018-10-02 2021-11-23 Samy Abdou Devices and methods for spinal implantation
KR20200071198A (ko) 2018-12-10 2020-06-19 네오이뮨텍, 인코퍼레이티드 Nrf2 발현 조절 기반 T 세포 항암면역치료법
US11602337B2 (en) 2019-04-24 2023-03-14 Nuvasive, Inc. Transmission assembly
US11547395B2 (en) 2019-06-18 2023-01-10 Nuvasive, Inc. Tissue retraction system
US11253243B2 (en) 2019-06-18 2022-02-22 Nuvasive, Inc. Tissue retraction system
CN110731803B (zh) * 2019-11-20 2021-05-25 吕振乾 一种心外科手术辅助器
US11944286B2 (en) * 2020-01-24 2024-04-02 Lsi Solutions, Inc. Surgical rib retractor
US11224415B1 (en) * 2020-07-10 2022-01-18 Warsaw Orthopedic, Inc. Tissue retractor
US12349889B2 (en) * 2020-07-10 2025-07-08 Warsaw Orthopedic, Inc. Tissue retractor, retraction modules, and associated methods
US12096923B2 (en) * 2020-07-10 2024-09-24 Warsaw Orthopedic, Inc. Tissue retractor, retraction modules, and associated methods
US12383249B2 (en) * 2020-07-10 2025-08-12 Warsaw Orthopedic, Inc. Tissue retractor, retraction modules, and associated methods
US11833059B2 (en) 2020-11-05 2023-12-05 Warsaw Orthopedic, Inc. Expandable inter-body device, expandable plate system, and associated methods
US11285014B1 (en) 2020-11-05 2022-03-29 Warsaw Orthopedic, Inc. Expandable inter-body device, system, and method
US11638653B2 (en) 2020-11-05 2023-05-02 Warsaw Orthopedic, Inc. Surgery instruments with a movable handle
US12171439B2 (en) 2020-11-05 2024-12-24 Warsaw Orthopedic, Inc. Protected drill
US12121453B2 (en) 2020-11-05 2024-10-22 Warsaw Orthopedic, Inc. Dual wedge expandable implant with eyelets, system, and method of use
US11517443B2 (en) 2020-11-05 2022-12-06 Warsaw Orthopedic, Inc. Dual wedge expandable implant, system and method of use
US11376134B1 (en) 2020-11-05 2022-07-05 Warsaw Orthopedic, Inc. Dual expanding spinal implant, system, and method of use
US11963881B2 (en) 2020-11-05 2024-04-23 Warsaw Orthopedic, Inc. Expandable inter-body device, system, and method
US12318308B2 (en) 2020-11-05 2025-06-03 Warsaw Orthopedic, Inc. Dual expandable inter-body device
US12239544B2 (en) 2020-11-05 2025-03-04 Warsaw Orthopedic, Inc. Rhomboid shaped implants
US11291554B1 (en) 2021-05-03 2022-04-05 Medtronic, Inc. Unibody dual expanding interbody implant
US11564724B2 (en) 2020-11-05 2023-01-31 Warsaw Orthopedic, Inc. Expandable inter-body device, system and method
US11395743B1 (en) 2021-05-04 2022-07-26 Warsaw Orthopedic, Inc. Externally driven expandable interbody and related methods
WO2022251644A1 (en) 2021-05-28 2022-12-01 Lyell Immunopharma, Inc. Nr4a3-deficient immune cells and uses thereof
US12268614B2 (en) 2021-06-24 2025-04-08 Warsaw Orthopedic, Inc. Interbody implant with adjusting shims
WO2022271280A1 (en) 2021-06-24 2022-12-29 Warsaw Orthopedic, Inc. Expandable interbody implant and corresponding surgical tool
US12440349B2 (en) 2021-11-01 2025-10-14 Warsaw Orthopedic, Inc. Expandable interbody implant and breakoff screw
US12485019B2 (en) 2021-06-24 2025-12-02 Warsaw Orthopedic, Inc. Parallel jaw inserter
US12295865B2 (en) 2021-06-24 2025-05-13 Warsaw Orthopedic, Inc. Expandable interbody implant and corresponding inserter
US11612499B2 (en) 2021-06-24 2023-03-28 Warsaw Orthopedic, Inc. Expandable interbody implant
US11730608B2 (en) 2021-07-13 2023-08-22 Warsaw Orthopedic, Inc. Monoblock expandable interbody implant
US20240336896A1 (en) 2021-10-14 2024-10-10 Lonza Sales Ag Modified producer cells for extracellular vesicle production
US11850163B2 (en) 2022-02-01 2023-12-26 Warsaw Orthopedic, Inc. Interbody implant with adjusting shims
KR20250027283A (ko) 2022-05-19 2025-02-25 라이엘 이뮤노파마, 인크. nr4a3을 표적하는 폴리뉴클레오타이드 및 이의 용도
WO2024064952A1 (en) 2022-09-23 2024-03-28 Lyell Immunopharma, Inc. Methods for culturing nr4a-deficient cells overexpressing c-jun
WO2024077174A1 (en) 2022-10-05 2024-04-11 Lyell Immunopharma, Inc. Methods for culturing nr4a-deficient cells
CN118853661A (zh) * 2023-04-28 2024-10-29 时夕(广州)生物科技有限公司 编辑rna的方法、组合物及其应用
US12533241B2 (en) 2023-05-16 2026-01-27 Warsaw Orthopedic, Inc. Distracting and angling expandable interbody device
WO2025217398A1 (en) 2024-04-10 2025-10-16 Lyell Immunopharma, Inc. Methods for culturing cells with improved culture medium

Citations (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
WO1993007883A1 (en) 1991-10-24 1993-04-29 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
WO1998039352A1 (en) 1997-03-07 1998-09-11 Takeshi Imanishi Novel bicyclonucleoside and oligonucleotide analogues
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
WO2000047599A1 (en) 1999-02-12 2000-08-17 Sankyo Company, Limited Novel nucleosides and oligonucleotide analogues
WO2000066604A2 (en) 1999-05-04 2000-11-09 Exiqon A/S L-ribo-lna analogues
WO2001023613A1 (en) 1999-09-30 2001-04-05 Isis Pharmaceuticals, Inc. Human rnase h and oligonucleotide compositions thereof
WO2004046160A2 (en) 2002-11-18 2004-06-03 Santaris Pharma A/S Amino-lna, thio-lna and alpha-l-oxy-ln
US20050272080A1 (en) * 2004-05-03 2005-12-08 Affymetrix, Inc. Methods of analysis of degraded nucleic acid samples
WO2007031091A2 (en) 2005-09-15 2007-03-22 Santaris Pharma A/S Rna antagonist compounds for the modulation of p21 ras expression
WO2007059533A2 (en) * 2005-11-18 2007-05-24 Myogen, Inc. Uses for camki i and hdacs in the treatment of heart conditions
WO2007090071A2 (en) 2006-01-27 2007-08-09 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
WO2007134181A2 (en) 2006-05-11 2007-11-22 Isis Pharmaceuticals, Inc. 5'-modified bicyclic nucleic acid analogs
WO2007146511A2 (en) 2006-05-05 2007-12-21 Isis Pharmaceuticals, Inc. Compounds and methods for modulating gene expression
WO2008113832A2 (en) 2007-03-22 2008-09-25 Santaris Pharma A/S SHORT RNA ANTAGONIST COMPOUNDS FOR THE MODULATION OF TARGET mRNA
WO2008150729A2 (en) 2007-05-30 2008-12-11 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
WO2008154401A2 (en) 2007-06-08 2008-12-18 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
WO2009006478A2 (en) 2007-07-05 2009-01-08 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
WO2009067647A1 (en) 2007-11-21 2009-05-28 Isis Pharmaceuticals, Inc. Carbocyclic alpha-l-bicyclic nucleic acid analogs
WO2010036698A1 (en) 2008-09-24 2010-04-01 Isis Pharmaceuticals, Inc. Substituted alpha-l-bicyclic nucleosides
WO2010077578A1 (en) 2008-12-09 2010-07-08 Isis Pharmaceuticals, Inc. Bis-modified bicyclic nucleic acid analogs
WO2011017521A2 (en) 2009-08-06 2011-02-10 Isis Pharmaceuticals, Inc. Bicyclic cyclohexose nucleic acid analogs
WO2011156202A1 (en) 2010-06-08 2011-12-15 Isis Pharmaceuticals, Inc. Substituted 2 '-amino and 2 '-thio-bicyclic nucleosides and oligomeric compounds prepared therefrom
US20120322851A1 (en) 2009-10-20 2012-12-20 Gregroy Hardee Oral delivery of therapeutically effective lna oligonucleotides
WO2013033230A1 (en) 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
WO2013036868A1 (en) 2011-09-07 2013-03-14 Marina Biotech Inc. Synthesis and uses of nucleic acid compounds with conformationally restricted monomers
WO2013154798A1 (en) 2012-04-09 2013-10-17 Isis Pharmaceuticals, Inc. Tricyclic nucleic acid analogs
WO2013173637A1 (en) * 2012-05-16 2013-11-21 Rana Therapeutics, Inc. Compositions and methods for modulating gene expression
WO2014076196A1 (en) 2012-11-15 2014-05-22 Santaris Pharma A/S Anti apob antisense conjugate compounds
WO2014179620A1 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
WO2014207232A1 (en) 2013-06-27 2014-12-31 Santaris Pharma A/S Antisense oligomers and conjugates targeting pcsk9

Family Cites Families (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3749088A (en) 1971-06-23 1973-07-31 W Kohlmann Surgical retractor device
WO1998021366A1 (en) 1996-11-13 1998-05-22 Qbi Enterprises, Ltd. Gene identification method
US6139493A (en) * 1998-07-08 2000-10-31 Koros; Tibor B. Retractor with adjustable length blades and light pipe guides
GB2375172A (en) 2000-02-07 2002-11-06 Quark Biotech Inc Fas pathway genes
WO2002060330A1 (en) * 2001-01-29 2002-08-08 Stephen Ritland Retractor and method for spinal pedicle screw placement
WO2005060667A2 (en) 2003-12-19 2005-07-07 The General Hospital Corporation Nucleic acid and amino acid sequences involved in pain
WO2003016475A2 (en) 2001-08-14 2003-02-27 The General Hospital Corporation Nucleic acid and amino acid sequences involved in pain
AU2002351828A1 (en) 2001-11-05 2003-05-19 Deutsches Krebsforschungszentrum Novel genetic markers for leukemias
US20030157082A1 (en) 2002-01-31 2003-08-21 Millennium Pharmaceuticals, Inc. Methods and compositions for treating cancer using 140, 1470, 1686, 2089, 2427, 3702, 5891, 6428, 7181, 7660, 25641, 69583, 49863, 8897, 1682, 17667, 9235, 3703, 14171, 10359, 1660, 1450, 18894, 2088, 32427, 2160, 9252, 9389, 1642, 85269, 10297, 1584, 9525, 14124, 4469, 8990, 2100, 9288, 64698, 10480,20893, 33230,1586, 9943, 16334, 68862, 9011, 14031, 6178, 21225, 1420, 32236, 2099, 2150, 26583, 2784, 8941, 9811, 27444, 50566 or 66428 molecules
US20040101855A1 (en) * 2002-11-22 2004-05-27 Isis Pharmaceuticals Inc. Modulation of PPAR binding protein expression
US9259144B2 (en) 2002-07-11 2016-02-16 Nuvasive, Inc. Surgical access system and related methods
WO2004012817A2 (en) 2002-07-31 2004-02-12 Kylix B.V. Use of genes identified to be involved in tumor development for the development of anti-cancer drugs
JP2006513701A (ja) 2002-10-11 2006-04-27 アーラム バイオシステムズ インコーポレイテッド 核酸ベースのシグナルトランスデューサーを含む立体構造的に敏感なプローブを有する標的検出システム
US7850608B2 (en) 2002-10-25 2010-12-14 K2M, Inc. Minimal incision maximal access MIS spine instrumentation and method
US7691057B2 (en) 2003-01-16 2010-04-06 Nuvasive, Inc. Surgical access system and related methods
US7256200B2 (en) 2003-02-10 2007-08-14 The Board Of Trustees Of The University Of Illinois, A Body Corporate And Politic Of The State Of Illinois Method and composition for potentiating an oplate analgesic
US7819801B2 (en) 2003-02-27 2010-10-26 Nuvasive, Inc. Surgical access system and related methods
US20050085436A1 (en) 2003-07-08 2005-04-21 Hao Li Method to treat conditions associated with insulin signalling dysregulation
US7481766B2 (en) 2003-08-14 2009-01-27 Synthes (U.S.A.) Multiple-blade retractor
US20050137461A1 (en) * 2003-12-18 2005-06-23 Depuy Spine, Inc. Telescoping blade assembly and instruments for adjusting an adjustable blade
US9622732B2 (en) * 2004-10-08 2017-04-18 Nuvasive, Inc. Surgical access system and related methods
JP2006223228A (ja) 2005-02-18 2006-08-31 Dainippon Sumitomo Pharma Co Ltd 自己免疫疾患治療剤のスクリーニング方法
US20060287584A1 (en) * 2005-06-16 2006-12-21 Javier Garcia-Bengochia Surgical retractor extensions
CN1904900A (zh) * 2005-07-28 2007-01-31 中国科学院生物物理研究所 人类的内源性siRNA序列及其应用和筛选方法
US20090156540A1 (en) * 2006-03-07 2009-06-18 Mckenna Katherine Method for diagnosing and/or predicting the development of an allergic disorder and agents for treating and/or preventing same
WO2008020435A2 (en) 2006-08-15 2008-02-21 Quark Pharmaceuticals, Inc Compositions and methods for treatment of mood disorders
ES2534430T3 (es) 2006-08-28 2015-04-22 The University Of Western Australia Método de modulación de la expresión del receptor del factor de crecimiento epidérmico (EGFR) que implica miARN
GB0617222D0 (en) 2006-08-31 2006-10-11 Vereniging Het Nl Kanker I Antibiotics
US8062217B2 (en) * 2007-01-26 2011-11-22 Theken Spine, Llc Surgical retractor with removable blades and method of use
WO2008152636A2 (en) * 2007-06-15 2008-12-18 Quark Pharmaceuticals, Inc. Compositions and methods for inhibiting nadph oxidase expression
DE202007012284U1 (de) 2007-09-01 2007-10-25 Aesculap Ag & Co. Kg Chirurgischer Retraktor
US8841423B2 (en) 2008-04-28 2014-09-23 University Of Iowa Research Foundation Monoclonal antibodies specific for oxidized calcium/calmodulin dependent protein kinase II
EP2177615A1 (en) 2008-10-10 2010-04-21 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Method for a genome wide identification of expression regulatory sequences and use of genes and molecules derived thereof for the diagnosis and therapy of metabolic and/or tumorous diseases
US8226554B2 (en) 2008-10-30 2012-07-24 Warsaw Orthopedic, Inc. Retractor assemblies for surgery in a patient
WO2010120969A1 (en) 2009-04-15 2010-10-21 Board Of Regents, The University Of Texas System Targeting of the mir-30 family and let-7 family as a treatment for heart disease
ES2555057T3 (es) * 2009-06-12 2015-12-28 Roche Innovation Center Copenhagen A/S Nuevos potentes compuestos antisentido anti-ApoB
US8563528B2 (en) * 2009-07-21 2013-10-22 Santaris Pharma A/S Antisense oligomers targeting PCSK9
US9737288B2 (en) * 2010-03-11 2017-08-22 Globus Medical, Inc Tissue retractor and methods of use
WO2012024255A2 (en) 2010-08-16 2012-02-23 Duke University Camkk-beta as a target for treating cancer
EP3778896A1 (en) 2011-08-09 2021-02-17 Fred Hutchinson Cancer Research Center Methods and compositions for inhibiting the growth and/or proliferation of myc-driven tumor cells
WO2013033436A1 (en) * 2011-09-01 2013-03-07 University Of Iowa Research Foundation Oligonucleotide-based probes for detection of bacterial nucleases
CA2857374A1 (en) 2011-09-02 2013-03-07 The Trustees Of Columbia University In The City Of New York Camkii, ip3r, calcineurin, p38 and mk2/3 inhibitors to treat metabolic disturbances of obesity
WO2013151999A1 (en) 2012-04-02 2013-10-10 President And Fellows Of Harvard College Cancer treatment and immune system regulation through fat10 pathway inhibition
WO2014077693A1 (en) 2012-11-16 2014-05-22 Academisch Ziekenhuis Leiden H.O.D.N. Lumc Means and methods for reducing an effect of aging in a mammalian cell
AU2014225889B2 (en) 2013-03-06 2018-12-06 The Johns Hopkins University CaMKII inhibitors and uses thereof
US20140329755A1 (en) 2013-05-01 2014-11-06 Gilead Sciences, Inc. Combination therapy for the treatment of arrhythmias or heart failure
WO2016037106A1 (en) 2014-09-05 2016-03-10 Allosteros Therapeutics, Inc CaMKII INHIBITORS AND USES THEREOF
PL3265563T3 (pl) 2015-02-02 2021-09-13 Meiragtx Uk Ii Limited Regulacja ekspresji genów poprzez modulację alternatywnego splicingu za pośrednictwem aptamerów
EP3286318A2 (en) 2015-04-22 2018-02-28 Mina Therapeutics Limited Sarna compositions and methods of use
US10494632B2 (en) * 2015-07-10 2019-12-03 Alnylam Pharmaceuticals, Inc. Insulin-like growth factor binding protein, acid labile subunit (IGFALS) compositions and methods of use thereof
US20210052631A1 (en) 2015-09-25 2021-02-25 Ionis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
EP3353306A4 (en) 2015-09-25 2019-06-05 Ionis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
CA3005090A1 (en) * 2015-12-14 2017-06-22 Cold Spring Harbor Laboratory Compositions and methods for treatment of liver diseases
AU2017292173B2 (en) * 2016-07-06 2022-01-13 Vertex Pharmaceuticals Incorporated Materials and methods for treatment of pain related disorders
SMT202400091T1 (it) 2016-08-03 2024-05-14 Meiragtx Uk Ii Ltd Screening ad alta produzione basato su cellule per 5 aptameri
WO2019049148A1 (en) 2017-09-10 2019-03-14 Carmel Haifa University Economic Corporation Ltd. METHOD OF TREATING DEPRESSION AND MAJOR DEPRESSIVE DISORDER
US10717981B2 (en) 2018-01-18 2020-07-21 Advanced ReGen Medical Technologies, LLC Therapeutic compositions and methods of making and using the same
KR20200140805A (ko) 2018-02-21 2020-12-16 브리스톨-마이어스 스큅 컴퍼니 Camk2d 안티센스 올리고뉴클레오티드 및 그의 용도
WO2019217459A1 (en) 2018-05-07 2019-11-14 Alnylam Pharmaceuticals, Inc. Extrahepatic delivery

Patent Citations (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (https=) 1986-01-30 1990-11-27 Cetus Corp
WO1993007883A1 (en) 1991-10-24 1993-04-29 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
WO1998039352A1 (en) 1997-03-07 1998-09-11 Takeshi Imanishi Novel bicyclonucleoside and oligonucleotide analogues
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
WO2000047599A1 (en) 1999-02-12 2000-08-17 Sankyo Company, Limited Novel nucleosides and oligonucleotide analogues
WO2000066604A2 (en) 1999-05-04 2000-11-09 Exiqon A/S L-ribo-lna analogues
WO2001023613A1 (en) 1999-09-30 2001-04-05 Isis Pharmaceuticals, Inc. Human rnase h and oligonucleotide compositions thereof
WO2004046160A2 (en) 2002-11-18 2004-06-03 Santaris Pharma A/S Amino-lna, thio-lna and alpha-l-oxy-ln
US20050272080A1 (en) * 2004-05-03 2005-12-08 Affymetrix, Inc. Methods of analysis of degraded nucleic acid samples
WO2007031091A2 (en) 2005-09-15 2007-03-22 Santaris Pharma A/S Rna antagonist compounds for the modulation of p21 ras expression
WO2007059533A2 (en) * 2005-11-18 2007-05-24 Myogen, Inc. Uses for camki i and hdacs in the treatment of heart conditions
WO2007090071A2 (en) 2006-01-27 2007-08-09 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
WO2007146511A2 (en) 2006-05-05 2007-12-21 Isis Pharmaceuticals, Inc. Compounds and methods for modulating gene expression
WO2007134181A2 (en) 2006-05-11 2007-11-22 Isis Pharmaceuticals, Inc. 5'-modified bicyclic nucleic acid analogs
WO2008113832A2 (en) 2007-03-22 2008-09-25 Santaris Pharma A/S SHORT RNA ANTAGONIST COMPOUNDS FOR THE MODULATION OF TARGET mRNA
WO2008150729A2 (en) 2007-05-30 2008-12-11 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
WO2008154401A2 (en) 2007-06-08 2008-12-18 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
WO2009006478A2 (en) 2007-07-05 2009-01-08 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
WO2009067647A1 (en) 2007-11-21 2009-05-28 Isis Pharmaceuticals, Inc. Carbocyclic alpha-l-bicyclic nucleic acid analogs
WO2010036698A1 (en) 2008-09-24 2010-04-01 Isis Pharmaceuticals, Inc. Substituted alpha-l-bicyclic nucleosides
WO2010077578A1 (en) 2008-12-09 2010-07-08 Isis Pharmaceuticals, Inc. Bis-modified bicyclic nucleic acid analogs
WO2011017521A2 (en) 2009-08-06 2011-02-10 Isis Pharmaceuticals, Inc. Bicyclic cyclohexose nucleic acid analogs
US20120322851A1 (en) 2009-10-20 2012-12-20 Gregroy Hardee Oral delivery of therapeutically effective lna oligonucleotides
WO2011156202A1 (en) 2010-06-08 2011-12-15 Isis Pharmaceuticals, Inc. Substituted 2 '-amino and 2 '-thio-bicyclic nucleosides and oligomeric compounds prepared therefrom
WO2013033230A1 (en) 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
WO2013036868A1 (en) 2011-09-07 2013-03-14 Marina Biotech Inc. Synthesis and uses of nucleic acid compounds with conformationally restricted monomers
WO2013154798A1 (en) 2012-04-09 2013-10-17 Isis Pharmaceuticals, Inc. Tricyclic nucleic acid analogs
WO2013173637A1 (en) * 2012-05-16 2013-11-21 Rana Therapeutics, Inc. Compositions and methods for modulating gene expression
WO2014076196A1 (en) 2012-11-15 2014-05-22 Santaris Pharma A/S Anti apob antisense conjugate compounds
WO2014179620A1 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
WO2014207232A1 (en) 2013-06-27 2014-12-31 Santaris Pharma A/S Antisense oligomers and conjugates targeting pcsk9

Non-Patent Citations (59)

* Cited by examiner, † Cited by third party
Title
"DNA Cloning", 1985
"GenBank", Database accession no. NC 005101.4
"GenBank", Database accession no. NC_000004.12
"GenBank", Database accession no. NM-001221.3
"Gene Transfer Vectors For Mammalian Cells", 1987, COLD SPRING HARBOR LABORATORY
"Handbook Of Experimental Immunology", vol. I-IV, 1986
"Immobilized Cells And Enzymes", 1986, IRL PRESS
"Immunochemical Methods In Cell And Molecular Biology", 1987, ACADEMIC PRESS
"Manipulating the Mouse Embryo", 1986, COLD SPRING HARBOR LABORATORY PRESS
"Methods In Enzymology", ACADEMIC PRESS, INC.
"Methods In Enzymology", vol. 154; 155
"Nucleic Acid Hybridization", 1984
"Oligonucleotide Synthesis", 1984
"Oxford Dictionary Of Biochemistry And Molecular Biology", 2000, OXFORD UNIVERSITY PRESS
"The Dictionary of Cell and Molecular Biology", 1999, ACADEMIC PRESS
"Transcription And Translation", 1984
ALTSCHUL ET AL., METHODS IN ENZYMOLOGY, vol. 266, 1996, pages 460 - 480
ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1991, pages 3389 - 3402
ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402
ANIL PUROHIT ET AL: "Oxidized Ca 2+ /Calmodulin-Dependent Protein Kinase II Triggers Atrial Fibrillation", CIRCULATION, vol. 128, no. 16, 15 October 2013 (2013-10-15), US, pages 1748 - 1757, XP055589939, ISSN: 0009-7322, DOI: 10.1161/CIRCULATIONAHA.113.003313 *
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1989, JOHN WILEY AND SONS
BARCISZEWSKI ET AL.: "Nucleic Acid and Peptide Aptamers: Methods and Protocols", vol. 535, 2009, article "Locked Nucleic Acid Aptamers"
BENJAMIN, E.J. ET AL., CIRCULATION, vol. 135, 2017, pages e146 - e603
BERGSTROM, CURRENT PROTOCOLS IN NUCLEIC ACID CHEMISTRY, 2009, pages 1.4.1
BLAZESKI ET AL., PROG BIOPHYS MOL BIOL, vol. 110, 2012, pages 166 - 177
BRAUN, A.P. ET AL., ANNUAL REVIEW OF PHYSIOLOGY, vol. 57, 1995, pages 417 - 445
CROOKE: "Antisense drug Technology: Principles, Strategies and Applications", 2007, CRC PRESS
DASS CR., J PHARM PHARMACOL, vol. 54, no. 1, 2002, pages 3 - 27
DATABASE EMBL [online] 27 August 2008 (2008-08-27), "Sequence 234707 from patent US 7374927.", XP002791545, retrieved from EBI accession no. EM_PAT:GC034707 Database accession no. GC034707 *
DATABASE EMBL [online] 8 July 2015 (2015-07-08), "Sequence 96675 from Patent EP2850184.", XP002791546, retrieved from EBI accession no. EM_PAT:JD784807 Database accession no. JD784807 *
DELEAVEY; DAMHA, CHEMISTRY AND BIOLOGY, vol. 19, 2012, pages 937
FREIER; ALTMANN, NUCL. ACID RES., vol. 25, 1997, pages 4429 - 4443
FRESHNEY: "Culture Of Animal Cells", 1987, ALAN R. LISS, INC.
HIRAO ET AL., ACCOUNTS OF CHEMICAL RESEARCH, vol. 45, 2012, pages 2055
INKYEOM KIM: "Ca2+calmodulin-dependent protein kinase II-dependent activation of contractility in ferret aorta", JOURNAL OF PHYSIOLOGY, vol. 526, 2000, pages 367 - 374, XP055589754 *
JUO, PEI-SHOW: "Concise Dictionary of Biomedicine and Molecular Biology", 2002, CRC PRESS
KARLIN ET AL., PROC. NATL. ACAD. SCI., vol. 87, 1990, pages 2264 - 2268
KARLIN ET AL., PROC. NATL. ACAD. SCI., vol. 90, 1993, pages 5873 - 5877
L.S. MAIER: "CaMKII[delta] overexpression in hypertrophy and heart failure: cellular consequences for excitation-contraction coupling", BRAZILIAN JOURNAL OF MEDICAL AND BIOLOGICAL RESEARCH, vol. 38, 2005, pages 1293 - 1302, XP055589943 *
MATTIAZZI A. ET AL., AM J PHYSIOL HEART CIRC PHYSIOL, vol. 308, 2015, pages H1177 - H1191
MATTIAZZI ET AL.: "t]he ubiquitous nature of CaMKII and its effects on different protein targets challenge the use of CaMKII inhibitors as a therapeutic tool", AM J PHYSIOL HEART CIRC PHYSIOL, vol. 308, 2015, pages H1177 - H1191
MITSUOKA ET AL., NUCLEIC ACIDS RESEARCH, vol. 37, no. 4, 2009, pages 1225 - 1238
MORITA ET AL., BIOORGANIC & MED.CHEM. LETT., vol. 12, pages 73 - 76
MYERS; MILLER, CABIOS, vol. 4, 1989, pages 11 - 17
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 444 - 453
PERBAL, A PRACTICAL GUIDE TO MOLECULAR CLONING, 1984
SAID M. ET AL., AM J PHYSIOL HEART CIRC PHYSIOL, vol. 285, 2003, pages H1198 - 205
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", vol. I; II, 1992, COLD SPRINGS HARBOR LABORATORY
SAMBROOK: "Molecular Cloning A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
SETH ET AL., J. ORG. CHEM, 2010
SETH ET AL., J. ORG. CHEM., vol. 75, no. 5, 2010, pages 1569 - 81
STANLEY T CROOKE: "Antisense Drug Technology: Principles, Strategies and Applications", 2007, CRC PRESS
STOWE, . VIROL. METHODS, vol. 75, no. 1, 1998, pages 93 - 91
T. W. GREENE; P. G. M. WUTS: "Protective Groups in Organic Chemistry", 1999, WILEY
THEODORA W GREENE; PETER G M WUTS: "Protective Groups in Organic Synthesis", 1999, JOHN WILEY & SONS
TOUBOUL, ANTICANCER RES., vol. 22, no. 6A, 2002, pages 3349 - 56
UHLMANN, CURR. OPINION IN DRUG DEVELOPMENT, vol. 3, no. 2, 2000, pages 293 - 213
VERJOUT, MUTAT. RES., vol. 640, 2000, pages 127 - 38
ZHANG ET AL., CIRC RES, vol. 104, no. 4, 2009, pages 230 - 41

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11058767B2 (en) 2018-02-21 2021-07-13 Bristol-Myers Squibb Company CAMK2D antisense oligonucleotides and uses thereof
WO2021158810A1 (en) 2020-02-05 2021-08-12 Bristol-Myers Squibb Company Oligonucleotides for splice modulation of camk2d

Also Published As

Publication number Publication date
IL320427A (en) 2025-06-01
MX2020008581A (es) 2020-09-21
BR112020016347A2 (pt) 2021-01-12
IL276549B1 (en) 2025-05-01
AU2019226001A1 (en) 2020-09-03
EP3755800A1 (en) 2020-12-30
JP7500426B2 (ja) 2024-06-17
IL276549B2 (en) 2025-09-01
US11058767B2 (en) 2021-07-13
US20190275148A1 (en) 2019-09-12
CN112020559A (zh) 2020-12-01
KR20200140805A (ko) 2020-12-16
IL276549A (en) 2020-09-30
JP2021513861A (ja) 2021-06-03
US20190321022A1 (en) 2019-10-24
SG11202007652UA (en) 2020-09-29
US11083444B2 (en) 2021-08-10
AU2019226001B2 (en) 2025-07-10
CA3091789A1 (en) 2019-08-29

Similar Documents

Publication Publication Date Title
US11058767B2 (en) CAMK2D antisense oligonucleotides and uses thereof
JP2024056820A (ja) Scn9a発現を調節するためのオリゴヌクレオチド
EP4083208A1 (en) Antisense nucleic acid that induces skipping of exon 50
CN114901821A (zh) Sept9抑制剂用于治疗乙型肝炎病毒感染的用途
EP4112083A1 (en) Antisense nucleic acid inducing skipping of exon 51
CN114829599A (zh) Scamp3抑制剂用于治疗乙型肝炎病毒感染的用途
JP2026002846A (ja) Angptl2アンチセンスオリゴヌクレオチドおよびその使用
JP7653997B2 (ja) B型肝炎ウイルス感染を処置するためのcops3阻害剤の使用
US20210378652A1 (en) Camk2d antisense oligonucleotides and uses thereof
JP2023527684A (ja) 神経疾患を治療するための補体成分c1s阻害剤、並びにそれを使用する関連組成物、システム及び方法
EP4150084A1 (en) Complement component 4 inhibitors for treating neurological diseases, and related compositons, systems and methods of using same
EA046329B1 (ru) Антисмысловые олигонуклеотиды camk2d и их применение
WO2021158810A1 (en) Oligonucleotides for splice modulation of camk2d
JP2024524874A (ja) オリゴヌクレオチドプログラニュリンアゴニスト
JP2023527693A (ja) 神経疾患を治療するための補体成分c1r阻害剤、並びに関連する組成物、システム、及びそれを使用する方法
HK40082253A (en) Antisense nucleic acid inducing skipping of exon 51
HK40078459A (en) Use of scamp3 inhibitors for treating hepatitis b virus infection
EA050113B1 (ru) Антисмысловые олигонуклеотиды angptl2 и их применения
HK40084486A (en) Complement component c1s inhibitors for treating a neurological disease, and related compositions, systems and methods of using same
HK40071185A (en) Use of sept9 inhibitors for treating hepatitis b virus infection
HK40085370A (en) Complement component 4 inhibitors for treating neurological diseases, and related compositons, systems and methods of using same
HK40081034A (en) Antisense nucleic acid that induces skipping of exon 50
WO2020007826A1 (en) Antisense oligonucleotides targeting mbtps1

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19710527

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3091789

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2020544270

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019226001

Country of ref document: AU

Date of ref document: 20190221

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019710527

Country of ref document: EP

Effective date: 20200921

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112020016347

Country of ref document: BR

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112020016347

Country of ref document: BR

Free format text: REAPRESENTE O BLOCO DOS DESENHOS COM A NUMERACAO CORRIGIDA.

ENP Entry into the national phase

Ref document number: 112020016347

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20200811

WWD Wipo information: divisional of initial pct application

Ref document number: 320427

Country of ref document: IL

WWR Wipo information: refused in national office

Ref document number: 1020207026765

Country of ref document: KR

WWW Wipo information: withdrawn in national office

Ref document number: 320427

Country of ref document: IL