US20160060311A1

US20160060311A1 - Development of Protein-Based Biotherapeutics That Penetrates Cell-Membrane and Induces Anti-Lung Cancer Effect - Improved Cell-Permeable Suppressor of Cytokine Signaling (iCP-SOCS3) Proteins, Polynucleotides Encoding the Same, and Anti-Lung Cancer Compositions Comprising the Same

Info

Publication number: US20160060311A1
Application number: US14/838,280
Authority: US
Inventors: Daewoong Jo; Young Sil CHOI; Kuy Sook LEE; Min Seok Jang
Original assignee: Cellivery Therapeutics Inc
Current assignee: Cellivery Therapeutics Inc
Priority date: 2014-08-27
Filing date: 2015-08-27
Publication date: 2016-03-03
Also published as: US20160060314A1; EP3341395A1; WO2017034330A1; EP3341394B1; US10975132B2; US10774123B2; US20190359669A1; EP3341394A1; US10385103B2; US10961292B2; WO2017034344A1; EP3341396B1; EP3341400A4; US10781241B2; WO2017034347A1; EP3341396A1; US20200299348A1; EP3341400A1; US20170198019A1; US20160060310A1

Abstract

In principle, protein-based biotherapeutics offers a way to control biochemical processes in living cells under non-steady state conditions and with fewer off-target effects than conventional small molecule therapeutics. However, systemic protein delivery in vivo has been proven difficult due to poor tissue penetration and rapid clearance. Protein transduction exploits the ability of some cell-penetrating peptide (CPP) sequences to enhance the uptake of proteins and other macromolecules by mammalian cells. Previously developed hydrophobic CPPs, named membrane translocating sequence (MTS), membrane translocating motif (MTM) and macromolecule transduction domain (MTD), are able to deliver biologically active proteins into a variety of cells and tissues. Various cargo proteins fused to these CPPs have been used to test the functional and/or therapeutic efficacy of protein transduction. Previously, recombinant proteins consisting of suppressor of cytokine signaling 3 (CP-SOCS3) protein fused to the fibroblast growth factor (FGF) 4-derived MTM were developed to inhibit inflammation and apoptosis. However, CP-SOCS3 fusion proteins expressed in bacteria cells were hard to be purified in soluble form. To address these critical limitations, CPP sequences called advanced MTDs (aMTDs) have been developed in this art. The development of this art has been accomplished by (i) analyzing previous developed hydrophobic CPP sequences to identify specific critical factors (CFs) that affect intracellular delivery potential and (ii) constructing artificial aMTD sequences that satisfy for each critical factor. In addition, solubilization domains (SDs) have been incorporated into the aMTD-fused SOCS3 recombinant proteins to enhance solubility with corresponding increases in protein yield and cell-/tissue-permeability. These recombinant SOCS3 proteins fused to aMTD/SD having much higher solubility/yield and cell-/tissue-permeability have been named as improved cell-permeable SOCS3 (iCP-SOCS3) proteins. Previously developed CP-SOCS3 proteins fused to MTM were only tested or used as anti-inflammatory agents to treat acute liver injury. In the present art, iCP-SOCS3 proteins have been tested for use as anti-cancer agents in the treatment of neoplasia in lung. Since SOCS3 is frequently deleted in cancer cells and loss of SOCS3 promotes resistance to apoptosis and proliferation, we reasoned that iCP-SOCS3 could be used as a protein-based intracellular replacement therapy for the treatment of lung cancer. The results demonstrated in this art support this reasoning: treatment of human non-small cell lung carcinoma cells with iCP-SOCS3 results in reduced cancer cell viability, enhanced apoptosis. Furthermore, iCP-SOCS3 inhibited migration/invasion of lung cancer cells. In the present invention with iCP-SOCS3, where SOCS3 is fused to an empirically determined combination of newly developed aMTD and customized SD, macromolecule intracellular transduction technology (MITT) enabled by the advanced MTDs may provide novel protein therapy against lung cancer.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of the filing date of U.S. Provisional Application No. 62/042,493, filed on Aug. 27, 2014, in the United States Patent and Trademark Office, the disclosure of which is incorporated herein in its entirety by reference.

TECHNICAL FIELD

The present invention pertains to have (i) improved cell-permeable SOCS3 (iCP-SOCS3) proteins as protein-based biotherapeutics, which are well-enhanced in their ability to transport biologically active SOCS3 proteins across the plasma membrane, to increase in its solubility and manufacturing yield, and to induce anti-non-small cell lung carcinoma effect; (ii) polynucleotides that encode the same, and (iii) anti-lung cancer compositions that comprise the same.

BACKGROUND ART

Worldwide, lung cancer is the most common cause of cancer-related death in men and women, and was responsible for 1.56 million deaths annually. There are two main types of primary lung cancer: non-small cell lung cancer (NSCLC), small cell lung cancer (SCLC). About 85% of lung cancers are NSCLCs which is the most common type of lung cancer. Squamous cell carcinoma, adenocarcinoma, and large cell carcinoma are all subtypes of non-small cell lung cancer. Cytokines including IL-6 and interferon-gamma (IFN-
) activate the Janus kinase (JAK)/signal transducers and activators of transcription (STAT) signaling pathway, a vital role promoting the inflammation, carcinogenesis and metastasis in the lung. STAT3, which functions as an oncogene downstream of IL-6/gp130, is hyper-activated in lung cancer cells contributes to increase cell proliferation and inhibits apoptosis.
Cytokine signaling is strictly regulated by the SOCS family proteins induced by different classes of agonists, including cytokines, hormones and infectious agents. Among them, SOCS1 and SOCS3 are relatively specific to STAT1 and STAT3, respectively. SOCS1 inhibits JAK activation through its N-terminal kinase inhibitory region (KIR) by the direct binding to the activation loop of JAKs, while SOCS3 binds to janus kinases (JAKs)-proximal sites on the receptor through its SH2 domain and inhibits JAK activity that blocks recruitment of STAT3. Both promote anti-inflammatory effects due to the suppression of inflammation-inducing cytokine signaling. Furthermore, the SOCS box, another domain in SOCS proteins, interacts with E3 ubiquitin ligases and/or couples the SH2 domain-binding proteins to the ubiquitin-proteasome pathway. Therefore, SOCSs inhibit cytokine signaling by suppressing JAK kinase activity and degrading the activated cytokine receptor complex.
A previous study has confirmed that SOCS3 may significantly inhibit the proliferation of lung cancer cells in vitro and indicated that SOCS3 may act as an anti-oncogene involved in the development of tumors. Furthermore, SOCS3 may regulate the movement and migration of tumor cells. Methylation-mediated silencing of SOCS3 has been reported in non-small lung cancer (NSCLC) and other human cancers. In addition to the effect of SOCS3 in inflammation, abnormalities of the JAK/STAT pathway are also associated with cancer. It has been reported that methylationin of CpG islands in the functional SOCS3 promoter is correlated with its transcription silencing in the lung cancer cell lines. Restoration of SOCS3 in lung cancer cells where SOCS3 was methylation-silenced resulted in the down-regulation of active STAT3, induction of apoptosis, and growth suppression of cancer cells. It means that SOCS3 silencing is one of the important mechanisms of constitutive activation of the JAK/STAT pathway in cancer pathogenesis. Therefore, it can be suggested that intracellular SOCS3 protein replacement therapy may be useful in the treatment of lung cancer.
In the previous study, recombinant SOCS3 proteins that contain a cell-penetrating peptide (CPP)-membrane-translocating motif (MTM) from fibroblast growth factor (FGF)-4 has been reported to negatively control JAK/STAT signaling. These recombinant SOCS3 proteins inhibited STAT phosphorylation, inflammatory cytokines production and MHC-II expression in cultured and primary macrophages. In addition, SOCS3 fused to MTM protected mice challenged with a lethal dose of the SEB super-antigen, by suppressing apoptosis and hemorrhagic necrosis in multiple organs. However, the SOCS3 proteins fused to FGF4-derived MTM displayed extremely low solubility, poor yields and relatively low cell- and tissue-permeability. Therefore, the MTM-fused SOCS3 proteins were not suitable for further clinical development as therapeutic agents. To overcome these limitations, improved SOCS3 recombinant proteins (iCP-SOCS3) fused to the combination of novel hydrophobic CPPs, namely advanced macromolecule transduction domains (aMTDs), to greatly improve the efficiency of membrane penetrating ability in vitro and in vivo with solubilization domains to increase their solubility and manufacturing yield when expressed and purified from bacteria cells.
In this new art of invention, aMTD/SD-fused SOCS3 recombinant proteins (iCP-SOCS3) have much improved physicochemical characteristics (solubility & yield) and functional activity (cell-/tissue-permeability) compared to the protein fused only to FGF-4-derived MTM. In addition, the newly developed iCP-SOCS3 proteins have now been demonstrated to have therapeutic application in treating the lung cancer, exploiting the ability of SOCS3 to suppress JAK/STAT signaling. The present invention represents that macromolecule intracellular transduction technology (MITT) enabled by the new hydrophobic CPPs that are aMTDs may provide novel protein therapy through SOCS3-intracellular protein replacement against the lung cancer. These findings suggest that restoration of SOCS3 by replenishing the intracellular SOCS3 with iCP-SOCS3 protein creates a new paradigm for anti-cancer therapy, and the intracellular protein replacement therapy with the SOCS3 recombinant protein fused to the combination of aMTD and SD pair may be useful to treat the lung cancer.

SUMMARY

An aspect of the present invention relates to improved cell-permeable SOCS3 (iCP-SOCS3) capable of mediating the transduction of biologically active macromolecules into live cells.
iCP-SOCS3 fused to novel hydrophobic CPPs—namely advanced macromolecule transduction domains (aMTDs)—greatly improve the efficiency of membrane penetrating ability in vitro and in vivo of the recombinant proteins.
iCP-SOCS3 fused to solubilization domains (SDs) greatly increase in their solubility and manufacturing yield when they are expressed and purified in the bacteria system.
An aspect of the present invention also relates to its therapeutic application for delivery of a biologically active molecule to a cell involving a cell-permeable SOCS3 recombinant protein, where the aMTD is attached to a biologically active cargo molecule.
Other aspects of the present invention relate to an efficient use of aMTD sequences for drug delivery, protein therapy, intracellular protein therapy, protein replacement therapy and peptide therapy.
An aspect of the present invention provides improved cell-permeable SOCS3 as a biotherapeutics having improved solubility/yield, cell-/tissue-permeability and anti-lung cancer effects. Therefore, this would allow their practically effective applications in drug delivery and protein therapy including intracellular protein therapy and protein replacement therapy.

BRIEF DESCRIPTION OF DRAWINGS

The above and other objects, features and other advantages of the present invention will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings.

FIG. 1 shows the structure of SOCS3 recombinant proteins. A schematic diagram of the His-tagged SOCS3 recombinant protein is illustrated and constructed according to the present invention. The his-tag for affinity purification (white), aMTD165 (black), SOCS3 (gray) and solubilization domain A and B (SDA & SDB, hatched) are shown.

FIG. 2 shows the construction of expression for SOCS3 recombinant proteins This figure shows the agarose gel electrophoresis analysis showing plasmid DNA fragments encoding SOCS3, aMTDs fused SOCS3 and SD cloned into the pET28 (+) vector according to the present invention.

FIG. 3 shows inducible expression and purification of SOCS3 recombinant proteins. Expression of SOCS3 recombinant proteins in E. coli before (−) and after (+) induction with IPTG and purification by Ni2+ affinity chromatography (P) were monitored by SDS-PAGE, and stained with Coomassie blue.

FIG. 4 shows the improvement of solubility/yield with aMTD/SD-fusion. The solubility, yield and recovery (in percent) of soluble form from denatured form are indicated (left). Relative yield of recombinant proteins is normalized to the yield of HS3 protein (Right).

FIG. 5 shows aMTD-mediated cell-permeability of SOCS3 recombinant proteins. RAW264.7 cells were exposed to FITC-labeled SOCS3 recombinant proteins (10

M) for 1 hr, treated with proteinase K to remove cell-associated but non-internalized proteins and analyzed by flow cytometry. Untreated cells (gray) and equimolar concentration of unconjugated FITC (FITC only, green)-treated cells were served as control.

FIG. 6 shows aMTD-mediated intracellular delivery and localization of SOCS3 recombinant proteins. Each of NIH3T3 cells was incubated for 1 hour at 37° C. with 10

M FITC-labeled SOCS3 protein. Cell-permeability of SOCS3 recombinant proteins was visualized by utilizing confocal microscopy LSM700 version.

FIG. 7 shows the systemic delivery of aMTD/SD-fused SOCS3 recombinant proteins In vivo. Cryosections of saline-perfused organs were prepared from mice 1 hr after intraperitoneal injection of FITC only or 600

g FITC-conjugated recombinant SOCS3 proteins, and were analyzed by fluorescence microscopy.

FIG. 8 shows the structure of SDB-fused SOCS3 recombinant protein. A schematic diagram of the SOCS3 recombinant protein is illustrated and constructed according to the present invention. The his-tag for affinity purification (white), SOCS3 (gray) and solubilization domain B (SDB, hatched) are shown.

FIG. 9 shows the expression, purification and determination of solubility/yield of SD-fused SOCS3 recombinant protein. Expression of SOCS3 recombinant proteins in E. coli before (−) and after (+) induction with IPTG and purification by Ni2+ affinity chromatography (P) were monitored by SDS-PAGE, and stained with Coomassie blue (Left, top). The solubility, yield and recovery (in percent) of soluble form from denatured form are indicated (Left, bottom). Relative yield of recombinant proteins is normalized to the yield of HS3 protein (Right).

FIG. 10 shows the mechanism of aMTD-mediated SOCS3 protein uptake into cells. (A-D) RAW264.7 cells were treated with 100 mM EDTA for 3 hrs (A), 5 mg/ml Proteinase K for 10 mins (B), 20 mM taxol for 30 mins (C), or 10 μM antimycin for 2 hrs either without or with 1 mM supplemental ATP for 3 hrs. Cells were exposed for 1 hr to 10

M FITC-labeled HS3 (black), -HS3B (blue) or -HM165S3B (red), treated with proteinase K for 20 mins, and analyzed by flow cytometry. Untreated cells (gray) and equimolar concentration of unconjugated FITC (FITC only, green)-treated cells were served as control. (E) RAW264.7 cells were exposed for the indicated times to 10 μM FITC-labeled HS3 (black), -HS3B (blue) or -HM165S3B (red), treated with proteinase K, and analyzed by flow cytometry.

FIG. 11 shows aMTD-mediated cell-to-cell delivery. RAW264.7 cells exposed to 10 μM FITC-HS3B or FITC-HM165S3B for 2 hrs, were mixed with non-treated RAW264.7 cells pre-stained with Cy5.5 labeled anti-CD14 antibody, and analyzed by flow cytometry (left, top). The top (right) panel shows a mixture of double negative cells (cells exposed to FITC-HS3B that did not incorporate the protein) and single positive Cy5.5 labeled cells; whereas, second panel from the left contains FITC-Cy5.5 double-positive cells generated by the transfer of FITC-HM165S3B to Cy5.5 labeled cells and the remaining FITC and Cy5.5 single-positive cells. The bottom panels show FITC fluorescence profiles of cell populations before mixing (coded as before) and 1 hr after the same cells were mixed with Cy5.5-labeled cells.

FIG. 12 shows the inhibition of STAT phosphorylation induced by IFN-

. Inhibition of STAT1 phosphorylation detected by immunoblotting analysis. The levels of phosphorylated STAT1 and STAT3 untreated and treated with IFN-

were compared to the levels in IFN-

-treated RAW 264.7 cells that were pulsed with 10

M of indicated proteins.

FIG. 13 shows the inhibition of cytokines secretion induced by LPS. Inhibition of TNF-

and IL-6 expression by recombinant SOCS3 proteins in primary macrophages isolated from peritoneal exudates of C3H/HeJ mice. Error bars indicate+s.d. of the mean value derived from each assay done in triplicate.

FIG. 14 shows the cell-permeability of iCP-SOCS3 (HM165S3B) in lung cancer cells. A549 lung cancer cells were exposed to FITC-labeled SOCS3 recombinant proteins (10

M) for 1 hr, treated with proteinase K to remove cell-associated proteins for 20 mins, and analyzed by flow cytometry. Untreated cells (gray) and equimolar concentration of unconjugated FITC (FITC only, green)-treated cells were served as control.

FIG. 15 shows the tissue distribution of iCP-SOCS3 (HM165S3B) into lung tissue. Cryosections of saline-perfused organs were prepared from mice 1 hr after intraperitoneal injection of FITC only or 600

FIG. 16 shows the inhibition of proliferation in lung cancer cells with iCP-SOCS3. A549 lung cancer cells were seeded in 96 well plates. Next day, cells were treated with DMEM (V), HS3 (1), HM165S3 (2), HM165S3A (3) or HM165S3B (4) recombinant proteins for 96 hrs in the presence of serum (2%). Cell viability was evaluated with the CellTiter-Glo Cell Viability Assay.

FIG. 17 shows the induction of apoptosis in lung cancer cells with iCP-SOCS3. A549 lung cancer cells were treated for 24 hrs with 10 μM HS3B or HM165S3B proteins and apoptotic cells were visualized by TUNEL staining.

FIG. 18 shows the stimulation of apoptosis in lung cancer cells with iCP-SOCS3. A549 lung cancer cells were treated for 24 hr with 10 μM HS3B or HM165S3B proteins and analyzed by flow cytometry of cells stained with annexin-V and 7-AAD.

FIG. 19 shows the inhibition of migration in lung cancer cells with iCP-SOCS3. A549 lung cancer cells were grown to 100% confluence and these procedures were performed on wound-healing assays. The wound areas were examined and photographed at 0 and 48 hrs post-wounding.

FIG. 20 shows the inhibition of migration/invasion in lung cancer cells with iCP-SOCS3. A549 lung cancer cells were treated with SOCS3 recombinant proteins for 24 hrs, and migration/invasion were measured by Transwell assay. The data shown are representative of three independent experiments. **, p<0.01.

DETAILED DESCRIPTION

In this invention, it has been hypothesized that exogenously administered SOCS3 proteins could compensate for the apparent inability of endogenously expressed members of this physiologic regulator to interrupt constitutively active cancer-initiating JAK/STAT signaling and excessive cell cycle, resulting in the inhibition of the tumorigenesis. To prove our hypothesis, the SOCS3 recombinant proteins were fused to novel hydrophobic CPPs called aMTDs to improve their cell-/tissue-permeability, additionally adopted solubilization domains to increase their solubility/yield in physiological condition, and then tested whether exogenous administration of SOCS3 proteins can reconstitute their endogenous stores and restore their basic function as the negative feedback regulator that attenuates JAK/STAT signaling. This art of invention has demonstrated “intracellular protein therapy” by designing and introducing cell-permeable form of SOCS3 that has a great potential of anti-cancer therapeutic applicability in lung cancer.

1. Novel Hydrophobic Cell-Penetrating Peptides—Advanced Macromolecule Transduction Domains

To address the limitation of previously developed hydrophobic CPPs, novel sequences have been developed. To design new hydrophobic CPPs for intracellular delivery of cargo proteins such as SOCS3, identification of optimal common sequence and/or homologous structural determinants, namely critical factors (CFs), had been crucial. To do it, the physicochemical characteristics of previously published hydrophobic CPPs were analyzed. To keep the similar mechanism on cellular uptake, all CPPs analyzed were hydrophobic region of signal peptide (HRSP)-derived CPPs (e.g. MTS and MTD).

(1) Basic Characteristics of CPPs Sequence.

These 17 hydrophobic CPPs published from 1995 to 2014 have been analyzed for their 11 different characteristics—sequence, amino acid length, molecular weight, pl value, bending potential, rigidity/flexibility, structural feature, hydropathy, residue structure, amino acid composition, and secondary structure of the sequences. Two peptide/protein analysis programs were used (ExPasy: http://web.expasy.org/protparam/, SoSui: http://harrier.nagahama-i-bio.ac.jp/sosui/sosui_submit.html) to determine various indexes, structural features of the peptide sequences and to design new sequence. Followings are important factors analyzed.
Average length, molecular weight and pl value of the peptides analyzed were 10.8±2.4, 1,011±189.6 and 5.6±0.1, respectively.

(2) Bending Potential (Proline Position: PP)

Bending potential (Bending or No-Bending) was determined based on the fact whether proline (P) exists and/or where the amino acid(s) providing bending potential to the peptide in recombinant protein is/are located. Proline differs from the other common amino acids in that its side chain is bonded to the backbone nitrogen atom as well as the alpha-carbon atom. The resulting cyclic structure markedly influences protein architecture which is often found in the bends of folded peptide/protein chain. Eleven out of 17 were determined as ‘Bending’ peptide which means that proline should be present in the middle of sequence for peptide bending and/or located at the end of the peptide for protein bending. As indicated above, peptide sequences could penetrate the plasma membrane in a “bent” configuration. Therefore, bending or no-bending potential is considered as one of the critical factors for the improvement of current hydrophobic CPPs.

(3) Rigidity/Flexibility (Instability Index: II)

Since one of the crucial structural features of any peptide is based on the fact whether the motif is rigid or flexible, which is an intact physicochemical characteristic of the peptide sequence, instability index (II) of the sequence was determined. The index value representing rigidity/flexibility of the peptide was extremely varied (8.9-79.1), but average value was 40.1±21.9 which suggested that the peptide should be somehow flexible, but not too rigid or flexible.

(4) Hydropathy (Grand Average of Hydropathy: GRAVY) and Structural Feature (Aliphatic Index: AI)

Alanine (V), valine (V), leucine (L) and isoleucine (I) contain aliphatic side chain and are hydrophobic—that is, they have an aversion to water and like to cluster. These amino acids having hydrophobicity and aliphatic residue enable them to pack together to form compact structure with few holes. Analyzed peptide sequence showed that all composing amino acids were hydrophobic (A, V, L and I) except glycine (G) in only one out of 17 and aliphatic (A, V, L, I, and P). Their hydropathic index (Grand Average of Hydropathy: GRAVY) and aliphatic index (AI) were 2.5±0.4 and 217.9±43.6, respectively.

(5) Secondary Structure (α-Helix)

As explained above, the CPP sequences may be supposed to penetrate the plasma membrane directly after inserting into the membranes in a “bent” configuration with hydrophobic sequences adopting an α-helical conformation. In addition, our analysis strongly indicated that bending potential was crucial. Therefore, structural analysis of the peptides conducted to determine whether the sequence was to form helix or not. Nine peptides were helix and 8 were not. It seems to suggest that helix structure may not be required.

(6) Determination of Critical Factors (CFs)

In the 11 characteristics analyzed, the following 6 are selected namely “Critical Factors (CFs)” for the development of new hydrophobic CPPs—advanced MTDs: i) amino acid length, ii) bending potential (proline presence and location), iii) rigidity/flexibility (instability index: II), iv) structural feature (aliphatic index: AI), v) hydropathy (GRAVY) and vi) amino acid composition/residue structure (hydrophobic and aliphatic A/a).

1-2. Analysis of Selected Hydrophobic CPPs to Optimize ‘Critical Factors’

Since the analyzed data of the 17 different hydrophobic CPPs (analysis A) previously developed during the past 2 decades showed high variation and were hard to make common- or consensus-features, additional analysis B and C was also conducted to optimize the critical factors for better design of improved CPPs-aMTDs.
In analysis B, 8 CPPs used with each cargo in vivo were selected. Length was 11±3.2, but 3 out of 8 CPPs possessed little bending potential. Rigidity/Flexibility was 41±15, but removing one [MTD85: rigid, with minimal (II: 9.1)] of the peptides increased the overall instability index to 45.6±9.3. This suggested that higher flexibility (40 or higher II) is potentially be better. All other characteristics of the 8 CPPs were similar to the analysis A, including structural feature and hydropathy.
To optimize the ‘Common Range and/or Consensus Feature of Critical Factor’ for the practical design of aMTDs and the random peptides, which were to prove that the ‘Critical Factors’ determined in the analysis A, B and C were correct to improve the current problems of hydrophobic CPPs—protein aggregation, low solubility/yield, and poor cell/tissue-permeability of the recombinant proteins fused to the MTS/MTM or MTD, and non-common sequence and non-homologous structure of the peptides, empirically selected peptides were analyzed for their structural features and physicochemical factor indexes.
The peptides which did not have a bending potential, rigid or too flexible sequences (too low or too high Instability Index), or too low or too high hydrophobic CPP were unselected, but secondary structure was not considered because helix structure of sequence was not required. 8 selected CPP sequences that could provide a bending potential and higher flexibility were finally analyzed. Common amino acid length is 12 (11.6±3.0). Proline should be presence in the middle of and/or the end of sequence. Rigidity/Flexibility (II) is 45.5-57.3 (Avg: 50.1±3.6). AI and GRAVY representing structural feature and hydrophobicity of the peptide are 204.7±37.5 and 2.4±0.3, respectively. All peptides are consisted with hydrophobic and aliphatic amino acids (A, V, L, I, and P). Therefore, analysis C was chosen as a standard for the new design of new hydrophobic CPPs (TABLE 1).

- 1. Amino Acid Length: 9-13
- 2. Bending Potential (Proline Position: PP): Proline presences in the middle (from 5′ to 8′ amino acid) and at the end of sequence
- 3. Rigidity/Flexibility (Instability Index: II): 40-60
- 4. Structural Feature (Aliphatic Index: AI): 180-220
- 5. Hydropathy (Grand Average of Hydropathy: GRAVY): 2.1-2.6
- 6. Amino Acid Composition: Hydrophobic and Aliphatic amino acids—A, V, L, I and P

TABLE 1

[Universal Structure of Newly Develop Hydrophobic CPPs]
Summarized Critical Factors of aMTD

	Newly Designed CPPs
Critical Factor	Range

Bending Potential	Proline presences in the middle (5′, 6′, 7′ or 8′)
(Proline Position: PP)	and at the end (12′) of peptides
Rigidity/Flexibility	40-60
(Instability Index: II)
Structural Feature	180-220
(Aliphatic Index: Al)
Hydropathy	2.1-2.6
(Grand Average of
Hydropathy GRAVY)
Length	9-13
(Number of Amino Acid)
Amino acid Composition	A, V, I, L, P

1-3. Determination of Critical Factors for Development of aMTDs

For confirming the validity of 6 critical factors providing the optimized cell-/tissue-permeability. All 240 aMTD sequences have been designed and developed based on six critical factors (TABLES 2-1 to 2-6). (The aMTD amino sequences are SEQ ID NOS: 1 to 240, and the aMTD nucleotide sequences are SEQ ID NOS: 241 to 480.)
All 240 aMTDs (hydrophobic, flexible, bending, aliphatic and helical 12 a/a-length peptides) were practically confirmed by their quantitative and visual cell-permeability. To determine the cell-permeability of aMTDs and random peptides which do not satisfy one or more critical factors have also been designed and tested. Relative cell-permeability of 240 aMTDs to the negative control (random peptide, hydrophilic & non-aliphatic 12A/a length peptide) was significantly increased by up to 164 fold, with average increase of 19.6±1.6. Moreover, compared with reference CPPs (MTM and MTD), novel 240 aMTDs averaged of 13±1.1 (maximum 109.9) and 6.6±0.5 (maximum 55.5) fold higher cell-permeability, respectively. As a result, there were vivid association of cell-permeability of the peptides and critical factors. According to the result from the newly designed and tested novel 240 aMTDs, the empirically optimized critical factors are provided below.

- 1. Amino Acid Length: 12
- 2. Bending Potential (Proline Position: PP)
- : Proline presences in the middle (from 5′ to 8′ amino acid) and at the end of sequence
- 3. Rigidity/Flexibility (Instability Index: II): 41.3-57.3
- 4. Structural Feature (Aliphatic Index: AI): 187.5-220.0
- 5. Hydropathy (Grand Average of Hydropathy: GRAVY): 2.2-2.6
- 6. Amino Acid Composition: Hydrophobic and Aliphatic amino acids—A, V, L, I and P

TABLE 2-1

[Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are
Considered and Satisfied (Sequence ID No. 1-46)]

Sequence				Rigidity/	Sturctural
ID				Flexibility	Feature	Hydropathy	Residue
Number	aMTD	Sequences	Length	(II)	(Al)	(GRAVY)	Structure

1	1	AAALAPVVLALP	12	57.3	187.5	2.1	Aliphatic

2	2	AAAVPLLAVVVP	12	41.3	195.0	2.4	Aliphatic

3	3	AALLVPAAVLAP	12	57.3	187.5	2.1	Aliphatic

4	4	ALALLPVAALAP	12	57.3	195.8	2.1	Aliphatic

5	5	AAALLPVALVAP	12	57.3	187.5	2.1	Aliphatic

6	11	VVALAPALAALP	12	57.3	187.5	2.1	Aliphatic

7	12	LLAAVPAVLLAP	12	57.3	211.7	2.3	Aliphatic

8	13	AAALVPVVALLP	12	57.3	203.3	2.3	Aliphatic

9	21	AVALLPALLAVP	12	57.3	211.7	2.3	Aliphatic

10	22	AVVLVPVLAAAP	12	57.3	195.0	2.4	Aliphatic

11	23	VVLVLPAAAAVP	12	57.3	195.0	2.4	Aliphatic

12	24	IALAAPALIVAP	12	50.2	195.8	2.2	Aliphatic

13	25	IVAVAPALVALP	12	50.2	203.3	2.4	Aliphatic

14	42	VAALPVVAVVAP	12	57.3	186.7	2.4	Aliphatic

15	43	LLAAPLVVAAVP	12	41.3	187.5	2.1	Aliphatic

16	44	ALAVPVALLVAP	12	57.3	203.3	2.3	Aliphatic

17	61	VAALPVLLAALP	12	57.3	211.7	2.3	Aliphatic

18	62	VALLAPVALAVP	12	57.3	203.3	2.3	Aliphatic

19	63	AALLVPALVAVP	12	57.3	203.3	2.3	Aliphatic

20	64	AIVALPVAVLAP	12	50.2	203.3	2.4	Aliphatic

21	65	IAIVAPVVALAP	12	50.2	203.3	2.4	Aliphatic

22	81	AALLPALAALLP	12	57.3	204.2	2.1	Aliphatic

23	82	AVVLAPVAAVLP	12	57.3	195.0	2.4	Aliphatic

24	83	LAVAAPLALALP	12	41.3	195.8	2.1	Aliphatic

25	84	AAVAAPLLLALP	12	41.3	195.8	2.1	Aliphatic

26	85	LLVLPAAALAAP	12	57.3	195.8	2.1	Aliphatic

27	101	LVALAPVAAVLP	12	57.3	203.3	2.3	Aliphatic

28	102	LALAPAALALLP	12	57.3	204.2	2.1	Aliphatic

29	103	ALIAAPILALAP	12	57.3	204.2	2.2	Aliphatic

30	104	AVVAAPLVLALP	12	41.3	203.3	2.3	Aliphatic

31	105	LLALAPAALLAP	12	57.3	204.1	2.1	Aliphatic

32	121	AIVALPALALAP	12	50.2	195.8	2.2	Aliphatio

33	123	AAIIVPAALLAP	12	50.2	195.8	2.2	Aliphatic

34	124	IAVALPALIAAP	12	50.3	195.8	2.2	Aliphatic

35	141	AVIVLPALAVAP	12	50.2	203.3	2.4	Aliphatio

36	143	AVLAVPAVLVAP	12	57.3	195.0	2.4	Aliphatic

37	144	VLAIVPAVALAP	12	50.2	203.3	2.4	Aliphatic

38	145	LLAVVPAVALAP	12	57.3	203.3	2.3	Aliphatic

39	161	AVIALPALIAAP	12	57.3	195.8	2.2	Aliphatic

40	162	AVVALPAALIVP	12	50.2	203.3	2.4	Aliphatic

41	163	LALVLPAALAAP	12	57.3	195.8	2.1	Aliphatic

42	164	LAAVLPALLAAP	12	57.3	195.8	2.1	Aliphatic

43	165	ALAVPVALAIVP	12	50.2	203.3	2.4	Aliphatic

44	182	ALIAPVVALVAP	12	57.3	203.3	2.4	Aliphatic

45	183	LLAAPVVIALAP	12	57.3	211.6	2.4	Aliphatic

46	184	LAAIVPAIIAVP	12	50.2	211.6	2.4	Aliphatic

TABLE 2-2

[Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors
Are Considered and Satisfied (Sequence ID No. 47-92)]

47	185	AALVLPLIIAAP	12	41.3	220.0	2.4	Aliphatic

48	201	LALAVPALAALP	12	57.3	195.5	2.1	Aliphatic

49	204	LIAALPAVAALP	12	57.3	195.5	2.2	Aliphatic

50	205	ALALVPAIAALP	12	57.3	195.8	2.2	Aliphatic

51	221	AAILAPIVALAP	12	50.2	195.8	2.2	Aliphatic

52	222	ALLIAPAAVIAP	12	57.3	195.8	2.2	Aliphatic

53	223	AILAVPIAVVAP	12	57.3	203.3	2.4	Aliphatic

54	224	ILAAVPIALAAP	12	57.3	195.8	2.2	Aliphatic

55	225	VAALLPAAAVLP	12	57.3	187.5	2.1	Aliphatic

56	241	AAAVVPVLLVAP	12	57.3	195.0	2.4	Aliphatic

57	242	AALLVPALVAAP	12	57.3	187.5	2.1	Aliphatic

58	243	AAVLLPVALAAP	12	57.3	187.5	2.1	Aliphatic

59	245	AAALAPVLALVP	12	57.3	187.5	2.1	Aliphatic

60	261	LVLVPLLAAAAP	12	41.3	211.6	2.3	Aliphatic

61	262	ALIAVPAIIVAP	12	50.2	211.6	2.4	Aliphatic

62	263	ALAVIPAAAILP	12	54.9	195.8	2.2	Aliphatic

63	264	LAAAPVVIVIAP	12	50.2	203.3	2.4	Aliphatic

64	265	VLAIAPLLAAVP	12	41.3	211.6	2.3	Aliphatic

65	281	ALIVLPAAVAVP	12	50.2	203.3	2.4	Aliphatic

66	282	VLAVAPALIVAP	12	50.2	203.3	2.4	Aliphatic

67	283	AALLAPALIVAP	12	50.2	195.8	2.2	Aliphatic

68	284	ALIAPAVALIVP	12	50.2	211.7	2.4	Aliphatic

69	285	AIVLLPAAVVAP	12	50.2	203.3	2.4	Aliphatic

70	301	VIAAPVLAVLAP	12	57.3	203.3	2.4	Aliphatic

71	302	LALAPALALLAP	12	57.3	204.2	2.1	Aliphatic

72	304	AIILAPIAAIAP	12	57.3	204.2	2.3	Aliphatic

73	305	IALAAPILLAAP	12	57.3	204.2	2.2	Aliphatic

74	321	IVAVALPALAVP	12	50.2	203.3	2.3	Aliphatic

75	322	VVAIVLPALAAP	12	50.2	203.3	2.3	Aliphatic

76	323	IVAVALPVALAP	12	50.2	203.3	2.3	Aliphatic

77	324	IVAVALPAALVP	12	50.2	203.3	2.3	Aliphatic

78	325	IVAVALPAVALP	12	50.2	203.3	2.3	Aliphatic

79	341	IVAVALPAVLAP	12	50.2	203.3	2.3	Aliphatic

80	342	VIVALAPAVLAP	12	50.2	203.3	2.3	Aliphatic

81	343	IVAVALPALVAP	12	50.2	203.3	2.3	Aliphatic

82	345	ALLIVAPVAVAP	12	50.2	203.3	2.3	Aliphatic

83	361	AVVIVAPAVIAP	12	50.2	195.0	2.4	Aliphatic

84	363	AVLAVAPALIVP	12	50.2	203.3	2.3	Aliphatic

85	364	LVAAVAPALIVP	12	50.2	203.3	2.3	Aliphatic

86	365	AVIVVAPALLAP	12	50.2	203.3	2.3	Aliphatic

87	381	VVAIVLPAVAAP	12	50.2	195.0	2.4	Aliphatic

88	382	AAALVIPAILAP	12	54.9	195.8	2.2	Aliphatic

89	383	VIVALAPALLAP	12	50.2	211.6	2.3	Aliphatic

90	384	VIVAIAPALLAP	12	50.2	211.6	2.4	Aliphatic

91	385	IVAIAVPALVAP	12	50.2	203.3	2.4	Aliphatic

92	401	AALAVIPAAILP	12	54.9	195.8	2.2	Aliphatic

TABLE 2-3

[Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are
Considered and Satisfied (Sequence ID No. 93-138)]

93	402	ALAAVIPAAILP	12	54.9	195.8	2.2	Aliphatic

94	403	AAALVIPAAILP	2	54.9	195.6	2.2	Aliphatic

95	404	LAAAVIPAAILP	2	54.9	195.8	2.2	Aliphatic

96	405	LAAAVIPVAILP	12	54.9	211.7	2.4	Aliphatic

97	421	AAILAAPLIAVP	12	57.3	195.8	2.2	Aliphatic

98	422	VVAILAPLLAAP	12	57.3	211.7	2.4	Aliphatic

99	424	AVVVAAPVLALP	12	57.3	195.0	2.4	Aliphatic

100	425	AVVAIAPVLALP	12	57.3	203.3	2.4	Aliphatic

101	442	ALAALVPAVLVP	12	57.3	203.3	2.3	Aliphatic

102	443	ALAALVPVALVP	12	57.3	203.3	2.3	Aliphatic

103	444	LAAALVPVALVP	12	57.3	203.3	2.3	Aliphatic

104	445	ALAALVPALVVP	12	57.3	203.3	2.3	Aliphatic

105	461	IAAVIVPAVALP	12	50.2	203.3	2.4	Aliphatic

106	462	IAAVLVPAVALP	12	57.3	203.3	2.4	Aliphatic

107	463	AVAILVPLLAAP	12	57.3	211.7	2.4	Aliphatic

108	464	AVVILVPLAAAP	12	57.3	203.3	2.4	Aliphatic

109	465	IAAVIVPVAALP	12	50.2	203.3	2.4	Aliphatic

110	481	AIAIAIVPVALP	12	50.2	211.6	2.4	Aliphatic

111	482	ILAVAAIPVAVP	12	54.9	203.3	2.4	Aliphatic

112	483	ILAAAIIPAALP	12	54.9	204.1	2.2	Aliphatic

113	484	LAVVLAAPAIVP	12	50.2	203.3	2.4	Aliphatic

114	485	AILAAIVPLAVP	12	50.2	211.6	2.4	Aliphatic

115	501	VIVALAVPALAP	12	50.2	203.3	2.4	Aliphatic

116	502	AIVALAVPVLAP	12	50.2	203.3	2.4	Aliphatic

117	503	AAIIIVLPAALP	12	50.2	220.0	2.4	Aliphatic

118	504	LIVALAVPALAP	12	50.2	211.7	2.4	Aliphatic

119	505	AIIIVIAPAAAP	12	50.2	195.8	2.3	Aliphatic

120	521	LAALIVVPAVAP	12	50.2	203.3	2.4	Aliphatic

121	522	ALLVIAVPAVAP	12	57.3	203.3	2.4	Aliphatic

122	524	AVALIVVPALAP	12	50.2	203.3	2.4	Aliphatic

123	525	ALAIVVAPVAVP	12	50.2	195.0	2.4	Aliphatic

124	541	LLALIIAPAAAP	12	57.3	204.1	2.1	Aliphatic

125	542	ALALIIVPAVAP	12	50.2	211.6	2.4	Aliphatic

126	543	LLAALIAPAALP	12	57.3	204.1	2.1	Aliphatic

127	544	IVALIVAPAAVP	12	43.1	203.3	2.4	Aliphatic

128	545	VVLVLAAPAAVP	12	57.3	195.0	2.3	Aliphatic

129	561	AAVAIVLPAVVP	12	50.2	195.0	2.4	Aliphatic

130	562	ALIAAIVPALVP	12	50.2	211.7	2.4	Aliphatic

131	563	ALAVIVVPALAP	12	50.2	203.3	2.4	Aliphatic

132	564	VAIALIVPALAP	12	50.2	211.7	2.4	Aliphatic

133	565	VAIVLVAPAVAP	12	50.2	195.0	2.4	Aliphatic

134	582	VAVALIVPALAP	12	50.2	203.3	2.4	Aliphatic

135	583	AVILALAPIVAP	12	50.2	211.6	2.4	Aliphatic

136	585	ALIVAIAPALVP	12	50.2	211.6	2.4	Aliphatic

137	601	AAILIAVPIAAP	12	57.3	195.8	2.3	Aliphatic

138	602	VIVALAAPVLAP	12	50.2	203.3	2.4	Aliphatic

TABLE 2-4

[Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are
Considered and Satisfied (Sequence ID No. 139-184)]

139	603	VLVALAAPVIAP	12	57.3	203.3	2.4	Aliphatic

140	604	VALIAVAPAVVP	12	57.3	195.0	2.4	Aliphatic

141	605	VIAAVLAPVAVP	12	57.3	195.0	2.4	Aliphatic

142	622	ALIVLAAPVAVP	12	50.2	203.3	2.4	Aliphatic

143	623	VAAAIALPAIVP	12	50.2	187.5	2.3	Aliphatic

144	625	ILAAAAAPLIVP	12	50.2	195.8	2.2	Aliphatic

145	643	LALVLAAPAIVP	12	50.2	211.6	2.4	Aliphatic

146	645	ALAVVALPAIVP	12	50.2	203.3	2.4	Aliphatic

147	661	AAILAPIVAALP	12	50.2	195.8	2.2	Aliphatic

148	664	ILIAIAIPAAAP	12	54.9	204.1	2.3	Aliphatic

149	665	LAIVLAAPVAVP	12	50.2	203.3	2.3	Aliphatic

150	666	AAIAIIAPAIVP	12	50.2	195.8	2.3	Aliphatic

151	667	LAVAIVAPALVP	12	50.2	203.3	2.3	Aliphatic

152	683	LAIVLAAPAVLP	12	50.2	211.7	2.4	Aliphatic

153	684	AAIVLALPAVLP	12	50.2	211.7	2.4	Aliphatic

154	685	ALLVAVLPAALP	12	57.3	211.7	2.3	Aliphatic

155	686	AALVAVLPVALP	12	57.3	203.3	2.3	Aliphatic

156	687	AILAVALPLLAP	12	57.3	220.0	2.3	Aliphatic

157	703	IVAVALVPALAP	12	50.2	203.3	2.4	Aliphatic

158	705	IVAVALLPALAP	12	50.2	211.7	2.4	Aliphatic

159	706	IVAVALLPAVAP	12	50.2	203.3	2.4	Aliphatic

160	707	IVALAVLPAVAP	12	50.2	203.3	2.4	Aliphatic

161	724	VAVLAVLPALAP	12	57.3	203.3	2.3	Aliphatic

162	725	IAVLAVALAVLP	12	57.3	203.3	2.3	Aliphatic

163	726	LAVAIIAPAVAP	12	57.3	187.5	2.2	Aliphatic

164	727	VALAIALPAVLP	12	57.3	211.6	2.3	Aliphatic

165	743	AIAIALVPVALP	12	57.3	211.6	2.4	Aliphatic

166	744	AAVVIVAPVALP	12	50.2	195.0	2.4	Aliphatic

167	746	VAIIVVAPALAP	12	50.2	203.3	2.4	Aliphatic

168	747	VALLAIAPALAP	12	57.3	195.8	2.2	Aliphatic

169	763	VAVLIAVPALAP	12	57.3	203.3	2.3	Aliphatic

170	764	AVALAVLPAVVP	12	57.3	195.0	2.3	Aliphatic

171	765	AVALAVVPAVLP	12	57.3	195.0	2.3	Aliphatic

172	766	IVVIAVAPAVAP	12	50.2	195.0	2.4	Aliphatic

173	767	IVVAAVVPALAP	12	50.2	195.0	2.4	Aliphatic

174	783	IVALVPAVAIAP	12	50.2	203.3	2.5	Aliphatic

175	784	VAALPAVALVVP	12	57.3	195.0	2.4	Aliphatic

176	786	LVAIAPLAVLAP	12	41.3	211.7	2.4	Aliphatic

177	787	AVALVPVIVAAP	12	50.2	195.0	2.4	Aliphatic

178	788	AIAVAIAPVALP	12	57.3	187.5	2.3	Aliphatic

179	803	AIALAVPVLALP	12	57.3	211.7	2.4	Aliphatic

180	805	LVLIAAAPIALP	12	41.3	220.0	2.4	Aliphatic

181	806	LVALAVPAAVLP	12	57.3	203.3	2.3	Aliphatic

182	807	AVALAVPALVLP	12	57.3	203.3	2.3	Aliphatic

183	808	LVVLAAAPLAVP	12	41.3	203.3	2.3	Aliphatic

184	809	LIVLAAPALAAP	12	50.2	195.8	2.2	Aliphatic

TABLE 2-5

[Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are
Considered and Satisfied (Sequence ID No. 185-230)]

185	810	VIVLAAPALAAP	12	50.2	187.5	2.2	Aliphatic

186	811	AVVLAVPALAVP	12	57.3	195.0	2.3	Aliphatic

187	824	LIIVAAAPAVAP	12	50.2	187.5	2.3	Aliphatic

188	825	IVAVIVAPAVAP	12	43.2	195.0	2.5	Aliphatic

189	826	LVALAAPIIAVP	12	41.3	211.7	2.4	Aliphatic

190	827	IAAVLAAPALVP	12	57.3	187.5	2.2	Aliphatic

191	828	IALLAAPIIAVP	12	41.3	220.0	2.4	Aliphatic

192	829	AALALVAPVIVP	12	50.2	203.3	2.4	Aliphatic

193	830	IALVAAPVALVP	12	57.3	203.3	2.4	Aliphatic

194	831	IIVAVAPAAIVP	12	43.2	203.3	2.5	Aliphatic

195	832	AVAAIVPVIVAP	12	43.2	195.0	2.5	Aliphatic

196	843	AVLVLVAPAAAP	12	41.3	219.2	2.5	Aliphatic

197	844	VVALLAPLIAAP	12	41.3	211.8	2.4	Aliphatic

198	845	AAVVIAPLLAVP	12	41.3	203.3	2.4	Aliphatic

199	846	IAVAVAAPLLVP	12	41.3	203.3	2.4	Aliphatic

200	847	LVAIVVLPAVAP	12	50.2	219.2	2.6	Aliphatic

201	848	AVAIVVLPAVAP	12	50.2	195.0	2.4	Aliphatic

202	849	AVILLAPLIAAP	12	57.3	220.0	2.4	Aliphatic

203	850	LVIALAAPVALP	12	57.3	211.7	2.4	Aliphatic

204	851	VLAVVLPAVALP	12	57.3	219.2	2.5	Aliphatic

205	852	VLAVAAPAVLLP	12	57.3	203.3	2.3	Aliphatic

206	863	AAVVLLPIIAAP	12	41.3	211.7	2.4	Aliphatic

207	864	ALLVIAPAIAVP	12	57.3	211.7	2.4	Aliphatic

208	865	AVLVIAVPAIAP	12	57.3	203.3	2.5	Aliphatic

209	867	ALLVVIAPLAAP	12	41.3	211.7	2.4	Aliphatic

210	868	VLVAAILPAAIP	12	54.9	211.7	2.4	Aliphatic

211	870	VLVAAVLPIAAP	12	41.3	203.3	2.4	Aliphatic

212	872	VLAAAVLPLVVP	12	41.3	219.2	2.5	Aliphatic

213	875	AIAIVVPAVAVP	12	50.2	195.0	2.4	Aliphatic

214	877	VAIIAVPAVVAP	12	57.3	195.0	2.4	Aliphatic

215	878	IVALVAPAAVVP	12	50.2	195.0	2.4	Aliphatic

216	879	AAIVLLPAVVVP	12	50.2	219.1	2.5	Aliphatic

217	881	AALIVVPAVAVP	12	50.2	195.0	2.4	Aliphatic

218	882	AIALVVPAVAVP	12	57.3	195.0	2.4	Aliphatic

219	883	LAIVPAAIAALP	12	50.2	195.8	2.2	Aliphatic

220	885	LVAIAPAVAVLP	12	57.3	203.3	2.4	Aliphatic

221	887	VLAVAPAVAVLP	12	57.3	195.0	2.4	Aliphatic

222	888	ILAVVAIPAAAP	12	54.9	187.5	2.3	Aliphatic

223	889	ILVAAAPIAALP	12	57.3	195.8	2.2	Aliphatic

224	891	ILAVAAIPAALP	12	54.9	195.8	2.2	Aliphatic

225	893	VIAIPAILAAAP	12	54.9	195.8	2.3	Aliphatic

226	895	AIIIVVPAIAAP	12	50.2	211.7	2.5	Aliphatic

227	896	AILIVVAPIAAP	12	50.2	211.7	2.5	Aliphatic

228	897	AVIVPVAIIAAP	12	50.2	203.3	2.5	Aliphatic

229	899	AVVIALPAVVAP	12	57.3	195.0	2.4	Aliphatic

230	900	ALVAVIAPVVAP	12	57.3	195.0	2.4	Aliphatic

TABLE 2-6

[Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are
Considered and Satisfied (Sequence ID No. 231-240)]

231	901	ALVAVLPAVAVP	12	57.3	195.0	2.4	Aliphatic

232	902	ALVAPLLAVAVP	12	41.3	203.3	2.3	Aliphatic

233	904	AVLAVVAPVVAP	12	57.3	186.7	2.4	Aliphatic

234	905	AVIAVAPLVVAP	12	41.3	195.0	2.4	Aliphatic

235	906	AVIALAPVVVAP	12	57.3	195.0	2.4	Aliphatic

236	907	VAIALAPVVVAP	12	57.3	195.0	2.4	Aliphatic

237	908	VALALAPVVVAP	12	57.3	195.0	2.3	Aliphatic

238	910	VAALLPAVVVAP	12	57.3	195.0	2.3	Aliphatic

239	911	VALALPAVVVAP	12	57.3	195.0	2.3	Aliphatic

240	912	VALLAPAVVVAP	12	57.3	195.0	2.3	Aliphatic
				52.6 ± 5.1	201.7 ± 7.8	2.3 ± 0.1

These examined critical factors are within the range that we have set for our critical factors; therefore, we were able to confirm that the aMTDs that satisfy these critical factors have much higher cell-permeability (TABLE 3) and intracellular delivery potential compared to reference hydrophobic CPPs reported during the past two decades.

TABLE 3

[Summarized Critical Factors of aMTD After In-Depth Analysis
of Experimental Results]
Summarized Critical Factors of aMTD

	Analysis of Experimental Results
Critical Factor	Range

Bending Potential	Proline presences in the middle (5′, 6′, 7′ or 8′)
(Proline Position: PP)	and at the end (12′) of peptides
Rigidity/Flexibility	41.3-57.3
(Instability Index: II)
Structural Feature	187.5-220.0
(Aliphatic Index: Al)
Hydropathy	2.2-2.6
(Grand Average of
Hydropathy GRAVY)
Length	12
(Number of Amino Acid)
Amino acid Composition	A, V, I, L, P

2. Development of SOCS3 Recombinant Proteins Fused to aMTD and Solubilization Domain 2-1. Design of Novel Hydrophobic CPPs-aMTDs for Development of Recombinant SOCS3 Proteins

Based on these six critical factors proven by experimental data, newly designed advanced macromolecule transduction domains (aMTDs) have been developed, and optimized for their practical therapeutic usage to facilitate protein translocation across the membrane. For this present invention, cell-permeable SOCS3 recombinant proteins have been developed by adopting aMTD165 (TABLE 4) that satisfied all 6 critical factors (TABLE 5).

TABLE 4

[Amino Acid and Nucleotide Sequence of
Newly Developed Advanced MTD 165
Which Follow All Critical Factors]

ID	Amino Acid Sequence	Nucleotide Sequence

165	ALAVPVALAIVP	GCG CTG GCG GTG CCG GTG
		GCG CTG GCG ATT GTG CCG

TABLE 5

[Critical Factors of aMTD165]

		Bending
		Potential
		Prolin	Rigidity/	Sturctural
Theoretical	M.W.	Position	Flexibility	Feature	Hydropathy

ID	Length	pl	(Da)	5′	6′	12′	(II)	(Al)	(GRAVY)

165	12	5.57	1133.4	—	1	1	50.2	195.8	2.2

2-2. Selection of Solubilization Domain (SD) for 50053 Recombinant Proteins

In the previous study, recombinant cargo (SOCS3) proteins fused to hydrophobic CPP could be expressed in bacteria system and purified with single-step affinity chromatography; however, protein dissolved in physiological buffers (e.q. PBS, DMEM or RPMI1640 etc.) was highly insoluble and had extremely low. Therefore, an additional non-functional protein domain (solubilization domain: SD; TABLE 6) has been fused to the recombinant proteins at their C terminus to improve low solubility/yield and to enhance relative cell-/tissue-permeability.

TABLE 6

[Information of Solublization Domains]

			Protein		Instability
SD	Genbank ID	Origin	(kDa)	pl	Index (II)	GRAVY

A	CP000113.1	Bacteria	23	4.6	48.1	−0.1
B	BC086945.1	Pansy	11	4.9	43.2	−0.9
C	CP012127.1	Human	12	5.8	30.7	−0.1
D	CP012127.1	Bacteria	23	5.9	26.3	−0.1
E	CP011550.1	Human	11	5.3	44.4	−0.9
F	NG_034970	Human	34	7.1	56.1	−0.2

According to the specific aim, solubilization domain A (SDA) and B (SDB) were first selected. We hypothesize that fusion of SOCS3 with SDs and novel hydrophobic CPP, aMTD, would greatly increase solubility/yield and cell-/tissue-permeability of recombinant cargo proteins—SOCS3—for the clinical application. SDA is a soluble tag, a tandem repeat of 2 N-terminal domain (NTD) sequences of CP_—000113.1, which is a very stable soluble protein present in a spore surface coat of Myxococcus xanthus. SDB, a heme-binding part of cytochrome, provides a visual aid for estimating expression level and solubility. Bacteria expressing SDB containing fusion proteins appears red when the fused proteins are soluble.

2-3. Preparation of SOCS3 Recombinant Proteins

Histidine-tagged human SOCS3 proteins were designed (FIG. 1) and constructed by amplifying the SOCS3 cDNA (225 amino acids) from nt 4 to 678 using primers [TABLE 7] for SOCS3 cargo fused to aMTD. The PCR products were subcloned with NdeI (5′) and BamHI (3′) into pET-28a(+). Coding sequences for SDA or SDB were fused to the C terminus of his-tagged aMTD-fused SOCS3 and cloned at between the BamHI (5′) and SalI (3′) sites in pET-28a(+) (FIG. 2).
PCR primers for SOCS3 and SDA and/or SDB fused to SOCS3 are summarized in TABLES 7, 8 and 9, respectively. The cDNA and amino acid sequences of histidine tag are provided in SEQ ID NO: 481 and 482, and cDNA and amino acid sequences of aMTDs are indicated in SEQ ID NO: 483 and 484, respectively. The cDNA and amino acid sequences are displayed in SEQ ID NO: 485 and 486 (S0053); SEQ ID NO: 487 and 488 (SDA); and SEQ ID NO: 489 and 490 (SDB), respectively.

[cDNA Sequence of Histidine Tag]
SEQ ID NO: 481
ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGC

[Amino Acid Sequence of Histidine Tag]
SEQ ID NO: 482
Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro Arg Gly Ser

[cDNA Sequences of aMTDs]
SEQ ID NO: 483
Please see TABLE 4

[Amino Acid Sequences of aMTDs]
SEQ ID NO: 484
Please see TABLE 4

[cDNA Sequence of human SOC53]
SEQ ID NO: 485
ATGGTCACCC ACAGCAAGTT TCCCGCCGCC GGGATGAGCC GCCCCCTGGA CACCAGCCTG

CGCCTCAAGA CCTTCAGCTC CAAGAGCGAG TACCAGCTGG TGGTGAACGC AGTGCGCAAG

CTGCAGGAGA GCGGCTTCTA CTGGAGCGCA GTGACCGGCG GCGAGGCGAA CCTGCTGCTC

AGTGCCGAGC CCGCCGGCAC CTTTCTGATC CGCGACAGCT CGGACCAGCG CCACTTCTTC

ACGCTCAGCG TCAAGACCCA GTCTGGGACC AAGAACCTGC GCATCCAGTG TGAGGGGGGC

AGCTTCTCTC TGCAGAGCGA TCCCCGGAGC ACGCAGCCCG TGCCCCGCTT CGACTGCGTG

CTCAAGCTGG TGCACCACTA CATGCCGCCC CCTGGAGCCC CCTCCTTCCC CTCGCCACCT

ACTGAACCCT CCTCCGAGGT GCCCGAGCAG CCGTCTGCCC AGCCACTCCC TGGGAGTCCC

CCCAGAAGAG CCTATTACAT CTACTCCGGG GGCGAGAAGA TCCCCCTGGT GTTGAGCCGG

CCCCTCTCCT CCAACGTGGC CACTCTTCAG CATCTCTGTC GGAAGACCGT CAACGGCCAC

CTGGACTCCT ATGAGAAAGT CACCCAGCTG CCGGGGCCCA TTCGGGAGTT CCTGGACCAG

TACGATGCCC CGCTT

[Amino Acid Sequence of human S0053]
SEQ ID NO: 486
Met Val Thr His Ser Lys Phe Pro Ala Ala Gly Met Ser Arg Pro Leu Asp Thr Ser Leu Arg Leu Lys

Thr Phe Ser Ser Lys Ser Glu Tyr Gln Leu Val Val Asn Ala Val Arg Lys Leu Gln Glu Ser Gly Phe Tyr

Trp Ser Ala Val Thr Gly Gly Glu Ala Asn Leu Leu Leu Ser Ala Glu Pro Ala Gly Thr Phe Leu Ile Arg

Asp Ser Ser Asp Gln Arg His Phe Phe Thr Leu Ser Val Lys Thr Gln Ser Gly Thr Lys Asn Leu Arg Ile

Gln Cys Gly Gly Gly Ser Phe Ser Leu Gln Ser Asp Pro Arg Ser Thr Gln Pro Val Pro Arg Phe Asp

Cys Val Leu Lys Leu Val His His Tyr Met Pro Pro Pro Gly Ala Pro Ser Phe Pro Ser Pro Pro Thr Glu

Pro Ser Ser Glu Val Pro Glu Gln Pro Ser Ala Gln Pro Leu Pro Gly Ser Pro Pro Arg Arg Ala Tyr Tyr

Ile Tyr Ser Gly Gly Glu Lys Ile Pro Leu Val Leu Ser Arg Pro Leu Ser Ser Asn Val Ala Thr Leu Gln

His Leu Cys Arg Lys Thr Val Asn Gly His Leu Asp Ser Tyr Glu Lys Val Thr Gln Leu Pro Gly Pro Ile

Arg Glu Phe Leu Asp Gln Tyr Asp Ala Pro Leu

[cDNA Sequences of SDA]
SEQ ID NO: 487
ATGGCAAATATT ACCGTTTTCTAT AACGAAGACTTC CAGGGTAAGCAG GTCGATCTGCCG

CCTGGCAACTAT ACCCGCGCCCAG TTGGCGGCGCTG GGCATCGAGAAT AATACCATCAGC

TCGGTGAAGGTG CCGCCTGGCGTG AAGGCTATCCTG TACCAGAACGAT GGTTTCGCCGGC

GACCAGATCGAA GTGGTGGCCAAT GCCGAGGAGTTG GGCCCGCTGAAT AATAACGTCTCC

AGCATCCGCGTC ATCTCCGTGCCC GTGCAGCCGCGC ATGGCAAATATT ACCGTTTTCTAT

AACGAAGACTTC CAGGGTAAGCAG GTCGATCTGCCG CCTGGCAACTAT ACCCGCGCCCAG

TTGGCGGCGCTG GGCATCGAGAAT AATACCATCAGC TCGGTGAAGGTG CCGCCTGGCGTG

AAGGCTATCCTC TACCAGAACGAT GGTTTCGCCGGC GACCAGATCGAA GTGGTGGCCAAT

GCCGAGGAGCTG GGTCCGCTGAAT AATAACGTCTCC AGCATCCGCGTC ATCTCCGTGCCG

GTGCAGCCGAGG

[Amino Acid Sequences of SDA]
SEQ ID NO: 488
Met Ala Asn ile Thr Val Phe Tyr Asn Glu Asp Phe Gln Gly Lys Gln Val Asp Leu Pro Pro Gly Asn

Tyr Thr Arg Ala Gln Leu Ala Ala Leu Gly Ile Glu Asn Asn Thr Ile Ser Ser Val Lys Val Pro Pro Gly

Val Lys Ala Ile Leu Tyr Gln Asn Asp Gly Phe Ala Gly Asp Gln Ile Glu Val Val Ala Asn Ala Glu Glu

Leu Gly Pro Leu Asn Asn Asn Val Ser Ser Ile Arg Val Ile Ser Val Pro Val Gln Pro Arg Met Ala Asn

Ile Thr Val Phe Tyr Asn Glu Asp Phe Gln Gly Lys Gln Val Asp Leu Pro Pro Gly Asn Tyr Thr Arg

Ala Gln Leu Ala Ala Leu Gly ile Glu Asn Asn Thr Ile Ser Ser Val Lys Val Pro Pro Gly Val Lys Ala

Ile Leu Tyr Gln Asn Asp Gly Phe Ala Gly Asp Gln Ile Glu Val Val Ala Asn Ala Glu Glu Leu Gly Pro

Leu Asn Asn Asn Val Ser Ser Ile Arg Val Ile Ser Val Pro Val Gln Pro Arg

[cDNA Sequences of SDB]
SEQ ID NO: 489
ATGGCA GAACAAAGCG ACAAGGATGT GAAGTACTAC ACTCTGGAGG AGATTCAGAA

GCACAAAGAC AGCAAGAGCA CCTGGGTGAT CCTACATCAT AAGGTGTACG ATCTGACCAA

GTTTCTCGAA GAGCATCCTG GTGGGGAAGA AGTCCTGGGC GAGCAAGCTG GGGGTGATGC

TACTGAGAAC TTTGAGGACG TCGGGCACTC TACGGATGCA CGAGAACTGT CCAAAACATA

CATCATCGGG GAGCTCCATC CAGATGACAG ATCAAAGATA GCCAAGCCTT CGGAAACCCT T

[Amino Acid Sequences of SDB]
SEQ ID NO: 490
Met Ala Glu Gln Ser Asp Lys Asp Val Lys Tyr Tyr Thr Leu Glu Glu Ile Gln Lys His Lys Asp Ser Lys

Ser Thr Trp Val Ile Leu His His Lys Val Tyr Asp Leu Thr Lys Phe Leu Glu Glu His Pro Gly Gly Glu

Glu Val Leu Gly Glu Gln Ala Gly Gly Asp Ala Thr Glu Asn Phe Glu Asp Val Gly His Ser Thr Asp Ala

Arg Glu Leu Ser Lys Thr Tyr Ile Ile Gly Glu Leu His Pro Asp Asp Arg Ser Lys Ile Ala Lys Pro Ser

Glu Thr Leu

The SOCS3 recombinant proteins were expressed in E. coli BL21-CodonPlus (DE3) cells, grown to an OD₆₀₀of 0.6 and induced for 3 hrs with 0.6 mM isopropyl-β-D-thiogalactopyranoside (IPTG). The proteins were purified by Ni2⁺ affinity chromatography and dissolved in a physiological buffer such as DMEM medium.

TABLE 7

[PCR Primers for His-Tagged SOCS3 Proteins]

	aMTD	Recombinant
Cargo	ID	Protein		5′ Primers	3′ Primers

SOCS3	—	HS3	5′-GGAATTCCAT	5′-CCCSGATCCT
			ATGGTCACCCACA	TAAAGCGGGGCAT
			GCARGTTTCCCGC	CGTACTGGTCCAG
			CGCC-3′	GAA-3′
	165	HM₁₆₅S3	5′-GGAATTCCAT
	165	HM₁₆₅S3A	ATGGCGCTGGCGG	5′-CCGGATCCAA
	165	HM₁₆₅S3B	TGCCGGTGGCGCT	GCGGGGCATCGTA
			GGCGATTGTGCCG	CTGGTCCAGGAA-3′
			GTCACCCACAGCA
			AGTTTC-3′
	—	HS3B	5′-GGAATTCCAT
			ATGGTCACCCACA
			GCAAGTTTCCCGC
			CGCC-3′

TABLE 8

[PCR Primers for aMTD/SDA-Fused SOCS3 Proteins]

		Recombinant
Cargo	SD	Protein		5′ Primers	3′ Primers

SOCS3	SDA	HM₁₆₅S3A	5′-CCCGGATCCATG	5′-CGCGTCGACTTA
			GCAAATATTACCGTT	CCTCGGCTGCACCGG
			TTCTATAACGAA-3′	CACGGCGATGAC-3′

TABLE 9

[PCR Primers for aMTD/SDB-Fused SOCS3 Proteins]

		Recombinant
Cargo	SD	Protein		5′ Primers	3′ Primers

SOCS3	SDB	HM₁₆₅S3B	5′-CCCGGATCCGC	5′-CGCGTCGACTTA
		HS3B	AGAACAAAGCGACA	AAGGGTTTCCGAAGG
			AGGATGTGAAG-3′	CTTGGCTATCTT-3′

2-4. Determination of Solubility and Yield of Each SOCS3 Recombinant Protein

The histidine-tagged SOCS3 proteins were expressed, purified, and prepared in soluble form (FIG. 3). The yield of each soluble SOCS3 recombinant proteins was determined by measuring absorbance (A450).
SOCS3 recombinant proteins containing aMTD165 and solubilization domain (HM₁₆₅S3A and HM₁₆₅S3B) had little tendency to precipitate whereas recombinant SOCS3 proteins lacking a solubilization domain (HS3 and HM₁₆₅S3) were largely insoluble. Solubility of aMTD/SD-fused SOCS3 proteins was scored on a 5 point scale compared with that of SOCS3 proteins lacking the solubilization domain (FIG. 4).
Yields per L of E. coli for each recombinant protein (mg/L) ranged from 1 to 47 mg/L (FIG. 4). Yields of SOCS3 proteins containing an aMTD and SDB (HM₁₆₅S3B) were 50% higher than his-tagged SOCS3 protein (HS3).
3. aMTD/SD-Fused SOCS3 Recombinant Proteins Significantly Increase Cell- and Tissue-Permeability
3-1. aMTD/SD-Fused 50053 Recombinant Proteins are Cell-Permeable
To examine protein uptake, SOCS3 recombinant proteins were conjugated to 5/6-fluorescein isothiocyanate (FITC). RAW 264.7 (FIG. 5) or NIH3T3 cells (FIG. 6) were treated with 10
M FITC-labeled SOCS3 recombinant proteins. The cells were washed three times with ice-cold PBS and treated with proteinase K to remove surface-bound proteins, and internalized proteins were measured by flow cytometry (FIG. 5) and visualized by confocal laser scanning microscopy (FIG. 6). SOCS3 proteins containing aMTD165 (HM165S3, HM165S3A and HM165S3B) efficiently entered the cells (FIGS. 5 and 6) and were localized to various extents in cytoplasm (FIG. 6). In contrast, SOCS3 protein (HS3) containing lacking aMTD did not appear to enter cells. While all SOCS3 proteins containing aMTD165 transduced into the cells, HM165S3B displayed more uniform cellular distribution, and protein uptake of HM165S3B was also very efficient.
3-2. aMTD/SD-Fused SOCS3 Recombinant Proteins Enhance the Systemic Delivery to a Variety of Tissues
To further investigate in vivo delivery of SOCS3 recombinant proteins, FITC-labeled SOCS3 proteins were monitored following intraperitoneal (IP) injections in mice. Tissue distributions of fluorescence-labeled-SOCS3 proteins in different organs was analyzed by fluorescence microscopy (FIG. 7). SOCS3 recombinant proteins fused to aMTD165 (HM₁₆₅S3, HM₁₆₅S3A and HM₁₆₅S3B) were distributed to a variety of tissues (liver, kidney, spleen, lung, heart and, to a lesser extent, brain). Predictably, liver showed highest levels of fluorescent cell-permeable SOCS3 since intraperitoneal administration favors the delivery of proteins to this organ via the portal circulation. SOCS3 containing aMTD165 was detectable to a lesser degree in lung, spleen and heart. aMTD/SDB-fused SOCS3 recombinant protein (HM₁₆₅S3B) showed the highest systemic delivery of SOCS3 protein to the tissues comparable to the SOCS3 containing only aMTD (HM₁₆₅S3) or aMTD/SDA (HM165S3A) proteins. These data suggest that SOCS3 protein containing both of aMTD165 and SDB leads to higher cell-/tissue-permeability due to the increase in solubility and stability of the protein, and it displayed a dramatic synergic effect on cell-/tissue-permeability.
3-3. aMTD-Mediated Intracellular Delivery is Bidirectional Mode
SOCS3 recombinant proteins lacking SD (HS3 and HM165S3) were less soluble, produced lower yields, and showed tendency to precipitate when they were expressed and purified in E. coli. Therefore, we additionally designed (FIG. 8) and constructed SOCS3 recombinant protein containing only SDB (without aMTD165: HS3B) as a negative control. As expected, its solubility and yield increased compared to that of SOCS3 proteins lacking SDB (HS3; FIG. 9). Therefore, HS3B proteins were used as a control protein.
We next investigated how of aMTD165-mediated intracellular delivery was occurred. The aMTD-mediated intracellular delivery of SOCS3 protein did not require protease-sensitive protein domains displayed on the cell surface (FIG. 10B), microtubule function (FIG. 10C), or ATP utilization (FIG. 10D), since aMTD165-dependent uptake [compare to HS3 (black) and HS3B (blue)] was essentially unaffected by treating cells with proteinase K, taxol, or the ATP depleting agent, antimycin. Conversely, aMTD165-fused SOCS3 proteins uptake was blocked by treatment with EDTA and low temperature (FIGS. 10A and E), indicating the importance of membrane integrity and fluidity for aMTD-mediated protein transduction.
Moreover, we also tested whether cells treated with aMTD165-fused SOCS3 protein could transfer the protein to neighboring cells. For this, cells transduced with FITC-HM165S3B (green) were mixed with CD14-labeled cells (red), and cell-to-cell protein transfer was assessed by flow cytometry, scoring for CD14/FITC double-positive cells. Efficient cell-to-cell transfer of HM165S3B, but not HS3 or HS3B (FIG. 11), suggests that SOCS3 recombinant proteins containing aMTD165 are capable of bidirectional passage across the plasma membrane.
4. aMTD/SD-Fused SOCS3 Protein Efficiently Inhibits Cellular Processes
4-1. aMTD/SD-Fused SOCS3 Protein Inhibits the Activation of STATs Induced by INF-γ
The ultimate test of cell-penetrating efficiency is a determination of intracellular activity of SOCS3 proteins transported by aMTD. Since endogenous SOCS3 are known to block phosphorylation of STAT1 and STAT3 by IFN-γ-mediated Janus kinases (JAK) 1 and 2 activation, we demonstrated whether cell-permeable SOCS3 inhibits the phosphorylation of STATs. All SOCS3 recombinant proteins containing aMTD (HM₁₆₅S3, HM₁₆₅S3A and HM₁₆₅S3B), suppressed IFN-γ-induced phosphorylation of STAT1 and STAT3 (FIG. 12). In contrast, STAT phosphorylation was readily detected in cells exposed to HS3, which lacks the aMTD motif required for membrane penetration (FIG. 12), indicating that HS3, which lacks an MTD sequence and did not enter the cells, has no biological activity.
4-2. aMTD/SD-Fused SOCS3 Recombinant Protein Inhibits the Secretion of Inflammatory Cytokines TNF-α and IL-6
We next investigated the effect of cell-permeable SOCS3 proteins on cytokines secretion. Treatment of C3H/HeJ primary peritoneal macrophages with SOCS3 proteins containing aMTD165 suppressed TNF-α and IL-6 secretion induced by the combination of IFN-γ and LPS by 50-90% during subsequent 9 hrs of incubation (FIG. 13). In particular, aMTD165/SDB-fused SOCS3 recombinant protein showed the greatest inhibitory effect on cytokine secretion. In contrast, cytokine secretion in macrophages treated with non-permeable SOCS3 protein (HS3) was unchanged, indicating that recombinant SOCS3 lacking the aMTD doesn't affect intracellular signaling. Therefore, we conclude that differences in the biological activities of HM₁₆₅S3B as compared to HS3B are due to the differences in protein uptake mediated by the aMTD sequence. In light of solubility/yield, cell-/tissue-permeability, and biological effect, SOCS3 recombinant protein containing aMTD and SDB (HM₁₆₅S3B) is a prototype of a new generation of improved cell-permeable SOCS3 (iCP-SOCS3), and will be selected for further evaluation as a potential anti-tumor agent.
5. iCP-SOCS3 Suppresses Pro-Tumorigenic Functions in Lung Cancer Cells
5-1. iCP-50053 Enhances the Cellular Uptake into Lung Cancer Cells and the Systemic Delivery to the Lung Tissue
Although lung cancer is one of the most common cancers with a high mortality rate, there are few drugs for treating this lethal disorder. Since constitutive activation of STAT3 is found in various cancers and SOCS3 is closely related to the development of lung cancer, we first chose lung cancer as a primary indication of the iCP-SOCS3 as an anti-cancer agent.
To determine the cell-permeability of iCP-SOCS3 in the lung cancer cells, cellular uptake of FITC-labeled SOCS3 recombinant proteins was quantitatively evaluated by flow cytometry. FITC-HM₁₆₅S3B recombinant protein (iCP-SOCS3) promoted the transduction into cultured A549 lung cancer cells (FIG. 14). In addition, iCP-SOCS3 proteins enhanced the systemic delivery to lung tissue after intraperitoneal injection (FIG. 15). Therefore, these data indicate that iCP-SOCS3 protein could be intracellularly delivered and distributed to the lung cells and tissue, contributing for beneficial biotherapeutic effects.
5-2. iCP-50053 Inhibits Viability of Lung Cancer Cells
Since the endogenous level of SOCS3 protein is reduced in lung cancer patients, and SOCS3 negatively regulates cell growth and motility in cultured lung cancer cells, we investigated whether iCP-SOCS3 inhibits cell viability through SOCS3 intracellular delivery in lung cancer cells. As shown in FIG. 16, SOCS3 recombinant proteins containing aMTD165 significantly suppressed cancer cell proliferation. HM₁₆₅S3B (iCP-SOCS3) protein was the most cytotoxic to A549 lung cancer cells—over 80% in 10 μM treatment (p<0.01)—especially compared to vehicle alone (i.e. exposure of cells to culture media without recombinant proteins; FIG. 16, left). However, neither cell-permeable SOCS3 protein adversely affected the cell viability of non-cancer cells (NIH3T3) even after exposing these cells to equal concentrations (10 μM) of protein over 4 days (FIG. 16, right). These results suggest that the iCP-SOCS3 protein is not overly toxic to normal cells and selectively kills cancer cells, and would have a great ability to inhibit cell survival-associated phenotypes in lung cancer without any severe aberrant effects as a protein-based biotherapeutics.
5-3. iCP-SOCS3 Protein Induces Apoptosis in Lung Cancer Cells
To further determine the effect of iCP-SOCS3 on the tumorigenicity of lung cancer cells, we subsequently investigated whether iCP-SOCS3 regulates apoptosis in A549 cells. HM₁₆₅S3B protein (iCP-SOCS3) was a considerably efficient inducer of apoptosis in A549 cells, as assessed either by a fluorescent terminal dUTP nick-end labeling (TUNEL) assay (FIG. 17) and Annexin V staining (FIG. 18). Consistently, no changes in TUNEL and Annexin V staining were observed in A549 cells treated with HS3B compared to untreated cells (Vehicle).
5-4. iCP-SOCS3 Inhibits Migration/Invasion of Lung Cancer Cells
We next examined the ability of iCP-SOCS3 to influence cell migration. A549 cells were treated with recombinant proteins for 2 hrs, the monolayers were wounded, and cell migration in the wound was monitored after 48 hrs (FIG. 19). HM₁₆₅S3B protein (iCP-SOCS3) suppressed the repopulation of wounded monolayer although SOCS3 protein lacking aMTD165 (HS3B) had no effect on the cell migration. Consistent with this, A549 cells treated with HM₁₆₅S3B recombinant protein (iCP-SOCS3) also showed significant inhibitory effect on their Transwell migration compared with untreated cells (Vehicle) and non-permeable SOCS3 protein-treated cells (HS3B; FIG. 20). In addition, A549 cells treated with HM₁₆₅S3B recombinant protein (iCP-SOCS3) caused remarkable decrease in invasion compared with the control proteins (HS3B; FIG. 21). Taken together, these data indicate that iCP-SOCS3 contributes to inhibit tumorigenic activities of lung cancer cells.

Example

The following examples are presented to aid practitioners of the invention, to provide experimental support for the invention, and to provide model protocols. In no way are these examples to be understood to limit the invention.

Example 1

Development of Novel Advanced Macromolecule Transduction Domain (aMTD)

H-regions of signal sequences (HRSP)-derived CPPs (MTM, MTS and MTD) do not have a common sequence, a sequence motif, and/or a common structural homologous feature. In this invention, the aim is to develop improved hydrophobic CPPs formatted in the common sequence and structural motif that satisfy newly determined ‘critical factors’ to have a ‘common function’, to facilitate protein translocation across the membrane with similar mechanism to the analyzed CPPs. 6 critical factors have been selected to artificially develop novel hydrophobic CPP, namely advanced macromolecule transduction domain (aMTD). These 6 critical factors include the followings: amino acid length of the peptides (ranging from 9 to 13 amino acids), bending potentials (dependent with the presence and location of proline in the middle of sequence (at 5′, 6′, 7′ or 8′ amino acid) and at the end of peptide (at 12′)), instability index (II) for rigidity/flexibility (II: 40-60), grand average of hydropathy (GRAVY) for hydropathy (GRAVY: 2.1-2.4), and aliphatic index (AI) for structural features (AI: 180-220). Based on these standardized critical factors, new hydrophobic peptide sequences, namely advanced macromolecule transduction domain peptides (aMTDs), in this invention have been developed and selected to be fused with the cargo protein, SOCS3, to develop improved cell-permeable SOCS3 recombinant protein (iCP-SOCS3).

Example 2

Construction of Expression Vectors for Recombinant SOCS3 Proteins

Histidine-tagged human SOCS3 proteins were constructed by amplifying the SOCS3 cDNA (225 amino acids) for aMTD fused to SOCS3 cargo. The PCR reactions (100 ng genomic DNA, 10 pmol each primer, each 0.2 mM dNTP mixture, lx reaction buffer and 2.5 U Pfu(+) DNA polymerase (Doctor protein, Korea)) were digested on the restriction enzyme site between Nde I (5′) and Sal I (3′) involving 35 cycles of denaturing (95° C.), annealing (62° C.), and extending (72° C.) for 45 sec each. For the last extension cycle, the PCR reactions remained for 10 min at 72° C. The PCR products were subcloned into 6×His expression vector, pET-28a(+) (Novagen). Coding sequence for SDA or SDB fused to C terminus of his-tagged aMTD-SOCS3 was cloned at BamHI (5′) and SalI (3′) in pET-28a(+) from PCR-amplified DNA segments and confirmed by DNA sequence analysis of the resulting plasmids.

Example 3

Inducible Expression, Purification, and Preparation of Recombinant Proteins

The recombinant proteins were purified from E. coli BL21-CodonPlus (DE3) cells grown to an A600 of 0.6 and induced for 3 hrs with 0.6 mM IPTG. Denatured recombinant proteins were purified by Ni2+ affinity chromatography as directed by the supplier (Qiagen, Hilden, Germany). After purification, they were dialyzed against a refolding buffer (0.55 M guanidine HCl, 0.44 M L-arginine, 50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 100 mM NDSB, 2 mM reduced glutathione, and 0.2 mM oxidized glutathione) and changed to a physiological buffer such as DMEM medium.

Example 4

Determination of Quantitative Cell-Permeability of Recombinant Proteins

For quantitative cell-permeability, recombinant SOCS3 proteins were conjugated to 5/6-fluorescein isothiocyanate (FITC) according to the manufacturer's instructions (Sigma-Aldrich, St. Louis, Mo.). RAW 264.7 cells were treated with 10 μM FITC-labeled recombinant proteins for 1 hr at 37° C., washed three times with cold PBS, and treated with proteinase K (10 μg/mL) for 20 min at 37° C. to remove cell-surface bound proteins. Cell-permeability of these recombinant proteins was analyzed by flow cytometry (Guava, Millipore, Darmstadt, Germany) using the FlowJo cytometric analysis software.

Example 5

Determination of Intracellular Localization of SOCS3 Recombinant Proteins

For visual cell permeability, NIH3T3 cells were cultured on coverslips in 24-well plates and with 10 μM FITC-conjugated recombinant proteins for 1 hr at 37° C. These cells on coverslips were washed with PBS, fixed with 4% formaldehyde for 10 min, and washed three times with PBS at room temperature. Coverslips were mounted with VECTASHIELD Mounting Medium (Vector laboratories, Burlingame, Calif.) with DAPI (4′,6-diamidino-2-phenylindole) for nuclear staining. Intracellular localization of fluorescent signal was determined by confocal laser scanning microscopy (LM700, Zeiss, Germany).

Example 6

Determination of Tissue Distribution of Recombinant SOCS3 Proteins

ICR mice (6-week-old, female) were injected intraperitoneally (600 μg/head) with either FITC only or FITC-conjugated SOCS3 recombinant proteins. After 2 hrs, the liver, kidney, spleen, lung, heart, and brain were isolated, washed with an O.C.T. compound (Sakura), and frozen on dry ice. Cryosections (20 μm) were analyzed by fluorescence microscopy (Carl Zeiss, Gottingen, Germany).

Example 7

Mechanism of aMTD-Mediated Intracellular Delivery

RAW264.7 cells were pretreated with different agents to assess the effect of various conditions on protein uptake: (i) 5 μg/ml proteinase K for 10 min, (ii) 20 μM Taxol for 30 min, (iii) 10 μM antimycin in the presence or absence of 1 mM ATP for 2 hrs, (iv) incubation on ice (or maintained at 37° C.) for 60 min, and (v) 100 mM EDTA for 3 hrs. These agents were used at concentrations known to be active in other applications. The cells were then incubated with 10 μM FITC-labeled proteins for 1 hr at 37° C., washed three times with ice-cold phosphate-buffered saline, treated with proteinase K (10 μg/ml for 5 min at 37° C.) to remove cell-surface bound proteins, and analyzed by flow cytometry. To assess cell-to-cell protein transfer, RAW264.7 cells containing FITC-conjugated protein were prepared in the same way and mixed with untreated cells labeled with PreCP-Cy5.5-CD14 antibody for 2 hrs. Cell-to-cell protein transfer, resulting in FITC-Cy5.5 double-positive cells, was monitored by flow cytometry.

Example 8

STAT Phosphorylation: Western Blot Analysis

PANC-1 cells (Korean Cell Line Bank, Seoul, Korea) were cultured in modified Eagle's medium (DMEM; Welgene, Daege, Korea) supplemented with 10% (v/v) FBS, penicillin (100 units/ml), and streptomycin (10
g/ml, Gibco BRL) and pretreated with 10
M of SOCS3 recombinant proteins for 2 hrs followed by exposing the cells to agonists (100 ng/ml IFN-
) for 15 min. Cells were lysed with RIPA lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1% Nonidet P-40, 0.1% SDS, 0.5% sodium deoxycholate, 10 mM NaF, and 2 mM Na3VO4) containing a protease inhibitor cocktail and then centrifuged at 13,000×g for 15 min at 4° C. Equal amounts of lysates were resolved by SDS-PAGE, transferred onto PVDF membranes, and probed with phospho (pY701)-specific STAT1 (Cell Signaling, Danvers, Mass.).

Example 9

Cytokine Measurement: Cytometric Bead Array (CBA) Assay

Peritoneal macrophages were obtained from C3H/HeJ mice. Peritoneal macrophages were incubated with 10 μM recombinant proteins (1:HS3, 2:HM165S3, 3:HM165S3A and 4:HM165S3B, respectively) for 1 hr at 37° C. and then stimulated them with LPS (500 ng/ml) and/or IFN-
(100 U/ml) without removing iCP-SOCS3 proteins for 3, 6, or 9 hrs. The culture media were collected, and the extracellular levels of cytokine were measured by a cytometric bead array (BD Biosciences, Pharmingen) according to the manufacturer's instructions.

Example 10

Cell Proliferation: CellTiter-Glo Cell Viability Assay

Cells originated from lung cancer and mouse fibroblast (NIH3T3) were purchased (ATCC, Manassas, Va.) and maintained as recommended by the supplier. These cells (3×103/well) were seeded in 96 well plates. The next day, cells were treated with DMEM (vehicle) or recombinant SOCS3 proteins for 96 hrs in the presence of serum (2%). Proteins were replaced daily. Cell growth and survival were evaluated with the CellTiter-Glo Cell Viability Assay (Promega, Madison, Wis.). Measurements using a Luminometer (Turner Designs, Sunnyvale, Calif.) were conducted following the manufacturer's protocol.

Example 11

Apoptosis: TUNEL Assay

Apoptotic cells were analyzed using terminal dUTP nick-end labeling (TUNEL) assay with In Situ Cell Death Detection kit TMR red (Roche, 4056 Basel, Switzerland). Cells were treated with either 10 μM SOCS3 recombinant protein or buffer alone for 16 hrs with 2% fetal bovine serum. Treated cells were washed with cold PBS two times, fixed in 4% paraformaldehyde (PFA, Junsei, Tokyo, Japan) for 1 hr at room temperature, and incubated in 0.1% Triton X-100 for 2 min on the ice. Cells were washed with cold PBS twice, and treated TUNEL reaction mixture for 1 hr at 37° C. in dark, washed cold PBS three times and observed by fluorescence microscopy (Nikon, Tokyo, Japan).

Example 12

Apoptosis: Annexin V/7-AAD Staining

Annexin V/7-Aminoactinomycin D (7-AAD) staining was performed using flow cytometry according to the manufacturer's guidelines. Briefly, 1×106 cells were washed three times with ice-cold PBS. The cells were then resuspended in 100 μl of binding buffer and incubated with 1 μl of 7-AAD and 1 μl of annexin V-PE for 30 min in the dark at 37° C. Flow cytometric analysis was immediately performed using a guava easyCyte™ 8 Instrument (Merck Millipore).

Example 13

Cell Migration: Wound-Healing Assay

Cells were seeded into 12-well plates, grown to 90% confluence, and incubated with 10 μM HS3, HM16553, HM165S3A or HM165S3B in serum-free medium for 2 hrs prior to changing the growth medium. The cells were washed twice with PBS, and the monolayer at the center of the well was “wounded” by scraping with a pipette tip. Cells were cultured for an additional 48 hrs and cell migration was observed by phase contrast microscopy. The migration is quantified by counting the number of cells that migrated from the wound edge into the clear area.

Example 14

Transwell Migration Assay

The lower surface of Transwell inserts (Costar) was coated with gelatin (10
g/ml), and the membranes were allowed to dry for 1 hr at room temperature. The Transwell inserts were assembled into a 24-well plate, and the lower chamber was filled with growth media containing 10% FBS and FGF2 (10
g/ml). Cells (5×105) were added to each upper chamber, and the plate was incubated at 37° C. in a 5% CO2 incubator for 24 hrs. Migrated cells were stained with 0.6% hematoxylin and 0.5% eosin and counted.

Example 15

Invasion Assay

The lower surface of Transwell inserts (Costar) was coated with gelatin (10
g/ml), the upper surface of Transwell inserts was coated with matrigel (40
g per well; BD Biosciences), and the membranes were allowed to dry for 1 hr at room temperature. The Transwell inserts were assembled into a 24-well plate, and the lower chamber was filled with growth media containing 10% FBS and FGF2 (10
g/ml). Cells (5×105) were added to each upper chamber, and the plate was incubated at 37° C. in a 5% CO2 incubator for 24 hrs. Migrated cells were stained with 0.6% hematoxylin and 0.5% eosin and counted.

Example 16

Statistical Analysis

All data are presented as mean±s.d. Differences between groups were tested for statistical significance using Student's t-test and were considered significant at p<0.05 or p<0.01.
It will be apparent to those skilled in the art that various modifications can be made to the above-described exemplary embodiments of the present invention without departing from the spirit or scope of the invention. Thus, it is intended that the present invention covers all such modifications provided that they come within the scope of the appended claims and their equivalents.

Claims

What is claimed is:

1. The list of amino acid sequences of SOCS3 recombinant proteins fused to newly invented hydrophobic cell-penetrating peptides (CPPs)—advanced macromolecule transduction domains (aMTDs) and solubilization domain (SD).

2. The list of cDNA sequences of the SOCS3 recombinant proteins fused to newly invented hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction domains (aMTDs) and solubilization domain (SD) of claim 1.

3. A list of 240 aMTD amino acid sequences according to claim 1 that satisfy all six critical factors as shown in TABLE 3

4. Varied numbers and locations of solubilization domain (SD) according to claim 1 that are fused to SOCS3 recombinant proteins for high solubility and yield

5. The result of therapeutic applicability in lung cancer with SOCS3 recombinant proteins fused to newly invented hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction domains (aMTDs) and solubilization domain (SD)