WO2018169283A1 - Novel use of rigosertib for treatment of hepatitis c virus disease - Google Patents

Abstract

The present invention relates to the novel use of rigosertib and, more particularly, to the use of rigosertib, which can specifically and effectively inhibit HCV infection without a resistance problem, in prevention or treatment of a liver disease caused by hepatitis C virus and in anti-viral activity to hepatitis C virus. Inhibiting the binding of micro RNA-122 to ELAVL1/HuR, rigosertib according to the present invention can be a therapeutic agent specific and effective for HCV infection. Furthermore, in contrast to developed preexisting anti-HCV therapeutic agents, rigosertib inhibits the activity of molecules acting in human hepatocytes without targeting a HCV protein and thus can solve the problem with developed, preexisting drugs with regard to drug resistance. Therefore, the rigosertib can be used alone or in combination with already known therapeutic agents, finding useful applications in a good therapeutic strategy of treating HCV without causing resistance.

Description

Novel Use of Ligosertip for the Treatment of Hepatitis C Virus Disease

The present invention relates to a novel use of ligosertip, and more particularly, to the use or prevention of ligosertip for the prevention or treatment of liver disease by hepatitis C virus and the antiviral use against hepatitis C virus.

Rigosertib (Onconova Therapeutics, Inc.) is a synthetic benzyl styryl sulfone substance, previously known as an anticancer agent, and has effects such as treatment of proliferative diseases (US7598232), myelodysplastic syndrome and acute myeloid leukemia (US8664272). Is known. However, there have been no reported uses associated with liver disease and further hepatitis C.

Drug repositioning is a concept that develops new indications for drugs currently in use and is recognized as an alternative to dramatically improve the potential for new drug development. New drug re-creation can reduce the cost and duration of new drug development if the safety of the candidate drug is verified and validated. Drug re-creation has (1) the use, preparation and stability of the drug (Drug) established; (2) Absorption, Distribution, Metabolism, Excretion and Toxicity (ADMET) data, namely drug absorption, diffusion, metabolism, excretion and drug toxicity information, are established; (3) the probability of failure due to safety issues is significantly lower, based on the results of clinical trials of the drug prior to drug use change; (4) Post-marketing Surveillance (PMS) has the advantage of not having to spend time obtaining safety data.

On the other hand, hepatitis C is mostly symptomatic in the early stage of infection, and when hepatitis C is infected, it is known to become chronic in more than 75% of the hepatitis B virus infection. Chronic hepatitis C is a disease in which the liver's inflammation continues chronically when the body's immune system does not completely remove the hepatitis C virus and the infection continues for more than 6 months.

Hepatitis C virus (HCV) is an RNA virus classified as the hepacivirus genus of the Flaviviridae family, and was discovered in the United States in 1989. It is a clinically important virus that causes hepatitis, cirrohosis and hepatocellular carcinoma (HCC). HCV is the leading cause of chronic hepatitis in developed countries such as the United States and Europe. According to the WHO, hepatitis C virus (HCV) is a more serious problem, with approximately 200 million people worldwide, more than 3% of the total population, and an increase of 3-4 million additional infections each year. .

Especially, the virus rarely disappears without treatment, and 5-20% progress to cirrhosis over the course of 20-25 years, and patients with liver cirrhosis progress to liver cancer at an incidence of 1-5% per year. It is known to become. About 12% of liver cirrhosis patients and about 15% of hepatocellular carcinoma patients are caused by hepatitis C virus and are known to be the main cause of chronic liver disease with hepatitis B virus.

Until now, the most widely used therapeutic agent for HCV is co-therapy of peginterferon and ribavirin, and the treatment rate is only 30-50%, which is also effective depending on the genotype of HCV. Different. Recently, therapies targeting HCV non-structural proteins, such as Sovaldi and Harvoni of Gilead Sciences, have been reported, but these are expensive to apply to the treatment of most patients.

The development of antiviral agents is constantly required to overcome the emergence of resistant viruses, drug side effects and high production costs. In the case of HCV, the development of a system capable of producing infectious virus has not been long since, and the mutation rate is high, and the frequent variants appear. Therefore, there is an urgent need for the development of therapeutic drugs that work widely with new mechanisms of action.

Accordingly, the present inventors have made an effort to develop a new HCV infection-treated or preventive agent that can solve the problem of resistance of existing drugs while acting specifically and effectively against HCV infection, and thus play an indispensable role in the hepatitis C virus replication. I found ELAVL1 / HuR, an intracellular molecule that specifically binds miRNA-122, which is known to bind, and revealed that ELAVL1 / HuR binds specifically and strongly to ligosertip. By inhibiting the binding of miRNA-122 and ELAVL1 / HuR, which are important for translation / replication, the present invention was completed as a specific and effective inhibitor against HCV infection, and has a medicinal use as an anti-HCV therapeutic agent.

The above information described in this Background section is only for improving the understanding of the background of the present invention, and therefore does not include information that forms a prior art known to those of ordinary skill in the art. You may not.

An object of the present invention is to provide a pharmaceutical composition that can prevent or treat liver disease caused by the new hepatitis C virus.

Another object of the present invention is to provide an antiviral composition for hepatitis C virus.

Another object of the present invention to provide a health functional food composition that can prevent or improve liver disease caused by hepatitis C virus.

Still another object of the present invention is to provide a method for preventing or treating liver disease caused by hepatitis C virus.

Still another object of the present invention is to provide a use for preventing or treating liver disease caused by hepatitis C virus.

Another object of the present invention is to provide an antiviral use against hepatitis C virus.

In order to achieve the above object, the present invention provides a novel use of ligosertip.

In particular, the present invention provides a use for the prevention or treatment of liver disease by hepatitis C virus of rigosertib or a pharmaceutically acceptable salt thereof.

In particular, the present invention provides an antiviral use against hepatitis C virus of rigosertib or a pharmaceutically acceptable salt thereof.

Specifically, the present invention is a pharmaceutical composition for the treatment or prevention of hepatitis C virus (Hepatitis C virus, HCV) containing ligosertip (rigosertib) or a pharmaceutically acceptable salt thereof as an active ingredient To provide.

The present invention also provides an antiviral composition against HCV, which contains ligosertip or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a nutraceutical composition for the improvement or prevention of liver disease by HCV containing the ligosertip or a food acceptable salt thereof as an active ingredient.

Specifically, the present invention provides a method for preventing or treating liver disease caused by hepatitis C virus of rigosertib or a pharmaceutically acceptable salt thereof.

The present invention provides a novel use of antiviral agents against HCV and liver disease caused by HCV that can specifically and effectively inhibit HCV infection without hepatitis C virus treatment, prevention, antiviral use, and resistance problems. Prophylactic or therapeutic compositions are provided.

Ligosertip according to the present invention can be a specific and effective treatment for HCV infection by inhibiting the binding of microRNA-122 and ELAVL1 / HuR. Moreover, unlike the anti-HCV treatments developed in the past, they do not target HCV proteins and inhibit the action of hepatocyte agonists in humans, which can solve the problem of resistance to the previously developed drugs. Combination therapy with known therapeutic agents is possible, and is also useful as a good treatment strategy for HCV that does not cause resistance.

1 shows miRNA-122 directly binding to ELAVL1 / HuR and ELAVL1 / HuR efficacy verification results, 1A is the isomiR structure of miRNA-122, and 1B is an RNA electro mobility shift assay (REMSA) using GST-HuR. 1C is the knockout result of intracellular molecule ELAVL1 / HuR using HCV subgenomic replicon capable of translation / replication assay, and 1D is specifically knockout of Huh7 intracellular ELAVL1 / HuR using CRISPR / Cas9 system. This is the result of the Westing blot when you make it.

Figure 2A is a graph of the screening results of compounds inhibiting HCV translation / proliferation using the structure of subgenomic replicon (HIRL-2Aneo-NSrep) of HCV capable of reporter assay and Seleckchem cellular kinase inhibitor libray, and 2B is a recombinant GST-HuR protein. The result of direct binding between biotin-rigosertb and in vitro pulldown assay is shown. 2C and 2D show the chemical structure of ligosertip and biotin-lygosertip, and 2E shows the interaction between HCV and molecules in the cell. (ELAVL1 / HuR-microRNA-122-HCV translation / cloning) is shown.

Figure 3 is a graph re-validating the anti-HCV effect of ligosertip through HIRL-2Aneo-NSrep_FL Huh-7 luciferase assay.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

Definitions of main terms used in the detailed description of the present invention are as follows.

The term "treatment" in the present invention means an approach for obtaining beneficial or desirable clinical results. For the purposes of the present invention, beneficial or desirable clinical outcomes include, but are not limited to, alleviation of symptoms, reduction of disease range, stabilization of disease state (ie, not worsening), delay or slowing of disease progression, disease state Improvement or temporary mitigation and alleviation (which may be partial or total), detectable or not detected. "Treatment" refers to both therapeutic treatment and prophylactic or preventative measures. Such treatments include the disorders to be prevented as well as the treatments required in the already occurring intestine. By "palliating" a disease, the extent to which the disease state and / or undesirable clinical signs and / or the time course of progression is slowed or lengthened, as compared to the case without treatment.

The term "prevention" in the present invention refers to a therapy that protects against the onset of a disease or disorder so that clinical symptoms of the disease do not develop. Thus, “prophylaxis” refers to administering a therapy to a subject (eg, administering a therapeutic agent) before the indication of the disease is detectable in the subject (eg, to a detectable infectious agent (eg, To a subject in the absence of the virus). A subject may be an individual at risk of developing a disease or disorder, such as an individual having one or more risk factors known to be associated with the development or onset of the disease or disorder. Thus, in certain embodiments, the term “preventing HCV infection” refers to administering an anti-HCV therapeutic substance to a subject having no detectable HCV infection. It is understood that the subject for anti-HCV prophylaxis may be an individual at risk for HCV virus.

As used herein, the term “therapeutically effective amount” or “effective amount” refers to an amount effective to elicit a desired biological or medical response, such as an amount of a compound sufficient to effect such treatment for a disease when administered to a subject for treating the disease. Refers to. The effective amount will vary depending on the compound, the disease and its severity and the age, weight, etc. of the subject to be treated. An effective amount can include a range of amounts. As will be understood in the art, an effective amount may be one or more doses, ie a single dose or multiple doses may be required to achieve the desired treatment endpoint. An effective amount can be considered in connection with administering one or more therapeutic agents, and a single agent can be considered to be provided in an effective amount if a desirable or beneficial result can be achieved or is achieved with one or more other agents. Suitable doses of any co-administered compound can be optionally reduced due to the combined action of the compound (eg, additional or synergistic effects).

Throughout this specification, the phrases “comprises” and “comprises”, unless stated otherwise in the context, include a given step or group of steps, but do not exclude any other step or group of steps. It must be understood.

Hereinafter, the present invention will be described in detail.

In one aspect, the present invention provides a method for preventing or treating liver disease caused by hepatitis C virus of rigosertib or a pharmaceutically acceptable salt thereof, and for use in a pharmaceutical composition for preventing or treating liver disease. It is about.

The present invention, in one aspect, relates to antiviral use for hepatitis C virus, or use for antiviral composition against hepatitis C virus, of rigosertib or a pharmaceutically acceptable salt thereof.

In one aspect, the present invention provides a pharmaceutical composition for the treatment or prevention of hepatitis C virus (Hepatitis C virus, HCV) containing a rigosertib or a pharmaceutically acceptable salt thereof as an active ingredient. It relates to a composition.

Rigosertipib (rigosertib) is a material known as an anticancer agent, specifically, a material having a structure as shown in the following formula (1).

[Formula 1]

Hepatitis C virus consists of a single stranded ~ 10-kb single stranded (+) sense RNA in molecular biology, belongs to flaviviridae, and utilizes an abnormal translation initiation process such as an internal ribosomal entry site. The translation process occurs and is cleaved by proteolytic enzymes encoded by intracellular proteases or viruses, respectively, to designate non-structural proteins that are important for the translation, replication, and proliferation of structural proteins or viruses, respectively. . Existing studies have been shown to actively utilize intracellular molecules in the replication and translation process of HCV. One of these intracellular molecules, microRNA-122 (miRNA-122, accounts for 70% of human hepatocyte microRNAs). Is known to play an essential role in the replication of hepatitis C virus.

In the embodiment of the present invention confirmed the association between miRNA-122 and ELAVL1 / HuR, and again confirmed that the ligand ELAVL1 / HuR that the lygosertip is found to be important for HCV translation and replication process, and thus Sertips have been shown to inhibit the translation / cloning / proliferation of HCV by inhibiting the direct binding of miRNA-122, an intracellular molecule with ELAVL1 / HuR molecules, which is known to play an important role in the replication process of HCV translation.

In another embodiment of the present invention, it was confirmed that ligosertip strongly inhibits replicon proliferation similarly to the danoprevir already developed by Roche and used in clinical trials, and shows an inhibitory effect of 80% or more even at low concentrations (0.2 μM).

Thus, the ligosertip of the present invention, unlike the anti-HCV therapeutic agent developed in the past, inhibits the action of host factors (miRNA-122 and ELAVL1), which is not a protein produced by HCV itself (miRNA-122 and ELAVL1) / HuR), because it does not target the HCV protein, it can be used as a preventive or therapeutic agent for liver disease caused by the new concept hepatitis C virus, which can solve the resistance problems of previously developed drugs.

In this case, the hepatitis C virus may be hepatitis C, hepatic fibrosis by hepatitis C virus, cirrhosis by hepatitis C virus, and liver cancer by hepatitis C virus.

At this time, the ligosertip may be characterized in that it is administered in combination with an HCV therapeutic agent, for example, sovaldi (sovaldi), Danoprevir (Daclatasvir).

It may also be co-administered with antiviral agents, for example ribavirin.

In addition, the ligosertip may be used as an antiviral agent for hepatitis C virus, which inhibits the translation / replication / proliferation of hepatitis C virus, and thus, the present invention is in another aspect, the ligosertip or pharmaceutically acceptable thereof. An antiviral composition for HCV containing possible salts as an active ingredient.

“Pharmaceutically acceptable salts” in the present invention refers to salts of any compound of the present invention that are not toxic or inappropriate for pharmaceutical use while maintaining the biological properties of the compound ligosertip of the present invention. Such salts can be derived from and include various organic and inorganic counterions known in the art. Such salts include (1) organic or inorganic acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, sulfamic acid, acetic acid, trifluoroacetic acid, trichloroacetic acid, propionic acid, hexanoic acid, cyclopentylpropionic acid, glycolic acid, gluc Taric acid, pyruvic acid, lactic acid, malonic acid, succinic acid, sorbic acid, ascorbic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, 3- (4-hydroxybenzoyl) benzoic acid, picric acid, cinnamic acid, mandelic acid, Phthalic acid, lauric acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethane-disulfonic acid, 2-hydroxyethanesulfonic acid, benzene sulfonic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphoric acid , Camphorsulfonic acid, 4methylbicyclo [2.2.2] -oct-2-ene-1-carboxylic acid, glucoheptonic acid, 3-phenylpropionic acid, trimethylacetic acid, tert-butylacetic acid, lauryl sulfate, gluconic acid , Benzoic acid, glutamic acid, hydroxynaphthoic acid, Acid addition salts formed as florisil acid, stearic acid, sulfamic acid cyclohexylsulfonyl, kwinsan, mu acid; Or (2) acidic protons present in the parent compound (a) metal ions (eg, alkali metal ions, alkaline earth metal ions or aluminum ions), alkali metal or alkaline earth metal hydroxides (eg, sodium, potassium, calcium, magnesium , Aluminum, lithium, zinc and barium hydroxides), ammonia, or (b) an organic base such as aliphatic, cycloaliphatic or aromatic organic amines such as ammonia, methylamine, dimethylamine, diethylamine, picoline , Ethanolamine, diethanolamine, triethanolamine, ethylenediamine, lysine, arginine, ornithine, choline, N, N'-dibenzylethylene-diamine, chloroprocaine, diethanolamine, procaine, N-benzylphenethyl Salts formed when coordinating with amines, N-methylglucamine piperazine, tris (hydroxymethyl) -aminomethane, tetramethylammonium hydroxide, and the like.

Further examples of salts include sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium salts, and the like, if the compound contains basic functional groups, salts with non-toxic organic or inorganic acids, such as hydrohalides (eg hydro Chloride or hydrobromide), sulfate, phosphate, sulfamate, nitrate, acetate, trifluoroacetate, trichloroacetate, propionate, hexanoate, cyclopentylpropionate, glycolate, glutarate, pyruvate Bate, Lactate, Malonate, Succinate, Sorbate, Ascorbate, Maleate, Maleate, Fumarate, Tartarate, Citrate, Benzoate, 3- (4-hydroxybenzoyl) benzoate, Peak Late, cinnamate, mandelate, phthalate, laurate, methanesulfonate mesylate), ethanesulfone , 1,2-ethane-disulfonate, 2-hydroxyethanesulfonate, benzenesulfonate (besylate), 4-chlorobenzenesulfonate, 2-naphthalenesulfonate, 4-toluenesulfonate, camphorate, Camphorsulfonate, 4-methylbicyclo [2.2.2] -oct-2-ene-1-carboxylate, glucoheptonate, 3-phenylpropionate, trimethylacetate, tert-butylacetate, lauryl sulfide Pate, gluconate, benzoate, glutamate, hydroxynaphthoate, salicylate, stearate, cyclohexylsulfate, quinate, muconate salt and the like.

The igorsertip or a pharmaceutically acceptable salt thereof is administered to a subject or patient, wherein the “subject (s)” are animals, eg non-primates (eg, cattle, pigs, horses, cats, Mammals, including, for example, dogs, rats and mice) and primates (eg, monkeys such as cynomolgous monkeys, chimpanzees and humans), and eg humans. In one embodiment, the subject does not resist or respond to current treatments for hepatitis C infection. In another embodiment, the subject is a livestock animal (eg, horse, cow, pig, etc.) or a pet animal (eg, dog or cat). In a preferred embodiment, the subject is a human.

The term “therapeutic agent (s) or therapeutic composition” as used herein refers to any agent (s) that can be used to treat or prevent a disorder or one or more indications thereof. In certain embodiments, the term “therapeutic agent” refers to a ligosertip, which is a compound of the present invention. In other specific embodiments, the term "therapeutic agent" does not refer to a compound of the present invention. In one embodiment, the therapeutic agent is an agent that is known to be useful for treating or preventing a disorder or one or more indications thereof, has been used for this purpose, or is currently in use.

The ligosertip used in the process of the invention preferably uses a compound of formula (I), where appropriate in the form of a salt, alone, or one or more suitable pharmaceutically acceptable carriers such as diluents or adjuvants, Or by using a pharmaceutical composition containing in form in combination with another anti-HCV agent.

In clinical practice, the derivatives of the present invention can be administered by any conventional route, in particular by oral, parenteral, rectal route, or by inhalation (eg in aerosol form).

As solid compositions for oral administration, tablets, pills, hard gelatin capsules, powders or granules can be used. In these compositions, the compounds according to the invention are admixed with at least one inert diluent or adjuvant such as sucrose, lactose or starch. These compositions may comprise, in addition to diluents, substances such as, for example, lubricants such as magnesium stearate, or coatings for controlled release.

As liquid compositions for oral administration, inert diluents such as pharmaceutically acceptable solutions, suspensions, emulsions, syrups and elixirs containing water or liquid paraffin can be used. These compositions may also include, in addition to diluents, substances such as, for example, wetting agents, sweetening agents or flavoring agents.

The composition for parenteral administration may be an emulsion or a sterile solution. As solvents or vehicles, propylene glycol, polyethylene glycol, vegetable oils, in particular olive oil or injectable organic esters such as ethyl oleate can be used. These compositions may also contain adjuvants, especially wetting agents, isotonic agents, emulsifiers, dispersants and stabilizers. Sterilization can be carried out in a number of ways, for example by using a filter for bacteria, by irradiation or by heating. They can also be prepared in the form of sterile solid compositions that, when used, can be dissolved in sterile water or any other injectable sterile medium.

Compositions for rectal administration are suppositories or capsules for rectal administration, which contain, in addition to the active ingredient, excipients such as cocoa butter, semisynthetic glycerides or polyethylene glycols.

The composition may also be an aerosol. When used in liquid aerosol form, the composition may be a stable sterile solution, or a solid composition which, when used, is dissolved in non-pyrogenic sterile water, saline or any other pharmaceutically acceptable vehicle. When used in anhydrous aerosol form for direct inhalation, the active ingredient is finely divided and mixed with a water soluble solid diluent or vehicle, for example dextran, mannitol or lactose.

In one embodiment, the compositions of the invention are pharmaceutical compositions or single unit dosage forms. Pharmaceutical compositions and single unit dosage forms of the invention may be used in a prophylactic or therapeutically effective amount of one or more prophylactic or therapeutic agents (eg, a compound of the invention, or other prophylactic or therapeutic agents), and typically one or more pharmaceutically acceptable Carriers or excipients.

In certain embodiments and contexts, the term "pharmaceutically acceptable" means that it can be used in animals, more specifically in humans, as listed in a pharmacopoeia that has been approved or generally accepted by the government or regulatory bodies of the government. do. The term “carrier” refers to a diluent, adjuvant (eg, Freund's adjuvant (complete and incomplete adjuvant)), excipient, or vehicle with which the therapeutic agent is administered. Such pharmaceutical carriers can be sterile liquids such as water and oils including oils or synthetic oils of petroleum, animal or vegetable origin, for example peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is the preferred carrier when the pharmaceutical composition is administered intravenously.

Saline solutions, and aqueous dextrose and glycerol solutions can also be used as liquid carriers, in particular injectable solutions. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E. W. Martin.

Conventional pharmaceutical compositions and dosage forms comprise one or more excipients. Suitable excipients are known to those skilled in the pharmaceutical arts, and non-limiting examples of suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, flour, silica gel, sodium stearate, glycerol monostearate, Talc, sodium chloride, skim milk powder, glycerol, propylene, glycol, water, ethanol and the like. Whether it is suitable for a particular excipient to be incorporated into a pharmaceutical composition or dosage form depends on various factors known in the art, including the manner in which the dosage form is administered to the subject, the specific active ingredients included in the dosage form, and the like. If desired, the composition or single unit dosage form may also contain small amounts of wetting or emulsifying agents, or pH buffers.

The invention also includes anhydrous pharmaceutical compositions and dosage forms comprising the active ingredient. For example, the addition of water (eg 5%) is widely accepted in the pharmaceutical industry as a simulated long term storage means for determining the properties (eg shelf life or stability) of a formulation over time. See, eg, Jens T. Carstensen, Drug Stability: Principles & Practice, 2d. Ed., Marcel Dekker, NY, NY, 1995, pp. 379 80. Indeed, water and heat accelerate the decomposition of some compounds. Thus, water and / or moisture typically occur during the manufacture, handling, packaging, storage, transportation and use of the formulation, so the effect of water on the formulation can be very important.

Anhydrous pharmaceutical compositions and dosage forms of the invention can be prepared using anhydrous or low moisture components and low moisture or low humidity conditions. If it is anticipated to be in substantial contact with moisture and / or moisture during manufacture, packaging and / or storage, pharmaceutical compositions and dosage forms comprising lactose and at least one active ingredient comprising primary or secondary amines may be in anhydrous form. Is preferably. Anhydrous pharmaceutical compositions should be prepared and stored so that their anhydrous properties are maintained. Therefore, it is desirable to package using known materials to prevent the anhydrous composition from exposure to water and to include it in a suitable specification kit. Examples of suitable packaging include, but are not limited to, sealed foils, plastics, unit dose containers (eg, vials), blister packs, and strip packs.

The invention also encompasses pharmaceutical compositions and dosage forms comprising one or more compounds that reduce the rate of degradation of the active ingredient. Such compounds (referred to herein as "stabilizers") include, but are not limited to, antioxidants (eg, ascorbic acid), pH buffers, or salt buffers.

The pharmaceutical compositions and single unit dosage forms can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release preparations and the like. Formulations for oral administration may include standard carriers such as pharmaceutical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate and the like. Such compositions and dosage forms contain a prophylactic or therapeutically effective amount of a prophylactic or therapeutic agent, preferably in purified form, together with a suitable amount of carrier, and will be provided in a form suitable for administration to a subject. The formulation should be suitable for the mode of administration. In a preferred embodiment, the pharmaceutical composition or single unit dosage form is sterile and is in a form suitable for administration to a subject, preferably an animal subject, more preferably a mammalian subject, and most preferably a human subject.

Pharmaceutical compositions of the invention are formulated to be suitable for their intended route of administration. Examples of routes of administration include parenteral routes of administration such as intravenous, intradermal, subcutaneous, intramuscular, subcutaneous, oral, oral, sublingual, inhalation, intranasal, transdermal, topical, transmucosal, intratumoral, synovial and There is, but is not limited to, a rectal route of administration. In certain embodiments, the composition is formulated into a pharmaceutical composition that has been modified for intravenous, subcutaneous, intramuscular, oral, intranasal or topical administration to a human according to conventional procedures. In one embodiment, the pharmaceutical composition is formulated into a composition that is administered subcutaneously to a human according to conventional procedures.

Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. If desired, the composition may also include solubilizers and local anesthetics (eg lignocaine) to soothe pain at the injection site.

Examples of dosage forms include tablets; Caplets; Capsules such as soft elastic gelatin capsules; Casein; Troches; Lozenges; Dispersion liquids; Suppositories; Ointment; Poultice (foam medicine); Paste; Powder; dressing; cream; salve; Solution; patch; Aerosols (eg, nasal sprays or inhalers); Gels; Liquid dosage forms suitable for oral or mucosal administration to a subject, including suspensions (eg, aqueous or non-aqueous liquid suspensions, oil-in-water emulsions, or water-in-oil liquid emulsions), solutions and elixirs; Liquid dosage forms suitable for parenteral administration to a subject; And sterile solids (eg, crystalline or amorphous solids) which, when restored, can provide a liquid dosage form suitable for parenteral administration to a subject.

The type of compositions, forms and dosage forms of the invention will typically vary depending on their use. For example, the dosage form used for the initial treatment of a viral infection may contain one or more active ingredients in an amount greater than the amount included in the dosage form used for the maintenance therapy of the viral infection. Similarly, parenteral dosage forms may contain one or more active ingredients in an amount less than that included in oral dosage forms used to treat the same disease or disorder. Other ways of modifying this mode and the specific dosage forms encompassed by this invention will already be apparent to those skilled in the art. See, eg, Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing, Easton PA (1990).

The components of the compositions of the present invention are generally anhydrous lyophilized powders or water-free concentrates in sealed containers, such as ampoules or sachets, for example indicative of the amount of active agent, mixed separately or together in a unit dosage form. It is provided in the form. When the composition is administered by infusion, the composition may be dispensed into an infusion container containing sterile pharmaceutical grade water or saline. When the composition is administered by injection, sterile water or saline ampoules for injection may be provided to allow the components to be mixed prior to administration.

Conventional dosage forms of the present invention comprise a compound of the present invention, ligosertip, or a pharmaceutically acceptable salt, solvate or hydrate thereof in an amount ranging from about 0.1 mg to about 1000 mg / day, which is in the morning A single dose once a day or divided doses with meals preferably for one day.

Pharmaceutical compositions of the invention suitable for oral administration may be in separate dosage forms, such as tablets (eg chewing tablets), caplets, capsules and liquids (eg flavor syrups) and the like. Such dosage forms contain a predetermined amount of active ingredient and can be prepared by methods of pharmacy known to those skilled in the art. In general, see Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing, Easton PA (1990). In certain embodiments, oral dosage forms are solid and are prepared under anhydrous conditions using anhydrous ingredients as detailed in the paragraphs above.

However, the scope of the present invention extends to other than anhydrous solid oral dosage forms. Conventional oral dosage forms of the invention are prepared by combining the active ingredient (s) as an intimate mixture with one or more excipients according to conventional pharmaceutical synthesis techniques. Excipients can take a wide variety of forms depending on the form of preparation desired for administration. For example, excipients suitable for use in liquid or aerosol dosage forms for oral administration include, but are not limited to, water, glycols, oils, alcohols, flavoring agents, preservatives and coloring agents. Suitable excipients for use in solid oral dosage forms (eg, powders, tablets, capsules and caplets) include, but are not limited to, starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders and disintegrants Does not. When solid excipients are used, they appear in the most advantageous oral dosage unit form because tablets and capsules are easy to administer. If desired, tablets may be coated by standard aqueous or non-aqueous techniques. Such dosage forms can be prepared by any of the methods of preparation.

In general, pharmaceutical compositions and dosage forms are prepared by uniformly and intimately mixing the active ingredient with a liquid carrier, a finely divided solid carrier, or both, and then molding the product, if necessary, into the desired shape. For example, tablets can be made by compression or molding. Compressed tablets may be prepared by compressing, in a suitable machine, the active ingredient in a free flowing form (eg, powder or granules), optionally mixed with excipients. Molded tablets may be made by molding in a suitable machine a mixture of powdered compounds moistened with an inert liquid diluent.

Examples of excipients that can be used in oral dosage forms of the invention include, but are not limited to, binders, fillers, disintegrants and lubricants. Suitable binders for use in pharmaceutical compositions and dosage forms include corn starch, potato starch or other starch, gelatin, natural and synthetic gums such as acacia gum, sodium alginate, alginic acid, other alginates, powder tragacanth, guar gum, Cellulose and its derivatives (e.g. ethyl cellulose, cellulose acetate, carboxymethyl cellulose calcium, sodium carboxymethyl cellulose), polyvinyl pyrrolidone, methyl cellulose, pregelatinized starch, hydroxypropyl methyl cellulose, (e.g. , 2208, 2906, 2910), microcrystalline cellulose, and mixtures thereof.

Examples of fillers suitable for use in the pharmaceutical compositions and dosage forms disclosed herein include talc, calcium carbonate (eg, granules or powders), microcrystalline cellulose, powdered cellulose, dexrate, kaolin, mannitol, silicic acid, sorbitol, starch , Pregelatinized starch, and mixtures thereof, but is not limited thereto. The binder or filler included in the pharmaceutical composition of the present invention is typically present in an amount of about 50 to about 99 weight percent of the pharmaceutical composition or dosage form. Suitable forms of microcrystalline cellulose include AVISEL PH 101, AVICEL PH 103, AVICEL RC 581, AVICE PH 105 and are commercially available (FMC Corporation, American Viscose Division, Avicel Sales). Sales; commercially available from Markus Hook, Pennsylvania, USA), and mixtures thereof.

The use of disintegrants in the compositions of the present invention provides tablets that disintegrate when exposed to an aqueous environment. Tablets containing too much disintegrant may disintegrate upon storage, and tablets containing too little disintegrant may not disintegrate at the desired rate or under the desired conditions. Therefore, a sufficient amount of disintegrant should not be used to form the solid oral dosage form of the present invention, which is neither too much nor too little to deleteriously alter the release of the active ingredient. The amount of disintegrant used depends on the type of formulation and can be readily determined by one skilled in the art. Typical pharmaceutical compositions comprise about 0.5 to about 15 weight percent, specifically about 1 to about 5 weight percent disintegrant. Disintegrants that can be used in the pharmaceutical compositions and dosage forms of the invention include agar, alginic acid, calcium carbonate, microcrystalline cellulose, croscarmellose sodium, crospovidone, polyacrylic potassium, sodium starch glycolate, potato or tapioca starch, Pregelatinized starch, other starches, clays, other algins, other celluloses, gums, and mixtures thereof.

Lubricants that can be used in the pharmaceutical compositions and dosage forms of the present invention include calcium stearate, magnesium stearate, mineral oil, mineral diesel, glycerin, sorbitol, mannitol, polyethylene glycol, other glycols, stearic acid, sodium lauryl sulfate Talc, hydrogenated vegetable oils (e.g. peanut oil, cottonseed oil, sunflower seed oil, sesame oil, olive oil, corn oil and soybean oil), zinc stearate, ethyl oleate, ethyl laurate, agar, and their Mixtures are but are not limited to these. Additional lubricants include, for example, siloid silica gel (AEROSIL 200, manufactured by WR Grace Co., Baltimore, MD), solidified aerosol of synthetic silica (Degussa Corporation) (Available from Degussa Co., Piano, Tex.), CAB O SIL (pyrogenic silicon dioxide product, from Cabot Co .; Boston, Mass.), And mixtures thereof. . When used, lubricants are typically used in amounts less than about 1% by weight of the pharmaceutical composition or dosage form into which they are incorporated.

The ligosertip of the present invention can be administered, for example, by controlled release means or delivery devices known to those skilled in the art. Such dosage forms can be, for example, hydropropylmethyl cellulose, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings, particulates, liposomes, microspheres, or combinations thereof to provide a desired release profile at various ratios. Water may be used to delay or release controlled release of one or more active ingredients. Suitable controlled release formulations known to those skilled in the art, including those described herein, can be readily selected for use with the active ingredients of the present invention. Accordingly, the present invention includes single unit dosage forms suitable for oral administration, such as tablets, capsules, gelcaps and caplets, etc., modified to controlled release.

All controlled release drugs have a common purpose to provide improved drug therapies than are achieved by their corresponding non-controlled release drugs. Ideally, the use of controlled release formulations that are best designed for medical treatment is characterized by the use of a minimum amount of drug substance to cure or control symptoms within a minimum amount of time. Advantages of controlled release formulations include extended activity of the drug, a decrease in the number of doses and an increase in compliance of the subject. In addition, controlled release formulations may be used to affect the time of onset of the drug or other properties such as blood levels of the drug, thus affecting the development of side effects (adverse effects).

Most controlled release formulations initially release an amount of drug (active ingredient) that immediately produces the desired therapeutic effect, and release the drug stepwise and continuously in an amount that sustains the level of the therapeutic or prophylactic effect over an extended period of time. It is designed to As such, to maintain a constant drug level in the body, the drug must be released from the dosage form at a rate that replaces the amount of drug that is metabolized and secreted by the human body. Controlled release of the active ingredient can be stimulated by a variety of conditions including pH, temperature, enzymes, water, or other physiological conditions or compounds, and the like.

In certain embodiments, the drug can be administered using intravenous infusion, implantable osmotic pumps, transdermal patches, liposomes, or other modes of administration. In one embodiment, a pump can be used (Sefton, CRC Crit. Ref. Biomed. Eng. 14: 201 (1987)); Buchwald et al., Surgery 88: 507 (1980); Saudek et al., N. Engl. J. Med. 321: 574 (1989). In other embodiments, polymeric materials can be used. In another embodiment, a controlled release system can be located at a suitable site determined by one of skill in the art in a subject, ie only a portion of the systemic dosage is required (eg, Goodson, Medical Applications of Controlled Release, vol. 2, pp. 115-138 (1984)). Other controlled release systems have been reviewed and discussed by Langer (Science 249: 1527-1533 (1990)). The active ingredient is a solid internal matrix such as polymethylmethacrylate, polybutylmethacrylate, plasticized or unplasticized polyvinylchloride, plasticized nylon, plasticized polyethylene terephthalate, natural rubber, polyisoprene , Polyisobutylene, polybutadiene, polyethylene, ethylene-vinylacetate, copolymers, silicone rubber, polydimethylsiloxane, silicone carbonate copolymers, hydrogels of hydrophilic polymers such as acrylic acid and methacrylic acid, collagen, It can be dispersed in crosslinked polyvinylalcohol and partially hydrolyzed crosslinked polyvinyl acetate, which is an external polymer membrane such as polyethylene, polypropylene, ethylene / propylene copolymer, ethylene / ethyl acrylate copolymer, ethylene / vinyl Acetate copolymer, silicone rubber, polydimethyl siloxane, four Friendly rubber, chlorinated polyethylene, polyvinyl chloride; Vinyl acetate, vinylidene chloride, vinyl chloride copolymer with ethylene and propylene, ionomer polyethylene terephthalate, butyl rubber epichlorohydrin rubber, ethylene / vinyl alcohol copolymer, ethylene / vinyl acetate / vinyl alcohol tripolymer, and ethylene / It is surrounded by vinyloxyethanol copolymer, which is insoluble in body fluids. The active ingredient then diffuses through the outer polymeric membrane in the release rate control step. The proportion of active ingredient in such parenteral compositions is highly dependent on the particular nature of the subject as well as the needs of the subject.

The invention also provides parenteral dosage forms. Parenteral dosage forms can be administered to a subject by a variety of routes including subcutaneous, intravenous (including bolus injection), intramuscular and intraarterial routes of administration, and the like. Because these parenteral routes of administration typically bypass the subject's natural defenses against contaminants, parenteral dosage forms are preferably sterile or can be sterilized prior to administration to the subject. Examples of parenteral dosage forms include, but are not limited to, injectable solutions, anhydrous products that can be dissolved or suspended in pharmaceutically acceptable injectable vehicles, injectable suspensions, and emulsions.

Suitable vehicles are known to those skilled in the art that can be used to provide the parenteral dosage forms of the invention. Examples of these include water for injection (USP); Aqueous vehicles such as sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, lactated Ringer's injection, and the like; Water miscible vehicles such as ethyl alcohol, polyethylene glycol, polypropylene glycol, and the like; And non-aqueous vehicles such as corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate and benzyl benzoate, and the like. In addition, compounds that increase the solubility of one or more active ingredients disclosed herein may also be incorporated into the parenteral dosage forms of the invention.

The invention also provides transdermal, topical and mucosal dosage forms. Transdermal, topical and mucosal dosage forms of the invention include, but are not limited to, ophthalmic solutions, sprays, aerosols, creams, lotions, ointments, gels, solutions, emulsions, suspensions or other forms known to those skilled in the art. See, eg, Remington's Pharmaceutical Sciences, 16th, 18th and 20th eds., Mack Publishing, Easton PA (1980, 1990 & 2000) and Introduction to Pharmaceutical dose form, 4th ed., Lea & Febiger, Philadelphia (1985). )].

Suitable dosage forms for treating oral mucosal tissue may be formulated as oral cleaning solutions or oral gel formulations. In addition, transdermal dosage forms include "reservoir" or "matrix" patches, which may be skin or wound The site may be applied for a certain period of time to infiltrate the desired amount of active ingredient.

Suitable excipients (eg, carriers and diluents) included in the present invention, and other materials that can be used to provide transdermal, topical and mucosal dosage forms, are known to those of ordinary skill in the art of pharmacy, and they are given in any given pharmaceutical composition or dosage form. It depends on the specific organization to which it applies. In view of this fact, conventional excipients include water, acetone, ethanol, ethylene glycol, propylene glycol, butane 1,3 diol, isopropyl myristate, isopropyl, forming lotions, tinctures, creams, emulsions, gels or ointments. Palmitate, mineral oil, and mixtures thereof, and the like, which are non-toxic and pharmaceutically acceptable. If desired, humectants or humectants may also be added to the pharmaceutical compositions and dosage forms. Examples of such additional ingredients are known in the art. See, eg, Remington's Pharmaceutical Sciences, 16th, 18th and 20th eds., Mack Publishing, Easton PA (1980, 1990 & 2000).

Depending on the particular tissue to be treated, additional ingredients may be used prior to treatment with the active ingredients of the invention, used with the active ingredients of the invention, or after treatment with the active ingredients of the invention. For example, penetration enhancers can be used to assist in delivering the active ingredient to the tissue. Suitable penetration enhancers include acetone; Various alcohols such as ethanol, oleyl and tetrahydrofuryl; Alkyl sulfoxides such as dimethyl sulfoxide; Dimethyl acetamide; Dimethyl formamide; Polyethylene glycol; Pyrrolidones such as polyvinylpyrrolidone; Kollidon grades (povidone, polyvidone); Urea; And various water soluble or water insoluble sugar esters such as Tween 80 (polysorbate 80) and Span 60 (sorbitan monostearate).

In addition, the pH of the pharmaceutical composition or dosage form or the pH of the tissue to which the pharmaceutical composition or dosage form is applied can be adjusted to improve delivery of one or more active ingredients. Similarly, the delivery can be improved by adjusting the polarity of the solvent carrier, its ionic strength or tension. The delivery may also be improved by adding a compound, such as stearate, to the pharmaceutical composition or dosage form to advantageously alter the hydrophilicity or lipophilicity of one or more active ingredients. In this regard, stearates may act as liquid vehicles for formulation, emulsifiers or surfactants, and delivery or penetration enhancers. Other salts, hydrates or solvates of the active ingredient can be used to further adjust the properties of the resulting composition.

When treating a human, the physician will determine the dosage that is considered most appropriate, depending on the prophylactic or curative treatment, and the age, weight, stage of infection and other factors specific to the subject to be treated. Generally, for adults, the dosage is about 1 to about 1000 mg / day, about 5 to about 250 mg / day, or about 10 to 50 mg / day. In certain embodiments, the dosage is about 5 to about 400 mg / day, more preferably 25 to 200 mg / day, per adult. Also preferred is a dosage rate of about 50 to about 500 mg / day.

In a further aspect, the present invention provides a method of treating or preventing a hepatitis C virus infection by administering to a subject in need thereof an effective amount of a compound of the invention having a high therapeutic index for the hepatitis C virus or a pharmaceutically acceptable salt thereof. Hepatitis C virus infection, a method for treating or preventing liver disease caused by such a virus. The therapeutic index can be measured according to any method known to those skilled in the art, such as those described in the Examples below. In certain embodiments, the therapeutic index is the ratio of the concentration of the compound that is toxic to the concentration of the compound effective for hepatitis C virus. Toxicity can be measured by any technique known to those of skill in the art, including cytotoxicity (eg IC50 or IC90) and lethal dose (eg LD50 or LD90). Similarly, the effective concentration can be measured using any technique known to those skilled in the art, including effective concentrations (eg, EC50 or EC90) and effective doses (eg, ED50 or ED90). Preferably, similar measurements are compared in proportions (eg IC50 / EC50, IC90 / EC90, LD50 / ED50 or LD90 / ED90). In certain embodiments, the therapeutic index may be as high as 2.0, 5.0, 10.0, 15.0, 20.0, 25.0, 50.0, 75.0, 100.0, 125.0, 150.0 or more.

The amount of a compound or composition of the present invention effective to prevent, treat, manage or ameliorate a disorder or one or more indications thereof will vary depending on the nature and severity of the disease or condition and the route by which the active ingredient is administered. The frequency and dosage of administration may also be determined for each subject depending on the particular therapy (eg, therapeutic or prophylactic) administered, the severity of the disorder, disease or condition, the route of administration as well as the subject's age, weight, response and past history. It will depend on the specific element. Effective dosages may be extrapolated from dose-response curves derived from in vitro or animal model test systems.

Examples of composition dosages are amounts of active compound (mg or μg) per kilogram of subject or sample, for example about 10 μg / kg to about 50 mg / kg, about 100 μg / kg to about 25 mg / kg, or about 100 μg / kg to about 10 mg / kg.

For compositions of the present invention, the dosage administered to a subject is typically 0.140 mg to 3 mg per kg body weight of the subject based on the weight of the active compound. Preferably, the dosage administered to a subject is 0.20 mg to 2.00 mg or 0.30 mg to 1.50 mg per kg body weight of the subject.

In general, the daily dosage range of the compositions of the present invention proposed for the symptoms described herein is about 0.1 to about 1000 mg / day, which is a single dose once a day or divided doses throughout the day. In one embodiment, the daily dose is divided into equal amounts and administered twice daily. The daily dosage range should be about 10 to about 200 mg / day, more specifically about 10 to about 150 mg / day, even more specifically about 25 to about 100 mg / day. As will be apparent to those skilled in the art, in some cases it may be necessary to use the active ingredient in dosages outside the dosage ranges disclosed herein. It is also noted that the clinician or therapist will know when and how to stop, adjust or terminate the therapy with respect to the subject's response.

As is already known to those skilled in the art, different therapeutically effective amounts can be applied for different diseases and conditions. Similarly, an amount sufficient to prevent, manage, treat or ameliorate the disorder but not sufficient to cause side effects associated with the compositions of the present invention or sufficient to reduce the side effects is also included in the dosage and frequency schedule described above. do. In addition, when administering a composition of the present invention to a subject in multiple doses, not all doses need to be identical. For example, the dosage administered to a subject can be increased to improve the prophylactic or therapeutic effect of the composition, which can be reduced to reduce one or more side effects experienced by a particular subject.

The ligosertip of the present invention or a food acceptable salt thereof may be used for the improvement or prevention of liver disease caused by hepatitis C virus, and thus the present invention provides the ligosertip or a foodstuff thereof. The present invention relates to a nutraceutical composition for improving or preventing liver disease caused by HCV containing an acceptable salt as an active ingredient.

The health functional food of the present invention can be prepared and processed in the form of tablets, capsules, powders, granules, liquids, pills and the like for the purpose of preventing and improving liver disease caused by HCV.

The term "health functional food" used in the present invention refers to a food manufactured and processed using raw materials or ingredients having functional properties useful for the human body according to Act No. 6767 of the Health Functional Food Act, and the structure and function of the human body. It means the ingestion for the purpose of obtaining a useful effect for health use such as nutrient control or physiological action.

The health functional food of the present invention may include a conventional food additive, and the suitability as a food additive, unless otherwise specified, in accordance with the General Regulations of the Food Additives and General Test Methods approved by the Food and Drug Administration, etc. Judging by the standards and standards.

Examples of the items listed in the "Food Additive Reduction" include chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid and cinnamic acid; Natural additives such as dark blue pigment, licorice extract, crystalline cellulose, high amount pigment and guar gum; And mixed preparations such as sodium L-glutamate, algae additives, preservatives and tar dyes.

For example, the health functional food in the form of tablets is granulated in a conventional manner by mixing a mixture of ligosertip, an active ingredient of the present invention with excipients, binders, disintegrants and other additives, and then compressed with a lubricant and the like. Or the mixture can be directly compression molded. In addition, the health functional food in the form of tablets may contain a mating agent or the like as necessary.

Hard capsules of the health functional food in the form of capsules can be prepared by filling a conventional hard capsules mixture of a mixture of ligosertip, which is the active ingredient of the present invention, with additives such as excipients, and the soft capsule is excipient The mixture mixed with such additives can be prepared by filling in a capsule base such as gelatin. The soft capsule agent may contain a plasticizer such as glycerin or sorbitol, a colorant, a preservative, and the like, as necessary.

The health functional food in the form of a cyclic form may be prepared by molding a mixture of the compound of Formula 1, an excipient, a binder, a disintegrant, etc., which is the active ingredient of the present invention by a known method, and if necessary, sucrose or other It may be encapsulated with a skin coating, or the surface may be coated with a material such as starch, talc.

The health functional food in the form of granules can be prepared in the form of a mixture of a mixture of ligosertip and excipients, excipients, binders, disintegrants, etc., which are the active ingredients of the present invention, by a conventionally known method. And the like.

The health functional food may be beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes and health supplements.

Example

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1

ELAVL1 Of Hur  by miRNA -122 Regulation and Identification of Hepatitis C Bias Replication Correlation

Intracellular molecules that bind miRNA-122, which is known to play an essential role in the translation / replication / proliferation of hepatitis C virus (Jopling et al.), Were searched. It was analyzed by intracellular molecules that bind to biotinylated miRNA-122 using LC-MS / MS technique. As a result, ELAVL1 / HuR was identified and specific binding between miRNA-122 and ELAVL1 / HuR was removed. In order to monitor transcription / cloning of HCV at knockout), the following experiment was performed.

1-1: Confirmation of specific binding between ELAVL1 / HuR and miRNA-122

There are four types of isomiR for miRNA-122 in liver cells (FIG. 1A). Specific binding between miRNA-122s was confirmed by RNA electro-mobility shift assay (REMSA), and specific recombinant ELAVL1 / HuR purification was performed. And REMSA process is as follows.

Esherichia coli Recombinant glutathione from plasmid pGEX-KG-HuR (WT) using strain BL21 (DE3) pLysS (Promega)SELAVL1 / HuR (GST-HuR) fused to transferase (GST) was produced. Isopropyl-β-D-thio galactopyranoside (final concentration 0.5 mM) was added to induce GST-HuR protein expression at OD 600 0.5. After 5 hours incubation at 25 ° C., cells are harvested and lysed [20 mM phosphate (pH 7.6), 300 mM NaCl, 0.5 mM phenyl methane sulfonylfluoride (PMSF), 1 mM β-mercaptoethanol and 10% glycerol (v / v)] followed by sonication. The resulting cell extracts were loaded into glutathione agarose 4B (Peptron, Dajeon, Korea), washed with lysis buffer, and bound GST-HuR was eluted with reduced glutathione. Purified recombinant GST-HuR contains 20 mM HEPES-KOH (pH 7.5), 50 mM KCl, 5 mM MgCl₂, Dialysis was performed with buffer containing 10% glycerol (v / v). The 5 ′ end of miRNA-122 artificially synthesized using T4 polynucleotide kinase (PNK) for REMSA³²After labeling with P, 25,000 cpm was used for each reaction. Each recombinant protein is 1 mM MgCl₂Mixed with 5% glycerol (v / v), 0.5 mM dithiothreitol, 1 unit / μl RNaseOUT and reacted at 30 ° C. for 20 minutes, and then the RNA-protein complex was added to a 5% non-denatured gel. Analyzed by auto radiography.

As a result, the wild type had only one nucleotide difference in the 3 ′ end region of miRNA-122, the binding of which was the strongest, indicating that the 3 ′ end region of miRNA-122 was very important for binding to ELAVL1 / HuR. 1B shows that ELAVL1 / HuR accounts for 70% of human hepatocyte miRNA and binds directly to miRNA-122, which is known to play an essential role in the replication process of hepatitis C virus.

1-2: Identification of ELAVL1 / Hur and Hepatitis C Bias Replication Correlation

To study the correlation between ELAVL1 / HuR and hepatitis C virus replication, luciferase-expressing hepatitis C subgenomic replicons derived from the infectious hepatitis C virus production system (pJFH1) were introduced and identified using the CRISPR / Cas9 system ELAVL1 / HuR. When knocking out ELAVL1 / HuR using specific sgRNA, the degree of synthesis of hepatitis C virus and the activity of hepatitis C subgenomic replicon, which can be luciferase assayed, were tracked. If ELAVL1 / HuR is knocked out, type C Inhibition of hepatitis subgenomic replicon translation / replication was confirmed as follows.

Knockout using the CRISPR / Cas9 system of the target genes (ELAVL1 / HuR) was performed using pLentiCRISPRv2 (Addgene) and stably transduced Huh7 cells were selected using puromycin. Cells were selected with puromycin and collected and colonies of selected Huh7 cells were analyzed using Western blot 30 days after infection. Genomic DNA of selected colonies was isolated using the Genomic DNA Column Kit (Zymo Reserch), amplified from genomic DNA adjacent to the ELAVL1 / HuR target site for the inserted guide RNA sequence and DNA sequencing of the resulting amplicon sequences (Cosmo). Genentech).

First, pSGR-JFG1 / Luc-GND (Ralf Bartenschlager), which is a mutant of the activation site of pSGR-JFG1 / Luc or NS5B, which is a subgenomic replicon capable of two types of Rutherase assays, is digested with restriction enzymes and then in vitro transcription is performed. RNA of luciferase-expressing hepatitis C subgenomic replicon was synthesized. The naive Huh7 cell line or CRISPR / Cas9 gene shears were used to transduce ELAVL1 / HuR knockout cells using electroporation (1 ug of RNA into 1 × 10 ^ 6 cells). After injection (transfection) was fractionated at each time period to perform a luciferase assay. Fractionated cells were lysed with 1 × passive lysis buffer (Promega), and a portion of the lysate was analyzed by the Dual-Luciferase® Reporter Assay System (Promega), and the firefly luciferase signal was normalized to Renilla signal or total protein amount.

As a result, as shown in FIG. 1C, when ELAVL1 / HuR was KO, hepatitis C subgenomic replicon translation / replication was inhibited.

In addition, western blots were performed. First, anti-HuR antibody (mouse monoclonal antibody, 3A2, Santa Cruz Biotech), anti-eIF-4GI (rabbit polyclonal antibody, Pohang University of Science and Technology), anti-GST antibody (rabbit polyclonal, Genescript) as primary antibody And cell lysates were mixed with 5 × protein sample buffer for Western blot analysis, denatured at 95 ° C. for 5 min and then electrophoresed on 11% polyacrylamide-SDS gel. After electrophoresis, the proteins were transferred to nitrocellulose membrane at 4 ° C., 80v for 1 hour. 5% skim milk powder in TBS (50 mM Tris-HCl [pH7.4] and 150 mM NaCl) containing 0.1% Tween-20 was reacted for 30 minutes at room temperature, followed by reaction at 4 ° C. with primary antibody overnight. I was. The nitrocellulose membrane was washed three times with TBS-T for 15 minutes before being treated with the secondary antibody. Anti-rabbit and anti-mouse IgG (1 / 5,000 dilution, Vector Laboratories) with horseradish-peroxidase bound as a secondary antibody was used.

As a result, as shown in FIG. 1D, when ELAVL1 / HuR was KO, hepatitis C subgenomic replicon translation / replication was completely inhibited.

Example 2

Isolation and Analysis of Ligosertip as HCV Inhibitor

2-1: Isolation of Ligosertip as HCV Inhibitor

To validate the importance of cell signaling in the interactions between HCV's intracellular molecules and to investigate the effects of these processes on the translation / cloning / proliferation process of HCV, HCV subgenomic replicons are available. Primary screening was attempted using inhibitor libraries for various kinases in the cell.

First, the Huh7 cell line containing assayable HCV 1b subgenomic replicon HIRL-2Aneo-NSrep was plated, followed by treatment with Selleckchem cellular kinase inhibitory chemicals (Korea Research Institute of Bioscience and Biotechnology) to a concentration of 1 μM, followed by luciferase assay 24 hours later Was performed. Fractionated cells were lysed with 1 × passive lysis buffer (Promega), and a portion of the lysate was analyzed by the Dual-Luciferase® Reporter Assay System (Promega), and the firefly luciferase signal was normalized to Renilla signal or total protein amount.

As a result, the primary screening of 211 Selleckchem cellular kinase inhibitory chemicals revealed that rigosertip (# 65, FIG. 2C), a well-known anti-cancer agent in Phase III, is currently a novel inhibitor of HCV translation / proliferation. Excavated as. Moreover, the material strongly inhibited replicon proliferation and showed over 80% inhibition even at low concentrations (0.2 μM), similar to danoprevir already developed by Roche and in clinical use (FIG. 2A).

2-2: In vitro pulldown assay as an HCV inhibitor

Dilute the isolated recombinant GST protein or GST-HuR protein with Drosha lysis buffer [20 mM Tris-HCl (pH 7.5), 100 mM KCl, 0.2 mM EDTA, 2 mM MgCl ₂ , 2 mM CaCl ₂ , Protease Inhibitor Cocktail] The RNase inhibitor was added thereto and then mixed with biotinylated-rigosertib (FIG. 2D) combined with streptavidin-magnetic bead (Promega). After binding, the bead samples were washed four times with modified Drosha wash buffer and the remaining wash buffer was completely removed. Then 5 × sample buffer for Western blot was added to the beads and Western blot was performed using GST specific antibody (Genescript).

As a result, as shown in FIG. 2B, it was confirmed that the molecule ELAVL1 / HuR, which has been found to be important for HCV translation and replication process, directly binds to igor sertip, and therefore, igor sertip plays an important role in the replication process of HCV translation. By inhibiting the direct binding of miRNA-122, which is known to be, to the intracellular molecule ELAVL1 / HuR molecule, it was confirmed to inhibit translation / cloning / proliferation of HCV (FIG. 2E).

Example 3

Revalidation of anti-HCV effects of ligosertip

In order to reverify that the ligosertip identified in Example 2 is a specific and effective inhibitor against HCV infection, the following experiment was additionally performed.

First, an assayable HCV 1b subgenomic replicon HIRL-2Aneo-NSrep and firefly luciferase were assayed for HCV-specific inhibitor ligosertip, which was discovered using a subgenomic replicon of HCV capable of reporter assay in the same line as the screening result of Example 2. After the Huh7 cell line was plated by 2 × 10 ^ 4 cells in 24 wells, 1 μM of rigosertib was treated for 0, 24, 48, and 72 hours, and then fractionated at each time period to perform luciferase assay. Fractionated cells were lysed with 1 × passive lysis buffer (Promega) and a portion of the lysate was analyzed by Dual-Luciferase® Reporter Assay System (Promega). Renilla signals were normalized to firefly luciferase signals.

As a result, as shown in FIG. 3A, it was confirmed that the translation / proliferation of HCV was suppressed. In addition, when the same experiment was performed by comparing the sergoti with 0.5 μM concentration, it was confirmed that the same inhibition as shown in Figure 3B.

This means that the inhibition mechanism of ligosertip according to the present invention, unlike the anti-HCV therapeutic agent developed in the past, inhibits the action of host factors (acting molecules of human hepatocytes) that are not proteins produced by HCV itself (miRNA- Because it does not target 122 and ELAVL1 / HuR) and HCV proteins, it is expected to be a new concept of anti-hepatitis C virus that can solve the problem of resistance to drug. It is expected to be a good treatment strategy for HCV which is inexpensive and does not cause resistance because it is used alone or in combination with previously known ribavirin.

As described above in detail a specific part of the content of the present invention, for those skilled in the art, such a specific description is only a preferred embodiment, which is not limited by the scope of the present invention Will be obvious. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

SEQ ID NO: 1 (Wild type of miR-122):

uggagugugacaaugguguuug

SEQ ID NO: 2 (Isomir of miR-122 (+ A)):

uggagugugacaaugguguuuga

SEQ ID NO: 3 (Isomir of miR-122 (+ U)):

uggagugugacaaugguguuugu

SEQ ID NO: 4 (Isomir of miR-122 (-G)):

uggagugugacaaugguguuu

SEQ ID NO: 5 (miR-21):

uagcuuaucagacugauguuga

Claims (10)

1. Pharmaceutical composition for the treatment or prevention of hepatitis C virus (Hepatitis C virus, HCV) containing rigosertib (rigosertib) or a pharmaceutically acceptable salt thereof as an active ingredient.
2. The method of claim 1, wherein the hepatitis C virus is selected from the group consisting of hepatitis C, liver fibrosis by hepatitis C virus, cirrhosis by hepatitis C virus, and liver cancer by hepatitis C virus. Pharmaceutical composition, characterized in that any one or more.
3. The pharmaceutical composition according to claim 1, which is administered in combination with an HCV therapeutic agent or an antiviral agent against HCV.
4. The pharmaceutical composition of claim 1, wherein the ligosertip binds to ELAVL1 / HuR to inhibit the binding of miRNA-122 and ELAVL1 / HuR.
5. An antiviral composition for HCV, containing ligostertip or a pharmaceutically acceptable salt thereof as an active ingredient.
6. A dietary supplement for the improvement or prevention of liver disease caused by HCV, which contains ligosertip or a food acceptable salt thereof as an active ingredient.
7. The method of claim 6, wherein the hepatitis C virus is selected from the group consisting of hepatitis C, liver fibrosis by hepatitis C virus, cirrhosis by hepatitis C virus, and liver cancer by hepatitis C virus. Health functional food composition, characterized in that any one or more.
8. A method of treating liver disease by Hepatitis C virus (HCV), comprising administering rigosertib or a pharmaceutically acceptable salt thereof to a subject in need thereof.
9. Use for the treatment or prevention of liver disease by Hepatitis C virus (HCV) of rigosertib or a pharmaceutically acceptable salt thereof.
10. Antiviral use against Hepatitis C virus (HCV) of rigosertib or a pharmaceutically acceptable salt thereof.

Images