WO2018160993A1 - Compositions and methods for immunotherapy - Google Patents

Compositions and methods for immunotherapy Download PDF

Info

Publication number
WO2018160993A1
WO2018160993A1 PCT/US2018/020704 US2018020704W WO2018160993A1 WO 2018160993 A1 WO2018160993 A1 WO 2018160993A1 US 2018020704 W US2018020704 W US 2018020704W WO 2018160993 A1 WO2018160993 A1 WO 2018160993A1
Authority
WO
WIPO (PCT)
Prior art keywords
car
seq
cell
cells
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/020704
Other languages
English (en)
French (fr)
Inventor
Vipin Suri
Kutlu Goksu ELPEK
Michelle Lynn OLS
Brian DOLINSKI
Nicole KOSMIDER
Scott Francis HELLER
Abhishek KULKARNI
Mara Christine INNISS
Dan Jun LI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Obsidian Therapeutics Inc
Original Assignee
Obsidian Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AU2018226857A priority Critical patent/AU2018226857B2/en
Priority to CN201880029032.0A priority patent/CN110913954A/zh
Priority to EP18761512.5A priority patent/EP3589373A4/en
Priority to JP2019568591A priority patent/JP7660343B2/ja
Priority to CA3055200A priority patent/CA3055200A1/en
Application filed by Obsidian Therapeutics Inc filed Critical Obsidian Therapeutics Inc
Publication of WO2018160993A1 publication Critical patent/WO2018160993A1/en
Priority to US16/558,224 priority patent/US11629340B2/en
Anticipated expiration legal-status Critical
Priority to US17/646,212 priority patent/US12104178B2/en
Priority to US18/787,024 priority patent/US20240401004A1/en
Priority to JP2024182138A priority patent/JP2025013868A/ja
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/39Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/31Chimeric antigen receptors [CAR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/4203Receptors for growth factors
    • A61K40/4205Her-2/neu/ErbB2, Her-3/ErbB3 or Her 4/ ErbB4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/421Immunoglobulin superfamily
    • A61K40/4211CD19 or B4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/4214Receptors for cytokines
    • A61K40/4215Receptors for tumor necrosis factors [TNF], e.g. lymphotoxin receptor [LTR], CD30
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4244Enzymes
    • A61K40/4252Phosphatases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4256Tumor associated carbohydrates
    • A61K40/4258Gangliosides, e.g. GM2, GD2 or GD3
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • C07K14/55IL-2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0012Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0026Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on CH-NH groups of donors (1.5)
    • C12N9/0028Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on CH-NH groups of donors (1.5) with NAD or NADP as acceptor (1.5.1)
    • C12N9/003Dihydrofolate reductase [DHFR] (1.5.1.3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0055Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/485Exopeptidases (3.4.11-3.4.19)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6472Cysteine endopeptidases (3.4.22)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88Lyases (4.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90Isomerases (5.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y105/00Oxidoreductases acting on the CH-NH group of donors (1.5)
    • C12Y105/01Oxidoreductases acting on the CH-NH group of donors (1.5) with NAD+ or NADP+ as acceptor (1.5.1)
    • C12Y105/01003Dihydrofolate reductase (1.5.1.3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/04Phosphoric diester hydrolases (3.1.4)
    • C12Y301/040533',5'-Cyclic-AMP phosphodiesterase (3.1.4.53)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/14Dipeptidyl-peptidases and tripeptidyl-peptidases (3.4.14)
    • C12Y304/14005Dipeptidyl-peptidase IV (3.4.14.5)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y402/00Carbon-oxygen lyases (4.2)
    • C12Y402/01Hydro-lyases (4.2.1)
    • C12Y402/01001Carbonate dehydratase (4.2.1.1), i.e. carbonic anhydrase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y502/00Cis-trans-isomerases (5.2)
    • C12Y502/01Cis-trans-Isomerases (5.2.1)
    • C12Y502/01008Peptidylprolyl isomerase (5.2.1.8), i.e. cyclophilin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55522Cytokines; Lymphokines; Interferons
    • A61K2039/55527Interleukins
    • A61K2039/55533IL-2
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/58Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation
    • A61K2039/585Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation wherein the target is cancer
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/80Vaccine for a specifically defined cancer
    • A61K2039/82Colon
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/27Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by targeting or presenting multiple antigens
    • A61K2239/29Multispecific CARs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/31Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the route of administration
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16211Lymphocryptovirus, e.g. human herpesvirus 4, Epstein-Barr Virus
    • C12N2710/16234Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to compositions and methods for immunotherapy.
  • compositions comprise destabilizing domains (DDs) which tune protein stability.
  • Cancer immunotherapy aims to eradicate cancer cells by rejuvenating the tumoricidal functions of tumor-reactive immune cells, predominantly T cells.
  • Strategies of cancer immunotherapy including the recent development of checkpoint blockade, adoptive cell transfer (ACT) and cancer vaccines which can increase the anti-tumor immune effector cells have produced remarkable results in several tumors.
  • ACT adoptive cell transfer
  • TME tumor microenvironment
  • immunotherapeutic agent expression is needed in case of adverse events.
  • adoptive cell therapies may have a very long and an indefinite half-life. Since toxicity can be progressive, a safety switch is desired to eliminate the infused cells.
  • Systems and methods that can tune the transgenic protein level and expression window with high flexibility can enhance therapeutic benefit, and reduce potential side effects.
  • the present invention provides biocircuit systems to control the expression of immunotherapeutic agents.
  • the biocircuit system comprises a stimulus and at least one effector module that responds to the stimulus.
  • the effector module may include a stimulus response element (SRE) that binds and is responsive to a stimulus and an immunotherapeutic agent operably linked to the SRE.
  • SRE stimulus response element
  • a SRE is a destabilizing domain (DD) which is destabilized in the absence of its specific ligand and can be stabilized by binding to its specific ligand.
  • the present invention provides compositions and methods for immunotherapy.
  • the compositions relate to tunable systems and agents that induce anti-cancer immune responses in a cell or in a subject.
  • the tunable system and agent may be a biocircuit system comprising at least one effector module that is responsive to at least one stimulus.
  • the biocircuit system may be, but is not limited to, a destabilizing domain (DD) biocircuit system, a dimerization biocircuit system, a receptor biocircuit system, and a cell biocircuit system.
  • DD destabilizing domain
  • the composition for inducing an immune response may comprise a first effector module.
  • the effector module may comprise a first stimulus response element (SRE) operably linked to at least one payload.
  • the payload may be an immunotherapeutic agent.
  • the immunotherapeutic agent may be selected from, but is not limited to a cytokine, a safety switch, a regulatory switch, a chimeric antigen receptor and combinations thereof.
  • the first SRE of the composition may be responsive to or interact with at least one stimulus.
  • the first SRE may comprise a destabilizing domain (DD).
  • the DD may be derived from a parent protein or from a mutant protein having one, two, there, or more amino acid mutations compared to the parent protein.
  • the parent protein may be selected from, but is not limited to, human protein FKBP, comprising the amino acid sequence of SEQ. ID NO. 3; human DHFR (hDHFR), comprising the amino acid sequence of SEQ. ID NO. 2; E. Coli DHFR, comprising the amino acid sequence of SEQ. ID NO. 1;
  • PDE5 comprising the amino acid sequence of SEQ. ID NO. 4
  • PPAR gamma comprising the amino acid sequence of SEQ. ID NO. 5
  • CA2 comprising the amino acid sequence of SEQ. ID NO. 6
  • orNQ02 comprising the amino acid sequence of SEQ. ID NO. 7.
  • the parent protein is hDHFR and the DD comprises a mutant protein having at least one mutation selected from Mldel,V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T, G54R, K56E, K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F, L68S, K69E, 69
  • the stimulus of the SRE may be Trimethoprim or Methotrexate.
  • the immunotheiapeutic agent may be a cytokine.
  • the cytokine may be an interleukin, an interferon, a tumor necrosis factor, a transforming growth factor B, a CC chemokine, a CXC chemokine, a CX3C chemokine or a growth factor.
  • the cytokine is an interleukin.
  • the interleukin is selected from a group consisting of IL1, IL1 -alpha, ILl-beta, IL1 -delta, ILl-epsilon, ILl-eta, ILl-zeta, IL-RA, IL2, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL10, IL10C, IL10D, IL1 la, IL1 lb, IL13, IL14, IL16, IL17, IL-17A, IL17B, IL17C, IL17E, IL17F, IL18, IL19, IL20, IL20L, IL21, IL22, IL23, 1L23A, IL24, IL25, IL26, 1L27, 1L28, 1L29, 1L30, IL31, 1L32, IL33, IL34, IL36a, IL1, IL1,
  • the interleukin may be IL2, comprising the amino acid sequence of SEQ ID NO . 51.
  • the immune-therapeutic agent may be a safety switch.
  • the safety switch may be selected from a Caspase 9, an inducible FAS (iFAS), an inducible caspase 9 (icasp9), a CD20/anti-CD20 antibody pair, a protein tag/anti-tag antibody, and a compact suicide gene (RQR8).
  • the safety switch may be Caspase 9 comprising the amino acid sequence of SEQ ID NO. 65.
  • the immunotherapeutic agent may encode a regulatory switch.
  • the regulatory switch may be selected from a FOXP3, a Nr4a, a FOXO, and a NF- B.
  • the regulatory switch may be a FOXP3, comprising the amino acid sequence of SEQ ID NO. 103-106.
  • the immunotherapeutic agent may be a chimeric antigen receptor (CAR).
  • the CAR may be selected from a GD2 CAR, a Her2 CAR, a BCMA CAR, a CD33 CAR, an ALK CAR, a CD22 CAR, and a CD276 CAR.
  • the CARs described herein may comprise an extracellular moiety, a transmembrane domain, an intracellular signaling domain, and optionally, one or more co-stimulatory domains.
  • the CAR may be selected from, but is not limited, to a standard CAR, a split CAR, an off-switch CAR, an on-switch CAR, a first-generation CAR, a second-generation CAR, a third-generation CAR, or a fourth-generation CAR
  • the extracellular target moiety of the CAR may be selected from, but is not limited to an Ig NAR, a Fab fragment, a Fab' fragment, a F(ab)'2 fragment, a F(ab)'3 fragment, an Fv, a single chain variable fragment (scFv), abis-scFv, a (scFv)2, a minibody, a diabody, a triabody, a tetrabody, an intrabody, a disulfide stabilized Fv protein (dsFv), a unibody, a nanobody, and an antigen binding region derived from an antibody that may specifically bind to any of a protein of interest, a ligand, a receptor, a receptor fragment or a peptide aptamer.
  • an antigen binding region derived from an antibody that may specifically bind to any of a protein of interest, a ligand, a receptor, a receptor fragment or a peptide aptamer.
  • the extracellular target moiety may be selected from an ALK target moiety, comprising the amino acid sequence of SEQ ID NO. 242- 257 and 422-429, a CD22 target moiety, comprising the amino acid sequence of SEQ ID NO.258-262 and 430-432, a CD276 target moiety, comprising the amino acid sequence of SEQ YD NO. 263-270 and 433- 436, a GD2 target moiety, comprising the amino acid sequence of SEQ ID NO.271-349 and 437- 465, a CD33 target moiety, comprising the amino acid sequence of SEQ ID NO. 350-357, a BCMA target moiety, comprising the amino acid sequence of SEQ ID NO. 358-365, and a Her2 target moiety, comprising the amino acid sequence of SEQ ID NO. 366-421 and 466-473.
  • ALK target moiety comprising the amino acid sequence of SEQ ID NO. 242- 257 and 422-429
  • a CD22 target moiety comprising the amino acid sequence of S
  • the intracellular signaling domain of the CAR may be derived from T cell receptor CD3zeta or a cell surface molecule selected from the group consisting of FcR gamma, FcRbeta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d.
  • the CAR may comprise a co-stimulatory domain.
  • the costimulatory domain may be selected from the group consisting of 2B4, HVEM, ICOS, LAG3, DAP10, DAP 12, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), glucocorticoid-induced tumor necrosis factor receptor (GITR), lymphocyte function-associated antigen- 1 (LFA-1), CD2, CD7, LIGHT, NKG2C, and B7-H3.
  • GITR glucocorticoid-induced tumor necrosis factor receptor
  • LFA-1 lymphocyte function-associated antigen- 1
  • the transmembrane domain of the CAR may be derived from a transmembrane domain.
  • the transmembrane domain may comprise the amino acid sequence selected from, but not limited to SEQ ID NO. 527-624.
  • the CAR of the effector module may further comprise a hinge region near the transmembrane domain.
  • the hinge region may comprise an amino acid sequence selected from the group consisting of any of SEQ ID NOs. 628-694.
  • the first effector module may comprise an IL2-DD, comprising the amino acid sequence of any of SEQ ID NOs. 52-54.
  • the first effector module may comprise a Caspase 9-DD, comprising the amino acid sequence of any of SEQ ID NOs. 72-80.
  • the first effector module may comprise a FOXP3-DD, comprising the amino acid sequence of any of SEQ ID NOs. 107-116.
  • the first effector module may comprise a BCMA CAR-DD, comprising the amino acid sequence of any of SEQ ID NOs. 775-777. [0032] In one aspect, the first effector module may comprise a HER2-DD, comprising the amino acid sequence of any of SEQ ID NO. 906.
  • the present invention also provides polynucleotides encoding the compositions of the invention.
  • the polynucleotides may be a DNA or RNA molecule. In one aspect, the polynucleotides may comprise spatiotemporally selected codons. In some embodiments, the polynucleotides may be an RNA molecule. In one aspect, the RNA molecule may be a messenger molecule. In some embodiments, the RNA molecule may be chemically modified. In some embodiments, the polynucleotides may comprise spatiotemporally selected codons.
  • the polynucleotides may further comprise, at least one additional feature selected from, but not limited to, a promoter, a linker, a signal peptide, a tag, a cleavage site and a targeting peptide.
  • the present invention also provides vectors comprising polynucleotides described herein.
  • the vector may be a viral vector.
  • the viral vector may be a retroviral vector, a lentiviral vector, a gamma retroviral vector, a recombinant AAV vector, an adeno viral vector, and an oncolytic viral vector.
  • the present invention also provides immune cells for adoptive cell transfer (ACT) which may express the compositions of the invention, the polynucleotides described herein.
  • the immune cells may be infected or transfected with the vectors described herein.
  • the immune cells for ACT may be selected from, but not limited to a CD8+ T cell, a CD4+ T cell, a helper T cell, a natural killer (NK) cell, a NKT cell, a cytotoxic T lymphocyte (CTL), a tumor infiltrating lymphocyte (TIL), a memory T cell, a regulatory T (Treg) cell, a cytokine- induced killer (CIK) cell, a dendritic cell, a human embryonic stem cell, a mesenchymal stem cell, a hematopoietic stem cell, or a mixture thereof.
  • the immune cell may comprise a destabilizing domain DD, wherein the DD is derived from human protein FKBP comprising the amino acid sequence of SEQ ID NO. 3, DHFR comprising the amino acid sequence of SEQ ID NO. 1-2, PDE5 comprising the amino acid sequence of SEQ ID NO. 4, PPAR gamma comprising the amino acid sequence of SEQ ID NO. 5, CA2 comprising the amino acid sequence of SEQ ID NO. 6 and NQ02 comprising the amino acid sequence of SEQ ID NO. 7.
  • DD is derived from human protein FKBP comprising the amino acid sequence of SEQ ID NO. 3, DHFR comprising the amino acid sequence of SEQ ID NO. 1-2, PDE5 comprising the amino acid sequence of SEQ ID NO. 4, PPAR gamma comprising the amino acid sequence of SEQ ID NO. 5, CA2 comprising the amino acid sequence of SEQ ID NO. 6 and NQ02 comprising the amino acid sequence of SEQ ID NO. 7.
  • the DD may be derived from a parent protein and the parent protein is hDHFR and the DD comprises a mutant protein having at least one mutation selected from Mldel, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, NHS, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T, G54R, K56E, K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F
  • the immune cells may be autologous, allogeneic, syngeneic, or xenogeneic in relation to a particular individual subject.
  • the present invention provides methods for reducing a tumor volume or burden in a subject comprising contacting the subject with the immune cells of the invention. Also provided herein, is a method for inducing an anti-tumor immune response in a subject, comprising administering the immune cells of the system to the subject.
  • compositions of the invention are provided herein, administering the compositions of the invention, the polynucleotides of the invention, and/or the immune cells of the invention to the subject.
  • the present invention also provides methods for preventing or reversing T cell exhaustion in a subject in need thereof.
  • Such methods may comprise administering to the subject, a therapeutically effective amount of compositions described herein, the polynucleotides of the invention, the vectors of the invention, or the immune cells described herein.
  • Such methods may comprise an SRE that responds to a stimulus and tunes the expression and/or function of the immunotherapeutic agent, thereby preventing or reversing T cell exhaustion.
  • the immunotherapeutic agent is a chimeric antigen receptor.
  • the chimeric antigen receptor may be a GD2 CAR, a BCMA CAR, a CD33 CAR, a Her2 CAR, an AL CAR, a CD22 CAR, or a CD276 CAR.
  • a method for detecting cancer in a mammal comprising the steps of (a) contacting a sample comprising one or more cells from the mammal with the compositions, the polynucleotides, the vector or the immune cells of the invention, and (b) detecting the complex, wherein the detection of the complex may be indicative of the presence of cancer in the mammal.
  • the effector module comprises a stimulus response element (SRE) and at least one payload comprising a protein of interest (POI).
  • SRE stimulus response element
  • POI protein of interest
  • the SRE may be a destabilizing domain (DD).
  • the DD is a mutant domain derived from a protein such as FKBP (FK506 binding protein), E. coli DHFR (Dihydrofolate reductase) (ecDHFR), human DHFR (hDHFR), or any protein of interest.
  • FKBP FK506 binding protein
  • E. coli DHFR Dihydrofolate reductase
  • hDHFR human DHFR
  • the biocircuit system is a DD biocircuit system.
  • the payload may be any immunotherapeutic agent used for cancer immunotherapy such as a cytokine such as IL2, a safety switch such as Caspase 9, a regulatory switch encoding FOXP3, a chimeric antigen receptor such as BCMA CAR, CD33 CAR, GD2 CAR, Her2 CAR, ALK CAR, CD22 CAR, CD276 CAR or any agent that can induce an immune response.
  • a cytokine such as IL2
  • a safety switch such as Caspase 9
  • a chimeric antigen receptor such as BCMA CAR, CD33 CAR, GD2 CAR, Her2 CAR, ALK CAR, CD22 CAR, CD276 CAR or any agent that can induce an immune response.
  • the SRE and payload may be operably linked through one or more linkers and the positions of components may vary within the effector module.
  • the effector module may further comprise of one or more additional features such as linker sequences (with specific sequences and lengths), cleavage sites, regulatory elements (that regulate expression of the protein of interest such as microRNA targeting sites), signal sequences that lead the effector module to a specific cellular or subcellular location, penetrating sequences, or tags and biomarkers for tracking the effector module.
  • linker sequences with specific sequences and lengths
  • regulatory elements that regulate expression of the protein of interest such as microRNA targeting sites
  • signal sequences that lead the effector module to a specific cellular or subcellular location
  • penetrating sequences or tags and biomarkers for tracking the effector module.
  • the invention provides isolated biocircuit polypeptides, effector modules, stimulus response elements (SREs) and payloads, as well as polynucleotides encoding any of the foregoing; vectors comprising polynucleotides of the invention; and cells expressing
  • polypeptides polypeptides, polynucleotides and vectors of the invention.
  • the polypeptides, polynucleotides, viral vectors and cells are useful for inducing anti-tumor immune responses in a subject.
  • the vector of the invention is a viral vector.
  • the viral vector may include, but is not limited to a retroviral vector, an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector.
  • the vector of the invention may be a non-viral vector, such as a nanoparticles and liposomes.
  • the present invention also provides immune cells engineered to include one or more polypeptides, polynucleotides, or vectors of the present invention.
  • the cells may be immune effector cells, including T cells such as cytotoxic T cells, helper T cells, memory T cells, regulatory T cells, natural killer (NK) cells, NK T cells, cytokine-induced killer (CDC) cells, cytotoxic T lymphocytes (CTLs), and tumor infiltrating lymphocytes (TILs).
  • T cells such as cytotoxic T cells, helper T cells, memory T cells, regulatory T cells, natural killer (NK) cells, NK T cells, cytokine-induced killer (CDC) cells, cytotoxic T lymphocytes (CTLs), and tumor infiltrating lymphocytes (TILs).
  • T cells such as cytotoxic T cells, helper T cells, memory T cells, regulatory T cells, natural killer (NK) cells, NK T cells, cytokine-induced killer (CDC) cells, cytotoxic T lymphocytes (CTL
  • the present invention also provides methods for inducing immune responses in a subject using the compositions of the invention. Also provided are methods for reducing a tumor burden in a subject using the compositions of the invention and methods for preventing or reversing T cell exhaustion.
  • FIG. 1 shows an overview diagram of a biocircuit system of the invention.
  • the biocircuit comprises a stimulus and at least one effector module responsive to a stimulus, where the response to the stimulus produces a signal or outcome.
  • the effector module comprises at least one stimulus response element (SRE) and one payload.
  • SRE stimulus response element
  • Figure 2 shows representative effector modules carrying one payload.
  • the signal sequence (SS), SRE and payload may be located or positioned in various arrangements without (A to F) or with (G to Z, and AA to DD) a cleavage site.
  • An optional linker may be inserted between each component of the effector module.
  • Figure 3 shows representative effector modules carrying two payloads without a cleavage site.
  • the two payloads may be either directly linked to each other or separated.
  • Figure 4 shows representative effector modules carrying two payloads with a cleavage site.
  • an SS is positioned at the N-terminus of the construct, while other components: SRE, two payloads and the cleavage site may be located at different positions (A to L).
  • the cleavage site is positioned at the N-terminus of the construct (M to X).
  • An optional linker may be inserted between each component of the effector module.
  • Figure S shows effector modules of the invention carrying two payloads, where an SRE is positioned at the N-terminus of the construct (A to L), while SS, two payloads and the cleavage site can be in any configuration.
  • An optional linker may be inserted between each component of the effector module.
  • Figure 6 shows effector modules of the invention carrying two payloads, where either the two payloads (A to F) or one of the two payloads (G to X) is positioned at the N-terminus of the construct (A to L), while SS, SRE and the cleavage site can be in any configuration.
  • An optional linker may be inserted between each component of the effector module.
  • Figure 7 depicts representative configurations of the stimulus and effector module within a biocircuit system.
  • a trans-membrane effector module is activated either by a free stimulus (Figure 7A) or a membrane bound stimulus ( Figure 7B) which binds to SRE.
  • the response to the stimulus causes the cleavage of the intracellular signal/payload, which activates down-stream effector/payload.
  • Figure 8 depicts a dual stimulus-dual presenter biocircuit system, where two bound stimuli (A and B) from two different presenters (e.g., different cells) bind to two different effector modules in a single receiver (e.g., another single cell) simultaneously and create a dual- signal to downstream payloads.
  • a and B bound stimuli from two different presenters
  • a single receiver e.g., another single cell
  • Figure 9 depicts a dual stimulus-single presenter biocircuit system, where two bound stimuli (A and B) from the same presenter (e.g., a single cell) bind to two different effector modules in another single cell simultaneously and create a dual-signal.
  • a and B bound stimuli from the same presenter
  • Figure 10 depicts a single-stimulus-bridged receiver biocircuit system.
  • a bound stimulus (A) binds to an effector module in the bridge cell and creates a signal to activate a payload which is a stimulus (B) for another effector module in the final receiver (e.g., another cell).
  • Figure 11 depicts a single stimulus-single receiver biocircuit system, wherein the single receiver contains the two effector modules which are sequentially activated by a single stimulus.
  • Figure 12 depicts a biocircuit system which requires a dual activation.
  • one stimulus must bind the transmembrane effector module first to prime the receiver cell being activated by the other stimulus.
  • the receiver only activates when it senses both stimuli (B).
  • Figure 13 is a line graph depicting the effect of Shield-1 on DD-IL2 levels.
  • Figure 14 denotes the frequency of IFNgamma positive T cells.
  • Figure 15A depicts IFN gamma production in T cells.
  • Figure 15B depicts T cell expansion with IL15/IL15Ra treatment.
  • Figure 15C is a dot plot depicting percentage human cells after in vivo cell transfer.
  • Figure 15D is scatter plot depicting CD4+/CD8+ T cells.
  • Figure 16A is a western blot depicting luciferase levels in DD-luciferase expressing cells.
  • Figure 16B depicts luciferase activity.
  • Figure 17A and Figure 17B are western blot depicting DD regulated expression of FOXP3.
  • Figure 18 is a bar graph representing the effect of promoters on transgene expression.
  • Figure 19 represents Shield-1 regulation of DD-IL2 secretion from HCT116 cells in vivo.
  • Figure 20 depicts the viability of T cells cultured with different ratios of CD3/CD8 beads.
  • Figure 21 represents the percentage BCMA CAR positive T cells with ligand treatment. DETAILED DESCMPTION OF THE INVENTION
  • Cancer immunotherapy aims' at the induction or restoration of the reactivity of the immune system towards cancer.
  • Significant advances in immunotherapy research have led to the development of various strategies which may broadly be classified into active immunotherapy and passive immunotherapy. In general, these strategies may be utilized to directly kill cancer cells or to counter the immunosuppressive tumor microenvironment.
  • Active immunotherapy aims at induction of an endogenous, long-lasting tumor-antigen specific immune response. The response can further be enhanced by non-specific stimulation of immune response modifiers such as cytokines.
  • passive immunotherapy includes approaches where immune effector molecules such as tumor-antigen specific cytotoxic T cells or antibodies are administered to the host. This approach is short lived and requires multiple applications.
  • a major risk involved in immunotherapy is the on-target but off tumor side effects resulting from T-cell activation in response to normal tissue expression of the tumor associated antigen (TAA).
  • TAA tumor associated antigen
  • Immunotherapy may also produce on target, on-tumor toxicities that emerge when tumor cells are killed in response to the immunotherapy.
  • the adverse effects include tumor lysis syndrome, cytokine release syndrome and the related macrophage activation syndrome. Importantly, these adverse effects may occur during the destruction of tumors, and thus even a successful on-tumor immunotherapy might result in toxicity.
  • Approaches to regulatably control immunotherapy are thus highly desirable since they have the potential to reduce toxicity and maximize efficacy.
  • the present invention provides systems, compositions, immune-therapeutic agents and methods for cancer immunotherapy. These compositions provide tunable regulation of gene expression and function in immunotherapy.
  • the present invention also provides biocircuit systems, effector modules, stimulus response elements (SREs) and payloads, as well as polynucleotides encoding any of the foregoing.
  • the systems, compositions, immune-therapeutic agents and other components of the invention can be controlled by a separately added stimulus, which provides a significant flexibility to regulate cancer immunotherapy.
  • the systems, compositions and the methods of the present invention may also be combined with therapeutic agents such as chemotherapeutic agents, small molecules, gene therapy, and antibodies.
  • compositions of the invention has the potential to improve the potency and duration of the efficacy of immunotherapies.
  • Reversibly silencing the biological activity of adoptively transferred cells using compositions of the present invention allows maximizing the potential of cell therapy without irretrievably killing and terminating the therapy.
  • the present invention provides methods for fine tuning of immunotherapy after administration to patients. This in turn improves the safety and efficacy of immunotherapy and increases the subject population that may benefit from immunotherapy.
  • biocircuit systems which comprise, at their core, at least one effector module system.
  • Such effector module systems comprise at least one effector module having associated, or integral therewith, one or more stimulus response elements (SREs).
  • SREs stimulus response elements
  • the overall architecture of a biocircuit system of the invention is illustrated in Figure 1.
  • a stimulus response element may be operably linked to a payload construct which could be any protein of interest (POI) (e.g., an immune-therapeutic agent), to form an effector module.
  • POI protein of interest
  • the SRE when activated by a particular stimulus, e.g., a small molecule, can produce a signal or outcome, to regulate transcription and/or protein levels of the linked payload either up or down by perpetuating a stabilizing signal or destabilizing signal, or any other types of regulation.
  • a biocircuit system are taught in co-owned U.S. Provisional Patent Application No. 62/320,864 filed April 11, 2016, 62/466,596 filed March 3, 2017 and the International Publication WO2017/180587 (the contents each of which are herein incorporated by reference in their entirety).
  • biocircuit systems, effector modules, SREs and components that tune expression levels and activities of any agents used for immunotherapy are provided.
  • Biologic systems are generally understood to be any cell, tissue, organ, organ system or organism, whether animal, plant, fungi, bacterial, or viral.
  • biocircuits may be artificial circuits which employ the stimuli or effector modules taught by the present invention and effect signals or outcomes in acellular environments such as with diagnostic, reporter systems, devices, assays or kits.
  • the artificial circuits may be associated with one or more electronic, magnetic, or radioactive components or parts.
  • a biocircuit system may be a destabilizing domain (DD) biocircuit system, a dimerization biocircuit system, a receptor biocircuit system, and a cell biocircuit system. Any of these systems may act as a signal to any other of these biocircuit systems.
  • DD destabilizing domain
  • an immune-therapeutic agent may be an antibody and fragments and variants thereof, a cancer specific T cell receptor (TCR) and variants thereof, an anti-tumor specific chimeric antigen receptor (CAR), a chimeric switch receptor, an inhibitor of a co-inhibitory receptor or ligand, an agonist of a co-stimulatory receptor and ligand, a cytokine, chemokine, a cytokine receptor, a chemokine receptor, a soluble growth factor, a metabolic factor, a suicide gene, a homing receptor, or any agent that induces an immune response in a cell and a subject.
  • TCR cancer specific T cell receptor
  • CAR anti-tumor specific chimeric antigen receptor
  • a chimeric switch receptor an inhibitor of a co-inhibitory receptor or ligand, an agonist of a co-stimulatory receptor and ligand, a cytokine, chemokine, a cytokine receptor, a chemok
  • the biocircuits of the invention include at least one effector module as a component of an effector module system.
  • an effector module is a single or multi-component construct or complex comprising at least (a) one or more stimulus response elements (i.e. proteins of interest (POIs).
  • POIs proteins of interest
  • SRE stimulation response element
  • SRE is a component of an effector module which is joined, attached, linked to or associated with one or more payloads of the effector module and in some instances, is responsible for the responsive nature of the effector module to one or more stimuli.
  • the "responsive" nature of an SRE to a stimulus may be characterized by a covalent or non-covalent interaction, a direct or indirect association or a structural or chemical reaction to the stimulus.
  • the response of any SRE to a stimulus may be a matter of degree or kind.
  • the response may be a partial response.
  • the response may be a reversible response.
  • the response may ultimately lead to a regulated signal or output.
  • Such output signal may be of a relative nature to the stimulus, e.g., producing a modulatory effect of between 1% and 100% or a factored increase or decrease such as 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or more.
  • the present invention provides methods for modulating protein expression, function or level.
  • the modulation of protein expression, function or level refers to modulation of expression, function or level by at least about 20%, such as by at least about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% and 100%, or at least 20-30%, 20- 40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30- 60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40- 90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60- 80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80- 100%, 90
  • the present invention provides methods for modulating protein, expression, function or level by measuring the stabilization ratio and destabilization ratio.
  • the stabilization ratio may be defined as the ratio of expression, function or level of a protein of interest in response to the stimulus to the expression, function or level of the protein of interest in the absence of the stimulus specific to the SRE.
  • the stabilization ratio is at least 1, such as by at least 1-10, 1-20, 1 -30, 1-40, 1-50, 1- 60, 1-70, 1-80, 1- 90, 1-100, 20-30, 20-40, 20-50, 20-60, 20-70, 20-80, 20-90, 20-95, 20-100, 30-40, 30-50, 30-60, 30-70, 30- 80, 30-90, 30-95, 30-100, 40-50, 40-60, 40-70, 40-80, 40-90, 40-95, 40-100, 50-60, 50-70, 50- 80, 50-90, 50-95, 50-100, 60-70, 60-80, 60-90, 60-95, 60-100, 70-80, 70-90, 70-95, 70-100, 80- 90, 80-95, 80-100, 90-95, 90-100 or 95-100.
  • the destabilization ratio may be defined as the ratio of expression, function or level of a protein of interest in the absence of the stimulus specific to the effector module to the expression, function or level of the protein of interest, that is expressed constitutively and in the absence of the stimulus specific to the SRE.
  • constitutively refers to the expression, function or level of a protein of interest that is not linked to an SRE, and is therefore expressed both in the presence and absence of the stimulus.
  • the destabilization ratio is at least 0, such as by at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or at least, 0-0.1, 0-0.2, 0 -0.3, 0-0.4, 0-0.5, 0-0.6, 0-0.7, 0-0.8, 0-0.9, 0.1-0.2, 0.1 -0.3, 0.1-0.4, 0.1-0.5, 0.1-0.6, 0.1-0.7, 0.1-0.8, 0.1-0.9, 0.2 -0.3, 0.2-0.4, 0.2-0.5, 0.2- 0.6, 0.2-0.7, 0.2-0.8, 0.2-0.9, 0.3-0.4, 0.3-0.5, 0.3-0.6, 0.3-0.7, 0.3-0.8, 0.3-0.9, 0.4-0.5, 0.4-0.6, 0.4-0.7, 0.4-0.8, 0.4-0.9, 0.5-0.6, 0.5-0.7, 0.5-0.8, 0.5-0.9, 0.6-0.7, 0.6-0.8, 0.6-0.9, or at least
  • the SRE of the effector module may be selected from, but is not limited to, a peptide, peptide complex, peptide-protein complex, protein, fusion protein, protein complex, protein- protein complex.
  • the SRE may comprise one or more regions derived from any natural or mutated protein, or antibody.
  • the SRE is an element, when responding to a stimulus, can tune intracellular localization, intramolecular activation, and/or degradation of payloads.
  • effector modules of the present invention may comprise additional features that facilitate the expression and regulation of the effector module, such as one or more signal sequences (SSs), one or more cleavage and/or processing sites, one or more targeting and/or penetrating peptides, one or more tags, and/or one or more linkers. Additionally, effector modules of the present invention may further comprise other regulatory moieties such as inducible promoters, enhancer sequences, microRNA sites, and/or microRNA targeting sites. Each aspect or tuned modality may bring to the effector module or biocircuit a differentially tuned feature.
  • SSs signal sequences
  • cleavage and/or processing sites one or more targeting and/or penetrating peptides
  • tags one or more tags
  • linkers such as inducible promoters, enhancer sequences, microRNA sites, and/or microRNA targeting sites.
  • Each aspect or tuned modality may bring to the effector module or biocircuit a differentially tuned feature.
  • an SRE may represent a destabilizing domain
  • mutations in the protein payload may alter its cleavage sites or dimerization properties or half-life and the inclusion of one or more microRNA or microRNA binding site may impart cellular detargeting or trafficking features.
  • the present invention embraces biocircuits which are multifactorial in their tenability .
  • Such biocircuits may be engineered to contain one, two, three, four or more tuned features.
  • effector modules of the present invention may include one or more degrons to tune expression.
  • a "degron" refers to a minimal sequence within a protein that is sufficient for the recognition and the degradation by the proteolytic system.
  • An important property of degrons is that they are transferrable, that is, appending a degron to a sequence confers degradation upon the sequence.
  • the degron may be appended to the destabilizing domains, the payload or both. Incorporation of the degron within the effector module of the invention, confers additional protein instability to the effector module and may be used to minimize basal expression.
  • the degron may be an N- degron, a phospho degron, a heat inducible degron, a photosensitive degron, an oxygen dependent degron.
  • the degron may be an Ornithine decarboxylase degron as described by Takeuchi et al. (Takeuchi J et al. (2008). Biochem J. 2008 Mar l;410(2):401-7; the contents of which are incorporated by reference in their entirety).
  • Other examples of degrons useful in the present invention include degrons described in International patent publication Nos. WO2017004022, WO2016210343, and WO2011062962; the contents of each of which are incorporated by reference in their entirety'.
  • each component of the effector module may be located or positioned in various arrangements without (A to F) or with (G to Z, and AA to DD) a cleavage site.
  • An optional linker may be inserted between each component of the effector module.
  • Figures 3 to 6 illustrate representative effector module embodiments comprising two payloads, i.e. two immunotherapeutic agents. In some aspects, more than two
  • immunotherapeutic agents may be included in the effector module under the regulation of the same SRE (e.g., the same DD).
  • the two or more agents may be either directly linked to each other or separated ( Figure 3).
  • the SRE may be positioned at the N-terminus of the construct, or the C-terminus of the construct, or in the internal location.
  • the two or more immunotherapeutic agents may be the same type such as two antibodies, or different types such as a CAR construct and a cytokine IL12. Biocircuits and components utilizing such effector molecules are given in Figures 7-12.
  • biocircuits of the invention may be modified to reduce their immunogenicity.
  • Immunogenicity is the result of a complex series of responses to a substance that is perceived as foreign and may include the production of neutralizing and non-neutralizing antibodies, formation of immune complexes, complement activation, mast cell activation, inflammation, hypersensitivity responses, and anaphylaxis.
  • factors can contribute to protein immunogenicity, including, but not limited to protein sequence, route and frequency of administration and patient population.
  • compositions of the invention may be engineered to reduce the immunogenicity of the compositions of the invention.
  • modifications to reduce immunogenicity may include modifications that reduce binding of the processed peptides derived from the parent sequence to major histocompatibility complex (MHC) proteins.
  • MHC major histocompatibility complex
  • amino acid modifications may be engineered such that the minimum number of immune epitopes are available to bind with high affinity to any prevalent MHC alleles.
  • Epitope identification and subsequent sequence modification may be applied to reduce immunogenicity.
  • the identification of immunogenic epitopes may be achieved using physical or computational methods. Physical methods of epitope identification may include, for example, mass spectrometry and tissue culture/cellular techniques. Computational approaches use antigen processing, loading and display information, structural and/or p oteomic data to identify non- self-peptides produced by antigen processing with good MHC groove binding characteristics. One or more mutations may be introduced into the biocircuits of the invention directing the expression of the protein, to maintain its functionality while simultaneously rendering the identified epitope less ornon-immunogenic.
  • Protein modifications may also be employed to interfere with antigen processing and peptide loading e.g. glycosylation and PEGylation.
  • Compositions of the invention may also be engineered to include non-classical amino acid side chains to design less immunogenic compositions. Any of the methods discussed in International Patent Publication No.
  • WO2005051975 for reducing immunogenicity may be useful in the present invention (the contents of which are incorporated by reference in their entirety).
  • patients may also be stratified according to the immunogenic peptides presented by their immune cells and may be utilized as a parameter to determine suitable patient cohorts that may therapeutically benefit for the compositions of the invention.
  • reduced immunogenicity may be achieved by limiting immunoproteasome processing.
  • the proteasome is an important cellular protease that is found in two forms: the constitutive proteasome, which is expressed in all cell types and which contains active e.g. catalytic subunits and the immunoproteasome that is expressed in cell of the hematopoietic lineage, and which contains different active subunits termed low molecular weight proteins (LMP) namely LMP-2, LMP- 7 and LMP-10.
  • LMP low molecular weight proteins
  • a well described function of the immunoproteasome is to generate peptides with hydrophobic C terminus that can be processed to fit in the groove of MHC class I molecules.
  • Deol P et al. have shown that immunoproteasomes may lead to a frequent cleavage of specific peptide bonds and thereby to a faster appearance of a certain peptide on the surface of the antigen presenting cells; and enhanced peptide quantities (Deol P et al. (2007) J Immunol 178 (12) 7557-7562; the contents of which are incorporated herein reference in its entirety). This study indicates that reduced immunoproteasome processing may be accompanied by reduced immunogenicity.
  • immunogenicity of the compositions of the invention may be reduced by modifying the sequence encoding the compositions of the invention to prevent immunoproteasome processing.
  • Biocircuits of the present invention may also be combined with immunoproteasome-selective inhibitors to achieve the same effects.
  • inhibitors useful in the present invention include UK-101 (Bli selective compound), IPSI-001, ONX 0914 (PR-957), and PR-924 (IPSI).
  • Another embodiment of the invention provides a method of detecting the presence of cancer in a mammal, comprising: (a) contacting a sample comprising one or more cells from the mammal with any of the CARs, nucleic acids, recombinant expression vectors, host cells, population of cells, or pharmaceutical compositions of the invention, thereby forming a complex, (b) and detecting the complex, wherein detection of the complex is indicative of the presence of cancer in the mammal.
  • the sample may be obtained by any suitable method, e.g., biopsy or necropsy.
  • a biopsy is the removal of tissue and or cells from an individual. Such removal may be to collect tissue and/or cells from the individual in order to perform experimentation on the removed tissue and/or cells. This experimentation may also be used to determine if the individual has and or is suffering from cancer.
  • the sample comprising cells of the mammal can be a sample comprising whole cells, lysates thereof, or a fraction of the whole cell lysates, e.g., a nuclear or cytoplasmic fraction, a whole protein traction, or a nucleic acid fraction.
  • the cells can be any cells of the mammal, e.g., the cells of any organ or tissue, including tumor cells.
  • the contacting can take place in vitro or in vivo with respect, to the mammal. Preferably, the contacting is in vitro. Also, detection of the complex can occur through any number of ways known in the art.
  • the inventive CARs, nucleic acids, recombinant expression vectors, host cells, populations of cells, or pharmaceutical compositions described herein can be labeled with a detectable label such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles).
  • FITC fluorescein isothiocyanate
  • PE phycoerythrin
  • an enzyme e.g., alkaline phosphatase, horseradish peroxidase
  • element particles e.g., gold particles
  • Immunol, 163: 507-51 3 (1999) teaches methods of measuring the release of cytokines (e.g., interferon ⁇ , granulocyte/monocyte colony stimulating factor (GM-CSF), tumor necrosis factor a (TNF-a) or interleukin 2 (IL2)).
  • cytokines e.g., interferon ⁇ , granulocyte/monocyte colony stimulating factor (GM-CSF), tumor necrosis factor a (TNF-a) or interleukin 2 (IL2)
  • cytokines e.g., interferon ⁇ , granulocyte/monocyte colony stimulating factor (GM-CSF), tumor necrosis factor a (TNF-a) or interleukin 2 (IL2)
  • cytokines e.g., interferon ⁇ , granulocyte/monocyte colony stimulating factor (GM-CSF), tumor necrosis factor a (TNF-a) or interleukin 2 (IL2)
  • the stimulus of the present invention maybe ultrasound stimulation.
  • the SREs of the present invention may derived from mechanosensitive proteins.
  • the SRE of the present invention may be the mechanically sensitive ion channel, Piezol.
  • the SREs of the present invention may be derived from calcium biosensors, and the stimulus of the present invention may calcium.
  • the calcium may be generated by the ultrasound induced mechanical stimulation of mechanosensitive ion channels.
  • the ultrasound activation of the ion channel causes a calcium influx thereby generating the stimulus.
  • the mechanosensitive ion channel is Piezo 1.
  • Mechanosensors may be advantageous to use since they provide spatial control to a specific location in the body. 1.
  • biocircuit systems, effector modules, and compositions of the present invention relate to post-translational regulation of protein (payload) function anti-tumor immune responses of immune-therapeutic agents.
  • the SRE is a
  • the presence, absence or an amount of a small molecule ligand that binds to or interacts with the DD, can, upon such binding or interaction modulate the stability of the payload(s) and consequently the function of the payload.
  • the altered function of the payload may vary, hence providing a Ci tuning'' of the payload function.
  • destabilizing domains described herein or known in the art may be used as SREs in the biocircuit systems of the present invention in association with any of the immunotherapeutic agents (payloads) taught herein.
  • Destabilizing domains are small protein domains that can be appended to a target protein of interest. DDs render the attached protein of interest unstable in the absence of a DD-binding ligand such that the protein is rapidly degraded by the ubiquitin-proteasome system of the cell (Stankunas, K., et al., Mol.
  • the desired characteristics of the DDs may include, but are not limited to, low protein levels in the absence of a ligand of the DD (i.e. low basal stability), large dynamic range, robust and predictable dose-response behavior, and rapid kinetics of degradation. DDs that bind to a desired ligand but not endogenous molecules may be preferred.
  • FDD fluorescent destabilizing domain
  • DDs also include those described in U.S. Pat. NO. 8,173,792 and U.S. Pat. NO. 8,530,636, the contents of which are each incorporated herein by reference in their entirety.
  • the DDs of the present invention may be derived from some known sequences that have been approved to be capable of post-translational regulation of proteins.
  • Xiong et al. have demonstrated that the non-catalytic N-terminal domain (54-residues) of ACS7 (1-aminocyclopropane-l-carboxylate synthase) in Arabidopsis, when fused to the ⁇ -glucuronidase (GUS) reporter, can significantly decrease the accumulation of the GUS fusion protein (Xiong et ai, J. Exp. Bot., 2014, 65(15): 4397-4408). Xiong et al.
  • both exogenous 1-aminocyclopropane-l-carboxylic acid (ACC) treatment and salt can rescue the levels of accumulation of the ACS N-terminal and GUS fusion protein.
  • the ACS N-terminus mediates the regulation of ACS7 stability through the ubiquitin-26S proteasome pathway.
  • SCR Stret Control region
  • a destabilizing mutation LI 10A, and a stabilizing mutation A109L dramatically affect Tropomyosin protein dynamics (Kirwan and Hodges, J. Biol. Chem., 2014, 289: 4356-4366).
  • Such sequences can be screened for ligands that bind them and regulate their stability.
  • the identified sequence and ligand pairs may be used as components of the present invention.
  • the DDs of the present invention may be developed from known proteins. Regions or portions or domains of wild type proteins may be utilized as SREs/DDs in whole or in part. They may be combined or rearranged to create new peptides, proteins, regions or domains of which any may be used as SREs/DDs or the starting point for the design of further SREs and/or DDs.
  • Ligands such as small molecules that are well known to bind candidate proteins can be tested for their regulation in protein responses.
  • the small molecules may be clinically approved to be safe and have appropriate pharmaceutical kinetics and distribution.
  • the stimulus is a ligand of a destabilizing domain (DD), for example, a small molecule that binds a destabilizing domain and stabilizes the POI fused to the destabilizing domain.
  • DDs destabilizing domain
  • SREs of the present invention include without limitation, any of those taught in Tables 2-4 of copending commonly owned U.S. Provisional Application NOs. 62/320,864, filed on 4/11/2016, or in US Provisional Application No.
  • DDs of the invention may be FKBP DD or ecDHFR DDs such as those listed in Table 2.
  • the position of the mutated amino acid listed in Table 2 is relative to the ecDHFR (Uniprot ID: P0ABQ4) of SEQ ID NO. 1 for ecDHFR DDs and relative to FKBP (Uniprot ID: P62942) of SEQ ID NO. 3 for FKBP DDs.
  • Inventors of the present invention have tested and identified several candidate human proteins that may be used to develop destabilizing domains. As show in Table 2, these candidates include human DHFR (hDHFR), PDE5 (phosphodiesterase 5), PPAR gamma (peroxisome proliferator-activated receptor gamma), CA2 (Carbonic anhydrase II) and NQ02 (NRH:
  • Candidate destabilizing domain sequence identified from protein domains of these proteins may be mutated to generate libraries of mutants based on the template candidate domain sequence.
  • Mutagenesis strategies used to generate DD libraries may include site-directed mutagenesis e.g. by using structure guided information; or random mutagenesis e.g. using error-prone PCR, or a combination of both.
  • destabilizing domains identified using random mutagenesis may be used to identify structural properties of the candidate DDs that may be required for destabilization, which may then be used to further generate libraries of mutations using site directed mutagenesis.
  • novel DDs derived from E.coli DHFR may comprise amino acids 2-159 of the wild type ecDHFR sequence. This may be referred to as an Mldel mutation.
  • novel DDs derived from ecDHFR may comprise amino acids 2- 159 of the wild type ecDHFR sequence (also referred to as an Mldel mutation), and may include one, two, three, four, five or more mutations including, but not limited to, Mldel, R12Y, R12H, Y100I, and E129K.
  • novel DDs derived from FKBP may comprise amino acids 2- 107 of the wild type FKBP sequence. This may be referred to as an Mldel mutation.
  • novel DDs derived from FKBP may comprise amino acids 2- 107 of the wild type FBKP sequence (also referred to as an Mldel mutation), and may include one, two, three, four, five or more mutations including, but not limited to, Mldel, E31G, F36V, R71G, K105E, and L106P.
  • DD mutant libraries may be screened for mutations with altered, preferably higher binding affinity to the ligand, as compared to the wild type protein.
  • DD libraries may also be screened using two or more ligands and DD mutations that are stabilized by some ligands but not others may be preferentially selected.
  • DD mutations that bind preferentially to the ligand compared to a naturally occurring protein may also be selected. Such methods may be used to optimize ligand selection and ligand binding affinity of the DD. Additionally, such approaches can be used to minimize deleterious effects caused by off-target ligand binding.
  • suitable DDs may be identified by screening mutant libraries using barcodes. Such methods may be used to detect, identify and quantify individual mutant clones within the heterogeneous mutant library.
  • Each DD mutant within the library may have distinct barcode sequences (with respect to each other).
  • the polynucleotides can also have different barcode sequences with respect to 2,3,4,5,6,7,8,9,10 or more nucleic acid bases.
  • Each DD mutant within the library may also comprise a plurality of barcode sequences. When used in plurality may be used such that each barcode is unique to any other barcode. Alternatively, each barcode used may not be unique, but the combination of barcodes used may create a unique sequence that can be individually tracked.
  • the barcode sequence may be placed upstream of the SRE, downstream of the SRE, or in some instances may be placed within the SRE.
  • DD mutants may be identified by barcodes using sequencing approaches such as Sanger sequencing, and next generation sequencing, but also by polymerase chain reaction and quantitative polymerase chain reaction.
  • polymerase chain reaction primers that amplify a different size product for each barcode may be used to identify each barcode on an agarose gel.
  • each barcode may have a unique quantitative polymerase chain reaction probe sequence that enables targeted amplification of each barcode.
  • DDs of the invention may be derived from human dihydrofolate reductase (hDHFR).
  • hDHFR is a small (18 kDa) enzyme that catalyzes the reduction of dihydrofolate and plays a vital role in variety of anabolic pathway.
  • Dihydrofolate reductase (DHFR) is an essential enzyme that converts 7,8-dihydrofblate (DHF) to 5,6,7,8, tetrahydrofolate (THF) in the presence of nicotinamide adenine dihydrogen phosphate (NADPH).
  • DHF 7,8-dihydrofblate
  • THF 5,6,7,8, tetrahydrofolate
  • NADPH nicotinamide adenine dihydrogen phosphate
  • Anti-folate drugs such as methotrexate (MTX), a structural analogue of folic acid, which bind to DHFR more strongly than the natural substrate DHF, interferes with folate metabolism, mainly by inhibition of dihydrofolate reductase, resulting in the suppression of purine and pyrimidine precursor synthesis.
  • Other inhibitors of hDHFR such as folate, TQD, Trimethoprim (TMP), epigallocatechin gallate (EGCG) and ECG (epicatechin gallate) can also bind to hDHFR mutants and regulates its stability.
  • the DHFR DDs of the invention may include mutations such as, but not limited to V2A, C7R, I8V, V9A, A10T, A10V, Q13R, NHS, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, 33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T, G54R, K56E, K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F, L68S, K69E, K69R, R71G, I72
  • the stimulus is a small molecule that binds to a SRE in order to post-translationally regulate protein levels.
  • DHFR ligands trimethoprim (TMP) and methotrexate (MTX) are used to stabilize hDHFR mutants.
  • TMP trimethoprim
  • MTX methotrexate
  • the hDHFR based destabilizing domains are listed in Table 3.
  • the position of the mutated amino acid listed in Table 3 is relative to the human DHFR (Uniprot ID: P00374) of SEQ ID NO. 2 for human DHFR.
  • the mutations are underlined and in bold.
  • "del" means that the mutation is the deletion of the amino acid at that position relative to the wild type sequence.
  • DD mutations that do not inhibit ligand binding may be preferentially selected.
  • ligand binding may be improved by mutation of residues in DHFR.
  • Amino acid positions selected for mutation include aspartic acid at position 22 of SEQ ID NO. 2, glutamic acid at position 31 of SEQ ID NO. 2; phenyl alanine at position 32 of SEQ ID NO. 2; arginine at position 33 of SEQ ID NO. 2; glutamine at position 36 of SEQ ID NO. 2; asparagine at position 65 of SEQ ID NO. 2; and valine at position 115 of SEQ ID NO. 2.
  • one or more of the following mutations may be utilized in the DDs of the present invention to improve TMP binding, including but not limited to, D22S, E3 ID, F32M, R33S, Q36S, N65S, and VI 161.
  • the position of the mutated amino acids is relative to the wildtype human DHFR (Uniprot ID: P00374) of SEQ ID NO. 2.
  • novel DDs derived from human DHFR may include one, two, three, four, five or more mutations including, but not limited to, Mldel, V2A, C7R, 18 V, V9A, A10T, A10V, Q13R, NHS, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T, G54R, K56E, K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F, L68S
  • novel DDs derived from human DHFR may comprise amino acids 2-187 of the wild type human DHFR sequence. This may be referred to as an Mldel mutation.
  • novel DDs derived from human DHFR may comprise amino acids 2-187 of the wild type human DHFR sequence (also referred to as an M ldel mutation), and may include one, two, three, four, five or more mutations including, but not limited to, Mldel, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, NHS, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37
  • Biocircuits of the invention are triggered by one or more stimuli.
  • Stimuli may be selected from a ligand, an externally added or endogenous metabolite, the presence or absence of a defined ligand, pH, temperature, light, ionic strength, radioactivity, cellular location, subject site, microenvironment, the presence or the concentration of one or more metal ions.
  • the stimulus is a ligand.
  • Ligands may be nucleic acid-based, protein-based, lipid based, organic, inorganic or any combination of the foregoing.
  • the ligand is selected from the group consisting of a protein, peptide, nucleic acid, lipid, lipid derivative, sterol, steroid, metabolite derivative and a small molecule.
  • the stimulus is a small molecule.
  • the small molecules are cell permeable.
  • Ligands useful in the present invention include without limitation, any of those taught in Table 2 of copending commonly owned US serial number 62/320,684, filed on 4/11/2017, or in US Provisional Application No. 62/466,596 filed March 3, 2017 and the International Publication WO2017/180587, the contents of each of which are incorporated herein by reference in their entirety.
  • the small molecules are FDA-approved, safe and orally administered.
  • the ligand binds to dihydrofolate reductase. In some embodiments, the ligand binds to and inhibits dihydrofolate reductase function and is herein referred to as a dihydrofolate inhibitor.
  • the ligand may be a selective inhibitor of human DHFR.
  • Ligands of the invention may also be selective inhibitors of dihydrofolate reductases of bacteria and parasitic organisms such as Pneumocystis spp., Toxoplasma spp., Trypanosoma spp., Mycobacterium spp., and Streptococcus spp.
  • Ligands specific to other DHFR may be modified to improve binding to human dihydrofolate reductase.
  • dihydrofolate inhibitors include, but are not limited to, Trimethoprim (TMP), Methotrexate (MTX), Pralatrexate, Piritrexim Pyrimethamine, Talotrexin,
  • DHFR inhibitors include BAL0030543, BAL0030544 and BAL0030545, developed by Basillea Pharmaceuticals; as well as WR 99210, and P218. Any of the inhibitors described by Zhang Q et al. (2015) Int J Antimicrob Agents. 2015 Aug; 46(2): 174-182 (the contents of which are incorporated herein by reference in their entirety). Some inhibitors contain bulky benzyl groups that dramatically diminish binding to human DHFR. In some embodiments, the inhibitors may be designed without bulky benzyl groups to improve TMP binding.
  • ligands of the present invention may be polyglutamate or non polyglutamylatable.
  • polyglutamatable folates also contain a glutamic acid residue and therefore undergo intracellular polyglutamylation.
  • non- polyglutamatable antifolates are devoid of a glutamate residue and thus are not available for polyglutamylation.
  • polyglutamylatable ligands may be preferred to increase intracellular retention as they can no longer be exported out of the cell. In other embodiments, non polyglutamylatable ligands may be preferred to decrease intracellular retention.
  • ligands of the present invention may include dihydrofolic acid or any of its derivatives that may bind to human DHFR.
  • the ligands of the present invention may be 2,4, diaminohetrocyclic compounds.
  • the 4-oxo group in dihydrofolate may be modified to generate DHFR inhibitors.
  • the 4 -oxo group may be replaced by 4-amino group.
  • Various diamino heterocycles including pteridines, quinazolines, pyridopyrimidines, pyrimidines, and triazines, may also be used as scaffolds to develop DHFR inhibitors and may be used in the present invention.
  • the crystal structure of DHFR in complex with known DHFR inhibitors may be utilized in the rational design of better DHFR ligands.
  • the ligands used herein include a 2,4-diaminopyrimidine ring with a propargyl group linked to an optionally substituted aryl or heteroaryl ring (as described in US Patent No. US 8,426,432; the contents of which are incorporated herein by reference in their entirety).
  • ligands include TMP- derived ligands containing portions of the ligand known to mediate binding to DHFR. Ligands may also be modified to reduce off-target binding to other folate metabolism enzymes and increase specific binding to DHFR.
  • payloads of the present invention may be immunotherapeutic agents that induce immune responses in an organism.
  • the immunotherapeutic agent may be, but is not limited to a cytokine, a safety switch (e.g., a suicide gene), a regulatory switch, a chimeric antigen receptor, or any agent that induces an immune response.
  • the immunotherapeutic agent induces an anti-cancer immune response in a cell, or in a subject.
  • the payload of the invention may be any of the co-stimulatory molecules and/or intracellular domains described herein.
  • one or more co- stimulatory molecules, each under the control of different SRE may be used in the present invention.
  • SRE regulated co- stimulatory molecules may also be expressed in conjunction with a first generation CAR, a second generation CAR, a third generation CAR, a fourth generation, or any other CAR design described herein.
  • payloads of the present invention may be cytokines, chemokines, growth factors, and soluble proteins produced by immune cells, cancer cells and other cell types, which act as chemical communicators between cells and tissues within the body. These proteins mediate a wide range of physiological functions, from effects on cell growth, differentiation, migration and survival, to several effector activities. For example, activated T cells produce a variety of cytokines for cytotoxic function to eliminate tumor cells.
  • payloads of the present invention may be cytokines, and fragments, variants, analogs and derivatives thereof, including but not limited to interleukins, tumor necrosis factors (TNFs), interferons (IFNs), TGF beta and chemokines.
  • TNFs tumor necrosis factors
  • IFNs interferons
  • TGF beta TGF beta
  • chemokines chemokines
  • certain gene and/or protein nomenclature for the same gene or protein may be inclusive or exclusive of punctuation such as a dash "-" or symbolic such as Greek letters. Whether these are included or excluded herein, the meaning is not meant to be changed as would be understood by one of skill in the art.
  • IL2, IL2 and IL 2 refer to the same interleukin.
  • TNFalpha, TNFa, TNF-alpha, TNF-a, TNF alpha and TNF a all refer to the same protein.
  • payloads of the present invention may be cytokines that stimulate immune responses.
  • payloads of the invention may be antagonists of cytokines that negatively impact anti-cancer immune responses.
  • payloads of the present invention may be cytokine receptors, recombinant receptors, variants, analogs and derivatives thereof; or signal components of cytokines.
  • cytokines of the present invention may be utilized to improve expansion, survival, persistence, and potency of immune cells such as CD8+TEM, natural killer cells and tumor infiltrating lymphocytes (TIL) cells used for immunotherapy.
  • TIL tumor infiltrating lymphocytes
  • T cells engineered with two or more DD regulated cytokines are utilized to provide kinetic control of T cell activation and tumor microenvironment remodeling.
  • the present invention provides biocircuits and compositions to minimize toxicity related to cytokine therapy. Despite its success in mitigating tumor burden, systemic cytokine therapy often results in the development of severe dose limiting side effects.
  • cytokines of the present invention may be utilized to modulate cytokine expression in the event of adverse effects.
  • cytokines of the present invention may be designed to have prolonged life span or enhanced specificity to minimize toxicity.
  • the payload of the present invention may be an interleukin (IL) cytokine.
  • Interleukins are a class of glycoproteins produced by leukocytes for regulating immune responses.
  • the term "interleukin (IL)” refers to an interleukin polypeptide from any species or source and includes the full-length protein as well as fragments or portions of the protein.
  • the interleukin payload is selected from IL1, IL1 alpha (also called hematopoietin-1), ILlbeta (catabolin), IL1 delta, ILlepsilon, ILleta, IL1 zeta, interleukin- 1 family member 1 to 11 (IL1F1 to IL1F11), interleukin- 1 homolog 1 to 4 (1L1H1 to IL1H4), IL1 related protein 1 to 3 (IL1RP1 to IL1RP3), IL2, IL3, IL4, IL5, IL6, 1L7, IL8, IL9, IL10, IL10C, IL10D, IL11, IL1 la, IL1 lb, IL12, IL13, IL14, IL15, IL16, IL17, IL17A, I117B, IL17C, IL17E, IL17F, IL18, IL19, IL20
  • the payload of the present invention may be an interleukin receptor selected from CD121a, CDwl21b, IL2Ra/CD25, IL2Rp7CD122, IL2Ry/CD132, CDwl31, CD124, CD131, CDwl25, CD126, CD130, CD127, CDw210, IL8RA, ILllRa, CD212, CD213al, CD213a2, IL14R, IL15Ra, CDw217, IL18Ra, IL18Rp ⁇ IL20Ra, and IL20Rp ⁇
  • interleukin receptor selected from CD121a, CDwl21b, IL2Ra/CD25, IL2Rp7CD122, IL2Ry/CD132, CDwl31, CD124, CD131, CDwl25, CD126, CD130, CD127, CDw210, IL8RA, ILllRa, CD212, CD213al, CD213a2, IL14R, IL
  • the payload of the invention may comprise IL2.
  • the effector module of the invention may be a DD-IL2 fusion polypeptide.
  • the amino acid sequences corresponding to DD-IL2 and its components are listed in the Table 4.
  • the amino acid sequences in Table 4 may comprise a stop codon which is denoted in the table with a ""*" at the end of the amino acid sequence.
  • an IL2 mute in may be used as a payload.
  • the term "mutein” is a construct, molecule or sequence of a mutation, change or alteration in a protein and hence is also known as a mutant, e.g., a protein mutant, mutein. Consequently, an "IL2 mutein” is an IL2 mutant.
  • an IL2 mutein is a variant of wild type IL2 protein, where the wildtype IL2 consists of the amino acid sequence of SEQ ID NO. 51.
  • an IL2 variant which binds to and activates only cells expressing IL2Rafty, but does not significantly bind to or activate cell expressing only IL2Rpy
  • an IL2 mutein may be an IL2 protein in which residues of IL2 responsible for binding to either IL2Rp * or IL2Ry are substituted to abolish the interaction of IL2 with IL2Rp * or IL2Ry.
  • an IL2 mutein may be an IL2 protein comprising mutations conferring high affinity for IL2Ra.
  • An IL2 mutein may be an IL2 selective agonist (IL2SA) which can preferentially activate the high affinity IL2 receptor (i.e., IL2Rapy) which is necessary to selectively activate T cells with respect to NK cells.
  • IL2SA IL2 selective agonist
  • the IL2 mutein may be IL2 protein which preferentially binds to the lower affinity IL2Rffy but with reduced affinity to CD25.
  • IL2 muteins may be used to preferentially expand or stimulate Treg cells.
  • preferentially expand or stimulate Treg cells means the IL2 muteins promote the proliferation, survival, activation and /or function of T regulatory cells.
  • Exemplary IL2 muteins may include, but are not limited to, N88R substitution
  • an IL2 with a V91K substitution (e.g., US Patent publication NO. US20140286898); V91K substitution, C125A substitution, an IL2 with three mutations: V69A, N71R, Q74P; an IL2 mutein with high affinity for IL2Ra (N29S, Y31H, K35R, T37A, K48E, V69A, N71R, Q74P); an IL2 mutein with high affinity for IL2Ra and reduced signaling activity (N29S, Y31H, K35R, T37A, K48E, V69A, N71R, Q74P, N88D), and D20H, D20I, N88G, N88I, N88R, and Q126L substitutions as described in PCT application NO.
  • IL2 muteins may include those described in US Patent NOs. 4,518,584; 5,116,943; 5,206,344; 6,955,807; 7,105,653; 7,371,371; 7,803,361; 8,124,066; 8,349,311;
  • the IL2 mutein may be fused to a polypeptide that extends the serum half-life of the IL2 mutein, such as an IgG Fc fragment.
  • a polypeptide that extends the serum half-life of the IL2 mutein such as an IgG Fc fragment.
  • Preferred Fc regions are derived from human IgG, which includes IgGl, IgG2, IgG3, and lgG4.
  • the payload of the invention may be an IL2 fusion protein comparing a second functional polypeptide.
  • an IL2 fusion protein may comprise an IL2 or IL2 mutein polypeptide fused with a pro-apoptotic Bcl-2 family polypeptide (such as Bad, Bik/Nbk, Bid, Bim/Bod, Hrk, Bak or Bax); such fusion protein may be capable of inhibiting cell survival, inhibiting cell proliferation, or enhancing cell death or apoptosis of a target cell expressing an IL2 receptor.
  • an IL2 or IL2 mutein polypeptide may be fused with an anti-apoptotic Bcl-2 family polypeptide (such as BC1-XL, Bcl-w or Bcl-2).
  • the fusion protein may be capable of enhancing cell survival, enhancing cell proliferation, or inhibiting cell death or apoptosis of a target cell expressing an IL2 receptor. See, e.g., US patent publication NOS. US2016/0229901.
  • the IL2 fusion protein may be a IL2-GMCSF fusion protein which can promote cell-cell interaction; therefore, enhances anti-cancer immune responses (Wen et al., J. TranslationalMed., 2016, 14: 41).
  • payloads of the present invention may comprise SRE regulated safety switches that can eliminate adoptively transferred cells in the case of severe toxicity, thereby mitigating the adverse effects of T cell therapy.
  • Adoptively transferred T cells in immunotherapy may attack normal cells in response to normal tissue expression of TAA. Even on-tumor target activity of adoptively transferred T cells can result in toxicities such as tumor lysis syndrome, cytokine release syndrome and the related macrophage activation syndrome.
  • Safety switches may be utilized to eliminate inappropriately activated adoptively transferred cells by induction of apoptosis or by immunosurveillance.
  • payloads of the present invention may comprise inducible killer/suicide genes that acts as a safety switch.
  • the killer/suicide gene when introduced into adoptively transferred immune cells, could control their alloreactivity.
  • the killer/suicide gene may be an apoptotic gene (e.g., any Caspase gene) which allows conditional apoptosis of the transduced cells by administration of anon-therapeutic ligand of the SRE (e.g., DD).
  • the payload of the present invention may be Caspase 9.
  • Caspase 9 may be modified to have low basal expression and lacking the caspase recruitment domain (CARD) (SEQ ID NOS. 26 and SEQ ID NOS. 28 of US Patent No.
  • the payload of the present invention is a suicide gene system, iCasp9/Chemical induced dimerization (CID) system which consists of a polypeptide derived from the Caspase9 gene fused to a drug binding domain derived from the human FK506 protein.
  • CID iCasp9/Chemical induced dimerization
  • Administration of bioinert, small molecule AP1903(rimiducid) induces cross linking of the drug binding domains and dimerization of the fusion protein and in turn the dimerization of Caspase 9.
  • the payload of the invention may comprise Caspase 9.
  • the effector module of the invention may be a DD-Caspase9 fusion polypeptide.
  • the DD-Caspase 9 may comprise the amino acid sequences provided in Table 5.
  • the amino acid sequences in Table 5 may comprise a stop codon which is denoted in the table with a "*" at the end of the amino acid sequence
  • the iCasp9/CID system has been shown to have a basal rate of dimerization even in the absence of rimiducid, resulting in unintended cell death. Regulating the expression levels of iCasp9/CID is critical for maximizing the efficacy of iCasp9/CID system. Biocircuits of the present invention and/or any of their components may be utilized in regulating or tuning the iCasp9/CID system to optimize its utility.
  • proteins used in dimerization-induced apoptosis paradigm may include, but are not limited to Fas receptor, the death effector domain of Fas-associated protein, FADD, Caspase 1, Caspase 3, Caspase 7 and Caspase 8.
  • Fas receptor the death effector domain of Fas-associated protein
  • FADD the death effector domain of Fas-associated protein
  • Caspase 1 the death effector domain of Fas-associated protein
  • Caspase 8 Caspase 8.
  • the safety switch of the present invention may comprise a metabolic enzyme, such as herpes simplex virus thymidine kinase (HSV-TK) and cytosine deaminase (CD).
  • HSV-TK phosphorylates nucleoside analogs, including acyclovir and ganciclovir (GCV) to generate triphosphate form of nucleosides. When incorporated into DNA, it leads to chain termination and cell death.
  • a metabolic enzyme such as herpes simplex virus thymidine kinase (HSV-TK) and cytosine deaminase (CD).
  • HSV-TK phosphorylates nucleoside analogs, including acyclovir and ganciclovir (GCV) to generate triphosphate form of nucleosides. When incorporated into DNA, it leads to chain termination and cell death.
  • GCV ganciclovir
  • Cytosine deaminase can converts 5- fluorocytosine (5-FC) into the cytotoxic 5-fluorouracil (5-FU) (Tiraby et al., FEMSLett., 1998, 167: 41-49).
  • the safety switch of the present invention may comprise a CYP4B1 mutant (as suicide gene), which may be co-expressed in a CAR engineered T cells (Roellecker et al., Gen Ther., 2016, May 19, doi: 10.1038/gt.2016.38.).
  • the payload of the present invention may comprise a fusion construct that can induce cell death, for example, a polypeptide with the formula of St-Rl-S 1-Q- S2-R2, wherein the St is a stalk sequence, Rl/2 and Q are different epitopes; and S 1/2 are optional spacer sequences (See International patent publication NOS. WO2013153391; the content of which are incorporated herein by reference in their entirety).
  • safety switch may be mediated by therapeutic antibodies which specifically bind to an antigen that is expressed in the plasma membrane of adoptively transferred cells.
  • the antigen-antibody interaction allows cell removal after administration of a specific monoclonal antibody against the antigen.
  • payloads of the present invention may comprise the antigen and antibody pair used to mediate safety switch such as CD20 and anti-CD20 antibody (Griffioen et al., Haematologica, 2009, 94: 1316-1320), a protein tag and anti-tag antibody (Kieback et al., Natl. Acad. Sci.
  • GVHD graft versus host disease
  • GVHD occurs when adoptively transferred T cells elicit an immune response resulting in host tissue damage. Recognition of host antigens by the graft cells triggers a proinflammatory cytokine storm cascade that signifies acute GVHD.
  • GVHD is characterized as an imbalance between the effector and the regulatory arms of the immune system.
  • the payloads of the present invention may be used as regulatory switches.
  • regulatory switch refers proteins, which when expressed in target cells increase tolerance to the graft by enhancing the regulatory arm of the immune system.
  • regulatory switches may include payloads that preferentially promote the expansion of regulatory T (Treg cells).
  • Tregs arc a distinct population of cells that are positively selected on high affinity ligands in the thymus and play an important role in the tolerance to self-antigens.
  • T regs have also been shown to play a role in peripheral tolerance to foreign antigens. Since Tregs promote immune tolerance, expansion of Tregs with the compositions of the invention may be desirable to limit GVHD.
  • the regulatory switch may include, but is not limited to T regs activation factors such NFKB, FOXO, nuclear receptor Nr4a, Retinoic acid receptor alpha, NFAT, AP-1 and SMAD.
  • T regs activation factors such as NFKB, FOXO, nuclear receptor Nr4a, Retinoic acid receptor alpha, NFAT, AP-1 and SMAD.
  • FXP3 Fork headbox P3
  • the regulatory switch may be FOXP3, a transcriptional regulator in T cells.
  • a function of FOXP3 is to suppress the function of NFAT, which leads to the suppression of expression of many genes including IL2 and effector T-cell cytokines.
  • FOXP3 acts also as a transcription activator for genes such as CD2S, Cytotoxic T-Lymphocyte Antigen Cytotoxic T-Lymphocyte Antigen 4 (CTLA4), glucocorticoid-induced TNF receptor family gene (GITR) and folate receptor 4.
  • CTL4 Cytotoxic T-Lymphocyte Antigen Cytotoxic T-Lymphocyte Antigen 4
  • GITR glucocorticoid-induced TNF receptor family gene
  • FOXP3 also inhibits the differentiation of IL17 producing helper T-cells (Thl7) by antagonizing RORC (RAR related orphan receptor C).
  • the effector module of the invention may be a DD-FOXP3 fusion polypeptide.
  • the DD-FOXP3 may comprise the amino acid sequences provided in Table 6.
  • the amino acid sequences in Table 6 may comprise a stop codon which is denoted in the table with a "*" at the end of the amino acid sequence.
  • antibodies, fragments and variants thereof are payloads of the present invention.
  • antibodies of the present invention include without limitation, any of those taught in Table 5 of copending commonly owned U.S. Provisional Patent
  • antibody fragments and variants may comprise antigen binding regions from intact antibodies.
  • antibody fragments and variants may include, but are not limited to Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules such as single chain variable fragment (scFv); and multispecific antibodies formed from antibody fragments.
  • Papain digestion of antibodies produces two identical antigen- binding fragments, called "Fab” fragments, each with a single antigen-binding site. Also produced is a residual "Fc" fragment, whose name reflects its ability to crystallize readily.
  • Pepsin treatment yields an F(ab')2 fragment that has two antigen-binding sites and is still capable of cross-linking with the antigen.
  • Pharmaceutical compositions, biocircuits, biocircuit components, effector modules including their SREs or payloads of the present invention may comprise one or more of these fragments.
  • an “antibody” may comprise a heavy and light variable domain as well as an Fc region.
  • the term “native antibody” usually refers to a heterotetrameric glycoprotein of about 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Genes encoding antibody heavy and light chains are known and segments making up each have been well characterized and described (Matsuda et al., The Journal of Experimental Medicine. 1998, 188(11): 2151-62 and Li et al., Blood, 2004, 103(12): 4602-4609; the content of each of which are herein incorporated by reference in their entirety).
  • Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes.
  • Each heavy and light chain also has regularly spaced intrachain disulfide bridges.
  • Each heavy chain has at one end a variable domain (VH) followed by a number of constant domains.
  • Each light chain has a variable domain at one end (VL) and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain.
  • variable domain refers to specific antibody domains found on both the antibody heavy and light chains that differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen.
  • Variable domains comprise hypervariable regions.
  • hypervariable region refers to a region within a variable domain comprising amino acid residues responsible for antigen binding. The amino acids present within the hypervariable regions determine the structure of the complementarity determining regions (CDRs) that become part of the antigen- binding site of the antibody.
  • CDR refers to a region of an antibody comprising a structure that is complimentary to its target antigen or epitope.
  • the antigen-binding site (also known as the antigen combining site or paratope) comprises the amino acid residues necessary to interact with a particular antigen.
  • the exact residues making up the antigen-binding site are typically elucidated by co-crystallography with bound antigen. however computational assessments based on comparisons with other antibodies can also be used (Strohl, W.R. Therapeutic Antibody Engineering. Woodhead Publishing, Philadelphia PA. 2012. Ch. 3, p47-54, the contents of which are herein incorporated by reference in their entirety).
  • Determining residues that make up CDRs may include the use of numbering schemes including, but not limited to, those taught by Kabat (Wu et al., JEM, 1970, 132(2):211-250 and Johnson et al. Nucleic Acids Res. 2000, 28(1): 214-218, the contents of each of which are herein incorporated by reference in their entirety), Chothia (Chothia and Lesk, J. Mol. Biol. 1987, 196, 901, Chothia et al. Nature, 1989, 342, 877, and Al-Lazikani et al, J. Mol. Biol.
  • VH and VL domains have three CDRs each.
  • VL CDRs are referred to herein as CDR- Ll , CDR-L2 and CDR-L3, in order of occurrence when moving from N- to C- terminus along the variable domain polypeptide.
  • VH CDRs are referred to herein as CDR-H1, CDR-H2 and CDR-H3, in order of occurrence when moving from N- to C- terminus along the variable domain polypeptide.
  • CDR-H3 comprises amino acid sequences that may be highly variable in sequence and length between antibodies resulting in a variety of three-dimensional structures in antigen-binding domains (Nikoloudis, et al, PeerJ. 2014, 2: e456).
  • CDR-H3s may be analyzed among a panel of related antibodies to assess antibody diversity.
  • Various methods of determining CDR sequences are known in the art and may be applied to known antibody sequences (Strohl, W.R. Therapeutic Antibody Engineering. Woodhead Publishing, Philadelphia PA. 2012. Ch. 3, p47-54, the contents of which are herein incorporated by reference in their entirety).
  • Fv refers to an antibody fragment comprising the minimum fragment on an antibody needed to form a complete antigen-binding site. These regions consist of a dimer of one heavy chain and one light chain variable domain in tight, non-covalent association. Fv fragments can be generated by proteolytic cleavage, but are largely unstable. Recombinant methods are known in the art for generating stable Fv fragments, typically through insertion of a flexible linker between the light chain variable domain and the heavy chain variable domain (to form a single chain Fv (scFv)) or through the introduction of a disulfide bridge between heavy and light chain variable domains (Strohl, W.R. Therapeutic Antibody Engineering. Woodhead Publishing, Philadelphia PA. 2012.
  • the term "light chain” refers to a component of an antibody from any vertebrate species assigned to one of two clearly distinct types, called kappa and lambda based on amino acid sequences of constant domains. Depending on the amino acid sequence of the constant domain of their heavy chains, antibodies can be assigned to different classes. There are five major classes of intact antibodies: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgGl, IgG2, IgG3, IgG4, IgA, and IgA2.
  • single chain Fv refers to a fusion protein of VH and VL antibody domains, wherein these domains are linked together into a single polypeptide chain by a flexible peptide linker.
  • the Fv polypeptide linker enables the scFv to form the desired structure for antigen binding.
  • scFvs are utilized in conjunction with phage display, yeast display or other display methods where they may be expressed in association with a surface member (e.g. phage coat protein) and used in the identification of high affinity peptides for a given antigen.
  • tascFv tandem scFv
  • Blinatumomab is an anti-CD 19/anti-CD3 bispecific tascFv that potentiates T-cell responses to B-cell non-Hodgkin lymphoma in Phase 2.
  • MT110 is an anti-EP-CAM/anti-CD3 bispecific tascFv that potentiates T-cell responses to solid tumors in Phase 1.
  • Bispecific, tetravalent 'TandAbs are also being researched by Affimed (Nelson, A.
  • maxibodies (bivalent scFv fused to the amino terminus of the Fc (CH2-CH3 domains) of IgG may also be included.
  • bispecific antibody refers to an antibody capable of binding two different antigens. Such antibodies typically comprise regions from at least two different antibodies. Bispecific antibodies may include any of those described in Riethmuller, G. Cancer Immunity. 2012, 12:12-18, Marvin et al., 2005. Acta Pharmacologica Sinica. 2005, 26(6): 649- 658 and Schaefer et al., PNAS. 2011, 108(27): 11187-11192, the contents of each of which are herein incorporated by reference in their entirety.
  • diabody refers to a small antibody fragment with two antigen-binding sites.
  • Diabodies are functional bispecific single-chain antibodies (bscAb).
  • Diabodies comprise a heavy chain variable domain VH connected to a light chain variable domain VL in the same polypeptide chain. By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the bscAb.
  • Diabodies are described more fully in, for example, EP 404,097; WO 93/11161 ; and Hollinger et al. (Hollinger, P. et al., "Diabodies”: Small bivalent and bispecific antibody fragments. PNAS, 1993. 90: 6444- 6448); the contents of each of which are incorporated herein by reference in their entirety.
  • Intrabody refers to a form of antibody that is not secreted from a cell in which it is produced, but instead targets one or more intracellular proteins. Intrabodies may be used to affect a multitude of cellular processes including, but not limited to intracellular trafficking, transcription, translation, metabolic processes, proliferative signaling and cell division.
  • methods of the present invention may include intrabody-based therapies.
  • variable domain sequences and/or CDR sequences disclosed herein may be incorporated into one or more constructs for intrabody-based therapy.
  • the term "monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous cells (or clones), i.e., the individual antibodies comprising the population are identical and/or bind the same epitope, except for possible variants that may arise during production of the monoclonal antibodies, such variants generally being present in minor amounts.
  • each monoclonal antibody is directed against a single determinant on the antigen.
  • the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
  • the monoclonal antibodies herein include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies.
  • humanized antibody refers to a chimeric antibody comprising a minimal portion from one or more non-human (e.g., murine) antibody source(s) with the remainder derived from one or more human immunoglobulin sources.
  • humanized antibodies are human immunoglobulins (recipient antibody) in which residues from the hypervariable region from an antibody of the recipient are replaced by residues from the hypervariable region from an antibody of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and/or capacity.
  • the antibody may be a humanized full-length antibody.
  • the antibody may have been humanized using the methods taught in US Patent Publication NO. US20130303399, the contents of which are herein incorporated by reference in its entirety.
  • antibody variant refers to a modified antibody (in relation to a native or starting antibody) or a biomolecule resembling a native or starting antibody in structure and/or function (e.g., an antibody mimetic).
  • Antibody variants may be altered in their amino acid sequence, composition or structure as compared to a native antibody.
  • Antibody variants may include, but are not limited to, antibodies with altered isotypes (e.g., IgA, IgD, IgE, IgGl , IgG2, IgG3, IgG4, or IgM), humanized variants, optimized variants, multispecific antibody variants (e.g., bispecific variants), and antibody fragments.
  • compositions, biocircuits, biocircuit components, effector modules including their SREs or payloads of the present invention may be antibody mimetics.
  • antibody mimetic refers to any molecule which mimics the function or effect of an antibody and which binds specifically and with high affinity to their molecular targets.
  • antibody mimetics may be monobodies, designed to incorporate the fibronectin type III domain (Fn3) as a protein scaffold (US).
  • antibody mimetics may be those known in the art including, but are not limited to affibody molecules, affilins, affitins, anticalins, avimers, Centyrins, DARPINSTM, Fynomers and Kunitz and domain peptides. In other embodiments, antibody mimetics may include one or more non-peptide regions.
  • the antibody may comprise a modified Fc region.
  • the modified Fc region may be made by the methods or may be any of the regions described in US Patent Publication NO. US20150065690, the contents of which are herein incorporated by reference in its entirety.
  • payloads of the invention may encode multispecific antibodies that bind more than one epitope.
  • the terms “multibody” or “multispecific antibody” refer to an antibody wherein two or more variable regions bind to different epitopes. The epitopes may be on the same or different targets.
  • the multispecific antibody may be generated and optimized by the methods described in International Patent Publication NO. WO2011109726 and US Patent Publication NO. US20150252119, the contents of which each of which are herein incorporated by reference in their entirety. These antibodies are able to bind to multiple antigens with high specificity and high affinity.
  • a multi-specific antibody is a "bispecific antibody" which recognizes two different epitopes on the same or different antigens.
  • bispecific antibodies are capable of binding two different antigens.
  • Such antibodies typically comprise antigen-binding regions from at least two different antibodies.
  • a bispecific monoclonal antibody (BsMAb, BsAb) is an artificial protein composed of fragments of two different monoclonal antibodies, thus allowing the BsAb to bind to two different types of antigen.
  • Bispecific antibody frameworks may include any of those described in RiethmuUer, G., 2012. Cancer Immunity, 2012, 12: 12-18; Marvin et al., Acta Pharmacologica Sinica.
  • BsMAb basic bispecific antibodies
  • trifunctional bispecific antibodies consist of two heavy and two light chains, one each from two different antibodies, where the two Fab regions (the arms) are directed against two antigens, and the Fc region (the foot) comprises the two heavy chains and forms the third binding site.
  • payloads may encode antibodies comprising a single antigen- binding domain. These molecules are extremely small, with molecular weights approximately one-tenth of those observed for full-sized mAbs. Further antibodies may include "nanobodies” derived from the antigen-binding variable heavy chain regions (VHHs) of heavy chain antibodies found in camels and llamas, which lack light chains (Nelson, A. L, MAbs.2010. Jan-Feb;
  • the antibody may be "miniaturized".
  • mAb miniaturization are the small modular immunopharmaceuticals (SMIPs) from Trubion Pharmaceuticals. These molecules, which can be monovalent or bivalent, are recombinant single- chain molecules containing one VL, one VH antigen-binding domain, and one or two constant "effector" domains, all connected by linker domains. Presumably, such a molecule might offer the advantages of increased tissue or tumor penetration claimed by fragments while retaining the immune effector functions conferred by constant domains. At least three "miniaturized" SMIPs have entered clinical development.
  • TRU-015 an anti-CD20 SMIP developed in collaboration with Wyeth, is the most advanced project, having progressed to Phase 2 for rheumatoid arthritis (RA). Earlier attempts in systemic lupus erythematosus (SLE) and B cell lymphomas were ultimately discontinued. Trubion and Facet Biotechnology are collaborating in the development of TRU-016, an anti-CD37 SMIP, for the treatment of CLL and other lymphoid neoplasias, a project that has reached Phase 2. Wyeth has licensed the anti-CD20 SMIP SBI-087 for the treatment of autoimmune diseases, including RA, SLE and possibly multiple sclerosis, although these projects remain in the earliest stages of clinical testing. (Nelson, A. L., MAbs, 2010. Jan- Feb; 2(l):77-83).
  • miniaturized antibodies On example of miniaturized antibodies is called “unibody” in which the hinge region has been removed from IgG4 molecules. While IgG4 molecules are unstable and can exchange light-heavy chain heterodimers with one another, deletion of the hinge region prevents heavy chain-heavy chain pairing entirely, leaving highly specific monovalent light/heavy heterodimers, while retaining the Fc region to ensure stability and half-life in vivo. This configuration may minimize the risk of immune activation or oncogenic growth, as IgG4 interacts poorly with FcRs and monovalent unibodies fail to promote intracellular signaling complex formation (see, e.g., Nelson, A. L., MAbs, 2010. Jan-Feb; 2(l):77-83).
  • payloads of the invention may encode single-domain antibodies (sdAbs, or nanobodies) which are antibody fragment consisting of a single monomelic variable antibody domain. Like a whole antibody, it is able to bind selectively to a specific antigen.
  • a sdAb may be a "Camel Ig or "camelid VHH".
  • camel Ig refers to the smallest known antigen-binding unit of a heavy chain antibody (Koch-No lte, et al, FASEBJ., 2007, 21: 3490- 3498).
  • a “heavy chain antibody” or a “camelid antibody” refers to an antibody that contains two VH domains and no light chains (Riechmann L. et al, ./ Immunol. Methods, 1999, 231: 25-38; International patent publication NOs. WO1994/04678 and
  • a sdAb may be a
  • immunoglobulin new antigen receptor refers to class of antibodies from the shark immune repertoire that consist of homodimers of one variable new antigen receptor (VNAR) domain and five constant new antigen receptor (CNAR) domains. IgNARs represent some of the smallest known
  • immunoglobulin-based protein scaffolds are highly stable and possess efficient binding characteristics.
  • the inherent stability can be attributed to both (i) the underlying Ig scaffold, which presents a considerable number of charged and hydrophilic surface exposed residues compared to the conventional antibody VH and VL domains found in murine antibodies; and (ii) stabilizing structural features in the complementary determining region (CDR) loops including inter-loop disulphide bridges, and patterns of intra-loop hydrogen bonds.
  • CDR complementary determining region
  • payloads of the invention may encode intrabodies.
  • Intrabodies are a form of antibody that is not secreted from a cell in which it is produced, but instead targets one or more intracellular proteins. Intrabodies are expressed and function intracellularly, and may be used to affect a multitude of cellular processes including, but not limited to intracellular trafficking, transcription, translation, metabolic processes, proliferative signaling and cell division.
  • methods described herein include intrabody-based therapies.
  • variable domain sequences and/or CDR sequences disclosed herein are incorporated into one or more constructs for intrabody-based therapy.
  • intrabodies may target one or more glycated intracellular proteins or may modulate the interaction between one or more glycated intracellular proteins and an alternative protein.
  • intrabodies in different compartments of mammalian cells allows blocking or modulation of the function of endogenous molecules (Biocca, et al., EMBOJ. 1990, 9: 101-108; Colby et al., Proc. Natl. Acad. Sci. U.S.A. 2004, 101: 17616-17621).
  • Intrabodies can alter protein folding, protein-protein, protein-DNA, prate in-RNA interactions and protein modification. They can induce a phenotypic knockout and work as neutralizing agents by direct binding to the target antigen, by diverting its intracellular trafficking or by inhibiting its association with binding partners. With high specificity and affinity to target antigens, intrabodies have advantages to block certain binding interactions of a particular target molecule, while sparing others.
  • Intrabodies are often recombinantly expressed as single domain fragments such as isolated VH and VL domains or as a single chain variable fragment (scFv) antibody within the cell.
  • intrabodies are often expressed as a single polypeptide to form a single chain antibody comprising the variable domains of the heavy and light chains joined by a flexible linker polypeptide.
  • Intrabodies typically lack disulfide bonds and are capable of modulating the expression or activity of target genes through their specific binding activity.
  • Single chain intrabodies are often expressed from a recombinant nucleic acid molecule and engineered to be retained intracellularly (e.g., retained in the cytoplasm, endoplasmic reticulum, or periplasm).
  • Intrabodies may be produced using methods known in the art, such as those disclosed and reviewed in: (Marasco et al, PNAS, 1993, 90: 7889-7893; Chen et al. Hum. Gene Ther.
  • payloads of the invention may encode biosynthetic antibodies as described in U.S. Patent No. 5,091,513, the contents of which are herein incorporated by reference in their entirety.
  • Such antibody may include one or more sequences of amino acids constituting a region which behaves as a biosynthetic antibody binding site (BABS).
  • the sites comprise 1) non-covalently associated or disulfide bonded synthetic VH and VL dimers, 2) VH- VL or VL-VH single chains wherein the VH and VL are attached by a polypeptide linker, or 3) individuals VH or VL domains.
  • the binding domains comprise linked CDR and FR regions, which may be derived from separate immunoglobulins.
  • the biosynthetic antibodies may also include other polypeptide sequences which function, e.g., as an enzyme, toxin, binding site, or site of attachment to an immobilization media or radioactive atom. Methods are disclosed for producing the biosynthetic antibodies, for designing BABS having any specificity that can be elicited by in vivo generation of antibody, and for producing analogs thereof.
  • payloads may encode antibodies with antibody acceptor frameworks taught in U.S. Patent No. 8,399,625.
  • antibody acceptor frameworks may be particularly well suited accepting CDRs from an antibody of interest.
  • the antibody may be a conditionally active biologic protein.
  • An antibody may be used to generate a conditionally active biologic protein which are reversibly or irreversibly inactivated at the wild type normal physiological conditions as well as to such conditionally active biologic proteins and uses of such conditional active biologic proteins are provided.
  • Such methods and conditionally active proteins are taught in, for example,
  • the polynucleotides have a modular design to encode at least one of the antibodies, fragments or variants thereof.
  • the polynucleotide construct may encode any of the following designs: (1) the heavy chain of an antibody, (2) the light chain of an antibody, (3) the heavy and light chain of the antibody, (4) the heavy chain and light chain separated by a linker, (5) the VH1, CHI, CH2, CH3 domains, a linker and the light chain or (6) the VH1, CHI, CH2, CH3 domains, VL region, and the light chain.
  • polynucleotides of the present invention may be engineered to produce any standard class of immunoglobulins using an antibody described herein or any of its component parts as a starting molecule.
  • Recombinant antibody fragments may also be isolated from phage antibody libraries using techniques well known in the art and described in e.g. Clackson et al., 1991, Nature 352: 624-628; Marks et al., 1991, J. Mol. Biol. 222: 581-597. Recombinant antibody fragments may be derived from large phage antibody libraries generated by recombination in bacteria (Sblattero and Bradbury, 2000, Nature Biotechnology 18:75-80; the contents of which are incorporated herein by reference in its entirety).
  • payloads of the present invention may be antibodies, fragments and variants thereof which are specific to tumor specific antigens (TSAs) and tumor associated antigens (TAAs).
  • TSAs tumor specific antigens
  • TAAs tumor associated antigens
  • Antibodies circulate throughout the body until they find and attach to the TSA/TAA. Once attached, they recruit other parts of the immune system, increasing ADCC (antibody dependent cell-mediated cytotoxicity) and ADCP (antibody dependent cell-mediated phagocytosis) to destroy tumor cells.
  • TSA tumor specific antigen
  • a TSA may be a tumor neoantigen.
  • the tumor antigen specific antibody mediates complement-dependent cytotoxic response against tumor cells expressing the same antigen.
  • the tumor specific antigens TSAs
  • TAAs tumor associated antigens
  • pathogen associated antigens or fragments thereof
  • TSAs tumor specific antigens
  • TAAs tumor associated antigens
  • pathogen associated antigens or fragments thereof
  • TSAs tumor specific antigens
  • TAAs tumor associated antigens
  • pathogen associated antigens or fragments thereof
  • TSAs tumor specific antigens
  • TAAs tumor associated antigens
  • pathogen associated antigens or fragments thereof
  • Antigens associated with cancers or virus-induced cancers as described herein are well-known in the art.
  • TSA or TAA may be previously associated with a cancer or may be identified by any method known in the art.
  • the antigen may be GD2 ganglioside.
  • payloads of the present invention may be antibodies, fragments and variants thereof which are specific to GD2 antigen.
  • Gangliosides expressed on the tumor cell surface can be targets for cancer immunotherapy.
  • GD2 is a disialoganglioside with a molecular formula of
  • Gangliosides are acidic glycosphingolipids found on the outer surface of most cell membranes. They are ideal targets for immunotherapy because of the high antigen density, lack of modulation, relative homogeneity in many tumors and the possibility of up regulation by cytokines. Many tumors have abnormal glycolipid composition and structure. GD2 has been found in a wide spectrum of human tumors, including those of neuroectodermal or epithelial origin, virtually all melanomas, and approximately 50% of tumor samples from osteosarcoma and soft tissue sarcoma.
  • Antibodies with high affinity for GD2 include, but not limited to 1B7, 2H12, 1G2, 1E9, 1H3, 2F5, 2F7, 31F9, 31F9V2, 32E2, chl4.18, hul4.18, 3F8, 8B6, 4B5, 1A7, A1G4, GD2 mimotopes, hul4.18K322A, 5F11, 3G6, 14g2a, and 14.18.
  • the GD antibody is the 14g2a antibody (Mujoo K., et al. (1989) Cancer Res. 1;49(11):2857-61; the contents of which are incorporated herein by reference in its entirety)- Any of the GD2 antibodies described in Long A.H. et al. (2015) Nat Med. 21(6):581-90; the contents of which are incorporated by reference in their entirety).
  • the antigen is HER2 antigen.
  • payloads of the present invention may be antibodies, fragments and variants thereof which are specific to HER2 antigen.
  • HER2 is the oncogene product of human epidermal cell growth factor receptor 2 related oncogenes and is a transmembrane receptor protein having a molecular weight of 185 kDa and having a tyrosine kinase domain.
  • HER2 is a member of the EGFR family consisting of HER1 (EGFR, ERBB1), HER2 (neu, ERBB-2), HER2 (ErbB-3), and Her4 (ErbB-4) and is known to be autophosphorylated at intracellular tyrosine residues by its homodimer formation or heterodimer formation with another EGFR receptor HER1, HER3, HER4 and is activated in this manner. Thereby playing an important role in cell growth, differentiation, and survival in normal cells and tumor cells.
  • HER2 antibodies useful in the present invention may include 3B5 (from Oncogene Science/BAYER), 2C4 (ATCC HB-12697), 7C2 (ATCC HB- 12215), ApoB17F/ocHER2, 8A4 (ATCC PTA-4565), A10A12 (ATCC PTA- 4566), 9G6 , 7H4, A10E9, A12D6, A6B12, A10E11, B3G4, A5C7, 13A11, 11C11, 13E11, Her2Bi (OKT3 x 9184), Her2Bi (OKT3 x Here), 7F3 (ATCC HB-12216), huMAb4D5-l, huMAb4D5-2, huMAb4D5-3, huMAb4D5-4, huMAb4D5-6, huMAb4D5-7, 520C9, CB-11 (from Novocastra Laboratories), NCLB12
  • the antigen is CD33.
  • payloads of the present invention may be antibodies, fragments and variants thereof which are specific to CD33 antigen.
  • Acute myeloid leukemia AML is the second most common acute leukemia in the United States.
  • the commonly applied therapy of leukemic disease includes irradiation and/or chemotherapy.
  • AML-LSCs AML leukemia stem cells
  • AML-LSCs express a characteristic set of cell surface antigens including among other CD33.
  • CD33 (Sialic acid binding Ig-like lectin 3) or SIGLEC3(UNIPROT ID: P20138) is a transmembrane receptor expressed on cells of myeloid lineage. It is usually considered myeloid specific, but it can also be found on some lymphoid cells. It binds to sialic acid, therefore is a member of the SIGLEC family of lectins.
  • Exemplary antibodies targeting CD33 may include, but are not limited to M195, M2H12, DRB2, My 9-6. In one embodiment, the antibody is derived from My9.6. In some embodiments, antibodies with high affinity may be derived from any of the CD33 antibody heavy and light chain variables described in Table 7.
  • the antigen of the present invention is a BCMA (B-cell maturation antigen), also referred to as the CD269.
  • payloads of the present invention may be antibodies, fragments and variants thereof which are specific to BCMA antigen.
  • BCMA antigen (UNIPROT ID: Q02223) is encoded by the gene, TNFRS17.
  • BCMA is a member of the TNF receptor super family. It binds to B cell activating factor (BAFF) and a proliferation inducing ligand (APRIL).
  • BAFF B cell activating factor
  • APRIL proliferation inducing ligand
  • BCMA has been reported to be expressed mostly by plasma cells and subsets of mature B cells, but not T cells and NK cells. Therefore, BCMA represents a suitable therapeutic candidate in the treatment of multiple myeloma.
  • Exemplary antibodies targeting BCMA include, but are not limited to BCMA 50, BCMA30, CI 1D5.3 and C13F12.1 In one embodiment, the antibody is derived from C11D5.3. In some embodiments, antibodies with high affinity may be derived from any of the BCMA antibody heavy and light chain variables described in Table 7.
  • the antigen of the present invention is a CD276 (also known as B7- H3).
  • payloads of the present invention may be antibodies, fragment, and variants thereof which are specific to CD276.
  • CD276 is expressed in a variety of human tumors, including pediatric solid tumors and adult carcinomas. Any of the CD276 antibodies taught in International Patent publications WO2017044699 and WO2014160627 (the contents of which are incorporated herein by reference in their entirely), may be useful in the present invention.
  • antibodies with high affinity may be derived from any of the CD276 antibody heavy and light chain variables described in Table 7.
  • the antigen of the present invention is a ALK protein.
  • the developmentally-regulated cell surface receptor tyrosine kinase, ALK is known to be expressed as a tumor associated antigen as a fusion protein resulting from a chromosomal translocation. Cancer associated ALK was first described as a 2;5 translocation associated with
  • nucleophosphomin in anaplastic large cell leukemia.
  • the fusion protein is composed of intracellular component of NPM fused to ALK.
  • the ALK antigen may be the extracellular portion of the protein. Any of the antibodies, fragment and variants specific to ALK may be useful in the present invention.
  • the ALK antibodies described in the International Patent Publication, WO2015069922 (the contents of which are incorporated by reference herein in its entirety).
  • antibodies with high affinity may be derived from any of the ALK antibody heavy and light chain variables described in Table 7.
  • the antigen of the present invention is a CD22 antigen.
  • payloads of the present invention may be antibodies, fragment, and variants thereof which arc specific to CD22.
  • CD22 is a lineage restricted B cell antigen belonging to the immunoglobulin (Ig) superfamily. CD22 is expressed in 60-70% of B cell lymphomas and leukemias (e.g. B -chronic lymphocytic leukemia, hairy cell leukemia, acute lymphocytic leukemia (ALL) and Burkit's lymphoma) and is not present on the cell surface in early stages of B cell development or on to stem cells.
  • the antibodies, fragments, and variants thereof may be any of those taught in International Patent Publications,
  • antibodies with high affinity may be derived from any of the CD22 antibody heavy and light chain variables described in Table 7.
  • the payloads of the present invention may include an antigen binding region comprising variable heavy chain and variable light chains with the amino acid sequences selected from those in Table 7.
  • payloads of the present invention may be a chimeric antigen receptors (CARs) which when transduced into immune cells (e.g., T cells and NK cells), can redirect the immune cells against the target (e.g., a tumor cell) which expresses a molecule recognized by the extracellular target moiety of the CAR.
  • CARs chimeric antigen receptors
  • chimeric antigen receptor refers to a synthetic receptor that mimics TCR on the surface of T cells.
  • a CAR is composed of an extracellular targeting domain, a transmembrane domain/region and an intracellular signaling/activation domain.
  • the components: the extracellular targeting domain, transmembrane domain and intracellular signaling/activation domain are linearly constructed as a single fusion protein.
  • the extracellular region comprises a targeting domain/moiety (e.g., a scFv) that recognizes a specific tumor antigen or other tumor cell-surface molecules.
  • the intracellular region may contain a signaling domain of TCR complex (e.g., the signal region of CD3Q, and/or one or more costimulatory signaling domains, such as those from CD28, 4-1BB (CD137) and OX-40 (CD134).
  • a "first-generation CAR" only has the CD3 ⁇ signaling domain.
  • costimulatory intracellular domains are added, giving rise to second generation CARs having a CD3 ⁇ signal domain plus one costimulatory signaling domain, and third generation CARs having CD3 ⁇ signal domain plus two or more costimulatory signaling domains.
  • a CAR when expressed by a T cell, endows the T cell with antigen specificity determined by the extracellular targeting moiety of the CAR.
  • the extracellular targeting domain is joined through the hinge (also called space domain or spacer) and transmembrane regions to an intracellular signaling domain.
  • the hinge connects the extracellular targeting domain to the transmembrane domain which transverses the cell membrane and connects to the intracellular signaling domain.
  • the hinge may need to be varied to optimize the potency of CAR transformed cells toward cancer cells due to the size of the target protein where the targeting moiety binds, and the size and affinity of the targeting domain itself.
  • the intracellular signaling domain leads to an activation signal to the CAR T cell, which is further amplified by the "second signal" from one or more intracellular costimulatory domains.
  • the CAR T cell once activated, can destroy the target cell.
  • the CAR of the present invention may be split into two parts, each part is linked a dimerizing domain, such that an input that triggers the dimerization promotes assembly of the intact functional receptor.
  • Wu and Lim recently reported a split CAR in which the extracellular CD 19 binding domain and the intracellular signaling element are separated and linked to the FKBP domain and the FRB* (T2089L mutant of FKBP-rapamycin binding) domain that heterodimerize in the presence of the rapamycin analog AP21967.
  • the split receptor is assembled in the presence of AP21967 and together with the specific antigen binding, activates T cells (Wu et al. Science, 2015, 625(6258): aab4077).
  • the CAR of the present invention may be designed as an inducible CAR.
  • Sakemura et al recently reported the incorporation of a Tet-On inducible system to the CD19 CAR construct.
  • the CD19 CAR is activated only in the presence of doxycycline (Dox).
  • Sakemura reported that Tet-CD19CAR T cells in the presence of Dox were equivalently cytotoxic against CD 19 ⁇ cell lines and had equivalent cytokine production and proliferation upon CD19 stimulation, compared with conventional CD19CAR T cells (Sakemura et al., Cancer Immuno. Res., 2016, Jun 21, Epub ahead of print).
  • this Tet-CAR may be the payload of the effector module under the control of SREs (e.g., DDs) of the invention.
  • SREs e.g., DDs
  • the dual systems provide more flexibility to turn-on and off of the CAR expression in transduced T cells.
  • the payload of the present invention may be a first- generation CAR, or a second-generation CAR, or a third-generation CAR, or a fourth-generation CAR.
  • Representative effector module embodiments comprising CAR constructs are illustrated in Figures 13-18.
  • the payload of the present invention may be a full CAR construct composed of the extracellular domain, the hinge and transmembrane domain and the intracellular signaling region.
  • the payload of the present invention may be a component of the full CAR construct including an extracellular targeting moiety, a hinge region, a transmembrane domain, an intracellular signaling domain, one or more co-stimulatory domain, and other additional elements that improve CAR architecture and functionality including but not limited to a leader sequence, a homing element and a safety switch, or the combination of such components.
  • CARs regulated by biocircuits and compositions of the present invention are tunable and thereby offer several advantages.
  • the reversible on-off switch mechanism allows management of acute toxicity caused by excessive CAR-T cell expansion.
  • Pulsatile CAR expression using SREs of the present invention may be achieved by cycling ligand level.
  • the ligand conferred regulation of the CAR may be effective in offsetting tumor escape induced by- antigen loss, avoiding functional exhaustion caused by tonic signaling due to chronic antigen exposure and improving the persistence of CAR expressing cells invivo.
  • biocircuits and compositions of the invention may be utilized to down regulate CAR expression to limit on target on tissue toxicity caused by tumor lysis syndrome. Down regulating the expression of the CARs of the present invention following antitumor efficacy may prevent ( 1) On target off tumor toxicity caused by antigen expression in normal tissue. (2) antigen independent activation in vivo.
  • the extracellular target moiety of a CAR may be any agent that recognizes and binds to a given target molecule, for example, a neoantigen on tumor cells, with high specificity and affinity.
  • the target moiety may be an antibody and variants thereof that specifically binds to a target molecule on tumor cells, or a peptide aptamer selected from a random sequence pool based on its ability to bind to the target molecule on tumor cells, or a variant or fragment thereof that can bind to the target molecule on tumor cells, or an antigen recognition domain from native T- cell receptor (TCR) (e.g.
  • TCR native T- cell receptor
  • the targeting domain of a CAR may be a lg NAR, a Fab fragment, a Fab' fragment, a F(ab)'2 fragment, a F(ab)'3 fragment, Fv, a single chain variable fragment (scFv), a bis-scFv, a (scFv)2, a minibody, a diabody, a triabody, a tetrabody, a disulfide stabilized Fv protein (dsFv), a unitbody, a nanobody, or an antigen binding region derived from an antibody that specifically recognizes a target molecule, for example a tumor specific antigen (TSA).
  • TSA tumor specific antigen
  • the targeting moiety is a scFv antibody.
  • the scFv domain when it is expressed on the surface of a CAR T cell and subsequently binds to a target protein on a cancer cell, is able to maintain the CAR T cell in proximity to the cancer cell and to trigger the activation of the T cell.
  • a scFv can be generated using routine recombinant DNA technology techniques and is discussed in the present invention.
  • natural ligands may be used as the targeting moieties of the CARs of the present invention. Such natural ligands may be capable of binding to the antigens with affinity in the range of the scFvs and can redirect T cells specificity and effector functions to target cells expressing the complementary receptor.
  • the targeting moiety of the CAR may be neuregulin-1 (NRG1) which is a natural ligand for HER3 and HER4; VEGF which is a natural ligand of VEGFR; IL13 wildtype protein or IL13 mutein e.g.
  • E13Y which binds to IL13Ra2; NKG2D ligand, which is a natural ligand of NKG2D receptor; CD70 which is ligand of CD27; and a proliferation-inducing ligand (APRIL) which is a natural high affinity ligand for BCMA8 and transmembrane activator and CAML interactor (TACI).
  • APRIL proliferation-inducing ligand
  • the targeting moiety' of the CAR may recognize antigen such as, but not limited to a ganglioside, a growth factor receptor, a lectin or any other cell surface antigen.
  • antigen such as, but not limited to a ganglioside, a growth factor receptor, a lectin or any other cell surface antigen.
  • any of the sequences described in Table 7 or Table 8 may be useful in the present invention.
  • the targeting moiety of a CAR may recognize a tumor specific antigen (TSA), for example a cancer neoantigen that is only expressed by tumor cells because of genetic mutations or alterations in transcription which alter protein coding sequences, therefore creating novel, foreign antigens.
  • TSA tumor specific antigen
  • the genetic changes result from genetic substitution, insertion, deletion or any other genetic changes of a native cognate protein (i.e. a molecule that is expressed in normal cells
  • the targeting moieties of the present invention may be scFv comprising the amino acid sequences in Table 8. Table 8; scFv sequences
  • the intracellular domain of a CAR fusion polypeptide after binding to its target molecule, transmits a signal to the immune effector cell, activating at least one of the normal effector functions of immune effector cells, including cytolytic activity (e.g., cytokine secretion) or helper activity. Therefore, the intracellular domain comprises an "intracellular signaling domain" of a T cell receptor (TCR).
  • TCR T cell receptor
  • the entire intracellular signaling domain can be employed.
  • a truncated portion of the intracellular signaling domain may be used in place of the intact chain if it transduces the effector function signal.
  • the intracellular signaling domain of the present invention may contain signaling motifs which are known as immunoreceptor tyrosine-based activation motifs (ITAMs).
  • ITAMs immunoreceptor tyrosine-based activation motifs
  • ⁇ containing cytoplasmic signaling sequences include those derived from TCR CD3zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d.
  • the intracellular signaling domain is a CD3 zeta (CD3Q signaling domain.
  • the intracellular region of the present invention further comprises one or more costimulatoiy signaling domains which provide additional signals to the immune effector cells.
  • costimulatory signaling domains in combination with the signaling domain can further improve expansion, activation, memory, persistence, and tumor-eradicating efficiency of CAR engineered immune cells (e.g., CAR T cells).
  • CAR engineered immune cells e.g., CAR T cells.
  • costimulatory signaling region contains 1, 2, 3, or 4 cytoplasmic domains of one or more intracellular signaling and /or costimulatory molecules.
  • the costimulatory signaling domain may be the intracellular/cytoplasmic domain of a costimulatory molecule, including but not limited to CD2, CD7, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), GITR (glucocorticoid-induced tumor necrosis factor receptor), LFA-1 (lymphocyte function-associated antigen- 1), LIGHT, NKG2C, B7-H3.
  • the costimulatory signaling domain is derived from the cytoplasmic domain of CD28.
  • the costimulatory signaling domain is derived from the cytoplasmic domain of 4- IBB (CD 137).
  • the costimulatory signaling domain may be an intracellular domain of GITR as taught in U.S. Pat. NOS. 9, 175, 308; the contents of which are incorporated herein by reference in its entirety.
  • the intracellular region of the present invention may comprise a functional signaling domain from a protein selected from the group consisting of an MHC class I molecule, a TNF receptor protein, an immunoglobulin-like protein, a cytokine receptor, an integrin, a signaling lymphocytic activation protein (SLAM) such as CD48, CD229, 2B4, CD84, NTB-A, CRACC, BLAME,CD2F- 10, SLAMF6, SLAMF7, an activating NK cell receptor, BTLA, a Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1 (CD1 la/CD18), 4-1BB (CD137), B7-H3, CDS, ICAM-1, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM (LIGHTR), SLAMF7, NKp80 (KLRFl), NK
  • SLAM signaling lympho
  • the intracellular signaling domain of the present invention may contain signaling domains derived from JAK-STAT.
  • the intracellular signaling domain of the present invention may contain signaling domains derived from DAP- 12 (Death associated protein 12) (Topferet al., /mmttwo/., 2015, 194: 3201-3212; and Wang et al., Cancer Immunol., 2015, 3: 815-826).
  • DAP- 12 is a key signal transduction receptor in NK cells. The activating signals mediated by DAP- 12 play important roles in triggering NK cell cytotoxicity responses toward certain tumor cells and virally infected cells.
  • the cytoplasmic domain of DAP12 contains an Immunoreceptor Tyrosine-based Activation Motif ( ⁇ ).
  • a CAR containing a DAP12-derived signaling domain may be used for adoptive transfer of NK cells.
  • T cells engineered with two or more CARs incorporating distinct co-stimulatory domains and regulated by distinct DD may be used to provide kinetic control of downstream signaling.
  • the intracellular domain of the present invention may comprise amino acid sequences of Table 9.
  • the CAR of the present invention may comprise a
  • transmembrane domain refers broadly to an amino acid sequence of about 15 residues in length which spans the plasma membrane. More preferably, a transmembrane domain includes at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 amino acid residues and spans the plasma membrane.
  • the transmembrane domain of the present invention may be derived either from a natural or from a synthetic source.
  • the transmembrane domain of a CAR may be derived from any naturally membrane-bound or transmembrane protein.
  • the transmembrane region may be derived from (i.e. comprise at least the
  • the transmembrane domain of the present invention may be synthetic.
  • the synthetic sequence may comprise predominantly hydrophobic residues such as leucine and valine.
  • the transmembrane domain of the present invention may be selected from the group consisting of a CD8a transmembrane domain, a CD4 transmembrane domain, a CD 28 transmembrane domain, a CTLA-4 transmembrane domain, a PD-1 transmembrane domain, and a human Ig&i Fc region.
  • the transmembrane domain may be a CTLA-4 transmembrane domain comprising the amino acid sequences of SEQ ID NOs. 1-5 of International Patent Publication NOS. WO2014/100385; and a PD-1 transmembrane domain comprising the amino acid sequences of SEQ ID NOs. 6-8 of International Patent Publication NOS. WO2014100385; the contents of each of which are incorporated herein by reference in their entirety.
  • the CAR of the present invention may comprise an optional hinge region (also called spacer).
  • a hinge sequence is a short sequence of amino acids that facilitates flexibility of the extracellular targeting domain that moves the target binding domain away from the effector cell surface to enable proper cell/cell contact, target binding and effector cell activation (Patel et al., Gene Therapy, 1999; 6: 412-419).
  • the hinge sequence may be positioned between the targeting moiety and the transmembrane domain.
  • the hinge sequence can be any suitable sequence derived or obtained from any suitable molecule.
  • the hinge sequence may be derived from all or part of an immunoglobulin (e.g., IgGl, IgG2, IgG3, IgG4) hinge region, i.e., the sequence that falls between the CHI and CH2 domains of an immunoglobulin, e.g., an lgG4 Fc hinge, the extracellular regions of type 1 membrane proteins such as CD8a CD4, CD28 and CD7, which may be a wild type sequence or a derivative.
  • Some hinge regions include an immunoglobulin CH3 domain or both a CH3 domain and a CH2 domain.
  • the hinge region may be modified from an IgGl, IgG2, IgG3, or IgG4 that includes one or more amino acid residues, for example, 1, 2, 3, 4 or 5 residues, substituted with an amino acid residue different from that present in an unmodified hinge.
  • Table 10 provides various transmembrane regions that can be used in the CARs described herein.
  • Hinge region sequences useful in the present invention are provided in Table 11.
  • the CAR of the present invention may comprise one or more linkers between any of the domains of the CAR.
  • the linker may be between 1 -30 amino acids long.
  • the linker may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 amino acids in length.
  • the linker may be flexible.
  • the CH2CH3 may be preferentially excluded from the chimeric antigen structure to elicit a higher TNFa response as disclosed in WO2016149578 (the contents of which are herein incorporated by reference).
  • a CH2CH3 structural domain is included. This domain extends the scFV away from the plasma membrane extracellular surface, and allows for the efficient detection of transduced T cells with anti-IgG Fc-specific antibody.
  • CAR constructs which include CH2CH3 domain are disclosed in WO2015069922A3 (the contents of which are incorporated herein by reference in its entirety).
  • the components including the targeting moiety, transmembrane domain and intracellular signaling domains of the present invention may be constructed in a single fusion polypeptide.
  • the fusion polypeptide may be the payload of an effector module of the invention.
  • more than one CAR fusion polypeptides may be included in an effector module, for example, two, three or more CARs may be included in the effector module under the control of a single SRE (e.g., a DD).
  • Representative effector modules comprising the CAR payload are illustrated in Figures 2-6.
  • the CAR sequences may be selected from Table 12.
  • the payload of the invention is a CD33 specific CAR.
  • the CD33 heavy and light chain may be combined with any of the signal peptides, transmembrane domains, costimulatory domains, intracellular domains and destabilizing domains described herein.
  • the payload of the invention is a GD2 specific CAR.
  • the GD2 heavy and light chain may be combined with any of the signal peptides, transmembrane domains, costimulatory domains, intracellular domains and destabilizing domains described herein.
  • the payload of the invention is a Her2 specific C AR.
  • the Her2 heavy and light chain may be combined with any of the signal peptides, transmembrane domains, costimulatory domains, intracellular domains and destabilizing domains described herein.
  • Exemplary BCMA CAR sequences and its components are described in Table 13 A.
  • the amino acid sequences in Table 13 A may comprise a stop codon which is denoted in the table with a "*" at the end of the amino acid sequence
  • the CAR of the present invention is a BCMA (B-cell maturation antigen) CAR, also referred to as the CD269.
  • BCMA BCMA
  • the BCMA heavy and light chains may be combined with any of the signal peptides, transmembrane domains, costimulatory domains, intracellular domains and destabilizing domains described herein.
  • Exemplary BCMA CAR sequences and its components are described in Table 13B.
  • the amino acid sequences in Table 13B may comprise a stop codon which is denoted in the table with a "*" at the end of the amino acid sequence.
  • the CAR of the present invention may be a tandem chimeric antigen receptor (TanCAR) which is able to target two, three, four, or more tumor specific antigens.
  • the CAR is a bispecific TanCAR including two targeting domains which recognize two different TSAs on tumor cells.
  • the bispecific CAR may be further defined as comprising an extracellular region comprising a targeting domain (e.g., an antigen recognition domain) specific for a first tumor antigen and a targeting domain (e.g., an antigen recognition domain) specific for a second tumor antigen.
  • the CAR is a multispecific TanCAR that includes three or more targeting domains configured in a tandem arrangement.
  • the space between the targeting domains in the TanCAR may be between about 5 and about 30 amino acids in length, for example, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30 amino acids.
  • the components including the targeting moiety, transmembrane domain and intracellular signaling domains of the present invention may be split into two or more parts such that it is dependent on multiple inputs that promote assembly of the intact functional receptor.
  • the split synthetic CAR system can be constructed in which the assembly of an activated CAR receptor is dependent on the binding of a ligand to the SRE (e.g. a small molecule) and a specific antigen to the targeting moiety.
  • the split CAR consists of two parts that assemble in a small molecule-dependent manner; one part of the receptor features an extracellular antigen binding domain (e.g. scFv) and the other part has the intracellular signaling domains, such as the ⁇ 3 ⁇ intracellular domain.
  • the split parts of the CAR system can be further modified to increase signal.
  • the second part of cytoplasmic fragment may be anchored to the plasma membrane by incorporating a transmembrane domain (e.g., CD8a transmembrane domain) to the construct.
  • An additional extracellular domain may also be added to the second part of the CAR system, for instance an extracellular domain that mediates homo-dimerization.
  • the two parts of the split CAR system contain heterodimerization domains that conditionally interact upon binding of a heterodimerizing small molecule.
  • the receptor components are assembled in the presence of the small molecule, to form an intact system which can then be activated by antigen engagement. Any known heterodimerizing components can be incorporated into a split CAR system.
  • GID1-GAI gibberellin-induced dimerization system
  • trimethoprim-SLF induced ecDHFR and FKBP dimerization Czlapinski et al, J Am Chem Soc, 2008, 130(40): 13186-13187
  • ABA abcisic acid
  • PP2C and PYL domains Cutler et al., Aram Rev Plant Biol. 2010, 61: 651-679.
  • the dual regulation using inducible assembly (e.g., ligand dependent dimerization) and degradation (e.g., destabilizing domain induced CAR degradation) of the split CAR system may provide more flexibility to control the activity of the CAR modified T cells.
  • the CAR of the invention may be a switchable CAR.
  • Juillerat et al Juillerat et al (Juilerat et al., Sci. Rep., 2016, 6: 18950; the contents of which are incorporated herein by reference in their entirety) recently reported controllable CARs that can be transiently switched on in response to a stimulus (e.g. a small molecule).
  • a stimulus e.g. a small molecule
  • a system is directly integrated in the hinge domain that separate the scFv domain from the cell membrane domain in the CAR.
  • Such system is possible to split or combine different key functions of a CAR such as activation and costimulation within different chains of a receptor complex, mimicking the complexity of the TCR native architecture.
  • the CAR of the invention may be a reversible CAR system.
  • a LID domain ligand-induced degradation
  • the CAR can be temporarily down-regulated by adding a ligand of the LID domain.
  • the combination of LID and DD mediated regulation provides tunable control of continuingly activated CAR T cells, thereby reducing CAR mediated tissue toxicity.
  • payloads of the invention may be an activation-conditional chimeric antigen receptor, which is only expressed in an activated immune cell.
  • the expression of the CAR may be coupled to activation conditional control region which refers to one or more nucleic acid sequences that induce the transcription and/or expression of a sequence e.g. a CAR under its control.
  • activation conditional control regions may be promoters of genes that are upregulated during the activation of the immune effector cell e.g. IL2 promoter or NFAT binding sites.
  • activation of the immune cell may be achieved by a constitutively expressed CAR (International Publication NO. WO2016126608; the contents of which are incorporated herein by reference in their entirety).
  • the effector module of the present invention may further comprise a signal sequence which regulates the distribution of the payload of interest, a cleavage and/or processing feature which facilitate cleavage of the payload from the effector module construct, a targeting and/or penetrating signal which can regulate the cellular localization of the effector module, a tag, and/or one or more linker sequences which link different components of the effector module.
  • Signal sequences which regulates the distribution of the payload of interest, a cleavage and/or processing feature which facilitate cleavage of the payload from the effector module construct, a targeting and/or penetrating signal which can regulate the cellular localization of the effector module, a tag, and/or one or more linker sequences which link different components of the effector module.
  • effector modules of the invention may further comprise one or more signal sequences.
  • Signal sequences (sometimes referred to as signal peptides, targeting signals, target peptides, localization sequences, transit peptides, leader sequences or leader peptides) direct proteins (e.g., the effector module of the present invention) to their designated cellular and/or extracellular locations. Protein signal sequences play a central role in the targeting and translocation of nearly all secreted proteins and many integral membrane proteins.
  • a signal sequence is a short (5-30 amino acids long) peptide present at the N-terminus of the majority of newly synthesized proteins that are destined towards a particular location.
  • Signal sequences can be recognized by signal recognition particles (SRPs) and cleaved using type I and type II signal peptide peptidases.
  • SRPs signal recognition particles
  • Signal sequences derived from human proteins can be incorporated as a regulatory module of the effector module to direct the effector module to a particular cellular and/or extracellular location. These signal sequences are experimentally verified and can be cleaved (Zhang et al., Protein Sci. 2004, 13:2819-2824).
  • a signal sequence may be, although not necessarily, located at the N-terminus or C-terminus of the effector module, and may be, although not necessarily, cleaved off the desired effector module to yield a "mature" payload, i.e., an immunotherapeutic agent as discussed herein.
  • a signal sequence may be a secreted signal sequence derived from a naturally secreted protein, and its variant thereof.
  • the secreted signal sequences may be cytokine signal sequences such as, but not limited to, IL2 signal sequence ( amino acid of SEQ ID NO. 49, encoded by the nucleic acid sequence of SEQ ID NO. 55-56 and/or 117-118), p40 signal sequence (amino acid sequence of SEQ ID NO. 119, encoded by the nucleic acid sequence of SEQ ID NO. 120-128), or a GMCSF leader sequence (SEQ ID NO. 778 (encoded by SEQ ID NO. 922), 779, 780).
  • IL2 signal sequence amino acid of SEQ ID NO. 49, encoded by the nucleic acid sequence of SEQ ID NO. 55-56 and/or 117-118
  • p40 signal sequence amino acid sequence of SEQ ID NO. 119, encoded by the nucleic acid sequence of SEQ ID NO. 120-128
  • signal sequences directing the payload of interest to the surface membrane of the target cell may be used.
  • Expression of the payload on the surface of the target cell may be useful to limit the diffusion of the payload to non-target in vivo environments, thereby potentially improving the safety profile of the payloads.
  • the membrane presentation of the payload may allow for physiologically and qualitative signaling as well as stabilization and recycling of the payload for a longer half-life.
  • Membrane sequences may be the endogenous signal sequence of the N terminal component of the payload of interest. Optionally, it may be desirable to exchange this sequence for a different signal sequence.
  • Signal sequences may be selected based on their compatibility with the secretory pathway of the cell type of interest so that the payload is presented on the surface of the T cell.
  • the signal sequence may be IgE signal sequence (amino acid SEQ ID NO. 129 and nucleotide sequence of SEQ ID NO. 130), CD8a signal sequence (also referred to as CD8a leader) (amino acid SEQ ID NO. 131 and nucleotide sequence of SEQ ID NO. 132-136, and/or 915) or an IL15Ra signal sequence (amino acid SEQ ID NO. 781, encoded by SEQ ID NO. 782).
  • signal sequences include, a variant may be a modified signal sequence discussed in U.S. Pat. NOs. 8, 148, 494; 8,258,102; 9,133,265; 9,279,007; and U.S. patent application publication NOS. 20070141666; and International patent application publication NOS. WO1993018181; the contents of each of which are incorporated herein by reference in their entirety.
  • a signal sequence may be a heterogeneous signal sequence from other organisms such as virus, yeast and bacteria, which can direct an effector module to a particular cellular site, such as a nucleus (e.g., EP 1209450).
  • Other examples may include Aspartic Protease (NSP24) signal sequences from Trichoderma that can increase secretion of fused protein such as enzymes (e.g., U. S. Pat. NOS. 8,093,016 to Cervin and Kim), bacterial lipoprotein signal sequences (e.g., PCT application publication NOS. WO199109952 to Lau and Rioixx'X Kcoli enterotoxin II signal peptides (e.g., U.S. Pat.
  • Kcoli secretion signal sequence e.g., U.S. patent publication NOS. US2016090404 to Malley et al.
  • a lipase signal sequence from a methylotrophic yeast e.g., U.S. Pat. NOS. 8,975,041
  • signal peptides for DNases derived from Coryneform bacteria e.g., U.S. Pat. NOS. 4,965,197
  • Signal sequences may also include nuclear localization signals (NLSs), nuclear export signals (NESs), polarized cell tubulo-vesicular structure localization signals (See, e.g., U.S. Pat. NOS. 8, 993,742; Cour et al., Nucleic Acids Res. 2003, 31(1): 393-396; the contents of each of which are incorporated herein by reference in their entirety),extracellular localization signals, signals to subcellular locations (e.g. lysosome, endoplasmic reticulum, golgi, mitochondria, plasma membrane and peroxisomes, etc.) (See, e.g., U.S. Pat. NOS. 7,396,811; and Negi et al., Database, 2015, 1-7; the contents of each of which are incorporated herein by reference in their entirety).
  • NLSs nuclear localization signals
  • NESs nuclear export signals
  • polarized cell tubulo-vesicular structure localization signals See, e.g., U.
  • signal sequences of the present invention include without limitation, any of those taught in Table 7 of copending commonly owned U.S. Provisional Patent Application No. 62/320,864, filed on 4/11/2017, or in US Provisional Application No.
  • the effector module comprises a cleavage and/or processing feature.
  • the effector module of the present invention may include at least one protein cleavage signal/site.
  • the protein cleavage signal/site may be located at the N-terminus, the C-terminus, at any space between the N- and the C- termini such as, but not limited to, half-way between the N- and C-termini, between the N-terminus and the half-way point, between the half-way point and the C-terminus, and combinations thereof.
  • the effector module may include one or more cleavage signal(s)/site(s) of any proteinases.
  • the proteinases may be a serine proteinase, a cysteine proteinase, an endopeptidase, a dipeptidase, a metalloproteinase, a glutamic proteinase, a threonine proteinase and an aspartic proteinase.
  • the cleavage site may be a signal sequence of furin, actinidain, calpain-1, carboxypeptidase A, carboxypeptidase P, carboxypeptidase Y, caspase-1, caspase-2.
  • the cleavage site is a furin cleavage site comprising the amino acid sequence SARNRQKRS (SEQ ID NO. 137), encoded by nucleotide sequence of SEQ ID NO. 138; or a revised furin cleavage site comprising the amino acid sequence ARNRQKRS (SEQ ID NO. 139), encoded by nucleotide sequence of SEQ ID NO. 140; modified furin site comprising the amino acid sequence ESRRVRRNKRSK (SEQ ID NO. 141), encoded by nucleotide sequence of SEQ ID NO. 142-144; or a SGESRRVRRNKRSK (SEQ ID NO.
  • the cleavage site is a P2A cleavage site (ATNFSLLKQAGDVEENPGP (SEQ ID NO. 783), encoded by SEQ ID NO. 786, or GATNFSLLKQAGDVEENPGP (SEQ ID NO.. 864), encoded by SEQ ID NO. 865), wherein NPGP (SEQ ID NO. 866) is the P2A site.
  • cleavage sites of the present invention include without limitation, any of those taught in Table 7 of copending commonly owned U.S. Provisional Patent Application No. 62/320,864, filed on 4/11/2016, or in US Provisional Application No.
  • the effector module of the invention may comprise a protein tag.
  • the protein tag may be used for detecting and monitoring the process of the effector module.
  • the effector module may include one or more tags such as an epitope tag (e.g., a FLAG or hemagglutinin (HA) tag).
  • a large number of protein tags may be used for the present effector modules.
  • haloalkane dehalogenase halotag2 or halotag7
  • ACP tag e.g., haloalkane dehalogenase (halotag2 or halotag7)
  • ACP tag e.g., haloalkane dehalogenase (halotag2 or halotag7)
  • ACP tag e.g., haloalkane dehalogenase (halotag2 or halotag7)
  • ACP tag e.g., haloalkane dehalogenase (halotag2 or halotag7)
  • ACP tag e.g., haloalkane dehalogenase (halotag2 or halotag7)
  • ACP tag e.g., haloalkane dehalogenase (halotag2 or halotag7)
  • ACP tag e.g., haloalkane dehalogenase (halotag
  • affinity tags e.g., maltose-binding protein (MBP) tag, glutathione-S-transferase (GST) tag
  • immunogenic affinity' tags e.g., protein A/G, IRS, AU1, AU5, glu-glu, KT3, S-tag, HSV, VSV-G, Xpress and V5
  • other tags e.g., biotin (small molecule), StrepTag (Strepll), SBP, biotin carboxyl carrier protein (BCCP), eXact, CBP, CYD, HPC, CBD intein-chitin binding domain, Trx, ⁇ , and NusA.
  • a tag may also be selected from those disclosed in U.S. Pat. NOs. 8,999,897; 8,357,511; 7,094, 568; 5,011,912; 4,851,341; and 4,703,004; U.S patent application publication NOs. US2013115635 and US2013012687; and International application publication NOS. WO2013091661; the contents of each of which are incorporated herein by reference in their entirety.
  • a multiplicity of protein tags may be used; each of the tags may be located at the same N- or C-terminus, whereas in other cases these tags may be located at each terminus.
  • the protein tag is an HA tag.
  • a non-limiting example of an HA tag is YPYDVPDYA (SEQ ID NO. 852, encoded by SEQ ID NO. 853, 867, and/or 868).
  • protein tags of the present invention include without limitation, any of those taught in Table 8 of copending commonly owned U.S. Provisional Patent
  • the effector module of the invention may further comprise a targeting and/or penetrating peptide.
  • Small targeting and/or penetrating peptides that selectively recognize cell surface markers e.g. receptors, trans-membrane proteins, and extra-cellular matrix molecules
  • cell surface markers e.g. receptors, trans-membrane proteins, and extra-cellular matrix molecules
  • Short peptides (5-50 amino acid residues) synthesized in vitro and naturally occurring peptides, or analogs, variants, derivatives thereof, may be incorporated into the effector module for homing the effector module to the desired organs, tissues and cells, and/or subcellular locations inside the cells.
  • a targeting sequence and/or penetrating peptide may be included in the effector module to drive the effector module to a target organ, or a tissue, or a cell (e.g., a cancer cell).
  • a targeting and/or penetrating peptide may direct the effector module to a specific subcellular location inside a cell.
  • a targeting peptide has any number of amino acids from about 6 to about 30 inclusive.
  • the peptide may have 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 amino acids.
  • a targeting peptide may have 25 or fewer amino acids, for example, 20 or fewer, for example 15 or fewer.
  • Exemplary targeting peptides may include, but are not limited to, those disclosed in the art, e.g., U.S. Pat. NOs. 9,206,231; 9,110,059; 8,706,219; and 8,772,449; and U.S. application publication NOs. 2016089447; 2016060296; 2016060314; 2016060312; 2016060311;
  • targeting peptides of the present invention include without limitation, any of those taught in Table 9 of copending commonly owned U.S. Provisional Patent Application No. 62/320,864, filed on 4/11/2016, the contents of which are incorporated herein by reference in their entirety.
  • the effector module of the invention may further comprise a linker sequence.
  • the linker region serves primarily as a spacer between two or more
  • linker refers to a molecule or group of molecules that connects two molecules, or two parts of a molecule such as two domains of a recombinant protein.
  • Linker refers to an oligo- or polypeptide region of from about 1 to 100 amino acids in length, which links together any of the domains/regions of the effector module (also called peptide linker).
  • the peptide linker may be 1-40 amino acids in length, or 2-30 amino acids in length, or 20-80 amino acids in length, or 50-100 amino acids in length.
  • Linker length may also be optimized depending on the type of payload utilized and based on the crystal structure of the payload. In some instances, a shorter linker length may be preferably selected.
  • the peptide linker is made up of amino acids linked together by peptide bonds, preferably from 1 to 20 amino acids linked by peptide bonds, wherein the amino acids are selected from the 20 naturally occurring amino acids: Glycine (G), Alanine (A), Valine (V), Leucine (L), Isoleucine (I), Serine (S), Cysteine (C), Threonine (T), Methionine (M), Proline (P), Phenylalanine (F), Tyrosine (Y), Tryptophan (W), Mstidine (H), Lysine (K), Arginine (R), Aspartate (D), Glutamic acid (E), Asparagine (N), and Glutamine (Q).
  • amino acids of a peptide linker may be selected from Alanine (A), Glycine (G), Proline (P), Asparagine (R), Serine (S), Glutamine (Q) and Lysine (K).
  • an artificially designed peptide linker may preferably be composed of a polymer of flexible residues like Glycine (G) and Serine (S) so that the adjacent protein domains are free to move relative to one another.
  • Longer linkers may be used when it is desirable to ensure that two adjacent domains do not interfere with one another.
  • the choice of a particular linker sequence may concern if it affects biological activity, stability, folding, targeting and/or pharmacokinetic features of the fusion construct.
  • Examples of peptide linkers include, but are not limited to: MH, SG, GGSG (SEQ ID NO. 145; encoded by the nucleotide sequence SEQ ID NO. 146), GGSGG (SEQ ID NO.
  • SGGGSGGGGSGGGGSGGGGSGGGSLQ (SEQ ID NO. 171; encoded by the nucleotide sequence SEQ ID NO. 172, 838-843), EFSTEF (SEQ ID NO. 50; encoded by any of the nucleotide sequences SEQ ID NO. 57, 173), GKSSGSGSESKS (SEQ ID NO. 176),
  • GGSTSGSGKSSEGKG (SEQ ID NO. 177), GSTSGSGKSSSEGSGSTKG (SEQ ID NO. 178), GSTSGSGKPGSGEGSTKG (SEQ ID NO. 179), VDYPYDVPDYALD (SEQ ID NO. 67; encoded by nucleotide sequence SEQ ID NO. 84), EGKSSGSGSESKEF (SEQ ID NO. 180), SG3-(SG4)3-SG3-SLQ- YPYDVPDYA (SEQ ID NO. 787), encoded by the nucleotide sequence of SEQ ID NO. 788; DYKDDDDK (SEQ ID N0.789), encoded by the nucleotide sequence of SEQ ID NO. 790; SG3-(SG4)5-SG3-S (SEQ ID NO. 791), encoded by SEQ ID NO. 792;
  • SGGGSGGGGSGGGGSGGGGSYPYDVPDYASGGGS (SEQ ID NO. 793), encoded by SEQ ID NO. 794; GSGATNFSLLKQAGDVEENPGP (SEQ ID NO. 795), encoded by SEQ ID N0.796; SGGGSGGGGSGGGGSGGGGS (SEQ ID NO. 844), encoded by the nucleotide sequence of SEQ ID NO. 845; QLIGMLQGLMRDL (SEQ ID NO. 908), encoded by SEQ ID NO. 909; ASFE (SEQ ID NO. 920), encoded by SEQ ID NO.
  • GS encoded by GGTTCC
  • SG encoded by AGCGGC
  • EF encoded by GAGTTC
  • TS encoded by ACTAGT
  • HM encoded by CACATG
  • MH encoded by ATGCAC
  • GSG encoded by GGATCCGGA or GGATCCGGT
  • a peptide linker may be made up of a majority of amino acids that are sterically unhindered, such as Glycine (G) and Alanine (A).
  • exemplary linkers are polyglycines (such as (G)4 (SEQ ID NO. 929), (G)5 (SEQ ID NO. 930), (G)8 (SEQ ID NO. 931)), poly(GA), and polyalanines.
  • the linkers described herein are exemplary, and linkers that are much longer and which include other residues are contemplated by the present invention.
  • a linker sequence may be a natural linker derived from a multi-domain protein.
  • a natural linker is a short peptide sequence that separates two different domains or motifs within a protein.
  • linkers may be flexible or rigid. In other aspects, linkers may be cleavable or non- cleavable. As used herein, the terms “cleavable linker domain or region” or “cleavable peptide linker” are used interchangeably. In some embodiments, the linker sequence may be cleaved enzymatically and/or chemically. Examples of enzymes (e.g.,
  • proteinase/peptidase useful for cleaving the peptide linker include, but are not limited, to Arg-C proteinase, Asp-N endopeptidase, chymotrypsin, clostripain, enterokinase, Factor Xa, glutamyl endopeptidase, Granzyme B, Achromobacter proteinase I, pepsin, proline endopeptidase, proteinase K, Staphylococcal peptidase I, thermolysin, thrombin, trypsin, and members of the Caspase family of proteolytic enzymes (e.g. Caspases 1-10).
  • Chemical sensitive cleavage sites may also be included in a linker sequence.
  • Examples of chemical cleavage reagents include, but are not limited to, cyanogen bromide, which cleaves methionine residues; N-chloro succinimide, iodobenzoic acid or BNPS-skatole (2-(2-nitrophenylsulfenyl)-3-methylindole), which cleaves tryptophan residues; dilute acids, which cleave at aspartyl-prolyl bonds; and e aspartic acid- proline acid cleavable recognition sites (i.e., a cleavable peptide linker comprising one or more D-P dipeptide moieties).
  • the fusion module may include multiple regions encoding peptides of interest separated by one or more cleavable peptide linkers.
  • a cleavable linker may be a "self-cleaving" linker peptide, such as 2A linkers (for example T2A), 2A-like linkers or functional equivalents thereof and combinations thereof.
  • the linkers include the picornaviral 2A-like linker, CHYSEL sequences of porcine teschovirus (P2A), Thosea asigna virus (T2A) or combinations, variants and functional equivalents thereof.
  • P2A porcine teschovirus
  • T2A Thosea asigna virus
  • Other linkers will be apparent to those skilled in the art and may be used in connection with alternate embodiments of the invention.
  • the biocircuits of the present invention may include 2A peptides.
  • the 2A peptide is a sequence of about 20 amino acid residues from a virus that is recognized by a protease (2A peptidases) endogenous to the cell.
  • the 2A peptide was identified among picomaviruses, atypical example of which is the Foot-and Mouth disease virus (Robertson BH, et. al., J Virol 1985, 54:651-660).
  • 2A-like sequences have also been found in Picomaviridae like equine rhinitis A virus, as well as unrelated viruses such as porcine teschovirus- 1 and the insect Thosea asigna virus (TaV).
  • Hie 2A peptide mediates the co-translational cleavage of this polyprotein at a single site that forms the junction between the virus capsid and replication polyprotein domains.
  • the 2A sequences contain the consensus motif D-V7I-E-X-N-P- G-P (SEQ ID NO. 932). These sequences are thought to act co-translationally, preventing the formation of a normal peptide bond between the glycine and last proline, resulting in the ribosome skipping of the next codon (Donnelly ML et al. (2001). J Gen Virol, 82:1013-1025).
  • the short peptide After cleavage, the short peptide remains fused to the C -terminus of the protein upstream of the cleavage site, while the proline is added to the N-terminus of the protein downstream of the cleavage site.
  • FMDV 2A abbreviated herein as F2A
  • E2A equine rhinitis A virus
  • P2A porcine teschovirus- 1 2A
  • T2A Thoseaasigna virus 2A
  • the 2 A peptide sequences useful in the present invention are selected from SEQ ID NO.8-11 of International Patent Publication WO2010042490, the contents of which are incorporated by reference in its entirety.
  • the linkers of the present invention may also be non-peptide linkers.
  • alkyl linkers may further be substituted by any non-sterically hindering group such as lower alkyl (e.g., C1-C5) lower acyl, halogen (e.g., CI, Br), CN, NH2, phenyl, etc.
  • the linker may be an artificial linker from U.S. Pat. NOs. 4,946,778; 5, 525, 491; 5,856,456; and International patent publication NOs. WO2012/083424; the contents of each of which are incorporated herein by reference in their entirety.
  • linkers of the present invention include without limitation, any of those taught in Table 11 of copending commonly owned U.S. Provisional Patent Application No. 62/320,864, filed on 4/11/2016, or in US Provisional Application No. 62/466,596 filed March 3, 2017 and the International Publication WO2017/180587, the contents of which are incorporated herein by reference in their entirety.
  • compositions of the invention may include optional proteasome adaptors.
  • proteasome adaptor refers to any nucleotide/ amino acid sequence that targets the appended payload for degradation.
  • the adaptors target the payload for degradation directly thereby circumventing the need for ubiquitination reactions.
  • Proteasome adaptors may be used in conjunction with destabilizing domains to reduce the basal expression of the payload.
  • Exemplary proteasome adaptors include the UbL domain of Rad23 or hHR23b, HPV E7 which binds to both the target protein Rb and the S4 subunit of the proteasome with high affinity, which allows direct proteasome targeting, bypassing the ubiquitination machineiy; the protein gankyrin which binds to Rb and the proteasome subunit S6.
  • the linker may be a spacer region of one or more nucleotides.
  • spacers are TCTAGATAATACGACTCACTAGAGATCC (SEQ ID NO. 846), TATGGCCACAACCATG (SEQ ID NO. 847),
  • AATCTAGATAATACGACTCACTAGAGATCC (SEQ ID NO. 848), TCGCGAATG, TCGCGA, GCTTGCCACAACCCACAAGGAGACGACCTTCC (SEQ ID NO. 849), or ATNFSLLKQAGDVEENPGP (SEQ ID NO. 850, encoded by SEQ ID NO. 851).
  • the linker may be a BamHI site.
  • the BamHI site has the amino acid sequence GS and/or the DNA sequence GGATCC.
  • the effector module of the present invention may further comprise one or more microRNAs, microRNA binding sites, promoters and tunable elements.
  • microRNA may be used in support of the creation of tunable biocircuits.
  • Each aspect or tuned modality may bring to the effector module or biocircuit a differentially tuned feature.
  • a destabilizing domain may alter cleavage sites or dimerization properties or half-life of the payload, and the inclusion of one or more microRNA or microRNA binding site may impart cellular detargeting or trafficking features. Consequently, the present invention embraces biocircuits which are multifactorial in their tenability.
  • micro RNA sequences of the present invention include without limitation, any of those taught in Table 13 of copending commonly owned U.S. Provisional Patent Application No. 62/320,864, filed on 4/11/2017, or in US Provisional Application No. 62/466,596 filed March 3, 2017 and the International Publication WO2017/180587, the contents of which are incorporated herein by reference in their entirety.
  • polynucleotide or "nucleic acid molecule” in its broadest sense, includes any compound and/or substance that comprise a polymer of nucleotides, e.g., linked nucleosides. These polymers are often referred to as polynucleotides.
  • nucleic acids or polynucleotides of the invention include, but are not limited to, ribonucleic acids (RN As), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a ⁇ - D-ribo configuration, a-LNA having an a-L-ribo configuration (a diastereomer of LNA), 2'-amino-LNA having a 2'-amino functionalization, and 2'-amino- a-LNA having a 2'-amino functionalization) or hybrids thereof.
  • RN As ribonucleic acids
  • DNAs deoxyribonucleic acids
  • TAAs threose nucleic acids
  • GNAs glycol nucleic acids
  • PNAs peptide nucleic acids
  • LNAs locked
  • polynucleotides of the invention may be a messenger RNA (mRNA) or any nucleic acid molecule and may or may not be chemically modified.
  • the nucleic acid molecule is a mRNA.
  • messenger RNA messenger RNA
  • mRNA refers to any polynucleotide which encodes a polypeptide of interest and which is capable of being translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ or ex vivo.
  • the basic components of an mRNA molecule include at least a coding region, a 5'UTR, a 3'UTR, a 5' cap and a poly- A tail.
  • the present invention expands the scope of functionality of traditional mRNA molecules by providing payload constructs which maintain a modular organization, but which comprise one or more structural and/or chemical modifications or alterations which impart useful properties to the polynucleotide, for example tenability of function.
  • a payload constructs which maintain a modular organization, but which comprise one or more structural and/or chemical modifications or alterations which impart useful properties to the polynucleotide, for example tenability of function.
  • structural feature or modification is one in which two or more linked nucleosides are inserted, deleted, duplicated, inverted or randomized in a polynucleotide without significant chemical modification to the nucleosides themselves. Because chemical bonds will necessarily be broken and reformed to effect a structural modification, structural modifications are of a chemical nature and hence are chemical modifications. However, structural modifications will result in a different sequence of nucleotides. For example, the polynucleotide "ATCG” may be chemically modified to "AT-5meC-G". The same polynucleotide may be structurally modified from “ATCG” to "ATCCCG". Here, the dinucleotide "CC" has been inserted, resulting in a structural
  • polynucleotides of the present invention may harbor 5'UTR sequences which play a role in translation initiation.
  • 5'UTR sequences may include features such as Kozak sequences which are commonly known to be involved in the process by which the ribosome initiates translation of genes, Kozak sequences have the consensus XCCR(A/G) CCAUG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG) and X is any nucleotide.
  • the Kozak sequence is ACCGCC.
  • polynucleotides which may contain an internal ribosome entry site (IRES) which play an important role in initiating protein synthesis in the absence of 5' cap structure in the polynucleotide.
  • IRES may act as the sole ribosome binding site, or may serve as one of the multiple binding sites.
  • Polynucleotides of the invention containing more than one functional ribosome binding site may encode several peptides or polypeptides that are translated independently by the ribosomes giving rise to bicistronic and/or multicistronic nucleic acid molecules.
  • polynucleotides encoding biocircuits, effector modules, SREs and payloads of interest such as immunotherapeutic agents may include from about 30 to about 100,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 1,000, from 30 to 1,500, from 30 to 3,000, from 30 to 5,000, from 30 to 7,000, from 30 to 10,000, from 30 to 25,000, from 30 to 50,000, from 30 to 70,000, from 100 to 250, from 100 to 500, from 100 to 1,000, from 100 to 1,500, from 100 to 3,000, from 100 to 5,000, from 100 to 7,000, from 100 to 10,000, from 100 to 25,000, from 100 to 50,000, from 100 to 70,000, from 100 to 100,000, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 3,000, from 500 to 5,000, from 500 to 7,000, from 500 to 10,000, from 500 to 25,000, from 500 to 50,000, from from about
  • Regions of the polynucleotides which encode certain features such as cleavage sites, linkers, trafficking signals, tags or other features may range independently from 10-1,000 nucleotides in length (e.g., greater than 20, 30, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, and 900 nucleotides or at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, and 1,000 nucleotides).
  • polynucleotides of the present invention may further comprise embedded regulatory moieties such as microRNA binding sites within the 3'UTR of nucleic acid molecules which when bind to microRNA molecules, down-regulate gene expression either by reducing nucleic acid molecule stability or by inhibiting translation.
  • microRNA binding sites can be engineered out of (i.e. removed from) sequences in which they naturally occur in order to increase protein expression in specific tissues.
  • miR-142 and miR-146 binding sites may be removed to improve protein expression in the immune cells.
  • any of the encoded payloads may be may be regulated by an SRE and then combined with one or more regulatory sequences to generate a dual or multi-tuned effector module or biocircuit system.
  • polynucleotides of the present invention may encode fragments, variants, derivatives of polypeptides of the inventions.
  • the variant sequence may keep the same or a similar activity.
  • the variant may have an altered activity (e.g., increased or decreased) relative to the start sequence.
  • variants of a particular polynucleotide or polypeptide of the invention will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than 100% sequence identity to that particular reference polynucleotide or polypeptide as determined by sequence alignment programs and parameters described herein and known to those skilled in the art.
  • Such tools for alignment include those of the BLAST suite (Stephen et al., Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res., 1997, 25:3389-3402.)
  • polynucleotides of the present invention may be modified.
  • nucleoside is defined as a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”).
  • organic base e.g., a purine or pyrimidine
  • nucleotide is defined as a nucleoside including a phosphate group.
  • the modification may be on the internucleoside linkage (e.g., phosphate backbone).
  • phosphate backbone in the context of the polynucleotide backbone, the phrases "phosphate” and “phosphodiester” are used interchangeably.
  • Backbone phosphate groups can be modified by replacing one or more of the oxygen atoms with a different substituent.
  • the modified nucleosides and nucleotides can include the wholesale replacement of an unmodified phosphate moiety with another internucleoside linkage.
  • modified phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters.
  • Phosphorodithioates have both non-linking oxygens replaced by sulfur.
  • the phosphate linker can also be modified by the replacement of a Unking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates).
  • Other modifications which may be used are taught in, for example, International Application NO. WO2013052S23, the contents of which are incorporated herein by reference in their entirety.
  • nucleotides or nucleobases of the polynucleotides of the invention which are useful in the present invention include any modified substitutes known in the art, for example, ( ⁇ )l-(2-Hydrox> ⁇ ropyl)pseudouridine TP, (2R)-l-(2- Hydroxypropyl)pseudouridine TP, l-(4-Methoxy-phenyl)pseudo-UTP, ,2'-0-dimethyladenosine, l,2'-0-dimethylguanosine, l,2'-0-dimethylinosine, 1-Hexyl-pseudo-UTP , 1- Homoallylpseudouridine TP, 1 -Hydroxymethy lpseudouridine TP, 1-iso-propyl-pseudo-UTP , 1- Me-2-thio
  • Polynucleotides of the present invention may comprise one or more of the
  • nucleotide analogs or other modification(s) may be located at any position(s) of a polynucleotide such that the function of the polynucleotide is not substantially decreased.
  • a modification may also be a 5' or 3' terminal modification.
  • the polynucleotide may contain from about 1% to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e.
  • any one or more of A, G, U or C) or any intervening percentage e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, fiom 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 90% to 100%, and from 95% to 100%
  • one or more codons of the polynucleotides of the present invention may be replaced with other codons encoding the native amino acid sequence to tune the expression of the SREs, through a process referred to as codon selection. Since mRNA codon, and tRNA anticodon pools tend to vary among organisms, cell types, sub cellular locations and overtime, the codon selection described herein is a spatiotemporal (ST) codon selection.
  • ST spatiotemporal
  • certain polynucleotide features may be codon optimized.
  • Codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cell by replacing at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons of the native sequence with codons that are most frequently used in the genes of that host cell while maintaining the native amino acid sequence.
  • Codon usage may be measured using the Codon Adaptation Index (CAI) which measures the deviation of a coding polynucleotide sequence from a reference gene set.
  • CAI Codon Adaptation Index
  • Codon usage tables are available at the Codon Usage Database (http://www.kazusa.or.jp/codon/) and the CAI can be calculated by EMBOSS CAI program (http://emboss.sourceforge.net/). Codon optimization methods are known in the art and may be useful in efforts to achieve one or more of several goals. These goals include to match codon frequencies in target and host organisms to ensure proper folding, bias nucleotide content to alter stability or reduce secondary structures, minimize tandem repeat codons or base runs that may impair gene construction or expression, customize transcriptional and translational control regions, insert or remove protein signaling sequences, remove/add post translation modification sites in encoded protein (e.g.
  • Codon optimization tools, algorithms and services are known in the art, and non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA), OptimumGene (GenScript,
  • a polynucleotide sequence or portion thereof is codon optimized using optimization algorithms. Codon options for each amino acid are well-known in the art as are various species table for optimizing for expression in that particular species.
  • certain polynucleotide features may be codon optimized.
  • a preferred region for codon optimization may be upstream (5') or downstream (3') to a region which encodes a polypeptide. These regions may be incorporated into the polynucleotide before and/or after codon optimization of the payload encoding region or open reading frame (ORF).
  • the polynucleotide components are reconstituted and transformed into a vector such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes.
  • Spatiotemporal codon selection may impact the expression of the polynucleotides of the invention, since codon composition determines the rate of translation of the mRNA species and its stability.
  • codon composition determines the rate of translation of the mRNA species and its stability.
  • tRNA anticodons to optimized codons are abundant, and thus translation may be enhanced.
  • tRNA anticodons to less common codons are fewer and thus translation may proceed at a slower rate.
  • Presnyak et al. have shown that the stability of an mRNA species is dependent on the codon content, and higher stability and thus higher protein expression may be achieved by utilizing optimized codons (Presnyak et al. (2015) Cell 160, 1111-1124; the contents of which are incorporated herein by reference in their entirety).
  • ST codon selection may include the selection of optimized codons to enhance the expression of the SRES, effector modules and biocircuits of the invention.
  • spatiotemporal codon selection may involve the selection of codons that are less commonly used in the genes of the host cell to decrease the expression of the compositions of the invention.
  • the ratio of optimized codons to codons less commonly used in the genes of the host cell may also be varied to tune expression.
  • certain regions of the polynucleotide may be preferred for codon selection.
  • a preferred region for codon selection may be upstream (5') or downstream (3') to a region which encodes a polypeptide. These regions may be incorporated into the polynucleotide before and/or after codon selection of the payload encoding region or open reading frame (ORF).
  • the stop codon of the polynucleotides of the present invention may be modified to include sequences and motifs to alter the expression levels of the SREs, payloads and effector modules of the present invention. Such sequences may be incorporated to induce stop codon readthrough, wherein the stop codon may specify amino acids e.g. selenocysteine or pyrrolysine. In other instances, stop codons may be skipped altogether to resume translation through an alternate open reading frame. Stop codon read through may be utilized to tune the expression of components of the effector modules at a specific ratio (e.g.as dictated by the stop codon context).
  • stop codon motifs examples include UGAN, UAAN, and UAGN, where N is either C or U.
  • Polynucleotide modifications and manipulations can be accomplished by methods known in the art such as, but not limited to, site directed mutagenesis and recombinant technology. The resulting modified molecules may then be tested for activity using in vitro or in vivo assays such as those described herein or any other suitable screening assay known in the art.
  • polynucleotides of the invention may comprise two or more effector module sequences, or two or more payloads of interest sequences, which are in a pattern such as ABABAB or AABBAABBAABB or ABCABCABC or variants thereof repeated once, twice, or more than three times.
  • a pattern such as ABABAB or AABBAABBAABB or ABCABCABC or variants thereof repeated once, twice, or more than three times.
  • each letter, A, B, or C represent a different effector module component.
  • polynucleotides of the invention may comprise two or more effector module component sequences with each component having one or more SRE sequences (DD sequences), or two or more payload sequences.
  • the sequences may be in a pattern such as ABABAB or AABBAABBAABB or ABCABCABC or variants thereof repeated once, twice, or more than three times in each of the regions.
  • the sequences may be in a pattern such as ABABAB or
  • each letter, A, B, or C represent a different sequence or component.
  • polynucleotides encoding distinct biocircuits, effector modules, SREs and payload constructs may be linked together through the 3'-end using nucleotides which are modified at the 3'-terminus. Chemical conjugation may be used to control the stoichiometry of delivery into cells. Polynucleotides can be designed to be conjugated to other polynucleotides, dyes, intercalating agents (e.g. acridines), cross-linkers (e.g.
  • psoralene mitomycin C
  • porphyrins TPPC4, texaphyrin, sapphyrin
  • polycyclic aromatic hydrocarbons e.g., phenazine, dihydrophenazine
  • artificial endonucleases e.g. EDTA
  • alkylating agents phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, (MPEG) 2 , polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g.
  • biotin e.g., aspirin, vitamin E, folic acid
  • transport/absorption facilitators e.g., aspirin, vitamin E, folic acid
  • synthetic ribonucleases proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell, hormones and hormone receptors, non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, or a drug. As non-limiting examples, they may be conjugates with other immune conjugates.
  • the compositions of the polynucleotides of the invention may be generated by combining the various components of the effector modules using the Gibson assembly method.
  • the Gibson assembly reaction consists of three isothermal reactions, each relying on a different enzymatic activity including a 5' exonuclease which generates long overhangs, a polymerase which fills in the gaps of the annealed single strand regions and a DNA ligase which seals the nicks of the annealed and filled-in gaps.
  • Polymerase chain reactions performed prior to Gibson assembly may be used to generate PCR products with overlapping sequence. These methods can be repeated sequentially, to assemble larger and larger molecules.
  • the method can comprise repeating the steps described as above to join a second set of two or more DNA molecules of interest to one another, and then repeating the method again to join the first and second set DNA molecules of interest, and so on.
  • the assembled DNA can be amplified by transforming it into a suitable microorganism, or it can be amplified in vitro (e.g., with PCR).
  • polynucleotides of the present invention may encode a fusion polypeptide comprising a destabilizing domain (DD) and at least one immunotherapeutic agent taught herein.
  • the DD domain may be a FKBP mutant encoded by nucleotide sequence of SEQ ID NOS. 60, 87-88, and/or 878-889, an ecDHFR mutant encoded by nucleotide sequence of SEQ ID NO. 61, 89, 90, and/or 869-877, hDHFR mutant encoded by nucleotide sequence of SEQ ID NO. 91-93, 182-192, SEQ ID NO. 797-832, and/or 890-905.
  • the polynucleotides of the invention may encode effector modules comprising IL2 as the payload comprising the nucleotide sequence of SEQ ID NO. 62- 64, or caspase 9 as the payload comprising the nucleotide sequence of SEQ ID NO. 94-102, or FOXP3 as the payload, comprising the nucleotide sequence of SEQ ID NO. 193-202 or luciferase as the payload comprising the nucleotide sequence of SEQ ID NO. 203-208, or BCMA CAR as the payload comprising the nucleotide sequence of SEQ ID NO. 833-835 or Her2 as the payload comprising the nucleotide sequence of 907.
  • cells genetically modified to express at least one biocircuit, SRE (e. g, DD), effector module and immunotherapeutic agent of the invention are provided.
  • Cells of the invention may include, without limitation, immune cells, stem cells and tumor cells.
  • immune cells are immune effector cells, including, but not limiting to, T cells such as CD8 + T cells and CD4 + T cells (e.g., Thl, Th2, Thl7 , Foxp3+ cells), memory T cells such as T memory stem cells, central T memory cells, and effector memory T cells, terminally differentiated effector T cells, natural killer (NK) cells, NK T cells, tumor infiltrating lymphocytes (TILs), cytotoxic T lymphocytes (CTLs), regulatory T cells (Tregs), and dendritic cells (DCs), other immune cells that can elicit an effector function, or the mixture thereof.
  • T cells may be ⁇ cells and ⁇ cells.
  • stem cells may be from human embryonic stem cells, mesenchymal stem cells, and neural stem cells.
  • T cells may be depleted endogenous T cell receptors (See US Pat. NOs. 9, 273, 283; 9, 181, 527; and 9,028, 812; the contents of each of which are incorporated herein by reference in their entirety).
  • cells of the invention may be autologous, allogeneic, syngeneic, or xenogeneic in relation to a particular individual subject.
  • cells of the invention may be mammalian cells, particularly human cells.
  • Cells of the invention may be primary cells or immortalized cell lines.
  • cells of the invention may be expanded using expansion factors to trigger proliferation and expansion of the cells.
  • expansion factors include RAS such as KRAS, NRAS, RRAS, RRAS2, MRAS, ERAS, and HRAS, DIRAS such as DIRAS1, DIRAS2, and DIRAS3, NKIRAS such as NKTRAS1, and NKIRAS2, RAL such as RALA, and RALB, RAP such as RAP1A, RAP1B, RAP2A, RAP2B, and RAP2C, RASD such as RASD1, and RASD2, RASL such as RASL10A, RASL10B, RASL11A, RASL11B, and RASL12, REM such as REMl, and REM2, GEM, RERG, RERGL, and RRAD.
  • RAS such as KRAS, NRAS, RRAS, RRAS2, MRAS, ERAS, and HRAS
  • DIRAS such as DIRAS1, DIRA
  • Engineered immune cells can be accomplished by transducing a cell compositions with a polypeptide of a biocircuit, an effector module, a SRE and/or a payload of interest (i.e., immunotherapeutic agent), or a polynucleotide encoding said polypeptide, or a vector comprising said polynucleotide.
  • the vector may be a viral vector such as a lentiviral vector, a gamma-retroviral vector, a recombinant AAV, an adenoviral vector and an oncolytic viral vector.
  • non-viral vectors for example, nanoparticles and liposomes may also be used.
  • immune cells of the invention are genetically modified to express at least one immunotherapeutic agent of the invention which is tunable using a stimulus.
  • two, three or more immunotherapeutic agents constructed in the same biocircuit and effector module are introduced into a cell.
  • two, three, or more biocircuits, effector modules, each of which comprises an immunotherapeutic agent may be introduced into a cell.
  • T cells expressing Chimeric antigen receptors or T cells receptors may be further modified to express another one, two, three or more immunotherapeutic agents of the present invention.
  • the immunotherapeutic agents may be another a cytokine such as IL2, IL12, IL15 and IL18; a regulatory switch; or a safety switch gene (e.g., a suicide gene) that kills activated T cells when a severe event is observed after adoptive cell transfer or when the transferred immune cells are no-longer needed.
  • a cytokine such as IL2, IL12, IL15 and IL18
  • a regulatory switch e.g., a regulatory switch gene
  • a safety switch gene e.g., a suicide gene
  • immune cells of the invention may be NK cells modified to express payloads of the invention.
  • NK cells are members of the innate lymphoid cell family and characterized in humans by expression of the phenotypic marker CD56 (neural cell adhesion molecule) in the absence of CD3 (T-cell co-receptor). NK cells are potent effector cells of the innate immune system which mediate cytotoxic attack without the requirement of prior antigen priming, forming the first line of defense against diseases including cancer malignancies and viral infection.
  • NK cells Several pre-clinical and clinical trials have demonstrated that adoptive transfer of NK cells is a promising treatment approach against cancers such as acute myeloid leukemia (Ruggeri et al., Science; 2002, 295: 2097-2100; and Geller et al., Immunotherapy, 2011, 3: 1445-1459).
  • NK cell activation is characterized by an array of receptors with activating and inhibitory functions.
  • the important activation receptors on NK cells include CD94/NKG2C and NKG2D (the C-type lectin-like receptors), and the natural cytotoxicity receptors (NCR) NKp30, NKp44 and NKp46, which recognize ligands on tumor cells or virally infected cells.
  • NK cell inhibition is essentially mediated by interactions of the polymorphic inhibitory killer cell immunoglobulin-like receptors (KIRs) with their cognate human-leukocyte-antigen (HLA) ligands via the alpha- 1 helix of the HLA molecule.
  • KIRs polymorphic inhibitory killer cell immunoglobulin-like receptors
  • HLA human-leukocyte-antigen
  • NK cells may be isolated from peripheral blood mononuclear cells (PBMCs), or derived from human embryonic stem (ES) cells and induced pluripotent stem cells (iPSCs).
  • PBMCs peripheral blood mononuclear cells
  • ES human embryonic stem
  • iPSCs induced pluripotent stem cells
  • the primary NK cells isolated from PBMCs may be further expanded for adoptive immunotherapy.
  • Strategies and protocols useful for the expansion of NK cells may include interleukin 2 (IL2) stimulation and the use of autologous feeder cells, or the use of genetically modified allogeneic feeder cells.
  • IL2 interleukin 2
  • NK cells can be selectively expanded with a combination of stimulating ligands including IL15, IL21, IL2, 41BBL, IL12, IL18, MICA, 2B4, LFA-1, and BCM1/SLAMF2 (e.g., US patent publication NO. US20150190471).
  • stimulating ligands including IL15, IL21, IL2, 41BBL, IL12, IL18, MICA, 2B4, LFA-1, and BCM1/SLAMF2 (e.g., US patent publication NO. US20150190471).
  • cells of the present invention may be dendritic cells that are genetically modified to express the compositions of the invention.
  • cells of the invention may be Treg cells.
  • Payloads of the invention may be used to promote the proliferation, survival, activation and /or function of T regulator ⁇ ' cells.
  • Tregs are a distinct population of cells that are positively selected on high affinity ligands in the thymus and play an important role in the tolerance to self-antigens.
  • T regs have also been shown to play a role in peripheral tolerance to foreign antigens.
  • the ability of Tregs to induce tolerance may be utilized to tune immune responses to the immunotherapeutic agents described herein. Methods for expanding Tregs for immunotherapy have been described by Tang et al, 2004, J. Exp. Med.
  • the present invention further provides pharmaceutical compositions comprising one or more biocircuits, effector modules, SREs (e.g., DDs), stimuli and payloads of interest (i.e., immunotherapeutic agents), vectors, cells and other components of the invention, and optionally at least one pharmaceutically acceptable excipient or inert ingredient.
  • SREs e.g., DDs
  • stimuli and payloads of interest i.e., immunotherapeutic agents
  • vectors i.e., cells and other components of the invention
  • optionally at least one pharmaceutically acceptable excipient or inert ingredient optionally at least one pharmaceutically acceptable excipient or inert ingredient.
  • the term "pharmaceutical composition” refers to a preparation of biocircuits, SREs, stimuli and payloads of interest (i.e., immunotherapeutic agents), other components, vectors, cells and described herein, or pharmaceutically acceptable salts thereof, optionally with other chemical components such as physiologically suitable carriers and excipients.
  • the pharmaceutical compositions of the invention comprise an effective amount of one or more active compositions of the invention.
  • the preparation of a pharmaceutical composition that contains at least one composition of the present invention and/or an additional active ingredient will be known to those skilled in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference.
  • excipient or “inert ingredient” refers to an inactive substance added to a pharmaceutical composition and formulation to further facilitate administration of an active ingredient.
  • active ingredient generally refers to any one or more biocircuits, effector modules, SREs, stimuli and payloads of interest (i.e., immunotherapeutic agents), other components, vectors, and cells to be delivered as described herein.
  • pharmaceutically acceptable refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate.
  • compositions and formulations are administered to humans, human patients or subjects. Although the descriptions of pharmaceutical
  • compositions provided herein are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g. non-human mammals.
  • Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, non-human mammals, including agricultural animals such as cattle, horses, chickens and pigs, domestic animals such as cats, dogs, or research animals such as mice, rats, rabbits, dogs and non-human primates. It will be understood that, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards.
  • a pharmaceutical composition and formulation in accordance with the invention may be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses.
  • a '"unit dose is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient.
  • the amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and/or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
  • compositions of the present invention may be formulated in any manner suitable for delivery.
  • the formulation may be, but is not limited to, nanoparticles, poly (lactic-co- glycolic acid) (PLGA) microspheres, lipidoids, lipoplex, liposome, polymers, carbohydrates (including simple sugars), canonic lipids and combinations thereof.
  • PLGA poly (lactic-co- glycolic acid)
  • the formulation is a nanoparticle which may comprise at least one lipid.
  • the lipid may be selected from, but is not limited to, DLin-DMA, DLin-K-DMA, 98N12- 5, C12-200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG and PEGylated lipids.
  • the lipid may be a cationic lipid such as, but not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA and DODMA.
  • the formulation may be selected from any of those taught, for example, in International Application PCT/US2012/069610, the contents of which are incorporated herein by reference in its entirety.
  • compositions in accordance with the invention will vary, depending upon the identity, size, and/or condition of the subject treated and further depending upon the route by which the composition is to be administered.
  • the composition may comprise between 0.1 and 100, e.g., between 0.5 and 50, between 1-30, between 5-80, at least 80 (w/w) active ingredient.
  • Efficacy of treatment or amelioration of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters.
  • compositions of the present invention "effective against” for example a cancer, indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as an improvement of symptoms, a cure, a reduction in disease load, reduction in tumor mass or cell numbers, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating the particular type of cancer.
  • a treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated.
  • a favorable change of at least 10 in a measurable parameter of disease, and preferably at least 20, 30, 40, 50 or more can be indicative of effective treatment.
  • Efficacy for a given composition or formulation of the present invention can also be judged using an experimental animal model for the given disease as known in the art. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant change is observed.
  • the compositions of the invention are administered by injection, e.g., intravenously.
  • the pharmaceutically acceptable carrier for the cells for injection may include any isotonic carrier such as, for example, normal saline (about 0.90% w/v of NaCl in water, about 300 mOsm/L NaCl in water, or about 9.0 g NaCl per liter of water),
  • NORMOSOL R electrolyte solution (Abbott, Chicago, IL), PLASMA- LYTE A (Baxter, Deerfield, IL), about 5% dextrose in water, or Ringer's lactate.
  • the pharmaceutically acceptable carrier may be supplemented with human serum albumen. Any of the carriers taught in WO2016149578A1 may be useful in the present invention. IV. APPLICATIONS
  • methods for reducing a tumor volume or burden comprise administering a pharmaceutically effective amount of a pharmaceutical composition comprising at least one biocircuit system, effector module, DD, and/or payload of interest (i.e., an immune-therapeutic agent), at least one vector, or cells to a subject having a tumor.
  • a pharmaceutical composition comprising at least one biocircuit system, effector module, DD, and/or payload of interest (i.e., an immune-therapeutic agent), at least one vector, or cells.
  • a pharmaceutical composition comprising at least one biocircuit system, effector module, DD, and/or payload of interest (i.e., an immune-therapeutic agent), at least one vector, or cells
  • immunotherapeutic agent as described herein may be in forms of a polypeptide, or a
  • polynucleotide such as mRNA, or a viral vector comprising the polynucleotide, or a cell modified to express the biocircuit, effector module, DD, and payload of interest (i.e., immunotherapeutic agent).
  • methods for inducing an anti-tumor immune response in a subject comprise administering a pharmaceutically effective amount of a pharmaceutical composition comprising at least one biocircuit system, effector module, DD, and/or payload of interest (i.e., an immunotherapeutic agent), at least one vector, or cells to a subject having a tumor.
  • a pharmaceutical composition comprising at least one biocircuit system, effector module, DD, and/or payload of interest (i.e., an immunotherapeutic agent), at least one vector, or cells to a subject having a tumor.
  • the biocircuit and effector module having any immunotherapeutic agent as described herein may be in forms of a polypeptide, or a
  • polynucleotide such as mRNA, or a viral vector comprising the polynucleotide, or a cell modified to express the biocircuit, effector module, DD, and payload of interest (i.e., immunotherapeutic agent).
  • the methods may be adoptive cell transfer (ACT) using genetically engineered cells such as immune effector cells of the invention, cancer vaccines comprising biocircuit systems, effector modules, DDs, payloads of interest (i.e., immunotherapeutic agents) of the invention, or compositions that manipulate the tumor immunosuppressive microenvironment, or the combination thereof.
  • ACT adoptive cell transfer
  • cancer vaccines comprising biocircuit systems, effector modules, DDs, payloads of interest (i.e., immunotherapeutic agents) of the invention, or compositions that manipulate the tumor immunosuppressive microenvironment, or the combination thereof.
  • compositions that manipulate the tumor immunosuppressive microenvironment, or the combination thereof.
  • the safety switches described herein may be useful in the treatment of diseases of protein proliferation and/or protein aggregation e.g. renal diseases and/or neurological diseases such as Alzheimer's diseases, prior diseases etc.
  • safety switches of the present invention may be expressed in phagocytic cells that are engineered to target aggregated proteins such as amyloid proteins, wherein the safety switches described herein may be used to eliminate the phagocytic cells after the clearance of the aggregated proteins. 1.
  • Adoptive cell transfer (adoptive immunotherapy)
  • cells which are genetically modified to express at least one biocircuit system, effector module, DD, and/or payload of interest may be used for adoptive cell therapy (ACT).
  • adoptive cell therapy adoptive cell therapy
  • adoptive cell transfer refers to the administration of immune cells (from autologous, allogenic or genetically modified hosts) with direct anticancer activity.
  • ACT has shown promise in clinical application against malignant and infectious disease.
  • T cells genetically engineered to recognize CD19 have been used to treat follicular B cell lymphoma (Kochenderfer et al., Blood, 2010, 116:4099-4102; and Kochenderfer and Rosenberg, Nat Rev Clin Oncol, 2013, 10(5): 267-276) and ACT using autologous lymphocytes genetically-modified to express anti-tumor T cell receptors has been used to treat metastatic melanoma (Rosenberg and Dudley, Curr. Opin. Immunol. 2009, 21 : 233- 240).
  • the biocircuits and systems may be used in the development and implementation of cell therapies such as adoptive cell therapy.
  • Certain effector modules useful in cell therapy are given in Figures 7-12.
  • the biocircuits, their components, effector modules and their SREs and payloads may be used in cell therapies to regulate epitope tagged receptors, in APC platforms for stimulating T cells, as a tool to enhance ex vivo APC stimulation, to improve methods of T cell expansion, in ex vivo stimulation with antigen, in TCR/CAR combinations, in the manipulation or regulation of TILs, in allogeneic cell therapy, in combination T cell therapy with other treatment lines (e.g. radiation, cytokines).
  • other treatment lines e.g. radiation, cytokines
  • the methods involve preconditioning a subject in need thereof, modulating immune cells with SRE, biocircuits and compositions of the present invention, administering to a subject, engineered immune cells expressing compositions of the invention and the successful engraftment of engineered cells within the subject.
  • SREs, biocircuits and compositions of the present invention may be used to minimize preconditioning regimens associated with adoptive cell therapy.
  • preconditioning refers to any therapeutic regimen administered to a subject to improve the outcome of adoptive cell therapy.
  • Preconditioning strategies include, but are not limited to total body irradiation and/or lymphodepleting chemotherapy. Adoptive therapy clinical trials without preconditioning have failed to demonstrate any clinical benefit, indicating its importance in ACT. Yet, preconditioning is associated with significant toxicity and limits the subject cohort that is suitable for ACT.
  • immune cells for ACT may be engineered to express cytokines such as IL2 as payload using SREs of the present invention to reduce the need for preconditioning.
  • immune cells for ACT may be dendritic cells, T cells such as CD8 + T cells and CD4 + T cells, natural killer (NK) cells, NK T cells, Cytotoxic T lymphocytes (CTLs), tumor infiltrating lymphocytes (TILs), lymphokine activated killer (LAK) cells, memory T cells, regulatory T cells (Tregs), helper T cells, cytokine-induced killer (CIK) cells, and any combination thereof.
  • immune stimulatory cells for ACT may be generated from embryonic stem cell (ESC) and induced pluripotent stem cell (iPSC).
  • ESC embryonic stem cell
  • iPSC induced pluripotent stem cell
  • autologous or allogeneic immune cells are used for ACT.
  • NK cells engineered to express the present compositions may be used for ACT.
  • NK cell activation induces peiforin/granzyme-dependent apoptosis in target cells.
  • NK cell activation also induces cytokine secretion such as IFN-y, TNF-a and GM-CSF.
  • cytokine secretion such as IFN-y, TNF-a and GM-CSF.
  • NK cells may also be genetically reprogrammed to circumvent NK cell inhibitory signals upon interaction with tumor cells.
  • CRISPR, ZFN, or TALEN to genetically modify NK cells to silence their inhibitory receptors may enhance the anti-tumor capacity of NK cells.
  • Immune cells can be isolated and expanded ex vivo using a variety of methods known in the art. For example, methods of isolating and expanding cytotoxic T cells are described in U.S. Pat. NOs. 6,805,861 and 6,531, 451; US Patent Publication NOs. US20160348072A1 and International Patent Publication NO. WO2016168595A1; the contents of each of which are incorporated herein by reference in their entirety. Isolation and expansion of NK cells is described in US Patent Publication NOS. US20150152387A1, U.S. Patent NOS. 7,435, 596; and Oyer, J.L. (2016).
  • human primary NK cells may be expanded in the presence of feeder cells e.g. a myeloid cell line that has been genetically modified to express membrane bound IL15, IL21, IL12 and 4-1BBL.
  • feeder cells e.g. a myeloid cell line that has been genetically modified to express membrane bound IL15, IL21, IL12 and 4-1BBL.
  • sub populations of immune cells may be enriched for ACT.
  • Methods for immune cell enrichment are taught in International Patent Publication NOS.
  • T cells positive for B and T lymphocyte attenuator marker BTLA may be used to enrich for T cells that arc anti-cancer reactive as described in U.S. Pat. NOS. 9,512,401 (the content of each of which are incorporated herein by reference in their entirety).
  • immune cells for ACT may be depleted of select sub populations to enhance T cell expansion.
  • immune cells may be depleted of Foxp3+ T lymphocytes to minimize the ant-tumor immune response using methods taught in US Patent Publication NOS. US 20160298081A1; the contents of which are incorporated by reference herein in their entirety.
  • immune cells may be enriched for FOXP3+ cells to enrich for T cells that are critical for immune tolerance to reduce graft versus host disease.
  • activation and expansion of T cells for ACT is achieved antigenic stimulation of a transiently expressed Chimeric Antigen Receptor (CAR) on the cell surface.
  • CAR Chimeric Antigen Receptor
  • immune cells may be activated by antigens associated with antigen presenting cells (APCs).
  • the APCs may be dendritic cells, macrophages or B cells that antigen specific or nonspecific.
  • the APCs may autologous or homologous in their organ.
  • the APCs may be artificial antigen presenting cells (aAPCs) such as cell based aAPCs or acellular aAPCs.
  • aAPCs artificial antigen presenting cells
  • Cell based aAPCs are may be selected from either genetically modified allogeneic cells such as human erythroleukemia cells or xenogeneic cells such as murine fibroblasts and Drosophila cells.
  • the APCs maybe be acellular wherein the antigens or costimulatory domains are presented on synthetic surfaces such as latex beads, polystyrene beads, lipid vesicles or exosomes.
  • cells of the invention may be expanded using artificial cell platforms.
  • the mature T cells may be generated using artificial thymic organoids (ATOs) described by Seet CS et al. 2017. Nat Methods. 14, 521-530 (the contents of which are incorporated herein by reference in their entirety).
  • ATOs are based on a stromal cell line expressing delta like canonical notch ligand (DLL1).
  • DLL1 delta like canonical notch ligand
  • stromal cells are aggregated with hematopoietic stem and progenitor cells by centrifugation and deployed on a cell culture insert at the air-fluid interface to generate organoid cultures.
  • ATO-derived T cells exhibit naive phenotypes, a diverse T cell receptor (TCR) repertoire and TCR-dependent function.
  • TCR T cell receptor
  • the T cells of the invention may be separated from peripheral blood by a process known as apheresis, which separates lymphocytes from plasma, platelets and RBCs, and granulocytes. Lymphocyte in peripheral blood cells may further be separated from monocytes using a semi-automated elutriation device. T cells may also be enriched by magnetic selection with anti CD3/CD28 beads. In one embodiment, an additional step of using a plastic adherent surface to deplete monocytes from the PBMCs may be utilized. Methods of T cell enrichment are disclosed in Stroncek DF et al. (2017) Journal of Translational Medicine.15:59; the contents of which are incorporated by reference in its entirety.
  • adoptive cell therapy is carried out by autologous transfer, wherein the cells are derived from a subject in need of a treatment and the cells, following isolation and processing are administered to the same subject.
  • ACT may involve allogenic transfer wherein the cells are isolated and/or prepared from a donor subject other than the recipient subject who ultimately receives cell therapy.
  • the donor and recipient subject may be genetically identical, or similar or may express the same HLA class or subtype.
  • the multiple immune-therapeutic agents introduced into the immune cells for ACT may be controlled by the same biocircuit system.
  • a cytokine such as IL2 and a Caspase 9 are linked to the same hDHFR destabilizing domain. The expression of 1L2 and Caspase 9 is tuned using TMP simultaneously.
  • the multiple immunotherapeutic agents introduced into the immune cells for ACT may be controlled by different biocircuit systems.
  • a cytokine such as IL2 and Caspase 9 constructs are linked to different DDs in two separate effector modules, and can be tuned separately using different stimuli.
  • a suicide gene and a CAR construct may be linked to two separate effector modules.
  • biocircuits and compositions of the invention are administered to the subject in need thereof.
  • Methods for administration of cells for adoptive cell therapy are known and may be used in connection with the provided methods and compositions.
  • adoptive T cell therapy methods are described, e.g., in US Patent Application Publication No. 2003/0170238 to Gruenberg et al; US Patent No.
  • immune cells for ACT may be modified to express one or more immunotherapeutic agents which facilitate immune cells activation, infiltration, expansion, survival and anti-tumor functions.
  • immune cells used for adoptive cell transfer can be genetically manipulated to improve their persistence, cytotoxicity, tumor targeting capacity, and ability to home to disease sites in vivo, with the overall aim of further improving upon their capacity to kill tumors in cancer patients.
  • One example is to introduce effector modules of the invention comprising cytokines such as gamma-cytokines (IL2) into immune cells to promote immune cell proliferation and survival.
  • cytokine genes e.g., gamma-cytokines IL2
  • Transduction of cytokine genes e.g., gamma-cytokines IL2
  • IL2 gamma-cytokines
  • T cell exhaustion refers to the stepwise and progressive loss of T cell function caused by chronic T cell activation. T cell exhaustion is a major factor limiting the efficacy of antiviral and antitumor immunotherapies. Exhausted T cells have low proliferative and cytokine producing capabilities concurrent with high rates of apoptosis and high surface expression of multiple inhibitory receptors. T cell activation leading to exhaustion may occur either in the presence or absence of the antigen.
  • effector modules of the present invention useful for immunotherapy may be placed under the transcriptional control of the T cell receptor alpha locus constant (TRAC) locus in the T cells.
  • TRAC T cell receptor alpha locus constant
  • Eyquem et al. have shown that expression of the CAR from the TRAC locus prevents T cell exhaustion and the accelerated differentiation of T cells caused by excessive T cell activation (Eyquem J. et al (2017) Nature.543(7643): 113-117; the contents of which are incorporated herein by reference in their entirety).
  • payloads of the invention may be used in conjunction with antibodies or fragments that target T cell surface markers associated with T cell exhaustion.
  • T- cell surface markers associated with T cell exhaustion include, but are not limited to, CTLA-1, PD-1, TG1T, LAG-3, 2B4, BTLA, TIM3, VISTA, and CD96.
  • T cells that are specific to certain tumor antigens may be subject to chronic antigen exposure. Persistent antigen expression can lead to immune check-point expression, which in turn, induces a state of exhaustion among cognate antigen specific T cells. Constant expression of the chimeric antigen receptors of the invention may result in chronic interaction with the antigen, which leads to exhaustion.
  • the compositions disclosed herein may be used to prevent T cell exhaustion by modulating surface CAR expression using the stimulus specific to the invention.
  • the SREs of the present invention may be used to achieve pulsatile expression of the compositions of the invention.
  • pulsatile refers to a plurality of payload expression at spaced apart time intervals.
  • the expression of the payload is increased causing the first pulse; following the withdrawal of the stimulus, the expression of the payload decreases and this represents the interval time between the first exposure and the next exposure to the stimulus, after which the second exposure to the stimulus is initiated.
  • the effector module includes a stimulus response element (SRE) operably linked to at least one immunotherapeutic agent, such that the SRE responds to a stimulus and tunes the expression and/or function of the immunotherapeutic agent, thereby preventing or reversing T cell exhaustion.
  • the immunotherapeutic agent may be a chimeric antigen receptor. Examples of chimeric antigen receptors include, but are not limited to GD2 CAR, BCMA CAR, CD33 CAR, Her2 CAR, ALK CAR, CD22 CAR, or a CD276 CAR.
  • the CAR may be a bispecific CAR comprising an extracellular domain which recognizes at least one antigen such as GD2, BCMA, CD33, Her2, ALK, CD22 or a CD276.
  • the methods described herein may include pulsatile expression of the compositions of the invention to prevent T cell exhaustion. In some instances, T cell exhaustion may be reversed by the addition of the stimulus. In other instances, T cell exhaustion may be reversed by the withdrawal of the stimulus.
  • compositions of the present invention may be utilized to alter TIL (tumor infiltrating lymphocyte) populations in a subject.
  • any of the payloads described herein may be utilized to change the ratio of CD4 positive cells to CD8 positive populations.
  • TILs may be sorted ex vivo and engineered to express any of the cytokines described herein. Payloads of the invention may be used to expand CD4 and/or CD8 populations of TILs to enhance TIL mediated immune response.
  • biocircuits, effector modules, payloads of interest are biocircuits, effector modules, payloads of interest
  • immunotherapeutic agents may be used in conjunction with cancer vaccines.
  • dendritic cells are modified to express the compositions of the invention and used as cancer vaccines.
  • cancer vaccine may comprise peptides and/or proteins derived from tumor associated antigen (TAA).
  • TAA tumor associated antigen
  • Such strategies may be utilized to evoke an immune response in a subject, which in some instances may be a cytotoxic T lymphocyte (CTL) response.
  • CTL cytotoxic T lymphocyte
  • Peptides used for cancer vaccines may also be modified to match the mutation profile of a subject. For example, EGFR derived peptides with mutations matched to the mutations found in the subject in need of therapy have been successfully used in patients with lung cancer (Li F et al. (2016) Oncoimmunology. Oct 7;5(12): el238539; the contents of which are incorporated herein by reference in their entirety).
  • cancer vaccines of the present invention may superagonist altered peptide ligands (APL) derived from TAAs. These are mutant peptide ligands deviate from the native peptide sequence by one or more amino acids, which activate specific CTL clones more effectively than native epitopes. These alterations may allow the peptide to bind better to the restricting Class I MHC molecule or interact more favorably with the TCR of a given tumor- specific CTL subset.
  • APLs may be selected using methods taught in US Patent Publication NOS. US20160317633A1, the contents of which arc incorporated herein by reference in their entirety.
  • WTl hematopoietic stem cell transplantation
  • the Wilm's tumor (WTl) gene product is a tumor associated antigen that is expressed in acute leukemia and other hematological malignancies, with limited expression in normal tissues.
  • the compositions of the present invention may be co-administered with donor derived WTl peptide loaded dendritic cell vaccine to prevent relapse of disease following immunotherapy (Shah NN et al. (2016) Biol Blood Marrow Transplant. 22(12):2149-215; the contents of which are incorporated herein by reference in their entirety.
  • compositions, vectors and cells of the invention for administration to a subject.
  • Compositions of the invention comprising different immunotherapeutic agents may be used in combination or in conjunction with known immunotherapeutic agents for enhancement of immunotherapy.
  • compositions of the invention with adjuvants, that can enhance the potency and longevity of antigen-specific immune responses.
  • adjuvants used as immunostimulants in combination therapy include biological molecules or delivery carriers that deliver antigens.
  • the compositions of the invention may be combined with biological adjuvants such as cytokines, Toll Like Receptors, bacterial toxins, and/or saponins.
  • the compositions of the present invention may be combined with delivery carriers.
  • Exemplary delivery carriers include, polymer microspheres, immune stimulating complexes, emulsions (oil-in-water or water-in-oil), aluminum salts, liposomes and virosomes.
  • immune effector cells modified to express biocircuits, effector modules, DDs and payloads of the invention may be combined with the biological adjuvants described herein.
  • immune effector cells modified to expressed biocircuits, effector modules, DDs and payloads of the invention may be combined with cancer vaccines.
  • an effector module comprising a cytokine may be used in combination with an effector module encoding a safety switch or a regulatory switch.
  • methods of the invention may include combination of the compositions of the invention with other agents effective in the treatment of cancers, infection diseases and other immunodeficient disorders, such as anti-cancer agents.
  • anti-cancer agent refers to any agent which is capable of negatively affecting cancer in a subject, for example, by killing cancer cells, inducing apoptosis in cancer cells, reducing the growth rate of cancer cells, reducing the incidence or number of metastases, reducing tumor size, inhibiting tumor growth, reducing the blood supply to a tumor or cancer cells, promoting an immune response against cancer cells or a tumor, preventing or inhibiting the progression of cancer, or increasing the lifespan of a subject with cancer.
  • anti-cancer agent or therapy may be a chemotherapeutic agent, or radiotherapy, immunotherapeutic agent, surgery, or any other therapeutic agent which, in combination with the present invention, improves the therapeutic efficacy of treatment.
  • compositions of the present invention may be used in combination with immunotherapeutics other than the inventive therapy described herein, such as antibodies specific to some target molecules on the surface of a tumor cell.
  • Exemplar ⁇ ' chemotherapies include, without limitation, Acivicin; Aclarubicin;
  • Acodazole hydrochloride Acronine; Adozelesin; Aldesleukin; Altretamine; Ambomycin;
  • HMM hexamethylmelamine
  • alkyl sulfonates such as busulfan
  • triazines such as dacarbazine (DTIC)
  • antimetabolites including folic acid analogs such as methotrexate and trimetrexate, pyrrolidine analogs such as 5- fluorouracil, fluorodeoxyuridine, gemcitabine, cytosine arabinoside (AraC, cytarabine), 5-azacytidine, 2,2'- difluorodeoxycytidine, purine analogs such as 6-mercaptopurine, 6-thioguanine, azathioprine, 2'-deoxycoformycin
  • pentostatin erythrohydroxy-nonyladenine (EHNA), fludarabine phosphate, and 2- chlorodeoxyadenosine (cladribine, 2- CdA); natural products including antimitotic drugs such as paclitaxel, vinca alkaloids including vinblastine (VLB), ⁇ incristine, and vinorelbine, taxotere, estramustine, and estramustine phosphate; epipodophylotoxins such as etoposide and teniposide; antibiotics, such as actimomycin D, daunomycin (rubidomycin), doxorubicin, mitoxantrone, idarubicin, bleomycins, plicamycin (mithramycin), mitomycinC, and actinomycin; enzymes such as L-asparaginase, cytokines such as interferon (IFN)-gamma, tumor necrosis factor (TNF)- alpha, TNF-beta and
  • Radiotherapeutic agents and factors include radiation and waves that induce DNA damage for example, ⁇ -irradiation, X-rays, UV-irradiation, microwaves, electronic emissions, radioisotopes, and the like. Therapy may be achieved by irradiating the localized tumor site with the above described forms of radiations. It is most likely that all of these factors effect a broad range of damage DNA, on the precursors of DNA, the replication and repair of DNA, and the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 weeks), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.
  • the chemotherapeutic agent may be an immunomodulatory agent such as lenalidomide (LEN).
  • LEN lenalidomide
  • anti-tumor antibodies include tociUzumab, siltuximab.
  • compositions of the invention may also include, but not limited to, agents that affect the upregulation of cell surface receptors and their ligands such as Fas/Fas ligand, DR4 or DR5/TRAIL and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion such as focal adhesion kinase (FAKs) inhibitors and Lovastatin, or agents that increase the sensitivity of the hyper proliferative cells to apoptotic inducers such as the antibody C225.
  • agents that affect the upregulation of cell surface receptors and their ligands such as Fas/Fas ligand, DR4 or DR5/TRAIL and GAP junctions
  • cytostatic and differentiation agents such as focal adhesion kinase (FAKs) inhibitors and Lovastatin
  • FAKs focal adhesion kinase
  • Lovastatin agents that increase the sensitivity of the hyper proliferative cells to apoptotic inducers such as the antibody C225
  • the combinations may include administering the compositions of the invention and other agents at the same time or separately.
  • the present immunotherapy may precede or follow the other agent/therapy by intervals ranging from minutes, days, weeks to months.
  • CAR-T cells of the invention may be co-administered with retinoids to eradicate myeloid derived suppressor cells.
  • Myeloid-derived suppressor cells are a heterogeneous population of early myeloid progenitors, immature granulocytes, macrophages, and dendritic cells at different stages of differentiation. MDSCs have the capacity to suppress both the cytotoxic activities of natural killer (NK) and NKT cells, and the adaptive immune response mediated by CD4+ and CD8+ T cells.
  • NK natural killer
  • CD8+ and CD8+ T cells CD4+ and CD8+ T cells.
  • Adjuvant therapy refers to the treatment that is given in addition to primary therapy to kill any cancer cells, even if the cancer is undetectable by standard laboratory tests. Experimental data have demonstrated that the lymphocyte depletion induced by cytotoxic regimens for the treatment of cancer could contribute to relapse. Relapse to cancer
  • adjuvant therapy may include the co-administration of recombinant human Interleukin2 in conjunction with dendritic cells pulsed with peptides derived from tumor cells.
  • Interleukin 7 may also be coadministered as immunotherapy.
  • the risk of reinfusing donor- derived tumor cells may be purged with monoclonal antibody 8H9, which interacts with tumor cell surface antigens. Any of the adjuvant therapy methods taught in Merchant et al. (2016), Clin Cancer Res. 1;22(13):3182-91 may be utilized (the contents of which are incorporated by reference in their entirety).
  • compositions of the invention can be combined with CXCR2 inhibitors or anti - CXCR2 antibodies.
  • a method of reducing a tumor volume or burden in a subject in need comprising introducing into the subject a composition of the invention.
  • the present invention also provides methods for treating a cancer in a subject, comprising administering to the subject an effective amount of an immune effector cell genetically modified to express at least one effector module of the invention.
  • cancers may be treated with pharmaceutical compositions, biocircuits, biocircuit components, effector modules including their SREs or payloads of the present invention.
  • cancer refers to any of various malignant neoplasms characterized by the proliferation of anaplastic cells that tend to invade surrounding tissue and metastasize to new body sites and also refers to the pathological condition characterized by such malignant neoplastic growths.
  • Cancers may be tumors or hematological malignancies, and include but are not limited to, all types of lymphomas/leukemias, carcinomas and sarcomas, such as those cancers or tumors found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon/rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovaries, pancreas, penis, prostate, skin, small intestine, stomach, spinal marrow, tailbone, testicles, thyroid and uterus.
  • lymphomas/leukemias such as those cancers or tumors found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon/rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (ches
  • Types of carcinomas which may be treated with the compositions of the present invention include, but are not limited to, papilloma/carcinoma, choriocarcinoma, endodermal sinus tumor, teratoma, adenoma/adenocarcinoma, melanoma, fibroma, lipoma, leiomyoma, rhabdomyoma, mesothelioma, angioma, osteoma, chondroma, glioma, lymphoma/leukemia, squamous cell carcinoma, small cell carcinoma, large cell undifferentiated carcinomas, basal cell carcinoma and sinonasal undifferentiated carcinoma.
  • Types of carcinomas which may be treated with the compositions of the present invention include, but are not limited to, soft tissue sarcoma such as alveolar soft part sarcoma, angiosarcoma, dermatofibrosarcoma, desmoid tumor, desmoplastic small round cell tumor, extraskeletal chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, hemangiopericytoma, hemangiosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangiosarcoma, lymphosarcoma, malignant fibrous histiocytoma, neurofibrosarcoma, rhabdomyosarcoma, synovial sarcoma, and Askin's tumor, Ewing's sarcoma (primitive neuroectodermal tumor), malignant hemangioendothelioma, malignant schwannoma, osteos
  • the carcinoma which may be treated may be Acute granulocytic leukemia, Acute lymphocytic leukemia, Acute myelogenous leukemia,
  • Adenocarcinoma, Adenosarcoma, Adrenal cancer Adrenocortical carcinoma, Anal cancer, Anaplastic astrocytoma, Angiosarcoma, Appendix cancer, Astrocytoma, Basal cell carcinoma, B-Cell lymphoma ), Bile duct cancer, Bladder cancer, Bone cancer, Bowel cancer, Brain cancer, Brain stem glioma, Brain tumor, Breast cancer, Carcinoid tumors, Cervical cancer,
  • Intrahepatic bile duct cancer Intrahepatic bile duct cancer, Invasive / infiltrating breast cancer, Islet cell cancer, Jaw cancer, Kaposi sarcoma, Kidney cancer, Laryngeal cancer, Leiomyosarcoma, Leptomeningeal metastases, Leukemia, Lip cancer, Liposarcoma, Liver cancer, Lobular carcinoma in situ, Low-grade astrocytoma, Lung cancer, Lymph node cancer, Lymphoma, Male breast cancer, Medullary carcinoma, Medulloblastoma, Melanoma, Meningioma, Merkel cell carcinoma, Mesenchymal chondrosarcoma,
  • Soft tissue sarcoma Spinal cancer, Spinal column cancer, Spinal cord cancer.
  • Spinal tumor Squamous cell carcinoma, Stomach cancer, Synovial sarcoma, T-cell lymphoma ), Testicular cancer, Throat cancer, Thymoma / thymic carcinoma, Thyroid cancer, Tongue cancer, Tonsil cancer, Transitional cell cancer, Transitional cell cancer, Transitional cell cancer, Triple- negative breast cancer, Tubal cancer.
  • Tubular carcinoma Ureteral cancer, Ureteral cancer.
  • Urethral cancer Uterine adenocarcinoma
  • Uterine cancer Uterine sarcoma
  • Vaginal cancer Vaginal cancer
  • Vulvar cancer Vulvar cancer
  • the CARs of the present invention may be a CAR useful in the treatment of multiple myeloma such as a CS1 CAR, a CD38 CAR, a CD138 CAR, and a BCMA CAR.
  • the CARs of the present invention may be a CAR useful in the treatment of acute myeloid leukemia such as a CD33 CAR, a CD123 CAR, and a CLL1 CAR.
  • the CARs of the present invention may be a CAR useful in the treatment of T cell leukemia such as a CDS CAR, and a CD7 CAR.
  • the CARs of the present invention may be a CAR useful in the treatment of solid tumors such a mesothelin CAR, a GD2 CAR, a GPC3 CAR, a Her2 CAR, an EGFR CAR, a Mucl CAR, an EpCAM CAR, a PD- Ll CAR, a CEA CAR, a Mucl6 CAR, a CD133 CAR, a CD171 CAR, a CD70 CAR, a CLD18 CAR, a cMET CAR, a EphA2 CAR, a FAP CAR, a Folate Receptor CAR, an ILl 3Ra2 CAR, an MG7 CAR, a PSMA CAR, a ROR1 CAR, and a VEGFR2 CAR.
  • a CAR useful in the treatment of solid tumors such a mesothelin CAR, a GD2 CAR, a GPC3 CAR,
  • biocircuits of the invention may be used for the treatment of infectious diseases.
  • Biocircuits of the invention may be introduced in cells suitable for adoptive cell transfer such as macrophages, dendritic cells, natural killer cells, and or T cells.
  • Infectious diseases treated by the biocircuits of the invention may be diseases caused by viruses, bacteria, fungi, and/or parasites.
  • IL15-IL15Ra payloads of the invention may be used to increase immune cell proliferation and/or persistence of the immune cells useful in treating infectious diseases.
  • 'Infection diseases refer to diseases caused by any pathogen or agent that infects mammalian cells, preferably human cells and causes a disease condition. Examples thereof include bacteria, yeast, fungi, protozoans, mycoplasma, viruses, prions, and parasites.
  • Examples include those involved in (a) viral diseases such as, for example, diseases resulting from infection by an adenovirus, a herpesvirus (e.g., HSV-I, HSV-II, CMV, or VZV), a poxvirus (e-g-, an orthopoxvirus such as variola or vaccinia, or molluscum contagiosum), a picornavirus (e.g., ihinovirus or enterovirus), an orthomyxovirus (e.g., influenzavirus), a paramyxovirus (e.g., parainfluenza virus, mumps virus, measles virus, and respiratory syncytial virus (RSV)), a coronavirus (e.g., SARS), a papovavirus (e.g., papillomaviruses, such as those that cause genital warts, common warts, or plantar warts), a hepadnavirus (e.g.,
  • Campylobacter Vibrio, Serratia, Providencia, Chromobacierium, Brucella, Yersinia,
  • Haemophilus, or Bordetella other infectious diseases, such chlamydia, fungal diseases including but not limited to candidiasis, aspergillosis, histoplasmosis, cryptococcal meningitis, parasitic diseases including but not limited to malaria, Pneumocystis camii pneumonia, leishmaniasis, cryptosporidiosis, toxoplasmosis, and trypanosome infection and prions that cause human disease such as Creutzfeldt-Jakob Disease (CJD), variant Creutzfeldt- Jakob Disease (vCJD), Gerstmann-Straiissler-Scheinker syndrome, Fatal Familial Insomnia and kuru.
  • CJD Creutzfeldt-Jakob Disease
  • vCJD variant Creutzfeldt- Jakob Disease
  • Gerstmann-Straiissler-Scheinker syndrome Fatal Familial Insomnia and kuru.
  • Microbiome A diverse community of symbiotic, commensal and pathogenic microorganisms exist in all environmentally exposed sites in the body and is herein referred to as the "Microbiome.”
  • Environmentally exposed sites of the body that may be inhabited by a microbiome include the skin, nasopharynx, the oral cavity, the respiratory tract, the gastrointestinal tract, and the reproductive tract.
  • microbiome native or engineered with immunotherapeutic agents may be used to improve the efficacy of the anti-cancer immunotherapies.
  • Methods of using microbiome to improve responsive to immunotherapeutic agents have been described by Sivan et al. (Sivan A., et al.2015. Science; 350:1084-9; the contents of which are incorporated herein by reference in their entirety).
  • the microorganisms may be delivered along with immunotherapeutic compositions of the present invention to improve the efficacy of immunotherapy.
  • a therapeutic agent that may be used in generating immunotherapeutics for reducing a tumor volume or burden in a subject in need.
  • a considerable number of variables are involved in producing a therapeutic agent, such as structure of the payload, types of cell, methods of gene transfer, method and time of ex vivo expansion, preconditioning and the amount and type of tumor burden in the subject.
  • Such parameters may be optimized using tools and agents described herein.
  • Suitable mammalian cells include primary cells and immortalized cell lines.
  • Suitable mammalian cell lines include, but are not limited to Human embryonic kidney cell line 293, fibroblast cell line NIH 3T3, human colorectal carcinoma cell line HCT116, ovarian carcinoma cell line SKOV-3, immortalized T cell lines Jurkat cells and SupTl cells, lymphoma cell line Raji cells, NALM-6 cells, K562 cells, HeLa cells, PC12 cells, HL-60 cells, NK cell lines (e.g., NKL, NK92, NK962, and YTS), REH, SEM, KOPN8, Daudi, Raji, and the like.
  • the cell is not an immortalized cell line, but instead a cell obtained from an individual and is herein referred to as a primary cell.
  • the cell is a T lymphocyte obtained from an individual.
  • Other examples include, but are not limited to cytotoxic cells, stem cells, peripheral blood mononuclear cells or progenitor cells obtained from an individual.
  • the compositions of the invention may be desirable to track the compositions of the invention or the cells modified by the compositions of the invention. Tracking may be achieved by using payloads such as reporter moieties, which, as used herein, refers to any protein capable of creating a detectable signal, in response to an input. Examples include alkaline phosphatase, ⁇ - galactosidase, chloramphenicol acetyltransferase, ⁇ glucuronidase, peroxidase, ⁇ -lactamase, catalytic antibodies, bioluminescent proteins e.g. luciferase, and fluorescent proteins such as Green fluorescent protein (GFP).
  • GFP Green fluorescent protein
  • Reporter moieties may be used to monitor the response of the DD upon addition of the ligand corresponding to the DD. In other instances, reporter moieties may be used to track cell survival, persistence, cell growth, and/or localization in vitro, in vivo, or ex vivo.
  • the preferred reporter moiety may be luciferase proteins.
  • the reporter moiety is the Renilla luciferase, or a firefly luciferase.
  • Table 14 provides the sequences of the reporter moieties.
  • the amino acid sequences in Table 14 may comprise a stop codon which is denoted in the table with a "*" at the end of the amino acid sequence
  • compositions of the present invention may be tested in vivo animal models, preferably mouse models.
  • Mouse models used to may be syngeneic mouse models wherein mouse cells are modified with compositions of the invention and tested in mice of the same genetic background. Examples include pMEL-1 and 4T1 mouse models.
  • Immunodeficient mice used may be CByJ.Cg-Foxnl""/;, B6;l29S7-Ragl mlMom /i, B6.l29S7-Ragl tmlMom /J, B6. CBn-Prkd ⁇ /SzJ, KOO.l29S7(B6)-Ragl lMom /J, ' NOO.Cg-Ragl' mlMom Prfl' mISd z/Sz,
  • NOD.CB17- nWWSzJ ⁇ KOO.Cg-Prkdc scid B2m' mlUnc /J, NOD-ic/tf IL2Rg I,un , Nude (nu) mice, SCID mice, NOD mice, RAG1/RAG2 mice, NOD-Scid mice, IL2rgnw// mice, b2mnu// mice, NOD-SCK/ IL2rynull mice, NOD-sctt/-B2nvn.// mice, and HLA transgenic mice.
  • the effectiveness of the compositions of the inventions as immunotherapeutic agents may be evaluated using cellular assays.
  • Levels of expression and/or identity of the compositions of the invention may be determined according to any methods known in the art for identifying proteins and/or quantitating proteins levels.
  • such methods may include Western Blotting, flow cytometry, and immunoassays.
  • functional characterization is carried out in primary immune cells or immortalized immune cell lines and may be determined by expression of cell surface markers.
  • cell surface markers for T cells include, but are not limited to, CD3, CD4, CD8, CD 14, CD20, CD1 lb, CD16, CD45 and HLA-DR, CD 69, CD28, CD44, IFNgamma, PD1, ⁇ 3, LAG3.
  • cell surface markers for antigen presenting cells include, but are not limited to, MHC class I, MHC Class ⁇ , CD40, CD45, B7-1 , B7-2, IFN- ⁇ receptor and IL2 receptor, ICAM-1 and/or Fey receptor.
  • cell surface markers for dendritic cells include, but are not limited to, MHC class I, MHC Class II, B7-2, CD18, CD29, CD31, CD43, CD44, CD45, CD54, CD58, CD83, CD86, CMRF-44, CMRF-56, DCIR and or Dec tin -1 and the like; while in some cases also having the absence of CD2, CD3, CD4, CD8, CD14, CD15, CD16, CD 19, CD20, CD56, and/or CD57.
  • cell surface markers for NK cells include, but are not limited to, CCL3, CCL4, CCL5, CCR4, CXCR4, CXCR3, N G2D, CD71, CD69, CCR5, Phospho JAK/STAT, phospho ERK, phospho p38/ MAPK, phospho AKT, phospho STAT3, Granulysin, Granzyme B, Granzyme K, 1L10, 1L22, IFNg, LAP, Perforin, and TNFa.
  • the present invention also provides vectors that package polynucleotides of the invention encoding biocircuits, effector modules, SREs (DDs) and payload constructs, and combinations thereof.
  • Vectors of the present invention may also be used to deliver the packaged polynucleotides to a cell, a local tissue site or a subject.
  • These vectors may be of any kind, including DNA vectors, RNA vectors, plasmids, viral vectors and particles.
  • Viral vector technology is well known and described in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York).
  • Viruses which are useful as vectors include, but are not limited to lentiviral vectors, adenoviral vectors, adeno-associated viral (AAV) vectors, herpes simplex viral vectors, retroviral vectors, oncolytic viruses, and the like.
  • vectors contain an origin of replication functional in at least one organism, a promoter sequence and convenient restriction endonuclease site, and one or more selectable markers e.g. a drug resistance gene.
  • a promoter is defined as a DNA sequence recognized by transcription machinery of the cell, required to initiate specific transcription of the polynucleotide sequence of the present invention.
  • Vectors can comprise native or non-native promoters operably linked to the polynucleotides of the invention.
  • the promoters selected may be strong, weak, constitutive, inducible, tissue specific, development stage-specific, and/or organism specific.
  • One example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of polynucleotide sequence that is operatively linked to it.
  • CMV immediate early cytomegalovirus
  • This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of polynucleotide sequence that is operatively linked to it.
  • Another example of a preferred promoter is the Elongation Growth Factor- 1.
  • Alpha (EF-1. alpha) promoter may also be used, including, but not limited to simian virus 40 (SV40) promoter, the mouse mammary tumor virus (MMTV) promoter, human immunodeficiency virus (HIV) promoter, long terminal repeat (LTR), promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter as well as human gene promoters including, but not limited to the phosphoglycerate kinase (PGK) promoter, the actin promoter, the myosin promoter, the hemoglobin promoter, the Ubiquitin C (Ubc) promoter, the human U6 small nuclear protein promoter and the creatine kinase promoter.
  • SV40 simian virus 40
  • MMTV mouse mammary tumor virus
  • HSV human immunodeficiency virus
  • LTR long terminal repeat
  • promoter an avian leukemia virus promoter
  • inducible promoters such as but not limited to the metallothionine promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter may be used.
  • the promoter may be selected from the SEQ ID NO. 220-222, SEQ ID NO. 836.
  • the optimal promoter may be selected based on its ability to achieve minimal expression of the SREs and payloads of the invention in the absence of the ligand and detectable expression in the presence of the ligand.
  • Additional promoter elements e.g. enhancers may be used to regulate the frequency of transcriptional initiation. Such regions may be located 10-100 base pairs upstream or downstream of the start site. In some instances, two or more promoter elements may be used to cooperatively or independently activate transcription.
  • Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses.
  • the vector can be selected from the group consisting of the pUC series (Fermentas Life Sciences, Glen Burnie, MD), the pBluescript series (Stratagene, La Jolla, CA), the pET series (Novagen, Madison, WI), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Alto, CA).
  • Bacteriophage vectors such as ⁇ , ⁇ 1, ⁇ (Stratagene), >JEMBL4, and ⁇ 149, also can be used.
  • Examples of plant expression vectors include pBIOl, pBI 101.2, pBI101.3, pBI121 and pBIN19 (Clontech).
  • Examples of animal expression vectors include pEUK-Cl, pMAM, and pMAMneo (Clontech).
  • the recombinant expression vector may be a viral vector, e.g., a retroviral vector or a lenti viral vector.
  • the vector can be a transposon. Any of the vectors disclosed in the International Patent Publication WO2014065961, may be useful in the present invention (the contents of which are incorporated herein by reference in their entirety).
  • the recombinant expression vector may comprise regulator ⁇ ' sequences, such as transcription and translation initiation and termination codons, which are specific to the type of the host cell into which the vector is to be introduced.
  • lentiviral vectors/particles may be used as vehicles and delivery modalities.
  • Lentivi ruses are subgroup of the Retroviridae family of viruses, named because reverse transcription of viral RNA genomes to DNA is required before integration into the host genome.
  • the most important features of lentiviral vehicles particles are the integration of their genetic material into the genome of a target/host cell.
  • Some examples of lentivirus include the Human Immunodeficiency Viruses: HTV-1 and HTV-2, the Simian
  • Immunodeficiency Virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), Jembrana Disease Virus (JDV), equine infectious anemia virus (EIAV), equine infectious anemia virus, visna-maedi and caprine arthritis encephalitis virus (CAEV).
  • SIV feline immunodeficiency virus
  • BIV bovine immunodeficiency virus
  • JDV Jembrana Disease Virus
  • EIAV equine infectious anemia virus
  • CAEV visna-maedi and caprine arthritis encephalitis virus
  • lentiviral particles making up the gene delivery vehicle are replication defective on their own (also referred to as “self-inactivating ' "). Lentiviruses are able to infect both dividing and non-dividing cells by virtue of the entry mechanism through the intact host nuclear envelope (Naldini L et al., Curr. Opin. Biotechnol, 1998, 9: 457-463). Recombinant lentiviral vehicles/particles have been generated by multiply attenuating the HIV virulence genes, for example, the genes Env, Vif, Vpr, Vpu, Nef and Tat are deleted making the vector biologically safe.
  • lentiviral vehicles for example, derived from HIV-l HIV-2 can mediate the efficient delivery, integration and long-term expression of transgenes into non- dividing cells.
  • the term "recombinant” refers to a vector or other nucleic acid containing both lentiviral sequences and non-lentiviral retroviral sequences.
  • Lentiviral particles may be generated by co-expressing the virus packaging elements and the vector genome itself in a producer cell such as human HEK293T cells. These elements are usually provided in three (in second generation lentiviral systems) or four separate plasmids (in third generation lentiviral systems).
  • the producer cells are co-transfected with plasmids that encode lentiviral components including the core (i.e. structural proteins) and enzymatic components of the virus, and the envelope protein(s) (referred to as the packaging systems), and a plasmid that encodes the genome including a foreign transgene, to be transferred to the target cell, the vehicle itself (also referred to as the transfer vector).
  • the plasmids or vectors are included in a producer cell line.
  • the plasmids/vectors are introduced via transfection, transduction or infection into the producer cell line. Methods for transfection, transduction or infection are well known by those of skill in the art.
  • the packaging and transfer constructs can be introduced into producer cell lines by calcium phosphate transfection, lipofection or electroporation, generally together with a dominant selectable marker, such as neo, DHFR, Gin synthetase or ADA, followed by selection in the presence of the appropriate drug and isolation of clones.
  • the producer cell produces recombinant viral particles that contain the foreign gene, for example, the effector module of the present invention.
  • the recombinant viral particles are recovered from the culture media and titrated by standard methods used by those of skill in the art.
  • the recombinant lentiviral vehicles can be used to infect target cells.
  • Cells used to produce high-titer lentiviral particles may include, but are not limited to, HEK293T cells, 293G cells, STAR cells (Relander et al., >/. Ther., 2005, 11: 452 ⁇ 59), FreeStyleTM 293 Expression System (ThermoFisher, Waltham, MA), and other HEK293T-based producer cell lines (e.g., Stewart et al., Hum Gene Ther. 201 1, 22(3):357-369; Lee et al., Bioiechnol Bioeng, 2012, 10996): 1551-1560; Throm et al., BW. 2009, 113(21): 5104-5110; the contents of each of which are incorporated herein by reference in their entirety).
  • HEK293T cells e.g., Stewart et al., Hum Gene Ther. 201 1, 22(3):357-369; Lee et al., Bioiechnol Bioeng, 2012, 1099
  • the envelope proteins may be heterologous envelop proteins from other viruses, such as the G protein of vesicular stomatitis virus (VSV G) or baculoviral gp64 envelop proteins.
  • VSV G glycoprotein may especially be chosen among species classified in the vesiculovirus genus: Carajas virus (CJSV), Chandipura virus (CHPV), Cocal virus (COCV), Isfahan virus (ISFV), Maraba virus (MARA V), Piry virus (PIRYV), Vesicular stomatitis Alagoas virus (VSAV), Vesicular stomatitis Indiana virus (VSIV) and Vesicular stomatitis New Jersey virus (VSN JV) and/or stains provisionally classified in the vesiculovirus genus as Grass carp rhabdovirus, BeAn 157575 virus (BeAn 157575), Boteke virus (BTKV),
  • CJSV Caraja
  • AcMNPV Anagrapha falcifera nuclear polyhedrosis virus, Bombyx mori nuclear polyhedrosis virus, Choristoneura fumiferana nucleopolyhedrovirus, Orgyia pseudotsugata single capsid nuclear polyhedrosis virus, Epiphyas postvittana
  • nucleopolyhedrovirus Hyphantria cunea nucleopolyhedrovirus, Galleria mellonella nuclear polyhedrosis virus, Dhori virus, Thogoto virus, Antheraea pemyi nucleopolyhedrovirus or Batken virus.
  • Additional elements provided in lentiviral particles may comprise retroviral LTR (long- terminal repeat) at either 5 ' or 3' terminus, a retroviral export element, optionally a lentiviral reverse response element (RRE), a promoter or active portion thereof, and a locus control region (LCR) or active portion thereof.
  • retroviral LTR long- terminal repeat
  • RRE lentiviral reverse response element
  • Other elements include central polypurine tract (cPPT) sequence to improve transduction efficiency in non-dividing cells, Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE) which enhances the expression of the transgene, and increases titer.
  • WPRE Posttranscriptional Regulatory Element
  • Lenti virus vectors used may be selected from, but are not limited to pLVX, pLenti, pLenti6, pLJMl, FUGW, pWPXL, pWPI, pLenti CMV puro DEST, pLJMl-EGFP, pULTRA, plnducer20, pHIV-EGFP, pCW57.1, pTRPE, pELPS, pRRL, and pLionll.
  • Lentiviral vehicles known in the art may also be used (See, U.S. Pat. NOs. 9, 260, 725; 9,068,199; 9,023,646; 8,900,858; 8,748,169; 8,709,799; 8,420,104; 8,329,462; 8,076,106;
  • Retroviral vectors ( ⁇ -retro viral vectors)
  • retroviral vectors may be used to package and deliver the biocircuits, biocircuit components, effector modules, SREs or pay load constructs of the present invention.
  • Retroviral vectors allow the permanent integration of a transgene in target cells.
  • retroviral vectors based on simple gam ma-retro viruses have been widely used to deliver therapeutic genes and demonstrated clinically as one of the most efficient and powerful gene delivery- systems capable of transducing a broad range of cell types.
  • Example species of Gamma retroviruses include the murine leukemia viruses (MLVs) and the feline leukemia viruses (FeLV).
  • gamma-retro viral vectors derived from a mammalian gamma- retro virus such as murine leukemia viruses (MLVs)
  • MLVs murine leukemia viruses
  • the MLV families of gamma retroviruses include the ecotropic, amphotropic, xenotropic and polytropic subfamilies.
  • Ecotropic viruses can infect only murine cells using mC AT- 1 receptor.
  • Examples of ecotropic viruses are Moloney MLV and AKV.
  • Amphotropic viruses infect murine, human and other species through the Pit-2 receptor.
  • an amphotropic virus is the 4070A virus.
  • Xenotropic and polytropic viruses utilize the same (Xprl) receptor, but differ in their species tropism.
  • Gamma-retroviral vectors may be produced in packaging cells by co-transfecting the cells with several plasmids including one encoding the retroviral structural and enzymatic (gag- pol) polyprotein, one encoding the envelope (env) protein, and one encoding the vector mRNA comprising polynucleotide encoding the compositions of the present invention that is to be packaged in newly formed viral particles.
  • plasmids including one encoding the retroviral structural and enzymatic (gag- pol) polyprotein, one encoding the envelope (env) protein, and one encoding the vector mRNA comprising polynucleotide encoding the compositions of the present invention that is to be packaged in newly formed viral particles.
  • the recombinant gamma-retroviral vectors are pseudotyped with envelope proteins from other viruses.
  • Envelope glycoproteins are incorporated in the outer lipid layer of the viral particles which can increase/alter the cell tropism.
  • Exemplary envelop proteins include the gibbon ape leukemia virus envelope protein (GALV) or vesicular stomatitis virus G protein (VSV-G), or Simian endogenous retrovirus envelop protein, or Measles Virus H and F proteins, or Human immunodeficiency virus gpl20 envelope protein, or cocal vesiculovirus envelop protein (See, e.g., U.S. application publication NOS.
  • envelope glycoproteins may be genetically modified to incorporate targeting/binding ligands into gamma- retroviral vectors, binding ligands including, but not limited to, peptide ligands, single chain antibodies and growth factors (Waehler et al., Nat. Rev. Genet. 2007, 8(8):573-587; the contents of which are incorporated herein by reference in its entirety)- These engineered glycoproteins can retarget vectors to cells expressing their corresponding target moieties.
  • a "molecular bridge" may be introduced to direct vectors to specific cells.
  • the molecular bridge has dual specificities: one end can recognize viral glycoproteins, and the other end can bind to the molecular determinant on the target cell.
  • Such molecular bridges for example ligand- receptor, avidin-biotin, and chemical conjugations, monoclonal antibodies and engineered fusogenic proteins, can direct the attachment of viral vectors to target cells for transduction (Yang et al., Biotechnol. Bioeng., 2008, 101(2): 357-368; and Maetzig et al., Viruses, 201 1, 3, 677-713; the contents of each of which are incorporated herein by reference in their entirety).
  • the recombinant gamma-retroviral vectors are self-inactivating (SIN) gammaretro viral vectors.
  • the vectors are replication incompetent.
  • SIN vectors may harbor a deletion within the 3' U3 region initially comprising enhancer/promoter activity.
  • the 5' U3 region may be replaced with strong promoters (needed in the packaging cell line) derived from Cytomegalovirus or RSV, or an internal promoter of choice, and/or an enhancer element.
  • the choice of the internal promoters may be made according to specific requirements of gene expression needed for a particular purpose of the invention.
  • polynucleotides encoding the biocircuit, biocircuit components, effector module, and SRE are inserted within the recombinant viral genome.
  • the other components of the viral mR A of a recombinant gamma-retroviral vector may be modified by insertion or removal of naturally occurring sequences (e.g., insertion of an IRES, insertion of a heterologous polynucleotide encoding a polypeptide or inhibitory nucleic acid of interest, shuffling of a more effective promoter from a different retrovirus or virus in place of the wild- type promoter and the like).
  • the recombinant gamma-retroviral vectors may comprise modified packaging signal, and or primer binding site (PBS), and/or 5'- enhancer/promoter elements in the U3-region of the 5'- long terminal repeat (LTR), and/or 3'- SIN elements modified in the U3-region of the 3 -LTR. These modifications may increase the titers and the ability of infection.
  • PBS primer binding site
  • LTR 5'- enhancer/promoter elements in the U3-region of the 5'- long terminal repeat (LTR)
  • 3'- SIN elements modified in the U3-region of the 3 -LTR.
  • Gamma retroviral vectors suitable for delivering biocircuit components, effector modules, SREs or payload constructs of the present invention may be selected from those disclosed in U.S. Pat. NOs. 8,828,718; 7,585,676; 7,351,585; U.S. application publication NOS. 2007/048285; PCT application publication NOs. WO2010/113037; WO2014/121005;
  • Adeno-associated viral vectors AAV
  • polynucleotides of present invention may be packaged into recombinant adeno-associated viral (rAAV) vectors.
  • rAAV adeno-associated viral
  • Such vectors or viral particles may be designed to utilize any of the known serotype capsids or combinations of serotype capsids.
  • the serotype capsids may include capsids from any identified AAV serotypes and variants thereof, for example, AAV1, AAV2, AAV2G9, AAV3, AAV4, AAV4-4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12 and AAVrhlO.
  • the AAV serotype may be or have a sequence as described in United States Publication No. US20030138772, herein incorporated by reference in its entirety, such as, but not limited to, AAV1 (SEQ ID NO. 6 and 64 of US20030138772), AAV2 (SEQ ID NO. 7 and 70 of US20030138772), AAV3 (SEQ ID NO. 8 and 71 of US20030138772), AAV4 (SEQ ID NO. 63 of US20030138772), AAV5 (SEQ ID NO. 114 of US20030138772), AAV6 (SEQ ID NO. 65 of US20030138772), AAV7 (SEQ ID NO. 1-3 of US20030138772), AAV8 (SEQ ID NO. 4 and 95 of US20030138772), AAV9 (SEQ ID NO. 5 and 100 of
  • US20030138772 AAV10 (SEQ ID NO. 117 of US20030138772), AAV11 (SEQ ID NO. 118 of US20030138772), AAV12 (SEQ ID NO. 119 of US20030138772), AAVrhlO (amino acids 1 to 738 of SEQ ID NO. 81 of US20030138772) or variants thereof.
  • variants include SEQ ID NOs. 9, 27-45, 47-62, 66-69, 73-81, 84-94, 96, 97, 99, 101-113 of US20030138772, the contents of which are herein incorporated by reference in their entirety.
  • the AAV serotype may have a sequence as described in Pulichla et al. (Molecular Therapy, 2011, 19(6): 1070-1078), U.S. Pat. NOs. 6,156,303; 7,198,951; U.S. Patent Publication NOs. US2015/0159173 and US2014/0359799; and International Patent Publication NOs. WO1998/011244, WO2005/033321 and WO2014/14422; the contents of each of which are incorporated herein by reference in their entirety.
  • AAV vectors include not only single stranded vectors but self-complementary AAV vectors (scAAVs).
  • scAAV vectors contain DNA which anneals together to form double stranded vector genome. By skipping second strand synthesis, scAAVs allow for rapid expression in the cell.
  • the rAAV vectors may be manufactured by standard methods in the art such as by triple transfection, in sf9 insect cells or in suspension cell cultures of human cells such as HEK293 cells.
  • biocircuits, biocircuit components, effector modules, SREs or payload constructs may be encoded in one or more viral genomes to be packaged in the AAV capsids taught herein.
  • Such vectors or viral genomes may also include, in addition to at least one or two lTRs (inverted terminal repeats), certain regulator ⁇ ' elements necessary for expression from the vector or viral genome.
  • lTRs inverted terminal repeats
  • Such regulatory elements are well known in the art and include for example promoters, introns, spacers, stuffer sequences, and the like.
  • more than one effector module or SRE may be encoded in a viral genome.
  • polynucleotides of present invention may be packaged into oncolytic viruses, such as vaccine viruses.
  • Oncolytic vaccine viruses may include viral particles of a thymidine kinase (TK)-deficient, granulocyte macrophage (GM)-colony stimulating factor (CSF)-expressing, replication-competent vaccinia virus vector sufficient to induce oncolysis of cells in the tumor (e.g., US Pat. NOS. 9,226,977; the contents of which are incorporated by reference in their entirety).
  • TK thymidine kinase
  • GM granulocyte macrophage
  • CSF colony stimulating factor
  • the effector modules of the invention may be designed as a messenger RNA (mRNA).
  • mRNA messenger RNA
  • the term "messenger RNA” (mRNA) refers to any polynucleotide which encodes a polypeptide of interest and which is capable of being translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ or ex vivo.
  • mRNA molecules may have the structural components or features of any of those taught in International Application number PCT/US2013/030062, the contents of which are incorporated herein by reference in its entirety.
  • Polynucleotides of the invention may also be designed as taught in, for example, Ribostem Limited in United Kingdom patent application serial number 0316089.2 filed on July 9, 2003 now abandoned, PCT application number PCT/GB2004/002981 filed on July 9, 2004 published as WO2005005622, United States patent application national phase entry serial number 10/563,897 filed on June 8, 2006 published as US20060247195 now abandoned, and European patent application national phase entry serial number EP2004743322 filed on July 9, 2004 published as EP 1646714 now withdrawn; Novozymes, Inc.
  • PCT/EP2008/03033 filed on April 16, 2008 published as WO2009127230
  • PCT EP2006/004784 filed on May 19, 2005 published as WO2006122828
  • PCT/EP2008/00081 filed on January 9, 2007 published as WO2008083949
  • the effector modules may be designed as self-amplifying RNA.
  • ''Self-amplifying RNA refers to RNA molecules that can replicate in the host resulting in the increase in the amount of the RNA and the protein encoded by the RNA.
  • Such self-amplifying RNA may have structural features or components of any of those taught in International Patent Application Publication No. WO2011005799 (the contents of which are incorporated herein by reference in their entirety).
  • compositions of the invention may be delivered to a cell or a subject through one or more routes and modalities.
  • the viral vectors containing one or more effector modules, SREs, immune-therapeutic agents and other components described herein may be used to deliver them to a cell and/or a subject.
  • Other modalities may also be used such as mRNAs, plasmids, and as recombinant proteins.
  • polynucleotides encoding biocircuits, effector modules, SREs (e.g., DDs), payloads of interest (immune-therapeutic agents) and compositions of the invention and vectors comprising said polynucleotides may be introduced into cells such as immune effector cells.
  • polynucleotides encoding biocircuits, effector modules, SREs (e.g., DDs), payloads of interest (immunotherapeutic agents) and compositions of the invention may be packaged into viral vectors or integrated into viral genomes allowing transient or stable expression of the polynucleotides.
  • Preferable viral vectors are retroviral vectors including lentiviral vectors.
  • a polynucleotide molecule encoding a biocircuit, an effector module, a DD or a payload of interest i.e. an
  • immunotherapeutic agent is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective.
  • the recombinant viral vector is then introduced into a packaging cell line containing the gag, pol, and env genes, but without the LTR and packaging components.
  • the recombinant retroviral particles are secreted into the culture media, then collected, optionally concentrated, and used for gene transfer.
  • Lentiviral vectors are especially preferred as they are capable of infecting both dividing and non-dividing cells.
  • Vectors may also be transferred to cells by non-viral methods by physical methods such as needles, electroporation, sonoporation, hyrdoporation; chemical carriers such as inorganic particles (e.g. calcium phosphate, silica, gold) and/or chemical methods.
  • chemical carriers such as inorganic particles (e.g. calcium phosphate, silica, gold) and/or chemical methods.
  • synthetic or natural biodegradable agents may be used for delivery such as cationic lipids, lipid nano emulsions, nanoparticles, peptide based vectors, or polymer based vectors.
  • the polypeptides of the invention may be delivered to the cell directly.
  • the polypeptides of the invention may be delivered using synthetic peptides comprising an endosomal leakage domain (ELD) fused to a cell penetration domain (CLD).
  • ELD endosomal leakage domain
  • CLD cell penetration domain
  • the polypeptides of the invention are co introduced into the cell with the ELD-CLD- synthetic peptide.
  • ELDs facilitate the escape of proteins that are trapped in the endosome, into the cytosol.
  • Such domains are derived proteins of microbial and viral origin and have been described in the art.
  • CPDs allow the transport of proteins across the plasma membrane and have also been described in the art.
  • the ELD-CLD fusion proteins synergistically increase the transduction efficiency when compared to the co-transduction with either domain alone.
  • a histidine rich domain may optionally be added to the shuttle construct as an additional method of allowing the escape of the cargo from the endosome into the cytosol.
  • the shuttle may also include a cysteine residue at the N or C terminus to generate multimers of the fusion peptide. Multimers of the ELD-CLD fusion peptides generated by the addition of cysteine residue to the terminus of the peptide show even greater transduction efficiency when compared to the single fusion peptide constructs.
  • polypeptides of the invention may also be appended to appropriate localization signals to direct the cargo to the appropriate sub-cellular location e.g. nucleus.
  • appropriate localization signals e.g. nucleus.
  • WO2017175072 may be useful in the present invention (the contents of each of which are herein incorporated by reference in their entirety).
  • the present invention provides methods comprising administering any one or more compositions for immunotherapy to a subject in need thereof. These may be administered to a subject using any amount and any route of administration effective for preventing or treating a clinical condition such as cancer, infection diseases and other immunodeficient diseases.
  • compositions in accordance with the invention are typically formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the compositions of the present invention may be decided by the attending physician within the scope of sound medical judgment.
  • the specific therapeutically effective, or prophylactically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, previous or concurrent therapeutic interventions and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts.
  • compositions of the invention may be used in varying doses to avoid T cell energy, prevent cytokine release syndrome and minimize toxicity associated with immunotherapy.
  • low doses of the compositions of the present invention may be used to initially treat patients with high tumor burden, while patients with low tumor burden may be treated with high and repeated doses of the compositions of the invention to ensure recognition of a minimal tumor antigen load.
  • the compositions of the present invention may be delivered in a pulsatile fashion to reduce tonic T cell signaling and enhance persistence in vivo.
  • toxicity may be minimized by initially using low doses of the compositions of the invention, prior to administering high doses. Dosing may be modified if serum markers such as ferritin, serum C-reactive protein, IL-6, IFN- ⁇ , and TNF-a are elevated.
  • the compositions for immunotherapy may be administered to cells ex vivo and subsequently administered to the subject.
  • Immune cells can be isolated and expanded ex vivo using a variety of methods known in the art. For example, methods of isolating cytotoxic T cells are described in U.S. Pat. NOs. 6,805,861 and 6,531,451; the contents of each of which are incorporated herein by reference in their entirety. Isolation of NK cells are described in U.S. Pat. NOs. 7,435,596; the contents of which are incorporated by reference herein in its entirely.
  • compositions of the present invention may be administered by any of the methods of administration taught in the copending commonly owned U.S. Provisional Patent Application No. 62/320,864, filed on 4/11/2016, or in US Provisional Application No. 62/466,596 filed March 3, 2017 and the International Publication WO2017/180587, the contents of which are incorporated herein by reference in their entirety.
  • the cells may be introduced into a host organism e.g. a mammal, in a wide variety of ways including by injection, transfusion, infusion, local instillation or implantation.
  • the cells of the invention may be introduced at the site of the tumor.
  • the number of cells that are employed will depend upon a number of circumstances, the purpose for the introduction, the lifetime of the cells, the protocol to be used, for example, the number of administrations, the ability of the cells to multiply, or the like.
  • the cells may be in a physiologically-acceptable medium.
  • the cells of the invention may be administrated in multiple doses to subjects having a disease or condition.
  • the administrations generally effect an improvement in one or more symptoms of cancer or a clinical condition and/or treat or prevent cancer or clinical condition or symptom thereof.
  • compositions for immunotherapy may be administered in vivo.
  • polypeptides of the present invention comprising biocircuits, effector molecules, SREs, payloads of interest (immune-therapeutic agents) and compositions of the invention may be delivered in vivo to the subject.
  • immune-therapeutic agents In vivo delivery of immune-therapeutic agents is well described in the art. For example, methods of delivery of cytokines are described in the E.P. Pat. NOs. EP0930892 Al, the contents of which are incorporated herein by reference.
  • the payloads of the present invention may be administered in conjunction with inhibitors of SHP-1 and/or SHP-2.
  • SHP1 also known as PTPN6
  • SHP2 also known as PTPN11
  • PD1 Programmed Cell Death
  • the intracellular domain of PD1 contains an immunoreceptor tyrosine-based inhibitory motif ( ⁇ ) and an immunoreceptor tyrosine-based switch motif (TTSM). ITSM has been shown to recruit SHP-1 and 2.
  • inhibitors of SHP-1 and 2 may include expressing dominant negative versions of the proteins in T cells, TILs or other cell types to relieve exhaustion. Such mutants can bind to the endogenous, catalytically active proteins, and inhibit their function.
  • the dominant negative mutant of SHP-1 and/ or SHP-2 lack the phosphatase domain required for catalytic activity.
  • compositions, biocircuits, biocircuit components, effector modules including their SREs (e.g., DDs), payloads (i.e. immune-therapeutic agents), vectors and cells of the present invention may be administered by any route to achieve a therapeutically effective outcome.
  • SREs e.g., DDs
  • payloads i.e. immune-therapeutic agents
  • vectors and cells of the present invention may be administered by any route to achieve a therapeutically effective outcome.
  • enteral into the intestine
  • gastroenteral into the dura matter
  • oral by way of the mouth
  • transdermal peridural
  • intracerebral into the cerebrum
  • intracerebroventricular into the cerebral ventricles
  • epicutaneous application onto the skin
  • intradermal into the skin itself
  • subcutaneous under the skin
  • nasal administration through the nose
  • intravenous into a vein
  • intravenous bolus intravenous drip
  • intra-arterial into an artery
  • intramuscular into a muscle
  • intracranial into the heart
  • intraosseous infusion into the bone marrow
  • intrathecal into the spinal canal
  • intraperitoneal infusion or injection into the peritoneum
  • intrasinal infusion intravitreal
  • intravitreal through the eye
  • intravenous injection into a pathologic cavity
  • intracavitary intracavitary
  • intracorneal within the cornea
  • dental intracornal within the coronary arteries
  • intracorporus cavernosum within the dilatable spaces of the corporus cavernosa of the penis
  • intradiscal within a disc
  • intraductal within a duct of a gland
  • intraduodenal within the duodenum
  • intradural within or beneath the dura
  • intraepidermal to the epidermis
  • intraesophageal to the esophagus
  • intragastric within the stomach
  • intragingival within the gingivae
  • intraileal within the distal portion of the small intestine
  • intralesional within or introduced directly to a localized lesion
  • intraluminal within a lumen of a tube
  • intralymphatic within the lymph
  • intramedullary within the marrow cavity of a bone
  • intrameningeal within the meninge
  • a dressing which occludes the area
  • ophthalmic to the external eye
  • oropharyngeal directly to the mouth and pharynx
  • parenteral percutaneous, periarticular, peridural, perineural, periodontal, rectal, respiratory (within the respiratory tract by inhaling orally or nasally for local or systemic effect), retrobulbar (behind the pons or behind the eyeball), intramyocardial (entering the myocardium), soft tissue, subarachnoid, subconjunctival, submucosal, topical, transplacental (through or across the placenta), transtracheal (through the wall of the trachea), transtympanic (across or through the tympanic cavity), ureteral (to the ureter), urethral (to the urethra), vaginal, caudal block, diagnostic, nerve block, biliary perfusion, cardiac perfusion, photop
  • compositions of the present disclosure are disclosed in groups or in ranges. It is specifically intended that the present disclosure include each and every individual sub combination of the members of such groups and ranges. The following is a non-limiting list of term definitions.
  • Activity refers to the condition in which things are happening or being done.
  • Compositions of the invention may have activity and this activity may involve one or more biological events.
  • biological events may include cell signaling events.
  • biological events may include cell signaling events associated protein interactions with one or more corresponding proteins, receptors, small molecules or any of the biocircuit components described herein.
  • Adoptive cell therapy refers to a cell therapy involving in the transfer of cells into a patient, wherein cells may have originated from the patient, or from another individual, and are engineered (altered) before being transferred back into the patient.
  • the therapeutic cells may be derived from the immune system, such as Immune effector cells: CD4+ T cell; CD8+ T cell, Natural Killer cell (NK cell); and B cells and tumor infiltrating lymphocytes (TILs) derived from the resected tumors. Most commonly transferred cells are autologous anti-tumor T cells after ex vivo expansion or manipulation.
  • autologous peripheral blood lymphocytes can be genetically engineered to recognize specific tumor antigens by expressing T-cell receptors (TCR) or chimeric antigen receptor (CAR).
  • TCR T-cell receptors
  • CAR chimeric antigen receptor
  • agent refers to a biological, pharmaceutical, or chemical compound. Non-limiting examples include simple or complex organic or inorganic molecule, a peptide, a protein, an oligonucleotide, an antibody, an antibody derivative, antibody fragment, a receptor, and soluble factor.
  • Agonist refers to a compound that, in combination with a receptor, can produce a cellular response.
  • An agonist may be a ligand that directly binds to the receptor.
  • an agonist may combine with a receptor indirectly by, for example, (a) forming a complex with another molecule that directly binds to the receptor, or (b) otherwise resulting in the modification of another compound so that the other compound directly binds to the receptor.
  • An agonist may be referred to as an agonist of a particular receptor or family of receptors, e.g., agonist of a co-stimulatory receptor.
  • Antagonist refers to any agent that inhibits or reduces the biological activity of the targets) it binds.
  • Antigen the term "antigen" as used herein is defined as a molecule that provokes an immune response when it is introduced into a subject or produced by a subject such as tumor antigens which arise by the cancer development itself. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells such as cytotoxic T lymphocytes and T helper cells, or both.
  • An antigen can be derived from organisms, subunits of proteins/antigens, killed or inactivated whole cells or lysates.
  • antigens of interest refers to those proteins and/or other biomolecules provided herein that are immunospecifically bound or interact with antibodies of the present invention and/or fragments, mutants, variants, and/or alterations thereof described herein.
  • antigens of interest may comprise any of the polypeptides or payloads or proteins described herein, or fragments or portions thereof.
  • association means that the moieties are physically associated or connected with one another, either directly or via one or more additional moieties that serve as linking agents, to form a structure that is sufficiently stable so that the moieties remain physically associated under the conditions in which the structure is used, e.g., physiological conditions.
  • An “association” need not be strictly through direct covalent chemical bonding. It may also suggest ionic or hydrogen bonding or a hybridization based connectivity sufficiently stable such that the "associated" entities remain physically associated.
  • Autologous the term "autologous" as used herein is meant to refer to any material derived from the same individual to which it is later to be re-introduced into the individual.
  • Barcode refers to polynucleotide or amino acid sequence that distinguishes one polynucleotide or amino acid from another.
  • Cancer the term “cancer” as used herein refers a broad group of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth results in the formation of malignant tumors that invade neighboring tissues ultimately metastasize to distant parts of the body through the lymphatic system or bloodstream.
  • Co-stimulatory molecule refers to a group of immune cell surface receptor/ligands which engage between T cells and APCs and generate a stimulatory signal in T cells which combines with the stimulatory signal in T cells that results from T cell receptor (TCR) recognition of antigen/MHC complex (pMHC) on APCs
  • Cytokines the term "cytokines", as used herein, refers to a family of small soluble factors with pleiotropic functions that are produced by many cell types that can influence and regulate the function of the immune system.
  • Delivery refers to the act or manner of delivering a compound, substance, entity, moiety, cargo or payload.
  • a “delivery agent” refers to any agent which facilitates, at least in part, the in vivo delivery of one or more substances (including, but not limited to a compound and/or compositions of the present invention) to a cell, subject or other biological system cells.
  • Destabilized As used herein, the term “destable,” “destabilize,” “destabilizing region” or “destabilizing domain” means a region or molecule that is less stable than a starting, reference, wild-type or native form of the same region or molecule.
  • Engineered As used herein, embodiments of the invention are "engineered” when they are designed to have a feature or property, whether structural or chemical, that varies from a starting point, wild type or native molecule.
  • expression refers to one or more of the following events: (1) production of an R A template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5' cap formation, and/or 3' end processing); (3) translation of an RNA into a polypeptide or protein; (4) folding of a polypeptide or protein; and (5) post-translational modification of a polypeptide or protein.
  • Feature refers to a characteristic, a property, or a distinctive element.
  • Formulation includes at least a compound and/or composition of the present invention and a delivery agent.
  • fragments of proteins may comprise polypeptides obtained by digesting full-length protein.
  • a fragment of a protein includes at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250 or more amino acids.
  • fragments of an antibody include portions of an antibody.
  • a "functional" biological molecule is a biological entity with a structure and in a form in which it exhibits a property and/or activity by which it is characterized.
  • Immune cells refers to any cell of the immune system that originates from a hematopoietic stem cell in the bone marrow, which gives rise to two major lineages, a myeloid progenitor cell (which give rise to myeloid cells such as monocytes, macrophages, dendritic cells, megakaryocytes and granulocytes) and a lymphoid progenitor cell (which give rise to lymphoid cells such as T cells, B cells and natural killer (NK) cells).
  • myeloid progenitor cell which give rise to myeloid cells such as monocytes, macrophages, dendritic cells, megakaryocytes and granulocytes
  • lymphoid progenitor cell which give rise to lymphoid cells such as T cells, B cells and natural killer (NK) cells).
  • Exemplary immune system cells include a CD4+ T cell, a CD8+ T cell, a CD4- CD8- double negative T cell, a T ⁇ cell, a ⁇ cell, a regulatory T cell, a natural killer cell, and a dendritic cell.
  • Macrophages and dendritic cells may be referred to as "antigen presenting cells" or "APCs,” which are specialized cells that can activate T cells when a major histocompatibility complex (MHC) receptor on the surface of the APC complexed with a peptide interacts with a TCR on the surface of a T cell.
  • MHC major histocompatibility complex
  • Immunotherapy refers to a type of treatment of a disease by the induction or restoration of the reactivity of the immune system towards the disease.
  • Immunotherapeutic agent refers to the treatment of disease by induction or restoration of the reactivity of the immune system towards the disease with a biological, pharmaceutical, or chemical compound.
  • in vitro refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than within an organism (e.g., animal, plant, or microbe).
  • in vivo refers to events that occur within an organism (e.g., animal, plant, or microbe or cell or tissue thereof).
  • linker refers to a moiety that connects two or more domains, moieties or entities.
  • a linker may comprise 10 or more atoms.
  • a linker may comprise a group of atoms, e.g., 10-1,000 atoms, and can be comprised of the atoms or groups such as, but not limited to, carbon, amino, alkylamino, oxygen, sulfur, sulfoxide, sulfonyl, carbonyl, and imine.
  • a linker may comprise one or more nucleic acids comprising one or more nucleotides.
  • the linker may comprise an amino acid, peptide, polypeptide or protein.
  • a moiety bound by a linker may include, but is not limited to an atom, a chemical group, a nucleoside, a nucleotide, a nucleobase, a sugar, a nucleic acid, an amino acid, a peptide, a polypeptide, a protein, a protein complex, a payload (e.g., a therapeutic agent), or a marker (including, but not limited to a chemical, fluorescent, radioactive or bioluminescent marker).
  • the linker can be used for any useful purpose, such as to form multimers or conjugates, as well as to administer a payload, as described herein.
  • linker examples include, but are not limited to, alkyl, alkenyl, alkynyl, amido, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted, as described herein.
  • a disulfide bond e.g., ethylene or propylene glycol monomelic units, e.g., diethylene glycol, dipropylene glycol, triethylene glycol, tripropylene glycol, tetraethylene glycol, or tetraethylene glycol
  • dextran polymers Other examples include,
  • Non-limiting examples of a selectively cleavable bonds include an amido bond which may be cleaved for example by the use of tris(2- carboxyethyl) phosphine (TCEP), or other reducing agents, and/or photolysis, as well as an ester bond which may be cleaved for example by acidic or basic hydrolysis.
  • TCEP tris(2- carboxyethyl) phosphine
  • Checkpoint/factor As used herein, a checkpoint factor is any moiety or molecule whose function acts at the junction of a process. For example, a checkpoint protein, ligand or receptor may function to stall or accelerate the cell cycle.
  • Metabolite Metabolites are the intermediate products of metabolic reactions catalyzed by enzymes that naturally occur within cells. This term is usually used to describe small molecules, fragments of larger biomolecules or processed products.
  • Modified refers to a changed state or structure of a molecule or entity as compared with a parent or reference molecule or entity. Molecules may be modified in many ways including chemically, structurally, and functionally. In some
  • compounds and/or compositions of the present invention are modified by the introduction of non-natural amino acids.
  • mutations refers to a change and/or alteration.
  • mutations may be changes and or alterations to proteins (including peptides and polypeptides) and/or nucleic acids (including polynucleic acids).
  • mutations comprise changes and/or alterations to a protein and/or nucleic acid sequence.
  • Such changes and/or alterations may comprise the addition, substitution and or deletion of one or more amino acids (in the case of proteins and/or peptides) and/or nucleotides (in the case of nucleic acids and or polynucleic acids e.g., polynucleotides).
  • mutations comprise the addition and/or substitution of amino acids and/or nucleotides
  • such additions and/or substitutions may comprise 1 or more amino acid and/or nucleotide residues and may include modified amino acids and/or nucleotides.
  • the resulting construct, molecule or sequence of a mutation, change or alteration may be referred to herein as a mutant.
  • Neoantigen refers to a tumor antigen that is present in tumor cells but not normal cells and do not induce deletion of their cognate antigen specific T cells in thymus (i.e., central tolerance). These tumor neoantigens may provide a "foreign" signal, like pathogens, to induce an effective immune response needed for cancer immunotherapy. A neoantigen may be restricted to a specific tumor. A neoantigen be a peptide/protein with a missense mutation (missense neoantigen), or a new peptide with long, completely novel stretches of amino acids from novel open reading frames (neoORFs).
  • the neoORFs can be generated in some tumors by out-of-frame insertions or deletions (due to defects in DNA mismatch repair causing microsatcllite instability), gene-fusion, read-through mutations in stop codons, or translation of improperly spliced RNA (e.g., Saeterdal et al, Proc Natl Acad Sci USA, 2001, 98: 13255-13260).
  • off target refers to any unintended effect on any one or more target, gene, cellular transcript, cell, and/or tissue.
  • Operably linked refers to a functional connection between two or more molecules, constructs, transcripts, entities, moieties or the like.
  • Payload or pay load of interest refers to any protein or compound whose function is to be altered.
  • the POI is a component in the immune system, including both innate and adaptive immune systems.
  • Payloads of interest may be a protein, a fusion construct encoding a fusion protein, or non- coding gene, or variant and fragment thereof.
  • Payload of interest may, when amino acid based, may be referred to as a protein of interest.
  • compositions refers to any ingredient other than active agents (e.g., as described herein) present in pharmaceutical compositions and having the properties of being substantially nontoxic and non-inflammatory in subjects.
  • pharmaceutically acceptable excipients are vehicles capable of suspending and/or dissolving active agents.
  • Excipients may include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, f agrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspending or dispersing agents, sweeteners, and waters of hydration.
  • excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microciystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E
  • Pharmaceutically acceptable salts of the compounds described herein are forms of the disclosed compounds wherein the acid or base moiety is in its salt form (e.g., as generated by reacting a free base group with a suitable organic acid).
  • Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like.
  • Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pe
  • alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like.
  • Pharmaceutically acceptable salts include the conventional non-toxic salts, for example, from non-toxic inorganic or organic acids.
  • a pharmaceutically acceptable salt is prepared from a parent compound which contains a basic or acidic moiety by conventional chemical methods.
  • such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, P.H. Stahl and C.G.
  • solvates refers to a crystalline form of a compound wherein molecules of a suitable solvent are incorporated in the crystal lattice.
  • solvates may be prepared by crystallization, recrystallization, or precipitation from a solution that includes organic solvents, water, or a mixture thereof.
  • solvents examples include ethanol, water (for example, mono-, di-, and tri-hydrates), N-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), N, N'-dimethylformamide (DMF), N, N'-dimethylacetamide (DMAC), 1,3-dimethyl- 2-imidazolidinone (DMEU), l,3-dime l-3,4,5,6-teti ⁇ ydro-2-(lH)-pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like.
  • NMP N-methylpyrrolidinone
  • DMSO dimethyl sulfoxide
  • DMF N, N'-dimethylformamide
  • DMAC N, N'-dimethylacetamide
  • DMEU 1,3-dimethyl- 2-imidazolidin
  • the solvate When water is the solvent, the solvate is referred to as a "hydrate.”
  • the solvent incorporated into a solvate is of a type or at a level that is physiologically tolerable to an organism to which the solvate is administered (e.g., in a unit dosage form of a pharmaceutical composition).
  • Stable refers to a compound or entity that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and preferably capable of formulation into an efficacious therapeutic agent.
  • Stabilized As used herein, the term “stabilize”, “stabilized,” “stabilized region” means to make or become stable. In some embodiments, stability is measured relative to an absolute value. In some embodiments, stability is measured relative to a secondary status or state or to a reference compound or entity.
  • Standard CAR As used herein, the term "standard CAR” refers to the standard design of a chimeric antigen receptor.
  • the components of a CAR fusion protein including the extracellular scFv fragment, transmembrane domain and one or more intracellular domains are linearly constructed as a single fusion protein.
  • Stimulus response element is a component of an effector module which is joined, attached, linked to or associated with one or more payloads of the effector module and in some instances, is responsible for the responsive nature of the effector module to one or more stimuli.
  • the "responsive" nature of an SRE to a stimulus may be characterized by a covalent or non-covalent interaction, a direct or indirect association or a structural or chemical reaction to the stimulus. Further, the response of any SRE to a stimulus may be a matter of degree or kind. The response may be a partial response. The response may be a reversible response.
  • the response may ultimately lead to a regulated signal or output.
  • Such output signal may be of a relative nature to the stimulus, e.g., producing a modulatory effect of between 1 and 100 or a factored increase or decrease such as 2- fold, 3-fbld, 4-fold, 5-fold, 10-fold or more.
  • DD destabilizing domain
  • Subject refers to any organism to which a composition in accordance with the invention may be administered, e.g., for experimental, diagnostic, prophylactic, and/or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and/or plants.
  • animals e.g., mammals such as mice, rats, rabbits, non-human primates, and humans
  • T cell is an immune cell that produces T cell receptors (TCRs).
  • T cells can be naive (not exposed to antigen; increased expression of CD62L, CCR7, CD28, CD3, CD 127, and CD45RA, and decreased expression of CD45RO as compared to TCM), memory T cells (TM) (antigen-experienced and long-lived), and effector cells (antigen-experienced, cytotoxic).
  • T.M can be further divided into subsets of central memory T cells (TCM, increased expression of CD62L, CCR7, CD28, CD 127, CD45RO, and CD95, and decreased expression of CD54RA as compared to naive T cell and effector memory T cells (TEM, decreased expression of CD62L, CCR7, CD28, CD45RA, and increased expression of CD127 as compared to naive T cells or TCM).
  • Effector T cells refers to antigen-experienced CD8+ cytotoxic T lymphocytes that have decreased expression of CD62L, CCR7, CD28, and are positive for granzyme and perforin as compared to TCM.
  • Other exemplary T cells include regulatory T cells, such as CD4+ CD25+ (Foxp3+) regulatory T cells and Tregl7 cells, as well as Trl, Th3, CD8+CD28-, and Qa-1 restricted T cells.
  • T cell receptor refers to an immunoglobulin superfamily member having a variable antigen binding domain, a constant domain, a transmembrane region, and a short cytoplasmic tail, which is capable of specifically binding to an antigen peptide bound to a MHC receptor.
  • a TCR can be found on the surface of a cell or in soluble form and generally is comprised of a heterodimer having a and ⁇ chains (also known as TCRa and TCR * , respectively), or ⁇ and ⁇ chains (also known as TCRy and TCR6, respectively).
  • the extracellular portion of TCR chains contains two immunoglobulin domains, a variable domain (e.g., a-chain variable domain or Vo, ⁇ -chain variable domain or ⁇ ) at the N-terminus, and one constant domain (e.g., a-chain constant domain or C a and ⁇ -chain constant domain or C ,) adjacent to the cell membrane. Similar to immunoglobulin, the variable domains contain complementary determining regions (CDRs) separated by framework regions (FRs).
  • CDRs complementary determining regions
  • FRs framework regions
  • a TCR complex refers to a complex formed by the association of CD3 with TCR
  • a TCR complex can be composed of a CD3y chain, a CD35 chain, two CD3E chains, a homodimer of CD3 ⁇ chains, a TCRa chain, and a TCRp * chain.
  • a TCR complex can be composed of a CD3y chain, a CD35 chain, two CD3e chains, a homodimer of CD3 ⁇ chains, a TCRy chain, and a TCR5 chain.
  • a “component of a TCR complex,” as used herein, refers to a TCR chain (i.e., TCRa, TCRp ⁇ TCRy or TCR6), a CD3 chain (i.e., CD3y, CD36, CD3e or CD3Q, or a complex formed by two or more TCR chains or CD3 chains (e.g., a complex of TCRa and TCR ⁇ a complex of TCRy and TCR5, a complex of CD3E and CD35, a complex of CD3y and CD3 ⁇ , or a sub-TCR complex of TCRa, TCRp ⁇ CD3y, CD36, and two CD3e chains.
  • therapeutically effective amount means an amount of an agent to be delivered (e.g., nucleic acid, drug, therapeutic agent, diagnostic agent, prophylactic agent, etc.) that is sufficient, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and/or condition, to treat, improve symptoms of, diagnose, prevent, and/or delay the onset of the infection, disease, disorder, and/or condition.
  • a therapeutically effective amount is provided in a single dose.
  • a therapeutically effective amount is administered in a dosage regimen comprising a plurality of doses.
  • a unit dosage form may be considered to comprise a therapeutically effective amount of a particular agent or entity if it comprises an amount that is effective when administered as part of such a dosage regimen.
  • treatment or treating denote an approach for obtaining a beneficial or desired result including and preferably a beneficial or desired clinical result.
  • beneficial or desired clinical results include, but are not limited to, one or more of the following: reducing the proliferation of (or destroying) cancerous cells or other diseased, reducing metastasis of cancerous cells found in cancers, shrinking the size of the tumor, decreasing symptoms resulting from the disease, increasing the quality of life of those suffering from the disease, decreasing the dose of other medications required to treat the disease, delaying the progression of the disease, and/or prolonging survival of individuals.
  • Tune means to adjust, balance or adapt one thing in response to a stimulus or toward a particular outcome.
  • the SREs and/or DDs of the present invention adjust, balance or adapt the function or structure of compositions to which they are appended, attached or associated with in response to particular stimuli and/or environments.
  • articles such as “a,” “an,” and “the '” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context.
  • the invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process.
  • the invention includes embodiments in which more than one, or the entire group members are present in, employed in or otherwise relevant to a given product or process.
  • any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Since such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the compositions of the invention (e.g., any antibiotic, therapeutic or active ingredient; any method of production; any method of use; etc.) can be excluded from any one or more claims, for any reason, whether or not related to the existence of prior art.
  • a candidate ligand binding domain (LBD) is selected and a cell-based screen using yellow fluorescent protein (YFP) as a reporter for protein stability is designed to identify mutants of the candidate LBD possessing the desired characteristics of a destabilizing domain: low protein levels in the absence of a ligand of the LBD, (i.e., low basal stability), large dynamic range, robust and predictable dose-response behavior, and rapid kinetics of degradation (Banaszynski, etal., (2006) Cell; 126(5): 995-1004).
  • YFP yellow fluorescent protein
  • the candidate LBD sequence (as a template) is first mutated using a combination of nucleotide analog mutagenesis and error-prone PCR, to generate libraries of mutants based on the template candidate domain sequence.
  • the libraries generated are cloned in-frame at either the 5'- or 3'-ends of the YFP gene, and a retroviral expression system is used to stably transduce the libraries of YFP fusions into NIH3T3 fibroblasts.
  • the transduced NIH3T3 cells are subjected to three to four rounds of sorting using fluorescence-activated cell sorting (FACS) to screen the libraries of candidate DDs.
  • FACS fluorescence-activated cell sorting
  • Transduced NIH3T3 cells are cultured in the absence of the high affinity ligand of the ligand binding domain (LBD), and cells that exhibit low levels of YFP expression are selected through FACS.
  • the selected cell population is cultured in the presence of the high affinity ligand of the ligand binding domain for a period of time (e.g., 24 hours), at which point cells are sorted again by FACS.
  • Cells that exhibit high levels of YFP expression are selected through FACS and the selected cell population is split into two groups and treated again with the high affinity ligand of the ligand binding domain at different concentrations; one group is treated with the lower concentration of the ligand and the other is treated with a high concentration of the ligand, for a period of time (e.g., 24 hours), at which point cells are sorted again by FACS.
  • Cells expressing mutants that are responsive to lower concentrations of the ligand are isolated.
  • the selected cell population is subject to additional one or more sorts by FACS in the absence of high affinity ligand of LBD and cells that exhibit low levels of YFP expression are selected for further analysis.
  • Cells are treated with high affinity ligand of the ligand binding domain, for a period of time (e.g. 24 hours), and sorted again by FACS.
  • Cells expressing high levels of YFP are selected for through FACS.
  • Cells with high expression of YFP are treated with ligand again and cells exhibiting low fluorescence levels are collected 4 hours following removal of the ligand from the media to enrich cells that exhibit fast kinetics of degradation. Any of the sorting steps may be repeated to identify DDs with ligand dependent stability.
  • the cells are recovered after sotting.
  • the identified candidate cells are harvested and the genomic DNA is extracted.
  • the candidate DDs are amplified by PCR and isolated.
  • the candidate DDs are sequenced and compared to the LBD template to identify the mutations in candidate DDs.
  • FKBP L106P
  • ecDHFR R12Y, Y 1001
  • fusion partners e.g., a POI
  • Shield- 1 that binds to FKBP DDs and TMP or MTX that binds to DHFR DD.
  • An IL2 polypeptide was linked to either FKBP (F36V; L106P) or ecDHFR (R12Y, Y100I).
  • IL2 constructs were packaged into pLVX-lRES-Puro lentiviral vectors.
  • An IL2 signal sequence was inserted at the N terminus of the construct and linkers were placed between the signal sequence, the DD and IL2.
  • OT-IL2-001 FKBP was transduced into human colorectal carcinoma line, HCT-116.
  • HCT-116 human colorectal carcinoma line
  • IL2 ELISA Figure 13
  • IL2 increased with increase in Shield- 1 concentration and plateaued at higher Shield- 1 dose levels.
  • the half maximal effective concentration or ECso of Shield- 1 was determined to be 50 nM.
  • the goal of the study was to determine the T cell stimulation regimen and dose of IL12 required to maximize T cell persistence and T cell differentiation in vitro.
  • the study recapitulates the design of the adoptive cell therapy regimen wherein the T cells were initially exposed to the antigen in vitro which results in activation followed by a resting phase and finally in vivo transfer where the T cells encounter the antigen again.
  • T cells were stimulated CD3/CD28 beads or soluble CD3/CD28 on day 0 and the CD3/CD28 stimulus was washed off at the end of 48 hours. Cells were treated with a dose of IL12 ranging from 0.01- 1000 ng mL.
  • the Thl phenotype of the cells was evaluated by examining the frequency of IFNgamma positive CD4+ cells and CD8+ cells.
  • cells were divided into two groups- one group received a second CD3/CD28 stimulation and a second group that was not stimulated.
  • the Thl phenotype was evaluated in both groups using FACS. The results for day 16 are presented in Figure 14.
  • IFN gamma expression was higher in cells that received a CD3/CD28 re stimulation on day 14 compared to cells that did not receive second stimulation. This indicates that both antigen re stimulation and IL12 exposure were required for the Thl phenotype. Further, as little as 0.1 ng/mL of IL12 was able to cause Thl - skewing and IFN gamma production from T cells in vitro, and higher doses of IL12 further improved this effect.
  • Example 4 Measuring human T cell responses in vitro and in vivo
  • 1L12 promotes the differentiation of naive T cells into Thl cells which results in the secretion of IFN gamma from T cells.
  • Human T cells were treated with IL12 or left untreated and analyzed by flow cytometry for the expression of IFN gamma and T cell marker CD3.
  • Treatment with IL12 resulted in the differentiation of T cells as measured by an increase in the percentage of IFN gamma positive T cells from 0.21 to 22.3 (see inset of Figure 15A).
  • OT-IL15-008 membrane bound IL15/IL15Ra fusion protein
  • human T cells were transduced with the construct. T cell proliferation was measured by evaluating forward and side scatter of the T cell population using flow cytometry. Transduction with membrane bound IL15/IL15Ra fusion construct resulted in the expansion of human T cells (58.9) compared to control untransfected cells (37.8) ( Figure 15B).
  • mice were euthanized 168 hours after cell transfer and the bone marrow and spleen were harvested. Immune cells were isolated from all samples and analyzed for the presence of human T cells using CD3 and CD45 cell surface markers. As shown in Figure ISC, the percentage of CD3 positive, CD4S positive human T cells in the blood was higher in animals injected with human T cells, especially at 120 and 168 hours. CD3 positive, CD45 positive human T cells were also detected in the spleen and bone marrow of animals injected with human T cells. As expected no CD3 positive, CD45 positive human T cells were detected in control animals that were not injected with human T cells.
  • CD4 and CD8 T cells were analyzed for surface expression of CD45RA and CD62L. Both markers are highly expressed in naive T cells but are lost as the T cells become antigen exposure. As shown in Figure 15D, human CD4 and CD8 T cells showed high surface expression of both markers prior to injecting into mice, but was lost 48 hours after in vivo cell transfer indicating that the human T cells are exposed to the antigen in vivo.
  • a luciferase polypeptide was linked to either F BP (F36V, L106P or F36V, E31G, R71G, K105E) or ecDHFR (R12Y, Y100I) and cloned into pLVX.IRES. Pure vector.
  • DD regulated luciferase can be used to track cells in vivo e.g. T cells. Firefly luciferase or Renilla luciferase may be utilized as the payload. HCT-116 cells were stably transduced with the constitutive (OT-RLuc-001) or DD regulated constructs (OT-RLuc-002, OT-RLuc-003, OT- RLuc-004, OT-RLuc-005 and OT-RLuc-006).
  • luciferase expression was measured via western blotting using anti-ReniUa luciferase and anti-Firefly luciferase antibodies (Abeam, Cambridge, UK). Blots were also probed with anti-GAPDH antibody to ensure uniform protein loading in all samples. As shown in Figure 16A, OT-RLuc-003 showed strong Shield-1 dependent stabilization of Renilla luciferase.
  • OT-RLuc-004, 005 and 006 showed modest stabilization of Renilla luciferase in the presence of their corresponding ligand, while OT-FLuc- 002 showed modest stabilization of firefly luciferase with the addition of Shield-1.
  • the constitutive luciferase construct (OT-RLuc-001) showed expression of Renilla luciferase both in the presence and absence of ligand. ( Figure 16A).
  • DD-IL2 function is characterized in vivo by evaluating the ability of tumor cells expressing these constructs to establish tumors and proliferate under the treatment of corresponding synthetic ligands e.g. Shield-1, Trimethoprim or Methotrexate.
  • corresponding synthetic ligands e.g. Shield-1, Trimethoprim or Methotrexate.
  • 2-10 million HCT- 116 cells stably transduced with the constructs are subcutaneously xenografted with matrigel into mice that capable of producing functional B and NK cells.
  • mice are dosed with corresponding stabilizing ligands e.g. Shield-1, Trimethoprim or Methotrexate at varying concentrations every two days.
  • Shield-1 is injected with a carrier consisting of
  • HCT-116 cells stably transduced with DD-1L2 constructs are pretreated with corresponding stabilizing ligands, Shield- 1, Trimethoprim or Methotrexate and subsequently xenografted into mice. Reduction in tumor growth and a concomitant increase in IL2 levels in ligand treated mice compared to untreated controls is indicative conditional regulation of IL2 in vivo.
  • a caspase 9 polypeptide was linked to the N or C-terminus of FKBP, ecDHFR and hDHFR DDs and cloned into pLVX.IRES. Puro vectors.
  • HEK-293T cells are plated in a 6-well plate in growth media containing DMEM and 10 FBS and incubated overnight at 37°C, 5% C02.
  • Cells are transiently transfected with lOOng of DD-Caspase 9 constructs using Lipofectamine 2000 and incubated for 48 hrs.
  • growth media is exchanged for media containing ligands (Trimethoprim, Methotrexate, or Shield-1, depending on the construct used).
  • ligands Trimethoprim, Methotrexate, or Shield-1, depending on the construct used.
  • Immune cells such as T cells and NK cells are isolated from syngeneic mice and transduced with DD regulated payloads such as DD-1L2, and DD caspase9. Cells are then injected into mice bearing subcutaneous syngeneic tumors and treated with varying concentrations of ligand, Shield- 1, Trimethoprim or Methotrexate, depending on the DD used. Mice treated with immune cells transduced with DD regulated payload are expected to have a reduced tumor burden when compared to control animals.
  • DD-Interleukin e.g. DD-IL2 and DD Caspase9 or DD FOXP3 constructs.
  • Transfected cells are treated with stabilizing ligands depending on the DD utilized.
  • DD-IL2 expression in the media is measured by ELISA.
  • FOXP3 and caspase 9 expression are evaluated by immunoblotting for FOXP3 and caspase 9 respectively.
  • Example 10 In vivo tracking of DD hiciferase cells
  • DD hiciferase constructs can be utilized as an optical reporter to asses if the ligand and/or the cells expressing the DD constructs reach the targeted tissue. It may also be utilized to study pharmacokinetic and pharmacodynamic (PK/PD) relationships in the context of DD. PK/PD depends on (i) the PK of the stabilizing ligand (ii) behavior of the DD in a specific cell type (iii) cargo protein behavior; some of which may be studied by utilizing the DD regulated hiciferase constructs. DD hiciferase constructs are expressed or co-expressed in cells of interest such as primary T cells or cell lines e.g.
  • mice are treated with the corresponding ligand or vehicle control. 8-24 hours following ligand injection, mice are injected with D-Luciferin when the payload is firefly hiciferase and Coelentrazin when the payload is Renilla hiciferase. Animals are anesthetized and imaged using the Bioluminescence imager (PerkinElmer, Massachusetts). The hiciferase output of ligand injected mice is compared to control mice and the signal is quantitated using image analysis software (PerkinElmer, Massachusetts). Luciferase signal is expected to be much higher than background in mice treated with ligand compared to mice treated with vehicle control.
  • Immune cells such as Natural Killer cells depend on cytokines such as IL2 for their proliferation and survival. This dependence on cytokines can be used to test the functionality of DD regulated or constitutively expressed cytokines and cytokine fusion proteins.
  • NK-92 cell activation in response to cytokine treatment was evaluated by FACS analysis of a panel of markers whose increased expression is associated with NK activation. These include NKG2D, CD71, CD69; chemokine receptors such as CCR5, CXCR4, and CXCR3, Perforin, Granzyme B and Interferon gamma (IFNg).
  • NK cells Prior to FACS for IFNg, cells were cultured for 4 hours with Brefeldin A. IFNg levels were also measured in the media. NK cells respond to external stimuli such as cytokines in their environment through the phosphorylation of proteins JAK/STAT, ERK, and p38/MAPK pathways which are important for cell activation, signalling and differentiation pathways. The phosphorylation of AKT, STAT3 and STAT5 in response to cytokine addition was measured by FACS. Since phosphorylation events are transient NK-92 cells were treated with the cytokines for 15 or 60 minutes, prior to the analysis. The fold change in mean fluorescence intensities compared to untreated for IL2 treatment for select markers are presented in Table 15.
  • NK-92 cells natural killer cell line
  • T cell lines Jurkat cells and SupTl cells.
  • IL2 or IL15 were seeded at 40,000 per well and cultured in the presence of IL2 or IL15 for 3 days.
  • the number of NK-92 cells decreased with time in the untreated cells.
  • treatment with IL2 increased cell numbers.
  • the cell numbers obtained with cytokine treatment in SupTl and Jurkat cells was comparable to the untreated control.
  • NK-92 cells depend on cytokines for survival.
  • a fusion molecule is generated by fusing full length or truncated (FOXP3A2) and DDs such as ecDHFR (DD) or FKBP (DD). These fusion molecules were cloned into pLVX-IRES- Puro vectors.
  • HEK-293T cells were plated in a 6-well plate in growth media containing DMEM and 10% FBS and incubated overnight at 37°C, 5% C02. Cells were transfected with the constructs using Lipofectamine 2000 and incubated for 24 hrs. Following the incubation, media was exchanged for growth medium with or without ⁇ Trimethoprim or ⁇ Shield- 1 and further incubated for 24 hrs. Cells were harvested and FOXP3 levels were analyzed via western blotting using anti FOXP3 antibody (Abeam, Cambridge, UK).
  • OT-FOXP3-003, and OT-FOXP3-007 showed the strongest Shield- 1 dependent stabilization of FOXP3, while OT-FOXP3-008 showed the strongest Trimethoprim dependent stabilization of FOXP3 ( Figure 17A and Figure 17B).
  • Constructs OT-FOXP3-004 and OT-FOXP3-009 showed modest TMP and shield- 1 dependent stabilization.
  • T cells derived from two different donors were stimulated with CD3/CD28 and treated with ligand TMP at doses ranging from 0.04 ⁇ to 160 uM or with control vehicle (DMSO).
  • DMSO control vehicle
  • the percentage of divided cells within the CD4 and the CD8 populations of T cells was measured using FACS. Concentrations of TMP ranging from 0.04 ⁇ to 40 ⁇ showed no effect on the percentage of divided cells within the CD8 and CD4 populations, while 160 ⁇ concentration of TMP resulted in an 70-90% reduction in the percentage of divided cells.
  • the optimal concentration of TMP for T cell-based experiments was determined to be less than 160 ⁇ .
  • SREs expressed in a vector can be driven either by the retroviral long terminal repeat (LTR) or by cellular or viral promoters located upstream of the SRE.
  • LTR retroviral long terminal repeat
  • the activity of the promoter may vary with the cell type and thus promoter selection must be optimized for each cell type.
  • AcGFP SEQ ID No. 2283 was cloned into pLVX.
  • IRES Puro construct with a CMV or an EFla promoter.
  • Patient-derived T cells and Sup Tl cells were transduced with the constructs and GFP expression was measured at day 3 and day 5 after transduction using FACS.
  • both the CMV promoter and the EFla promoter can drive the expression of GFP in SupTl cells and T cells.
  • the percentage of GFP positive T cells was higher when the GFP expression was driven by CMV promoter compared to an EFla promoter, both at 3 days and 6 days after transduction.
  • the percentage of GFP positive cells was much higher when GFP expression was driven by the EFla promoter compared to the CMV promoter.
  • the optimum promoter suitable for expression differs based on the cell type.
  • HLA-A02 histocompatibility group HLA-A02 has been associated with the decreased risk of developing EBV positive Hodgkin's lymphoma, suggesting that the CTL peptide epitopes that promote viral clearance are presented by HLA-A02.
  • Primary human T cells obtained from various donors are expanded with CD3/CD28 dynabeads.
  • EBV antigen EBV positive Raji cells and EBV negative Ramos cells are used.
  • the involvement of HLA-A02 in antigen recognition is tested using anti-HLA antibodies to test assay specificity.
  • Cell killing assays are performed by incubating T cells with fluorescently labelled Raji cells or Ramos cells and the ability of the donor T cells to preferentially kill Raji cells is evaluated.
  • the activation of T cells in response to interaction with EBV antigen is measured by culturing mitomycin treated Raji or Ramos cells with fluorescently labelled T cells.
  • the activation and proliferation status of T cells is examined by measuring expression of IFNg, CD 107a, Granzyme, and Perforin. Since most humans have been exposed to EBV, the donor T cells in most instances are expected to be immunoreactive to Raji cells, but not Ramos cells. It is likely that T cells reactive to Raji cells will be positive for markers of T cell activation such as Granzyme and Perforin.
  • Example 16 Ligand dependent IL2 stabilization in vivo
  • IL2 polypeptide was linked to either FKBP (F36V; L106P) or ecDHFR (R12Y, Y100I).
  • FKBP F36V; L106P
  • ecDHFR R12Y, Y100I
  • IL2 constructs were packaged into pLVX-IRES-Puro lenti viral vectors.
  • An IL2 signal sequence was inserted at the N terminus of the construct and linkers were placed between the signal sequence, the DD and IL2.
  • OT-IL2-001 FKBP was transduced into human colorectal carcinoma line, HCT-116. 1L2 expression in vitro was confirmed by ELISA.
  • 5 million HCT 116 cells transduced with IL2 constructs were injected subcutaneously into the flanks of immunocompromised mice. Approximately, two weeks after injection, when the tumors reach a size of approximately 300 cubic mm, mice are dosed with corresponding stabilizing ligands or corresponding vehicle control.
  • Shield- 1 is injected with a carrier consisting of 10%Dimethylacetamide, 10% Solutol HS1S, and 80% saline at a concentration of lOmg/kg body weight.
  • mice were euthanized at tumor and plasma samples were collected and analyzed for IL2 levels.
  • Tumor 1L2 levels were measured by ELISA as picograms per mg of protein.
  • tumor IL2 levels detected with Shield- 1 treatment was higher than levels detected with vehicle control.
  • the T cell expansion and transduction protocol consists of stimulating donor derived human T cells on day zero with aCD3/aCD28 bead stimulation to promote T cell proliferation.
  • T cells were transduced with the construct of choice and expanded for up to day 11 with occasional media changes.
  • the beads were washed out and the cells were frozen in aliquots for use in various functional assays.
  • the process of T cell expansion and transduction requires optimization to ensure the exponential proliferation of T cells, following the initial 4- day lag in growth of the T cells which is caused by the viral transduction.
  • Unoptimized expansion protocol may result in static growth for up to 10 days requiring instead 21 days to achieve similar expected T cell number and a concomitant reduction in viability and abnormal CD4 to CD8 T cell ratio.
  • aCD3/aCD28 beads from different sources were utilized. These included dynabeads (ThermoFisher, Waltham, MA), CD3/CD28 +/- CD2 with anti-Biotin MACSiBead (Miltenyi Biotec, Germany), Macrobeads - 3um magnetic polymer beads with aCD3/aCD28 antibody coating, soluble tetrameric antibody complexes of aCD3/aCD28 (StemCell, Canada). Bead and T cells were mixed at 3:1, 1:1, 1:3 and 1:9 ratios to identity optimal ratios for co-culture.
  • Assays were also performed using two separate donors to account for donor related variabilities. Percentage cell viability was measured at 0, 4 and 7 days. As shown in Figure 20, both donors showed improved cell viability counts at 1:3 bead to cell ratio compared to all other conditions, especially at day 4. One of the donors also showed improved cell viability at with 1:9 bead to cell ratio. Cell number counts were performed using both the cellometer and flow cytometry analysis. Fortius analysis, cells were infected with viruses at MOI of 10 and compared to mock (Lentiboost (LB) transduced cells to examine the effects of viral transduction on T cell counts. The fold change in cell growth at day 4 and day 7 compared to growth at day 0 was analyzed and the results from the cellometer counts are represented in Table 16.
  • Donor 1 showed CD4 to CD8 ratio close to 3 when a bead to cell ratio of 1 :9 was used. Similar results were obtained for donor 2 when a bead to cell ratio of 1:3 was used.
  • a BCMA CAR fusion polypeptide was linked to either to the N terminus of the FKBP- DD, ecDHFR-DD or human DHFR-DD and the constructs were cloned into pLVX-IRES-Puro vector under the transcriptional control of EF la promoter.
  • DD-BCMA CAR constructs To test ligand dependent expression of DD-BCMA CAR constructs, 1 million HEK HCT116 cells were cultured in growth medium containing DMEM and 10% FBS and transfected with CAR constructs using Lipofectamine 2000 or LentiBoost. 48 hours after transfection, cells were treated with luM ⁇ Shield- 1, 10 ⁇ Trimethoprim, luM Methotrexate, or vehicle control and incubated for 24 hours.
  • Surface expression of DD-BCMA CAR constructs in HCT116 cells was measured using Fluorescence activated cell sorting (FACS) with Protein L- Biotin-Strepavidin-Allophycocyanin which binds to the kappa light chain of the CAR
  • FACS Fluorescence activated cell sorting
  • chimeric antigen receptors described herein such as, but not limited to CD22 CAR, ALK CAR, CD33 CAR, HER2 CAR and GD2 CAR constructs are fused to destabilizing domains such as ecDHFR DD, FKBP DD and hDHFR DDs.
  • destabilizing domains such as ecDHFR DD, FKBP DD and hDHFR DDs.
  • immune cells are cultured in growth medium containing DMEM and 10% and transduced are transduced with the CAR constructs. 48 hours after transduction, cells are treated with the ligand corresponding to the DD such as ⁇ ⁇ Shield-1, ⁇ Trimethoprim, ⁇ Methotrexate, or vehicle control and incubated for 24 hours.
  • Cells are then analyzed by western blot using the CD3 Zeta, a component of the CAR.
  • Surface expression of the CAR is analyzed by FACS using Protein L. Intracellular and surface expression of CARs is expected to be undetectable in the absence of ligand, but strongly induced by the presence of the ligand.
  • target cells expressing DD regulated CAR constructs in functionally interacting with target cells are evaluated.
  • the chosen target cells express the antigen related to the CAR either naturally or ectopically.
  • target cells which have high endogenous expression of BCMA include KMS11, MM- IS, RPMI-8226 cells; target cells expressing CD33 include HL-60, MOLM13, MOLM14 cells.
  • target cell lines may be engineered to ectopically express the antigen in cell lines that have low endogenous expression of the antigen.
  • Target cells Prior to co culture, the target cells are optionally cultured in the presence of mitomycin C to prevent target cell proliferation. This ensures that target cell growth does not out compete T cell growth. Cytotoxicity assays are used to measure the ability of T cells induce target cell death.
  • Target cells are engineered to express Renilla or Firefly luciferase and co cultured with T cells expressing DD regulated CAR constructs for 18 to 24 hours in the presence of the ligand related to the DD or vehicle control. At the end of co culture, cells are lysed and luciferase activity is measured using appropriate substrate.
  • Luciferase activity is expected to increase when DD regulated CAR expressing T cells are co cultured with antigen expressing target cells in the presence of ligand. Cytotoxicity is not expected in vehicle control cells or when the target cells do not express the antigen are utilized.
  • Cytolytic potential of DD CAR expressing cells is evaluated in primary human T cells or human cell lines (e.g. NALM6, K562 and Raji) using Chromium-51 Release Assay.
  • Target cells are loaded with of Naa 51 Cr04, washed twice and re suspended in phenol red-free growth medium. Untreated or ligand treated DD CAR and mock transduced cells are co-incubated with cognate antigen expressing target cells at various effector: target cell ratios, and chromium release into the supernatant is measured using a liquid scintillation counter.
  • Cells with DD CAR are expected to demonstrate specific cytolysis only in the presence of ligand.
  • Cells with DDCAR in the absence of ligand or mock transfected cells are expected to show minimal cytolytic activity.
  • Activation of T cells results in degranulation, an exocytic process by which cytotoxic T cells release molecules like perforin and granzymes which enable target cell killing.
  • Degranulation is measured by analysis of media for indications of exocytosis e.g. CD107 by FACS and by markers of degranulation such as perforin and granzyme using immunoassays.
  • T cell proliferation in response to antigen mediated T cell activation is measured by labelling T cells with Carboxyfluorescein succinimidyl ester, which is used to trace cells across multiple generations. Labelled T cells are cultured with Mitomycin treated target cells and cell proliferation is tracked over a period of 3 to 5 days. T cell proliferation and activation is expected to increase when DD regulated CAR expressing T cells are co cultured with cognate antigen expressing target cells in the presence of ligand. Both parameters are not expected in to change in vehicle control cells or when the target cells do not express antigen are utilized.
  • mice are injected intravenously with antigen positive target cells. Following injections, mice are treated with untransduced mock T cells or T cells that are transduced with antigen specific chimeric antigen receptors. Mice are then split into two cohorts; one cohort is treated with the ligand specific to the SRE and the second cohort which is treated with the vehicle control. Survival of the mice is monitored for up to 80 days after the administration of target cells. Tumor bearing mice treated with CAR transduced T cells and the ligand, are expected to survive longer than mice treated with untransduced cells; vector control transduced T cells or vehicle control.
  • mice are injected orthotopically with antigen positive target cells on day 0. The mice are then treated with cyclophosphamide intraperitoneally on day 3. Cells are treated with antigen specific CAR construct. The mice are treated with recombinant interleukin 7 or interleukin 7 complexed with IL7 antibody, two-three times a week for three weeks to promote T cell persistence. Mice are then split into two cohorts; one cohort is treated with the ligand specific to the SRE and the second cohort which is treated with the vehicle control. The size of the tumors is measured at various time points after inoculation. Mice treated with antigen specific CAR and the ligand are expected to be tumor free while mice treated with mock transduced cells, or vehicle controlled cells are predicted to succumb to the tumors
  • mice are orthotopically inoculated with antigen positive T cells expressing luciferase. Tumors are allowed to grow for 8 days, and the growth is monitored using bioluminescent imaging. On day 8, after tumor inoculation, CAR transduced cells are injected intravenously with or without cytokine and cytotoxic therapy augmentation. Concurrent ligand or vehicle control treatment is also initiated. Mice treated with CAR T cells are expected to show tumor regression and long term disease control in the presence of ligand, whereas all mice treated with mock transduced cells are expected to succumb to progressive tumor growth.
  • Primary T cells are activated using soluble CD3/CD28 or CD3/CD28 dynabeads. 24 hours later, cells are transduced with DD regulated CD 19 CAR constructs and allowed to rest for 24 hours. Cells are then treated with the ligand specific to the SRE or vehicle control. At day 4, the CD3/CD28 beads are removed and the cells are cultured for another 3 days. At day 7, cells are washed extensively to remove the ligand and replated in the absence of the ligand and cultured for 3 days. At day 10, cells were washed and replated in the absence of ligand. A sample of the cells are analyzed at day 10 for phenotypic and functional markers associated with exhaustion.
  • T cells cultured for the duration of the experiment either in the presence or absence of ligand are included as controls.
  • Phenotypic markers for exhaustion such as PD1, ⁇ 3, LAG3, BTLA, CD160, 2B4, and CD39a are measured both in CD4 and CD8 T cell populations. Since chronic T cell activation has been shown to result in T cell exhaustion, T cells cultured under the continuous presence of ligand throughout the experiment are expected to be positive for multiple markers of exhaustion.
  • T cells cultured in the absence of ligand throughout the experiment are expected to negative for multiple markers of exhaustion, since the expression of the CAR will be undetectable/low in the absence of ligand.
  • cells where the ligand is removed at day 7 are expected to have a lower percentage of cells that are positive for multiple exhaustion markers when compared to cells that have been treated with ligand throughout the duration of the experiment. This result is expected in both CD8 and CD4 population of T cells.
  • Example 21 Dual specific chimeric antigen receptor
  • Human T cells are transduced with a lentiviral vector encoding dual specific chimeric antigen receptors.
  • Dual specific CARs targets include, but not limited to GD2, CD33, BCMA, Her2, ALK, CD22 and CD276.
  • Cells are cultured in the presence of ligand or vehicle control for 24-48 hours. Additional controls such as human T cells that are mock transduced or transduced with a vector encoding septicity to one antigen only are included.
  • CAR expression is evaluated by flow cytometry using anti-idiotype CAR antibody.
  • T cells are also analyzed for proliferation, markers of apoptosis and memory phenotype.
  • Cells are cultured per methods described above.
  • Ligand is removed either at day 7 or day 10 and cells are analyzed at day 14 for apoptosis using Annexin V staining and for the memory phenotype using CD62L as the marker.
  • cells continuously treated with ligand are expected to show an increase in apoptotic cells, a decrease in proliferation and a decrease in CD62L expression, which are indicative of T cell exhaustion.
  • Ligand withdrawal at day 7 or day 10 is expected to show low Annexin V and high CD62L expression, and an increase in proliferation similar to untreated cells.
  • Primary T cells are activated using soluble CD3/CD28 or CD3/CD28 dynabeads. 24 hours later, cells are transduced with DD regulated CD 19 CAR constructs and allowed to rest for 24 hours. Cells are then treated with the ligand specific to the SRE or vehicle control. At day 4, the CD3/CD28 beads are removed and the cells are cultured for another 3 days. At day 7, cells are washed extensively to remove the ligand and replated in the absence of the ligand and cultured for 3 days. At day 10, cells were washed and replated in the absence of ligand. A sample of the cells are analyzed at day 10 for phenotypic and functional markers associated with exhaustion.
  • T cells cultured for the duration of the experiment either in the presence or absence of ligand are included as controls.
  • Phenotypic markers for exhaustion such as PD1, ⁇ 3, LAG3, BTLA, CD160, 2B4, and CD39a are measured both in CD4 and CD8 T cell populations. Since chronic T cell activation has been shown to result in T cell exhaustion, T cells cultured under the continuous presence of ligand throughout the experiment are expected to be positive for multiple markers of exhaustion.
  • T cells cultured in the absence of ligand throughout the experiment are expected to be negative for multiple markers of exhaustion, since the expression of the CAR will be undetectable low in the absence of ligand.
  • cells where the ligand is removed at day 7 are expected to have a lower percentage of cells that are positive for multiple exhaustion markers when compared to cells that have been treated with ligand throughout the duration of the experiment. This result is expected in both CD8 and CD4 population of T cells.
  • T cells are also analyzed for proliferation, markers of apoptosis and memory phenotype.
  • Cells are cultured per methods described above.
  • Ligand is removed either at day 7 or day 10 and cells are analyzed at day 14 for apoptosis using Annexin V staining and for the memory phenotype using CD62L as the marker.
  • cells continuously treated with ligand are expected to show an increase in apoptotic cells, a decrease in proliferation and a decrease in CD62L expression, which are indicative of T cell exhaustion.
  • Ligand withdrawal at day 7 or day 10 is expected to show low Annexin V and high CD62L expression, and an increase in proliferation similar to untreated cells.
  • Example 23 Functional analysis of reversal of T cell exhaustion
  • T cells expressing DD regulated CAR constructs are co cultured with target cells expressing the antigen (endogenously or ectopically). T cells are activated at day 0 using CD3/CD28 beads. 24 hours later, cells are transduced with DD regulated CAR constructs and allowed to rest for 24 hours. Cells are then treated with the ligand specific to the SRE or vehicle control. At day 4, the CD3/CD28 beads are removed and the cells are cultured for another 3 days. At day 7, cells are washed extensively to remove the ligand and replated in the absence of the ligand and cultured for 3 days.
  • cells are treated with ligand till day 10 instead of day 7.
  • T cells cultured for the duration of the experiment either in the presence or absence of ligand are included as controls.
  • Supernatant was collected from cells after 24 hours and IL2 and IFNg levels were measured as a read out of T cell function.
  • cells continuously treated with ligand are expected to show an increase in 1L2 and IFNg expression at day 14, which are indicative of functional T cells.
  • Ligand withdrawal at day 7 or day 10 is expected to minimally affect the levels of IFNg and IL2 levels.
  • T cells treated with ligand till day 10 are sorted and selected for cells that are positive for chimeric antigen receptor as well as multiple exhaustion makers (e.g. PD1, TIM3, LAG3).
  • the cells are divided into two groups, one group is treated with ligand, while the second group is treated with vehicle control.
  • Functionality of T cells is measured using IL2 levels as a surrogate.
  • Ligand withdrawal is predicted to reverse T cell exhaustion, and hence cells subject to ligand withdrawal at day 10 are expected to have higher IL2 levels compared to ligand treated cells.
  • the biocircuits of the invention comprise multiple modules which can be optimized. Libraries of each of the components is generated to allow for the rapid generation of new constructs with desired behaviors.
  • Ligand pharmacokinetics is a powerful tool for payload specific tuning in vivo, which can be used to shift the ligand response curve of the effector module to the left or right depending on the modulating factors. Several modulating factors are tested, including, but not limited to the ligand dose, concentrations, magnitude, duration, and route of administration.
  • Destabilizing domains can also be modified to improve biocircuit behavior. The destabilizing domain is the core determinant of the dynamic range of the biocircuit. Depending on the DD selected, the ligand response curve of the effector module can be shifted up or down.
  • DD position of the DD within the effector module as well as the number of DDs within an effector module are modified. DD selection is also altered depending on its degradation kinetics desired. Promoters that transcriptionally control the expression of the SREs are optimized. Choice of promoter impacts the basal-off state and affects the dynamic range of stabilization. Further, promoter choice contributes to the extent of stabilized payload produced. Other optimizable elements of the biocircuits include vector, translational elements, leader sequence, placement of the components within the SRE, codon selection, protease sites, linkers, and mRNA stability.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicinal Preparation (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2018/020704 2017-03-03 2018-03-02 Compositions and methods for immunotherapy Ceased WO2018160993A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
AU2018226857A AU2018226857B2 (en) 2017-03-03 2018-03-02 Compositions and methods for immunotherapy
CN201880029032.0A CN110913954A (zh) 2017-03-03 2018-03-02 免疫疗法的组合物和方法
EP18761512.5A EP3589373A4 (en) 2017-03-03 2018-03-02 COMPOSITIONS AND METHODS FOR IMMUNOTHERAPY
JP2019568591A JP7660343B2 (ja) 2017-03-03 2018-03-02 免疫療法のための組成物及び方法
CA3055200A CA3055200A1 (en) 2017-03-03 2018-03-02 Compositions and methods for immunotherapy
US16/558,224 US11629340B2 (en) 2017-03-03 2019-09-02 DHFR tunable protein regulation
US17/646,212 US12104178B2 (en) 2017-03-03 2021-12-28 DHFR tunable protein regulation
US18/787,024 US20240401004A1 (en) 2017-03-03 2024-07-29 Dhfr tunable protein regulation
JP2024182138A JP2025013868A (ja) 2017-03-03 2024-10-17 免疫療法のための組成物及び方法

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201762466601P 2017-03-03 2017-03-03
US62/466,601 2017-03-03
US201762484063P 2017-04-11 2017-04-11
US62/484,063 2017-04-11
US201762542402P 2017-08-08 2017-08-08
US62/542,402 2017-08-08

Related Child Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2018/020768 Continuation WO2018161038A1 (en) 2017-03-03 2018-03-02 Il12 compositions and methods for immunotherapy
US16/558,224 Continuation US11629340B2 (en) 2017-03-03 2019-09-02 DHFR tunable protein regulation

Publications (1)

Publication Number Publication Date
WO2018160993A1 true WO2018160993A1 (en) 2018-09-07

Family

ID=63370245

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/020704 Ceased WO2018160993A1 (en) 2017-03-03 2018-03-02 Compositions and methods for immunotherapy

Country Status (6)

Country Link
EP (1) EP3589373A4 (https=)
JP (3) JP7660343B2 (https=)
CN (1) CN110913954A (https=)
AU (1) AU2018226857B2 (https=)
CA (1) CA3055200A1 (https=)
WO (1) WO2018160993A1 (https=)

Cited By (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018237323A1 (en) * 2017-06-23 2018-12-27 The Board Of Trustees Of The Leland Stanford Junior University Pde5a destabilizing domains
WO2020056045A1 (en) 2018-09-13 2020-03-19 Nkarta, Inc. Natural killer cell compositions and immunotherapy methods for treating tumors
WO2020069005A1 (en) * 2018-09-28 2020-04-02 Harrow Health, Inc. Pharmaceutical compositions for prevention or treatment of cytokine release syndrome
US10704021B2 (en) 2012-03-15 2020-07-07 Flodesign Sonics, Inc. Acoustic perfusion devices
WO2020185632A1 (en) * 2019-03-08 2020-09-17 Obsidian Therapeutics, Inc. Human carbonic anhydrase 2 compositions and methods for tunable regulation
WO2020185628A1 (en) 2019-03-08 2020-09-17 Obsidian Therapeutics, Inc. Cd40l compositions and methods for tunable regulation
US10785574B2 (en) 2017-12-14 2020-09-22 Flodesign Sonics, Inc. Acoustic transducer driver and controller
WO2021040736A1 (en) 2019-08-30 2021-03-04 Obsidian Therapeutics, Inc. Tandem cd19 car-based compositions and methods for immunotherapy
US10975368B2 (en) 2014-01-08 2021-04-13 Flodesign Sonics, Inc. Acoustophoresis device with dual acoustophoretic chamber
US10993967B2 (en) 2018-10-17 2021-05-04 Senti Biosciences, Inc. Combinatorial cancer immunotherapy
CN112795543A (zh) * 2021-02-04 2021-05-14 华中农业大学 杂交瘤细胞株及其分泌的抗草鱼IL-15Rα单克隆抗体和应用
US11058725B2 (en) 2019-09-10 2021-07-13 Obsidian Therapeutics, Inc. CA2 compositions and methods for tunable regulation
WO2021079002A3 (en) * 2019-10-24 2021-07-22 Novago Therapeutics Ag Novel antibodies for neural repair and treatment of stroke
WO2021202581A1 (en) * 2020-03-30 2021-10-07 WUGEN, Inc. Engineered immune cells for adoptive cell therapy
US11214789B2 (en) 2016-05-03 2022-01-04 Flodesign Sonics, Inc. Concentration and washing of particles with acoustics
JP2022512161A (ja) * 2018-12-11 2022-02-02 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア 免疫療法のための組成物及び方法
US11241485B2 (en) 2017-06-12 2022-02-08 Obsidian Therapeutics, Inc. PDE5 compositions and methods for immunotherapy
WO2022060806A1 (en) * 2020-09-16 2022-03-24 Obsidian Therapeutics, Inc. Compositions and methods for expression of anti-bcma chimeric antigen receptors with small molecule-regulated il15 in t cells
CN114317385A (zh) * 2021-11-11 2022-04-12 元本(珠海横琴)生物科技有限公司 一种促进her2亲和体蛋白分泌表达的发酵培养基及发酵工艺
EP3983538A1 (en) * 2019-06-12 2022-04-20 Obsidian Therapeutics, Inc. Ca2 compositions and methods for tunable regulation
JP2022526671A (ja) * 2019-04-11 2022-05-25 エンクリアー セラピーズ, インク. 脳脊髄液の改善の方法ならびにそのためのデバイスおよびシステム
WO2022121860A1 (en) * 2020-12-07 2022-06-16 East China University Of Science And Technology Methods and kits for inducing immunotolerance to gene delivering target vehicle
US11377651B2 (en) 2016-10-19 2022-07-05 Flodesign Sonics, Inc. Cell therapy processes utilizing acoustophoresis
JP2022537052A (ja) * 2019-06-21 2022-08-23 カーナル バイオロジクス, インコーポレイテッド 操作された腫瘍選択的タンパク質発現
US11419898B2 (en) 2018-10-17 2022-08-23 Senti Biosciences, Inc. Combinatorial cancer immunotherapy
US11446332B2 (en) 2017-04-13 2022-09-20 Senti Biosciences, Inc. Combinatorial cancer immunotherapy
US20220378824A1 (en) * 2019-04-30 2022-12-01 Myeloid Therapeutics, Inc. Engineered chimeric fusion protein compositions and methods of use thereof
CN115558641A (zh) * 2022-11-14 2023-01-03 四川新生命干细胞科技股份有限公司 高纯度效应免疫细胞群及其培养方法、试剂组合物和应用
WO2023004461A1 (en) * 2021-07-28 2023-02-02 Prescient Therapeutics Ltd Universal receptor immune cell therapy
JP2023515247A (ja) * 2020-03-31 2023-04-12 ハンミ ファーマシューティカル カンパニー リミテッド 新規な免疫活性インターロイキン2アナログ
CN116082515A (zh) * 2021-11-08 2023-05-09 浙江海隆生物科技有限公司 一种在大肠杆菌中可溶性表达的口蹄疫病毒衣壳融合蛋白及其制备方法
US11708572B2 (en) 2015-04-29 2023-07-25 Flodesign Sonics, Inc. Acoustic cell separation techniques and processes
EP4137510A4 (en) * 2020-04-16 2023-11-01 YiChen Therapeutics Limited PD-1 MUTANT POLYPEPTIDE AND PRODUCTION AND USE THEREOF
CN117986362A (zh) * 2022-11-04 2024-05-07 茂行制药(苏州)有限公司 靶向b7h3的通用型car-t细胞及其制备方法和应用
US12006345B2 (en) 2019-02-21 2024-06-11 Xencor, Inc. Untargeted and targeted IL-10 Fc-fusion proteins
US12012441B2 (en) 2020-10-26 2024-06-18 Neptune Biosciences Llc Engineered human IL-21 cytokines and methods for using the same
WO2024140980A1 (zh) * 2022-12-30 2024-07-04 上药生物治疗(香港)有限公司 表达趋化因子受体的细胞及其用途
WO2024189583A1 (en) 2023-03-15 2024-09-19 Kyoto Prefectural Public University Corporation Peptide expression constructs and uses thereof
US20250032612A1 (en) * 2023-03-10 2025-01-30 The Regents Of The University Of Colorado, A Body Corporate Anti-cd276 and anti-cd99 logic gated chimeric antigen receptors for the treatment of cancer
US12329930B2 (en) 2020-09-29 2025-06-17 Enclear Therapies, Inc. Subarachnoid fluid management method and system
WO2025160432A1 (en) * 2024-01-26 2025-07-31 Poseida Therapeutics, Inc. Methods and compositions for enhancing in vivo persistence and potency of cell therapy
US12398187B2 (en) 2019-03-05 2025-08-26 Nkarta, Inc. CD19-directed chimeric antigen receptors and uses thereof in immunotherapy

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020081841A1 (en) * 2018-10-19 2020-04-23 Regents Of The University Of Minnesota Nk engager molecules and methods of use thereof
CN109735558B (zh) * 2018-12-12 2022-04-15 中南大学 一种重组car19-il24基因、慢病毒载体、car19-il24-t细胞及应用
CN113307870B (zh) * 2020-10-30 2022-12-23 上海洛启生物医药技术有限公司 抗il5纳米抗体及其应用
WO2022132720A1 (en) * 2020-12-14 2022-06-23 Allogene Therapeutics, Inc. Methods and reagents for characterizing car t cells for therapies
CN114685683B (zh) * 2020-12-31 2025-07-08 博生吉医药科技(苏州)有限公司 靶向gd2的car-t细胞及其制备和应用
CN116406426A (zh) * 2021-04-29 2023-07-07 苏州沙砾生物科技有限公司 一种修饰的肿瘤浸润淋巴细胞及其用途
CN115645515A (zh) * 2022-12-28 2023-01-31 北京圣美细胞生命科学工程研究院有限公司 肿瘤治疗组合物及应用、药物组合物和细胞生长抑制方法

Citations (157)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US451A (en) 1837-11-04 Island
US568A (en) 1838-01-09 Sphebometeb for
US596A (en) 1838-02-07 Improvement in machines for making and twisting strands in the process of making rope
US6531A (en) 1849-06-19 Beed musical instrument
US7094A (en) 1850-02-12 Connecting trucks with car-bodies
US7435A (en) 1850-06-18 Attaching neck-yokes to poles of carriages
US4518584A (en) 1983-04-15 1985-05-21 Cetus Corporation Human recombinant interleukin-2 muteins
EP0200280A2 (en) 1985-01-18 1986-11-05 Cetus Oncology Corporation Oxidation resistant IL-2 muteins and their production, formulations containing such muteins, and DNA sequences and expression vectors coding for such muteins and corresponding transformed host cells
US4690915A (en) 1985-08-08 1987-09-01 The United States Of America As Represented By The Department Of Health And Human Services Adoptive immunotherapy as a treatment modality in humans
EP0234599A1 (en) 1982-10-19 1987-09-02 Cetus Oncology Corporation Cysteine-depleted muteins of interleukin-2, their preparation, formulations containing them, and genes, vectors and organisms suitable for use in the preparation of said muteins
US4703004A (en) 1984-01-24 1987-10-27 Immunex Corporation Synthesis of protein with an identification peptide
US4851341A (en) 1986-12-19 1989-07-25 Immunex Corporation Immunoaffinity purification system
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
EP0404097A2 (de) 1989-06-22 1990-12-27 BEHRINGWERKE Aktiengesellschaft Bispezifische und oligospezifische, mono- und oligovalente Rezeptoren, ihre Herstellung und Verwendung
US5011912A (en) 1986-12-19 1991-04-30 Immunex Corporation Hybridoma and monoclonal antibody for use in an immunoaffinity purification system
US5091513A (en) 1987-05-21 1992-02-25 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US5116943A (en) 1985-01-18 1992-05-26 Cetus Corporation Oxidation-resistant muteins of Il-2 and other protein
US5206344A (en) 1985-06-26 1993-04-27 Cetus Oncology Corporation Interleukin-2 muteins and polymer conjugation thereof
WO1993011161A1 (en) 1991-11-25 1993-06-10 Enzon, Inc. Multivalent antigen-binding proteins
WO1994004678A1 (en) 1992-08-21 1994-03-03 Casterman Cecile Immunoglobulins devoid of light chains
WO1994025591A1 (en) 1993-04-29 1994-11-10 Unilever N.V. PRODUCTION OF ANTIBODIES OR (FUNCTIONALIZED) FRAGMENTS THEREOF DERIVED FROM HEAVY CHAIN IMMUNOGLOBULINS OF $i(CAMELIDAE)
US5525491A (en) 1991-02-27 1996-06-11 Creative Biomolecules, Inc. Serine-rich peptide linkers
WO1998011244A2 (en) 1996-09-11 1998-03-19 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Aav4 vector and uses thereof
US5856456A (en) 1992-11-20 1999-01-05 Enzon, Inc. Linker for linked fusion polypeptides
WO1999014346A2 (en) 1997-09-19 1999-03-25 Sequitur, Inc. SENSE mRNA THERAPY
US5994136A (en) 1997-12-12 1999-11-30 Cell Genesys, Inc. Method and means for producing high titer, safe, recombinant lentivirus vectors
US6005079A (en) 1992-08-21 1999-12-21 Vrije Universiteit Brussels Immunoglobulins devoid of light chains
US6013516A (en) 1995-10-06 2000-01-11 The Salk Institute For Biological Studies Vector and method of use for nucleic acid delivery to non-dividing cells
US6156303A (en) 1997-06-11 2000-12-05 University Of Washington Adeno-associated virus (AAV) isolates and AAV vectors derived therefrom
US6348584B1 (en) 1996-10-17 2002-02-19 John Edward Hodgson Fibronectin binding protein compounds
US20020119492A1 (en) 2000-07-10 2002-08-29 Chirino Arthur J. Protein design automation for designing protein libraries with altered immunogenicity
WO2002098443A2 (de) 2001-06-05 2002-12-12 Curevac Gmbh Stabilisierte mrna mit erhöhtem g/ c- gehalt und otimierter codon usage für die gentherapie
US6531451B1 (en) 1998-10-02 2003-03-11 Ludwig Institute For Cancer Research Tumor antigens and CTL clones isolated by a novel procedure
WO2003051401A2 (de) 2001-12-19 2003-06-26 Curevac Gmbh Stabilisierte mrna tumor-vakzine
US20030138772A1 (en) 2001-11-13 2003-07-24 Guangping Gao Method of detecting and/or identifying adeno-associated virus (AAV) sequences and isolating novel sequences identified thereby
US20030170238A1 (en) 2002-03-07 2003-09-11 Gruenberg Micheal L. Re-activated T-cells for adoptive immunotherapy
US6673901B2 (en) 1997-06-12 2004-01-06 Research Corporation Technologies, Inc. Artificial antibody polypeptides
US6805861B2 (en) 1996-01-17 2004-10-19 Imperial College Innovations Limited Immunotherapy using cytotoxic T lymphocytes (CTL)
US6808905B2 (en) 2001-05-14 2004-10-26 Cell Genesys, Inc. Lentiviral vectors encoding clotting factors for gene therapy
US20040230380A1 (en) 2002-01-04 2004-11-18 Xencor Novel proteins with altered immunogenicity
WO2005005622A2 (en) 2003-07-09 2005-01-20 Ribostem Limited Method of altering cell properties by administering rna
WO2005033321A2 (en) 2003-09-30 2005-04-14 The Trustees Of The University Of Pennsylvania Adeno-associated virus (aav) clades, sequences, vectors containing same, and uses therefor
WO2005051975A2 (en) 2003-07-03 2005-06-09 Avatar Biotechnologies, Inc. Methods for obtaining molecules with reduced immunogenicity
WO2005086751A2 (en) 2004-03-05 2005-09-22 Chiron Corporation Combinatorial interleukin-2 muteins
US6955807B1 (en) 1998-05-15 2005-10-18 Bayer Pharmaceuticals Corporation IL-2 selective agonists and antagonists
US20060148009A1 (en) 2004-10-12 2006-07-06 Xencor, Inc. Prediction and assessment of immunogenicity
WO2006122828A2 (de) 2005-05-19 2006-11-23 Curevac Gmbh Optimierte injektionsformulierung für mrna
EP1757702A1 (en) 2005-08-24 2007-02-28 Medizinische Hochschule Hannover Self-inactivating gammaretroviral vector
EP1757703A2 (en) 2005-08-24 2007-02-28 Medizinische Hochschule Hannover Self-inactivating retroviral vector
US20070048285A1 (en) 2005-08-24 2007-03-01 Christopher Baum Self-inactivating retroviral vector
WO2007024708A2 (en) 2005-08-23 2007-03-01 The Trustees Of The University Of Pennsylvania Rna containing modified nucleosides and methods of use thereof
DE102005046490A1 (de) 2005-09-28 2007-03-29 Johannes-Gutenberg-Universität Mainz Modifikationen von RNA, die zu einer erhöhten Transkriptstabilität und Translationseffizienz führen
US7198951B2 (en) 2001-12-17 2007-04-03 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) serotype 9 sequences, vectors containing same, and uses therefor
WO2007064952A2 (en) 2005-12-02 2007-06-07 University Of Rochester TARGETED PRE-mRNA/mRNA MODIFICATION AND GENE REGULATION
US7351585B2 (en) 2002-09-03 2008-04-01 Oxford Biomedica (Uk) Ltd. Retroviral vector
WO2008052770A2 (en) 2006-10-31 2008-05-08 Curevac Gmbh (base-)modified rna for increasing the expression of a protein
US7371371B2 (en) 2001-08-13 2008-05-13 University Of Southern California Interleukin-2 mutants with reduced toxicity
US7396811B2 (en) 2001-04-30 2008-07-08 Zystor Therapeutics, Inc. Subcellular targeting of therapeutic proteins
WO2008083949A2 (en) 2007-01-09 2008-07-17 Curevac Gmbh Rna-coded antibody
US7435596B2 (en) 2004-11-04 2008-10-14 St. Jude Children's Research Hospital, Inc. Modified cell line and method for expansion of NK cell
WO2008140615A2 (en) 2006-12-21 2008-11-20 Novozymes, Inc. Modified messenger rna stabilizing sequences for expressing genes in bacterial cells
WO2009077134A2 (en) 2007-12-14 2009-06-25 Johannes Gutenberg-Universität Mainz Use of rna for reprogramming somatic cells
US7575924B2 (en) 2000-11-13 2009-08-18 Research Development Foundation Methods and compositions relating to improved lentiviral vectors and their applications
WO2009127230A1 (en) 2008-04-16 2009-10-22 Curevac Gmbh MODIFIED (m)RNA FOR SUPPRESSING OR AVOIDING AN IMMUNOSTIMULATORY RESPONSE AND IMMUNOSUPPRESSIVE COMPOSITION
US7629153B2 (en) 2001-08-02 2009-12-08 Research Development Foundation Methods and compositions relating to improved lentiviral vector production systems
WO2010098861A1 (en) 2009-02-24 2010-09-02 The Scripps Research Institute Reengineering mrna primary structure for enhanced protein production
WO2010113037A1 (en) 2009-04-03 2010-10-07 Centre National De La Recherche Scientifique Gene transfer vectors comprising genetic insulator elements and methods to identify genetic insulator elements
WO2011012316A2 (de) 2009-07-31 2011-02-03 Ludwig-Maximilians-Universität Rna mit einer kombination aus unmodifizierten und modifizierten nucleotiden zur proteinexpression
WO2011062962A2 (en) 2009-11-17 2011-05-26 The Trustees Of The University Of Pennsylvania Smndelta7 degron: novel compositions and methods of use
WO2011071936A2 (en) 2009-12-07 2011-06-16 Gary Dahl Compositions and methods for reprogramming eukaryotic cells
US20110143397A1 (en) 2005-08-23 2011-06-16 Katalin Kariko Rna preparations comprising purified modified rna for reprogramming cells
WO2011109726A2 (en) 2010-03-05 2011-09-09 Bioatla Llc Homologous multi-specific antibodies
US20110244026A1 (en) 2009-12-01 2011-10-06 Braydon Charles Guild Delivery of mrna for the augmentation of proteins and enzymes in human genetic diseases
US8039214B2 (en) 2007-06-29 2011-10-18 Cellscript, Inc. Synthesis of tagged nucleic acids
US8076106B2 (en) 2007-03-02 2011-12-13 Richmond Chemical Corporation Method to increase the yield and improve purification of products from transaminase reactions
US20120046346A1 (en) 2010-04-16 2012-02-23 Immune Disease Institute, Inc. Sustained polypeptide expression from synthetic, modified rnas and uses thereof
US8173792B2 (en) 2007-02-09 2012-05-08 The Board Of Trustees Of The Leland Stanford Junior University Method for regulating protein function in cells using synthetic small molecules
WO2012079000A1 (en) 2010-12-09 2012-06-14 The Trustees Of The University Of Pennsylvania Use of chimeric antigen receptor-modified t cells to treat cancer
WO2012088446A1 (en) 2010-12-22 2012-06-28 Board Of Trustees Of The Leland Stanford Junior University Superagonists and antagonists of interleukin-2
WO2012083424A1 (en) 2010-12-21 2012-06-28 The University Of Western Ontario Novel amino acid linker sequences for ligand immobilization
US20120164118A1 (en) 2009-05-04 2012-06-28 Fred Hutchinson Cancer Research Center Cocal vesiculovirus envelope pseudotyped retroviral vectors
US8349311B2 (en) 2003-07-18 2013-01-08 Massachusetts Institute Of Technology Mutant interleukin-2 (IL-2) polypeptides
US20130012687A1 (en) 2009-09-21 2013-01-10 The Board Of Trustees Of The Leland Stanford Junior University Inducible self-cleaving protease tag and method of purifying recombinant proteins using the same
US8357511B2 (en) 2008-08-01 2013-01-22 The Regents Of The University Of Michigan Protein purification tags and uses thereof
US8399625B1 (en) 2009-06-25 2013-03-19 ESBATech, an Alcon Biomedical Research Unit, LLC Acceptor framework for CDR grafting
WO2013052523A1 (en) 2011-10-03 2013-04-11 modeRNA Therapeutics Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US8420104B2 (en) 2007-08-03 2013-04-16 Institut Pasteur Lentiviral gene transfer vectors and their medicinal applications
US8426432B2 (en) 2007-06-04 2013-04-23 University Of Connecticut Inhibitors of dihydrofolate reductase with antibacterial antiprotozoal, antifungal and anticancer properties
WO2013059593A1 (en) 2011-10-20 2013-04-25 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Anti-cd22 chimeric antigen receptors
US20130115635A1 (en) 2010-05-25 2013-05-09 Els Pardon Epitope tag for affinity-based applications
WO2013090648A1 (en) 2011-12-16 2013-06-20 modeRNA Therapeutics Modified nucleoside, nucleotide, and nucleic acid compositions
WO2013091661A2 (en) 2011-12-23 2013-06-27 Aarhus Universitet Proteolytic resistant protein affinity tag
US8530636B2 (en) 2008-05-07 2013-09-10 The Board Of Trustees Of The Leland Stanford Junior University Method for regulating protein function in cells in vivo using synthetic small molecules
WO2013151666A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of biologics and proteins associated with human disease
WO2013153391A1 (en) 2012-04-13 2013-10-17 Ucl Business Plc Polypeptide useful in adoptive cell therapy
US20130303399A1 (en) 2010-12-31 2013-11-14 Bioatla, Llc Express humanization of antibodies
US8706219B2 (en) 2005-12-22 2014-04-22 Board Of Regents, The University Of Texas System Method and apparatus for monitoring an organ of a patient
WO2014065961A1 (en) 2012-10-24 2014-05-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services M971 chimeric antigen receptors
US8748169B2 (en) 2001-10-02 2014-06-10 Research Development Foundation Methods and compositions relating to restricted expression lentiviral vectors and their applications
US8759486B2 (en) 2009-11-27 2014-06-24 Centro De Inmunologia Molecular Immunomodulatory interleukin-2 polypeptides and methods of treating melanoma
WO2014100385A1 (en) 2012-12-20 2014-06-26 Anthrogenesis Corporation Chimeric antigen receptors
US8772449B2 (en) 2009-05-20 2014-07-08 Toray Industries, Inc. Cell-penetrating peptides
WO2014121005A1 (en) 2013-02-01 2014-08-07 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Retroviral vector packaging cell lines and methods of purifying and producing retroviral particles
US20140286898A1 (en) 2013-03-14 2014-09-25 Amgen Inc. Interleukin-2 muteins for the expansion of t-regulatory cells
WO2014160627A1 (en) 2013-03-25 2014-10-02 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Anti-cd276 polypeptides, proteins, and chimeric antigen receptors
US20140359799A1 (en) 2011-12-23 2014-12-04 Case Western Reserve University Targeted gene modification using hybrid recombinant adeno-associated virus
US20140378660A1 (en) 2009-03-09 2014-12-25 Bioatla Llc Mirac proteins
WO2015007542A1 (en) * 2013-07-19 2015-01-22 Vib Vzw Targeted modified il-1 family members
US20150065690A1 (en) 2012-04-27 2015-03-05 Bioatla, Llc Modified antibody regions and uses thereof
WO2015039100A1 (en) 2013-09-16 2015-03-19 The Trustees Of The University Of Pennsylvania Cd137 enrichment for efficient tumor infiltrating lymphocyte selection
US8999897B2 (en) 2002-01-29 2015-04-07 Sense Proteomic Limited Protein tag comprising a biotinylation domain and method for increasing solubility and determining folding state
WO2015056014A1 (en) 2013-10-16 2015-04-23 Ucl Business Plc Retroviral vectors
WO2015069922A2 (en) 2013-11-06 2015-05-14 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Alk antibodies, conjugates, and chimeric antigen receptors, and their use
US20150152387A1 (en) 2012-05-07 2015-06-04 Korea University Research And Business Foundation Method for the induction and expansion of natural killer cells derived from peripheral blood mononuclear cells
US20150159173A1 (en) 2005-04-07 2015-06-11 The Trustees Of The University Of Pennsylvania Method of increasing the function of an aav vector
US20150166621A1 (en) 2012-07-09 2015-06-18 Hoffmann-La Roche Inc. Cell penetrating peptides to target eif4e
US9068199B2 (en) 2002-12-13 2015-06-30 Bluebird Bio, Inc. Therapeutic retroviral vectors for gene therapy
US20150190471A1 (en) 2012-06-28 2015-07-09 University Of Central Florida Research Foundation, Inc. Methods and Compositions for Natural Killer Cells
US9110059B2 (en) 2011-03-15 2015-08-18 Industry-Academic Cooperation Foundation, Yonsei University Bio-pin
US20150252119A1 (en) 2012-05-10 2015-09-10 Bioatla, Llc Multi-specific monoclonal antibodies
US9175308B2 (en) 2011-10-07 2015-11-03 Mie University Chimeric antigen receptor
US20150314011A1 (en) 2012-12-07 2015-11-05 The Queen's University Of Belfast Amphipathic peptide
US9181527B2 (en) 2009-10-29 2015-11-10 The Trustees Of Dartmouth College T cell receptor-deficient T cell compositions
WO2015175375A1 (en) 2014-05-13 2015-11-19 Short Jay M Conditionally active biological proteins
WO2015179691A2 (en) 2014-05-21 2015-11-26 Ohio State Innovation Foundation Cell penetrating peptides and methods of making and using thereof
WO2015183044A1 (ko) 2014-05-29 2015-12-03 주식회사 프로셀테라퓨틱스 신규한 세포투과성 펩타이드 및 이와 보툴리눔 독소 결합체 및 이들의 용도
US9206231B2 (en) 2009-09-18 2015-12-08 University Of Houston System Small peptide modulators of potassium channel trafficking
US9206243B2 (en) 2010-11-12 2015-12-08 Centro De Immunologia Molecular IL-2 derivative polypeptides
US9226977B2 (en) 2005-09-07 2016-01-05 Sillajen Biotherapeutics, Inc. Oncolytic vaccinia virus cancer therapy
US20160002613A1 (en) 2012-09-19 2016-01-07 Gemvax & Kael Co., Ltd. Cell Penetrating Peptide, Conjugate Comprising Same, and Composition Comprising Conjugate
US20160009772A1 (en) 2012-10-08 2016-01-14 Hoffmann-La Roche Inc. Cell penetrating peptides which bind irf5
US9273283B2 (en) 2009-10-29 2016-03-01 The Trustees Of Dartmouth College Method of producing T cell receptor-deficient T cells expressing a chimeric receptor
US20160060312A1 (en) 2014-08-27 2016-03-03 Cellivery Therapeutics, Inc. Development of Protein-Based Biotherapeutics That Penetrates Cell-Membrane and Induces Anti-Pancreatic Cancer Effect - Improved Cell-Permeable Suppressor of Cytokine Signaling (iCP-SOCS3) Proteins, Polynucleotides Encoding the Same, and Anti-Pancreatic Cancer Compositions Comprising the Same
US20160060296A1 (en) 2012-10-04 2016-03-03 Centre National De La Recherche Scientifique Cell Penetrating Peptides for Intracellular Delivery of Molecules
WO2016036916A1 (en) 2014-09-03 2016-03-10 Bioatla, Llc Discovering and producing conditionally active biologic proteins in the same eukaryotic cell production hosts
US20160089447A1 (en) 2012-10-04 2016-03-31 Centre National De La Recherche Scientifique Cell Penetrating Peptides for Intracellular Delivery of Molecules
US20160229901A1 (en) 2013-09-24 2016-08-11 Medicenna Therapeutics Pte Ltd Interleukin-2 fusion proteins and uses thereof
WO2016126608A1 (en) 2015-02-02 2016-08-11 Novartis Ag Car-expressing cells against multiple tumor antigens and uses thereof
US9434935B2 (en) 2013-03-10 2016-09-06 Bellicum Pharmaceuticals, Inc. Modified caspase polypeptides and uses thereof
WO2016149578A1 (en) 2015-03-19 2016-09-22 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Dual specific anti-cd22-anti-cd19 chimeric antigen receptors
US20160298081A1 (en) 2007-10-03 2016-10-13 The Fred Hutchinson Cancer Research Center Enhanced generation of cytotoxic t lymphocytes by il-21 mediated foxp3 suppression
WO2016161516A1 (en) 2015-04-10 2016-10-13 Feldan Bio Inc. Polypeptide-based shuttle agents for improving the transduction efficiency of polypeptide cargos to the cytosol of target eukaryotic cells, uses thereof, methods and kits relating to same
WO2016168595A1 (en) 2015-04-17 2016-10-20 Barrett David Maxwell Methods for improving the efficacy and expansion of chimeric antigen receptor-expressing cells
US20160317633A1 (en) 2010-05-04 2016-11-03 Cassian Yee Conditional Superagonist CTL Ligands for the Promotion of Tumor-Specific CTL Responses
US20160348072A1 (en) 2002-01-03 2016-12-01 The Trustees Of The University Of Pennsylvania Activation and Expansion of T-Cells Using an Engineered Multivalent Signaling Platform as a Research Tool
US9512401B2 (en) 2010-10-01 2016-12-06 Board Of Regents, The University Of Texas System B and T lymphocyte attenuator marker for use in adoptive T-cell therapy
US20160362467A1 (en) 2014-02-27 2016-12-15 Ucl Business Plc April variants
WO2016210343A1 (en) 2015-06-25 2016-12-29 Amyris, Inc. Maltose dependent degrons, maltose-responsive promoters, stabilization constructs, and their use in production of non-catabolic compounds
WO2017004022A2 (en) 2015-06-29 2017-01-05 The Board Of Trustees Of The Leland Stanford Junior University Degron fusion constructs and methods for controlling protein production
WO2017015427A1 (en) 2015-07-21 2017-01-26 Novartis Ag Methods for improving the efficacy and expansion of immune cells
WO2017044699A1 (en) 2015-09-10 2017-03-16 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Anti-cd276 chimeric antigen receptors
WO2017175072A1 (en) 2016-04-08 2017-10-12 Feldan Bio Inc. Peptide shuttle based gene disruption
WO2017180587A2 (en) 2016-04-11 2017-10-19 Obsidian Therapeutics, Inc. Regulated biocircuit systems
US9819492B2 (en) 2012-11-02 2017-11-14 Facebook, Inc. Providing user authentication
US10563897B2 (en) 2018-02-13 2020-02-18 Carrier Corporation Transport refrigeration unit with a renewable energy source and method of operation
US10729830B2 (en) 2015-11-12 2020-08-04 Koninklijke Philips N.V. Breast shield arrangement for breast pump, breast pump and method of operation
US10870110B2 (en) 2015-12-11 2020-12-22 Babson Diagnostics, Inc. Specimen container and centrifugation method for separating serum or plasma from whole blood therewith

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040141972A1 (en) * 1997-11-21 2004-07-22 Genentech, Inc. Compounds, compositions and methods for the treatment of diseases characterized by A-33 related antigens
EP1874342B1 (en) * 2005-04-26 2018-06-06 Eisai R&D Management Co., Ltd. Compositions and methods for cancer immunotherapy
CN101432306A (zh) * 2006-02-13 2009-05-13 健泰科生物技术公司 以relt作为靶物的方法和组合物
WO2011146568A1 (en) * 2010-05-19 2011-11-24 Genentech, Inc. Predicting response to a her inhibitor

Patent Citations (199)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US451A (en) 1837-11-04 Island
US568A (en) 1838-01-09 Sphebometeb for
US596A (en) 1838-02-07 Improvement in machines for making and twisting strands in the process of making rope
US6531A (en) 1849-06-19 Beed musical instrument
US7094A (en) 1850-02-12 Connecting trucks with car-bodies
US7435A (en) 1850-06-18 Attaching neck-yokes to poles of carriages
EP0234599A1 (en) 1982-10-19 1987-09-02 Cetus Oncology Corporation Cysteine-depleted muteins of interleukin-2, their preparation, formulations containing them, and genes, vectors and organisms suitable for use in the preparation of said muteins
US4518584A (en) 1983-04-15 1985-05-21 Cetus Corporation Human recombinant interleukin-2 muteins
US4703004A (en) 1984-01-24 1987-10-27 Immunex Corporation Synthesis of protein with an identification peptide
EP0200280A2 (en) 1985-01-18 1986-11-05 Cetus Oncology Corporation Oxidation resistant IL-2 muteins and their production, formulations containing such muteins, and DNA sequences and expression vectors coding for such muteins and corresponding transformed host cells
US5116943A (en) 1985-01-18 1992-05-26 Cetus Corporation Oxidation-resistant muteins of Il-2 and other protein
US5206344A (en) 1985-06-26 1993-04-27 Cetus Oncology Corporation Interleukin-2 muteins and polymer conjugation thereof
US4690915A (en) 1985-08-08 1987-09-01 The United States Of America As Represented By The Department Of Health And Human Services Adoptive immunotherapy as a treatment modality in humans
US4851341A (en) 1986-12-19 1989-07-25 Immunex Corporation Immunoaffinity purification system
US5011912A (en) 1986-12-19 1991-04-30 Immunex Corporation Hybridoma and monoclonal antibody for use in an immunoaffinity purification system
US5091513A (en) 1987-05-21 1992-02-25 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
EP0404097A2 (de) 1989-06-22 1990-12-27 BEHRINGWERKE Aktiengesellschaft Bispezifische und oligospezifische, mono- und oligovalente Rezeptoren, ihre Herstellung und Verwendung
US5525491A (en) 1991-02-27 1996-06-11 Creative Biomolecules, Inc. Serine-rich peptide linkers
WO1993011161A1 (en) 1991-11-25 1993-06-10 Enzon, Inc. Multivalent antigen-binding proteins
WO1994004678A1 (en) 1992-08-21 1994-03-03 Casterman Cecile Immunoglobulins devoid of light chains
US6005079A (en) 1992-08-21 1999-12-21 Vrije Universiteit Brussels Immunoglobulins devoid of light chains
US5856456A (en) 1992-11-20 1999-01-05 Enzon, Inc. Linker for linked fusion polypeptides
WO1994025591A1 (en) 1993-04-29 1994-11-10 Unilever N.V. PRODUCTION OF ANTIBODIES OR (FUNCTIONALIZED) FRAGMENTS THEREOF DERIVED FROM HEAVY CHAIN IMMUNOGLOBULINS OF $i(CAMELIDAE)
US6013516A (en) 1995-10-06 2000-01-11 The Salk Institute For Biological Studies Vector and method of use for nucleic acid delivery to non-dividing cells
US6805861B2 (en) 1996-01-17 2004-10-19 Imperial College Innovations Limited Immunotherapy using cytotoxic T lymphocytes (CTL)
WO1998011244A2 (en) 1996-09-11 1998-03-19 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Aav4 vector and uses thereof
US6348584B1 (en) 1996-10-17 2002-02-19 John Edward Hodgson Fibronectin binding protein compounds
US6156303A (en) 1997-06-11 2000-12-05 University Of Washington Adeno-associated virus (AAV) isolates and AAV vectors derived therefrom
US6673901B2 (en) 1997-06-12 2004-01-06 Research Corporation Technologies, Inc. Artificial antibody polypeptides
WO1999014346A2 (en) 1997-09-19 1999-03-25 Sequitur, Inc. SENSE mRNA THERAPY
US8846385B2 (en) 1997-12-12 2014-09-30 Gbp Ip, Llc Method and means for producing high titer, safe recombinant lentivirus vectors
US5994136A (en) 1997-12-12 1999-11-30 Cell Genesys, Inc. Method and means for producing high titer, safe, recombinant lentivirus vectors
US7105653B2 (en) 1998-05-15 2006-09-12 Shanafelt Armen B IL-2 selective agonists and antagonists
US6955807B1 (en) 1998-05-15 2005-10-18 Bayer Pharmaceuticals Corporation IL-2 selective agonists and antagonists
US6531451B1 (en) 1998-10-02 2003-03-11 Ludwig Institute For Cancer Research Tumor antigens and CTL clones isolated by a novel procedure
US20020119492A1 (en) 2000-07-10 2002-08-29 Chirino Arthur J. Protein design automation for designing protein libraries with altered immunogenicity
US7575924B2 (en) 2000-11-13 2009-08-18 Research Development Foundation Methods and compositions relating to improved lentiviral vectors and their applications
US8329462B2 (en) 2000-11-13 2012-12-11 Research Development Foundation Methods and compositions relating to improved lentiviral vectors and their applications
US9023646B2 (en) 2000-11-13 2015-05-05 Research Development Foundation Methods and compositions relating to improved lentiviral vectors and their applications
US7396811B2 (en) 2001-04-30 2008-07-08 Zystor Therapeutics, Inc. Subcellular targeting of therapeutic proteins
US6808905B2 (en) 2001-05-14 2004-10-26 Cell Genesys, Inc. Lentiviral vectors encoding clotting factors for gene therapy
US7179903B2 (en) 2001-05-14 2007-02-20 Cell Genesys, Inc Liver specific transcriptional enhancer
US7745179B2 (en) 2001-05-14 2010-06-29 Gbp Ip, Llc Lentiviral vectors featuring liver specific transcriptional enhancer and methods of using same
US20050032730A1 (en) 2001-06-05 2005-02-10 Florian Von Der Mulbe Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions
US20110269950A1 (en) 2001-06-05 2011-11-03 Curevac Gmbh PHARMACEUTICAL COMPOSITION CONTAINING A STABILISED mRNA OPTIMISED FOR TRANSLATION IN ITS CODING REGIONS
EP1392341A2 (de) 2001-06-05 2004-03-03 Curevac GmbH Stabilisierte mrna mit erhöhtem g/c-gehalt und optimierter codon usage für die gentherapie
US20110077287A1 (en) 2001-06-05 2011-03-31 Curevac Gmbh Pharmaceutical composition containing a stabilised mrna optimised for translation in its coding regions
US20100239608A1 (en) 2001-06-05 2010-09-23 Curevac Gmbh PHARMACEUTICAL COMPOSITION CONTAINING A STABILISED mRNA OPTIMISED FOR TRANSLATION IN ITS CODING REGIONS
WO2002098443A2 (de) 2001-06-05 2002-12-12 Curevac Gmbh Stabilisierte mrna mit erhöhtem g/ c- gehalt und otimierter codon usage für die gentherapie
US7629153B2 (en) 2001-08-02 2009-12-08 Research Development Foundation Methods and compositions relating to improved lentiviral vector production systems
US9260725B2 (en) 2001-08-02 2016-02-16 Research Development Foundation Methods and compositions relating to improved lentiviral vector production systems
US8900858B2 (en) 2001-08-02 2014-12-02 Research Development Foundation Methods and compositions relating to improved lentiviral vector production systems
US8124066B2 (en) 2001-08-13 2012-02-28 University Of Southern California Methods of using interleukin-2 mutants with reduced toxicity
US7803361B2 (en) 2001-08-13 2010-09-28 University Of Southern California Therapeutic use of interleukin-2 mutants
US7371371B2 (en) 2001-08-13 2008-05-13 University Of Southern California Interleukin-2 mutants with reduced toxicity
US8748169B2 (en) 2001-10-02 2014-06-10 Research Development Foundation Methods and compositions relating to restricted expression lentiviral vectors and their applications
US20030138772A1 (en) 2001-11-13 2003-07-24 Guangping Gao Method of detecting and/or identifying adeno-associated virus (AAV) sequences and isolating novel sequences identified thereby
US7198951B2 (en) 2001-12-17 2007-04-03 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) serotype 9 sequences, vectors containing same, and uses therefor
US20110311472A1 (en) 2001-12-19 2011-12-22 Curevac Gmbh Application of mrna for use as a therapeutic against tumour diseases
WO2003051401A2 (de) 2001-12-19 2003-06-26 Curevac Gmbh Stabilisierte mrna tumor-vakzine
EP1458410A2 (de) 2001-12-19 2004-09-22 Curevac GmbH Stabilisierte mrna tumor-vakzine
US20050059624A1 (en) 2001-12-19 2005-03-17 Ingmar Hoerr Application of mRNA for use as a therapeutic against tumour diseases
US20160348072A1 (en) 2002-01-03 2016-12-01 The Trustees Of The University Of Pennsylvania Activation and Expansion of T-Cells Using an Engineered Multivalent Signaling Platform as a Research Tool
US20040230380A1 (en) 2002-01-04 2004-11-18 Xencor Novel proteins with altered immunogenicity
US8999897B2 (en) 2002-01-29 2015-04-07 Sense Proteomic Limited Protein tag comprising a biotinylation domain and method for increasing solubility and determining folding state
US20030170238A1 (en) 2002-03-07 2003-09-11 Gruenberg Micheal L. Re-activated T-cells for adoptive immunotherapy
US7351585B2 (en) 2002-09-03 2008-04-01 Oxford Biomedica (Uk) Ltd. Retroviral vector
US7585676B2 (en) 2002-09-03 2009-09-08 Oxford Biomedica (Uk) Limited Retroviral vector
US9068199B2 (en) 2002-12-13 2015-06-30 Bluebird Bio, Inc. Therapeutic retroviral vectors for gene therapy
WO2005051975A2 (en) 2003-07-03 2005-06-09 Avatar Biotechnologies, Inc. Methods for obtaining molecules with reduced immunogenicity
WO2005005622A2 (en) 2003-07-09 2005-01-20 Ribostem Limited Method of altering cell properties by administering rna
US20060247195A1 (en) 2003-07-09 2006-11-02 Ribostem Limited Method of altering cell properties by administering rna
EP1646714A2 (en) 2003-07-09 2006-04-19 Ribostem Limited Method of altering cell properties by administering rna
US8349311B2 (en) 2003-07-18 2013-01-08 Massachusetts Institute Of Technology Mutant interleukin-2 (IL-2) polypeptides
WO2005033321A2 (en) 2003-09-30 2005-04-14 The Trustees Of The University Of Pennsylvania Adeno-associated virus (aav) clades, sequences, vectors containing same, and uses therefor
WO2005086751A2 (en) 2004-03-05 2005-09-22 Chiron Corporation Combinatorial interleukin-2 muteins
US20060148009A1 (en) 2004-10-12 2006-07-06 Xencor, Inc. Prediction and assessment of immunogenicity
US7435596B2 (en) 2004-11-04 2008-10-14 St. Jude Children's Research Hospital, Inc. Modified cell line and method for expansion of NK cell
US20150159173A1 (en) 2005-04-07 2015-06-11 The Trustees Of The University Of Pennsylvania Method of increasing the function of an aav vector
US20080267873A1 (en) 2005-05-19 2008-10-30 Curevac Gmbh Injection Solution for Rna
WO2006122828A2 (de) 2005-05-19 2006-11-23 Curevac Gmbh Optimierte injektionsformulierung für mrna
US20110143397A1 (en) 2005-08-23 2011-06-16 Katalin Kariko Rna preparations comprising purified modified rna for reprogramming cells
WO2007024708A2 (en) 2005-08-23 2007-03-01 The Trustees Of The University Of Pennsylvania Rna containing modified nucleosides and methods of use thereof
US20090286852A1 (en) 2005-08-23 2009-11-19 Katalin Kariko RNA containing modified nucleosides and methods of use thereof
US20070048285A1 (en) 2005-08-24 2007-03-01 Christopher Baum Self-inactivating retroviral vector
EP1757702A1 (en) 2005-08-24 2007-02-28 Medizinische Hochschule Hannover Self-inactivating gammaretroviral vector
EP1757703A2 (en) 2005-08-24 2007-02-28 Medizinische Hochschule Hannover Self-inactivating retroviral vector
US9226977B2 (en) 2005-09-07 2016-01-05 Sillajen Biotherapeutics, Inc. Oncolytic vaccinia virus cancer therapy
DE102005046490A1 (de) 2005-09-28 2007-03-29 Johannes-Gutenberg-Universität Mainz Modifikationen von RNA, die zu einer erhöhten Transkriptstabilität und Translationseffizienz führen
WO2007036366A2 (de) 2005-09-28 2007-04-05 Johannes Gutenberg-Universität Mainz, Vertreten Durch Den Präsidenten Modifikationen von rna, die zu einer erhöhten transkriptstabilität und translationseffizienz führen
EP1934345A2 (de) 2005-09-28 2008-06-25 Johannes Gutenberg-Universität Mainz, vertreten durch den Präsidenten Modifikationen von rna, die zu einer erhöhten transkriptstabilität und translationseffizienz führen
WO2007064952A2 (en) 2005-12-02 2007-06-07 University Of Rochester TARGETED PRE-mRNA/mRNA MODIFICATION AND GENE REGULATION
US20070141030A1 (en) 2005-12-02 2007-06-21 Yi-Tao Yu Targeted pre-mRNA/mRNA modification and gene regulation
US8706219B2 (en) 2005-12-22 2014-04-22 Board Of Regents, The University Of Texas System Method and apparatus for monitoring an organ of a patient
WO2008052770A2 (en) 2006-10-31 2008-05-08 Curevac Gmbh (base-)modified rna for increasing the expression of a protein
US20100047261A1 (en) 2006-10-31 2010-02-25 Curevac Gmbh Base-modified rna for increasing the expression of a protein
WO2008140615A2 (en) 2006-12-21 2008-11-20 Novozymes, Inc. Modified messenger rna stabilizing sequences for expressing genes in bacterial cells
EP2104739A2 (en) 2006-12-21 2009-09-30 Novozymes Inc. Modified messenger rna stabilizing sequences for expressing genes in bacterial cells
US20100028943A1 (en) 2006-12-21 2010-02-04 Novozymes, Inc. Modified Messenger RNA Stabilizing Sequences for Expressing Genes in Bacterial Cells
US20100189729A1 (en) 2007-01-09 2010-07-29 Curvac Gmbh Rna-coded antibody
WO2008083949A2 (en) 2007-01-09 2008-07-17 Curevac Gmbh Rna-coded antibody
US8173792B2 (en) 2007-02-09 2012-05-08 The Board Of Trustees Of The Leland Stanford Junior University Method for regulating protein function in cells using synthetic small molecules
US8076106B2 (en) 2007-03-02 2011-12-13 Richmond Chemical Corporation Method to increase the yield and improve purification of products from transaminase reactions
US8426432B2 (en) 2007-06-04 2013-04-23 University Of Connecticut Inhibitors of dihydrofolate reductase with antibacterial antiprotozoal, antifungal and anticancer properties
US8039214B2 (en) 2007-06-29 2011-10-18 Cellscript, Inc. Synthesis of tagged nucleic acids
US20120009649A1 (en) 2007-06-29 2012-01-12 Cellscript, Inc. Synthesis of tagged nucleic acids
US8709799B2 (en) 2007-08-03 2014-04-29 Institut Pasteur Lentiviral gene transfer vectors and their medicinal applications
US8420104B2 (en) 2007-08-03 2013-04-16 Institut Pasteur Lentiviral gene transfer vectors and their medicinal applications
US20160298081A1 (en) 2007-10-03 2016-10-13 The Fred Hutchinson Cancer Research Center Enhanced generation of cytotoxic t lymphocytes by il-21 mediated foxp3 suppression
EP2240572A2 (en) 2007-12-14 2010-10-20 BioNTech AG Use of rna for reprogramming somatic cells
US20110065103A1 (en) 2007-12-14 2011-03-17 Ugur Sahin Use of rna for reprogramming somatic cells
WO2009077134A2 (en) 2007-12-14 2009-06-25 Johannes Gutenberg-Universität Mainz Use of rna for reprogramming somatic cells
WO2009127230A1 (en) 2008-04-16 2009-10-22 Curevac Gmbh MODIFIED (m)RNA FOR SUPPRESSING OR AVOIDING AN IMMUNOSTIMULATORY RESPONSE AND IMMUNOSUPPRESSIVE COMPOSITION
US8530636B2 (en) 2008-05-07 2013-09-10 The Board Of Trustees Of The Leland Stanford Junior University Method for regulating protein function in cells in vivo using synthetic small molecules
US20140010791A1 (en) 2008-05-07 2014-01-09 The Board Of Trustees Of The Leland Stanford Junior University Methods for regulating protein function in cells in vivo using synthetic small molecules
US8357511B2 (en) 2008-08-01 2013-01-22 The Regents Of The University Of Michigan Protein purification tags and uses thereof
WO2010098861A1 (en) 2009-02-24 2010-09-02 The Scripps Research Institute Reengineering mrna primary structure for enhanced protein production
US20120053333A1 (en) 2009-02-24 2012-03-01 The Scripps Research Institue Reengineering MRNA Primary Structure For Enhanced Protein Production
US20140378660A1 (en) 2009-03-09 2014-12-25 Bioatla Llc Mirac proteins
WO2010113037A1 (en) 2009-04-03 2010-10-07 Centre National De La Recherche Scientifique Gene transfer vectors comprising genetic insulator elements and methods to identify genetic insulator elements
US8828718B2 (en) 2009-04-03 2014-09-09 Centre National De La Recherche Scientifique Gene transfer vectors comprising genetic insulator elements and methods to identify genetic insulator elements
US20120164118A1 (en) 2009-05-04 2012-06-28 Fred Hutchinson Cancer Research Center Cocal vesiculovirus envelope pseudotyped retroviral vectors
US8772449B2 (en) 2009-05-20 2014-07-08 Toray Industries, Inc. Cell-penetrating peptides
US8399625B1 (en) 2009-06-25 2013-03-19 ESBATech, an Alcon Biomedical Research Unit, LLC Acceptor framework for CDR grafting
WO2011012316A2 (de) 2009-07-31 2011-02-03 Ludwig-Maximilians-Universität Rna mit einer kombination aus unmodifizierten und modifizierten nucleotiden zur proteinexpression
US9206231B2 (en) 2009-09-18 2015-12-08 University Of Houston System Small peptide modulators of potassium channel trafficking
US20130012687A1 (en) 2009-09-21 2013-01-10 The Board Of Trustees Of The Leland Stanford Junior University Inducible self-cleaving protease tag and method of purifying recombinant proteins using the same
US9273283B2 (en) 2009-10-29 2016-03-01 The Trustees Of Dartmouth College Method of producing T cell receptor-deficient T cells expressing a chimeric receptor
US9181527B2 (en) 2009-10-29 2015-11-10 The Trustees Of Dartmouth College T cell receptor-deficient T cell compositions
WO2011062962A2 (en) 2009-11-17 2011-05-26 The Trustees Of The University Of Pennsylvania Smndelta7 degron: novel compositions and methods of use
US8759486B2 (en) 2009-11-27 2014-06-24 Centro De Inmunologia Molecular Immunomodulatory interleukin-2 polypeptides and methods of treating melanoma
US20110244026A1 (en) 2009-12-01 2011-10-06 Braydon Charles Guild Delivery of mrna for the augmentation of proteins and enzymes in human genetic diseases
WO2011071931A2 (en) 2009-12-07 2011-06-16 Katalin Kariko Rna preparations comprising purified modified rna for reprogramming cells
WO2011071936A2 (en) 2009-12-07 2011-06-16 Gary Dahl Compositions and methods for reprogramming eukaryotic cells
US20110143436A1 (en) 2009-12-07 2011-06-16 Gary Dahl Compositions and methods for reprogramming eukaryotic cells
WO2011109726A2 (en) 2010-03-05 2011-09-09 Bioatla Llc Homologous multi-specific antibodies
US20120046346A1 (en) 2010-04-16 2012-02-23 Immune Disease Institute, Inc. Sustained polypeptide expression from synthetic, modified rnas and uses thereof
US20160317633A1 (en) 2010-05-04 2016-11-03 Cassian Yee Conditional Superagonist CTL Ligands for the Promotion of Tumor-Specific CTL Responses
US20130115635A1 (en) 2010-05-25 2013-05-09 Els Pardon Epitope tag for affinity-based applications
US9512401B2 (en) 2010-10-01 2016-12-06 Board Of Regents, The University Of Texas System B and T lymphocyte attenuator marker for use in adoptive T-cell therapy
US9206243B2 (en) 2010-11-12 2015-12-08 Centro De Immunologia Molecular IL-2 derivative polypeptides
WO2012079000A1 (en) 2010-12-09 2012-06-14 The Trustees Of The University Of Pennsylvania Use of chimeric antigen receptor-modified t cells to treat cancer
WO2012083424A1 (en) 2010-12-21 2012-06-28 The University Of Western Ontario Novel amino acid linker sequences for ligand immobilization
WO2012088446A1 (en) 2010-12-22 2012-06-28 Board Of Trustees Of The Leland Stanford Junior University Superagonists and antagonists of interleukin-2
US20130303399A1 (en) 2010-12-31 2013-11-14 Bioatla, Llc Express humanization of antibodies
US9110059B2 (en) 2011-03-15 2015-08-18 Industry-Academic Cooperation Foundation, Yonsei University Bio-pin
WO2013052523A1 (en) 2011-10-03 2013-04-11 modeRNA Therapeutics Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9175308B2 (en) 2011-10-07 2015-11-03 Mie University Chimeric antigen receptor
WO2013059593A1 (en) 2011-10-20 2013-04-25 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Anti-cd22 chimeric antigen receptors
WO2013090648A1 (en) 2011-12-16 2013-06-20 modeRNA Therapeutics Modified nucleoside, nucleotide, and nucleic acid compositions
WO2013091661A2 (en) 2011-12-23 2013-06-27 Aarhus Universitet Proteolytic resistant protein affinity tag
US20140359799A1 (en) 2011-12-23 2014-12-04 Case Western Reserve University Targeted gene modification using hybrid recombinant adeno-associated virus
WO2013151666A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of biologics and proteins associated with human disease
WO2013153391A1 (en) 2012-04-13 2013-10-17 Ucl Business Plc Polypeptide useful in adoptive cell therapy
US20150093401A1 (en) 2012-04-13 2015-04-02 Ucl Business Plc Polypeptide useful in adoptive cell therapy
US20150065690A1 (en) 2012-04-27 2015-03-05 Bioatla, Llc Modified antibody regions and uses thereof
US20150152387A1 (en) 2012-05-07 2015-06-04 Korea University Research And Business Foundation Method for the induction and expansion of natural killer cells derived from peripheral blood mononuclear cells
US20150252119A1 (en) 2012-05-10 2015-09-10 Bioatla, Llc Multi-specific monoclonal antibodies
US20150190471A1 (en) 2012-06-28 2015-07-09 University Of Central Florida Research Foundation, Inc. Methods and Compositions for Natural Killer Cells
US20150166621A1 (en) 2012-07-09 2015-06-18 Hoffmann-La Roche Inc. Cell penetrating peptides to target eif4e
US20160002613A1 (en) 2012-09-19 2016-01-07 Gemvax & Kael Co., Ltd. Cell Penetrating Peptide, Conjugate Comprising Same, and Composition Comprising Conjugate
US20160089447A1 (en) 2012-10-04 2016-03-31 Centre National De La Recherche Scientifique Cell Penetrating Peptides for Intracellular Delivery of Molecules
US20160060296A1 (en) 2012-10-04 2016-03-03 Centre National De La Recherche Scientifique Cell Penetrating Peptides for Intracellular Delivery of Molecules
US20160009772A1 (en) 2012-10-08 2016-01-14 Hoffmann-La Roche Inc. Cell penetrating peptides which bind irf5
WO2014065961A1 (en) 2012-10-24 2014-05-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services M971 chimeric antigen receptors
US9819492B2 (en) 2012-11-02 2017-11-14 Facebook, Inc. Providing user authentication
US20150314011A1 (en) 2012-12-07 2015-11-05 The Queen's University Of Belfast Amphipathic peptide
WO2014100385A1 (en) 2012-12-20 2014-06-26 Anthrogenesis Corporation Chimeric antigen receptors
WO2014121005A1 (en) 2013-02-01 2014-08-07 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Retroviral vector packaging cell lines and methods of purifying and producing retroviral particles
US9434935B2 (en) 2013-03-10 2016-09-06 Bellicum Pharmaceuticals, Inc. Modified caspase polypeptides and uses thereof
US20140286898A1 (en) 2013-03-14 2014-09-25 Amgen Inc. Interleukin-2 muteins for the expansion of t-regulatory cells
WO2014160627A1 (en) 2013-03-25 2014-10-02 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Anti-cd276 polypeptides, proteins, and chimeric antigen receptors
WO2015007542A1 (en) * 2013-07-19 2015-01-22 Vib Vzw Targeted modified il-1 family members
WO2015039100A1 (en) 2013-09-16 2015-03-19 The Trustees Of The University Of Pennsylvania Cd137 enrichment for efficient tumor infiltrating lymphocyte selection
US20160229901A1 (en) 2013-09-24 2016-08-11 Medicenna Therapeutics Pte Ltd Interleukin-2 fusion proteins and uses thereof
WO2015056014A1 (en) 2013-10-16 2015-04-23 Ucl Business Plc Retroviral vectors
WO2015069922A2 (en) 2013-11-06 2015-05-14 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Alk antibodies, conjugates, and chimeric antigen receptors, and their use
US20160362467A1 (en) 2014-02-27 2016-12-15 Ucl Business Plc April variants
WO2015175375A1 (en) 2014-05-13 2015-11-19 Short Jay M Conditionally active biological proteins
WO2015179691A2 (en) 2014-05-21 2015-11-26 Ohio State Innovation Foundation Cell penetrating peptides and methods of making and using thereof
WO2015183044A1 (ko) 2014-05-29 2015-12-03 주식회사 프로셀테라퓨틱스 신규한 세포투과성 펩타이드 및 이와 보툴리눔 독소 결합체 및 이들의 용도
US20160060311A1 (en) 2014-08-27 2016-03-03 Daewoong Jo Development of Protein-Based Biotherapeutics That Penetrates Cell-Membrane and Induces Anti-Lung Cancer Effect - Improved Cell-Permeable Suppressor of Cytokine Signaling (iCP-SOCS3) Proteins, Polynucleotides Encoding the Same, and Anti-Lung Cancer Compositions Comprising the Same
US20160060314A1 (en) 2014-08-27 2016-03-03 Daewoong Jo Development of a Protein-Based Biotherapeutic Agent That Penetrates Cell-Membrane and Induces Anti-Tumor Effect in Solid Tumors - Improved Cell-Permeable Suppressor of Cytokine Signaling (iCP-SOCS3) Proteins, Polynucleotides Encoding the Same, and Anti-Tumor Compositions Comprising the Same
US20160060312A1 (en) 2014-08-27 2016-03-03 Cellivery Therapeutics, Inc. Development of Protein-Based Biotherapeutics That Penetrates Cell-Membrane and Induces Anti-Pancreatic Cancer Effect - Improved Cell-Permeable Suppressor of Cytokine Signaling (iCP-SOCS3) Proteins, Polynucleotides Encoding the Same, and Anti-Pancreatic Cancer Compositions Comprising the Same
WO2016036916A1 (en) 2014-09-03 2016-03-10 Bioatla, Llc Discovering and producing conditionally active biologic proteins in the same eukaryotic cell production hosts
WO2016126608A1 (en) 2015-02-02 2016-08-11 Novartis Ag Car-expressing cells against multiple tumor antigens and uses thereof
WO2016149578A1 (en) 2015-03-19 2016-09-22 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Dual specific anti-cd22-anti-cd19 chimeric antigen receptors
WO2016161516A1 (en) 2015-04-10 2016-10-13 Feldan Bio Inc. Polypeptide-based shuttle agents for improving the transduction efficiency of polypeptide cargos to the cytosol of target eukaryotic cells, uses thereof, methods and kits relating to same
WO2016168595A1 (en) 2015-04-17 2016-10-20 Barrett David Maxwell Methods for improving the efficacy and expansion of chimeric antigen receptor-expressing cells
WO2016210343A1 (en) 2015-06-25 2016-12-29 Amyris, Inc. Maltose dependent degrons, maltose-responsive promoters, stabilization constructs, and their use in production of non-catabolic compounds
WO2017004022A2 (en) 2015-06-29 2017-01-05 The Board Of Trustees Of The Leland Stanford Junior University Degron fusion constructs and methods for controlling protein production
WO2017015427A1 (en) 2015-07-21 2017-01-26 Novartis Ag Methods for improving the efficacy and expansion of immune cells
WO2017044699A1 (en) 2015-09-10 2017-03-16 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Anti-cd276 chimeric antigen receptors
US10729830B2 (en) 2015-11-12 2020-08-04 Koninklijke Philips N.V. Breast shield arrangement for breast pump, breast pump and method of operation
US10870110B2 (en) 2015-12-11 2020-12-22 Babson Diagnostics, Inc. Specimen container and centrifugation method for separating serum or plasma from whole blood therewith
WO2017175072A1 (en) 2016-04-08 2017-10-12 Feldan Bio Inc. Peptide shuttle based gene disruption
WO2017180587A2 (en) 2016-04-11 2017-10-19 Obsidian Therapeutics, Inc. Regulated biocircuit systems
US10563897B2 (en) 2018-02-13 2020-02-18 Carrier Corporation Transport refrigeration unit with a renewable energy source and method of operation

Non-Patent Citations (134)

* Cited by examiner, † Cited by third party
Title
"Pharmaceutical Salts: Properties, Selection, and Use", 2008, WILEY-VCH
"Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING COMPANY, pages: 1418
AL-LAZIKANI ET AL., J. MOL. BIOL., vol. 273, no. 4, 1997, pages 927 - 948
ARAFAT ET AL., CANCER GENE THER., vol. 7, 2000, pages 1250 - 6
BANASZYNSKI ET AL., CELL, vol. 126, no. 5, 2006, pages 995 - 1004
BANASZYNSKI, L.A.WANDLESS, T.J., CHEM. BIOL., vol. 13, 2006, pages 11 - 21
BATTAGLIA ET AL., BLOOD, vol. 105, 2005, pages 4743 - 4254
BELSHAW P.J. ET AL., CHEM BIOL., vol. 996, no. 9, 24 September 2010 (2010-09-24), pages 981 - 988
BERCHTOLD S, MOL ENDOCRINOL. APR, vol. 12, no. 4, 1998, pages 556 - 67
BERGE ET AL., JOURNAL OF PHARMACEUTICAL SCIENCE, vol. 66, 1977, pages 1 - 19
BERGERON S ET AL., ENDOCRINOLOGY., vol. 152, no. 12, December 2011 (2011-12-01), pages 4581 - 8
BIOCCA ET AL., EMBO J., vol. 9, 1990, pages 101 - 108
BUDDE ET AL., PLOS ONE, vol. 8, 2013
CHEN ET AL., HUM. GENE THER., vol. 5, 1994, pages 595 - 601
CHEN ET AL., HUM. GENE THERAP., vol. 7, 1996, pages 1515 - 1525
CHEN ET AL., PNAS, vol. 91, 1994, pages 5932 - 5936
CHOTHIA ET AL., NATURE, vol. 342, 1989, pages 877
CHOTHIALESK, J. MOL. BIOL., vol. 196, 1987, pages 901
CLACKSON ET AL., NATURE, vol. 352, 1991, pages 624 - 628
CLAY ET AL., J. IMMUNOL, vol. 163, 1999
COHEN ET AL., ONCOGENE, vol. 17, 1998, pages 2445 - 2456
COLBY ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 101, 2004, pages 17616 - 17621
COUR ET AL., NUCLEIC ACIDS RES., vol. 31, no. 1, 2003, pages 393 - 396
CUTLER ET AL., ANNU REV PLANT BIOL., vol. 61, 2010, pages 651 - 679
CZLAPINSKI ET AL., JAM CHEM SOC, vol. 130, no. 40, 2008, pages 13186 - 13187
DATABASE protein [O] 4 October 2016 (2016-10-04), "NIH) FKBP1A protein [Homo sapiens", XP055560112, Database accession no. AAI19733.1 *
DAVILA ET AL., PLOS ONE, vol. 8, no. 4, 2013, pages 61338
DEOL P ET AL., J IMMUNAL, vol. 178, no. 12, 2007, pages 7557 - 7562
DONNELLY ML ET AL., J GEN VIROL, vol. 82, 2001, pages 1013 - 1025
DUSTIN JB ET AL., J IMMUNOL. MAR, vol. 162, no. 5, 1999, pages 2717 - 24
EARLE ET AL., CLIN. IMMUNOL., vol. 115, 2005, pages 3 - 9
EGELER ET AL., J BIO!. CHEM., vol. 286, no. 36, 2011, pages 32328 - 31336
EYQUEM J. ET AL., NATURE, vol. 543, no. 7643, 2017, pages 113 - 117
GELLER ET AL., IMMUNOTHERAPY, vol. 3, 2011, pages 1445 - 1459
GRIFFIOEN ET AL., HAEMATOLOGICA, vol. 94, 2009, pages 1316 - 1320
HARLOWLANE: "Antibodies, A Laboratory Manual", 1988, COLD SPRING HARBOR LABORATORY PRESS
HASSANZADEH ET AL., FEBS LETT., vol. 437, 1998, pages 81 - 6
HIGHFILL SL ET AL., SCI TRANSL MED., vol. 6, no. 237, 21 May 2014 (2014-05-21)
HOFFMANN ET AL., BLOOD, vol. 104, no. 12, 2004, pages 4602 - 4609
HOLLINGER, P. ET AL.: "Diabodies'': Small bivalent and bispecific antibody fragments", PNAS, vol. 90, 1993, pages 6444 - 6448
HONEGGERPLUCKTHUN, J. MOL. BIOL., vol. 309, no. 3, 2001, pages 657 - 70
HOYOS ET AL., LEUKEMIA, vol. 24, no. 6, 2010, pages 1160 - 1170
JOHNSON ET AL., NUCLEIC ACIDS RES., vol. 28, no. 1, 2000, pages 214 - 218
JUILLERAT ET AL., SCI. REP, vol. 6, 2016, pages 18950
JUILLERAT ET AL., SCIENTIFIC REPORTS, vol. 6, 2016, pages 18950
KIEBACK ET AL., NATL. ACAD. SCI. U.S.A, vol. 105, 2008, pages 623 - 628
KIRWANHODGES, J. BIOL. CHEM., vol. 289, 2014, pages 4356 - 4366
KOCHENDERFER ET AL., BLOOD, vol. 116, 2010, pages 4099 - 4102
KOCHENDERFERROSENBERG, NAT REV CLIN ONCOL., vol. 10, no. 5, 2013, pages 267 - 276
KOCH-NO LTE ET AL., FASEB J., vol. 21, 2007, pages 3490 - 3498
LEE ET AL., BIOTECHNOL BIOENG, vol. 10996, 2012, pages 1551 - 1560
LEFRANC ET AL., IMMUNOME RES., vol. 1, 2005, pages 3
LI F ET AL., ONCOIMMUNOLOGY, vol. 5, no. 12, 2016, pages 1238539
LONG A.H. ET AL., NAT MED., vol. 21, no. 6, 2015, pages 581 - 90
LONG AH ET AL., CANCER IMMUNOL RES, vol. 4, no. 10, 2016, pages 869 - 880
MACCORKLE R.A. ET AL., PROC NATL ACAD SCI, vol. 95, 1998, pages 3655 - 3660
MACIEJEWSKI ET AL., NATURE MED, vol. 1, 1995, pages 667 - 673
MAETZIG ET AL., VIRUSES, vol. 3, 2011, pages 677 - 713
MARASCO ET AL., PNAS, vol. 90, 1993, pages 7889 - 7893
MARASCO, GENE THER., vol. 4, 1997, pages 11 - 15
MARASCO, IMMUNOTECH, vol. 1, 1995, pages 1 - 19
MARKS ET AL., J. MOL. BIOL., vol. 222, 1991, pages 581 - 597
MARVIN ET AL., ACTA PHARMACOLOGICA SINICA, vol. 26, no. 6, 2005, pages 649 - 658
MARVIN ET AL., ACTA PHARMACOLOGICA SINICA., vol. 26, no. 6, 2005, pages 649 - 658
MATSUDA ET AL., THE JOURNAL OF EXPERIMENTAL MEDICINE, vol. 188, no. 11, 1998, pages 2151 - 62
MAUR ET AL., J. BIOL. CHEM., vol. 277, 2002, pages 45075 - 85
MERCHANT ET AL., CLIN CANCER RES., vol. 22, no. 13, 2016, pages 3182 - 91
MHASHILKAR ET AL., EMBO J., vol. 14, pages 1542 - 51
MHASHILKAR ET AL., GENE THER., vol. 9, 2002, pages 307 - 19
MIYAZAKI ET AL., JAM CHEM. SOC., vol. 134, no. 9, 2012, pages 3942 - 3945
MOLECULAR THERAPY, vol. 19, no. 6, 2011, pages 1070 - 1078
MUJOO K. ET AL., CANCER RES., vol. 49, no. 11, 1989, pages 2857 - 61
NALDINI L ET AL., CURR. OPIN. BIOTECHNOL, vol. 9, 1998, pages 457 - 463
NAT. IMMUNOL., vol. 9, no. 5, 2008, pages 503 - 510
NAVARRO ET AL., ACS CHEM BIOL., 6 June 2016 (2016-06-06)
NEGI ET AL., DATABASE, 2015, pages 1 - 7
NELSON, A. L., MABS, vol. 2, no. 1, 2010, pages 77 - 83
NELSON, A. L., MABS, vol. 2, no. 1, January 2010 (2010-01-01), pages 77 - 83
NELSON, A. L., MABS., vol. 2, no. 1, 2010, pages 77 - 83
NIKOLOUDIS ET AL., PEERJ., vol. 2, 2014, pages 456
OHAGE ET AL., J. MOL. BIOL., vol. 291, 1999, pages 1129 - 1134
OTAHAL ET AL., ONCOIMMUNOLOGY, vol. 5, no. 4, 2015, pages 1115940
OYER, J.L., CYTOTHERAPY, vol. 18, no. 5, 2016, pages 653 - 63
PATEL ET AL., GENE THERAPY, vol. 6, 1999, pages 412 - 419
PHILIP ET AL., BLOOD, vol. 124, 2014, pages 1277 - 1287
PRESNYAK ET AL., CELL, vol. 160, 2015, pages 1111 - 1124
PROBA ET AL., J. MOL. BIOL., vol. 275, 1998, pages 245 - 253
RAKHIT R ET AL., CHEM BIOL., vol. 21, no. 9, 2014, pages 1238 - 1252
RELANDER ET AL., MOL. THER., vol. 11, 2005, pages 452 - 459
RICHARDSON ET AL., GENE THER., vol. 5, 1998, pages 635 - 44
RIECHMANN L. ET AL., J. IMMUNOL. METHODS, vol. 231, 1999, pages 207 - 222
RIETHMULLER, G., CANCER IMMUNITY, vol. 12, 2012, pages 12 - 18
RIETHMULLER, G., CANCER IMMUNITY., vol. 12, 2012, pages 12 - 18
ROBERTSON BH, J VIROL, vol. 54, 1985, pages 651 - 660
ROELLECKER ET AL., GEN THER., 19 May 2016 (2016-05-19)
RONDONMARASCO, ANNU. REV. MICROBIOL., vol. 51, 1997, pages 257 - 283
ROSENBERG, NAT REV CLIN ONCOL., vol. 8, no. 10, 2011, pages 577 - 85
ROSENBERGDUDLEY, CURR. OPIN. IMMUNOL., vol. 21, 2009, pages 233 - 240
RUGGERI ET AL., SCIENCE, vol. 295, 2002, pages 2097 - 2100
SAETERDAL ET AL., PROC NATL ACAD SCI USA, vol. 98, 2001, pages 13255 - 13260
SAKEMURA ET AL., CANCER IMMUNO. RES., 21 June 2016 (2016-06-21)
SBLATTEROBRADBURY, NATURE BIOTECHNOLOGY, vol. 18, 2000, pages 75 - 80
SCHAEFER ET AL., PNAS, vol. 108, no. 27, 2011, pages 11187 - 11192
SCHRAM ET AL., AM J PHYSIOL HEART CIRC PHYSIOL., vol. 302, no. 1, 2012, pages H231 - 43
See also references of EP3589373A4
SEET CS ET AL., NAT METHODS., vol. 14, 2017, pages 521 - 530
SHAH NN ET AL., BIOL BLOOD MARROW TRANSPLANT., vol. 22, no. 12, 2016, pages 2149 - 215
SHANAFELT ET AL., NATURE BIOTECH., vol. 18, 2000, pages 1197 - 1202
SIM, G.C. ET AL., CANCER IMMUNOL RES;, vol. 4, no. 11, 2016, pages 983 - 994
SIVAN ET AL., SCIENCE, vol. 350, no. 6258, 2015, pages 1084 - 9
SPENCER, D.M. ET AL., CURR BIOL., vol. 6, 1996, pages 839 - 847
STANKUNAS, K. ET AL., MOL. CELL, vol. 12, 2003, pages 1615 - 1624
STEPHEN ET AL.: "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402
STEWART ET AL., HUM GENE THER., vol. 22, no. 3, 2011, pages 357 - 369
STRONCEK DF ET AL., JOURNAL OF TRANSLATIONAL MEDICINE., vol. 15, 2017, pages 59
TAKEUCHI, BIOCHEM J., vol. 410, no. 2, 2008, pages 401 - 7
TANG ET AL., J. EXP. MED., vol. 199, 2004, pages 1455 - 65
THEMELI ET AL., NAT BIOTECHNOL., vol. 31, no. 10, 2013, pages 928 - 933
THROM ET AL., BLOOD, vol. 113, no. 21, 2009, pages 5104 - 5110
TIRABY ET AL., FEMS LETT., vol. 167, 1998, pages 41 - 49
TOPFER ET AL., IMMUNOL., vol. 194, 2015, pages 3201 - 3212
TSUKAHARA ET AL., BIOCHEM BIOPHYS RES COMMUN, vol. 438, no. 1, 2013, pages 84 - 9
WAEHLER ET AL., NAT. REV. GENET., vol. 8, no. 8, 2007, pages 573 - 587
WANG ET AL., BLOOD, vol. 118, 2011, pages 1255 - 1263
WANG ET AL., CANCER IMMUNOL., vol. 3, 2015, pages 815 - 826
WEN ET AL., J. TRANSLATIONAL MED., vol. 14, 2016, pages 41
WHEELER ET AL., FASEB J., vol. 17, 2003, pages 1733 - 5
WIRTZSTEIPE, PROTEIN SCI., vol. 8, 1999, pages 2245 - 2250
WU ET AL., JEM, vol. 132, no. 2, 1970, pages 211 - 250
XIONG ET AL., J. EXP. BOT., vol. 65, no. 15, 2014, pages 4397 - 4408
YANG ET AL., BIOTECHNOL. BIOENG., vol. 101, no. 2, 2008, pages 357 - 368
ZHANG ET AL., PROTEIN SCI., vol. 13, 2004, pages 2819 - 2824
ZHANG Q ET AL., INT J ANTIMICROB AGENTS., vol. 46, no. 2, August 2015 (2015-08-01), pages 174 - 182
ZHAO ET AL., J. IMMUNOL, 2005

Cited By (53)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10704021B2 (en) 2012-03-15 2020-07-07 Flodesign Sonics, Inc. Acoustic perfusion devices
US10975368B2 (en) 2014-01-08 2021-04-13 Flodesign Sonics, Inc. Acoustophoresis device with dual acoustophoretic chamber
US11708572B2 (en) 2015-04-29 2023-07-25 Flodesign Sonics, Inc. Acoustic cell separation techniques and processes
US11214789B2 (en) 2016-05-03 2022-01-04 Flodesign Sonics, Inc. Concentration and washing of particles with acoustics
US11377651B2 (en) 2016-10-19 2022-07-05 Flodesign Sonics, Inc. Cell therapy processes utilizing acoustophoresis
US11446332B2 (en) 2017-04-13 2022-09-20 Senti Biosciences, Inc. Combinatorial cancer immunotherapy
US11241485B2 (en) 2017-06-12 2022-02-08 Obsidian Therapeutics, Inc. PDE5 compositions and methods for immunotherapy
US11666642B2 (en) 2017-06-12 2023-06-06 Obsidian Therapeutics, Inc. PDE5 compositions and methods for immunotherapy
US11891634B2 (en) 2017-06-23 2024-02-06 The Board Of Trustees Of The Leland Stanford Junior University PDE5A destabilizing domains
WO2018237323A1 (en) * 2017-06-23 2018-12-27 The Board Of Trustees Of The Leland Stanford Junior University Pde5a destabilizing domains
US10785574B2 (en) 2017-12-14 2020-09-22 Flodesign Sonics, Inc. Acoustic transducer driver and controller
EP3850004A4 (en) * 2018-09-13 2022-09-07 Nkarta, Inc. NATURAL KILLER CELL COMPOSITIONS AND IMMUNOTHERAPY METHODS FOR TREATMENT OF TUMORS
WO2020056045A1 (en) 2018-09-13 2020-03-19 Nkarta, Inc. Natural killer cell compositions and immunotherapy methods for treating tumors
WO2020069005A1 (en) * 2018-09-28 2020-04-02 Harrow Health, Inc. Pharmaceutical compositions for prevention or treatment of cytokine release syndrome
US11419898B2 (en) 2018-10-17 2022-08-23 Senti Biosciences, Inc. Combinatorial cancer immunotherapy
US10993967B2 (en) 2018-10-17 2021-05-04 Senti Biosciences, Inc. Combinatorial cancer immunotherapy
JP2022512161A (ja) * 2018-12-11 2022-02-02 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア 免疫療法のための組成物及び方法
EP3893901A4 (en) * 2018-12-11 2023-01-04 The Regents of the University of California COMPOSITIONS AND METHODS FOR IMMUNOTHERAPY
US12006345B2 (en) 2019-02-21 2024-06-11 Xencor, Inc. Untargeted and targeted IL-10 Fc-fusion proteins
US12398187B2 (en) 2019-03-05 2025-08-26 Nkarta, Inc. CD19-directed chimeric antigen receptors and uses thereof in immunotherapy
WO2020185632A1 (en) * 2019-03-08 2020-09-17 Obsidian Therapeutics, Inc. Human carbonic anhydrase 2 compositions and methods for tunable regulation
WO2020185628A1 (en) 2019-03-08 2020-09-17 Obsidian Therapeutics, Inc. Cd40l compositions and methods for tunable regulation
JP2022524081A (ja) * 2019-03-08 2022-04-27 オブシディアン セラピューティクス, インコーポレイテッド 調整可能な制御のためのヒトカルボニックアンヒドラーゼ2組成物及び方法
JP7620560B2 (ja) 2019-03-08 2025-01-23 オブシディアン セラピューティクス, インコーポレイテッド 調整可能な制御のためのヒトカルボニックアンヒドラーゼ2組成物及び方法
JP2022526671A (ja) * 2019-04-11 2022-05-25 エンクリアー セラピーズ, インク. 脳脊髄液の改善の方法ならびにそのためのデバイスおよびシステム
US20220378824A1 (en) * 2019-04-30 2022-12-01 Myeloid Therapeutics, Inc. Engineered chimeric fusion protein compositions and methods of use thereof
US20220259284A1 (en) * 2019-06-12 2022-08-18 Obsidian Therapeutics, Inc. Ca2 compositions and methods for tunable regulation
EP3983538A1 (en) * 2019-06-12 2022-04-20 Obsidian Therapeutics, Inc. Ca2 compositions and methods for tunable regulation
JP2022537052A (ja) * 2019-06-21 2022-08-23 カーナル バイオロジクス, インコーポレイテッド 操作された腫瘍選択的タンパク質発現
WO2021040736A1 (en) 2019-08-30 2021-03-04 Obsidian Therapeutics, Inc. Tandem cd19 car-based compositions and methods for immunotherapy
US11058725B2 (en) 2019-09-10 2021-07-13 Obsidian Therapeutics, Inc. CA2 compositions and methods for tunable regulation
WO2021079002A3 (en) * 2019-10-24 2021-07-22 Novago Therapeutics Ag Novel antibodies for neural repair and treatment of stroke
WO2021202581A1 (en) * 2020-03-30 2021-10-07 WUGEN, Inc. Engineered immune cells for adoptive cell therapy
JP2023515247A (ja) * 2020-03-31 2023-04-12 ハンミ ファーマシューティカル カンパニー リミテッド 新規な免疫活性インターロイキン2アナログ
EP4137510A4 (en) * 2020-04-16 2023-11-01 YiChen Therapeutics Limited PD-1 MUTANT POLYPEPTIDE AND PRODUCTION AND USE THEREOF
WO2022060806A1 (en) * 2020-09-16 2022-03-24 Obsidian Therapeutics, Inc. Compositions and methods for expression of anti-bcma chimeric antigen receptors with small molecule-regulated il15 in t cells
US12329930B2 (en) 2020-09-29 2025-06-17 Enclear Therapies, Inc. Subarachnoid fluid management method and system
US12473335B2 (en) 2020-10-26 2025-11-18 Neptune Biosciences Llc Orthogonal IL-21 receptor/cytokine systems
US12012441B2 (en) 2020-10-26 2024-06-18 Neptune Biosciences Llc Engineered human IL-21 cytokines and methods for using the same
WO2022121860A1 (en) * 2020-12-07 2022-06-16 East China University Of Science And Technology Methods and kits for inducing immunotolerance to gene delivering target vehicle
CN112795543B (zh) * 2021-02-04 2022-09-27 华中农业大学 杂交瘤细胞株及其分泌的抗草鱼IL-15Rα单克隆抗体和应用
CN112795543A (zh) * 2021-02-04 2021-05-14 华中农业大学 杂交瘤细胞株及其分泌的抗草鱼IL-15Rα单克隆抗体和应用
WO2023004461A1 (en) * 2021-07-28 2023-02-02 Prescient Therapeutics Ltd Universal receptor immune cell therapy
EP4376855A4 (en) * 2021-07-28 2025-10-15 Prescient Therapeutics Ltd CELL-BASED THERAPY COMPRISING A UNIVERSAL IMMUNE RECEPTOR
CN116082515A (zh) * 2021-11-08 2023-05-09 浙江海隆生物科技有限公司 一种在大肠杆菌中可溶性表达的口蹄疫病毒衣壳融合蛋白及其制备方法
CN114317385A (zh) * 2021-11-11 2022-04-12 元本(珠海横琴)生物科技有限公司 一种促进her2亲和体蛋白分泌表达的发酵培养基及发酵工艺
CN114317385B (zh) * 2021-11-11 2024-02-13 元本(珠海横琴)生物科技有限公司 一种促进her2亲和体蛋白分泌表达的发酵培养基及发酵工艺
CN117986362A (zh) * 2022-11-04 2024-05-07 茂行制药(苏州)有限公司 靶向b7h3的通用型car-t细胞及其制备方法和应用
CN115558641A (zh) * 2022-11-14 2023-01-03 四川新生命干细胞科技股份有限公司 高纯度效应免疫细胞群及其培养方法、试剂组合物和应用
WO2024140980A1 (zh) * 2022-12-30 2024-07-04 上药生物治疗(香港)有限公司 表达趋化因子受体的细胞及其用途
US20250032612A1 (en) * 2023-03-10 2025-01-30 The Regents Of The University Of Colorado, A Body Corporate Anti-cd276 and anti-cd99 logic gated chimeric antigen receptors for the treatment of cancer
WO2024189583A1 (en) 2023-03-15 2024-09-19 Kyoto Prefectural Public University Corporation Peptide expression constructs and uses thereof
WO2025160432A1 (en) * 2024-01-26 2025-07-31 Poseida Therapeutics, Inc. Methods and compositions for enhancing in vivo persistence and potency of cell therapy

Also Published As

Publication number Publication date
EP3589373A1 (en) 2020-01-08
AU2018226857A1 (en) 2019-09-19
JP2020511528A (ja) 2020-04-16
JP7660343B2 (ja) 2025-04-11
CA3055200A1 (en) 2018-09-07
AU2018226857B2 (en) 2025-01-02
CN110913954A (zh) 2020-03-24
JP2021088598A (ja) 2021-06-10
JP2025013868A (ja) 2025-01-28
EP3589373A4 (en) 2020-12-23

Similar Documents

Publication Publication Date Title
AU2023214349B2 (en) CD19 compositions and methods for immunotherapy
JP7660343B2 (ja) 免疫療法のための組成物及び方法
JP7620560B2 (ja) 調整可能な制御のためのヒトカルボニックアンヒドラーゼ2組成物及び方法
US12104178B2 (en) DHFR tunable protein regulation
EP3894011B1 (en) Membrane bound il12 compositions and methods for tunable regulation
WO2018161026A1 (en) Il15 compositions and methods for immunotherapy
WO2018161038A1 (en) Il12 compositions and methods for immunotherapy
US20220267398A1 (en) Ca2 compositions and methods for tunable regulation
US20230092895A1 (en) Tandem cd19 car-based compositions and methods for immunotherapy
US20220259284A1 (en) Ca2 compositions and methods for tunable regulation
HK40026640A (en) Compositions and methods for immunotherapy
HK40023885B (zh) 用於免疫疗法的cd19组合物和方法
HK40023885A (en) Cd19 compositions and methods for immunotherapy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18761512

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3055200

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2019568591

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2018226857

Country of ref document: AU

Date of ref document: 20180302

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2018761512

Country of ref document: EP

Effective date: 20191004

WWG Wipo information: grant in national office

Ref document number: MX/A/2019/010421

Country of ref document: MX