WO2018169283A1 - C형 간염 바이러스 질환 치료를 위한 리고세르팁의 신규 용도 - Google Patents

C형 간염 바이러스 질환 치료를 위한 리고세르팁의 신규 용도 Download PDF

Info

Publication number
WO2018169283A1
WO2018169283A1 PCT/KR2018/002938 KR2018002938W WO2018169283A1 WO 2018169283 A1 WO2018169283 A1 WO 2018169283A1 KR 2018002938 W KR2018002938 W KR 2018002938W WO 2018169283 A1 WO2018169283 A1 WO 2018169283A1
Authority
WO
WIPO (PCT)
Prior art keywords
hepatitis
virus
hcv
rigosertib
hur
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2018/002938
Other languages
English (en)
French (fr)
Inventor
김종헌
박종배
조성찬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National Cancer Center Japan
National Cancer Center Korea
Original Assignee
National Cancer Center Japan
National Cancer Center Korea
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National Cancer Center Japan, National Cancer Center Korea filed Critical National Cancer Center Japan
Publication of WO2018169283A1 publication Critical patent/WO2018169283A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/16Amides, e.g. hydroxamic acids
    • A61K31/18Sulfonamides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/195Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/7056Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing five-membered rings with nitrogen as a ring hetero atom
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00

Definitions

  • the present invention relates to a novel use of ligosertip, and more particularly, to the use or prevention of ligosertip for the prevention or treatment of liver disease by hepatitis C virus and the antiviral use against hepatitis C virus.
  • Rigosertib (Onconova Therapeutics, Inc.) is a synthetic benzyl styryl sulfone substance, previously known as an anticancer agent, and has effects such as treatment of proliferative diseases (US7598232), myelodysplastic syndrome and acute myeloid leukemia (US8664272). Is known. However, there have been no reported uses associated with liver disease and further hepatitis C.
  • Drug repositioning is a concept that develops new indications for drugs currently in use and is recognized as an alternative to dramatically improve the potential for new drug development.
  • New drug re-creation can reduce the cost and duration of new drug development if the safety of the candidate drug is verified and validated.
  • Drug re-creation has (1) the use, preparation and stability of the drug (Drug) established; (2) Absorption, Distribution, Metabolism, Excretion and Toxicity (ADMET) data, namely drug absorption, diffusion, metabolism, excretion and drug toxicity information, are established; (3) the probability of failure due to safety issues is significantly lower, based on the results of clinical trials of the drug prior to drug use change; (4) Post-marketing Surveillance (PMS) has the advantage of not having to spend time obtaining safety data.
  • Drug Absorption, Distribution, Metabolism, Excretion and Toxicity
  • hepatitis C is mostly symptomatic in the early stage of infection, and when hepatitis C is infected, it is known to become chronic in more than 75% of the hepatitis B virus infection.
  • Chronic hepatitis C is a disease in which the liver's inflammation continues chronically when the body's immune system does not completely remove the hepatitis C virus and the infection continues for more than 6 months.
  • Hepatitis C virus is an RNA virus classified as the hepacivirus genus of the Flaviviridae family, and was discovered in the United States in 1989. It is a clinically important virus that causes hepatitis, cirrohosis and hepatocellular carcinoma (HCC). HCV is the leading cause of chronic hepatitis in developed countries such as the United States and Europe. According to the WHO, hepatitis C virus (HCV) is a more serious problem, with approximately 200 million people worldwide, more than 3% of the total population, and an increase of 3-4 million additional infections each year. .
  • liver cirrhosis progress to liver cancer at an incidence of 1-5% per year. It is known to become. About 12% of liver cirrhosis patients and about 15% of hepatocellular carcinoma patients are caused by hepatitis C virus and are known to be the main cause of chronic liver disease with hepatitis B virus.
  • HCV high-density lipoprotein
  • peginterferon and ribavirin the most widely used therapeutic agent for HCV
  • the treatment rate is only 30-50%, which is also effective depending on the genotype of HCV.
  • therapies targeting HCV non-structural proteins such as Sovaldi and Harvoni of Gilead Sciences, have been reported, but these are expensive to apply to the treatment of most patients.
  • the present inventors have made an effort to develop a new HCV infection-treated or preventive agent that can solve the problem of resistance of existing drugs while acting specifically and effectively against HCV infection, and thus play an indispensable role in the hepatitis C virus replication.
  • ELAVL1 / HuR an intracellular molecule that specifically binds miRNA-122, which is known to bind, and revealed that ELAVL1 / HuR binds specifically and strongly to ligosertip.
  • the present invention was completed as a specific and effective inhibitor against HCV infection, and has a medicinal use as an anti-HCV therapeutic agent.
  • An object of the present invention is to provide a pharmaceutical composition that can prevent or treat liver disease caused by the new hepatitis C virus.
  • Another object of the present invention is to provide an antiviral composition for hepatitis C virus.
  • Another object of the present invention to provide a health functional food composition that can prevent or improve liver disease caused by hepatitis C virus.
  • Still another object of the present invention is to provide a method for preventing or treating liver disease caused by hepatitis C virus.
  • Still another object of the present invention is to provide a use for preventing or treating liver disease caused by hepatitis C virus.
  • Another object of the present invention is to provide an antiviral use against hepatitis C virus.
  • the present invention provides a novel use of ligosertip.
  • the present invention provides a use for the prevention or treatment of liver disease by hepatitis C virus of rigosertib or a pharmaceutically acceptable salt thereof.
  • the present invention provides an antiviral use against hepatitis C virus of rigosertib or a pharmaceutically acceptable salt thereof.
  • the present invention is a pharmaceutical composition for the treatment or prevention of hepatitis C virus (Hepatitis C virus, HCV) containing ligosertip (rigosertib) or a pharmaceutically acceptable salt thereof as an active ingredient To provide.
  • Hepatitis C virus Hepatitis C virus, HCV
  • ligosertip rigosertib
  • a pharmaceutically acceptable salt thereof as an active ingredient To provide.
  • the present invention also provides an antiviral composition against HCV, which contains ligosertip or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention also provides a nutraceutical composition for the improvement or prevention of liver disease by HCV containing the ligosertip or a food acceptable salt thereof as an active ingredient.
  • the present invention provides a method for preventing or treating liver disease caused by hepatitis C virus of rigosertib or a pharmaceutically acceptable salt thereof.
  • the present invention provides a novel use of antiviral agents against HCV and liver disease caused by HCV that can specifically and effectively inhibit HCV infection without hepatitis C virus treatment, prevention, antiviral use, and resistance problems.
  • Prophylactic or therapeutic compositions are provided.
  • Ligosertip according to the present invention can be a specific and effective treatment for HCV infection by inhibiting the binding of microRNA-122 and ELAVL1 / HuR. Moreover, unlike the anti-HCV treatments developed in the past, they do not target HCV proteins and inhibit the action of hepatocyte agonists in humans, which can solve the problem of resistance to the previously developed drugs. Combination therapy with known therapeutic agents is possible, and is also useful as a good treatment strategy for HCV that does not cause resistance.
  • 1 shows miRNA-122 directly binding to ELAVL1 / HuR and ELAVL1 / HuR efficacy verification results
  • 1A is the isomiR structure of miRNA-122
  • 1B is an RNA electro mobility shift assay (REMSA) using GST-HuR
  • 1C is the knockout result of intracellular molecule ELAVL1 / HuR using HCV subgenomic replicon capable of translation / replication assay
  • 1D is specifically knockout of Huh7 intracellular ELAVL1 / HuR using CRISPR / Cas9 system. This is the result of the Westing blot when you make it.
  • Figure 2A is a graph of the screening results of compounds inhibiting HCV translation / proliferation using the structure of subgenomic replicon (HIRL-2Aneo-NSrep) of HCV capable of reporter assay and Seleckchem cellular kinase inhibitor libray
  • 2B is a recombinant GST-HuR protein.
  • the result of direct binding between biotin-rigosertb and in vitro pulldown assay is shown.
  • 2C and 2D show the chemical structure of ligosertip and biotin-lygosertip
  • 2E shows the interaction between HCV and molecules in the cell. (ELAVL1 / HuR-microRNA-122-HCV translation / cloning) is shown.
  • Figure 3 is a graph re-validating the anti-HCV effect of ligosertip through HIRL-2Aneo-NSrep_FL Huh-7 luciferase assay.
  • treatment in the present invention means an approach for obtaining beneficial or desirable clinical results.
  • beneficial or desirable clinical outcomes include, but are not limited to, alleviation of symptoms, reduction of disease range, stabilization of disease state (ie, not worsening), delay or slowing of disease progression, disease state Improvement or temporary mitigation and alleviation (which may be partial or total), detectable or not detected.
  • Treatment refers to both therapeutic treatment and prophylactic or preventative measures. Such treatments include the disorders to be prevented as well as the treatments required in the already occurring intestine. By “palliating" a disease, the extent to which the disease state and / or undesirable clinical signs and / or the time course of progression is slowed or lengthened, as compared to the case without treatment.
  • prevention in the present invention refers to a therapy that protects against the onset of a disease or disorder so that clinical symptoms of the disease do not develop.
  • prophylaxis refers to administering a therapy to a subject (eg, administering a therapeutic agent) before the indication of the disease is detectable in the subject (eg, to a detectable infectious agent (eg, To a subject in the absence of the virus).
  • a subject may be an individual at risk of developing a disease or disorder, such as an individual having one or more risk factors known to be associated with the development or onset of the disease or disorder.
  • the term “preventing HCV infection” refers to administering an anti-HCV therapeutic substance to a subject having no detectable HCV infection. It is understood that the subject for anti-HCV prophylaxis may be an individual at risk for HCV virus.
  • the term “therapeutically effective amount” or “effective amount” refers to an amount effective to elicit a desired biological or medical response, such as an amount of a compound sufficient to effect such treatment for a disease when administered to a subject for treating the disease. Refers to.
  • the effective amount will vary depending on the compound, the disease and its severity and the age, weight, etc. of the subject to be treated.
  • An effective amount can include a range of amounts.
  • an effective amount may be one or more doses, ie a single dose or multiple doses may be required to achieve the desired treatment endpoint.
  • An effective amount can be considered in connection with administering one or more therapeutic agents, and a single agent can be considered to be provided in an effective amount if a desirable or beneficial result can be achieved or is achieved with one or more other agents.
  • Suitable doses of any co-administered compound can be optionally reduced due to the combined action of the compound (eg, additional or synergistic effects).
  • the present invention provides a method for preventing or treating liver disease caused by hepatitis C virus of rigosertib or a pharmaceutically acceptable salt thereof, and for use in a pharmaceutical composition for preventing or treating liver disease. It is about.
  • the present invention in one aspect, relates to antiviral use for hepatitis C virus, or use for antiviral composition against hepatitis C virus, of rigosertib or a pharmaceutically acceptable salt thereof.
  • the present invention provides a pharmaceutical composition for the treatment or prevention of hepatitis C virus (Hepatitis C virus, HCV) containing a rigosertib or a pharmaceutically acceptable salt thereof as an active ingredient. It relates to a composition.
  • Hepatitis C virus HCV
  • HCV hepatitis C virus
  • Rigosertipib (rigosertib) is a material known as an anticancer agent, specifically, a material having a structure as shown in the following formula (1).
  • Hepatitis C virus consists of a single stranded ⁇ 10-kb single stranded (+) sense RNA in molecular biology, belongs to flaviviridae, and utilizes an abnormal translation initiation process such as an internal ribosomal entry site. The translation process occurs and is cleaved by proteolytic enzymes encoded by intracellular proteases or viruses, respectively, to designate non-structural proteins that are important for the translation, replication, and proliferation of structural proteins or viruses, respectively. .
  • Existing studies have been shown to actively utilize intracellular molecules in the replication and translation process of HCV.
  • microRNA-122 microRNA-122 (miRNA-122, accounts for 70% of human hepatocyte microRNAs). Is known to play an essential role in the replication of hepatitis C virus.
  • ligosertip strongly inhibits replicon proliferation similarly to the danoprevir already developed by Roche and used in clinical trials, and shows an inhibitory effect of 80% or more even at low concentrations (0.2 ⁇ M).
  • the ligosertip of the present invention unlike the anti-HCV therapeutic agent developed in the past, inhibits the action of host factors (miRNA-122 and ELAVL1), which is not a protein produced by HCV itself (miRNA-122 and ELAVL1) / HuR), because it does not target the HCV protein, it can be used as a preventive or therapeutic agent for liver disease caused by the new concept hepatitis C virus, which can solve the resistance problems of previously developed drugs.
  • host factors miRNA-122 and ELAVL1
  • HuR HuR
  • the hepatitis C virus may be hepatitis C, hepatic fibrosis by hepatitis C virus, cirrhosis by hepatitis C virus, and liver cancer by hepatitis C virus.
  • the ligosertip may be characterized in that it is administered in combination with an HCV therapeutic agent, for example, sovaldi (sovaldi), Danoprevir (Daclatasvir).
  • HCV therapeutic agent for example, sovaldi (sovaldi), Danoprevir (Daclatasvir).
  • antiviral agents for example ribavirin.
  • the ligosertip may be used as an antiviral agent for hepatitis C virus, which inhibits the translation / replication / proliferation of hepatitis C virus, and thus, the present invention is in another aspect, the ligosertip or pharmaceutically acceptable thereof.
  • An antiviral composition for HCV containing possible salts as an active ingredient.
  • “Pharmaceutically acceptable salts” in the present invention refers to salts of any compound of the present invention that are not toxic or inappropriate for pharmaceutical use while maintaining the biological properties of the compound ligosertip of the present invention. Such salts can be derived from and include various organic and inorganic counterions known in the art.
  • Such salts include (1) organic or inorganic acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, sulfamic acid, acetic acid, trifluoroacetic acid, trichloroacetic acid, propionic acid, hexanoic acid, cyclopentylpropionic acid, glycolic acid, gluc Taric acid, pyruvic acid, lactic acid, malonic acid, succinic acid, sorbic acid, ascorbic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, 3- (4-hydroxybenzoyl) benzoic acid, picric acid, cinnamic acid, mandelic acid, Phthalic acid, lauric acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethane-disulfonic acid, 2-hydroxyethanesulfonic acid, benzene sulfonic
  • salts include sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium salts, and the like, if the compound contains basic functional groups, salts with non-toxic organic or inorganic acids, such as hydrohalides (eg hydro Chloride or hydrobromide), sulfate, phosphate, sulfamate, nitrate, acetate, trifluoroacetate, trichloroacetate, propionate, hexanoate, cyclopentylpropionate, glycolate, glutarate, pyruvate Bate, Lactate, Malonate, Succinate, Sorbate, Ascorbate, Maleate, Maleate, Fumarate, Tartarate, Citrate, Benzoate, 3- (4-hydroxybenzoyl) benzoate, Peak Late, cinnamate, mandelate, phthalate, laurate, methanesulfonate mesylate), ethanesulfone , 1,2-e
  • the igorsertip or a pharmaceutically acceptable salt thereof is administered to a subject or patient, wherein the “subject (s)” are animals, eg non-primates (eg, cattle, pigs, horses, cats, Mammals, including, for example, dogs, rats and mice) and primates (eg, monkeys such as cynomolgous monkeys, chimpanzees and humans), and eg humans.
  • the subject does not resist or respond to current treatments for hepatitis C infection.
  • the subject is a livestock animal (eg, horse, cow, pig, etc.) or a pet animal (eg, dog or cat).
  • the subject is a human.
  • therapeutic agent (s) or therapeutic composition refers to any agent (s) that can be used to treat or prevent a disorder or one or more indications thereof.
  • therapeutic agent refers to a ligosertip, which is a compound of the present invention.
  • therapeutic agent does not refer to a compound of the present invention.
  • the therapeutic agent is an agent that is known to be useful for treating or preventing a disorder or one or more indications thereof, has been used for this purpose, or is currently in use.
  • the ligosertip used in the process of the invention preferably uses a compound of formula (I), where appropriate in the form of a salt, alone, or one or more suitable pharmaceutically acceptable carriers such as diluents or adjuvants, Or by using a pharmaceutical composition containing in form in combination with another anti-HCV agent.
  • the derivatives of the present invention can be administered by any conventional route, in particular by oral, parenteral, rectal route, or by inhalation (eg in aerosol form).
  • compositions for oral administration tablets, pills, hard gelatin capsules, powders or granules can be used.
  • the compounds according to the invention are admixed with at least one inert diluent or adjuvant such as sucrose, lactose or starch.
  • inert diluent or adjuvant such as sucrose, lactose or starch.
  • These compositions may comprise, in addition to diluents, substances such as, for example, lubricants such as magnesium stearate, or coatings for controlled release.
  • inert diluents such as pharmaceutically acceptable solutions, suspensions, emulsions, syrups and elixirs containing water or liquid paraffin can be used.
  • these compositions may also include, in addition to diluents, substances such as, for example, wetting agents, sweetening agents or flavoring agents.
  • the composition for parenteral administration may be an emulsion or a sterile solution.
  • solvents or vehicles propylene glycol, polyethylene glycol, vegetable oils, in particular olive oil or injectable organic esters such as ethyl oleate can be used.
  • These compositions may also contain adjuvants, especially wetting agents, isotonic agents, emulsifiers, dispersants and stabilizers. Sterilization can be carried out in a number of ways, for example by using a filter for bacteria, by irradiation or by heating. They can also be prepared in the form of sterile solid compositions that, when used, can be dissolved in sterile water or any other injectable sterile medium.
  • compositions for rectal administration are suppositories or capsules for rectal administration, which contain, in addition to the active ingredient, excipients such as cocoa butter, semisynthetic glycerides or polyethylene glycols.
  • the composition may also be an aerosol.
  • the composition When used in liquid aerosol form, the composition may be a stable sterile solution, or a solid composition which, when used, is dissolved in non-pyrogenic sterile water, saline or any other pharmaceutically acceptable vehicle.
  • the active ingredient When used in anhydrous aerosol form for direct inhalation, the active ingredient is finely divided and mixed with a water soluble solid diluent or vehicle, for example dextran, mannitol or lactose.
  • compositions of the invention are pharmaceutical compositions or single unit dosage forms.
  • Pharmaceutical compositions and single unit dosage forms of the invention may be used in a prophylactic or therapeutically effective amount of one or more prophylactic or therapeutic agents (eg, a compound of the invention, or other prophylactic or therapeutic agents), and typically one or more pharmaceutically acceptable Carriers or excipients.
  • prophylactic or therapeutic agents eg, a compound of the invention, or other prophylactic or therapeutic agents
  • Carriers or excipients typically one or more pharmaceutically acceptable Carriers or excipients.
  • the term "pharmaceutically acceptable” means that it can be used in animals, more specifically in humans, as listed in a pharmacopoeia that has been approved or generally accepted by the government or regulatory bodies of the government. do.
  • carrier refers to a diluent, adjuvant (eg, Freund's adjuvant (complete and incomplete adjuvant)), excipient, or vehicle with which the therapeutic agent is administered.
  • Such pharmaceutical carriers can be sterile liquids such as water and oils including oils or synthetic oils of petroleum, animal or vegetable origin, for example peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is the preferred carrier when the pharmaceutical composition is administered intravenously.
  • Saline solutions and aqueous dextrose and glycerol solutions can also be used as liquid carriers, in particular injectable solutions.
  • suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences” by E. W. Martin.
  • compositions and dosage forms comprise one or more excipients.
  • Suitable excipients are known to those skilled in the pharmaceutical arts, and non-limiting examples of suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, flour, silica gel, sodium stearate, glycerol monostearate, Talc, sodium chloride, skim milk powder, glycerol, propylene, glycol, water, ethanol and the like.
  • suitable excipient to be incorporated into a pharmaceutical composition or dosage form depends on various factors known in the art, including the manner in which the dosage form is administered to the subject, the specific active ingredients included in the dosage form, and the like.
  • the composition or single unit dosage form may also contain small amounts of wetting or emulsifying agents, or pH buffers.
  • the invention also includes anhydrous pharmaceutical compositions and dosage forms comprising the active ingredient.
  • water eg 5%
  • the addition of water is widely accepted in the pharmaceutical industry as a simulated long term storage means for determining the properties (eg shelf life or stability) of a formulation over time.
  • water and heat accelerate the decomposition of some compounds.
  • water and / or moisture typically occur during the manufacture, handling, packaging, storage, transportation and use of the formulation, so the effect of water on the formulation can be very important.
  • Anhydrous pharmaceutical compositions and dosage forms of the invention can be prepared using anhydrous or low moisture components and low moisture or low humidity conditions. If it is anticipated to be in substantial contact with moisture and / or moisture during manufacture, packaging and / or storage, pharmaceutical compositions and dosage forms comprising lactose and at least one active ingredient comprising primary or secondary amines may be in anhydrous form. Is preferably.
  • Anhydrous pharmaceutical compositions should be prepared and stored so that their anhydrous properties are maintained. Therefore, it is desirable to package using known materials to prevent the anhydrous composition from exposure to water and to include it in a suitable specification kit. Examples of suitable packaging include, but are not limited to, sealed foils, plastics, unit dose containers (eg, vials), blister packs, and strip packs.
  • compositions and dosage forms comprising one or more compounds that reduce the rate of degradation of the active ingredient.
  • compounds include, but are not limited to, antioxidants (eg, ascorbic acid), pH buffers, or salt buffers.
  • compositions and single unit dosage forms can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release preparations and the like.
  • Formulations for oral administration may include standard carriers such as pharmaceutical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate and the like.
  • Such compositions and dosage forms contain a prophylactic or therapeutically effective amount of a prophylactic or therapeutic agent, preferably in purified form, together with a suitable amount of carrier, and will be provided in a form suitable for administration to a subject.
  • the formulation should be suitable for the mode of administration.
  • the pharmaceutical composition or single unit dosage form is sterile and is in a form suitable for administration to a subject, preferably an animal subject, more preferably a mammalian subject, and most preferably a human subject.
  • compositions of the invention are formulated to be suitable for their intended route of administration.
  • routes of administration include parenteral routes of administration such as intravenous, intradermal, subcutaneous, intramuscular, subcutaneous, oral, oral, sublingual, inhalation, intranasal, transdermal, topical, transmucosal, intratumoral, synovial and There is, but is not limited to, a rectal route of administration.
  • the composition is formulated into a pharmaceutical composition that has been modified for intravenous, subcutaneous, intramuscular, oral, intranasal or topical administration to a human according to conventional procedures.
  • the pharmaceutical composition is formulated into a composition that is administered subcutaneously to a human according to conventional procedures.
  • compositions for intravenous administration are solutions in sterile isotonic aqueous buffer.
  • the composition may also include solubilizers and local anesthetics (eg lignocaine) to soothe pain at the injection site.
  • dosage forms include tablets; Caplets; Capsules such as soft elastic gelatin capsules; Casein; Troches; Lozenges; Dispersion liquids; Suppositories; Ointment; Poultice (foam medicine); Paste; Powder; dressing; cream; salve; Solution; patch; Aerosols (eg, nasal sprays or inhalers); Gels; Liquid dosage forms suitable for oral or mucosal administration to a subject, including suspensions (eg, aqueous or non-aqueous liquid suspensions, oil-in-water emulsions, or water-in-oil liquid emulsions), solutions and elixirs; Liquid dosage forms suitable for parenteral administration to a subject; And sterile solids (eg, crystalline or amorphous solids) which, when restored, can provide a liquid dosage form suitable for parenteral administration to a subject.
  • suspensions eg, aqueous or non-aqueous liquid suspensions, oil-in-water
  • compositions, forms and dosage forms of the invention will typically vary depending on their use.
  • the dosage form used for the initial treatment of a viral infection may contain one or more active ingredients in an amount greater than the amount included in the dosage form used for the maintenance therapy of the viral infection.
  • parenteral dosage forms may contain one or more active ingredients in an amount less than that included in oral dosage forms used to treat the same disease or disorder.
  • Other ways of modifying this mode and the specific dosage forms encompassed by this invention will already be apparent to those skilled in the art. See, eg, Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing, Easton PA (1990).
  • compositions of the present invention are generally anhydrous lyophilized powders or water-free concentrates in sealed containers, such as ampoules or sachets, for example indicative of the amount of active agent, mixed separately or together in a unit dosage form. It is provided in the form.
  • the composition When the composition is administered by infusion, the composition may be dispensed into an infusion container containing sterile pharmaceutical grade water or saline.
  • sterile water or saline ampoules for injection may be provided to allow the components to be mixed prior to administration.
  • Conventional dosage forms of the present invention comprise a compound of the present invention, ligosertip, or a pharmaceutically acceptable salt, solvate or hydrate thereof in an amount ranging from about 0.1 mg to about 1000 mg / day, which is in the morning A single dose once a day or divided doses with meals preferably for one day.
  • compositions of the invention suitable for oral administration may be in separate dosage forms, such as tablets (eg chewing tablets), caplets, capsules and liquids (eg flavor syrups) and the like.
  • dosage forms contain a predetermined amount of active ingredient and can be prepared by methods of pharmacy known to those skilled in the art. In general, see Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing, Easton PA (1990).
  • oral dosage forms are solid and are prepared under anhydrous conditions using anhydrous ingredients as detailed in the paragraphs above.
  • compositions of the invention are prepared by combining the active ingredient (s) as an intimate mixture with one or more excipients according to conventional pharmaceutical synthesis techniques.
  • Excipients can take a wide variety of forms depending on the form of preparation desired for administration.
  • excipients suitable for use in liquid or aerosol dosage forms for oral administration include, but are not limited to, water, glycols, oils, alcohols, flavoring agents, preservatives and coloring agents.
  • Suitable excipients for use in solid oral dosage forms include, but are not limited to, starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders and disintegrants Does not.
  • solid excipients When solid excipients are used, they appear in the most advantageous oral dosage unit form because tablets and capsules are easy to administer. If desired, tablets may be coated by standard aqueous or non-aqueous techniques.
  • Such dosage forms can be prepared by any of the methods of preparation.
  • compositions and dosage forms are prepared by uniformly and intimately mixing the active ingredient with a liquid carrier, a finely divided solid carrier, or both, and then molding the product, if necessary, into the desired shape.
  • tablets can be made by compression or molding.
  • Compressed tablets may be prepared by compressing, in a suitable machine, the active ingredient in a free flowing form (eg, powder or granules), optionally mixed with excipients.
  • Molded tablets may be made by molding in a suitable machine a mixture of powdered compounds moistened with an inert liquid diluent.
  • excipients that can be used in oral dosage forms of the invention include, but are not limited to, binders, fillers, disintegrants and lubricants.
  • Suitable binders for use in pharmaceutical compositions and dosage forms include corn starch, potato starch or other starch, gelatin, natural and synthetic gums such as acacia gum, sodium alginate, alginic acid, other alginates, powder tragacanth, guar gum, Cellulose and its derivatives (e.g. ethyl cellulose, cellulose acetate, carboxymethyl cellulose calcium, sodium carboxymethyl cellulose), polyvinyl pyrrolidone, methyl cellulose, pregelatinized starch, hydroxypropyl methyl cellulose, (e.g. , 2208, 2906, 2910), microcrystalline cellulose, and mixtures thereof.
  • natural and synthetic gums such as acacia gum, sodium alginate, alginic acid, other alginates, powder tragacanth, guar gum,
  • fillers suitable for use in the pharmaceutical compositions and dosage forms disclosed herein include talc, calcium carbonate (eg, granules or powders), microcrystalline cellulose, powdered cellulose, dexrate, kaolin, mannitol, silicic acid, sorbitol, starch , Pregelatinized starch, and mixtures thereof, but is not limited thereto.
  • the binder or filler included in the pharmaceutical composition of the present invention is typically present in an amount of about 50 to about 99 weight percent of the pharmaceutical composition or dosage form.
  • Suitable forms of microcrystalline cellulose include AVISEL PH 101, AVICEL PH 103, AVICEL RC 581, AVICE PH 105 and are commercially available (FMC Corporation, American Viscose Division, Avicel Sales). Sales; commercially available from Markus Hook, Pennsylvania, USA), and mixtures thereof.
  • disintegrants in the compositions of the present invention provides tablets that disintegrate when exposed to an aqueous environment. Tablets containing too much disintegrant may disintegrate upon storage, and tablets containing too little disintegrant may not disintegrate at the desired rate or under the desired conditions. Therefore, a sufficient amount of disintegrant should not be used to form the solid oral dosage form of the present invention, which is neither too much nor too little to deleteriously alter the release of the active ingredient.
  • the amount of disintegrant used depends on the type of formulation and can be readily determined by one skilled in the art. Typical pharmaceutical compositions comprise about 0.5 to about 15 weight percent, specifically about 1 to about 5 weight percent disintegrant.
  • Disintegrants that can be used in the pharmaceutical compositions and dosage forms of the invention include agar, alginic acid, calcium carbonate, microcrystalline cellulose, croscarmellose sodium, crospovidone, polyacrylic potassium, sodium starch glycolate, potato or tapioca starch, Pregelatinized starch, other starches, clays, other algins, other celluloses, gums, and mixtures thereof.
  • Lubricants that can be used in the pharmaceutical compositions and dosage forms of the present invention include calcium stearate, magnesium stearate, mineral oil, mineral diesel, glycerin, sorbitol, mannitol, polyethylene glycol, other glycols, stearic acid, sodium lauryl sulfate Talc, hydrogenated vegetable oils (e.g. peanut oil, cottonseed oil, sunflower seed oil, sesame oil, olive oil, corn oil and soybean oil), zinc stearate, ethyl oleate, ethyl laurate, agar, and their Mixtures are but are not limited to these.
  • hydrogenated vegetable oils e.g. peanut oil, cottonseed oil, sunflower seed oil, sesame oil, olive oil, corn oil and soybean oil
  • zinc stearate ethyl oleate, ethyl laurate, agar, and their Mixtures are but are not limited to these.
  • Additional lubricants include, for example, siloid silica gel (AEROSIL 200, manufactured by WR Grace Co., Baltimore, MD), solidified aerosol of synthetic silica (Degussa Corporation) (Available from Degussa Co., Piano, Tex.), CAB O SIL (pyrogenic silicon dioxide product, from Cabot Co .; Boston, Mass.), And mixtures thereof. .
  • AEROSIL 200 siloid silica gel
  • Degussa Corporation solidified aerosol of synthetic silica
  • CAB O SIL pyrogenic silicon dioxide product, from Cabot Co .; Boston, Mass.
  • lubricants are typically used in amounts less than about 1% by weight of the pharmaceutical composition or dosage form into which they are incorporated.
  • the ligosertip of the present invention can be administered, for example, by controlled release means or delivery devices known to those skilled in the art.
  • dosage forms can be, for example, hydropropylmethyl cellulose, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings, particulates, liposomes, microspheres, or combinations thereof to provide a desired release profile at various ratios.
  • Water may be used to delay or release controlled release of one or more active ingredients.
  • Suitable controlled release formulations known to those skilled in the art, including those described herein, can be readily selected for use with the active ingredients of the present invention. Accordingly, the present invention includes single unit dosage forms suitable for oral administration, such as tablets, capsules, gelcaps and caplets, etc., modified to controlled release.
  • controlled release drugs have a common purpose to provide improved drug therapies than are achieved by their corresponding non-controlled release drugs.
  • the use of controlled release formulations that are best designed for medical treatment is characterized by the use of a minimum amount of drug substance to cure or control symptoms within a minimum amount of time.
  • Advantages of controlled release formulations include extended activity of the drug, a decrease in the number of doses and an increase in compliance of the subject.
  • controlled release formulations may be used to affect the time of onset of the drug or other properties such as blood levels of the drug, thus affecting the development of side effects (adverse effects).
  • Controlled release of the active ingredient can be stimulated by a variety of conditions including pH, temperature, enzymes, water, or other physiological conditions or compounds, and the like.
  • the drug can be administered using intravenous infusion, implantable osmotic pumps, transdermal patches, liposomes, or other modes of administration.
  • a pump can be used (Sefton, CRC Crit. Ref. Biomed. Eng. 14: 201 (1987)); Buchwald et al., Surgery 88: 507 (1980); Saudek et al., N. Engl. J. Med. 321: 574 (1989).
  • polymeric materials can be used.
  • a controlled release system can be located at a suitable site determined by one of skill in the art in a subject, ie only a portion of the systemic dosage is required (eg, Goodson, Medical Applications of Controlled Release, vol. 2, pp. 115-138 (1984)). Other controlled release systems have been reviewed and discussed by Langer (Science 249: 1527-1533 (1990)).
  • the active ingredient is a solid internal matrix such as polymethylmethacrylate, polybutylmethacrylate, plasticized or unplasticized polyvinylchloride, plasticized nylon, plasticized polyethylene terephthalate, natural rubber, polyisoprene , Polyisobutylene, polybutadiene, polyethylene, ethylene-vinylacetate, copolymers, silicone rubber, polydimethylsiloxane, silicone carbonate copolymers, hydrogels of hydrophilic polymers such as acrylic acid and methacrylic acid, collagen, It can be dispersed in crosslinked polyvinylalcohol and partially hydrolyzed crosslinked polyvinyl acetate, which is an external polymer membrane such as polyethylene, polypropylene, ethylene / propylene copolymer, ethylene / ethyl acrylate copolymer, ethylene / vinyl Acetate copolymer, silicone rubber, polydimethyl siloxane, four Friendly rubber, chlorinated polyethylene, polyvinyl
  • parenteral dosage forms can be administered to a subject by a variety of routes including subcutaneous, intravenous (including bolus injection), intramuscular and intraarterial routes of administration, and the like. Because these parenteral routes of administration typically bypass the subject's natural defenses against contaminants, parenteral dosage forms are preferably sterile or can be sterilized prior to administration to the subject. Examples of parenteral dosage forms include, but are not limited to, injectable solutions, anhydrous products that can be dissolved or suspended in pharmaceutically acceptable injectable vehicles, injectable suspensions, and emulsions.
  • Suitable vehicles are known to those skilled in the art that can be used to provide the parenteral dosage forms of the invention. Examples of these include water for injection (USP); Aqueous vehicles such as sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, lactated Ringer's injection, and the like; Water miscible vehicles such as ethyl alcohol, polyethylene glycol, polypropylene glycol, and the like; And non-aqueous vehicles such as corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate and benzyl benzoate, and the like. In addition, compounds that increase the solubility of one or more active ingredients disclosed herein may also be incorporated into the parenteral dosage forms of the invention.
  • Transdermal, topical and mucosal dosage forms of the invention include, but are not limited to, ophthalmic solutions, sprays, aerosols, creams, lotions, ointments, gels, solutions, emulsions, suspensions or other forms known to those skilled in the art. See, eg, Remington's Pharmaceutical Sciences, 16th, 18th and 20th eds., Mack Publishing, Easton PA (1980, 1990 & 2000) and Introduction to Pharmaceutical dose form, 4th ed., Lea & Febiger, Philadelphia (1985). )].
  • Suitable dosage forms for treating oral mucosal tissue may be formulated as oral cleaning solutions or oral gel formulations.
  • transdermal dosage forms include "reservoir” or “matrix” patches, which may be skin or wound The site may be applied for a certain period of time to infiltrate the desired amount of active ingredient.
  • Suitable excipients included in the present invention, and other materials that can be used to provide transdermal, topical and mucosal dosage forms, are known to those of ordinary skill in the art of pharmacy, and they are given in any given pharmaceutical composition or dosage form. It depends on the specific organization to which it applies. In view of this fact, conventional excipients include water, acetone, ethanol, ethylene glycol, propylene glycol, butane 1,3 diol, isopropyl myristate, isopropyl, forming lotions, tinctures, creams, emulsions, gels or ointments.
  • conventional excipients include water, acetone, ethanol, ethylene glycol, propylene glycol, butane 1,3 diol, isopropyl myristate, isopropyl, forming lotions, tinctures, creams, emulsions, gels or ointments.
  • humectants or humectants may also be added to the pharmaceutical compositions and dosage forms. Examples of such additional ingredients are known in the art. See, eg, Remington's Pharmaceutical Sciences, 16th, 18th and 20th eds., Mack Publishing, Easton PA (1980, 1990 & 2000).
  • additional ingredients may be used prior to treatment with the active ingredients of the invention, used with the active ingredients of the invention, or after treatment with the active ingredients of the invention.
  • penetration enhancers can be used to assist in delivering the active ingredient to the tissue.
  • Suitable penetration enhancers include acetone; Various alcohols such as ethanol, oleyl and tetrahydrofuryl; Alkyl sulfoxides such as dimethyl sulfoxide; Dimethyl acetamide; Dimethyl formamide; Polyethylene glycol; Pyrrolidones such as polyvinylpyrrolidone; Kollidon grades (povidone, polyvidone); Urea; And various water soluble or water insoluble sugar esters such as Tween 80 (polysorbate 80) and Span 60 (sorbitan monostearate).
  • the pH of the pharmaceutical composition or dosage form or the pH of the tissue to which the pharmaceutical composition or dosage form is applied can be adjusted to improve delivery of one or more active ingredients.
  • the delivery can be improved by adjusting the polarity of the solvent carrier, its ionic strength or tension.
  • the delivery may also be improved by adding a compound, such as stearate, to the pharmaceutical composition or dosage form to advantageously alter the hydrophilicity or lipophilicity of one or more active ingredients.
  • stearates may act as liquid vehicles for formulation, emulsifiers or surfactants, and delivery or penetration enhancers.
  • Other salts, hydrates or solvates of the active ingredient can be used to further adjust the properties of the resulting composition.
  • the physician When treating a human, the physician will determine the dosage that is considered most appropriate, depending on the prophylactic or curative treatment, and the age, weight, stage of infection and other factors specific to the subject to be treated. Generally, for adults, the dosage is about 1 to about 1000 mg / day, about 5 to about 250 mg / day, or about 10 to 50 mg / day. In certain embodiments, the dosage is about 5 to about 400 mg / day, more preferably 25 to 200 mg / day, per adult. Also preferred is a dosage rate of about 50 to about 500 mg / day.
  • the present invention provides a method of treating or preventing a hepatitis C virus infection by administering to a subject in need thereof an effective amount of a compound of the invention having a high therapeutic index for the hepatitis C virus or a pharmaceutically acceptable salt thereof.
  • Hepatitis C virus infection a method for treating or preventing liver disease caused by such a virus.
  • the therapeutic index can be measured according to any method known to those skilled in the art, such as those described in the Examples below.
  • the therapeutic index is the ratio of the concentration of the compound that is toxic to the concentration of the compound effective for hepatitis C virus.
  • Toxicity can be measured by any technique known to those of skill in the art, including cytotoxicity (eg IC50 or IC90) and lethal dose (eg LD50 or LD90).
  • the effective concentration can be measured using any technique known to those skilled in the art, including effective concentrations (eg, EC50 or EC90) and effective doses (eg, ED50 or ED90).
  • similar measurements are compared in proportions (eg IC50 / EC50, IC90 / EC90, LD50 / ED50 or LD90 / ED90).
  • the therapeutic index may be as high as 2.0, 5.0, 10.0, 15.0, 20.0, 25.0, 50.0, 75.0, 100.0, 125.0, 150.0 or more.
  • the amount of a compound or composition of the present invention effective to prevent, treat, manage or ameliorate a disorder or one or more indications thereof will vary depending on the nature and severity of the disease or condition and the route by which the active ingredient is administered.
  • the frequency and dosage of administration may also be determined for each subject depending on the particular therapy (eg, therapeutic or prophylactic) administered, the severity of the disorder, disease or condition, the route of administration as well as the subject's age, weight, response and past history. It will depend on the specific element. Effective dosages may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
  • composition dosages are amounts of active compound (mg or ⁇ g) per kilogram of subject or sample, for example about 10 ⁇ g / kg to about 50 mg / kg, about 100 ⁇ g / kg to about 25 mg / kg, or about 100 ⁇ g / kg to about 10 mg / kg.
  • the dosage administered to a subject is typically 0.140 mg to 3 mg per kg body weight of the subject based on the weight of the active compound.
  • the dosage administered to a subject is 0.20 mg to 2.00 mg or 0.30 mg to 1.50 mg per kg body weight of the subject.
  • the daily dosage range of the compositions of the present invention proposed for the symptoms described herein is about 0.1 to about 1000 mg / day, which is a single dose once a day or divided doses throughout the day. In one embodiment, the daily dose is divided into equal amounts and administered twice daily.
  • the daily dosage range should be about 10 to about 200 mg / day, more specifically about 10 to about 150 mg / day, even more specifically about 25 to about 100 mg / day.
  • the clinician or therapist will know when and how to stop, adjust or terminate the therapy with respect to the subject's response.
  • compositions of the present invention can be administered for different diseases and conditions.
  • an amount sufficient to prevent, manage, treat or ameliorate the disorder but not sufficient to cause side effects associated with the compositions of the present invention or sufficient to reduce the side effects is also included in the dosage and frequency schedule described above. do.
  • the dosage administered to a subject can be increased to improve the prophylactic or therapeutic effect of the composition, which can be reduced to reduce one or more side effects experienced by a particular subject.
  • the ligosertip of the present invention or a food acceptable salt thereof may be used for the improvement or prevention of liver disease caused by hepatitis C virus, and thus the present invention provides the ligosertip or a foodstuff thereof.
  • the present invention relates to a nutraceutical composition for improving or preventing liver disease caused by HCV containing an acceptable salt as an active ingredient.
  • the health functional food of the present invention can be prepared and processed in the form of tablets, capsules, powders, granules, liquids, pills and the like for the purpose of preventing and improving liver disease caused by HCV.
  • health functional food used in the present invention refers to a food manufactured and processed using raw materials or ingredients having functional properties useful for the human body according to Act No. 6767 of the Health Functional Food Act, and the structure and function of the human body. It means the ingestion for the purpose of obtaining a useful effect for health use such as nutrient control or physiological action.
  • the health functional food of the present invention may include a conventional food additive, and the suitability as a food additive, unless otherwise specified, in accordance with the General Regulations of the Food Additives and General Test Methods approved by the Food and Drug Administration, etc. Judging by the standards and standards.
  • Food Additive Reduction examples include chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid and cinnamic acid; Natural additives such as dark blue pigment, licorice extract, crystalline cellulose, high amount pigment and guar gum; And mixed preparations such as sodium L-glutamate, algae additives, preservatives and tar dyes.
  • the health functional food in the form of tablets is granulated in a conventional manner by mixing a mixture of ligosertip, an active ingredient of the present invention with excipients, binders, disintegrants and other additives, and then compressed with a lubricant and the like. Or the mixture can be directly compression molded.
  • the health functional food in the form of tablets may contain a mating agent or the like as necessary.
  • Hard capsules of the health functional food in the form of capsules can be prepared by filling a conventional hard capsules mixture of a mixture of ligosertip, which is the active ingredient of the present invention, with additives such as excipients, and the soft capsule is excipient
  • the mixture mixed with such additives can be prepared by filling in a capsule base such as gelatin.
  • the soft capsule agent may contain a plasticizer such as glycerin or sorbitol, a colorant, a preservative, and the like, as necessary.
  • the health functional food in the form of a cyclic form may be prepared by molding a mixture of the compound of Formula 1, an excipient, a binder, a disintegrant, etc., which is the active ingredient of the present invention by a known method, and if necessary, sucrose or other It may be encapsulated with a skin coating, or the surface may be coated with a material such as starch, talc.
  • the health functional food in the form of granules can be prepared in the form of a mixture of a mixture of ligosertip and excipients, excipients, binders, disintegrants, etc., which are the active ingredients of the present invention, by a conventionally known method. And the like.
  • the health functional food may be beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes and health supplements.
  • Intracellular molecules that bind miRNA-122 which is known to play an essential role in the translation / replication / proliferation of hepatitis C virus (Jopling et al.), Were searched. It was analyzed by intracellular molecules that bind to biotinylated miRNA-122 using LC-MS / MS technique. As a result, ELAVL1 / HuR was identified and specific binding between miRNA-122 and ELAVL1 / HuR was removed. In order to monitor transcription / cloning of HCV at knockout), the following experiment was performed.
  • FIG. 1A There are four types of isomiR for miRNA-122 in liver cells (FIG. 1A). Specific binding between miRNA-122s was confirmed by RNA electro-mobility shift assay (REMSA), and specific recombinant ELAVL1 / HuR purification was performed. And REMSA process is as follows.
  • Esherichia coli Recombinant glutathione from plasmid pGEX-KG-HuR (WT) using strain BL21 (DE3) pLysS (Promega) S ELAVL1 / HuR (GST-HuR) fused to transferase (GST) was produced.
  • Isopropyl- ⁇ -D-thio galactopyranoside was added to induce GST-HuR protein expression at OD 600 0.5.
  • cells are harvested and lysed [20 mM phosphate (pH 7.6), 300 mM NaCl, 0.5 mM phenyl methane sulfonylfluoride (PMSF), 1 mM ⁇ -mercaptoethanol and 10% glycerol (v / v)] followed by sonication.
  • the resulting cell extracts were loaded into glutathione agarose 4B (Peptron, Dajeon, Korea), washed with lysis buffer, and bound GST-HuR was eluted with reduced glutathione.
  • RNA-protein complex was added to a 5% non-denatured gel. Analyzed by auto radiography.
  • the wild type had only one nucleotide difference in the 3 ′ end region of miRNA-122, the binding of which was the strongest, indicating that the 3 ′ end region of miRNA-122 was very important for binding to ELAVL1 / HuR.
  • 1B shows that ELAVL1 / HuR accounts for 70% of human hepatocyte miRNA and binds directly to miRNA-122, which is known to play an essential role in the replication process of hepatitis C virus.
  • luciferase-expressing hepatitis C subgenomic replicons derived from the infectious hepatitis C virus production system (pJFH1) were introduced and identified using the CRISPR / Cas9 system ELAVL1 / HuR.
  • pJFH1 infectious hepatitis C virus production system
  • Knockout using the CRISPR / Cas9 system of the target genes was performed using pLentiCRISPRv2 (Addgene) and stably transduced Huh7 cells were selected using puromycin. Cells were selected with puromycin and collected and colonies of selected Huh7 cells were analyzed using Western blot 30 days after infection. Genomic DNA of selected colonies was isolated using the Genomic DNA Column Kit (Zymo Reserch), amplified from genomic DNA adjacent to the ELAVL1 / HuR target site for the inserted guide RNA sequence and DNA sequencing of the resulting amplicon sequences (Cosmo). Genentech).
  • pSGR-JFG1 / Luc-GND (Ralf Bartenschlager), which is a mutant of the activation site of pSGR-JFG1 / Luc or NS5B, which is a subgenomic replicon capable of two types of Rutherase assays, is digested with restriction enzymes and then in vitro transcription is performed.
  • RNA of luciferase-expressing hepatitis C subgenomic replicon was synthesized.
  • the naive Huh7 cell line or CRISPR / Cas9 gene shears were used to transduce ELAVL1 / HuR knockout cells using electroporation (1 ug of RNA into 1 ⁇ 10 ⁇ 6 cells).
  • Fractionated cells were lysed with 1 ⁇ passive lysis buffer (Promega), and a portion of the lysate was analyzed by the Dual-Luciferase® Reporter Assay System (Promega), and the firefly luciferase signal was normalized to Renilla signal or total protein amount.
  • HCV subgenomic replicons are available. Primary screening was attempted using inhibitor libraries for various kinases in the cell.
  • the Huh7 cell line containing assayable HCV 1b subgenomic replicon HIRL-2Aneo-NSrep was plated, followed by treatment with Selleckchem cellular kinase inhibitory chemicals (Korea Research Institute of Bioscience and Biotechnology) to a concentration of 1 ⁇ M, followed by luciferase assay 24 hours later was performed.
  • Fractionated cells were lysed with 1 ⁇ passive lysis buffer (Promega), and a portion of the lysate was analyzed by the Dual-Luciferase® Reporter Assay System (Promega), and the firefly luciferase signal was normalized to Renilla signal or total protein amount.
  • Example 2 In order to reverify that the ligosertip identified in Example 2 is a specific and effective inhibitor against HCV infection, the following experiment was additionally performed.
  • HCV 1b subgenomic replicon HIRL-2Aneo-NSrep and firefly luciferase were assayed for HCV-specific inhibitor ligosertip, which was discovered using a subgenomic replicon of HCV capable of reporter assay in the same line as the screening result of Example 2.
  • Huh7 cell line was plated by 2 ⁇ 10 ⁇ 4 cells in 24 wells, 1 ⁇ M of rigosertib was treated for 0, 24, 48, and 72 hours, and then fractionated at each time period to perform luciferase assay.
  • Fractionated cells were lysed with 1 ⁇ passive lysis buffer (Promega) and a portion of the lysate was analyzed by Dual-Luciferase® Reporter Assay System (Promega). Renilla signals were normalized to firefly luciferase signals.
  • the inhibition mechanism of ligosertip according to the present invention unlike the anti-HCV therapeutic agent developed in the past, inhibits the action of host factors (acting molecules of human hepatocytes) that are not proteins produced by HCV itself (miRNA- Because it does not target 122 and ELAVL1 / HuR) and HCV proteins, it is expected to be a new concept of anti-hepatitis C virus that can solve the problem of resistance to drug. It is expected to be a good treatment strategy for HCV which is inexpensive and does not cause resistance because it is used alone or in combination with previously known ribavirin.
  • SEQ ID NO: 1 Wild type of miR-122
  • SEQ ID NO: 2 (Isomir of miR-122 (+ A)):
  • SEQ ID NO: 3 (Isomir of miR-122 (+ U)):
  • SEQ ID NO: 4 (Isomir of miR-122 (-G)):

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 리고세르팁의 신규 용도에 대한 것으로, 보다 상세하게는 내성 문제없이 HCV 감염을 특이적이고 효과적으로 저해할 수 있는 리고세르팁의 C형 간염 바이러스에 의한 간질환의 예방 또는 치료용 용도 및 C형 간염 바이러스에 대한 항바이러스 용도에 대한 것이다. 본 발명에 따른 리고세르팁은 마이크로 RNA-122와 ELAVL1/HuR의 결합을 저해함으로써 HCV 감염에 대한 특이적이고 효과적인 치료제가 될 수 있다. 더욱이, 기존 개발된 항 HCV 치료제와 달리 HCV 단백질을 표적 화하지 않고 인간의 간세포 작용분자들의 작용을 저해하는바, 기존에 개발된 약물에 대한 내성문제를 해결할 수 있는바 단독으로 사용되거나, 기존에 알려진 치료제와의 병용 치료가 가능하여, 내성을 유발하지 않은 HCV의 좋은 치료전략으로써도 유용하다.

Description

C형 간염 바이러스 질환 치료를 위한 리고세르팁의 신규 용도
본 발명은 리고세르팁의 신규 용도에 대한 것으로, 보다 상세하게는 리고세르팁의 C형 간염 바이러스에 의한 간질환의 예방 또는 치료용 용도 및 C형 간염 바이러스에 대한 항바이러스 용도에 대한 것이다.
리고세르팁(rigosertib, Onconova Therapeutics, Inc.)은 기존에 항암제로 알려져 있는 합성 벤질 스티릴 술폰 물질로, 증식성 질환의 치료(US7598232), 골수이형성 증후군 및 급성 골수성 백혈병 치료(US8664272) 등의 효과가 알려져 있다. 그러나, 간질환, 더 나아가 C형 간염과 관련된 용도는 보고된 바 없다.
신약 재창출(Drug Repositioning)은 현재 사용 중인 의약품의 새로운 적응증을 개발하는 개념으로 신약 개발의 성공가능성을 획기적으로 개선할 대안으로 인식되고 있다. 신약 재창출은 신약 후보물질에 대한 안전성이 검증되어 유효성만 확인되면 신약개발에 소요되는 비용과 기간을 단축할 수 있어 신약개발의 성공 가능성이 크다. 신약 재창출은 (1) 약물(Drug)의 용법과 제조법 및 안정성이 확립되어 있고; (2) ADMET(Absorption, Distribution, Metabolism, Excretion and Toxicity) 데이터, 즉 약물 흡수율, 확산, 대사, 배출 및 약물 독성 정보가 확립되어 있으며; (3) 약물 용도 변경 전 약물의 임상시험의 결과를 바탕으로 안전성의 문제로 인한 실패 확률이 현저히 낮고; (4) 시판 후 감시(Post-marketing Surveillance; PMS) 안전성 데이터를 확보하는데 시간을 소모할 필요가 없는 장점을 갖는다.
한편, C형 간염은 대부분 감염 초기에 증상이 없으며 성인에게 감염된 경우 B형 간염 바이러스 감염과 달리 75% 이상에서 만성화되는 것으로 알려져 있다. 만성 C형 간염은 체내 면역계가 C형 간염 바이러스를 완전히 제거하지 못하고 감염상태가 6개월 이상 지속되는 경우로 만성적으로 간의 염증이 지속되는 질환을 말한다.
C형 간염 바이러스(Hepatitis C virus, HCV)는 플라비바이러스과(Flaviviridae)의 헤파시바이러스 속(hepacivirus genus)으로 분류되는 RNA 바이러스로서, 1989년에 미국에서 발견되었다. 이는 간염, 간경변(cirrohosis)과 간암(HCC, Hepatocellular carcinoma)을 유발하는 임상적으로 매우 중요한 바이러스이며, 미국이나 유럽 등의 선진국에서는 HCV가 만성간염의 주원인이다. WHO에 따르면 C형 간염 바이러스 (HCV, Hepatitis C virus)는 전 세계적으로 전체 인구의 3%가 넘는 약 2억 명이 감염되어 있고 매년 3-4 백만 명의 추가 감염자가 늘고 있어 더욱 심각한 문제로 대두하고 있다.
특히 이는 치료 없이 자연적으로 바이러스가 사라지는 경우는 거의 없고, 20~25년의 기간을 거치면서 5~20%가 간경변증으로 진행되며, 간경변증으로 진행한 환자는 연간 1~5%의 발생률로 간암으로 진행되는 것으로 알려져 있다. 국내 간경변증 환자의 12%, 간세포암 환자의 15% 내외가 C형 간염 바이러스에 의해 질환이 발병되며 B형 간염 바이러스와 함께 만성간질환을 일으키는 주요 원인으로 알려져 있다.
현재까지 HCV의 치료제로 널리 사용되고 있는 것은 페그인터페론(peginterferon)와 리바비린(Ribavirin)과의 병합 요법(co-therapy)이며 치료율은 30-50%에 불과하며, 이 또한 HCV의 유전형에 따라 그 효과가 상이하다. 최근에 Gilead Sciences의 Sovaldi 그리고 Harvoni와 같이 HCV non-structural 단백질을 표적화한 치료제들이 보고되고 있으나, 이들은 대다수 환자들의 치료제로 적용하기에는 고가의 비용이 문제가 된다.
항바이러스제의 개발은 내성 바이러스 출현, 약제 부작용, 높은 생산 비용 등을 극복하도록 지속적으로 요구되고 있다. HCV의 경우 감염성 있는 바이러스를 생산할 수 있는 시스템을 개발한 지 오래되지 않았고 돌연변이율도 높아 잦은 변종의 출현되고 있어, 새로운 작용기전으로 폭넓게 작용하는 치료 약물의 개발이 시급하게 요구되고 있는 상황이다.
이에 본 발명자들은 HCV 감염에 특이적이고 효과적으로 작용하면서도 기존 약물의 내성문제를 해결할 수 있는 새로운 HCV 감염에 의한 간질환 치료 또는 예방제를 개발하고자 예의 노력한 결과, C형 간염 바이러스 복제에 필수불가결한 역할을 하는 것으로 알려진 miRNA-122번과 특이적으로 결합하는 세포내 분자인 ELAVL1/HuR을 발견하고, 이 ELAVL1/HuR이 리고세르팁과 특이적이고 강력하게 직접적으로 결합함을 밝힘으로써, 리고세르팁이 HCV의 번역/복제에 중요한 miRNA-122와 ELAVL1/HuR의 결합을 저해함으로써, HCV감염에 대한 특이적이고 효과적인 억제제로, 항 HCV 치료제로써의 의약용도를 가짐을 확인하고, 본 발명을 완성하였다.
본 배경기술 부분에 기재된 상기 정보는 오직 본 발명의 배경에 대한 이해를 향상시키기 위한 것이며, 이에 본 발명이 속하는 기술분야에서 통상의 지식을 가지는 자에게 있어 이미 알려진 선행기술을 형성하는 정보를 포함하지 않을 수 있다.
본 발명의 목적은 새로운 C형 간염 바이러스에 의한 간질환을 예방 또는 치료할 수 있는 약학적 조성물을 제공하는 데 있다.
본 발명의 다른 목적은 C형 간염 바이러스에 대한 항바이러스 조성물을 제공하는데 있다.
본 발명의 또 다른 목적은 C형 간염 바이러스에 의한 간질환을 예방 또는 개선할 수 있는 건강기능식품 조성물을 제공하는 데 있다.
본 발명의 또 다른 목적은 C형 간염 바이러스에 의한 간질환 예방 또는 치료 방법을 제공하는데 있다.
본 발명의 또 다른 목적은 C형 간염 바이러스에 의한 간질환 예방 또는 치료 용도를 제공하는데 있다.
본 발명의 또 다른 목적은 C형 간염 바이러스에 대한 항바이러스 용도를 제공하는데 있다.
상기 목적을 달성하기 위하여, 본 발명은 리고세르팁의 신규 용도를 제공한다.
구체적으로, 본 발명은 리고세르팁(rigosertib) 또는 이의 약학적으로 허용가능한 염의 C형 간염 바이러스에 의한 간질환 예방 또는 치료 용도를 제공한다.
구체적으로, 본 발명은 리고세르팁(rigosertib) 또는 이의 약학적으로 허용가능한 염의 C형 간염 바이러스에 대한 항바이러스 용도를 제공한다.
구체적으로, 본 발명은 리고세르팁(rigosertib) 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 C형 간염 바이러스(Hepatitis C virus, HCV)에 의한 간질환의 치료 또는 예방을 위한 약학적 조성물을 제공한다.
본 발명은 또한, 리고세르팁 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 HCV에 대한 항바이러스 조성물을 제공한다.
본 발명은 또한, 리고세르팁 또는 이의 식품학적으로 허용가능한 염을 유효성분으로 함유하는 HCV에 의한 간질환의 개선 또는 예방을 위한 건강기능식품 조성물을 제공한다.
구체적으로, 본 발명은 리고세르팁(rigosertib) 또는 이의 약학적으로 허용가능한 염의 C형 간염 바이러스에 의한 간질환 예방 또는 치료 방법을 제공한다.
본 발명은 신규 용도로써, C형 간염 바이러스에 의한 간질환 치료,예방 용도, 항바이러스 용도, 내성 문제없이 HCV 감염을 특이적이고 효과적으로 저해할 수 있는 새로운 HCV에 대한 항바이러스제 및 HCV에 의한 간질환의 예방 또는 치료용 조성물을 제공한다.
본 발명에 따른 리고세르팁은 마이크로 RNA-122와 ELAVL1/HuR의 결합을 저해함으로써 HCV 감염에 대한 특이적이고 효과적인 치료제가 될 수 있다. 더욱이, 기존 개발된 항 HCV 치료제와 달리 HCV 단백질을 표적 화하지 않고 인간의 간세포 작용분자들의 작용을 저해하는바, 기존에 개발된 약물에 대한 내성문제를 해결할 수 있는바 단독으로 사용되거나, 기존에 알려진 치료제와의 병용 치료가 가능하여, 내성을 유발하지 않은 HCV의 좋은 치료전략으로써도 유용하다.
도 1은 miRNA-122은 ELAVL1/HuR과 직접적으로 결합함과 ELAVL1/HuR 효능 검증 결과를 나타내는 것으로, 1A는 miRNA-122의 isomiR 구조들이고, 1B는 GST-HuR을 이용한 RNA electro mobility shift assay (REMSA) 결과이미지이고, 1C는 번역/복제 assay가 가능한 HCV subgenomic replicon을 이용한 세포내 분자 ELAVL1/HuR의 효능검증 결과이며, 1D는 CRISPR/Cas9 system을 이용하여 Huh7 세포내 ELAVL1/HuR을 특이적으로 knockout 시켰을 때의 웨스팅 블랏 결과이미지이다.
도 2A는 리포터 에세이가 가능한 HCV의 subgenomic replicon (HIRL-2Aneo-NSrep)의 구조 및 Seleckchem cellular kinase inhibitor libray를 이용한 HCV 번역/증식과정을 저해하는 화합물의 스크리닝 결과 그래프이고, 2B는 재조합 GST-HuR 단백질과 biotin-rigosertb간의 직접적인 결합을 in vitro pulldown assay를 통해서 검증한 결과 이미지이며, 2C 및 2D는 리고세르팁과 비오틴-리고세르팁의 화학구조를 나타내며, 2E는 세포 내의 분자들과 HCV 간의 상호작용도 (ELAVL1/HuR-마이크로RNA-122-HCV 번역/복제)를 나타낸 것이다.
도 3은 HIRL-2Aneo-NSrep_FL Huh-7 루시퍼라아제 어세이를 통하여 리고세르팁의 항-HCV 효과를 재검증한 그래프이다.
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명의 상세한 설명 등에서 사용되는 주요 용어의 정의는 다음과 같다.
본 발명에서의 용어 "치료"는 이롭거나 바람직한 임상적 결과를 수득하기 위한 접근을 의미한다. 본 발명의 목적을 위해서, 이롭거나 바람직한 임상적 결과는 비제한적으로, 증상의 완화, 질병 범위의 감소, 질병 상태의 안정화(즉, 악화되지 않음), 질병 진행의 지연 또는 속도의 감소, 질병 상태의 개선 또는 일시적 완화 및 경감(부분적이거나 전체적일 수 있음), 검출가능하거나 또는 검출되지 않거나의 여부를 포함한다. "치료"는 치료학적 치료 및 예방적 또는 예방 조치 방법 모두를 가리킨다. 상기 치료들은 예방되는 장애뿐만 아니라 이미 발생한 장에에 있어서 요구되는 치료를 포함한다. 질병을 "완화(palliating) "하는 것은 치료를 하지 않는 경우와 비교하여, 질병상태의 범위 및/또는 바람직하지 않은 임상적 징후가 감소되거나 진행의 시간적 추이가 늦춰지거나 길어지는 것을 의미한다.
본 발명에서의 용어 "예방"은 질환의 임상 증상이 발달하지 않도록 질환 또는 장애의 개시에 대해 보호하는 요법을 지칭한다. 따라서, "예방"은 질환의 징후가 대상체에서 검출가능하기 전에 대상체에게 요법을 투여하는 것 (예를 들어, 치료 물질을 투여하는 것) (예를 들어, 대상체 내 검출가능한 감염원 (예를 들어, 바이러스)의 부재 하에 대상체에게 치료 물질을 투여하는 것)에 관한 것이다. 대상체는 질환 또는 장애가 발달할 위험이 있는 개체, 예컨대 질환 또는 장애의 발달 또는 개시와 연관된 것으로 공지된 1종 이상의 위험 인자를 갖는 개체일 수 있다. 따라서, 특정 실시양태에서, 용어 "HCV 감염을 예방하는 것"은 검출가능한 HCV 감염을 갖지 않는 대상체에게 항-HCV 치료 물질을 투여하는 것을 지칭한다. 항-HCV 예방 요법을 위한 대상체는 HCV 바이러스에 걸릴 위험이 있는 개체일 수 있는 것으로 이해된다.
본원에 사용된 용어 "치료 유효량" 또는 "유효량"은 목적하는 생물학적 또는 의학적 반응을 도출하는데 유효한 양, 예컨대 질환을 치료하기 위한 대상체에게 투여했을 때 질환에 대한 이러한 치료를 발생시키는데 충분한 화합물의 양을 지칭한다. 유효량은 화합물, 질환 및 그의 중증도 및 치료될 대상체의 연령, 체중 등에 따라 달라질 것이다. 유효량은 양의 범위를 포함할 수 있다. 관련 기술분야에서 이해되는 바와 같이, 유효량은 1회 이상의 용량일 수 있고, 즉 목적하는 치료 종점을 달성하기 위해 단일 용량 또는 다중 용량이 요구될 수 있다. 유효량은 1종 이상의 치료제를 투여하는 것과 관련하여 고려될 수 있고, 단일 작용제는 1종 이상의 다른 작용제와 함께 바람직하거나 유익한 결과가 달성될 수 있거나 달성되는 경우에 유효량으로 제공되는 것으로 고려될 수 있다. 임의의 공-투여되는 화합물의 적합한 용량은 화합물의 조합 작용 (예를 들어, 추가적 또는 상승작용적 효과)으로 인해 임의로 저감될 수 있다.
본 명세서를 통하여, 문맥에서 달리 표현하지 않으면, "함유하다" 및 "포함하다"란 문구는 제시된 단계 또는 단계들의 군을 포함하나, 임의의 다른 단계 또는 단계들의 군이 배제되지 않음을 내포하는 것으로 이해하여야 한다.
이하, 구체적으로 본 발명을 설명한다.
본 발명은 일 관점에서, 리고세르팁(rigosertib) 또는 이의 약학적으로 허용가능한 염의 C형 간염 바이러스에 의한 간질환 예방 또는 치료 용도, 간질환 예방 또는 치료를 위한 약학적 조성물에 사용하기 위한 용도에 관한 것이다.
본 발명은 일 관점에서, 리고세르팁(rigosertib) 또는 이의 약학적으로 허용가능한 염의 C형 간염 바이러스에 대한 항바이러스 용도, C형 간염 바이러스에 대한 항바이러스 조성물에 사용하기 위한 용도에 관한 것이다.
본 발명은 일 관점에서, 리고세르팁(rigosertib) 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 C형 간염 바이러스(Hepatitis C virus, HCV)에 의한 간질환의 치료 또는 예방을 위한 약학적 조성물에 관한 것이다.
리고세르팁(rigosertib)은 항암제로 알려져 있는 물질로, 구체적으로 하기 화학식 1과 같은 구조를 가지는 물질이다.
[화학식 1]
Figure PCTKR2018002938-appb-I000001
C형 간염 바이러스는 분자생물학적으로 단일가닥의 ~10-kb의 single stranded (+) sense RNA로 구성되어 있으며 flaviviridae에 속하고, internal ribosomal entry site와 같은 비정상적인 번역개시과정을 이용하며, 하나의 polypeptide에서 번역과정이 발생하여 각각 세포 내 단백질 분해효소 또는 바이러스가 코딩하는 단백질 분해효소에 의해 절단이 되어 각각 구조 단백질 또는 바이러스의 번역과 복제, 증식과정에 중요한 비구조(non-structural) 단백질을 지정하게 된다. 기존 연구에 따르면 HCV의 복제와 번역과정에 있어서 세포 내 분자들을 적극 활용하는 것으로 알려져 있으며, 이러한 세포 내 분자 중 하나인 마이크로RNA-122번(miRNA-122, 인간 간세포의 마이크로RNA중 70%를 차지)이 C형 간염 바이러스의 복제과정에 있어서 필수 불가결한 역할을 하는 것으로 잘 알려져 있다.
본 발명의 실시예에서는 miRNA-122와 ELAVL1/HuR의 연관성을 확인하고, 다시 상기 리고세르팁이 HCV 번역과 복제과정에 중요한 것으로 밝혀낸 분자 ELAVL1/HuR이 직접적으로 결합하고 있음을 확인하였으며, 이에 리고세르팁은 HCV 번역의 복제과정에 중요한 역할을 하는 것으로 알려져있는 miRNA-122와 세포내 분자인 ELAVL1/HuR 분자의 직접 결합을 저해함으로써 HCV의 번역/복제/증식을 억제하는 것으로 확인되었다.
본 발명의 다른 실시예에서는, 리고세르팁이 이미 Roche에서 개발해서 임상에 사용 중인 danoprevir와 유사하게 replicon 증식을 강력하게 억제하고 낮은 농도 (0.2 μM)에서도 80% 이상의 억제효과를 보임을 확인하였다.
이에 본 발명의 리고세르팁은, 기존에 개발된 항 HCV 치료제와 달리, HCV 자체가 만들어 내는 단백질이 아닌 숙주 인자(host factor, 인간 간세포의 작용분자)들의 작용을 저해하며(miRNA-122과 ELAVL1/HuR), HCV 단백질을 표적화하지 않기 때문에 기존에 개발된 약물에 대한 내성문제들을 해결할 수 있는 신개념 C형 간염 바이러스에 의한 간질환 예방 또는 치료제로서 사용될 수 있다.
이때, 상기 C형 간염 바이러스에 의한 간질환은 C형 간염, C형 간염 바이러스에 의한 간섬유화, C형 간염 바이러스에 의한 간경화, 및 C형 간염 바이러스에 의한 간암 등일 수 있다.
이때, 상기 리고세르팁은 HCV 치료제, 예를 들어, 소발디(sovaldi), 다노프리비어(danoprevir), 또는 다클린자(Daclatasvir)과 병용 투여하는 것을 특징으로 할 수 있다.
또한, 항바이러스제, 예를 들어, 리바비린과 병용투여될 수 있다.
아울러, 리고세르팁은 C형 간염바이러스의 번역/복제/증식을 억제하는바 C형 간염 바이러스에 대한 항바이러스제로 사용될 수 있으며, 이에 본 발명은 다른 관점에서, 리고세르팁 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 HCV에 대한 항바이러스 조성물에 대한 것이다.
본 발명에서 "약학적으로 허용가능한 염"은 본 발명 화합물 리고세르팁의 생물학적 특성은 유지하면서도 독성을 나타내지 않거나 제약 용도로 부적절하지 않은 임의의 본 발명 화합물의 염을 나타낸다. 이러한 염은 당업계에 공지된 다양한 유기 및 무기 반대이온으로부터 유래될 수 있으며, 이들을 포함한다. 이러한 염으로는 (1) 유기 또는 무기산, 예컨대 염산,브롬화수소산, 황산, 질산, 인산, 술팜산, 아세트산, 트리플루오로아세트산, 트리클로로아세트산, 프로피온산,헥산산, 시클로펜틸프로피온산, 글리콜산, 글루타르산, 피루브산, 락트산, 말론산, 숙신산, 소르브산, 아스코르브산, 말산, 말레산, 푸마르산, 타르타르산, 시트르산, 벤조산, 3-(4-히드록시벤조일)벤조산, 피크르산,신남산, 만델산, 프탈산, 라우르산, 메탄술폰산, 에탄술폰산, 1,2-에탄-디술폰산, 2-히드록시에탄술폰산, 벤젠 술폰산, 4-클로로벤젠술폰산, 2-나프탈렌술폰산, 4-톨루엔술폰산, 캄포르산, 캄포르술폰산, 4메틸비시클로 [2.2.2]-옥트-2-엔-1-카르복실산, 글루코헵톤산, 3-페닐프로피온산, 트리메틸아세트산, tert-부틸아세트산, 라우릴 황산, 글루콘산, 벤조산, 글루탐산, 히드록시나프토산, 살리실산, 스테아르산, 시클로헥실술팜산, 퀸산,뮤콘산 등과 형성된 산 부가염; 또는 (2) 모 화합물에 존재하는 산성 양성자가 (a) 금속 이온 (예를 들면, 알칼리 금속 이온, 알칼리 토금속 이온 또는 알루미늄 이온), 알칼리 금속 또는 알칼리 토금속 수산화물 (예컨대,나트륨, 칼륨, 칼슘, 마그네슘, 알루미늄, 리튬, 아연 및 바륨 수산화물), 암모니아로 치환되거나, 또는 (b) 유기 염기, 예컨대 지방족, 지환족 또는 방향족 유기 아민, 예를 들면 암모니아, 메틸아민, 디메틸아민, 디에틸아민, 피콜린, 에탄올아민, 디에탄올아민, 트리에탄올아민, 에틸렌디아민, 리신, 아르기닌, 오르니틴, 콜린,N,N'-디벤질에틸렌-디아민, 클로로프로카인, 디에탄올아민, 프로카인, N-벤질페네틸아민, N-메틸글루카민 피페라진, 트리스(히드록시메틸)-아미노메탄, 테트라메틸암모늄 히드록시드와 배위결합한 경우에 형성된 염 등이 있다.
또한, 염의 예로는 나트륨, 칼륨, 칼슘, 마그네슘, 암모늄, 테트라알킬암모늄 염 등이 있으며, 화합물이 염기성 관능기를 함유하는 경우에는 비독성 유기산 또는 무기산과의 염, 예컨대 히드로할라이드 (예를 들면, 히드로클로라이드 또는 히드로브로마이드), 술페이트, 포스페이트, 술파메이트, 니트레이트, 아세테이트, 트리플루오로아세테이트, 트리클로로아세테이트, 프로피오네이트, 헥사노에이트, 시클로펜틸프로피오네이트, 글리콜레이트,글루타레이트, 피루베이트, 락테이트,말로네이트, 숙시네이트, 소르베이트, 아스코르베이트, 말레이트, 말레에이트, 푸마레이트, 타르타레이트, 시트레이트, 벤조에이트, 3-(4-히드록시벤조일)벤조에이트, 피크레이트, 신나메이트, 만델레이트, 프탈레이트, 라우레이트,메탄술포네이트 메실레이트), 에탄술포네이트, 1,2-에탄-디술포네이트, 2-히드록시에탄술포네이트, 벤젠술포네이트(베실레이트), 4-클로로벤젠술포네이트, 2-나프탈렌술포네이트, 4-톨루엔술포네이트, 캄포레이트, 캄포르술포네이트, 4-메틸비시클로[2.2.2]-옥트-2-엔-1-카르복실레이트,글루코헵토네이트, 3-페닐프로피오네이트, 트리메틸아세테이트, tert-부틸아세테이트, 라우릴 술페이트, 글루코네이트, 벤조에이트, 글루타메이트, 히드록시나프토에이트, 살리실레이트, 스테아레이트,시클로헥실술파메이트, 퀴네이트, 뮤코네이트 염 등이 있다.
상기 리고세르팁 또는 이의 약학적으로 허용가능한 염은 대상체 또는 환자에게로 투여되며, 이때 "대상체(들)"은 동물, 예를 들어 비-영장류 (예를 들면, 소, 돼지, 말, 고양이, 개, 래트 및 마우스) 및 영장류 (예를 들면, 원숭이, 예를 들어 사이노몰구스 (cynomolgous) 원숭이, 침팬지 및 인간)를 비롯한 포유동물, 및 예를 들어, 인간을 나타낸다. 한 실시양태에서, 대상체는 C형 간염 감염에 대한 현행 처치법에 저항성이거나 반응하지 않는다. 또다른 실시양태에서, 대상체는 축산용 동물 (예를 들면, 말, 소, 돼지 등) 또는 애완용 동물 (예를 들면, 개 또는고양이)이다. 바람직한 실시양태에서, 대상체는 인간이다.
본원에 사용된 용어 "치료제(들) 또는 치료용 조성물"은 장애 또는 그의 1종 이상의 징후를 치료 또는 예방하는 데 사용될 수 있는 임의의 작용제(들)을 나타낸다. 특정 실시양태에서, 용어 "치료제"는 본 발명의 화합물인 리고세르팁을 나타낸다. 다른 특정 실시양태에서, 용어 "치료제"는 본 발명의 화합물을 나타내지 않는다. 한 실시양태에서, 치료제는 장애 또는 그의 1종 이상의 징후를 치료 또는 예방하는 데 유용한 것으로 공지되어있거나, 상기 목적을 위해 사용되어 왔거나, 현재 사용되고 있는 작용제이다.
본 발명의 방법에 사용되는 리고세르팁은 바람직하게는 화학식 I의 화합물, 적절한 경우에는 염 형태의 화합물을 단독으로 사용하거나, 또는 1종 이상의 적합한 제약상 허용되는 담체, 예컨대 희석제 또는 아주반트와, 또는 또다른 항-HCV 제제와 조합된 형태로 함유하는 제약 조성물을 사용함으로써 제공된다.
임상 실무에서, 본 발명의 유도체는 임의의 통상적인 경로, 특히 경구, 비경구, 직장 경로로 투여되거나, 또는 흡입 (예를 들면, 에어로졸 형태로)에 의해 투여될 수 있다.
경구 투여용 고체 조성물로서, 정제, 환제, 경질 젤라틴 캡슐제, 분제 또는 과립제를 사용할 수 있다. 이들 조성물에서, 본 발명에 따른 화합물은 1종 이상의 불활성 희석제 또는 아주반트, 예컨대 수크로스, 락토스 또는 전분과 혼합된다. 이들 조성물은 희석제 이외에도, 예를 들면 윤활제, 예컨대 마그네슘 스테아레이트, 또는 제어 방출을 위한 코팅제와 같은 물질을 포함할 수 있다.
경구 투여용 액체 조성물로서, 불활성 희석제, 예컨대 물 또는 액체 파라핀을 함유하는 제약상 허용되는 용액제, 현탁액제, 에멀젼, 시럽 및 엘릭시르를 사용할 수 있다. 이들 조성물은 또한, 희석제 이외에도, 예를들면 습윤제, 감미제 또는 향미제와 같은 물질을 포함할 수 있다.
비경구 투여용 조성물은 에멀젼 또는 멸균 용액제일 수 있다. 용매 또는 비히클로서, 프로필렌 글리콜, 폴리에틸렌 글리콜, 식물성 오일, 특히, 올리브유 또는 주사용 유기 에스테르, 예를 들면 에틸 올레에이트를 사용할수 있다. 이들 조성물은 또한 아주반트, 특히 습윤제, 등장화제, 유화제, 분산제 및 안정화제를 함유할 수 있다. 멸균은 여러 방식으로 수행할 수 있는데, 예를 들면 박테리아용 필터를 사용하거나, 방사선을 조사하거나, 또는 가열함으로써 수행할 수 있다. 이들은 또한 사용할 때 멸균수 또는 임의의 다른 주사용 멸균 매질에 용해될 수 있는 멸균 고체 조성물의 형태로 제조될 수 있다.
직장 투여용 조성물은 좌제 또는 직장 투여용 캡슐제이며, 이들은 활성 성분 이외에 부형제, 예컨대 코코아 버터, 반합성 글리세리드 또는 폴리에틸렌 글리콜을 함유한다.
조성물은 또한 에어로졸일 수 있다. 액체 에어로졸 형태로 사용하는 경우,조성물은 안정한 멸균용액제이거나, 또는 사용할 때 비발열성 멸균수, 염수 또는 임의의 다른 제약상 허용되는 비히클에 용해되는 고체 조성물일 수 있다. 직접 흡입하기 위한 무수 에어로졸 형태로 사용하는 경우, 활성 성분은 미분되어 수용성 고체 희석제 또는 비히클, 예를 들면 덱스트란, 만니톨 또는 락토스와 함께 혼합된다.
한 실시양태에서, 본 발명의 조성물은 제약 조성물 또는 단일 단위 투여 형태이다. 본 발명의 제약 조성물 및 단일 단위 투여 형태는 예방상 또는 치료 유효량의 1종 이상의 예방제 또는 치료제 (예를 들면, 본 발명의 화합물, 또는 다른 예방제 또는 치료제), 및 통상적으로 1종 이상의 제약상 허용되는 담체 또는 부형제를 포함한다.
특정 실시양태 및 문맥에서, 용어 "약학적으로 허용되는"은 동물, 보다 구체적으로는 인간에 사용될 수 있는 것으로 정부 또는 정부의 규제 기관에 의해 승인되었거나 또는 일반적으로 공인된 약전에 열거되어 있는 것을 의미한다. 용어 "담체"는 치료제와 함께 투여되는 희석제, 아주반트 (예를 들면, 프로인트(Freund) 아주반트 (완전 및 불완전 아주반트)), 부형제 또는 비히클을 나타낸다. 이러한 제약 담체는 멸균 액체, 예컨대 물, 및 석유, 동물 또는 식물 기원의 오일 또는 합성 오일을 비롯한 오일, 예를 들면 낙화생유, 대두유, 미네랄 오일, 참깨유 등일 수 있다. 물은 제약 조성물이 정맥내 투여되는 경우에 바람직한 담체이다.
염수 용액, 및 덱스트로스 및 글리세롤 수용액은 또한 액체 담체, 특히 주사용 용액으로 사용될 수 있다. 적합한 제약 담체의 예는 문헌 ["Remington's Pharmaceutical Sciences" by E. W. Martin]에 기재되어 있다.
통상적인 제약 조성물 및 투여 형태는 1종 이상의 부형제를 포함한다. 적합한 부형제는 제약 분야의 당업자에게 공지되어 있으며, 적합한 부형제의 비제한적 예로는 전분, 글루코스, 락토스, 수크로스, 젤라틴, 맥아, 쌀, 밀가루, 호분, 실리카 겔, 나트륨 스테아레이트, 글리세롤 모노스테아레이트, 활석, 염화나트륨, 탈지 분유, 글리세롤, 프로필렌, 글리콜, 물, 에탄올 등이 있다. 특정 부형제가 제약 조성물 또는 투여 형태에 혼입되는 것이 적합한지 여부는 투여 형태가 대상체에게 투여되는 방식 및 투여 형태에 포함된 특정 활성 성분 등을 비롯한 당업계에 공지된 다양한 요소에 좌우된다. 경우에 따라, 조성물 또는 단일 단위 투여 형태는 또한 소량의 습윤제 또는 유화제, 또는 pH 완충제를 함유할 수 있다.
본 발명은 또한 활성 성분을 포함하는 무수 제약 조성물 및 투여 형태를 포함한다. 예를 들면, 물 (예를 들면, 5%)을 첨가하는 것은 시간에 경과함에 따라 제제의 특성 (예컨대, 저장 수명 또는 안정성)을 결정하기 위한 모의 장기 보관 수단으로서 제약 업계에 널리 허용되어 있다. 예를 들면, 문헌 [Jens T. Carstensen, Drug Stability: Principles & Practice, 2d. Ed., Marcel Dekker, NY,NY, 1995, pp. 379 80]을 참조한다. 실제로, 물 및 열이 몇몇 화합물의 분해를 가속화시킨다. 따라서, 통상적으로 제제를 제조, 취급, 포장, 보관, 운송 및 사용하는 동안에는 수분 및/또는 습기가 발생하므로 물이 제제에 미치는 영향이 매우 중요할 수 있다.
본 발명의 무수 제약 조성물 및 투여 형태는 무수 또는 저수분 성분 및 낮은 수분 또는 낮은 습도 조건을 이용하여 제조할 수 있다. 제조, 포장 및/또는 보관 중에 수분 및/또는 습기와 실질적으로 접촉할 것이 예상된다면, 락토스, 및 1급 또는 2급 아민을 포함하는 1종 이상의 활성 성분을 포함하는 제약 조성물 및 투여형태는 무수물 형태인 것이 바람직하다. 무수 제약 조성물은 그의 무수 특성이 유지되도록 제조하여 보관해야 한다. 따라서, 무수 조성물이 물에 노출되는 것을 방지하고 적합한 규격 키트에 포함될 수 있도록 공지된 물질을 사용하여 포장하는 것이 바람직하다. 적합한 포장의 예로는, 밀봉형 호일, 플라스틱, 단위 투여 용기 (예를 들면, 바이알), 블리스터 팩 및 스트립 팩이 있으나 이에 한정되지는 않는다.
본 발명은 또한 활성 성분의 분해 속도를 감소시키는 1종 이상의 화합물을 포함하는 약학적 조성물 및 투여 형태를 포함한다. 이러한 화합물 (본원에서는 "안정화제"로 지칭함)로는 항산화제 (예컨대, 아스코르브산), pH 완충제 또는 염 완충제가 있으나 이에 한정되지는 않는다.
약학적 조성물 및 단일 단위 투여 형태는 용액제, 현탁액제, 에멀젼, 정제, 환제, 캡슐제, 분제, 서방형 제제 등의 형태를 취할 수 있다. 경구 투여용 제제는 표준 담체, 예컨대 제약 등급의 만니톨, 락토스, 전분, 마그네슘 스테아레이트, 나트륨 사카린, 셀룰로스, 탄산마그네슘 등을 포함할 수 있다. 이러한 조성물 및 투여 형태는 예방상 또는 치료 유효량의 예방제 또는 치료제를 바람직하게는 정제된 형태로 적합한 양의 담체와 함께 함유하며, 대상체에 투여하기 적절한 형태로 제공될 것이다. 제제는 투여 방식에 적합해야 한다. 바람직한 실시양태에서, 제약 조성물 또는 단일 단위 투여 형태는 멸균 상태이며, 대상체, 바람직하게는 동물 대상체, 보다 바람직하게는 포유동물 대상체, 가장 바람직하게는 인간 대상체에게 투여하기 적합한 형태이다.
본 발명의 약학적 조성물 그의 의도된 투여 경로에 적합하도록 제제화된다. 투여 경로의 예로는 비경구 투여 경로, 예를 들면, 정맥내, 피내, 피하, 근육내, 피하, 경구, 구강, 설하, 흡입, 비강내, 경피, 국소, 경점막, 종양내, 활액내 및 직장 투여 경로가 있으나 이에 한정되지는 않는다. 특정 실시양태에서, 조성물은 통상적인 절차에 따라 인간에게 정맥내, 피하, 근육내, 경구, 비강내 또는 국소 투여되도록 변형된 제약 조성물로 제제화된다. 한 실시양태에서, 제약 조성물은 통상적인 절차에 따라 인간에게 피하 투여되는 조성물로 제제화된다.
통상적으로, 정맥내 투여용 조성물은 멸균 등장성 수성 완충액 중의 용액이다. 필요한 경우에, 조성물은 또한 가용화제 및 국부 마취제 (예컨대, 리그노카인)를 포함하여 주사 부위의 통증을 진정시킬 수 있다.
투여 형태의 예로는 정제; 캐플릿; 캡슐제, 예컨대 연질 탄성 젤라틴 캡슐제; 카세; 트로키; 로젠지; 분산액제; 좌제; 연고; 습포제 (찜질약); 페이스트; 분제; 드레싱; 크림; 고약; 용액제; 패치; 에어로졸 (예를 들면, 비강 스프레이 또는 흡입기); 겔; 현탁액제 (예를 들면, 수성 또는 비수성 액체 현탁액제, 수중유 에멀젼, 또는 유중 수 액체 에멀젼), 용액제 및 엘릭시르를 포함하는 대상체에게 경구 또는 점막 투여하기 적합한 액체 투여 형태; 대상체에게 비경구 투여하기에 적합한 액체 투여 형태; 및 복원되었을 때 대상체에게 비경구 투여하기에 적합한 액체 투여 형태를 제공할 수 있는 멸균 고체 (예를 들면, 결정형 또는 무정형고체)가 있으나 이에 한정되지는 않는다.
본 발명의 조성물, 형태 및 투여 형태의 유형은 통상적으로 이들의 용도에 따라 달라질 것이다. 예를 들면, 바이러스 감염의 초기 치료에 사용되는 투여 형태는 1종 이상의 활성 성분을 바이러스 감염의 유지 요법에 사용되는 투여 형태에 포함된 양보다 더 많은 양으로 함유할 수 있다. 이와 유사하게, 비경구 투여 형태는 1종 이상의 활성 성분을 동일한 질환 또는 장애 치료에 사용되는 경구 투여 형태에 포함된 양보다 더 적은 양으로 함유할 수 있다. 상기 방식 및 본 발명에 포함되는 특정 투여 형태를 변형시키는 또 다른 방식은 당업자에게 이미 명백할 것이다. 예를 들면, 문헌 [Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing, Easton PA (1990)]을 참조한다.
본 발명 조성물의 성분은 일반적으로, 예를 들면 활성제의 양을 표기한 앰풀 또는 샤세와 같은 밀봉된 용기 중 무수 동결건조된 분말 또는 수분 무함유 농축물로서, 단위 투여 형태 중에 별개로 또는 함께 혼합된 형태로 제공된다. 조성물을 주입에 의해 투여하는 경우, 이 조성물은 멸균된 제약 등급의 물 또는 염수를 함유하는 주입 용기에 분배될 수 있다. 조성물을 주사에 의해 투여하는 경우, 투여하기 전에 성분을 혼합할 수 있도록 주사용 멸균수 또는 염수 앰풀을 제공할 수 있다.
본 발명의 통상적인 투여 형태는 본 발명의 화합물인 리고세르팁, 또는 그의 약학적으로 허용되는 염, 용매화물 또는 수화물을 약 0.1 mg 내지 약 1000 mg/일 범위의 양으로 포함하며, 이는 오전에 1일 1회 단일 투여하거나, 바람직하게는 하루동안 식사와 함께 분할 투여한다.
경구 투여하기 적합한 본 발명의 약학적 조성물은 별개의 투여 형태, 예컨대 정제 (예를 들면, 츄잉 정제), 캐플릿, 캡슐제 및 액체 (예를 들면, 향미 시럽) 등의 형태로 존재할 수 있다. 이러한 투여 형태는 미리 결정된 양의 활성 성분을 함유하며, 당업자에게 공지된 조제 방법에 의해 제조할 수 있다. 일반적으로, 문헌[Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing, Easton PA (1990)]을 참조한다. 특정 실시양태에서, 경구 투여 형태는 고체이며, 상기 단락에 상세하게 기재된 바와 같이 무수 성분을 사용하여 무수 조건하에 제조한다.
그러나, 본 발명의 범위는 무수 고체 경구 투여 형태 이외의 것까지 확장된다. 본 발명의 통상적인 경구 투여 형태는 활성 성분(들)을 통상적인 제약 합성 기술에 따라 1종 이상의 부형제와 친밀 혼합물로서 합하여 제조한다. 부형제는 투여하기 바람직한 제제의 형태에 따라 매우 다양한 형태를 취할 수 있다. 예를 들면, 경구 투여용 액체 또는 에어로졸 투여 형태에 사용하기 적합한 부형제로는 물, 글리콜, 오일, 알코올, 향미제, 보존제 및 착색제가 있으나 이에 한정되지는 않는다. 고체 경구 투여 형태 (예를 들면,분제, 정제, 캡슐제 및 캐플릿)에 사용하기 적합한 부형제로는 전분, 당, 미정질 셀룰로스, 희석제, 과립화제, 윤활제, 결합제 및 붕해제가 있으나 이에 한정되지는 않는다. 고체 부형제가 사용되는 경우에는 정제 및 캡슐제가 투여하기 쉽기 때문에 가장 유리한 경구 투여 단위 형태로 나타난다. 바람직한 경우, 정제는 표준 수성 또는 비수성 기술에 의해 코팅될 수 있다. 이러한 투여 형태는 임의의 조제 방법에 의해 제조될 수 있다.
일반적으로, 제약 조성물 및 투여 형태는 활성 성분을 액체 담체, 미분된 고체 담체, 또는 이들 둘 모두와 균일하고 친밀하게 혼합한 후에, 필요한 경우에는 생성물을 원하는 형상으로 성형시켜 제조한다. 예를 들면, 정제는 압축 또는 성형에 의해 제조할 수 있다. 압축된 정제는 임의로는 부형제와 혼합된 자유 유동 형태 (예컨대, 분말 또는 과립)의 활성 성분을 적합한 기계에서 압축시켜 제조할 수 있다. 성형된 정제는 불활성 액체 희석제로 적신 분말 화합물의 혼합물을 적합한 기계에서 성형하여 제조할 수 있다.
본 발명의 경구 투여 형태에 사용될 수 있는 부형제의 예로는 결합제, 충전제, 붕해제 및 윤활제가 있으나 이에 한정되지는 않는다. 제약 조성물 및 투여 형태에 사용하기 적합한 결합제로는 옥수수 전분, 감자 전분 또는 다른 전분, 젤라틴, 천연 및 합성 검, 예컨대 아카시아 검, 나트륨 알기네이트, 알긴산, 다른 알기네이트, 분말 트래거캔스, 구아 검, 셀룰로스 및 그의 유도체 (예를 들면, 에틸 셀룰로스, 셀룰로스 아세테이트, 카르복시메틸 셀룰로스 칼슘, 나트륨 카르복시메틸 셀룰로스), 폴리비닐 피롤리돈, 메틸 셀룰로스, 전호화된 전분, 히드록시프로필 메틸 셀룰로스, (예를 들면, 번호 2208, 2906, 2910), 미정질 셀룰로스, 및 이들의 혼합물이 있으나 이에 한정되지는 않는다.
본원에 개시된 약학적 조성물 및 투여 형태에 사용하기 적합한 충전제의 예로는 활석, 탄산칼슘 (예를 들면, 과립 또는 분말), 미정질 셀룰로스, 분말셀룰로스, 덱스트레이트, 카올린, 만니톨, 규산, 소르비톨, 전분, 전호화된 전분, 및 이들의 혼합물이 있으나, 이에 한정되지는 않는다. 본 발명의 약학적 조성물에 포함된 결합제 또는 충전재는 통상적으로 제약 조성물 또는 투여 형태의 약 50 내지 약 99 중량%의 양으로 존재한다. 미정질 셀룰로스의 적합한 형태로는 아비셀(AVICEL) PH 101, 아비셀 PH 103, 아비셀 RC 581, 아비셀 PH 105로 시판되는 물질 (에프엠씨 코포레이션, 아메리칸 비스코스 디비젼, 아비셀 세일즈 (FMC Corporation, American Viscose Division, Avicel Sales; 미국 펜실베니아주 마쿠스 훅 소재)로부터 시판됨), 및 이들의 혼합물이 있으나, 이에 한정되지는 않는다.
본 발명의 조성물에 붕해제를 사용함으로써 수성 환경에 노출되었을 때 붕해되는 정제를 제공한다. 너무 많은 붕해제를 함유하는 정제는 보관시 붕해될 수 있으며, 너무 적은 붕해제를 함유하는 정제는 원하는 속도로 붕해되지 않거나 원하는 조건하에서 붕해되지 않을 수 있다. 따라서, 너무 많지도 너무 적지도 않아 활성 성분의 방출을 유해하게 변경시키지 않는 충분한 양의 붕해제를 사용하여 본 발명의 고체 경구 투여 형태를 형성해야 한다. 사용되는 붕해제의 양은 제제의 유형에 따라 달라지며, 당업자가 용이하게 결정할 수 있다. 통상적인 제약 조성물은 약 0.5 내지 약 15 중량%, 구체적으로는 약 1 내지 약 5 중량%의 붕해제를 포함한다. 본 발명의 제약 조성물 및 투여 형태에 사용될 수 있는 붕해제로는 한천, 알긴산, 탄산칼슘, 미정질 셀룰로스, 크로스카르멜로스 나트륨, 크로스포비돈, 폴라크릴린 칼륨, 나트륨 전분 글리콜레이트, 감자 또는 타피오카 전분, 전호화된 전분, 다른 전분, 점토, 다른 알긴, 다른 셀룰로스, 검, 및 이들의 혼합물이 있으나 이에 한정되지는 않는다.
본 발명의 약학적 조성물 및 투여 형태에 사용될 수 있는 윤활제로는 칼슘 스테아레이트, 마그네슘 스테아레이트, 미네랄 오일, 미네랄 경유, 글리세린, 소르비톨, 만니톨, 폴리에틸렌 글리콜, 다른 글리콜, 스테아르산, 나트륨 라우릴 술페이트, 활석, 수소화된 식물성 오일 (예를 들면, 낙화생유, 면실유, 해바라기씨유, 참깨유,올리브유, 옥수수 오일 및 대두유), 아연 스테아레이트, 에틸 올레에이트, 에틸 라우레에이트, 한천, 및 이들의 혼합물이 있으나 이에 한정되지는 않는다. 추가의 윤활제로는, 예를 들면 실로이드 실리카 겔 (AEROSIL 200, 더블유.알. 그레이스 코포레이션 (W.R. Grace Co.; 미국 매릴랜드주 발티모어 소재)에서 제조됨), 합성 실리카의 응고된 에어로졸 (데구사 코포레이션 (Degussa Co.; 미국 텍사스주 피아노 소재)에서 시판됨), CAB O SIL(발열성 이산화규소 제품, 캐봇 코포레이션 (Cabot Co.; 미국 메사추세츠주 보스톤 소재)에서 시판됨), 및 이들의 혼합물이 있다. 사용되는 경우, 윤활제는 통상적으로 이들이 혼입되는 제약 조성물 또는 투여 형태의 약 1 중량% 미만의 양으로 사용된다.
본 발명의 리고세르팁은 예컨대 당업자에게 공지된 제어 방출 수단 또는 전달 장치로 투여할 수 있다. 이러한 투여 형태는, 예를 들면 다양한 비율에서 원하는 방출 프로파일을 제공하기 위해 히드로프로필메틸 셀룰로스, 다른 중합체 매트릭스, 겔, 투과가능한 막, 삼투 시스템, 다층 코팅, 미립자, 리포좀, 미소구, 또는 이들의 조합물을 이용하여, 1종 이상의 활성 성분을 지연 방출 또는 제어 방출시킬 때 사용할 수 있다. 본원에 기재된 것들을 비롯하여 당업자에게 공지된 적합한 제어 방출형 제제는 본 발명의 활성 성분과 함께 사용하기 위해 용이하게 선택할 수 있다. 따라서, 본 발명은 경구 투여에 적합한 단일 단위 투여 형태, 예컨대 제어 방출형으로 변형된 정제, 캡슐제, 겔캡 및 캐플릿 등을 포함한다.
모든 제어 방출형 약품은 이들에 상응하는 비-제어 방출형 약품에 의해 달성되는 것보다 개선된 약물 요법을 제공하고자 하는 공통적인 목적을 갖는다. 이상적으로, 의학적 처치에 가장 알맞게 고안된 제어 방출형 제제의 사용은 최소량의 약물 물질을 사용하여 최소 시간 내에 증상을 치유 또는 제어함을 특징으로 한다. 제어 방출형 제제의 이점은 약물의 확장된 활성, 투여 횟수의 감소 및 대상체의 순응성 증가를 포함한다. 또한, 제어 방출형 제제를 사용하여 약물의 작용 개시 시간 또는 다른 특성, 예컨대 약물의 혈중 농도에 영향을 끼칠 수 있으며, 이에 따라 부작용 (역효과) 발생에도 영향을 끼칠 수 있다.
대부분의 제어 방출형 제제는 처음에는 원하는 치료 효과를 즉각적으로 나타내는 양의 약물 (활성 성분)을 방출하고, 연장된 기간에 걸쳐 상기 치료 또는 예방 효과 수준을 지속시키는 양의 약물을 단계적 및 지속적으로 방출하도록 고안되어 있다. 이와 같이 체내에서 일정한 약물 수준을 유지하기 위해, 약물은 대사되어 인체에서 분비되는 약물의 양을 대체하는 속도로 투여 형태로부터 방출되어야 한다. 활성 성분의 제어 방출은 pH, 온도, 효소, 물, 또는 다른 생리학적 조건 또는 화합물 등을 비롯한 다양한 조건에 의해 자극될 수 있다.
특정 실시양태에서, 약물은 정맥내 주입, 이식 가능한 삼투압 펌프, 경피 팻치, 리포좀, 또는 기타 투여 방식을 사용하여 투여될 수 있다. 한 실시양태에서, 펌프가 사용될 수 있다 (문헌 [Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987)]; [Buchwald et al., Surgery 88:507 (1980)]; [Saudek et al., N. Engl. J. Med.321:574 (1989)] 참조). 다른 실시양태에서, 중합 물질이 사용될 수 있다. 또 다른 실시양태에서, 제어 방출시스템이 대상체에서 당업자에 의해 결정된 적합한 부위에서 위치할 수 있으며, 즉, 이로써 전신 투여량의 일부 만이 필요하다 (예를 들어, 문헌 [Goodson, Medical Applications of Controlled Release, vol.2, pp. 115-138(1984)] 참조). 기타 제어 방출 시스템은 랑거 (Langer [Science 249:1527-1533 (1990)])에 의해 재검토되어 논의되었다. 활성 성분은 고체 내부 매트릭스, 예를 들어 폴리메틸메타크릴레이트, 폴리부틸메타크릴레이트, 가소화된 또는 비가소화된 폴리비닐클로라이드, 가소화된 나일론, 가소화된 폴리에틸렌테레프탈레이트, 천연 고무, 폴리이소프렌, 폴리이소부틸렌, 폴리부타디엔, 폴리에틸렌, 에틸렌-비닐아세테이트, 공중합체, 실리콘고무, 폴리디메틸실록산, 실리콘 카르보네이트 공중합체, 친수성 중합체, 예컨대 아크릴산 및 메타크릴산의 에스테르의 히드로겔, 콜라겐, 가교 폴리비닐알코올 및 부분적으로 가수분해된 가교 폴리비닐 아세테이트 중에 분산될 수 있으며, 이는 외부 중합체막, 예를 들어 폴리에틸렌, 폴리프로필렌, 에틸렌/프로필렌 공중합체, 에틸렌/에틸 아크릴레이트 공중합체, 에틸렌/비닐아세테이트 공중합체, 실리콘 고무, 폴리디메틸 실록산, 네오프렌 고무, 염화 폴리에틸렌, 폴리비닐클로라이드; 비닐 아세테이트, 비닐리덴 클로라이드, 에틸렌 및 프로필렌과의 비닐클로라이드 공중합체, 이오노머 폴리에틸렌 테레프탈레이트, 부틸 고무 에피클로로히드린 고무, 에틸렌/비닐 알코올 공중합체, 에틸렌/비닐 아세테이트/비닐 알코올 삼중중합체, 및 에틸렌/비닐옥시에탄올 공중합체에 의해 둘러싸여 있고, 이는 체액에 불용성이다. 이어서, 활성 성분은 방출 속도 제어 단계에서 외부 중합체막을 통해 확산된다. 그러한 비경구 조성물에서 활성 성분의 비율은 그의 특정 성질 뿐만 아니라 대상체의 필요에 따라 매우 달라진다.
본 발명은 또한 비경구 투여 형태도 제공한다. 비경구 투여 형태는 피하, 정맥내 (볼루스 주사 포함), 근육내 및 동맥내 투여 경로 등을 비롯한 다양한 경로로 대상체에게 투여될수 있다. 이들 비경구 투여 경로는 통상적으로 오염 물질에 대한 대상체의 자연적 방어 경로를 피해가기 때문에, 비경구 투여 형태는 멸균 상태이거나 대상체에 투여하기 전에 멸균시킬 수 있는 것이 바람직하다. 비경구 투여 형태의 예로는 주사용 용액, 제약상 허용되는 주사용 비히클에 용해되거나 현탁시킬 수 있는 무수 제품, 주사용 현탁액, 및 에멀젼이 있으나 이에 한정되지는 않는다.
본 발명의 비경구 투여 형태를 제공하는 데 사용될 수 있는 적합한 비히클이 당업자에게 공지되어 있다. 이들 의 예로는 주사용수 (USP); 수성 비히클, 예컨대 나트륨 클로라이드 주사액, 링거 주사액, 덱스트로스 주사액,덱스트로스 및 나트륨 클로라이드 주사액 및 락테이트화된 링거 주사액 등; 수혼화성 비히클, 예컨대 에틸 알코올, 폴리에틸렌 글리콜 및 폴리프로필렌 글리콜 등; 및 비수성 비히클, 예컨대 옥수수유, 면실유, 낙화생유, 참깨유, 에틸 올레에이트, 이소프로필 미리스테이트 및 벤질 벤조에이트 등이 있으나 이에 한정되지는 않는다. 또한, 본원에 개시된 1종 이상의 활성 성분의 용해도를 증가시키는 화합물도 본 발명의 비경구 투여 형태에 혼입될 수 있다.
본 발명은 또한 경피, 국소 및 점막 투여 형태를 제공한다. 본 발명의 경피, 국소 및 점막 투여 형태로는 안구용 용액, 스프레이, 에어로졸, 크림, 로션, 연고, 겔, 용액, 에멀젼, 현탁액 또는 당업자에 공지된 다른 형태가 있으나 이에 한정되지는 않는다. 예를 들면, 문헌 [Remington's Pharmaceutical Sciences, 16th, 18th and 20th eds., Mack Publishing, Easton PA (1980, 1990 & 2000)] 및 [Introduction to Pharmaceutical dose form, 4th ed., Lea & Febiger, Philadelphia (1985)]을 참조한다.
구강내 점막 조직을 처치하기 적합한 투여 형태는 구강세정용 용액 또는 경구용 겔 제제로 제제화될 수 있다.또한, 경피 투여 형태는 "저장소형" 또는 "매트릭스형" 패치를 포함하며, 이들은 피부 또는 상처 부위에 특정 기간 동안 적용되어 원하는 양의 활성 성분을 침투시킬 수 있다.
본 발명에 포함되는 적합한 부형제 (예를 들면, 담체 및 희석제), 및 경피, 국소 및 점막 투여 형태를 제공하는데 사용될 수 있는 다른 물질은 제약 분야의 당업자에게 공지되어 있으며, 이들은 주어진 제약 조성물 또는 투여 형태가 적용되는 특정 조직에 따라 달라진다. 이러한 사실을 고려하여, 통상적인 부형제로는 로션, 팅크,크림, 에멀젼, 겔 또는 연고를 형성하는 물, 아세톤, 에탄올, 에틸렌 글리콜, 프로필렌 글리콜, 부탄 1,3 디올, 이소프로필 미리스테이트, 이소프로필팔미테이트, 미네랄 오일, 및 이들의 혼합물 등이 있으며, 이들은 비독성이고 제약상 허용되는 것이다. 바람직한 경우, 보습제 또는 습윤제를 제약 조성물 및 투여 형태에 첨가할 수도 있다. 이러한 부가 성분의 예는 당업계에 공지되어 있다. 예를 들면, 문헌 [Remington's Pharmaceutical Sciences, 16th, 18th and 20th eds.,Mack Publishing, Easton PA (1980, 1990 & 2000)]를 참조한다.
치료될 특정 조직에 따라, 추가의 성분을 본 발명의 활성 성분으로 처치하기 전에 사용하거나, 본 발명의 활성 성분과 함께 사용하거나, 또는 본 발명의 활성 성분으로 처치한 후에 사용할 수 있다. 예를 들면, 침투 증진제를 사용하여 조직에 활성 성분을 전달시키는 것을 보조할 수 있다. 적합한 침투 증진제로는 아세톤; 다양한 알코올, 예컨대 에탄올, 올레일 및 테트라히드로푸릴; 알킬 술폭시드, 예컨대 디메틸 술폭시드; 디메틸 아세트아미드; 디메틸 포름아미드; 폴리에틸렌 글리콜; 피롤리돈, 예컨대 폴리비닐피롤리돈; 콜리돈 (Kollidon) 등급(포비돈, 폴리비돈); 우레아; 및 다양한 수용성 또는 수불용성 당 에스테르, 예컨대 Tween 80 (폴리소르베이트80) 및 Span 60 (소르비탄 모노스테아레이트)이 있으나 이에 한정되지는 않는다.
또한, 제약 조성물 또는 투여 형태의 pH, 또는 제약 조성물 또는 투여 형태가 적용되는 조직의 pH를 조정하여 1 종 이상의 활성 성분의 전달을 개선시킬 수 있다. 이와 유사하게, 용매 담체의 극성, 그의 이온 강도 또는 긴장성을 조정하여 상기 전달을 개선시킬 수 있다. 화합물, 예컨대 스테아레이트를 제약 조성물 또는 투여 형태에 첨가하여 1종 이상의 활성 성분의 친수성 또는 친유성을 유리하게 변경시킴으로써 상기 전달을 개선시킬 수도 있다. 이와 관련하여, 스테아레이트는 제제화용 액체 비히클, 유화제 또는 계면활성제, 및 전달 증진제 또는 침투 증진제로서 작용할 수 있다. 활성 성분의 다른 염, 수화물 또는 용매화물을 사용하여 생성된 조성물의 특성을 더 조정할 수 있다.
인간을 치료하는 경우, 의사는 예방 또는 치유적 치료, 및 치료할 대상체의 연령, 체중, 감염 단계 및 이들에게 특이적인 다른 요소에 따라 가장 적절한 것으로 여겨지는 투여 용량을 결정할 것이다. 일반적으로, 성인의 경우, 투여량은 약 1 내지 약 1000 mg/일, 약 5 내지 약 250 mg/일, 또는 약 10 내지 50 mg/일이다. 특정 실시양태에서, 투여량은 성인 1인 당 약 5 내지 약 400 mg/일, 보다 바람직하게는 25 내지 200 mg/일이다. 약 50 내지 약 500 mg/일의 투여 속도도 또한 바람직하다.
추가 측면에서, 본 발명은 C형 간염 바이러스 감염의 치료 또는 예방이 필요한 대상체에게 C형 간염 바이러스에 대해 높은 치료 지수를 갖는 본 발명의 화합물 또는 그의 약학적으로 허용가능한 염을 유효량으로 투여하여 상기 대상체에서 C형 간염 바이러스 감염, 이러한 바이러스에 의한 간질환을 치료 또는 예방하는 방법을 제공한다. 치료 지수는 당업자에게 공지된 임의의 방법, 예컨대 하기 실시예에 기재한 방법에 따라 측정할 수 있다. 특정 실시양태에서, 치료 지수는 C형 간염 바이러스에 유효한 화합물의 농도에 대한, 독성을 나타내는 화합물의 농도의 비율이다. 독성은 세포독성(예를 들면, IC50 또는 IC90) 및 치사량 (예를 들면, LD50 또는 LD90)을 비롯한 당업자에게 공지된 임의의 기술로 측정할 수 있다. 이와 마찬가지로, 유효 농도 (예를 들면, EC50 또는 EC90) 및 유효 투여량 (예를 들면, ED50 또는 ED90)을 비롯한 당업자에게 공지된 임의의 기술을 이용하여 유효 농도를 측정할 수 있다. 바람직하게는, 유사한 측정값을 비율로 비교한다 (예를 들면, IC50/EC50, IC90/EC90, LD50/ED50 또는 LD90/ED90). 특정 실시양태에서, 치료 지수는 2.0, 5.0, 10.0, 15.0, 20.0, 25.0, 50.0, 75.0, 100.0, 125.0, 150.0 또는 그 이상만큼 높을 수 있다.
장애 또는 그의 1종 이상의 징후를 예방, 치료, 관리 또는 개선시키는데 유효한 본 발명 화합물 또는 조성물의 양은 질환 또는 증상의 특성 및 중증도, 및 활성 성분이 투여되는 경로에 따라 달라질 것이다. 투여 횟수 및 투여량 또한 투여된 특정 요법제 (예를 들면, 치료제 또는 예방제), 장애, 질환 또는 증상의 중증도, 투여 경로뿐만 아니라 대상체의 연령, 체중, 반응 및 과거 병력에 의존하는 각 대상체에 대한 특이적 요소에 따라 달라질것이다. 유효 투여량은 시험관내 또는 동물 모델 시험 시스템으로부터 유래된 투여량-반응 곡선으로부터 외삽법에 의해 추정할 수 있다.
조성물 투여량의 예는, 대상체 또는 샘플 중량 1 kg 당 활성 화합물의 양 (mg 또는 ㎍)으로서, 예를 들면 약 10 ㎍/kg 내지 약 50 mg/kg, 약 100 ㎍/kg 내지 약 25 mg/kg, 또는 약 100 ㎍/kg 내지 약 10 mg/kg을 포함한다.
본 발명의 조성물의 경우, 대상체에 투여된 투여량은 통상적으로 활성 화합물의 중량에 기초하여 대상체 체중 1kg 당 0.140 mg 내지 3 mg이다. 바람직하게는, 대상체에 투여된 투여량은 대상체 체중 1 kg 당 0.20 mg 내지 2.00 mg 또는 0.30 mg 내지 1.50 mg이다.
일반적으로, 본원에 기재된 증상에 대해 제안된 본 발명 조성물의 일일 투여량 범위는 약 0.1 내지 약 1000 mg/일이며, 이는 1일 1회 단일 투여되거나 또는 하루 동안 분할 투여된다. 한 실시양태에서, 상기 일일 투여량은 동등한 양으로 분할되어 매일 2회 투여된다. 일일 투여량 범위는, 구체적으로는 약 10 내지 약 200 mg/일, 보다 구체적으로는 약 10 내지 약 150 mg/일, 보다 더 구체적으로는 약 25 내지 약 100 mg/일이어야 한다. 당업자에게 명백한 바와 같이, 몇몇 경우에는 활성 성분을 본원에 개시된 투여량 범위를 벗어난 투여량으로 사용할 필요가 있을 수 있다. 또한, 임상의 또는 치료 담당의는 대상체의 반응과 관련하여 요법을 언제 어떻게 중단,조정 또는 종결해야 할지 알고 있을 것임에 주목한다.
당업자에게 이미 공지된 바와 같이, 상이한 질환 및 증상에 대해 상이한 치료 유효량을 적용할 수 있다. 이와 유사하게, 상기 장애를 예방, 관리, 치료 또는 개선시키기에는 충분하지만 본 발명의 조성물과 관련된 부작용을 유발하기에는 불충분하거나 상기 부작용을 감소시키기에 충분한 양이 또한 상기 기재된 투여량 및 투여 횟수 계획에 포함된다. 또한, 대상체에게 본 발명의 조성물을 다중 투여량으로 투여하는 경우, 모든 투여량이 동일할 필요는 없다. 예를 들면, 대상체에 투여되는 투여량을 증가시켜 조성물의 예방 또는 치료 효과를 개선시킬 수 있으며, 이를 감소시켜 특정 대상체가 경험하는 1종 이상의 부작용을 감소시킬 수 있다.
본 발명의 리고세르팁 또는 이의 식품학적으로 허용가능한 염은 C형 간염 바이러스에 의한 간질환의 개선 또는 예방을 위해 사용될 수 있으며, 이에 본 발명은 또 다른 관점에서, 리고세르팁 또는 이의 식품학적으로 허용가능한 염을 유효성분으로 함유하는 HCV에 의한 간질환의 개선 또는 예방을 위한 건강기능식품 조성물에 관한 것이다.
본 발명의 건강기능식품은 HCV에 의한 간질환의 예방 및 개선을 목적으로, 정제, 캅셀, 분말, 과립, 액상, 환 등의 형태로 제조 및 가공할 수 있다.
본 발명에서 사용된 용어 "건강기능식품"이라 함은 건강기능식품에 관한 법률 제6727호에 따른 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 제조 및 가공한 식품을 말하며, 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건 용도에 유용한 효과를 얻을 목적으로 섭취하는 것을 의미한다.
본 발명의 건강기능식품은 통상의 식품 첨가물을 포함할 수 있으며, 식품 첨가물로서의 적합 여부는 다른 규정이 없는 한, 식품의약품안전청에 승인된 식품 첨가물 공전의 총칙 및 일반시험법 등에 따라 해당 품목에 관한 규격 및 기준에 의하여 판정한다.
상기 "식품 첨가물 공전"에 수재된 품목으로는 예를 들어, 케톤류, 글리신, 구연산칼슘, 니코틴산, 계피산 등의 화학적 합성물; 감색소, 감초 추출물, 결정셀룰로오스, 고량색소, 구아검 등의 천연첨가물; L-글루타민산나트륨제제, 면류첨가알칼리제, 보존료제제, 타르색소제제 등의 혼합제제류 등을 들 수 있다.
예를 들어, 정제 형태의 건강기능식품은 본 발명의 유효성분인 리고세르팁을 부형제, 결합제, 붕해제 및 다른 첨가제와 혼합한 혼합물을 통상의 방법으로 과립화한 다음, 활택제 등을 넣어 압축성형하거나, 상기 혼합물을 직접 압축 성형할 수 있다. 또한 상기 정제 형태의 건강기능식품은 필요에 따라 교미제 등을 함유할 수도 있다.
캅셀 형태의 건강기능식품 중 경질 캅셀제는 통상의 경질 캅셀에 본 발명의 유효성분인 리고세르팁을 부형제 등의 첨가제와 혼합한 혼합물을 충진하여 제조할 수 있으며, 연질 캅셀제는 상기 리고세르팁을 부형제 등의 첨가제와 혼합한 혼합물을 젤라틴과 같은 캅셀기제에 충진하여 제조할 수 있다. 상기 연질 캅셀제는 필요에 따라 글리세린 또는 소르비톨 등의 가소제, 착색제, 보존제 등을 함유할 수 있다.
환 형태의 건강기능식품은 본 발명의 유효성분인 상기 화학식 1의 화합물과 부형제, 결합제, 붕해제 등을 혼합한 혼합물을 기존에 공지된 방법으로 성형하여 조제할 수 있으며, 필요에 따라 백당이나 다른 제피제로 제피할 수 있으며, 또는 전분, 탈크와 같은 물질로 표면을 코팅할 수도 있다.
과립 형태의 건강기능식품은 본 발명의 유효성분인 리고세르팁과 부형제, 결합제, 붕해제 등을 혼합한 혼합물을 기존에 공지된 방법으로 입상으로 제조할 수 있으며, 필요에 따라 착향제, 교미제 등을 함유할 수 있다.
상기 건강기능식품은 음료류, 육류, 초코렛, 식품류, 과자류, 피자, 라면, 기타 면류, 껌류, 사탕류, 아이스크림류, 알코올 음료류, 비타민 복합제 및 건강보조식품류 등일 수 있다.
실시예
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1
ELAVL1 / Hur에 의한 miRNA -122 조절 및 C형 간염 바이어스 복제 상관관계의 확인
C형 간염 바이러스의 번역/복제/증식 과정에서 필수적인 역할을 하는 것으로 알려져 있는(Jopling et al.) miRNA-122번과 결합하는 세포내 분자들을 탐색하였다. 이는 바이오틴화 miRNA-122에 결합하는 세포내 분자를 LC-MS/MS 기법을 이용해 분석하였고, 그 결과 ELAVL1/HuR을 발굴한 후 이와 miRNA-122간의 특이적 결합을 확인하고, ELAVL1/HuR 제거(knockout) 시 HCV의 전사/복제를 모니터링하기 위하여, 다음의 실험을 수행하였다.
1-1: ELAVL1/HuR과 miRNA-122간의 특이적 결합 확인
간 세포 내에는 miRNA-122에 대한 4종류의 isomiR가 존재한다(도 1A) REMSA(RNA electro-mobility shift assay)를 통해 이들과 miRNA-122들간 특이적 결합을 확인하였으며, 구체적인 재조합 ELAVL1/HuR 정제 및 REMSA 과정은 다음과 같다.
Escherichia coli 균주 BL21(DE3)pLysS (Promega)를 사용하여 플라스미드 pGEX-KG-HuR(WT)로부터 재조합 글루타티온 S-트랜스퍼라제(GST)가 융합된 ELAVL1/HuR (GST-HuR)을 생산하였다. 이소프로필-β-D-티오 갈락토피라노시드 (최종농도 0.5 mM)를 첨가하여 OD 600 0.5에서 GST-HuR 단백질 발현을 유도하였다. 25℃에서 5시간 인큐베이션 한 후, 세포를 수확하고, 이를 용해 완충액 [20 mM 인산염 (pH 7.6), 300 mM NaCl, 0.5 mM 페닐 메탄 술포닐플루오라이드 (PMSF), 1 mM β-메르캅토에탄올 및 10% 글리세롤 (v/v)]에 용해한 뒤 초음파 파쇄 처리하였다. 생성된 세포 추출물을 글루타티온 아가로오스 4B (Peptron, Dajeon, Korea)에 로딩하고, 용해 완충액으로 세척하고, 결합된 GST-HuR을 환원 글루타티온으로 용출시켰다. 정제된 재조합 GST-HuR은 20 mM HEPES-KOH (pH 7.5), 50 mM KCl, 5 mM MgCl2, 10 % 글리세롤 (v/v)을 함유하는 완충액로 dialysis를 수행하였다. REMSA를 위해서 T4 폴리뉴클레오타이드 키나아제 (PNK)를 이용하여 인공 합성된 miRNA-122의 5′말단을 32P로 표지한 뒤 25,000 cpm을 각각의 반응에 이용하였다. 각각의 재조합 단백질을 1 mM MgCl2, 5% 글리세롤 (v/v), 0.5 mM 디티오트레이톨, 1 unit/㎕ RNaseOUT과 혼합하여 30°C에서 20분 동안 반응시킨 뒤, RNA-단백질 복합체를 5% 비변성젤에 넣고 결과를 오토 라디오그래피로 분석하였다.
그 결과, 야생형은 miRNA-122의 3′말단 영역의 단지 한 뉴클레오타이드의 차이만 있는데 그 결합이 제일 강력하였으며 이는 miRNA-122의 3′말단 영역이 ELAVL1/HuR과의 결합에 매우 중요함을 나타냈다. 도 1B는 ELAVL1/HuR가 인간 간세포 miRNA 중 70%를 차지하며 C형 간염 바이러스의 복제 과정에 필수 불가결한 역할을 하는 것으로 알려진 miRNA-122과 직접적으로 결합하고 있음을 나타낸다.
1-2: ELAVL1/Hur와 C형 간염 바이어스 복제 상관관계의 확인
ELAVL1/HuR과 C형 간염바이러스 복제의 상관관계 연구를 위해 감염성 C형 간염 바이러스 제작 시스템(pJFH1)으로부터 유래된 루시퍼레이즈 발현 C형 간염 subgenomic replicon을 도입하여 확인하였으며 CRISPR/Cas9 시스템을 적용 ELAVL1/HuR 특이적인 sgRNA를 이용하여 ELAVL1/HuR를 knockout 시켰을 때 C형 간염 바이러스의 합성 정도 그리고 루시퍼레이즈 assay가 가능한 C형 간염 subgenomic replicon의 활성도가 어떠한지 추적하였으며 ELAVL1/HuR이 녹아웃(Knockout)되어있는 경우 C형 간염 subgenomic replicon 번역/복제의 저해 여부를 다음과 같이 확인하였다.
표적 유전자(ELAVL1/HuR)의 CRISPR/Cas9 시스템을 이용한 녹아웃은 pLentiCRISPRv2(Addgene)를 이용하였으며 안정적으로 형질도입 된 Huh7 세포는 puromycin을 사용하여 선별하였다. 세포를 puromycin으로 선별하고 수집한 뒤 선택된 Huh7 세포의 콜로니를 감염 후 30일째에 웨스턴 블랏을 이용하여 분석하였다. 선택된 콜로니의 게놈 DNA는 게놈 DNA 칼럼 키트 (Zymo Reserch)를 사용하여 분리하였고, 삽입된 가이드 RNA 서열에 대해 ELAVL1/HuR 표적 부위에 인접하여 게놈 DNA로부터 증폭하였고 생성된 앰플리콘 서열을 DNA 시퀀싱(Cosmo Genentech)으로 검증하였다.
먼저, 두 종류의 루스퍼레이즈 어세이가 가능한 subgenomic replicon인 pSGR-JFG1/Luc 또는 NS5B의 활성화 부위의 돌연변이체인 pSGR-JFG1/Luc-GND (Ralf Bartenschlager)를 제한효소로 절취한 뒤 in vitro transcription을 수행해서 루시퍼레이즈 발현 C형 간염 subgenomic replicon의 RNA를 합성하였다. 이를 naive Huh7 세포주나 또는 CRISPR/Cas9 유전자 가위를 이용해서 ELAVL1/HuR을 녹아웃(knockout)시킨 세포주에 전기천공법(electroporation) 방법을 이용해서 (1 ug의 RNA를 1×10^6 세포에) 형질주입(transfection)한 뒤 각각의 시간대에 분획하여 루시퍼레이즈 어세이를 수행하였다. 분획된 세포를 1 × passive lysis 버퍼 (Promega)으로 용해시킨 뒤 용해물의 일부를 Dual-Luciferase® Reporter Assay System (Promega)으로 분석하였으며 반딧불이 루시퍼라제 신호를 Renilla 신호 또는 전체 단백질량으로 normalization을 수행하였다
그 결과, 도 1C에 나타난 바와 같이, ELAVL1/HuR이 KO되어있는 경우 C형 간염 subgenomic replicon 번역/복제가 저해되는 결과를 얻을 수 있었다.
추가로, 웨스턴 블랏을 수행하였다. 우선, 1차 항체로 항-HuR 항체 (마우스 단클론 항체, 3A2, Santa Cruz Biotech), 항-eIF-4GI (토끼 폴리클론 항체, 포항공과대학교 장승기), 항-GST 항체(토끼 폴리클론, Genescript)를 사용하였고 웨스턴 블랏 분석을 위해 세포 용해물을 5× 단백질 시료 완충액과 혼합하고 95℃에서 5분간 변성시킨 후 11 % 폴리아크릴아미드-SDS 겔에 전기영동시켰다. 전기영동 후, 단백질을 4℃, 80v에서 1 시간 동안 니트로셀룰로오스(nitrocellulose) 막으로 옮겼다. 0.1% Tween-20를 함유한 TBS (50 mM Tris-HCl [pH7.4] 및 150 mM NaCl) 중 5% 탈지분유를 포함시켜 실온에서 30분간 반응시킨 후, 1차 항체로 4℃에서 밤새 반응시켰다. 니트로셀룰로오스 막을 2차 항체로 처리하기 전에 TBS-T로 15 분 동안 3회 세척하였다. 2차 항체로서 양고추냉이-퍼옥시다아제가 결합된 항-토끼 및 항-마우스 IgG (1/5,000 희석, Vector Laboratories)를 사용하였다.
그 결과, 도 1D에 나타난 바와 같이 ELAVL1/HuR이 KO되어있는 경우 C형 간염 subgenomic replicon 번역/복제가 완전히 저해되는 결과를 얻을 수 있었다.
실시예 2
HCV 저해제로서의 리고세르팁의 분리 및 분석
2-1: HCV 저해제로서의 리고세르팁의 분리
HCV의 세포내 분자들 간의 상호작용에 있어서 세포신호전달의 중요성을 검증하고 이러한 과정들이 HCV의 번역/복제/증식과정에 미치는 영향을 조사하기 위해서 리포터 분석(assay)이 가능한 HCV의 subgenomic replicon을 이용하여 세포내 다양한 키나제(kinase)에 대한 저해제 라이브러리를 이용하여 1차적인 스크리닝을 시도하였다.
먼저 assayable HCV 1b subgenomic replicon HIRL-2Aneo-NSrep을 포함하고 있는 Huh7 세포주를 plating한 뒤 Selleckchem cellular kinase inhibitory chemicals (한국생명공학연구원, 조성찬)를 1 μM 농도가 되도록 처리해주고 24시간 뒤 루시퍼레이즈 어세이를 수행하였다. 분획된 세포를 1 × passive lysis 버퍼 (Promega)으로 용해시킨 뒤 용해물의 일부를 Dual-Luciferase® Reporter Assay System (Promega)으로 분석하였으며 반딧불이 루시퍼라제 신호를 Renilla 신호 또는 전체 단백질량으로 normalization을 수행하였다
그 결과, 211개의 Selleckchem cellular kinase inhibitory chemical에 대한 1차 스크리닝 결과, 현재 항암제로서 임상 III상에서 그 효능이 잘 알려져 있는 리고세르팁(rigosertib, #65, 도 2C)을 HCV의 번역/증식의 새로운 억제제로 발굴하였다. 더욱이, 이 물질은 이미 Roche에서 개발해서 임상에 사용 중인 danoprevir와 유사하게 replicon 증식을 강력하게 억제하고 낮은 농도 (0.2 μM)에서도 80% 이상의 억제효과를 보였다(도 2A).
2-2: HCV 저해제로서의 리고세르팁의 분석(in vitro pulldown assay)
분리동정된 재조합 GST 단백질 또는 GST-HuR 단백질을 Drosha 용해완충액 [20 mM Tris-HCl (pH 7.5), 100 mM KCl, 0.2 mM EDTA, 2 mM MgCl2, 2 mM CaCl2, 프로테아제 억제제 칵테일]로 희석하였고 여기에 RNase 억제제를 첨가한 뒤 streptavidin-magnetic bead(Promega)과 결합된 biotinylated-rigosertib(도 2D)과 혼합해준다. 결합 후, 비드 샘플을 변형된 Drosha 세척 완충액을 사용하여 4회 세척하고 잔류 세척 완충액을 완전히 제거하였다. 이후 웨스턴 블랏을 위한 5× 샘플버퍼를 비즈에 첨가하고 GST 특이적 항체(Genescript)를 이용하여 웨스턴 블랏을 수행하였다.
그 결과, 도 2B에 나타난 바와 같이, HCV 번역과 복제과정에 중요한 것으로 밝혀낸 분자 ELAVL1/HuR이 리고세르팁과 직접적인 결합하고 있음을 확인하였으며, 이에 리고세르팁은 HCV 번역의 복제과정에 중요한 역할을 하는 것으로 알려져 있는 miRNA-122와 세포내 분자인 ELAVL1/HuR 분자의 직접 결합을 저해함으로써 HCV의 번역/복제/증식을 억제하는 것으로 확인되었다 (도 2E).
실시예 3
리고세르팁의 항HCV 효과의 재검증
실시예 2에서 확인한 리고세르팁이 HCV 감염에 특이적이고 효과적인 억제제임을 재검증하기 위하여, 추가적으로 다음의 실험을 수행하였다.
먼저, 실시예 2의 스크리닝 결과와 동일선상에서 리포터 에세이가 가능한 HCV의 subgenomic replicon을 이용하여 발굴된 HCV 특이적 저해제 리고세르팁에 대해 assayable HCV 1b subgenomic replicon HIRL-2Aneo-NSrep과 반딧불이 루시퍼레이즈를 포함하고 있는 Huh7 세포주를 24 well에 2×10^4개 만큼 plating 한 뒤 1μM의 rigosertib을 0, 24, 48, 72시간 동안 처리한 뒤 각 시간대에 분획하여 루시퍼레이즈 어세이를 수행하였다. 분획된 세포를 1 × passive lysis 버퍼 (Promega)으로 용해시킨 뒤 용해물의 일부를 Dual-Luciferaseⓡ Reporter Assay System (Promega)으로 분석하였으며 Renilla 신호를 반딧불이 루시퍼라제 신호로 normalization을 수행하였다.
그 결과, 도 3A와 같이 HCV의 번역/증식을 억제함을 확인할 수 있었다. 추가로 동일한 실험을 리고세르팁을 0.5 μM 농도 처리하여 비교하였을 때, 도 3B에 나타난 바와 같이 동일하게 저해시킴을 확인할 수 있었다.
이는 본 발명에 따른 리고세르팁의 저해 기전은 기존에 개발된 항 HCV 치료제와 달리, HCV 자체가 만들어 내는 단백질이 아닌 숙주 인자(host factor, 인간 간세포의 작용분자)들의 작용을 저해하며(miRNA-122과 ELAVL1/HuR), HCV 단백질을 표적화하지 않기 때문에 기존에 개발된 약물에 대한 내성문제들을 해결할 수 있는 신개념 항 C형 간염 바이러스제제로서 기대된다. 이는 단독으로 사용되거나 기존에 알려진 리바비린(ribavirin) 등과 병용투여되어 저렴하고 내성을 유발하지 않은 HCV의 좋은 치료 전략이 될 것으로 기대된다.
이상으로 본 발명의 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
SEQ ID NO: 1 (Wild type of miR-122):
uggagugugacaaugguguuug
SEQ ID NO: 2 (Isomir of miR-122(+A)):
uggagugugacaaugguguuuga
SEQ ID NO: 3 (Isomir of miR-122(+U)):
uggagugugacaaugguguuugu
SEQ ID NO: 4 (Isomir of miR-122(-G)):
uggagugugacaaugguguuu
SEQ ID NO: 5 (miR-21):
uagcuuaucagacugauguuga

Claims (10)

  1. 리고세르팁(rigosertib) 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 C형 간염 바이러스(Hepatitis C virus, HCV)에 의한 간질환의 치료 또는 예방을 위한 약학적 조성물.
  2. 제1항에 있어서, 상기 C형 간염 바이러스에 의한 간질환은 C형 간염, C형 간염 바이러스에 의한 간섬유화, C형 간염 바이러스에 의한 간경화, 및 C형 간염 바이러스에 의한 간암으로 이루어진 군에서 선택된 어느 하나 이상인 것을 특징으로 하는 약학적 조성물.
  3. 제1항에 있어서, HCV 치료제 또는 HCV에 대한 항바이러스제와 병용 투여하는 것을 특징으로 하는 약학적 조성물.
  4. 제1항에 있어서, 리고세르팁이 ELAVL1/HuR에 결합하여 miRNA-122와 ELAVL1/HuR의 결합을 저해하는 것을 특징으로 하는 약학적 조성물.
  5. 리고세르팁 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 HCV에 대한 항바이러스 조성물.
  6. 리고세르팁 또는 이의 식품학적으로 허용가능한 염을 유효성분으로 함유하는 HCV에 의한 간질환의 개선 또는 예방을 위한 건강기능식품 조성물.
  7. 제6항에 있어서, 상기 C형 간염 바이러스에 의한 간질환은 C형 간염, C형 간염 바이러스에 의한 간섬유화, C형 간염 바이러스에 의한 간경화, 및 C형 간염 바이러스에 의한 간암으로 이루어진 군에서 선택된 어느 하나 이상인 것을 특징으로 하는 건강기능식품 조성물.
  8. 필요한 개체에 리고세르팁(rigosertib) 또는 이의 약학적으로 허용가능한 염을 투여하는 단계를 포함하는, C형 간염 바이러스(Hepatitis C virus, HCV)에 의한 간질환의 치료방법.
  9. 리고세르팁(rigosertib) 또는 이의 약학적으로 허용가능한 염의 C형 간염 바이러스(Hepatitis C virus, HCV)에 의한 간질환의 치료 또는 예방을 위한 용도.
  10. 리고세르팁(rigosertib) 또는 이의 약학적으로 허용가능한 염의 C형 간염 바이러스(Hepatitis C virus, HCV)에 대한 항바이러스 용도.
PCT/KR2018/002938 2017-03-14 2018-03-13 C형 간염 바이러스 질환 치료를 위한 리고세르팁의 신규 용도 Ceased WO2018169283A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20170031850 2017-03-14
KR10-2017-0031850 2017-03-14

Publications (1)

Publication Number Publication Date
WO2018169283A1 true WO2018169283A1 (ko) 2018-09-20

Family

ID=63522247

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/002938 Ceased WO2018169283A1 (ko) 2017-03-14 2018-03-13 C형 간염 바이러스 질환 치료를 위한 리고세르팁의 신규 용도

Country Status (2)

Country Link
KR (1) KR101991365B1 (ko)
WO (1) WO2018169283A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021243162A1 (en) * 2020-05-29 2021-12-02 Icahn School Of Medicine At Mount Sinai Use of rigosertib to treat rna virus infections

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024123010A1 (ko) * 2022-12-05 2024-06-13 국립암센터 Hcv/mir-122 활성 이중계측 발광플랫폼 및 도출물질 리고세르팁의 소포스부비어 저항성 hcv 치료 용도

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060120037A (ko) * 2003-10-11 2006-11-24 버텍스 파마슈티칼스 인코포레이티드 Hcv 감염 치료용 병용 요법
US8106033B2 (en) * 2005-03-11 2012-01-31 Temple University - Of The Commonwealth System Of Higher Education Composition and methods for the treatment of proliferative diseases
KR20150050384A (ko) * 2013-10-29 2015-05-08 가톨릭대학교 산학협력단 C형 간염 바이러스 감염 질환의 예방 또는 치료용 약학 조성물
JP2015519400A (ja) * 2012-06-12 2015-07-09 エフ.ホフマン−ラ ロシュ アーゲーF. Hoffmann−La Roche Aktiengesellschaft Hcv感染症を治療するための治療剤の組合せ
US9566280B2 (en) * 2014-01-28 2017-02-14 Massachusetts Institute Of Technology Combination therapies and methods of use thereof for treating cancer

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MXPA04008356A (es) 2002-02-28 2005-09-12 Univ Temple (e)-2,6-dialcoxiestiril bencilsulfonas sustituidas con un grupo amino y en la posicion 4 para tratar trastornos poliferativos.
JP5278968B2 (ja) 2006-08-30 2013-09-04 テンプル・ユニバーシティ−オブ・ザ・コモンウェルス・システム・オブ・ハイアー・エデュケイション 骨髄異形性症候群及び急性骨髄性白血病の治療のための組成物及び方法

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060120037A (ko) * 2003-10-11 2006-11-24 버텍스 파마슈티칼스 인코포레이티드 Hcv 감염 치료용 병용 요법
US8106033B2 (en) * 2005-03-11 2012-01-31 Temple University - Of The Commonwealth System Of Higher Education Composition and methods for the treatment of proliferative diseases
JP2015519400A (ja) * 2012-06-12 2015-07-09 エフ.ホフマン−ラ ロシュ アーゲーF. Hoffmann−La Roche Aktiengesellschaft Hcv感染症を治療するための治療剤の組合せ
KR20150050384A (ko) * 2013-10-29 2015-05-08 가톨릭대학교 산학협력단 C형 간염 바이러스 감염 질환의 예방 또는 치료용 약학 조성물
US9566280B2 (en) * 2014-01-28 2017-02-14 Massachusetts Institute Of Technology Combination therapies and methods of use thereof for treating cancer

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
CHEN, YUNG-CHIA: "Polo-like kinase 1 is involved in Hepatitis C virus replication by hyperphosphorylating NS5A", JOURNAL OF VIROLOGY, vol. 84, no. 16, 2010, pages 7983 - 7993, XP055608776 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021243162A1 (en) * 2020-05-29 2021-12-02 Icahn School Of Medicine At Mount Sinai Use of rigosertib to treat rna virus infections
US20230248680A1 (en) * 2020-05-29 2023-08-10 Icahn School Of Medicine At Mount Sinai Use of rigosertib to treat rna virus infections
US12616671B2 (en) 2020-05-29 2026-05-05 Icahn School Of Medicine At Mount Sinai Use of rigosertib to treat RNA virus infections

Also Published As

Publication number Publication date
KR20180105084A (ko) 2018-09-27
KR101991365B1 (ko) 2019-06-21

Similar Documents

Publication Publication Date Title
JP5854841B2 (ja) デングウイルス感染を治療及び予防するためのチエノピリジン誘導体類
US20080075695A1 (en) Combination therapy method for treating hepatitis c virus infection and pharmaceutical compositions for use therein
MX2011012983A (es) Tratamiento y prevencion de infecciones del virus del dengue.
MX2011002602A (es) Combinacion de inhibidor de la proteasa ns3 de hcv con interferon y ribavirina.
TW201023858A (en) Synergistic combinations of a macrocyclic inhibitor of HCV and a nucleoside
WO2013070048A1 (ko) 단핵식세포계 세포의 age-알부민 합성 또는 분비 저해제를 유효성분으로 포함하는 허혈성 심장질환 예방 또는 치료용 조성물
WO2011152671A2 (ko) 라말린을 함유하는 염증질환 또는 면역질환의 예방 또는 치료용 약학 조성물
US11364256B2 (en) Viral inhibition
WO2022103138A1 (ko) 비피도박테리움 롱검 rapo (kctc13773bp)를 포함하는 암 예방 또는 치료용 조성물
BRPI0616476A2 (pt) uso de uma quantidade terapeuticamente eficaz de um derivado de ciclosporina, e, composição farmacêutica
KR20120106942A (ko) Bi201335, 인터페론 알파 및 리바비린을 포함하는 hcv 병용 치료요법을 위한 투여 용법
KR101306956B1 (ko) 부추로부터 분리된 신규 화합물 및 그 화합물의 항바이러스제로서의 용도
KR101991365B1 (ko) C형 간염 바이러스 질환 치료를 위한 리고세르팁의 신규 용도
WO2018155921A1 (ko) 고시폴 및 펜포르민을 유효성분으로 포함하는 췌장암 예방 및 치료용 약학적 조성물
WO2022005228A1 (ko) 3-케토아실 coa 타이올레이스 억제제 및 카르니틴 아실카르니틴 운반자 억제제를 포함하는 암 예방 또는 치료용 약학적 조성물
WO2018070711A2 (ko) 히알루론산 나노입자를 함유하는 염증질환 및 대사질환의 예방 또는 치료용 약학 조성물
US9839645B2 (en) Agents for killing HIV-1-infected cells and application thereof
KR101325058B1 (ko) 신규한 케르세틴 유도체, 3',4'-디플루오로케르세틴, 그 제조방법 및 그 용도
KR101295010B1 (ko) 검은 생강으로부터 분리된 신규 화합물 및 그 화합물의 항바이러스제로서의 용도
KR101293249B1 (ko) C형 간염 바이러스 헬리카제 및 rna 복제효소의 활성을 동시에 저해하는 케르세틴 유도체
US10071062B2 (en) Methods for the treatment of hepatitis C
KR101068160B1 (ko) C형 간염 바이러스 rna핵산 중합효소의 활성을 저해하는 신규 플라보놀 유도체
WO2021054510A1 (ko) 셀레노사마필린 a를 유효성분으로 포함하는 유방암 예방 및 치료용 조성물
WO2023113349A1 (ko) 성게 유래 펩타이드 및 이의 용도
KR101261006B1 (ko) C형 간염 바이러스의 활성을 억제하는 신규 5,6-디히드록시크로몬 유도체 및 그 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18766794

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18766794

Country of ref document: EP

Kind code of ref document: A1