WO2019138030A1 - Gentherapeutische behandlung von schwerhörigkeit - Google Patents

Gentherapeutische behandlung von schwerhörigkeit Download PDF

Info

Publication number
WO2019138030A1
WO2019138030A1 PCT/EP2019/050618 EP2019050618W WO2019138030A1 WO 2019138030 A1 WO2019138030 A1 WO 2019138030A1 EP 2019050618 W EP2019050618 W EP 2019050618W WO 2019138030 A1 WO2019138030 A1 WO 2019138030A1
Authority
WO
WIPO (PCT)
Prior art keywords
promoter
aav
vector
viral vector
use according
Prior art date
Application number
PCT/EP2019/050618
Other languages
English (en)
French (fr)
Inventor
Tobias Moser
Maria Magdalena PILCHER
Tina PANGRSIC VILFAN
Vladan RANKOVIC
Original Assignee
Georg-August-Universität Göttingen Stiftung Öffentlichen Rechts, Universitätsmedizin
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Georg-August-Universität Göttingen Stiftung Öffentlichen Rechts, Universitätsmedizin filed Critical Georg-August-Universität Göttingen Stiftung Öffentlichen Rechts, Universitätsmedizin
Publication of WO2019138030A1 publication Critical patent/WO2019138030A1/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4728—Calcium binding proteins, e.g. calmodulin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A61K38/1738—Calcium binding proteins, e.g. calmodulin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0075—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0306—Animal model for genetic diseases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0046—Ear
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present invention relates to a viral vector, in particular an adeno-associated virus (AAV) vector, and its use in the gene therapy of deafness, especially DFNB93 deafness.
  • AAV adeno-associated virus
  • Deafness is a limitation of hearing, to deafness / deafness.
  • deafness may be mild (softest audible tones between 25-40 dB, WHO 1), medium (gradual) (softest audible tones between 41-60 dB, WHO 2), strong / high (lowest audible tones between 61 -80 dB, WHO 3) and very close to deafness (quietest audible tones above 81 dB, WHO 4).
  • the causes are manifold and include e.g. Excessive noise exposure (the most common cause), age, various diseases and genetic causes.
  • hereditary deafness is approximately 1 to 650-1000, with more than 100 different genes currently known to have defects / mutations associated with deafness.
  • WHO classification the WHO classification
  • DFNB93 is a human autosomal recessive deafness caused by a defect in the gene / protein CaBP2 (Calcium Binding Protein 2, calcium binding protein 2). Patients suffer from moderate to severe prelingual deafness, which is most pronounced in the mid-frequency range (Picher et al., Proc Natl Acad, USA 2017, 114 (9): E1717-E1726; Schrauwen et al., Am Hum Genet., 2012: 91-636-645). As with other hereditary hearing impairments, no pharmaceuticals can be used to restore hearing, and no causal treatments are available. The patients must therefore resort to a hearing aid or a cochlear implant.
  • Gene therapy ie the introduction of intact copies of defective genes into the affected toe populations in the ear, could represent a major advance towards restoring hearing in felling monogenic (but also acquired) hearing loss - for example, animal studies show a partial improvement in gene therapy hearing in mutant Mice (see Akil et al., Neuron 2012, 75: 283-293; Askew et al., Transl. Med. 2015, 7: 295ral08; Jung et al., EMBO J. 2015, 34: 2686-2702).
  • the inventors of the present invention have developed a knockout mouse model for DFNB93 and identified a mechanism underlying the affected hearing loss (Picher et al., Proc. Natl. Acad. See, USA 2017, 114 (9): E1717-E1726 ). By examining the phenotype of the mouse model, they classified DFNB93 as a form of auditory synaptopathy, i. the impairment of hearing is due to a defect in the synaptic function of the inner hair cells of the cochlea. The inventors proposed a mechanism whereby the lack of CaBP2 causes steady-state inactivation of the voltage-gated calcium channels, which reduces the amount of calcium entering the cell after stimulation.
  • the present invention provides a viral vector comprising a nucleic acid comprising a promoter and a coding sequence operatively linked thereto which encodes calcium binding protein 2 (CaBP2) or a functional fragment or variant thereof.
  • CaBP2 calcium binding protein 2
  • the viral vector is selected from the group consisting of adeno-associated virus vector (AAV vector), adenovirus vector and lentivirus vector.
  • AAV vector adeno-associated virus vector
  • adenovirus vector adenovirus vector
  • lentivirus vector adeno-associated virus vector
  • the nucleic acid is DNA or RNA, preferably DNA.
  • the viral vector is an AAV vector.
  • the AAV vector is a serotype AAV vector selected from the group consisting of AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV -8, AAV-9, AAV-10, AAV-1 and combinations thereof.
  • the AAV vector is a serotype AAV vector selected from the group consisting of AAV-6, AAV-8, AAV-9, and AAV-2/1.
  • the AAV vector is an AAV-2/1 vector.
  • the promoter is selected from the group consisting of cytomegalovirus (CMV) promoter, human ⁇ -actin / CMV hybrid promoter, chicken ⁇ -actin / CMV hybrid promoter, Math 1 promoter, VGLUT3 promoter, parvalbumin promoter, Calretinin promoter, calbindin 28k promoter, prestin promoter, otoferlin promoter and myosin V, VI or VIIa promoter.
  • CMV cytomegalovirus
  • the promoter is a human ⁇ -actin / CMV hybrid promoter.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a viral vector of the present invention and a pharmaceutically acceptable carrier or excipient.
  • the present invention provides a viral vector of the present invention or a pharmaceutical composition of the present invention for use as a medicament.
  • the present invention provides a viral vector of the present invention or a pharmaceutical composition of the present invention for use in a method of treating deafness.
  • deafness is DFNB93 deafness.
  • the method comprises the administration of the viral vector into the inner ear, in particular into the cochlea, in particular into inner hair cells of the cochlea.
  • administration comprises injection through the round window, injection into the scalp vestibuli via stapedotomy, injection into the scalp tympani via cochleostomy, and / or application as a depot into the round window niche, eg, as part of a gel or via an application catheter.
  • administration results in expression of calcium-binding protein 2 (CaBP2) or the functional fragment or variant thereof in inner hair cells of the cochlea.
  • CaBP2 calcium-binding protein 2
  • the present invention provides the use of a viral vector of the present invention in the manufacture of a medicament for the treatment of deafness.
  • deafness is DFNB93 deafness.
  • the present invention provides a method of treating deafness comprising administering the viral vector of the present invention into the inner ear, particularly the cochlea, especially into the inner hair cells of the cochlea.
  • deafness is DFNB93 deafness.
  • administration comprises injection through the round window, injection into the scalp vestibule via stapedotomy, injection into the scalp tympani via cochleostomy and / or administration as a depot into the round window niche, e.g. as part of a gel or via an application catheter.
  • the administration results in expression of CaBP2 or the functional fragment or variant thereof in inner hair cells of the cochlea.
  • Figure 1 shows the vector map of the viral construct AAV2 / l-CaBP2-P2A-EGFP.
  • Figure 2 shows the improvement in hearing of CaBP2 knockout mice (CaBP2 LacZ / LacZ ) after postnatal injection of the viral construct AAV2 / l-CaBP2-P2A-EGFP.
  • the present invention provides a viral vector comprising a nucleic acid comprising a promoter and a coding sequence operatively linked thereto which encodes calcium binding protein 2 (CaBP2) or a functional fragment or variant thereof.
  • CaBP2 calcium binding protein 2
  • the nucleic acid is DNA or RNA, preferably DNA.
  • the nucleic acid may also be referred to herein as a genetic construct.
  • viral vector refers to a virus particle used to target genetic material (e.g., a coding sequence encoding calcium-binding protein 2 (CaBP2) or a functional fragment or variant thereof) into target cells.
  • target genetic material e.g., a coding sequence encoding calcium-binding protein 2 (CaBP2) or a functional fragment or variant thereof.
  • CaBP2 calcium-binding protein 2
  • the viral vector is selected from the group consisting of adeno-associated virus vector (AAV vector), adenovirus vector and fentivirus vector, and preferably an AAV vector or an adenovirus vector (eg Ad5, Ad26 or Hd-Ad).
  • AAV vector adeno-associated virus vector
  • Ad26 Ad26
  • Hd-Ad adenovirus vector
  • the viral vector is an AAV vector.
  • AAV vector includes AAV vectors of all serotypes, as well as AAV vectors based on the combination of different serotypes (also referred to as “hybrid AAV vectors"). Also included are other synthetic AAV vectors such as AAV-PHP.B, AAV-PHP.B2, AAV-PHP.B3, AAV-PHP.A, AAV-PHP.eB and AAV-PHP.S (Deverman et Nature Biotechnol 2016, 34: 204-209; Chan et al., Nature Neuroscience 2017, 20: 1172-1179) or AAV-Anc80 (WO 2017/100791 Al). Suitable AAV vectors are also commercially available, e.g. Penn Vector Core (PA, USA) and SignaGen Faboratories (MD, USA).
  • PA Penn Vector Core
  • MD SignaGen Faboratories
  • the AAV vector is a serotype AAV vector selected from the group consisting of AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV -8, AAV-9, AAV-10, AAV-1 and combinations thereof.
  • the AAV vector is a serotype AAV vector selected from the group consisting of AAV-6, AAV-8, AAV-9, and AAV-2/1.
  • the AAV vector is an AAV -2/1 vector.
  • AAV-2/1 vector refers to an AAV vector containing the serotype 2 genome packaged in the serotype 1 capsid.
  • the promoter is a constitutive promoter.
  • constitutive promoter refers to an unregulated promoter that permits continuous expression of its associated gene.
  • the promoter is selected from the group consisting of cytomegalovirus (CMV) promoter, human ⁇ -actin / CMV hybrid promoter, chicken ⁇ -actin / CMV hybrid promoter, Math 1 promoter, VGLUT3 promoter, parvalbumin promoter, Calretinin promoter, calbindin 28k promoter, prestin promoter, otoferlin promoter and myosin V, VI or VIIa promoter.
  • the said hybrid promoters contain the sequence of the human or chicken ⁇ -actin promoter and the enhancer-promoter sequences of CMV (see SEQ ID NO: 9 as an example of the human ⁇ -actin / CMV hybrid promoter).
  • the promoter is a human ⁇ -actin / CMV hybrid promoter.
  • calcium-binding protein 2 is wild-type CaBP2.
  • wild-type CaBP2 has four so-called EF-hand amino acid motifs, ie, helix-loop-helix motifs with charged amino acids, three of which each bind Ca 2+ ions.
  • CaBP2 is human CaBP2 (see eg UniProt Database ID: Q9NPB3, especially Q9NPB3-1).
  • CaBP2 has the amino acid sequence of SEQ ID NO: 1.
  • the term "functional fragment” refers to a fragment of CaBP2 that has the same or substantially the same (eg +/- 20% or +/- 10%) functional activity as CaBP2.
  • the functional fragment is an N-terminal and / or C-terminal truncated form of CaBP2.
  • the functional fragment comprises at least 50, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 contiguous amino acid residues of CaBP2.
  • the functional fragment of CaBP2 is preferably a fragment having an amino acid sequence long enough to identify the fragment as a fragment of CaBP2 and to exclude that it is the fragment of a protein other than CaBP2 (eg another CaBP family member, such as CaBPl and CaBP4, or calmodulin).
  • the variant is a functional variant of CaBP2, eg, a variant of CaBP2 which has the same or substantially the same (eg +/- 20% or +/- 10%) functional activity as CaBP2.
  • the variant comprises one or more amino acid insertions, amino acid additions, amino acid deletions and / or amino acid substitutions. In one embodiment, the variant comprises the insertion, addition, deletion and / or substitution of up to 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5 , 4, 3 or 2 amino acids. In one embodiment, the variant comprises an exchange of one or more EF hand amino acid motifs (eg EF hand 3 and / or EF hand 4) by EF hand amino acid motifs from related proteins (eg corresponding EF hand amino acid motifs from another CaBP family member, such as CaBPl and CaBP4, or calmodulin).
  • EF hand amino acid motifs eg EF hand 3 and / or EF hand 4
  • related proteins eg corresponding EF hand amino acid motifs from another CaBP family member, such as CaBPl and CaBP4, or calmodulin.
  • the positions of the EF hand amino acid motifs are as follows: EF hand 1 - amino acid residues 78-113; EF hand 2 - amino acid residues 111-146; EF hand 3 - amino acid residues 152-187; EF hand 4 - amino acid residues 189-220.
  • variants may also refer to naturally occurring mutants, variants and homologs (e.g., orthologues) of CaBP2.
  • the naturally occurring mutant / variant is human CaBP2 having the amino acid substitution R94Q (SEQ ID NO: 3).
  • the naturally occurring homologue is mouse CaBP2 (SEQ ID NO: 5).
  • the variant comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical is with the amino acid sequence of SEQ ID NO: 1, or consists of this amino acid sequence.
  • the above-mentioned functional activity is Ca 2+ binding activity. This activity can be measured by standard methods familiar to a person skilled in the art.
  • the above-mentioned functional activity is inhibition of inactivation of Ca v channels, eg Ca v 1.3 channels in HEK293 cells or inner hair cells of the cochlea. This activity can be achieved, for example, by a method as described in Picher et al. (Picher et al., Proc. Natl. Acad. Sci. USA 2017, 114 (9): E1717-E1726). In one embodiment, these are both of the named activities.
  • the coding sequence comprises a nucleotide sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%, at least 96%, at least 97%, at least 98% or at least 99%. is identical to the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 6, or consists of this nucleotide sequence. In one embodiment, the coding sequence comprises the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 6, or consists of this nucleotide sequence.
  • the similarity of two nucleotide or amino acid sequences can be determined by sequence alignments.
  • sequence alignments may be performed by various algorithms known to those skilled in the art, preferably using the mathematical algorithms of Karlin and Altschul (Karlin & Altschul Proc Natl Acad., U.S.A. 1993, 90: 5873-5877), e.g. with hmmalign (HMMER Package, http://hmmer.wustl.edu/), or with the CLUSTAL algorithm (Thompson JD et al., Nucleic Acids Res.
  • the viral vector of the invention contained nucleic acid further sequence elements.
  • sequence elements include, for example, inverted terminal repeats (ITRs, eg, AAV-2 ITRs), Kozak sequences, resistance genes (eg, Ampr), polyadenylation sequences (eg, the polyadenylation sequence of bovine growth hormone, bGH), and regulatory elements, such as the marmot's post-transcriptional regulatory element Hepatitis virus (WPRE).
  • the nucleic acid may contain further coding sequences.
  • additional coding sequences may, for example, encode additional therapeutically active proteins or marker proteins (e.g., fluorescent proteins such as EGFP).
  • the CaBP2 coding sequence and the further coding sequence are linked via an internal ribosomal entry site (IRES) or a sequence encoding a 2A peptide (e.g., P2A).
  • the present invention provides a nucleic acid (or a genetic construct) as described herein.
  • the present invention provides a host cell comprising a viral vector of the present invention or a nucleic acid (or a genetic construct) of the present invention.
  • This host cell may be prokaryotic in nature (eg a bacterial cell) or eukaryotic in nature (eg a fungal cell, plant cell or animal cell).
  • the host cell is isolated.
  • the host cell is a producer cell or producer cell line enabling production of the viral vector of the invention (eg, AAV vector), eg, based on the nucleic acid (or genetic construct) of the present invention and co-transfection of suitable helper constructs, eg, helper plasmids (see eg US 2004/0235174 Al).
  • suitable producer cells or producer cell lines are known in the art and include, for example, HEK293 cells.
  • the present invention provides a non-human transgenic animal comprising a viral vector of the present invention or a nucleic acid (or a genetic construct) of the present invention.
  • non-human transgenic animal refers in particular to non-human primates or other animals, in particular a mammal such as cow, horse, pig, sheep, goat, dog, cat, bird such as chicken or rodent such as mouse, rat, guinea pig , Hamster and Mongolian gerbil.
  • a method for producing e.g. of an AAV vector is the triple transfection of a suitable producer cell line, e.g. HEK293, and subsequent purification via iodixanol or cesium chloride gradient.
  • the producer cells are transfected with three vectors: on a first vector / plasmid the gene of interest is encoded (here CaBP2), flanked by corresponding packaging signals (see Figure 1); on a second vector / plasmid the required AAV proteins, in particular rap and cap, are encoded; and a third vector / plasmid provides adenoviral helper functions without which AAV particle production is not possible.
  • Suitable methods are also described in Grieger et al. (Nature Protocols 2006, 1 (3): 1412-1428).
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a viral vector of the present invention and a pharmaceutically acceptable carrier or excipient.
  • the pharmaceutical composition of the invention is preferably sterile and contains a therapeutically effective amount of the viral vector.
  • a “therapeutically effective amount” refers to the amount which, alone or in conjunction with other doses, achieves a desired response or effect, e.g. an improvement or partial or complete recovery of the hearing.
  • a therapeutically effective amount will depend on the condition being treated, the severity of the disease, the individual parameters of the patient, including age, physiological condition, height and weight, duration of treatment, type of concomitant therapy (if any), the specific route of administration and similar factors.
  • about 10 8 to about 10 13 viral particles are administered suspended in a suitable volume of a carrier.
  • Possible carriers eg solvents
  • Possible carriers are, for example, artificial perilymph, sterile water, Ringer's solution, lactated Ringer's solution, physiological saline, bacteriostatic saline (eg 0.9% benzyl alcohol-containing saline), phosphate-buffered saline (PBS), Hanks's solution, fixed oils , Polyalkylene glycols, hydrogenated naphthalene and biocompatible polylactides, lactide / glycolide copolymers or polyoxyethylene / polyoxypropylene copolymers.
  • the resulting solutions or suspensions are preferably isotonic.
  • Suitable carriers and their formulation are also described in detail in Remington's Pharmaceutical Sciences, 17th edition, 1985, Mack Publishing Co.
  • the carrier is fabric artificial perilymph.
  • adjuvant includes all substances that may be included in a pharmaceutical composition and are not themselves active ingredients, such as salts, excipients (eg, lactose, dextrose, sucrose, trehalose, sorbitol, mannitol), Lubricants, thickeners, surface-active agents, preservatives, emulsifiers, buffer substances, stabilizers, flavorings or colorants.
  • pharmaceutically acceptable refers to a non-toxic material which preferably does not interfere with the action of the active ingredient of the pharmaceutical composition.
  • pharmaceutically acceptable means that the subject substance has been approved by a governmental regulatory agency for use in animals, and particularly humans, or in U.S. Pat. Pharmacopoeia, European Pharmacopoeia or other recognized pharmacopoeias for use in animals and in particular humans.
  • the present invention provides a viral vector of the present invention or a pharmaceutical composition of the present invention for use as a medicament.
  • drug refers to a substance or composition that is used therapeutically, that is, in the treatment, amelioration or prevention of a disease or disorder.
  • the present invention provides a viral vector of the present invention or a pharmaceutical composition of the present invention for use in a method of treating deafness.
  • the treated patient or the treated individual is a human, non-human primate or other animal, in particular a mammal such as cow, horse, pig, sheep, Goat, dog, cat, bird like chicken or rodent like mouse, rat, guinea pig, hamster and mongolian gerbil.
  • the treated patient or subject is a human.
  • the deafness is DFNB93 - hearing loss.
  • the method comprises the administration of the viral vector into the inner ear, in particular into the cochlea, in particular into inner hair cells of the cochlea.
  • administration comprises injection through the round window, injection into the scalp vestibule via stapedotomy, injection into the scalp tympani via cochleostomy and / or administration as a depot into the round window niche, e.g. as part of a gel or via an application catheter.
  • the administration comprises intratympanic injection.
  • administration results in expression of calcium-binding protein 2 (CaBP2) or the functional fragment or variant thereof in inner hair cells of the cochlea, e.g. in inner hair cells of the apical turn of the cochlea.
  • CaBP2 calcium-binding protein 2
  • RNA or of RNA and protein are used according to the invention in its most general meaning and includes e.g. the production of RNA or of RNA and protein.
  • the viral vector of the present invention, the pharmaceutical composition of the invention, and the methods and uses of the present invention allow expression of CaBP2 or the functional fragment or variant thereof in at least 50%, at least 60%, at least 70%, at least 80%. , in at least 90% or in at least 95% of the inner hair cells of the cochlea, preferably the inner hair cells of the apical turn of the cochlea.
  • the viral vector of the invention and the pharmaceutical composition of the invention are administered in therapeutically effective amounts.
  • the present invention provides the use of a viral vector of the present invention in the manufacture of a medicament for the treatment of deafness.
  • deafness is DFNB93 deafness.
  • the present invention provides a method of treating deafness comprising administering the viral vector of the present invention into the inner ear, particularly the cochlea, especially into the inner hair cells of the cochlea.
  • deafness is DFNB93 deafness.
  • administration comprises injection through the round window, injection into the scalp vestibule via stapedotomy, injection into the scalp tympani via cochleostomy and / or administration as a depot into the round window niche, e.g. as part of a gel or via an application catheter.
  • the administration comprises intratympanic injection.
  • administration results in expression of calcium-binding protein 2 (CaBP2) or the functional fragment or variant thereof in inner hair cells of the cochlea, e.g. in inner hair cells of the apical turn of the cochlea.
  • CaBP2 calcium-binding protein 2
  • a viral vector containing CaBP2-encoding DNA was developed for postnatal (AAV-mediated) inner hair cell (IHC) transduction.
  • the CaBP2 is mouse CaBP2 (Mus musculus).
  • the construct used in the animal experiments also contained an EGFP (Enhanced Green Fluorescent Protein) coding sequence linked to the CaBP2 coding sequence via a 2A peptide (P2A).
  • EGFP Enhanced Green Fluorescent Protein
  • CM V cytomegalovirus
  • hBA human ⁇ -actin / CMV Hybrid promoter
  • CMV promoter or chick ⁇ -actin / CMV hybrid promoter
  • AAV was purchased by Penn Vector Core, Philadelphia.
  • the vector map of the viral construct AAV2 / 1-CaBP2-P2A-EGFP is shown in Figure 1, its DNA sequence (SEQ ID NO: 10) is shown below - with individual elements labeled as follows:
  • Example 2 In vivo. of the viral construct AAV2 / 1-CaBP2-P2A-EGFP
  • AAV2 / l-CaBP2-P2A-EGFP (0.5-1m ⁇ with l.97xl0 13 GC / ml) was added to the scaffold (scala tympani) of the right ear of 5-7 day old CaBP2 knockout mice (CaBP2 LacZ / LacZ ). or control mice injected over the round window, essentially as in the study by Akil et al. (Akil et al Neuron 2012, 75: 283-293).
  • ABR Brain stem audiometry
  • the viral CaBP2-encoding DNA-containing vector of the present invention allows efficient, postnatal transduction of inner hair cells and significant enhancement of hearing in knockout mouse models.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Plant Pathology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Immunology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

Die vorliegende Erfindung betrifft einen viralen Vektor, insbesondere einen Adeno-assoziierten Virus (AAV)-Vektor, und dessen Verwendung bei der gentherapeutischen Behandlung von Schwerhörigkeit, insbesondere von DFNB93-Schwerhörigkeit.

Description

Gentherapeutische Behandlung von Schwerhörigkeit
Technisches Gebiet der Erfindung
Die vorliegende Erfindung betrifft einen viralen Vektor, insbesondere einen Adeno-assoziierten Virus (AAV)-Vektor, und dessen Verwendung bei der gentherapeutischen Behandlung von Schwerhörigkeit, insbesondere von DFNB93-Schwerhörigkeit.
Technischer Hintergrund der Erfindung
Das Hören ist ein komplexer Prozess, durch den akustische Signale über die Ohren und im Gehirn wahrgenommen und verarbeitet werden. Schwerhörigkeit ist eine Einschränkung des Hörvermögens, bis hin zur Gehörlosigkeit/Taubheit. Nach der Klassifikation der WHO kann die Schwerhörigkeit leicht (leiseste wahrnehmbare Töne zwischen 25-40 dB; WHO 1), mittel(gradig) (leiseste wahrnehmbare Töne zwischen 41-60 dB; WHO 2), stark/hochgradig (leiseste wahrnehmbare Töne zwischen 61-80 dB; WHO 3) und sehr stark bzw. an Taubheit grenzend (leiseste wahrnehmbare Töne über 81 dB; WHO 4) sein. Die Ursachen sind vielfältig und umfassen z.B. übermäßige Lärmbelastung (die häufigste Ursache), Alter, diverse Erkrankungen sowie genetische Ursachen. Die Inzidenz erblich bedingter Schwerhörigkeit hegt bei ca. 1 zu 650-1000, wobei derzeit über 100 verschiedene Gene bekannt sind, bei denen Defekte/Mutationen mit Schwerhörigkeit verbunden sind. Weltweit sind etwa 360 Millionen Menschen, in Deutschland etwa 16% der Bevölkerung über 18 Jahre nach der Klassifikation der WHO schwerhörig. Im Alter über 65 handelt es sich dabei um jeden zweiten Mann und jede dritte Frau.
Die DFNB93 -Schwerhörigkeit ist eine humane autosomal -rezessive Schwerhörigkeit, welche durch einen Defekt im Gen/Protein CaBP2 (Calcium-Binding Protein 2, Kalzium-bindendes Protein 2) verursacht wird. Die Patienten leiden an mittlerer bis starker prälingualer Schwerhörigkeit, welche am stärksten im mittleren Frequenzbereich ausgeprägt ist (Picher et al. Proc. Natl. Acad. Sei. U.S.A. 2017, 114(9):E1717- E1726; Schrauwen et al. Am. J. Hum. Genet. 2012, 91:636-645). Wie bei anderen, erblich bedingten Beeinträchtigungen des Hörvermögens können keine Pharmazeutika verwendet werden, um das Hörvermögen wiederherzustehen, und es sind keine ursachenbekämpfenden Behandlungsverfahren verfügbar. Die Patienten müssen somit auf ein Hörgerät oder ein Cochleaimplantat zurückgreifen. Gentherapie, d.h. die Einführung intakter Kopien defekter Gene in die betroffenen Zehpopulationen im Ohr, könnte einen großen Fortschritt hin zur Wiederherstellung des Hörvermögens in Fähen monogenen (aber auch erworbenen) Gehörverlusts darstehen - so zeigen zum Beispiel Tierstudien eine partielle Verbesserung des Hörvermögens bei Gentherapie in mutierten Mäusen (siehe Akil et al. Neuron 2012, 75:283-293; Askew et al. Sei. Transl. Med. 2015, 7:295ral08; Jung et al. EMBO J. 2015, 34:2686-2702). Klinische Studien, die darauf abzielen, visuelle, auditive oder vestibuläre Funktion im Falle von isolierten genetischen Defekten oder von nicht -genetischen Krankheiten wiederherzustellen, sind im Gange - zum Beispiel eine Phase l/2-Studie mit CGF166, einem rekombinanten Adenovirus 5 (Ad5) Vektor, der eine DNA enthält, welche den humanen Transkriptionsfaktor Atonal (Hathl) kodiert, zur Behandlung von schwerem erworbenem Gehörverlust; eine Phase 3-Studie mit GS0101 zur Behandlung der Leberschen hereditären Optikusneuopathie; und eine Phase l-Studie mit rAAV2-hRPE65 zur Behandlung von Leberscher kongenitaler Amaurose (siehe ClinicalTrials.com). Jede monogene Gehörerkrankung erfordert die Entwicklung eines individuellen gentherapeutischen (viralen) Konstrukts, welches das fragliche reparierte Gen in die betroffenen Zellen einführt, und solche Konstrukte sind noch nicht allgemein verfügbar.
Die Erfinder der vorliegenden Erfindung haben ein Knockout-Maus-Modell für DFNB93 entwickelt und einen Mechanismus identifiziert, der dem betreffenden Gehörverlust zugrunde liegt (Picher et al. Proc. Natl. Acad. Sei. U.S.A. 2017, 114(9):E1717-E1726). Durch Untersuchung des Phänotyps des Mausmodells klassifizierten sie DFNB93 als eine Form von auditiver Synaptopathie, d.h. die Beeinträchtigung des Hörvermögens beruht auf einem Defekt der synaptischen Funktion der inneren Haarzellen der Gehörschnecke. Die Erfinder schlugen einen Mechanismus vor, demzufolge der Mangel an CaBP2 eine Steady-State-Inaktivierung der spannungsgesteuerten Kalziumkanäle verursacht, was die Menge an Kalzium, das in die Zelle nach Stimulierung eintritt, verringert. Kalzium wird benötigt, um die Exozytose synaptischer Vesikel an der ersten Synapse im auditiven Signalweg hervorzurufen. Der Mangel an (funktionellem) CaBP2 führt somit zu einem Defekt in der Schallkodierung (Picher et al. Proc. Natl. Acad. Sei. U.S.A. 2017, 114(9):E1717-E1726).
Es war ein Ziel der vorliegenden Erfindung, einen gentherapeutischen viralen Vektor und ein entsprechendes gentherapeutisches Verfahren zur Behandlung von DFNB93-Schwerhörigkeit zur Verfügung zu stellen.
Kurze Beschreibung der Erfindung
Die vorliegende Erfindung stellt einen viralen Vektor zur Verfügung, der eine Nukleinsäure umfasst, die einen Promotor und eine damit operativ verbundene kodierende Sequenz umfasst, die für Kalzium bindendes Protein 2 (CaBP2) oder ein funktionelles Fragment oder eine Variante davon kodiert.
In einer Ausführungsform ist der virale Vektor ausgewählt aus der Gruppe bestehend aus Adeno- assoziierter Virus Vektor (AAV -Vektor), Adenovirus Vektor und Lentivirus Vektor.
In einer Ausführungsform ist die Nukleinsäure DNA oder RNA, vorzugsweise DNA.
In einer Ausführungsform ist der virale Vektor ein AAV-Vektor. In einer Ausführungsform ist der AAV -Vektor ein AAV-Vektor mit einem Serotyp ausgewählt aus der Gruppe bestehend aus AAV-l, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV- 10, AAV-l 1 und Kombinationen davon.
In einer Ausführungsform ist der AAV-Vektor ein AAV-Vektor mit einem Serotyp ausgewählt aus der Gruppe bestehend aus AAV-6, AAV-8, AAV-9 und AAV-2/1.
In einer Ausführungsform ist der AAV-Vektor ein AAV-2/ 1 Vektor.
In einer Ausführungsform ist der Promotor ausgewählt aus der Gruppe bestehend aus Cytomegalovirus (CMV) -Promotor, humaner ß-Actin/CMV -Hybridpromotor, Hühner ß-Actin/CMV-Hybridpromotor, Math 1 -Promotor, VGLUT3-Promotor, Parvalbumin-Promotor, Calretinin-Promotor, Calbindin28k- Promotor, Prestin -Promotor, Otoferlin -Promotor und Myosin V-, VI- oder Vlla-Promotor.
In einer Ausführungsform ist der Promotor ein humaner ß-Actin/CMV-Hybridpromotor.
In einem weiteren Aspekt stellt die vorliegende Erfindung eine pharmazeutische Zusammensetzung zur Verfügung, die einen viralen Vektor der vorliegenden Erfindung und einen pharmazeutisch verträglichen Träger- oder Hilfsstoff umfasst.
In einem weiteren Aspekt stellt die vorliegende Erfindung einen viralen Vektor der vorliegenden Erfindung oder eine pharmazeutische Zusammensetzung der vorliegenden Erfindung zur Verwendung als Medikament zur Verfügung.
In einem weiteren Aspekt stellt die vorliegende Erfindung einen viralen Vektor der vorliegenden Erfindung oder eine pharmazeutische Zusammensetzung der vorliegenden Erfindung zur Verwendung in einem Verfahren zur Behandlung von Schwerhörigkeit zur Verfügung.
In einer Ausführungsform ist die Schwerhörigkeit DFNB93-Schwerhörigkeit.
In einer Ausführungsform umfasst das Verfahren die Verabreichung des viralen Vektors in das Innenohr, insbesondere in die Gehörschnecke, insbesondere in innere Haarzellen der Gehörschnecke.
In einer Ausführungsform umfasst die Verabreichung die Injektion durch das runde Fenster, die Injektion in die Scala vestibuli über eine Stapedotomie, die Injektion in die Scala tympani über eine Cochleostomie und/oder die Applikation als Depot in die Rundfenster-Nische, z.B. als Bestandteil eines Gels oder über einen Applikations-Katheter. In einer Ausführungsform führt die Verabreichung zu einer Expression von Kalzium-bindendem Protein 2 (CaBP2) oder des funktionellen Fragmentes oder der Variante davon in inneren Haarzellen der Gehörschnecke.
In einem weiteren Aspekt stellt die vorliegende Erfindung die Verwendung eines viralen Vektors der vorliegenden Erfindung bei der Herstellung eines Medikaments zur Behandlung von Schwerhörigkeit zur Verfügung.
In einer Ausführungsform ist die Schwerhörigkeit DFNB93-Schwerhörigkeit.
In einem weiteren Aspekt stellt die vorliegende Erfindung ein Verfahren zur Behandlung von Schwerhörigkeit zur Verfügung, welches die Verabreichung des viralen Vektors der vorliegenden Erfindung in das Innenohr, insbesondere in die Gehörschnecke, insbesondere in innere Haarzellen der Gehörschnecke umfasst.
In einer Ausführungsform ist die Schwerhörigkeit DFNB93-Schwerhörigkeit.
In einer Ausführungsform umfasst die Verabreichung die Injektion durch das runde Fenster, die Injektion in die Scala vestibuli über eine Stapedotomie, die Injektion in die Scala tympani über eine Cochleostomie und/oder die Applikation als Depot in die Rundfenster -Nische, z.B. als Bestandteil eines Gels oder über einen Applikations-Katheter.
In einer Ausführungsform führt die Verabreichung zu einer Expression von CaBP2 oder des funktionellen Fragmentes oder der Variante davon in inneren Haarzellen der Gehörschnecke.
Beschreibung der Figuren
Figur 1 zeigt die Vektorkarte des viralen Konstrukts AAV2/l-CaBP2-P2A-EGFP.
Figur 2 zeigt die Verbesserung des Hörvermögens von CaBP2 Knockout-Mäusen ( CaBP2LacZ/LacZ ) nach postnataler Injektion des viralen Konstrukts AAV2/l-CaBP2-P2A-EGFP. A) Apikale Windung eines aus einem injizierten CaBP2LacZ/LacZ- Tier isolierten Corti-Organs, abgebildet mittels eines Epifluoreszenzmikroskops. Es wurden mehrere Bilder aufgenommen, um das gesamte Explantat zu rekonstruieren. Die Reihe der inneren Haarzellen ist aufgrund der Expression von EGFP eindeutig sichtbar, was eine erfolgreiche Transduktion der inneren Haarzellen und Expression von CaBP2 vom viralen Konstrukt nahelegt. B) ABR-Wellenformen bei Klicks bei 80 dB SPL. C) ABR-Schwellenwerte bei Tonstößen oder Klicks in 5-9 Wochen alten Tieren. Nur Daten aus Tieren, die eine Verbesserung des Hörvermögens zeigten (ca. 63% der injizierten Tiere) wurden für den Graph berücksichtigt. Bei jedem Tier wurde nur in ein Ohr (nämlich das rechte Ohr) injiziert. Das Hörvermögen des injizierten Ohrs wurde mit dem Hörvermögen des linken, nicht-injizierten Ohrs verglichen. Sternchen: p< 0.05, ** / <().005, *** / <().0005; gepaarter Student-Test. D) Heterozygote Mäuse, CaBP2+/LacZ, die keine Beeinträchtigung des Hörvermögens zeigten, wurden auf potentielle negative Auswirkungen der Virusinjektion untersucht. Das Hörvermögen in den injizierten Ohren war vergleichbar mit dem der nicht- injizierten Kontrollen.
Detaillierte Beschreibung der Erfindung
Die vorliegende Erfindung stellt einen viralen Vektor zur Verfügung, der eine Nukleinsäure umfasst, die einen Promotor und eine damit operativ verbundene kodierende Sequenz umfasst, die für Kalzium bindendes Protein 2 (CaBP2) oder ein funktionelles Fragment oder eine Variante davon kodiert.
In einer Ausführungsform ist die Nukleinsäure DNA oder RNA, vorzugsweise DNA. Die Nukleinsäure kann hierin auch als genetisches Konstrukt bezeichnet werden.
Der Begriff„viraler Vektor“ bezeichnet ein Viruspartikel, der dazu verwendet wird, genetisches Material (z.B. eine kodierende Sequenz, die für Kalzium-bindendes Protein 2 (CaBP2) oder ein funktionelles Fragment oder eine Variante davon kodiert) in Zielzellen zu schleusen. Der Transport dieses genetischen Materials wird als„Transduktion“ bezeichnet.
In einer Ausführungsform ist der virale Vektor ausgewählt aus der Gruppe bestehend aus Adeno- assoziierter Virus Vektor (AAV -Vektor), Adenovirus Vektor und Fentivirus Vektor, und vorzugsweise ein AAV-Vektor oder ein Adenovirus Vektor (z.B. Ad5, Ad26 oder Hd-Ad).
In einer bevorzugten Ausführungsform ist der virale Vektor ein AAV-Vektor.
Der Begriff„AW-Vektor“ schließt AAV -Vektoren sämtlicher Serotypen ein, sowie AAV -Vektoren, die auf der Kombination verschiedener Serotypen beruhen (auch als„Hybrid- AAV- Vektoren“ bezeichnet). Ebenfalls eingeschlossen sind andere synthetische AAV-Vektoren, wie etwa AAV-PHP.B, AAV- PHP.B2, AAV-PHP.B 3, AAV-PHP.A, AAV-PHP.eB und AAV-PHP.S (Deverman et al. Nature Biotechnol 2016, 34:204-209; Chan et al. Nature Neuroscience 2017, 20:1172-1179) oder AAV-Anc80 (WO 2017/100791 Al). Geeignete AAV-Vektoren sind auch kommerziell erhältlich, z.B. von Penn Vector Core (PA, USA) und SignaGen Faboratories (MD, USA).
In einer Ausführungsform ist der AAV-Vektor ein AAV-Vektor mit einem Serotyp ausgewählt aus der Gruppe bestehend aus AAV-l, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV- 10, AAV-l 1 und Kombinationen davon. In einer Ausführungsform ist der AAV -Vektor ein AAV-Vektor mit einem Serotyp ausgewählt aus der Gruppe bestehend aus AAV-6, AAV- 8, AAV-9 und AAV-2/1.
In einer Ausführungsform ist der AAV-Vektor ein AAV -2/1 -Vektor. Der Begriff„AAV-2/1 -Vektor“ bezeichnet einen AAV-Vektor, der das Genom von Serotyp 2, eingepackt in das Kapsid von Serotyp 1, enthält.
In einer Ausführungsform ist der Promotor ein konstitutiver Promotor. Der Begriff „konstitutiver Promotor“, wie hierin verwendet, bezeichnet einen nicht-regulierten Promotor, der eine kontinuierliche Expression seines assoziierten Gens erlaubt.
In einer Ausführungsform ist der Promotor ausgewählt aus der Gruppe bestehend aus Cytomegalovirus (CMV) -Promotor, humaner ß-Actin/CMV -Hybridpromotor, Hühner ß-Actin/CMV-Hybridpromotor, Math 1 -Promotor, VGLUT3-Promotor, Parvalbumin-Promotor, Calretinin-Promotor, Calbindin28k- Promotor, Prestin-Promotor, Otoferlin-Promotor und Myosin V-, VI- oder Vlla-Promotor. Die genannten Hybridpromotoren enthalten die Sequenz des humanen bzw. Hühner ß-Actin Promotors und die Enhancer-Promotor-Sequenzen von CMV (siehe SEQ ID NO: 9 als Beispiel für den humanen ß- Actin/CMV -Hybridpromotor).
In einer Ausführungsform ist der Promotor ein humaner ß-Actin/CMV-Hybridpromotor.
In einer Ausführungsform handelt es sich bei dem Kalzium-bindenden Protein 2 (CaBP2) um Wildtyp- CaBP2. Wildtyp-CaBP2 weist insbesondere vier sogenannte EF-Hand-Aminosäuremotive auf, d.h. Helix- Loop-Helix -Motive mit geladenen Aminosäuren, von denen drei jeweils Ca2+-Ionen binden. In einer Ausführungsform handelt es sich bei CaBP2 um humanes CaBP2 (siehe z.B. UniProt-Datenbank ID: Q9NPB3, insbesondere Q9NPB3-1). In einer Ausführungsform hat CaBP2 die Aminosäuresequenz von SEQ ID NO: 1.
Der Begriff„funktionelles Fragment“ bezeichnet ein Fragment von CaBP2, welches die gleiche oder eine im Wesentlichen gleiche (z.B. +/- 20% oder +/- 10%) funktionelle Aktivität wie CaBP2 aufweist. In einer Ausführungsform ist das funktionelle Fragment eine N-terminal und/oder C-terminal trunkierte Form von CaBP2. In einer Ausführungsform umfasst das funktionelle Fragment mindestens 50, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 oder 200 zusammenhängende Aminosäurereste von CaBP2. Das funktionelle Fragment von CaBP2 ist vorzugsweise ein Fragment, das eine Aminosäuresequenz aufweist, die lang genug ist, um das Fragment als ein Fragment von CaBP2 zu identifizieren und auszuschließen, dass es sich um das Fragment eines Proteins handelt, welches nicht CaBP2 ist (z.B. ein anderes CaBP- Familienmitglied, wie etwa CaBPl und CaBP4, oder Calmodulin). In einer Ausführungsform handelt es sich bei der Variante um eine funktionelle Variante von CaBP2, z.B. eine Variante von CaBP2, welche die gleiche oder eine im Wesentlichen gleiche (z.B. +/- 20% oder +/- 10%) funktionelle Aktivität wie CaBP2 aufweist.
In einer Ausführungsform umfasst die Variante eine oder mehrere Aminosäure-Insertionen, Ami nosäure - Additionen, Aminosäure-Deletionen und/oder Aminosäure-Substitutionen. In einer Ausführungsform umfasst die Variante die Insertion, Addition, Deletion und/oder Substitution von bis zu 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3 oder 2 Aminosäuren. In einer Ausführungsform umfasst die Variante einen Austausch eines oder mehrerer EF-Hand-Aminosäuremotive (z.B. EF-Hand 3 und/oder EF-Hand 4) durch EF-Hand-Aminosäuremotive aus verwandten Proteinen (z.B. entsprechende EF-Hand- Aminosäuremotive aus einem anderen CaBP-Familienmitglied, wie etwa CaBPl und CaBP4, oder Calmodulin). Für humanes CaBP2 mit der Aminosäuresequenz von SEQ ID NO: 1 oder SEQ ID NO: 3 sind die Positionen der EF-Hand-Aminosäuremotive wie folgt: EF-Hand 1 - Aminosäurereste 78-113; EF-Hand 2 - Aminosäurereste 111-146; EF-Hand 3 - Aminosäurereste 152-187; EF-Hand 4 - Aminosäurereste 189-220.
Der Begriff„Variante“, wie hierin verwendet, kann sich auch auf natürlich vorkommende Mutanten, Varianten und Homologe (z.B. Orthologe) von CaBP2 beziehen. In einer Ausführungsform ist die natürlich vorkommende Mutante/Variante humanes CaBP2 mit der Aminosäuresubstitution R94Q (SEQ ID NO: 3). In einer Ausführungsform ist das natürlich vorkommende Homolog Mäuse-CaBP2 (SEQ ID NO: 5).
In einer Ausführungsform umfasst die Variante eine Aminosäuresequenz, die mindestens 70%, mindestens 75%, mindestens 80%, mindestens 85%, mindestens 90%, mindestens 95%, mindestens 96%, mindestens 97%, mindestens 98% oder mindestens 99% identisch ist mit der Aminosäuresequenz von SEQ ID NO: 1, oder besteht aus dieser Aminosäuresequenz.
In einer Ausführungsform handelt es sich bei der oben genannten funktionellen Aktivität um Ca2+- Bindungsaktivität. Diese Aktivität kann mittels Standardverfahren gemessen werden, die einem Fachmann geläufig sind. In einer Ausführungsform handelt es sich bei der oben genannten funktionellen Aktivität um die Hemmung der Inaktivierung von Cav-Kanälen, z.B. Cav 1.3 -Kanälen in HEK293-Zellen oder inneren Haarzellen der Cochlea. Diese Aktivität kann zum Beispiel mittels eines Verfahrens wie es in Picher et al. (Picher et al. Proc. Natl. Acad. Sei. U.S.A. 2017, 114(9):E1717-E1726) beschrieben ist bestimmt werden. In einer Ausführungsform handelt es sich um beide der genannten Aktivitäten.
In einer Ausführungsform umfasst die kodierende Sequenz eine Nukleotidsequenz, die mindestens 70%, mindestens 75%, mindestens 80%, mindestens 85%, mindestens 90% oder mindestens 95%, mindestens 96%, mindestens 97%, mindestens 98% oder mindestens 99% identisch ist mit der Nukleotidsequenz von SEQ ID NO: 2 oder SEQ ID NO: 4 oder SEQ ID NO: 6, oder besteht aus dieser Nukleotidsequenz. In einer Ausführungsform umfasst die kodierende Sequenz die Nukleotidsequenz von SEQ ID NO: 2 oder SEQ ID NO: 4 oder SEQ ID NO: 6, oder besteht aus dieser Nukleotidsequenz.
Die Ähnlichkeit zweier Nukleotid- oder Aminosäuresequenzen, z.B. ausgedrückt durch den Prozentsatz Ihrer Identität, kann über Sequenz-Alignments bestimmt werden. Solche Alignments können mit verschiedenen, dem Fachmann bekannten Algorithmen durchgeführt werden, vorzugsweise mit den mathematischen Algorithmen von Karlin und Altschul (Karlin & Altschul Proc. Natl. Acad. Sei. U.S.A. 1993, 90:5873-5877), z.B. mit hmmalign (HMMER Package, http://hmmer.wustl.edu/), oder mit dem CLUSTAL Algorithmus (Thompson J.D. et al. Nucleic Acids Res. 1994, 22:4673-80), welcher zum Beispiel auf http://www.ebi.ac.uk/Tools/clustalw/ oder auf http://www.ebi.ac.uk/Tools/clustalw2/index.html oder auf http://npsa-pbil.ibcp.fr/cgi- bin/npsa_automat.pl?page=/NPSA/npsa_clustalw.html verfügbar ist.
In einer Ausführungsform umfasst die im erfindungsgemäßen viralen Vektor, z.B. AAV-Vektor, enthaltene Nukleinsäure weitere Sequenzelemente. Solche Sequenzelemente umfassen zum Beispiel invertierte terminale Repeats (ITRs; z.B. AAV-2 ITRs), Kozak-Sequenzen, Resistenzgene (z.B. Ampr), Polyadenylierungssequenzen (z.B. die Polyadenylierungsequenz von bovinem Wachstumshormon, bGH) und regulatorische Elemente, wie das posttranskriptionale regulatorische Element des Murmeltier Hepatitis Virus (WPRE). Außerdem kann die Nukleinsäure weitere kodierende Sequenzen enthalten. Solche weiteren kodierenden Sequenzen können zum Beispiel für zusätzliche therapeutisch aktive Proteine oder für Markerproteine (z.B. fluoreszierende Proteine, wie etwa EGFP) kodieren. In einer Ausführungsform sind die CaBP2-kodierende Sequenz und die weitere kodierende Sequenz über eine interne ribosomale Eintrittsstelle (IRES) oder eine Sequenz verbunden, die für ein 2A-Peptid (z.B. P2A) kodiert.
In einem weiteren Aspekt stellt die vorliegende Erfindung eine Nukleinsäure (oder ein genetisches Konstrukt) zur Verfügung wie es hierin beschrieben wird.
In einem weiteren Aspekt stellt die vorliegende Erfindung eine Wirtszelle zur Verfügung, die einen viralen Vektor der vorliegenden Erfindung oder eine Nukleinsäure (oder ein genetisches Konstrukt) der vorliegenden Erfindung umfasst. Diese Wirtszelle kann prokaryotischer Natur (z.B. eine bakterielle Zelle) oder eukaryotischer Natur (z.B. eine Pilzzelle, Pflanzenzelle oder Tierzelle) sein. Vorzugsweise ist die Wirtszelle isoliert. In einer Ausführungsform ist die Wirtszelle eine Produzentenzelle oder Produzentenzelllinie, die die Produktion des erfindungsgemäßen viralen Vektors (z.B. AAV-Vektors) ermöglicht, z.B. auf Basis der Nukleinsäure (oder des genetischen Konstrukts) der vorliegenden Erfindung und mittels Ko-Transfektion geeigneter Helferkonstrukte, z.B. Helferplasmide (siehe z.B. US 2004/0235174 Al). Geeignete Produzentenzellen oder Produzentenzelllinien sind dem Fachmann bekannt und schließen zum Beispiel HEK293-Zellen ein.
In einem weiteren Aspekt stellt die vorliegende Erfindung ein nicht-humanes transgenes Tier zur Verfügung, das einen viralen Vektor der vorliegenden Erfindung oder eine Nukleinsäure (oder ein genetisches Konstrukt) der vorliegenden Erfindung umfasst. Der Begriff„nicht -humanes transgenes Tier“ bezieht sich insbesondere auf nicht-menschliche Primaten oder andere Tiere, insbesondere ein Säugetier wie Kuh, Pferd, Schwein, Schaf, Ziege, Hund, Katze, Vogel wie Huhn oder Nagetier wie Maus, Ratte, Meerschwein, Hamster und Mongolische Rennmaus.
Verfahren zur Herstellung von viralen Vektoren sind dem Fachmann bekannt. Ein Verfahren zur Herstellung z.B. eines AAV-Vektors besteht in der Tripel-Transfektion einer geeigneten Produzentenzelllinie, z.B. HEK293, und anschließender Aufreinigung über Iodixanol- oder Cäsiumchlorid-Gradienten. Hierbei werden die Produzenten-Zellen mit drei Vektoren transfiziert: Auf einem ersten Vektor/Plasmid ist das Gen von Interesse kodiert (hier CaBP2), flankiert von entsprechenden Verpackungssignalen (siehe Figur 1); auf einem zweiten Vektor /Plasmid sind die benötigten AAV-Proteine, insbesondere rap und cap, kodiert; und ein dritter/s Vektor/Plasmid stellt adenovirale Helferfunktionen bereit, ohne die eine AAV -Partikelproduktion nicht möglich ist. Geeignete Verfahren sind auch in Grieger et al. (Nature Protocols 2006, 1(3): 1412-1428) beschrieben.
In einem weiteren Aspekt stellt die vorliegende Erfindung eine pharmazeutische Zusammensetzung zur Verfügung, die einen viralen Vektor der vorliegenden Erfindung und einen pharmazeutisch verträglichen Träger- oder Hilfsstoff umfasst.
Die erfindungsgemäße pharmazeutische Zusammensetzung ist vorzugsweise steril und enthält eine therapeutisch wirksame Menge des viralen Vektors.
Eine„therapeutisch wirksame Menge“ betrifft die Menge, die alleine oder zusammen mit weiteren Dosen eine gewünschte Reaktion oder eine gewünschte Wirkung erzielt, z.B. eine Verbesserung bzw. teilweise oder vollständige Wiederherstellung des Hörvermögens. Eine therapeutisch wirksame Menge wird von dem zu behandelnden Zustand, der Schwere der Krankheit, den individuellen Parametern des Patienten, einschließlich Alter, physiologischer Zustand, Größe und Gewicht, der Dauer der Behandlung, der Art einer begleitenden Therapie (falls vorhanden), dem spezifischen Verabreichungsweg und ähnlichen Faktoren abhängen.
In einer Ausführungsform werden ca. 108 bis ca. 1013 virale Partikel verabreicht, suspendiert in einem geeigneten Volumen eines Trägerstoffs. Mögliche Trägerstoffe (z.B. Lösungsmittel) sind zum Beispiel künstliche Perilymphe, steriles Wasser, Ringerlösung, laktierte Ringerlösung, physiologische Salzlösung, bakteriostatische Salzlösung (z.B. 0,9% Benzylalkohol enthaltende Salzlösung), Phosphat-gepufferte Salzlösung (PBS), Hanks-Lösung, fixierte Öle, Polyalkylenglykole, hydrierte Naphtaline und biokompatible Polylaktide, Laktid/Glykolid Kopolymere oder Polyoxyethylen/Polyoxy-Propylen-Kopolymere. Die entstehenden Lösungen oder Suspensionen sind vorzugsweise isotonisch. Geeignete Trägerstoffe und ihre Formulierung sind außerdem im Detail in Remington’s Pharmaceutical Sciences, 17. Ausgabe, 1985, Mack Publishing Co. beschrieben.
In einer bevorzugten Ausführungsform ist der Träger Stoff künstliche Perilymphe.
Der Begriff „Hilfsstoff‘, wie hierin verwendet, schließt alle Substanzen ein, die in einer pharmazeutischen Zusammensetzung enthalten sein können und selbst keine aktiven Wirkstoffe sind, wie etwa Salze, Bindemittel (z.B. Laktose, Dextrose, Saccharose, Trehalose, Sorbitol, Mannitol), Gleitmittel, Verdickungsmittel, oberflächenaktive Stoffe, Konservierungsmittel, Emulgatoren, Puffersubstanzen, Stabilisierungsmittel, Geschmackstoffe oder Farbstoffe.
Der Begriff„pharmazeutisch verträglich“ betrifft ein nicht-toxisches Material, das vorzugsweise nicht mit der Wirkung des aktiven Bestandteils der pharmazeutischen Zusammensetzung wechselwirkt. Insbesondere bedeutet der Begriff„pharmazeutisch verträglich“, dass die betreffende Substanz von einer staatlichen regulatorischen Behörde zur Verwendung in Tieren und insbesondere Menschen zugelassen wurde oder in der U.S. Pharmakopoe, Europäischen Pharmakopoe oder anderen anerkannten Pharmakopoen für die Verwendung in Tieren und insbesondere Menschen aufgeführt ist.
In einem weiteren Aspekt stellt die vorliegende Erfindung einen viralen Vektor der vorliegenden Erfindung oder eine pharmazeutische Zusammensetzung der vorliegenden Erfindung zur Verwendung als Medikament zur Verfügung.
Der Begriff„Medikament“, wie hierin verwendet, bezieht sich auf eine Substanz oder Zusammensetzung, die therapeutisch verwendet wird, d.h., bei der Behandlung, Verbesserung oder Prävention einer Krankheit oder gesundheitlichen Störung.
In einem weiteren Aspekt stellt die vorliegende Erfindung einen viralen Vektor der vorliegenden Erfindung oder eine pharmazeutische Zusammensetzung der vorliegenden Erfindung zur Verwendung in einem Verfahren zur Behandlung von Schwerhörigkeit zur Verfügung.
Erfindungsgemäß ist der behandelte Patient oder das behandelte Individuum ein Mensch, nicht menschlicher Primat oder ein anderes Tier, insbesondere ein Säugetier wie Kuh, Pferd, Schwein, Schaf, Ziege, Hund, Katze, Vogel wie Huhn oder Nagetier wie Maus, Ratte, Meerschwein, Hamster und Mongolische Rennmaus. In einer besonders bevorzugten Ausführungsform ist der behandelte Patient oder das behandelte Individuum ein Mensch.
In einer Ausführungsform ist die Schwerhörigkeit DFNB93 -Schwerhörigkeit.
In einer Ausführungsform umfasst das Verfahren die Verabreichung des viralen Vektors in das Innenohr, insbesondere in die Gehörschnecke, insbesondere in innere Haarzellen der Gehörschnecke.
In einer Ausführungsform umfasst die Verabreichung die Injektion durch das runde Fenster, die Injektion in die Scala vestibuli über eine Stapedotomie, die Injektion in die Scala tympani über eine Cochleostomie und/oder die Applikation als Depot in die Rundfenster -Nische, z.B. als Bestandteil eines Gels oder über einen Applikations-Katheter.
In einer Ausführungsform umfasst die Verabreichung intratympanale Injektion.
In einer Ausführungsform führt die Verabreichung zu einer Expression von Kalzium-bindendem Protein 2 (CaBP2) oder des funktionellen Fragmentes oder der Variante davon in inneren Haarzellen der Gehörschnecke, z.B. in inneren Haarzellen der apikalen Windung der Gehörschnecke.
Der Begriff „Expression” wird erfindungsgemäß in seiner allgemeinsten Bedeutung verwendet und umfasst z.B. die Produktion von RNA oder von RNA und Protein.
In einer Ausführungsform ermöglichen der erfindungsgemäße virale Vektor, die erfindungsgemäße pharmazeutische Zusammensetzung und die erfindungsgemäßen Verfahren und Verwendungen eine Expression von CaBP2 oder des funktionelles Fragmentes oder der Variante davon in mindestens 50%, in mindestens 60%, in mindestens 70%, in mindestens 80%, in mindestens 90% oder in mindestens 95% der inneren Haarzellen der Gehörschnecke, vorzugsweise der inneren Haarzellen der apikalen Windung der Gehörschnecke.
Der erfindungsgemäße virale Vektor und die erfindungsgemäße pharmazeutische Zusammensetzung werden in therapeutisch wirksamen Mengen verabreicht.
In einem weiteren Aspekt stellt die vorliegende Erfindung die Verwendung eines viralen Vektors der vorliegenden Erfindung bei der Herstellung eines Medikaments zur Behandlung von Schwerhörigkeit zur Verfügung.
In einer Ausführungsform ist die Schwerhörigkeit DFNB93-Schwerhörigkeit. In einem weiteren Aspekt stellt die vorliegende Erfindung ein Verfahren zur Behandlung von Schwerhörigkeit zur Verfügung, welches die Verabreichung des viralen Vektors der vorliegenden Erfindung in das Innenohr, insbesondere in die Gehörschnecke, insbesondere in innere Haarzellen der Gehörschnecke umfasst.
In einer Ausführungsform ist die Schwerhörigkeit DFNB93-Schwerhörigkeit.
In einer Ausführungsform umfasst die Verabreichung die Injektion durch das runde Fenster, die Injektion in die Scala vestibuli über eine Stapedotomie, die Injektion in die Scala tympani über eine Cochleostomie und/oder die Applikation als Depot in die Rundfenster -Nische, z.B. als Bestandteil eines Gels oder über einen Applikations-Katheter.
In einer Ausführungsform umfasst die Verabreichung intratympanale Injektion.
In einer Ausführungsform führt die Verabreichung zu einer Expression von Kalzium-bindendem Protein 2 (CaBP2) oder des funktionellen Fragmentes oder der Variante davon in inneren Haarzellen der Gehörschnecke, z.B. in inneren Haarzellen der apikalen Windung der Gehörschnecke.
Figure imgf000013_0001
des viralen Konstrukts AAV2/l-CaBP2-P2A-EGFP
Es wurde ein CaBP2-kodierende DNA enthaltender viraler Vektor zur postnatalen (AAV-vermittelten) Transduktion von inneren Haarzellen (Inner Hair Cells, IHCs) entwickelt. Bei dem CaBP2 handelt es sich um Mäuse-CaBP2 (Mus musculus). Das in den Tierversuchen verwendete Konstrukt enthielt ferner eine EGFP-kodierende Sequenz (EGFP = Enhanced Green Fluorescent Protein), die über ein 2A -Peptid (P2A) mit der CaBP2-kodierenden Sequenz verlinkt war.
Um die transgene Expression von CaBP2-P2A-EGFP in inneren Haarzellen zu bewirken, wurden AAV- 2/1 und der Cytomegalovirus (CM V) -verstärkte humane ß-Actin (hBA) -Promotor (auch bezeichnet als humaner ß-Actin/CMV-Hybridpromotor; Reisinger et al. J. Neurosci. Off. J. Soc. Neurosci. 2011, 31:4886-4895) verwendet. Alternativ könnte man auch den CMV-Promotor oder den Hühner ß- Actin/CMV-Hybridpromotor verwenden (Askew et al. Sei. Transl. Med. 2015, 7:295ral08; Haque et al. J. Vis. Exp. JoVE 2015 95:e52260). HBA zeigte jedoch eine sehr hohe Transduktionseffizienz in inneren Haarzellen, was mittels eines Epifluoreszenzmikroskops überprüft wurde. AAV wurde von Penn Vector Core, Philadelphia, gekauft. Die Vektorkarte des viralen Konstrukts AAV2/l-CaBP2-P2A-EGFP ist in Figur 1 gezeigt, seine DNA- Sequenz (SEQ ID NO: 10) ist unten dargestellt - wobei einzelne Elemente wie folgt markiert sind:
Figure imgf000014_0001
CMV Enhancer Promotor (SEQ ID NO 9).
AATTCGCCACCATGGTTCAGAGACCCATGGGGAACTGTGCCAAGACGCCATGGCACCGGGGGTCTAAGGA ACGCTGGCAGTGGCCTGGATCCCCCCTAGGGGGCTCCCGCCCCAGCCCTGGTCCCAGAACTGAGGAGCAG GAGGGGACACAGGGCTACTCAGTGCTCGGCAGCCTGGTGGGGCCAGCATGCATCTTCCTTCGACCCAGCA TCGCGGCTACCCAGCTCGATCGAGAGCTGAGACCAGAAGAGATCGAAGAGCTGCAGATCGCCTTCCAGGA GTTTGACCGAGACCGGGACGGCTACATCGGCTACCGGGAGCTGGGTGCCTGCATGCGGACACTGGGCTAC ATGCCCACGGAGATGGAGCTCATTGAGATATCACAACAGATCAGTGGTGGGAAGGTGGATTTTGAAGATT TTGTGGAGCTGATGGGTCCCAAGCTGCTGGCAGAGACGGCAGACATGATTGGCGTGAGGGAGCTTCGAGA CGCCTTCCGGGAGTTCGACACCAACGGTGATGGCTGCATCAGCGTAGGGGAGCTCCGGGCAGCCCTCAAA GCTCTGCTGGGGGAACGCCTCAGCCAACGGGAAGTAGATGAGATACTCCAAGACATTGACCTCAATGGAG ATGGCCTGGTTGACTTTGAAGAATTTGTTCGGATGATGTCTCGGGCT AGCGGAAGCGGAGCTACTAACTT CAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTGAACCGGTCGCCACCATGGTGAGC AAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACA AGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCAC CACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGC CGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGC GCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCT GGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAG TACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCA AGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGG CGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAAC GAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGC
rGAACAAGAAAAGCGGCCGCAAGCTTATCGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGAC TGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCT ATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGT TGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGG CATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTC ATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGT CGGGGAAGCTGACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTT CTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCT CTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCATCGATACC GTCGACTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCC CCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCAT CGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTG GGAAGACAATAGCAGGCATGCTGGGGAGAGATCTAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTC TGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGC CTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACCCCCCCCCCCCCCCCCCTGCAGCCAGCTGG CGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGTAGCCTGAATGGCGAATGGCGCG ACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGC CAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGT CAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAAC TTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGA GTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCT TTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTA ACGCGAATTTTAACAAAATATTAACGTTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGC GGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCC GACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGC TGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAG GGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCA CTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCT CATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTC CGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGA AAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAA
GATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGC
GCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACT
TGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGC
TGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTA
ACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAG
CCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAAC
TGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGA
CCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGT
CTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGG
GAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGG
TAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGA
TCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGC
GTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTG
CAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGA
AGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCA
CTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGT
GGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCT
GAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCG
TGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTC
GGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTC
GCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAG
CAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCC
CCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCG
AGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTG
GCCGATTCATTAATGCAGCTGGGCTGCAGGGGGGGGGGGGGGGGGGTTGGCCACTCCCTCTCTGCGCGCT
CGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGA
GCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTAGATCTAGGATCACGCGTT
Figure imgf000015_0002
GCCCAGCACCCCAAGGCGGCCAACGCCAAAACTCTCCCCCCTCCTCTTCCTCAATCTCGCTCTCGCTCTT
TT TT TT TT TCGCAAAAGGAGGGGAGAGGGGGTAAAAAAAT GCTGCACT GT GCGGCGAAGCCGGT GAGT GA
GCGGCGCGGGGCCAATCAGCGTGCGCCGTTCCGAAAGTTGCCTTTTATGGCTCGAGCGGCCGGCCGCGGC
GGCGCCCTATAAAACCCAGCGGCGCGACGCGCCACCACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGA
GCCTCGCCTTTGCCGATCCGCCGCCCGTCCACACCCGCCGCCAGGTAAGCCCGGCCAGCCGACCGGGGCA
GGCGGCTCACGGCCCGGCCGCAGGCGGCCGCCCAAAG (SEQ ID NO: 10)
Beispiel 2: In vivo-.
Figure imgf000015_0001
des viralen Konstrukts AAV2/l-CaBP2-P2A-EGFP
AAV2/l-CaBP2-P2A-EGFP (0.5-1 mΐ mit l.97xl013 GC/ml) wurde in die Paukentreppe (Scala tympani) des rechten Ohres von 5 bis 7 Tage alten CaBP2 Knockout -Mäusen ( CaBP2LacZ/LacZ ) oder Kontrollmäusen über des runde Fenster injiziert, im Wesentlichen wie in der Studie von Akil et al. (Akil et al. Neuron 2012, 75:283-293) beschrieben.
4 bis 9 Wochen nach der Injektion wurde das Hörvermögen (Funktion der inneren Haarzellen) mittels Hirnstammaudiometrie (Auditory Brainstem Recording, ABR) getestet. Alle Experimente wurden in Einklang mit den nationalen Tierpflegerichtlinien durchgeführt und vom Ausschuss für Tierschutz der Universität Göttingen und dem Büro für Tierschutz des Landes Niedersachsen genehmigt (AZ: 33.4-42502-04-14/1391). Ergebnisse
Die Untersuchung transduzierter Organe mittels eines Epifluoreszenzmikroskops zeigte eine beinahe l00%-ige Transduktionseffizienz in den inneren Haarzellen - die Zellen wiesen starke EGFP-Fluoreszenz auf, was wiederum auf erfolgreiche Transduktion und Expression der gewünschten Proteine hinwies (Figur 2A).
Mit Hilfe von Hirnstammaudiometrie (ABR) konnte eine teilweise Verbesserung des Hörvermögens bei ca. 63% der injizierten Knockout-Tiere beobachtet werden (66% der 5-7 Wochen alten injizierten Tiere und 57% der 8-9 Wochen alten injizierten Tiere), mit signifikant reduzierten ABR-Schwellenwerten (um ca. 20 dB bei den Frequenzen 6, 12 und 24 kHz und Klicks) - siehe Figuren 2B bis 2D. Die Injektion in heterozygote Mäuse (welche keine Einschränkung des Hörvermögens aufweisen) hatte keine offensichtlichen Auswirkungen auf das Hörvermögen.
Zusammengefasst lässt sich feststellen, dass der virale CaBP2 -kodierende DNA-enthaltende Vektor der vorliegenden Erfindung die effiziente, postnatale Transduktion von inneren Haarzellen und eine signifikante Verbesserung des Hörvermögens in Knockout-Maus-Modellen ermöglicht.

Claims

1. Viraler Vektor zur Verwendung in einem Verfahren zur Behandlung von Schwerhörigkeit, umfassend eine Nukleinsäure, die einen Promotor und eine damit operativ verbundene kodierende Sequenz umfasst, die für Kalzium-bindendes Protein 2 (CaBP2) oder ein funktionelles Fragment oder eine Variante davon kodiert.
2. Viraler Vektor zur Verwendung nach Anspruch 1, wobei der virale Vektor ausgewählt ist aus der Gruppe bestehend aus Adeno-assoziierter Virus Vektor (AAV-Vektor), Adenovirus Vektor und Lenti virus Vektor.
3. Viraler Vektor zur Verwendung nach Anspruch 1 oder 2, wobei der virale Vektor ein AAV- Vektor ist.
4. Viraler Vektor zur Verwendung nach Anspruch 3, wobei der AAV-Vektor ein AAV-Vektor mit einem Serotyp ausgewählt aus der Gruppe bestehend aus AAV-l, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7 AAV-8, AAV-9, AAV-10, AAV-l 1 und Kombinationen davon ist.
5. Viraler Vektor zur Verwendung nach Anspruch 3 oder 4, wobei der AAV-Vektor ein AAV-2/ 1- Vektor ist.
6. Viraler Vektor zur Verwendung nach einem der Ansprüche 1 bis 5, wobei der Promotor ausgewählt ist aus der Gruppe bestehend aus Cytomegalo virus (CMV) -Promotor, humaner ß- Actin/CMV-Hybridpromotor, Hühner ß-Actin/CMV-Hybridpromotor, Mathl -Promotor, VGLUT3- Promotor, Parvalbumin-Promotor, Calretinin-Promotor, Calbindin28k-Promotor, Prestin-Promotor, Otoferlin-Promotor und Myosin V-, VI- oder Vlla-Promotor.
7. Viraler Vektor zur Verwendung nach einem der Ansprüche 1 bis 6, wobei der Promotor ein humaner ß-Actin/CMV-Hybridpromotor ist.
8. Pharmazeutische Zusammensetzung zur Verwendung in einem Verfahren zur Behandlung von Schwerhörigkeit, umfassend einen viralen Vektor wie er in einem der Ansprüche 1 bis 7 definiert ist und einen pharmazeutisch verträglichen Träger- oder Hilfsstoff.
9. Viraler Vektor zur Verwendung nach einem der Ansprüche 1 bis 7 oder pharmazeutische Zusammensetzung zur Verwendung nach Anspruch 8, wobei es sich bei der Schwerhörigkeit um DFNB93-Schwerhörigkeit handelt.
10. Viraler Vektor zur Verwendung nach einem der Ansprüche 1 bis 7 und 9 oder pharmazeutische Zusammensetzung zur Verwendung nach Anspruch 8 oder 9, wobei das Verfahren die Verabreichung des viralen Vektors oder der pharmazeutischen Zusammensetzung in das Innenohr umfasst, wobei die Verabreichung vorzugsweise die Injektion durch das runde Fenster, die Injektion in die Scala vestibuli über eine Stapedotomie, die Injektion in die Scala tympani über eine Cochleostomie und/oder die Applikation als Depot in die Rundfenster -Nische, z.B. als Bestandteil eines Gels oder über einen Applikations-Katheter, umfasst.
11. Viraler Vektor zur Verwendung nach einem der Ansprüche 1 bis 7, 9 und 10 oder pharmazeutische Zusammensetzung zur Verwendung nach einem der Ansprüche 8 bis 10, wobei die Verabreichung des viralen Vektors oder der pharmazeutischen Zusammensetzung zu einer Expression von Kalzium-bindendem Protein 2 (CaBP2) oder des funktionellen Fragmentes oder der Variante davon in inneren Haarzellen der Gehörschnecke führt.
12. Adeno-assoziierter Virus Vektor (AAV -Vektor), umfassend eine Nukleinsäure, die einen Promotor und eine damit operativ verbundene kodierende Sequenz umfasst, die für Kalzium-bindendes Protein 2 (CaBP2) oder ein funktionelles Fragment oder eine Variante davon kodiert, wobei der AAV- Vektor ein AAV-2/1 -Vektor ist.
13. AAV-Vektor nach Anspruch 12, wobei der Promotor ausgewählt ist aus der Gruppe bestehend aus Cytomegalovirus (CM V) -Promotor, humaner ß-Actin/CMV -Hybridpromotor, Hühner ß-Actin/CMV- Hybridpromotor, Math 1 -Promotor, VGFUT3-Promotor, Parvalbumin-Promotor, Calretinin-Promotor, Calbindin28k-Promotor, Prestin-Promotor, Otoferlin-Promotor und Myosin V-, VI- oder Vlla-Promotor.
14. AAV-Vektor nach Anspruch 12 oder 13, wobei der Promotor ein humaner ß-Actin/CMV- Hybridpromotor ist.
15. Pharmazeutische Zusammensetzung, umfassend einen AAV-Vektor nach einem der Ansprüche 12 bis 14 und einen pharmazeutisch verträglichen Träger- oder Hilfsstoff.
PCT/EP2019/050618 2018-01-12 2019-01-11 Gentherapeutische behandlung von schwerhörigkeit WO2019138030A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102018100619.5 2018-01-12
DE102018100619.5A DE102018100619A1 (de) 2018-01-12 2018-01-12 Gentherapeutische Behandlung von Schwerhörigkeit

Publications (1)

Publication Number Publication Date
WO2019138030A1 true WO2019138030A1 (de) 2019-07-18

Family

ID=65031054

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2019/050618 WO2019138030A1 (de) 2018-01-12 2019-01-11 Gentherapeutische behandlung von schwerhörigkeit

Country Status (2)

Country Link
DE (1) DE102018100619A1 (de)
WO (1) WO2019138030A1 (de)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115052989A (zh) * 2019-11-04 2022-09-13 分贝治疗公司 耳蜗内毛细胞启动子及其用途
CN116515773A (zh) * 2023-04-24 2023-08-01 华中科技大学同济医学院附属协和医院 一种重组腺相关病毒及在制备妊娠期内耳靶向基因治疗药物中的应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999049038A2 (en) * 1998-03-26 1999-09-30 Incyte Pharmaceuticals, Inc. Human calcium-binding proteins
US20040235174A1 (en) 2001-04-25 2004-11-25 Dirk Grimm Aav helper plasmids for helper virus-free packaging and pseudo typification of aav vectors
WO2017100791A1 (en) 2015-12-11 2017-06-15 Massachusetts Eye And Ear Infirmary Materials and methods for delivering nucleic acids to cochlear and vestibular cells

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1755400A2 (de) * 2004-06-18 2007-02-28 The University Of Montana Aav-vermittelte genabgabe an kochlearzellen

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999049038A2 (en) * 1998-03-26 1999-09-30 Incyte Pharmaceuticals, Inc. Human calcium-binding proteins
US20040235174A1 (en) 2001-04-25 2004-11-25 Dirk Grimm Aav helper plasmids for helper virus-free packaging and pseudo typification of aav vectors
WO2017100791A1 (en) 2015-12-11 2017-06-15 Massachusetts Eye And Ear Infirmary Materials and methods for delivering nucleic acids to cochlear and vestibular cells

Non-Patent Citations (17)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", vol. 17, 1985, MACK PUBLISHING CO.
AKIL ET AL., NEURON, vol. 75, 2012, pages 283 - 293
ASKEW ET AL., SCI. TRANSL. MED., vol. 7, 2015, pages 295ra108
CHAN ET AL., NATURE NEUROSCIENCE, vol. 20, 2017, pages 1172 - 1179
DEVERMAN ET AL., NATURE BIOTECHNOL, vol. 34, 2016, pages 204 - 209
E. REISINGER ET AL: "Probing the Functional Equivalence of Otoferlin and Synaptotagmin 1 in Exocytosis", THE JOURNAL OF NEUROSCIENCE, vol. 31, no. 13, 30 March 2011 (2011-03-30), US, pages 4886 - 4895, XP055563602, ISSN: 0270-6474, DOI: 10.1523/JNEUROSCI.5122-10.2011 *
GRIEGER ET AL., NATURE PROTOCOLS, vol. 1, no. 3, 2006, pages 1412 - 1428
HAQUE ET AL., J. VIS. EXP. JOVE, vol. 95, 2015, pages e52260
ISABELLE SCHRAUWEN ET AL: "A Mutation in CABP2 , Expressed in Cochlear Hair Cells, Causes Autosomal-Recessive Hearing Impairment", AMERICAN JOURNAL OF HUMAN GENETICS, vol. 91, no. 4, 1 October 2012 (2012-10-01), US, pages 636 - 645, XP055562747, ISSN: 0002-9297, DOI: 10.1016/j.ajhg.2012.08.018 *
JUNG ET AL., EMBO J., vol. 34, 2015, pages 2686 - 2702
KARLIN; ALTSCHUL, PROC. NATL. ACAD. SCI. U.S.A., vol. 90, 1993, pages 5873 - 5877
MARIA MAGDALENA PICHER ET AL: "Ca 2+ -binding protein 2 inhibits Ca 2+ -channel inactivation in mouse inner hair cells", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 114, no. 9, 9 February 2017 (2017-02-09), US, pages E1717 - E1726, XP055562749, ISSN: 0027-8424, DOI: 10.1073/pnas.1617533114 *
PICHER ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 114, no. 9, 2017, pages E1717 - E1726
REISINGER ET AL., J. NEUROSCI. OFF. J. SOC. NEUROSCI., vol. 31, 2011, pages 4886 - 4895
SCHRAUWEN ET AL., AM. J. HUM. GENET., vol. 91, 2012, pages 636 - 645
SIEHE AKIL ET AL., NEURON, vol. 75, 2012, pages 283 - 293
THOMPSON J.D. ET AL., NUCLEIC ACIDS RES., vol. 22, 1994, pages 4673 - 80

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115052989A (zh) * 2019-11-04 2022-09-13 分贝治疗公司 耳蜗内毛细胞启动子及其用途
CN116515773A (zh) * 2023-04-24 2023-08-01 华中科技大学同济医学院附属协和医院 一种重组腺相关病毒及在制备妊娠期内耳靶向基因治疗药物中的应用
CN116515773B (zh) * 2023-04-24 2023-12-29 华中科技大学同济医学院附属协和医院 一种重组腺相关病毒及在制备妊娠期内耳靶向基因治疗药物中的应用

Also Published As

Publication number Publication date
DE102018100619A1 (de) 2019-07-18

Similar Documents

Publication Publication Date Title
EP3132043B1 (de) Viraler vektor für den zielgerichteten gentransfer in gehirn und rückenmark
CN109310745B (zh) 用于将核酸递送至耳蜗和前庭细胞的材料和方法
DE60106763T2 (de) Glutaminsäure decarboxylase (gad) abgabesystem zur behandlung neurodegeneraliver erkrankungen
Pfingst et al. Neurotrophin gene therapy in deafened ears with cochlear implants: long-term effects on nerve survival and functional measures
DE69534618T2 (de) Verfahren zur herstellung rekombinanter adeno-associated viren (aav) und deren verwendung
WO2019162396A1 (de) Gentherapeutische behandlung von schwerhörigkeit
DE69535703T2 (de) AAV-vermittelte Zufuhr von DNA an Zellen des Nervensystems
DE60129229T2 (de) Adeno-assoziierte virus-vermittelte übertragung von angiogenesefaktoren
Ivanchenko et al. AAV-S: A versatile capsid variant for transduction of mouse and primate inner ear
DE60309513T2 (de) Substanzen zur Vorbeugung und Behandlung von Autoimmunkrankheiten
DE69535155T2 (de) Für gdnf-kodierende rekombinante adenoviren
Cooper et al. AAV-mediated delivery of the caspase inhibitor XIAP protects against cisplatin ototoxicity
JP2021519609A (ja) 蝸牛および前庭細胞に核酸を送達するための組成物および方法
Shibata et al. Gene transfer using bovine adeno-associated virus in the guinea pig cochlea
Leake et al. Neurotrophin gene therapy to promote survival of spiral ganglion neurons after deafness
EP3536794A2 (de) Peptide mit spezifität für die lunge
WO2019138030A1 (de) Gentherapeutische behandlung von schwerhörigkeit
Leake et al. AAV-mediated neurotrophin gene therapy promotes improved survival of cochlear spiral ganglion neurons in neonatally deafened cats: comparison of AAV2-hBDNF and AAV5-hGDNF
CN114516901B (zh) 一种神经系统高亲和性的aav载体及其应用
DE69432856T2 (de) Zufuhr von genprodukten mittels mesangium-zellen
CN110023327A (zh) 在具有改善光敏感性的通道视蛋白变体中突变的识别及其使用方法
Blanc et al. A single cisterna magna injection of AAV leads to binaural transduction in mice
DE60023944T2 (de) Replikationsunfähige herpesvirus-vektoren
WO1996018737A2 (de) Vektoren und viren zur gentherapie
DE69912118T2 (de) Entomopoxvirus vektor zur abgabe und expression von dns heterologen in vertebratenzellen

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19700670

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19700670

Country of ref document: EP

Kind code of ref document: A1