WO2018119198A1 - Compositions and methods for modulating the immune system - Google Patents
Compositions and methods for modulating the immune system Download PDFInfo
- Publication number
- WO2018119198A1 WO2018119198A1 PCT/US2017/067830 US2017067830W WO2018119198A1 WO 2018119198 A1 WO2018119198 A1 WO 2018119198A1 US 2017067830 W US2017067830 W US 2017067830W WO 2018119198 A1 WO2018119198 A1 WO 2018119198A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- domain
- cell
- intracellular signaling
- protein
- signaling domain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/14—Blood; Artificial blood
- A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/36—Immune checkpoint inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70517—CD8
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70521—CD28, CD152
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70596—Molecules with a "CD"-designation not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0636—T lymphocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
- A61K2239/48—Blood cells, e.g. leukemia or lymphoma
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/02—Atmosphere, e.g. low oxygen conditions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/50—Cell markers; Cell surface determinants
- C12N2501/51—B7 molecules, e.g. CD80, CD86, CD28 (ligand), CD152 (ligand)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/50—Cell markers; Cell surface determinants
- C12N2501/515—CD3, T-cell receptor complex
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Definitions
- compositions and methods to manipulate the immune system to treat cancer There are many compositions and methods to manipulate the immune system to treat cancer. However, there is still a need for improved compositions and methods to treat cancer.
- the presently disclosed subject matter fulfills these needs and others that would be evident to one of skill in the art
- Embodiments disclosed herein provide for proteins comprising an extracellular domain of PD-1; a transmembrane domain selected from the group consisting of: 4- IBB transmembrane domain, CD28 transmembrane domain, CD27 transmembrane domain, and ICOS transmembrane domain; and an intracellular signaling domain selected from the group consisting of 4- IBB intracellular signaling domain, CD28 intracellular signaling domain, CD27 intracellular signaling domain, and ICOS intracellular signaling domain, and any combination thereof.
- Embodiments disclosed herein also provide for nucleic acid molecules encoding the proteins provided herein.
- recombinant cells comprising the proteins or the nucleic acid molecules described herein are provided.
- methods of making the recombinant cells are provided.
- Embodiments for increasing an immune response or treating a neoplasm are also provided.
- compositions, and methods are described in terms of “comprising” various components or steps (interpreted as meaning “including, but not limited to”), the compositions, methods, and devices can also “consist essentially of or “consist of the various components and steps, and such terminology should be interpreted as defining essentially closed-member groups.
- beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of extent of condition, disorder or disease; stabilized (i.e., not worsening) state of condition, disorder or disease; delay in onset or slowing of condition, disorder or disease progression; amelioration of the condition, disorder or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or improvement of condition, disorder or disease.
- treatment of cancer means an activity that alleviates or ameliorates any of the primary phenomena or secondary symptoms associated with the cancer or any other condition described herein.
- the cancer that is being treated is one of the cancers recited herein.
- autologous can be used to refer to any material derived from the same individual to which it is later to be re-introduced into the individual.
- Allogeneic refers to a graft derived from a different animal of the same species.
- Xenogeneic refers to a graft derived from an animal of a different species.
- cancer as used herein is defined as disease characterized by the rapid and uncontrolled growth of aberrant cells. Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. Examples of various cancers include but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, multiple myeloma, lung cancer and the like. Examples of cancer also include but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies.
- cancers include kidney or renal cancer, breast cancer, colon cancer, rectal cancer, colorectal cancer, lung cancer including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung and squamous carcinoma of the lung, squamous cell cancer (e.g. epithelial squamous cell cancer), cervical cancer, ovarian cancer, prostate cancer, liver cancer, bladder cancer, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, gastrointestinal stromal tumors (GIST), pancreatic cancer, head and neck cancer, glioblastoma, retinoblastoma, astrocytoma, thecomas,
- lung cancer including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung and squamous carcinoma of the lung, squamous cell cancer (e.g. epithelial squamous cell cancer), cervical cancer, ovarian cancer, prostate cancer, liver
- arrhenoblastomas hepatoma, hematologic malignancies including non-Hodgkins lymphoma (NHL), multiple myeloma and acute hematologic malignancies, endometrial or uterine carcinoma, endometriosis, fibrosarcomas, choriocarcinoma, salivary gland carcinoma, vulvar cancer, thyroid cancer, esophageal carcinomas, hepatic carcinoma, anal carcinoma, penile carcinoma, nasopharyngeal carcinoma, laryngeal carcinomas, Kaposi's sarcoma, melanoma, skin carcinomas, Schwannoma, oligodendroglioma, neuroblastomas, rhabdomyosarcoma, osteogenic sarcoma, leiomyosarcomas, urinary tract carcinomas, thyroid carcinomas, Wilm's tumor, as well as B-cell lymphoma (including low grade/follicular non-Hodgkin's lympho
- CLL chronic lymphocytic leukemia
- ALL acute lymphoblastic leukemia
- PTLD post-transplant lymphoproliferative disorder
- Tumor refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.
- Effective amount or “therapeutically effective amount” are used interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result. Such results may include, but are not limited to, the inhibition of virus infection as determined by any means suitable in the art.
- “Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed.
- An expression vector can comprise sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system.
- Expression vectors include all those known in the art, such as cosmids, plasmids (e g , naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno- associated viruses) that incorporate the recombinant polynucleotide.
- nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence.
- the phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s). In some embodiments, the nucleotide sequence does not contain an intron and only contains a coding sequence.
- a "lentivirus” as used herein refers to a genus of the Retroviridae family. Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell, so they are one of the most efficient methods of a gene delivery vector. HIV, SIV, and FIV are all examples of lentiviruses. Vectors derived from lentiviruses can achieve significant levels of gene transfer in vivo.
- operably linked refers to functional linkage between a regulatory sequence and a heterologous nucleic acid sequence resulting in expression of the latter.
- a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
- a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
- operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame.
- polynucleotide as used herein is defined as a chain of nucleotides.
- nucleic acids are polymers of nucleotides.
- nucleic acids and polynucleotides as used herein are interchangeable.
- nucleic acids are polynucleotides, which can be hydrolyzed into the monomelic "nucleotides.”
- the monomelic nucleotides can be hydrolyzed into nucleosides.
- polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCRTM, and the like, and by synthetic means.
- recombinant means i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCRTM, and the like, and by synthetic means.
- a protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence.
- Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.
- Polypeptides include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others.
- the polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
- promoter as used herein is defined as a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence.
- promoter/regulatory sequence means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulatory sequence.
- this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product.
- the promoter/regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.
- a “constitutive" promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.
- an “inducible” promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only when an inducer which corresponds to the promoter is present in the cell.
- a “tissue-specific” promoter is a nucleotide sequence which, when operably linked with a polynucleotide encodes or specified by a gene, causes the gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.
- substantially purified cell is a cell that is essentially free of other cell types.
- a substantially purified cell also refers to a cell which has been separated from other cell types with which it is normally associated in its naturally occurring state.
- a population of substantially purified cells refers to a homogenous population of cells. In other instances, this term refers simply to cell that have been separated from the cells with which they are naturally associated in their natural state.
- the cells are cultured in vitro. In other embodiments, the cells are not cultured in vitro.
- transfected or “transformed” or “transduced” as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell.
- a “transfected” or “transformed” or “transduced” cell is one which has been transfected, transformed or transduced with exogenous nucleic acid.
- the cell includes the primary subject cell and its progeny.
- under transcriptional control or "operatively linked” as used herein means that the promoter is in the correct location and orientation in relation to a polynucleotide to control the initiation of transcription by RNA polymerase and expression of the polynucleotide.
- a “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell.
- vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses.
- the term “vector” includes an autonomously replicating plasmid or a virus.
- the term should also be construed to include non- plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like.
- viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, and the like.
- ranges throughout this disclosure, various embodiments can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
- the embodiments relate to a chimeric receptor, comprising an extracellular domain expressing of a domain of a protein that can prevent the deactivation of the immune system and an activating intracellular domain. This has the advantage of hijacking the tolerogenic mechanisms into activating signals.
- This approach can be used in all clinical situations in which T cell anergy is a major aspect of the pathogenesis of the disease and where the antigen specificity is provided by the endogenous T cell repertoire.
- the embodiments relate to a chimeric transmembrane protein, comprising an extracellular domain of an inhibitory receptor, a transmembrane domain, and an intracellular signaling domain.
- the intracellular signaling domain can activate an immune response.
- the intracellular signaling domain may comprise a portion of an intracellular signaling protein.
- the intracellular domain can be used to maintain the activation of a cell, such as a T-cell.
- the extracellular domain can transduce a signal to the intracellular signaling domain.
- the extracellular domain may transduce a signal to the intracellular signaling domain upon binding an agonist of the native inhibitory receptor.
- Signal transduction may comprise oligomerization of the protein.
- Oligomerization may comprise homo-oligomerization or hetero-oligomerization.
- Oligomerization may comprise dimerization of the protein, i.e., homo-dimerization with a second chimeric transmembrane protein or hetero-dimerization with a different protein.
- Signal transduction may comprise phosphorylation.
- the intracellular signaling domain may comprise kinase activity and/or a phosphorylation site.
- Signal transduction may comprise autophosphorylation, e.g., autophosphorylation of the intracellular signaling domain.
- the receptor which can also be referred to as a "Switch Receptor” comprises an amino acid sequence described herein. In some embodiments, the receptor is encoded by a nucleic acid sequence described herein.
- the receptor comprises a CD8 Leader Peptide, a PD-1
- the leader peptide is cleaved during the processing of the protein in a cell leaving a receptor comprising the PD-1 Extracellular Domain, a 4-lBB Transmembrane Domain, and a 4-lBB Intracellular Domain.
- the domains comprise an amino acid sequence as described herein and below.
- the receptor comprises a CD8 Leader Peptide, a PD-1
- the leader peptide is cleaved during the processing of the protein in a cell leaving a receptor comprising the PD-1 Extracellular Domain, a CD28 Transmembrane Domain, and a CD28 Intracellular Domain.
- the domains comprise an amino acid sequence as described herein and below.
- the receptor comprises a CD8 Leader Peptide, a PD-1
- the leader peptide is cleaved during the processing of the protein in a cell leaving a receptor comprising the PD-1 Extracellular Domain, a CD28Transmembrane Domain, a CD28 Intracellular Domain, and a 4-lBB Intracellular Domain.
- the domains comprise an amino acid sequence as described herein and below.
- the receptor comprises a CD8 Leader Peptide, a PD-1
- the leader peptide is cleaved during the processing of the protein in a cell leaving a receptor comprising the PD-1 Extracellular Domain, a CD27 Transmembrane Domain, and a CD27 Intracellular Domain.
- the domains comprise an amino acid sequence as described herein and below.
- the receptor comprises a CD8 Leader Peptide, a PD-1 Extracellular Domain, a CD27 Transmembrane Domain, a CD27 Intracellular Domain, and a 4- 1BB Intracellular Domain.
- the leader peptide is cleaved during the processing of the protein in a cell leaving a receptor comprising the PD-1 Extracellular Domain, a CD27 Transmembrane Domain, a CD27 Intracellular Domain, and a 4-1BB Intracellular Domain.
- the domains comprise an amino acid sequence as described herein and below.
- the receptor comprises a CD8 Leader Peptide, a PD-1
- the leader peptide is cleaved during the processing of the protein in a cell leaving a receptor comprising the PD-1 Extracellular Domain, a ICOS Transmembrane Domain, and a ICOS Intracellular Domain.
- the domains comprise an amino acid sequence as described herein and below.
- the extracellular domain is the extracellular domain of an inhibitory receptor.
- the extracellular domain comprises a ligand-binding domain, e.g., the agonist-binding domain of the inhibitory receptor.
- the extracellular domain comprises sufficient structure to transduce a signal across the membrane in response to ligand binding.
- the mere presence of a ligand-binding domain may be sufficient structure to transduce a signal across the membrane in response to ligand binding.
- the extracellular domain may require native structure between the ligand-binding domain and transmembrane domain to transduce a signal across the membrane in response to ligand binding.
- an extracellular domain may comprise the native sequence of the inhibitory receptor from its ligand-binding domain to its
- the native inhibitory receptor can be a human inhibitory receptor or a mouse inhibitory receptor.
- the extracellular domain may comprise a human or mouse amino acid sequence.
- the origin of the native inhibitory receptor is selected to match the species of a subject that is being treated, e.g., to avoid an immune response against the chimeric transmembrane protein.
- the native inhibitory receptor may be selected from a different species, e.g., for convenience. Accordingly, the chimeric protein may or may not be xenogeneic-derived relative either to the species of cell in which the protein is expressed or the subject to which the protein is administered.
- the native inhibitory receptor is selected from proteins that reduce immune activity upon binding a native agonist.
- the native inhibitory receptor may reduce T cell proliferation, T cell survival, cytokine secretion, or immune cytolytic activity upon binding a native agonist.
- the native inhibitory receptor may be a lymphocyte inhibitory receptor (i.e., the inhibitory receptor may be expressed on lymphocytes, such as T cells).
- the native inhibitory receptor may be expressed on T cells, and the binding of an agonist to the native inhibitory receptor may cause cell signaling that disfavors T cell proliferation, T cell survival, cytokine secretion, or immune cytolytic activity.
- the native inhibitory receptor may be CTLA-4 (cytotoxic T- lymphocyte-associated protein 4; CD 152), PD-1 (Programmed cell death protein 1; CD279), LAG-3 (Lymphocyte-activation gene 3; CD223), or Tim-3 (T cell immunoglobulin mucin-3).
- CTLA-4 cytotoxic T- lymphocyte-associated protein 4
- PD-1 Programmed cell death protein 1; CD279)
- LAG-3 Lymphocyte-activation gene 3; CD223)
- Tim-3 T cell immunoglobulin mucin-3
- the extracellular domain may be the extracellular domain from CTLA-4, PD-1, LAG-3, or Tim-3.
- the inhibitory receptor may be PD-1.
- the transmembrane protein comprises the extracellular domain of PD-1.
- sequence of the extracellular domain comprises the PD-1 domain as described herein.
- the intracellular signaling domain is the signaling domain of an intracellular signaling protein.
- the intracellular signaling domain may comprise kinase activity or a phosphorylation site.
- the intracellular signaling domain can, in some embodiments, activate a signaling molecule, such as a kinase or phosphorylase, e.g., following signal transduction across a cell membrane.
- the intracellular signaling domain may signal through a downstream kinase or a phosphorylase.
- the intracellular signaling protein may be a human protein or a mouse protein.
- the intracellular signaling domain may comprise a human or mouse amino acid sequence.
- the intracellular signaling protein is selected to match the species of a subject and cell that is being used for treatment, e.g., so that the signaling domain may utilize the cell's cytosolic machinery to activate downstream signaling molecules. Nevertheless, the intracellular signaling protein may be selected from a different species, e.g., for convenience, such as described above.
- the intracellular signaling protein increases immune activity.
- signal transduction via the chimeric transmembrane protein can result in a signal cascade that increases immune activity, wherein the intracellular signaling domain mediates the intracellular signaling cascade.
- the intracellular signaling protein can enhance T cell proliferation, T cell survival, cytokine secretion, or immune cytolytic activity.
- the intracellular signaling protein is a transmembrane protein or the intracellular signaling protein can bind a native transmembrane protein.
- the intracellular signaling protein may be a lymphocyte protein (i.e., the intracellular signaling protein may be expressed on lymphocytes, such as T cells).
- the intracellular signaling protein is CD3 ⁇ (T-cell surface glycoprotein CD3 zeta chain; CD247), 4- IBB (tumor necrosis factor receptor superfamily member 9; CD137), or CD28 (T-cell-specific surface glycoprotein CD28; Tp44).
- the intracellular signaling protein may comprise a signaling domain from CD3 ⁇ , 4-lBB, or CD28.
- the intracellular signaling protein may be 4-lBB.
- the intracellular signaling protein may comprise a signaling domain from 4- IBB.
- the intracellular domain comprises the intracellular domains described herein.
- the chimeric transmembrane protein comprises a suicide domain, i.e., to kill a recombinant cell comprising the protein.
- the suicide domain may comprise thymidine kinase activity or caspase activity.
- the suicide domain may be a thymidine kinase or a caspase.
- the suicide domain is the thymidine kinase domain of HSV thymidine kinase ("HSV-TK”) or the suicide domain comprises a portion of caspase 9.
- CD28 FWVLVWGGV TTTTGGGTGCTCGTGGTCGTTGGCGGAGTGCTGGCCTGTTATAGCCTGCT
- CD27 ILVIFSGMFL ATCCTCGTGATCTTCAGCGGCATGTTCCTGGTGTTCACACTGGCTGGCGC
- the switch receptor comprises a sequence provided for in the table below:
- Extracellular LLWTEGDNATFTCSFSNTS CCTCCAACATTCAGCCCCGCTCTGCTGGTGGTTACCGAG
- ESFVLNWYRMSPSNQTDKLA GGCGATAATGCCACCTTCACCTGTAGCTTCAGCAACACC
- Extracellular LLWTEGDNATFTCSFSNTS CCTCCAACATTCAGCCCCGCTCTGCTGGTGGTTACCGAG
- ESFVLNWYRMSPSNQTDKLA GGCGATAATGCCACCTTCACCTGTAGCTTCAGCAACACC
- Intracellular RPAGQFQTLVILVIFSGMFL CGGGCCAGAAGAAACGACAGCGGCACATATCTGTGCGGC
- Extracellular LLWTEGDNATFTCSFSNTS CCTCCAACATTCAGCCCCGCTCTGCTGGTGGTTACCGAG
- ESFVLNWYRMSPSNQTDKLA GGCGATAATGCCACCTTCACCTGTAGCTTCAGCAACACC
- the receptors provided for in the table above comprise a N-terminal CD8 leader peptide sequence.
- the leader sequence is
- the receptor comprises the leader sequence it can be appended to the N-terminus of the sequence in the table and form a contiguous sequence.
- the leader sequence can be encoded, for example, a nucleotide sequence of SEQ ID NO: 2.
- the intracellular domains provided herein can also be referred to as intracellular signaling domains.
- the receptor comprises a sequence as provided in the following table:
- CD28 SESFVLNWYRMSPSNQTDKL CCCGCTCTGCTGGTGGTTACCGAGGGCGATAATGCCACC
- Intracellular AELRVTERRAEVPTAHPSPS CAGGACTGCCGGTTCAGAGTTACACAGCTGCCCAACGGC
- CD27 SESFVLNWYRMSPSNQTDKL CCCGCTCTGCTGGTGGTTACCGAGGGCGATAATGCCACC
- Intracellular AELRVTERRAEVPTAHPSPS CAGGACTGCCGGTTCAGAGTTACACAGCTGCCCAACGGC Domain PRPAGQFQTLVILVIFSGMF CGGGACTTCCACATGTCTGTCGTCCGGGCCAGAAGAAAC
- CD27 SESFVLNWYRMSPSNQTDKL CCCGCTCTGCTGGTGGTTACCGAGGGCGATAATGCCACC
- PRPAGQFQTLVILVIFSGMF CGGGACTTCCACATGTCTGTCGTCCGGGCCAGAAGAAAC
- Intracellular AELRVTERRAEVPTAHPSPS CAGGACTGCCGGTTCAGAGTTACACAGCTGCCCAACGGC Domain PRPAGQFQTLVFWLPIGCAA CGGGACTTCCACATGTCTGTCGTCCGGGCCAGAAGAAAC
- the embodiments relates to a nucleic acid molecule encoding a chimeric transmembrane protein as described herein.
- the nucleic acid molecule may comprise a promoter, wherein the promoter is operably linked to a nucleotide sequence encoding the chimeric transmembrane protein, e.g., for expression of a chimeric transmembrane protein in a recombinant cell.
- the promoter is a constitutive promoter.
- the promoter is a cell specific promoter.
- the promoter is a tissue specific promoter.
- the nucleic acid molecule may comprise the sequence set forth above.
- the nucleic acid molecule may comprise a nucleotide sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%o, 96%o, 97%o, 98%, or 99% sequence homology with the nucleotide sequence set forth herein. Since the genetic code is degenerate variations in the nucleic acid sequence may not change the encoded amino acid sequence. Accordingly, degenerate changes are intended to be encompassed by the present disclosure.
- the nucleic acid molecule may comprise a nucleotide sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence homology with at least about 100, 200, 300, 400, 500, 600, or 700 consecutive nucleotides in the nucleotide sequence set forth herein.
- the nucleic acid molecule may comprise a nucleotide sequence having at least 95% sequence homology with at least 100 consecutive nucleotides in the nucleotide sequence set forth herein. Homology can be used running Blastn or BlastP at the NCBI website using default settings to compare or align two sequences.
- the nucleic acid molecule encodes an amino acid sequence as described herein. In some embodiments, the nucleic acid molecule encodes an amino acid sequence comprising one or more of the amino acid sequences set forth herein. In some embodiments, the nucleic acid molecule may comprise a nucleotide sequence that encodes an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence homology with an amino acid sequence set forth herein. Homology can be identity or similarly in the context of a protein. Homology can be used by employing routine tools such as Expasy, BLASTp, Clustal, and the like using default settings.
- the chimeric transmembrane protein comprises one or more amino acid sequences set forth herein and above.
- the chimeric transmembrane protein comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence homology with one of the amino acid sequences set forth herein.
- variants of the amino acid sequences described herein may be included in various embodiments.
- the term "variant” refers to a protein or polypeptide in which one or more (e.g., 1, 2, 3, 4, etc.) amino acid substitutions, deletions, and/or insertions are present as compared to the amino acid sequence of a protein or polypeptide, and the term includes naturally occurring allelic variants and alternative splice variants of a protein or polypeptide.
- variant includes the replacement of one or more amino acids in an amino acid sequence with a similar or homologous amino acid(s) or a dissimilar amino acid(s). Some variants include alanine substitutions at one or more amino acid positions in an amino acid sequence.
- substitutions include conservative substitutions that have little or no effect on the overall net charge, polarity, or hydrophobicity of the protein.
- Conservative substitutions may have insignificant effect on the function of the chimeric transmembrane protein.
- the function can be the specificity of a protein when expressed in a lymphocyte, e.g. , a marrow-infiltrating lymphocyte (MIL).
- MIL marrow-infiltrating lymphocyte
- One of skill in the art can determine if a substitution affects the function of a chimeric transmembrane protein by comparing to the sequences provided herein. Non-limiting exemplary conservative substitutions are set forth in the table below.
- a chimeric transmembrane protein has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with an amino acid sequence described herein.
- 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the amino acid residues of an amino acid sequence disclosed herein are modified with conservative substitutions.
- only 1, 2, 3, 4 or 5 amino acid residues are substituted with conservative substitutions.
- the chimeric transmembrane protein comprises a sequence (SEQ ID NO: 1-44) described herein or a variant thereof.
- the protein comprises a leader sequence of CD8 (SEQ ID NO: 1) it is replaced with another signal peptide or leader sequence, that can assist in trafficking the chimeric transmembrane protein to the extracellular membrane.
- the embodiments relate to a recombinant cell, comprising a nucleic acid as disclosed herein.
- the embodiments relate to a recombinant cell, comprising a chimeric transmembrane protein as described herein.
- the cell comprises a chimeric protein comprising an amino acid sequence set forth herein or a variant thereof.
- the cell is a lymphocyte.
- the cell may be a T cell.
- the cell may be a tumor-infiltrating lymphocyte ("TIL”) or a marrow infiltrating lymphocyte (“MIL").
- TIL tumor-infiltrating lymphocyte
- MIL marrow infiltrating lymphocyte
- the cell comprising a chimeric transmembrane protein described herein persist longer in a subject when administered to the subject as compared to a cell without a chimeric transmembrane protein.
- the embodiments relate to a method for making a recombinant cell, comprising transfecting a cell with a nucleic acid molecule as described herein. In some aspects, the embodiments relate to a method for making a recombinant cell, comprising transfecting a cell with a nucleic acid molecule encoding an amino acid sequence as described herein.
- the nucleic acid molecule may be a plasmid.
- the cell can be transfected by a plasmid comprising one or more nucleotide sequences as described herein.
- the cell can also be infected with a virus or virus-like particle comprising the nucleic acid molecule.
- the virus is a lentivirus, adenovirus, or adeno-associated virus ("AAV").
- the cell is a TIL or a MIL.
- the MIL is an activated MIL. MILs can be activated, for example, by incubating them with anti-CD3/anti-CD28 beads and appropriate cytokines, e.g., under hypoxic conditions. An example of growing the MILs under hypoxic conditions can found, for example, in WO2016037054, which is hereby incorporated by reference in its entirety.
- the nucleic acid molecule is transfected into a cell after the cell has been incubated in a hypoxic environment as described herein.
- the nucleic acid molecule is transfected into a cell after the cell has been incubated in a hypoxic environment for about 1, 2, 3, 4, or 5 days. In some embodiments, the cell is then incubated under normoxic conditions for about 1, 2, 3, 4, or 5 days.
- a MIL comprising the chimeric transmembrane protein is prepared according to a method described in WO2016037054, which is hereby incorporated by reference in its entirety.
- the method may comprise removing cells in the bone marrow, lymphocytes, and/or marrow infiltrating lymphocytes ("MILs") from the subject; incubating the cells in a hypoxic environment, thereby producing activated MILs; and administering the activated MILs to the subject.
- the cells can also be activated in the presence of anti-CD3/anti-CD28 antibodies and cytokines as described herein.
- a nucleic acid molecule encoding a chimeric transmembrane protein, such as one of those described herein, can be transfected or infected into a cell before or after the MIL is incubated in a hypoxic environment.
- the hypoxic environment may comprise less than about 21 % oxygen, such as less than about 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 1 1%, 10%, 9%, 8%, 7%, 6%, 5%, 4%), or less than about 3% oxygen.
- the hypoxic environment may comprise about 0%) oxygen to about 20% oxygen, such as about 0% oxygen to about 19% oxygen, about 0% oxygen to about 18% oxygen, about 0% oxygen to about 17% oxygen, about 0% oxygen to about 16%) oxygen, about 0% oxygen to about 15% oxygen, about 0% oxygen to about 14% oxygen, about 0%) oxygen to about 13% oxygen, about 0% oxygen to about 12% oxygen, about 0% oxygen to about 11% oxygen, about 0% oxygen to about 10% oxygen, about 0% oxygen to about 9%) oxygen, about 0% oxygen to about 8% oxygen, about 0% oxygen to about 7% oxygen, about 0%) oxygen to about 6% oxygen, about 0% oxygen to about 5% oxygen, about 0% oxygen to about 4%) oxygen, or about 0% oxygen to about 3% oxygen.
- oxygen to about 20% oxygen such as about 0% oxygen to about 19% oxygen, about 0% oxygen to about 18% oxygen, about 0% oxygen to about 17% oxygen, about 0% oxygen to about 16%) oxygen, about 0% oxygen to about 15% oxygen, about 0% oxygen to
- the hypoxic environment comprises about 1 %> to about 7% oxygen. In some embodiments, the hypoxic environment is about 1% to about 2% oxygen. In some embodiments, the hypoxic environment is about 0.5%) to about 1.5% oxygen. In some embodiments, the hypoxic environment is about 0.5%) to about 2%) oxygen.
- the hypoxic environment may comprise about 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 1 1%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or about 0% oxygen. In some embodiments, the hypoxic environment comprises about 7%, 6%, 5%, 4%, 3%, 2%), or 1%) oxygen.
- Incubating MILs in a hypoxic environment may comprise incubating the MILs, e.g., in tissue culture medium, for at least about 1 hour, such as at least about 12 hours, 18 hours, 24 hours, 30 hours, 36 hours, 42 hours, 48 hours, 60 hours, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 1 1 days, 12 days, 13 days, or even at least about 14 days.
- Incubating may comprise incubating the MILs for about 1 hour to about 30 days, such as about 1 day to about 20 days, about 1 day to about 14 days, or about 1 day to about 12 days.
- incubating MILs in a hypoxic environment comprises incubating the MILs in a hypoxic environment for about 2 days to about 5 days.
- the method may comprise incubating MILs in a hypoxic environment for about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 day, 9 days, 10 days, 11 days, 12 days, 13 days, or 14 days.
- the method comprises incubating the MILs in a hypoxic environment for about 3 days.
- the method comprises incubating the MILs in a hypoxic environment for about 2 days to about 4 days. In some embodiments, the method comprises incubating the MILs in a hypoxic environment for about 3 days to about 4 days.
- the method further comprises incubating the MILs in a normoxic environment, e.g., after incubating the MILs in a hypoxic environment.
- the normoxic environment may comprise at least about 21% oxygen.
- the normoxic environment may comprise about 5% oxygen to about 30%> oxygen, such as about 10%> oxygen to about 30%) oxygen, about 15%> oxygen to about 25% oxygen, about 18%> oxygen to about 24% oxygen, about 19% oxygen to about 23% oxygen, or about 20% oxygen to about 22% oxygen.
- the normoxic environment comprises about 21 % oxygen.
- Incubating MILs in a normoxic environment may comprise incubating the MILs, e.g., in tissue culture medium, for at least about 1 hour, such as at least about 12 hours, 18 hours, 24 hours, 30 hours, 36 hours, 42 hours, 48 hours, 60 hours, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 1 1 days, 12 days, 13 days, or even at least about 14 days.
- Incubating may comprise incubating the MILs for about 1 hour to about 30 days, such as about 1 day to about 20 days, about 1 day to about 14 days, about 1 day to about 12 days, or about 2 days to about 12 days.
- the cell is transfected or infected with a nucleic acid molecule encoding a chimeric transmembrane protein described herein after being placed in a normoxic environment or before it is placed in a normoxic environment.
- the MILs are obtained by extracting a bone marrow sample from a subject and culturing/incubating the cells as described herein.
- the bone marrow sample is centrifuged to remove red blood cells.
- the bone marrow sample is not subject to apheresis.
- the bone marrow sample does not comprise peripheral blood lymphocytes ("PBL") or the bone marrow sample is substantially free of PBLs.
- PBL peripheral blood lymphocytes
- TILs can be selected by known methods to one of skill in the art and can be transfected or infected with the nucleic acid molecules described herein such that the TILs can express the chimeric transmembrane protein described herein.
- the cells are also activated by culturing with antibodies to CD3 and CD28. This can be performed, for example by incubating the cells with anti-CD3/anti-CD28 beads that are commercially available or that can be made by one of skill in the art.
- the cells can then be plated in a plate, flask, or bag. Hypoxic conditions can be achieved by flushing either the hypoxic chamber or cell culture bag for 3 minutes with a 95% Nitrogen and 5% C0 2 gas mixture. This can lead to, for example, 1-2% or less 0 2 gas in the receptacle.
- Cells can be then cultured as described herein or as in the examples of WO2016037054, which is hereby incorporated by reference.
- a hypoxic MIL comprising a chimeric transmembrane protein as described herein is provided.
- the hypoxic MIL is in an environment of about 0.5% to about 5% oxygen gas.
- the hypoxic MIL is in an environment of about 1% to about 2% oxygen gas.
- the hypoxic MIL is in an environment of about 1% to about 3% oxygen gas.
- the hypoxic MIL is in an environment of about 1% to about 4% oxygen gas.
- a hypoxic MIL is a MIL that has been incubated in a hypoxic environment, such as those described herein, for a period of time, such as those described herein.
- hypoxic MIL will undergo changes in protein and/or gene expression that affect the anti-tumor capabilities of the MIL.
- the hypoxic MIL can also be activated with the presence of anti- CD3/anti-CD28 beads or other similar activating reagents.
- a hypoxic MIL can also be an activated-hypoxic MIL.
- the embodiments relates to a method for increasing an immune response in a subject, comprising administering to the subject a recombinant cell as described herein.
- the embodiments relate to a method for treating a neoplasm in a subject, comprising administering to the subject a recombinant cell as described herein.
- the neoplasm may be a benign neoplasm, a malignant neoplasm, or a secondary neoplasm.
- the neoplasm may be cancer.
- the neoplasm may be a lymphoma or a leukemia, such as chronic lymphocytic leukemia ("CLL”) or acute lymphoblastic leukemia ("ALL").
- CLL chronic lymphocytic leukemia
- ALL acute lymphoblastic leukemia
- the neoplasm may be multiple myeloma as well as any solid tumor (e.g., breast cancer, prostate cancer, lung cancer, esophageal cancer, brain cancer, kidney cancer, bladder cancer, pancreatic cancer, osteosarcoma, and the like).
- the cancer can also be a cancer described herein.
- the method may comprise administering to the subject a plurality of recombinant cells as described herein.
- the method may comprise administering to the subject an effective amount of recombinant cells as described herein.
- the cell is an autologous cell with respect to the subject receiving the recombinant cells.
- the cell is an allogenic cell with respect to the subject receiving the recombinant cells.
- the cell is a xenogenic cell with respect to the subj ect receiving the recombinant cells.
- the cell is a cell obtained from the subject and modified with the receptor provided for herein and then administered back to the subject.
- the cell can be as described herein.
- the cell is a cell obtained from a different subject and modified with the receptor provided for herein and then administered back to a subject that is not the same as the source of the cells.
- the cell can be as described herein.
- the cell is a cell obtained from a different species (e.g. pig) and modified with the receptor provided for herein and then administered back to a subject that is not the same as the source of the cells.
- the cell can be as described herein.
- the cell is obtained from the subject.
- the cell that is transfected or infected may be obtained from the subject.
- the cell can be obtained as described herein.
- a cell that is administered may be autologous to the subject.
- the cell that is administered is allogeneic to the subject.
- the cell may be obtained from the subject and transfected or infected with a nucleic acid encoding a chimeric transmembrane protein as described herein.
- the cell may be a daughter cell, wherein a parent of the daughter cell was obtained from the subject.
- the recombinant cell may have been transfected or infected with the nucleic acid or a parent of the recombinant cell may have been transfected or infected with the nucleic acid.
- the cell after being transfected or infected expresses a protein comprising one or more of the amino sequences described herein.
- the method may further comprise making the recombinant cell, wherein making the recombinant cell comprises transfecting or infecting a cell with a nucleic acid encoding a chimeric transmembrane protein, such as those described herein.
- the chimeric transmembrane protein comprises an amino acid sequence set forth in any one of SEQ ID NO: 5, 6, 7, 8, 9, 10, or 11 or a variant thereof.
- the method may further comprise making a plurality of recombinant cells, wherein making the plurality of recombinant cells comprises transfecting or infecting a plurality of cells with nucleic acids encoding a chimeric transmembrane protein, such as those described herein.
- the method may further comprise expanding a parent cell, e.g., the recombinant cell may be a daughter cell of the parent cell.
- the method may comprise expanding a population of cells, e.g., the method may comprise administering to the subject a plurality of recombinant cells as described herein, and each cell of the plurality of recombinant cells may be a daughter cell of a parent cell.
- the method may further comprise isolating the cell or a parent cell from the subject.
- the method may further comprise sorting the cell, e.g., by fluorescence activated cell sorting ("FACS”) or magnetic activated cell sorting ("MACS").
- FACS fluorescence activated cell sorting
- MCS magnetic activated cell sorting
- the cells can be administered to a subject by any suitable route in, for example, a pharmaceutically acceptable composition.
- the composition is pyrogen free.
- administration of the cells may be carried out using any method known in the art.
- administration may be parenteral, intravenous, intra-arterial, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intracisternal, intraperitoneal, intracerebroventricular, or intrathecal.
- parenteral parenteral, intravenous, intra-arterial, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intracisternal, intraperitoneal, intracerebroventricular, or intrathecal.
- the cells may be administered by either intravenous, subcutaneous, or intramuscular injection, in compositions with pharmaceutically acceptable vehicles or carriers.
- the cells can be formulated for parenteral administration by injection, for example, by bolus injection or continuous infusion.
- the compositions can take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and can contain formulatory agents, for example, suspending, stabilizing, and/or dispersing agents.
- the pharmaceutical compositions may be formulated with a pharmaceutically acceptable carrier to provide sterile solutions or suspensions for injectable administration.
- injectables can be prepared in conventional forms, either as liquid solutions or suspensions or as emulsions. Suitable excipients are, for example, water, saline, dextrose, mannitol, lactose, lecithin, albumin, sodium glutamate, cysteine hydrochloride, or the like.
- the injectable pharmaceutical compositions may contain minor amounts of nontoxic auxiliary substances, such as wetting agents, pH buffering agents, and the like. Suitable pharmaceutical carriers are described in "Remington's pharmaceutical Sciences" by E. W. Martin.
- the subject may be any organism that comprises immune cells.
- the subject may be selected from rodents, canines, felines, porcines, ovines, bovines, equines, and primates.
- the subject may be a mouse or a human.
- the subject may have a neoplasm.
- the neoplasm may be a benign neoplasm, a malignant neoplasm, or a secondary neoplasm.
- the neoplasm may be cancer.
- the neoplasm may be a lymphoma or a leukemia, such as chronic lymphocytic leukemia ("CLL") or acute lymphoblastic leukemia ("ALL").
- CLL chronic lymphocytic leukemia
- ALL acute lymphoblastic leukemia
- the subject may have a glioblastoma, medulloblastoma, breast cancer, head and neck cancer, kidney cancer, ovarian cancer, Kaposi's sarcoma, acute myelogenous leukemia, and B-lineage malignancies.
- the subject may have multiple myeloma.
- the subject is a subject "in need thereof.”
- the phrase "in need thereof means that the subject has been identified or suspected as having a need for the particular method or treatment.
- the identification can be by any means of diagnosis.
- the subject can be in need thereof.
- the receptors provided herein can also placed into cells with other chimeric activated receptors, which can also be referred to as a "CAR".
- Example 1 PD-1 switch receptor expression in lentivirus transduced Jurkat leukemia cell line.
- the receptors described below were transduced into Jurkat cells using a lentivirus expression system and as described herein. Briefly, Jurkat cells were transduced with lentivirus carrying an empty vector control carrying green fluorescent protein (GFP) only (Empty Vector) or with lentiviruses carrying each of the six PD-1 switch receptors linked to GFP by a T2a cleavable peptide. Four days following transduction, the cells were labelled with either anti-PD-PECy7 or with an isotype-matched control antibody and analyzed using a Beckman Coulter Galios flow cytometer. Untransduced Jurkat cells that do not express PD-1 PD-1 switch receptors or GFP (Untransduced) were labelled in the same way and used as a negative control. The receptors were found to be expressed in the cells.
- GFP green fluorescent protein
- the receptors were also found to be expressed after being transduced into MILs. Briefly, Bone Marrow (BM) from three multiple myeloma patients (A) Patient 476-2312, B) Patient 1431, C) Patient 1943) were used to generate activated MILs under hypoxic conditions. On day 3, the MILs were transduced with lentivirus carrying an empty vector control carrying GFP only (Empty Vector) or with lentiviruses carrying each of the six PDl switch receptors linked to GFP by a T2a cleavable peptide.
- the cells were labeled with anti- CD3-APC, anti-CD8-APCH7, Live-dead Yellow, and either anti-PDl-PECy7 or an isotype- matched control antibody, and analyzed using a Beckman Coulter Galios flow cytometer.
- Untransduced MILs that do not express the PDl switch receptors or GFP were labeled in the same way and used as a negative control. The expression was measured by flow cytometry. The increase in PDl -expression observed in GFP+ PD-1 switch receptor-transduced MILs compared to empty vector control-transduced MILs corresponds to the expression of the PDl switch receptors.
- the MILs had been activated under hypoxic conditions. These results demonstrate that the receptors were capable of being expressed in different cell types. Cells expressing the receptors can be used to treat neoplasms, such as the cancers described herein.
- Example 2 Hypoxic Activated MILs Treat Cancer
- MILs obtained from subjects are activated and expanded as described herein. Briefly, after the marrow sample is obtained from the subject, the cells are incubated under hypoxic conditions in the presence of anti-CD3/anti-CD28 beads and cytokines as described in
- the MILs are then infected with a virus comprising a nucleic acid molecule encoding a chimeric transmembrane protein comprising SEQ ID NO: 21, 23, 25, 27, 29, or 31.
- the nucleic acid molecule can also be introduced by transfection or transduction.
- the chimeric receptor may also comprise a leader sequence as provided herein.
- the cells are then grown under normoxic conditions and allowed to expand.
- the control and infected MILs are contacted with different cell types. Neither the expansion of the MILS nor the ability of the MILs to recognize antigens is negatively affected by the presence of the chimeric transmembrane protein.
- Adding a chimeric transmembrane protein to a MIL is not detrimental to its functions and growth.
- the MILs are administered to a subject with cancer, such as multiple myeloma, and the cancer is treated and the subject is in remission.
- the cells are also found to persist and continue to keep the subject in remission.
- the embodiments and examples provided herein demonstrate that cells expressing a chimeric transmembrane protein provided herein can be effectively used to treat cancer and/or modulate an immune response.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Epidemiology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Hematology (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Developmental Biology & Embryology (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2019530043A JP2020512284A (ja) | 2016-12-22 | 2017-12-21 | 免疫系調節組成物および方法 |
| AU2017382243A AU2017382243A1 (en) | 2016-12-22 | 2017-12-21 | Compositions and methods for modulating the immune system |
| KR1020197014105A KR20190096969A (ko) | 2016-12-22 | 2017-12-21 | 면역계를 조절하기 위한 조성물 및 방법 |
| MX2019006852A MX2019006852A (es) | 2016-12-22 | 2017-12-21 | Composiciones y metodos para modular el sistema inmunologico. |
| CN201780079696.3A CN110267666A (zh) | 2016-12-22 | 2017-12-21 | 用于调节免疫系统的组合物和方法 |
| CA3038150A CA3038150A1 (en) | 2016-12-22 | 2017-12-21 | Compositions and methods for modulating the immune system |
| EP17885380.0A EP3525805A4 (en) | 2016-12-22 | 2017-12-21 | COMPOSITIONS AND METHODS OF MODULATION OF THE IMMUNE SYSTEM |
| US16/471,854 US20190330306A1 (en) | 2016-12-22 | 2017-12-21 | Compositions and Methods for Modulating the Immune System |
| IL266386A IL266386A (en) | 2016-12-22 | 2019-05-01 | Compositions and methods for regulating the immune system |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662438106P | 2016-12-22 | 2016-12-22 | |
| US62/438,106 | 2016-12-22 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018119198A1 true WO2018119198A1 (en) | 2018-06-28 |
Family
ID=62627209
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/067830 Ceased WO2018119198A1 (en) | 2016-12-22 | 2017-12-21 | Compositions and methods for modulating the immune system |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US20190330306A1 (https=) |
| EP (1) | EP3525805A4 (https=) |
| JP (1) | JP2020512284A (https=) |
| KR (1) | KR20190096969A (https=) |
| CN (1) | CN110267666A (https=) |
| AU (1) | AU2017382243A1 (https=) |
| CA (1) | CA3038150A1 (https=) |
| IL (1) | IL266386A (https=) |
| MX (1) | MX2019006852A (https=) |
| WO (1) | WO2018119198A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4444869A4 (en) * | 2021-12-06 | 2026-01-07 | Vycellix Inc | CHIMERICAL SWITCHING RECEPTORS IN NK CELLS |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016037054A1 (en) * | 2014-09-04 | 2016-03-10 | The Johns Hopkins University | Activation of marrow infiltrating lymphocytes in hypoxic alternating with normoxic conditions |
| PL3298033T5 (pl) | 2015-05-18 | 2023-10-30 | TCR2 Therapeutics Inc. | Kompozycje i zastosowania medyczne do reprogramowania TCR z zastosowaniem białek fuzyjnych |
| DK3909972T5 (da) | 2015-06-19 | 2024-08-05 | Sebastian Kobold | Pd1-cd28-fusionsproteiner og disses anvendelse i medicin |
| JP7291396B2 (ja) | 2016-11-22 | 2023-06-15 | ティーシーアール2 セラピューティクス インク. | 融合タンパク質を用いたtcrの再プログラミングのための組成物及び方法 |
| WO2020236964A1 (en) * | 2019-05-20 | 2020-11-26 | The Trustees Of The University Of Pennsylvania | Engineered expression of cell surface and secreted sialidase by car t cells for increased efficacy in solid tumors |
| WO2022211376A1 (ko) * | 2021-04-01 | 2022-10-06 | 주식회사 이뮤노로지컬디자이닝랩 | 키메릭 항원 수용체(car)를 포함하는 형질전환된 항원 특이적 전문적 항원표출세포 및 이의 용도 |
| KR20220144000A (ko) * | 2021-04-16 | 2022-10-26 | 주식회사 이뮤노로지컬디자이닝랩 | Programmed death-ligand 1(PD-L1)에 특이적으로 결합하는 키메릭 항원 수용체 및 이의 용도 |
| EP4334331A1 (en) * | 2021-05-07 | 2024-03-13 | Medigene Immunotherapies GmbH | Combination of prame specific t cell receptors and chimeric co-stimulatory receptors |
| WO2025056659A1 (en) * | 2023-09-15 | 2025-03-20 | Medigene Immunotherapies Gmbh | T-CELL RECEPTOR VARIANT AGAINST mKRAS7-16 G12V AND G12C |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014130635A1 (en) * | 2013-02-20 | 2014-08-28 | Novartis Ag | Effective targeting of primary human leukemia using anti-cd123 chimeric antigen receptor engineered t cells |
| WO2015048744A2 (en) * | 2013-09-30 | 2015-04-02 | Moderna Therapeutics, Inc. | Polynucleotides encoding immune modulating polypeptides |
| WO2016019300A1 (en) * | 2014-07-31 | 2016-02-04 | Novartis Ag | Subset-optimized chimeric antigen receptor-containing t-cells |
| CA2978186A1 (en) * | 2015-03-05 | 2016-09-09 | Fred Hutchinson Cancer Research Center | Immunomodulatory fusion proteins and uses thereof |
| WO2016170176A1 (en) * | 2015-04-22 | 2016-10-27 | Curevac Ag | Rna containing composition for treatment of tumor diseases |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| MX2014001222A (es) * | 2011-07-29 | 2014-09-15 | Univ Pennsylvania | Receptores coestimuladores de cambio. |
| WO2016037054A1 (en) * | 2014-09-04 | 2016-03-10 | The Johns Hopkins University | Activation of marrow infiltrating lymphocytes in hypoxic alternating with normoxic conditions |
| US20180334490A1 (en) * | 2014-12-03 | 2018-11-22 | Qilong H. Wu | Methods for b cell preconditioning in car therapy |
| CN108064251A (zh) * | 2014-12-19 | 2018-05-22 | 达纳-法伯癌症研究所公司 | 碳酸酐酶ix特异性嵌合抗原受体及其使用方法 |
| WO2016179319A1 (en) * | 2015-05-04 | 2016-11-10 | Cellerant Therapeutics, Inc. | Chimeric antigen receptors with ctla4 signal transduction domains |
| JP2018520679A (ja) * | 2015-06-29 | 2018-08-02 | ザ・ジョンズ・ホプキンス・ユニバーシティー | 免疫チェックポイントキメラ抗原受容体療法 |
| CN105153315B (zh) * | 2015-10-09 | 2019-04-02 | 重庆精准生物技术有限公司 | 免疫抑制受体联合肿瘤抗原嵌合受体及其应用 |
| EP3433269B1 (en) * | 2016-03-23 | 2023-09-27 | Helmholtz Zentrum München - Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH) | Fusion proteins of pd-1 and 4-1bb |
-
2017
- 2017-12-21 AU AU2017382243A patent/AU2017382243A1/en not_active Abandoned
- 2017-12-21 KR KR1020197014105A patent/KR20190096969A/ko not_active Withdrawn
- 2017-12-21 CA CA3038150A patent/CA3038150A1/en not_active Abandoned
- 2017-12-21 EP EP17885380.0A patent/EP3525805A4/en not_active Withdrawn
- 2017-12-21 JP JP2019530043A patent/JP2020512284A/ja active Pending
- 2017-12-21 WO PCT/US2017/067830 patent/WO2018119198A1/en not_active Ceased
- 2017-12-21 US US16/471,854 patent/US20190330306A1/en not_active Abandoned
- 2017-12-21 MX MX2019006852A patent/MX2019006852A/es unknown
- 2017-12-21 CN CN201780079696.3A patent/CN110267666A/zh active Pending
-
2019
- 2019-05-01 IL IL266386A patent/IL266386A/en unknown
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014130635A1 (en) * | 2013-02-20 | 2014-08-28 | Novartis Ag | Effective targeting of primary human leukemia using anti-cd123 chimeric antigen receptor engineered t cells |
| WO2015048744A2 (en) * | 2013-09-30 | 2015-04-02 | Moderna Therapeutics, Inc. | Polynucleotides encoding immune modulating polypeptides |
| WO2016019300A1 (en) * | 2014-07-31 | 2016-02-04 | Novartis Ag | Subset-optimized chimeric antigen receptor-containing t-cells |
| CA2978186A1 (en) * | 2015-03-05 | 2016-09-09 | Fred Hutchinson Cancer Research Center | Immunomodulatory fusion proteins and uses thereof |
| WO2016141357A1 (en) * | 2015-03-05 | 2016-09-09 | Fred Hutchinson Cancer Research Center | Immunomodulatory fusion proteins and uses thereof |
| WO2016170176A1 (en) * | 2015-04-22 | 2016-10-27 | Curevac Ag | Rna containing composition for treatment of tumor diseases |
Non-Patent Citations (4)
| Title |
|---|
| ISHIDA, Y ET AL.: "Induced Expression of PD-1, A Novel Member of the Immunoglobulin Gene Superfamily , Upon Programmed Cell Death", EMBO J., vol. 11, no. 11, 1 November 1992 (1992-11-01), pages 3887 - 3895, XP002070368, Retrieved from the Internet <URL:doi:10.1002/j.1460-2075.1992.tb05481.x> * |
| See also references of EP3525805A4 * |
| SHINOHARA, T ET AL.: "Structure and Choromosomal Localization of the Human PD-1 Gene (PDCD1)", GENOMICS, vol. 23, no. 3, 1 October 1994 (1994-10-01), pages 704 - 706, XP024796771, Retrieved from the Internet <URL:https://doi.org/10.1006/geno.1994.1562> * |
| TANG, X ET AL.: "The Advantages of PD1 Activating Chimeric Receptor (PD1-ACR) Engineered Lymphocytes for PDL1+ Cancer Therapy", AM J TRANSL RES, vol. 7, no. 3, 30 March 2015 (2015-03-30), pages 460 - 473, XP055497234, Retrieved from the Internet <URL:www.ajtr.org/ISSN:1943-8141/AJTR0002962> * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4444869A4 (en) * | 2021-12-06 | 2026-01-07 | Vycellix Inc | CHIMERICAL SWITCHING RECEPTORS IN NK CELLS |
Also Published As
| Publication number | Publication date |
|---|---|
| CA3038150A1 (en) | 2018-06-28 |
| EP3525805A4 (en) | 2020-07-29 |
| EP3525805A1 (en) | 2019-08-21 |
| MX2019006852A (es) | 2019-08-26 |
| US20190330306A1 (en) | 2019-10-31 |
| AU2017382243A1 (en) | 2019-05-02 |
| JP2020512284A (ja) | 2020-04-23 |
| IL266386A (en) | 2019-06-30 |
| KR20190096969A (ko) | 2019-08-20 |
| CN110267666A (zh) | 2019-09-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2018119198A1 (en) | Compositions and methods for modulating the immune system | |
| US20180185434A1 (en) | Immune checkpoint chimeric antigen receptors therapy | |
| US20250034244A1 (en) | Bicistronic chimeric antigen receptors and their uses | |
| US11034763B2 (en) | Flag tagged CD19-CAR-T cells | |
| ES2905557T3 (es) | Receptor de antígeno quimérico anti-CD30 y su uso | |
| JP2023082052A (ja) | キメラ抗原受容体およびその使用 | |
| WO2018118494A2 (en) | Use of car-modified human natural killer cells to treat cancer | |
| US11965014B2 (en) | Immune synapse-stabilizing chimeric antigen receptor (CAR) T cell | |
| KR20240156654A (ko) | 키메라 ilt 수용체 조성물 및 방법 | |
| WO2017179015A1 (en) | Compositions for the treatment of cancer | |
| WO2021190550A1 (zh) | 含有保护肽的嵌合抗原受体及其用途 | |
| CN111850014B (zh) | 一种细胞因子增效的嵌合抗原受体及其应用 | |
| JP7209091B2 (ja) | ヒト抗antxrキメラ抗原受容体及びその用途 | |
| CN114907487A (zh) | 新型嵌合抗原受体以及包含其的免疫细胞 | |
| US20230058774A1 (en) | Novel dominant negative fas polypeptides, cells comprising thereof and uses thereof | |
| US20240000937A1 (en) | Methods and compositions of car-expressing natural killer cells with bispecific antigen-binding molecules as cancer therapeutic agents | |
| HK40013643A (en) | Compositions and methods for modulating the immune system | |
| JP2023501506A (ja) | T細胞機能を改善するtmem59タンパク質二量体またはキメラ発現受容体 | |
| CN110938641A (zh) | 靶向april的嵌合抗原受体及其用途 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17885380 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3038150 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2017382243 Country of ref document: AU Date of ref document: 20171221 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20197014105 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2019530043 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2017885380 Country of ref document: EP Effective date: 20190517 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |