WO2018046512A1 - Procédés et agents de production microbienne d'acide aminolévulinique - Google Patents

Procédés et agents de production microbienne d'acide aminolévulinique Download PDF

Info

Publication number
WO2018046512A1
WO2018046512A1 PCT/EP2017/072284 EP2017072284W WO2018046512A1 WO 2018046512 A1 WO2018046512 A1 WO 2018046512A1 EP 2017072284 W EP2017072284 W EP 2017072284W WO 2018046512 A1 WO2018046512 A1 WO 2018046512A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleotide sequence
seq
recombinant
methanolicus
promoter
Prior art date
Application number
PCT/EP2017/072284
Other languages
German (de)
English (en)
Inventor
Volker Wendisch
Marta Irla
Lidia Paul
Original Assignee
Universitaet Bielefeld
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universitaet Bielefeld filed Critical Universitaet Bielefeld
Publication of WO2018046512A1 publication Critical patent/WO2018046512A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/005—Amino acids other than alpha- or beta amino acids, e.g. gamma amino acids

Definitions

  • aminolevulinic acid is the first step in the biosynthesis of tetrapyrroles or porphyrins such as chlorophyll, vitamin B 12 or heme. Furthermore, ALA is used in photodynamic cancer treatment. So far, ALA has been produced in E. coli. However, glucose is needed for this (Zhang et al., Scientific Reports, 2015, No. 5, Article No. 8584, doi: 10.1038 / srep / 08584).
  • JP H05184376 discloses a process for producing ALA by, for example, Methanobacterium thermoautotrophicum and Methanosarcina barkeri in a methanol-containing medium, wherein the degradation of ALA is inhibited by the inhibition of the enzyme ALA dehydrogenase.
  • JP H0735984 describes the production of ALA by means of bacteria of the genus Methanosarcina at room temperature for 6 days in a methanol-containing basal medium.
  • Bacillus methanolicus is a Gram-positive bacterium.
  • a wild type of B. methanolicus (PB1) is available under accession no. ATCC 51375 deposited with the American Type Culture Collection (ATCC).
  • B. methanolicus strain MGA3 is a particularly temperature-tolerant strain first isolated from Minnesota soil samples and available under accession no. ATCC 53907 deposited with the ATCC. This strain is used inter alia for the production of L-lysine and L-glutamate from methanol (Heggeset et al, Applied and Environmental Microbiology August 2012, Vol. 78 No. 15, pages 5170-5181).
  • B. methanolicus can C1 compounds, z. As methanol, use as sole carbon source. So z. B. genetically modified B. methanolicus for the synthesis of 1,5-diaminopentane (cadaverine) from methanol (Naerdal et al, Microbial Biotechnology, 2015, no. 8, pages 342-350). No. 6,110,713 describes the production of glutamic acid from methanol by means of B. methanolicus, EP 2 297 329 describes the fermentative production of lysine by means of B. methanolicus.
  • Methanol as a source of carbon has the advantage of not being in competition with food production for humans and animals over glucose and other compounds traditionally used as a carbon source in biotechnology, and the price is also not dependent on factors such as weather and agro-cultural policy.
  • methanol can be easily prepared in various ways. l As in most bacteria, it is believed that ALA synthesis in B. methanolicus is similar to B. subtilis, according to the C 5 synthesis pathway.
  • glutamate is converted by means of glutamate-tRNA ligase (GltX) to glutamyl-tRNA Glu , followed by the conversion by glutamyl-tRNA reductase (HemA) to glutamate-1-semialdehyde, followed by the conversion by means of glutamate-1 - semialdehyde aminomutase to aminovaleric acid (ALA).
  • ALA is converted to Häme.
  • This biosynthesis requires, inter alia, in a first step, the condensation of two ALA molecules by means of ALA dehydrogenase (HemB) to porphobilinogen (PBG). From each four PBG is formed by PBG deaminase the tetrapyrrole hydroxymethylbilane which can then be converted by further steps to vitamin B 12 , protohaem or chlorophyll.
  • the object of the present invention is a microbial process for the production of ALA from sources other than glucose.
  • Such a method offers the advantage of a simple carbon source, which also does not compete with food production, as z. B. is the case with glucose.
  • One aspect of the invention is directed to a method of producing aminolevulinic acid (ALA) from methanol in recombinant B. methanolicus, wherein the genome of the recombinant B. methanolicus comprises at least one recombinant nucleotide sequence, a portion of which recombinant nucleotide sequence encodes at least one HemA protein and which is produced in this recombinant B. methanolicus.
  • the HemA protein produced in this way should of course have HemA activity, ie be active.
  • One embodiment is directed to a method according to aspect 1 and its embodiments, wherein B. methanolicus strain is MGA3.
  • One embodiment is directed to a method according to aspect 1 and its embodiments comprising the step of incubating said recombinant B. methanolicus in a nutrient medium at at least 40 ° C, preferably at 45 ° C, said nutrient medium comprising methanol as carbon source.
  • nucleotide sequence is a nucleotide sequence according to SEQ ID NO. 1, or a nucleotide sequence having at least 80% identity with SEQ ID NO. 1, or a nucleotide sequence encoding the completeness of SEQ ID NO. 1 under high stringency conditions (0.1 x SSC, 0.1% SDS, 65 ° C and washing conditions 2x SSC, 0.1% SDS, 65 ° C, followed by 0.1x SSC, 0.1% SDS, 65 ° C) or hybridized for an amino acid sequence according to SEQ ID NO. 2, or encodes an amino acid having at least 80% identity with SEQ ID NO. 2, more preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO. 2, and their encoded amino acid sequence has the activity of a glutamyl-tRNA reductase
  • nucleotide sequence is a nucleotide sequence according to SEQ ID NO. 3, or a nucleotide sequence having at least 80% identity with SEQ ID NO. 3, or a nucleotide sequence associated with the complement of SEQ ID NO. 3 under high stringency conditions (0.1 x SSC, 0.1% SDS, 65 ° C and washing conditions 2x SSC, 0.1% SDS, 65 ° C, followed by 0.1 x SSC, 0.1% SDS, 65 ° C) or that for an amino acid sequence according to SEQ ID NO. 4, or encodes an amino acid having at least 80% identity with SEQ ID NO. 4, more preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO. 2, and their encoded amino acid sequence thereby has the activity of a glutamyl-tRNA reductase.
  • One embodiment is directed to a method according to aspect 1 and its embodiments, wherein the at least one recombinant nucleotide sequence comprises a promoter nucleotide sequence and wherein the promoter nucleotide sequence is operably linked to the nucleotide sequence encoding at least one HemA protein.
  • One embodiment is directed to the previous embodiment wherein the promoter is selected from the group consisting of a methanol dehydrogenase promoter, a xylose inducible promoter, and a mannitol inducible promoter.
  • the promoter is selected from the group consisting of a methanol dehydrogenase promoter, a xylose inducible promoter, and a mannitol inducible promoter.
  • One embodiment is directed to the previous embodiment in which the promoter is selected from the group consisting of methanol dehydrogenase promoter mp according to SEQ ID No .: 20, xylose inducible promoter xpx according to SEQ ID No .: 18 and mannitol inducible promoter m2p according to SEQ ID No .: 19.
  • One embodiment is directed to a method according to aspect 1 and its embodiments, wherein the concentration of methanol in the nutrient medium is at least 100 mM, preferably in the range of 100 mM and 500 mM.
  • One embodiment is directed to a method according to aspect 1 and its embodiments, wherein the concentration of zinc ions in the nutrient medium is in the range of 0.002 ⁇ and 0.2 ⁇ .
  • One embodiment is directed to a method according to aspect 1 and its embodiments, wherein the incubation temperature is at least 45 ° C.
  • One embodiment is directed to a method according to aspect 1 and its embodiments, wherein the incubation time after addition of the methanol is in the range of 12 hours and 72 hours.
  • a further aspect 2 is directed to a vector comprising a nucleotide sequence encoding a HemA protein operably linked to a promoter nucleotide sequence.
  • One embodiment is directed to a vector according to aspect 2 comprising a nucleotide sequence according to one of the embodiments for the method according to aspect 1 and a nucleotide sequence according to one of the embodiments for the method according to aspect 1, which are operatively linked together.
  • a further aspect is directed to the use of a recombinant B. methanolicus strain MGA3 for the production of ALA or Herne, wherein the genome of the recombinant B. methanolicus comprises at least one recombinant nucleotide sequence, of which a part of this recombinant nucleotide sequence codes for at least one HemA protein and which is expressed.
  • HemA protein related non-recombinant microorganism Compared to the level of expression of the gene in the comparable, based on this gene non-recombinant microorganism is increased.
  • An example of one on HemA protein related non-recombinant microorganism is B. methanolicus strain MGA3.
  • Another example of a HemA protein related non-recombinant microorganism is e.g. A recombinant strain MGA3, but whose genome has a vector based on a HemA nucleotide sequence.
  • overexpressed in one embodiment also encompasses the possibility that overexpression may be due to the introduction of multiple copies of a HemA nucleotide sequence or the introduction of one or more HemA nucleotide sequences which are not subject to transcriptional repression, eg caused by mutation or Elimination of recognition elements for transcriptional repression, or use of promoters that are not subject to transcriptional regulation, which normally control the expression of HemA genes in a microorganism.
  • Gene expression is to be understood here in view of the additionally produced amount of protein which can be determined by the use of methods known in the art.
  • a method for determining the promoter activity is z.
  • B. The use of constructs comprising green fluorescence protein (GFPuv) operatively linked to a promoter.
  • the constructs can be transformed into B. methanolicus cells and the resulting amount of GFPuv can be determined by flow cytometry.
  • the fluorescence intensity thus measured corresponds to the gene expression rate in the corresponding cells operatively linked to the corresponding promoter.
  • the expression can also be determined by determining and comparing the HemA protein activity of a recombinant one related to the production of HemA protein and one related to the production of HemA protein non-recombinant culture.
  • the amount of ALA produced from both cultures can be determined. Possibly. must be inhibited in such an assay HemB.
  • the additional activity can be determined and thus each inferred to the expression.
  • a gene or genes are "operably linked" to a promoter when expression of that gene or genes is triggered by this promoter.
  • production refers to the production of a protein that is due to the overexpression of a recombinant gene encoding that protein.
  • recombinant microorganism in the context of the present invention refers to a microorganism into which nucleotide sequences have been introduced by genetic engineering methods.
  • recombinant nucleotide sequences are understood to mean nucleotide sequences which have been introduced into a (then recombinant) microorganism by genetic engineering methods.
  • a "recombinant nucleotide sequence" in the context of the present invention refers to an artificial DNA molecule , which was assembled in vitro by genetic engineering.
  • An example of a recombinant nucleotide sequence is a plasmid, e.g. B. was first isolated from bacterial cells and incorporated into the further nucleotide sequences.
  • the further nucleotide sequences may be derived from different organisms or synthesized in vitro (eg by means of chemical oligonucleotide synthesis, or enzymatically by means of polymerase chain reaction (PCR)).
  • a recombinant protein is produced from recombinant DNA.
  • a "recombinant" protein in the context of the present invention is understood as meaning a protein which is encoded by a recombinant nucleotide sequence and is expressed in a recombinant microorganism (via).
  • non-native promoter refers to a promoter that is not a native promoter for B. methanolicus for a gene coding for B. methanolicus HemA protein (HemA gene) (ie no native, functional).
  • HemA gene a promoter that is not a native promoter for B. methanolicus for a gene coding for B. methanolicus HemA protein (HemA gene) (ie no native, functional
  • HemA gene ie no native, functional
  • the use of a non-native promoter may have the beneficial effect of disallowing transcriptional repression of the expression of HemA protein-encoding gene (s), since at least some of the recognition elements for Such a promoter, which is part of a recombinant nucleotide sequence, can be from another organism or derived from B. methanolicus, as long as it is not functionally functional in B.
  • methanolicus as a native promoter with a HemA gene that is, as a native promoter in B. methanolicus controls genes other than a HemA gene (not natively with respect to a HemA gene). Gene in B. methanolicus).
  • HemA protein is a protein which has glutamyl-tRNA reductase activity
  • the source of this enzyme or the source of the corresponding nucleotide sequence encoding this enzyme can be derived from any known source, including those known from the literature Enzymes and organisms that have nucleotide sequences that encode a HemA protein
  • Non-limiting examples for HemA proteins, the proteins used herein are SEQ ID NOS: 1 and SEQ ID NO: 3.
  • Fig. 1 shows the increase in fluorescence caused by the overproduction of a GFPuv protein operatively linked to an mp promoter (optimized green fluorescence protein) in B. methanolicus strain MGA3.
  • MGA3 pHTI mp
  • MGA3 without a gene operatively linked to a recombinant mp promoter.
  • MGA3 pTHI mp-gfpyv
  • MGA3 is a recombinant B.
  • methanolicus strain MGA3 with a GFPuv-encoding nucleotide sequence operatively linked to a recombinant mp promoter nucleotide sequence in the presence of 200 mM methanol and 50 mM mannitol, respectively.
  • the fluorescence measured in the presence of mannitol is background fluorescence to be subtracted.
  • Figure 2 shows the increase in fluorescence caused by the overproduction of a GFPuv protein operatively linked to an xpx promoter in B. methanolicus strain MGA3.
  • MGA3 pTH1mp-gfpuv
  • MGA3 pTHIxpx-gfpw
  • MGA3 pTHIxpx-gfpw
  • Fig. 3 shows the increase in fluorescence caused by the overproduction of a GFPuv protein operatively linked to a m2p promoter in B. methanolicus strain MGA3.
  • MGA3 pTH1 m2p-gfpt / ⁇
  • Fig. 5 shows the production increase of ALA in recombinant B. methanolicus strain MGA3 with pTH1 mp - /? Em> A (WT) at zinc ion concentrations in the range below 1 ⁇ (0.01 ⁇ , 0.1 ⁇ , 1 ⁇ , 10 ⁇ and 100 ⁇ ).
  • WT pTH1 mp - /? Em> A
  • SEQ ID NO .: 1 refers to a nucleotide sequence from a wild type of B. methanolicus which codes for a glutamyl-tRNA reductase (HemA ⁇ 'sequence):
  • AAAC GATG AAAAG CATTG AAAGAAAGTTG CCTAACTTAACTG AACGTG AAAAG AAAGT
  • SEQ ID NO: 2 refers to an amino acid sequence from a wild type of B. met anolicus encoded by SEQ ID NO: 1:
  • SEQ ID NO .: 3 refers to a mutant nucleotide sequence from B. methanolicus encoding a glutamyl-tRNA reductase (HemA (M) sequence):
  • AAAT AAAT
  • SEQ ID No .: 4 refers to an amino acid sequence from B. methanolicus encoded by SEQ ID NO .: 3:
  • SEQ ID No .: 5 refers to primer 1 according to Table 1 (GFAF):
  • SEQ ID No .: 6 refers to primer 2 according to Table 1 (GFPR):
  • SEQ ID No .: 7 refers to primer 3 according to Table 1 (P43F):
  • SEQ ID No .: 8 refers to primer 4 according to Table 1 (P43R):
  • SEQ ID No .: 9 refers to primer 5 according to Table 1 (XPFW):
  • SEQ ID No .: 10 refers to primer 6 according to Table 1 (XPRW):
  • SEQ ID NO: 1 refers to primer 7 according to Table 1 (GXRW): ACGACGGCCAGTGAATTCGAGCTCTTATTTGTAGAGCTCATCCA SEQ ID No .: 12 refers to primer 8 according to Table 1 (GXXF):
  • SEQ ID No .: 13 refers to primer 9 according to Table 1 (MGAF):
  • SEQ ID No .: 14 refers to primer 10 according to Table 1 (MGR2):
  • SEQ ID No .: 15 refers to primer 1 1 according to Table 1 (HAMF):
  • SEQ ID No .: 16 refers to primer 12 according to Table 1 (HAMR):
  • SEQ ID NO: 17 refers to primer 13 according to Table 1 (HMMF):
  • SEQ ID No .: 18 refers to the nucleotide sequence of a xylose-inducible promoter (xpx) from B. megaterium:
  • SEQ ID No .: 19 refers to the nucleotide sequence of a mannitol inducible promoter (m2p):
  • SEQ ID NO: 20 refers to the nucleotide sequence of a methanol dehydrogenase promoter from B. methanolicus (mp): GTTCATTAAAGAGCAGCTGATGATGACTTTAATCCGTGTTCTTGTGCATAAGTTTGAGCA
  • the problem underlying the invention is achieved by a process for the preparation of aminolevulinic acid (ALA) from methanol in recombinant bacteria, preferably in recombinant Gram-positive bacteria, even more preferably in recombinant B. methanolicus, wherein the genome of the recombinant bacterium, preferably the recombinant Gram-positive bacterium, more preferably the recombinant B. methanolicus, comprises a recombinant nucleotide sequence, part of which recombinant nucleotide sequence encodes at least one HemA protein which in these recombinant bacteria, preferably in these recombinant Gram-positive bacteria, more preferably in this recombinant B. methanolicus is expressed.
  • ALA aminolevulinic acid
  • the method is a method of producing aminolevulinic acid (ALA) from methanol in recombinant bacteria, preferably recombinant Gram-positive bacteria, more preferably recombinant B.
  • methanolicus which comprises a recombinant nucleotide sequence, part of which recombinant Nucleotide sequence for a HemA protein and in which this recombinant HemA protein is produced, comprising the step of incubating this recombinant B.
  • methanolicus in a nutrient medium at at least 40 ° C for example: in Range of 40 ° C and 70 ° C, more preferably in the range of 45 ° C and 65 ° C, even more preferably in the range of 45 ° C and 60 ° C such.
  • B. 50 ⁇ 5 ° C or 50 ⁇ 4 ° C wherein the nutrient medium comprises methanol as a carbon source.
  • a process according to the invention is preferably a process for preparing aminolevulinic acid (ALA) from methanol in recombinant bacteria, preferably recombinant Gram-positive bacteria, even more preferably in recombinant B.
  • methanolicus which comprise a recombinant nucleotide sequence, part of which recombinant nucleotide sequence encoding a HemA protein, and in which said recombinant nucleotide sequence encoding a HemA protein is expressed and said recombinant HemA protein is produced, comprising the step of incubating said recombinant B.
  • methanolicus in a nutrient medium at least 40 ° C e.g., in the range of 40 ° C and 70 ° C, more preferably in the range of 45 ° C and 65 ° C, even more preferably in the range of 45 ° C and 60 ° C such as 50 ⁇ 5 ° C or 50 ⁇ 4 ° C
  • the nutrient medium comprising methanol as the carbon source.
  • the recombinant nucleotide sequence of the bacteria described herein additionally comprises a promoter nucleotide sequence operably linked to at least one recombinant nucleotide sequence encoding a HemA protein.
  • sequence coding for a protein HEMA nucleic sequence is a nucleotide sequence produced using primers 1 1/12 ⁇ HEMA)) or 13/12 ⁇ hemA) shown in Table 1 from genomic DNA from B. methanolicus strain MGA3.
  • the nucleic acid sequence coding for a HemA protein in a method according to the invention is a nucleotide sequence according to SEQ ID No .: 1 or SEQ ID No .: 3.
  • a method according to the invention comprises the step
  • the incubation temperature is at least 45 ° C.
  • the incubation temperature is at least 47 ° C.
  • the incubation temperature is a maximum of 70 ° C.
  • the temperature range in which the bacteria, preferably Gram-positive bacteria, more preferably B. methanolicus is incubated is in the range of 40 ° C and 70 ° C, more preferably in the range of 45 ° C and 65 ° C, even more preferably in the range of 45 ° C and 60 ° C such. 50 ⁇ 5 ° C or 50 ⁇ 4 ° C.
  • the concentration of methanol at the beginning of the incubation is in the range of 50 mM and 500 mM, more preferably in the range of 100 mM and 500 mM, e.g. In the range of 150 mM and 500 mM, in the range of 150 mM and 300 mM or in the range of 150 mM and 250 mM.
  • bacterium B. methanolicus particularly preferred is the recombinant bacterium B. methanolicus.
  • the recombinant B. methanolicus is maintained for a period in the range of 4 to 48 hours, more preferably for a period in the range of 12 to 48 hours, for a period in the range of 18 and 48 hours or in the range of 18 to 24 hours, incubated.
  • the invention also encompasses a process for the production of aminolevulinic acid (ALA) from methanol in a recombinant B. methanolicus according to the invention, comprising the step of inserting a nucleotide sequence into said B. methanolicus wherein the nucleotide sequence comprises a nucleotide sequence which codes for a HemA protein and overexpressed, and wherein this recombinant HemA protein encoded by this nucleotide sequence is overproduced.
  • ALA aminolevulinic acid
  • overexpression is preferably carried out by a promoter nucleotide sequence which is operatively linked to the nucleotide sequence which codes for a HemA protein and is introduced into the B. methanolicus together with the nucleotide sequence which codes for a HemA protein.
  • a method according to the invention comprises the four steps:
  • the temperature in this first incubation step is in the range of 50 ⁇ 5 ° C.
  • the incubation can be interrupted in the meantime also to z.
  • the initial methanol concentration in the nutrient medium is in the range of 20 mM and 500 mM, more preferably in the range of 180 mM and 220 mM, e.g. B. 200 ⁇ 5 mM.
  • Transferring in this context means either adding nutrient medium to the existing liquid bacterial culture of 1), adding the liquid bacterial culture of 1) or part of the liquid bacterial culture of 1) to a nutrient medium according to 2) (eg separation 1) or converting (part of) the liquid bacterial culture from 1) into a nutrient medium.)
  • concentration may be increased after adding the new medium or after adding (a part of) the bacterial culture 1) can be determined by methods known to those skilled in the art (eg gas chromatography) .
  • the methanol concentration may already be initially introduced into the nutrient medium 2) or during or after mixing the nutrient medium from 2) with (a part of) the bacterial culture from FIG ) can be adjusted by adding methanol.
  • the initial concentration of bacterial culture in the new medium in step 2 is an OD 6 oo value in the range of 0.02 to 0.8, more preferably in the range of 0.05 and 0.6, even more preferably in the range of 0.05 to 0.4, such as. In the range of 0.075 to 0.25 or 0.1 and 0.2.
  • the ingredients of the nutrient medium are the same as in the nutrient medium in the first step with the deviation that the methanol concentration is possibly higher.
  • the initial methanol concentration of the nutrient medium in the second step is in the range of 200 ⁇ 50 mM, such as 200 mM.
  • the incubation temperature is in the range of 50 ⁇ 5 ° C.
  • the duration of the incubation is in the range of 8 and 48 hours, such as. In the range of 10 and 28 hours or in the range of 24 and 26 hours.
  • the incubation is carried out until an OD 6 oo value in the range of 1 to 12, preferably in the range of 3 to 10, more preferably in the range of 5 and 9 is reached.
  • the components of the nutrient medium in step 2) and 3) are the same components of the nutrient medium as in step 1, z. B. an MVcMY medium.
  • the volume of the nutrient medium in step 2) or 3) is at least twice, at least three times, more preferably at least four times or at least five times greater than the volume of the nutrient medium in step one.
  • a preferred embodiment is directed to a method according to the invention wherein the overexpression of a nucleotide sequence coding for a HemA protein in a recombinant B. methanolicus is operatively linked to a nucleotide sequence coding for a HemA protein, preferably for the HemA gene in B methanolicus non-native, promoter is achieved.
  • a nucleotide sequence coding for a HemA protein preferably for the HemA gene in B methanolicus non-native, promoter is achieved.
  • promoter p43 a constitutively expressed in B. subtilis promoter, z. Example, with the help of the primer 3/4 according to Table 1 from pTHp43-gfpuv can be obtained, is an example of an inappropriate promoter.
  • Methanol dehydrogenase promoters e.g. B. a methanol dehydrogenase promoter from B. methanolicus (mp).
  • Plasmids with an mp promoter (which is the expression of nucleotide sequence-controlling promoter in B. methanolicus coding for methanol dehydrogenase but which is not native to B. methanolicus nucleotide sequences coding for HemA protein) may e.g. B. using the plasmid pTH1 mp- / ysC be prepared.
  • pTH1 mp- / ysC and vector produced by Peil pTM mp are z.
  • a preferred mp promoter has SEQ ID No .: 20,
  • xylose-inducible promoters e.g. B. a xylose inducible promoter (xpx) from B. megaterium according to SEQ ID No .: 18,
  • mannitol-inducible promoters e.g. B. a mannitol inducible promoter (m2p) according to SEQ ID No .: 19
  • xylose-inducible promoters such as B. an xpx promoter according to SEQ ID No .: 18.
  • an mp promoter can be in B methanolicus, preferably B. methanolicus strain MGA3, in the presence of methanol, the expression of a gene operatively linked to this promoter, z. B. a HemA nucleotide sequence or GFPuv nucleotide sequence, by at least a factor of 1, 5 increase compared with non-methanol-tropic conditions (see also Fig. 1 methanol vs mannitol).
  • the concentration of methanol in the nutrient medium in a method according to the invention is at least 10 mM, more preferably at least 20 mM, even more preferably at least 30 mM or at least 100 mM or at least 150 mM.
  • the concentration of methanol in the nutrient medium in a method according to the invention is at least 10 mM, more preferably at least 100 mM, even more preferably at least 30 mM and is at most 800 mM, more preferably at most 500 mM, such as. B. a maximum of 300 mM or a maximum of 250 mM.
  • a xylose-inducible promoter preferably an xpx promoter, particularly preferably an xpx promoter according to SEQ ID No .: 18, can be in B. methanolicus, preferably B. methanolicus strain MGA3, in the presence of xylose, the expression of an operatively with this Promoter linked gene, z.
  • B. HemA nucleotide sequence or GFPuv nucleotide sequence by at least a factor of 10 (ten), more preferably by at least a factor of 30 (thirty) increase compared with B. methanolicus, preferably B.
  • methanolicus strain MGA3 in a media without xylose or compared to a (recombinant) B. methanolicus, preferably B. methanolicus strain MGA3, in which no gene is operatively linked to a recombinant promoter (see also Fig. 2).
  • the concentration of xylose is preferably in a nutrient medium for a recombinant B. methanolicus, preferably B. methanolicus strain MGA3, comprising a xylose Inducible promoter in a range of 0.01 wt.%, in each case based on the medium to 3 wt.%, More preferably in a range of 0.75 wt.% And 2.5 wt.%, Even more preferably in a range of 0.1% by weight and 2% by weight
  • a m2p promoter By using a m2p promoter can be in B. methanolicus, preferably B. methanolicus strain MGA3, in the presence of mannitol, the expression of a gene operatively linked to this promoter by at least a factor 6 increase compared to media without mannitol (see Fig. 3).
  • the concentration of mannitol is in a nutrient medium for a recombinant B. methanolicus, preferably B. methanolicus strain MGA3, comprising a mannitol inducible promoter in a range of 20 mM and 150 mM, more preferably 25 mM and 100 mM.
  • the nutrient medium used may be any nutrient medium suitable for B. methanolicus.
  • Nutrient media for Gram-positive bacteria and in particular B. methanolicus are well known (see, for example, Brautaset et al. ((2007) Appl. Microbiol. Biotechnol., 74: 22-34).
  • the nutrient medium preferably comprises not more than 20% by weight, more preferably not more than 10% by weight, even more preferably not more than 5% by weight of further carbon sources, based on the concentration of methanol in the nutrient medium.
  • the nutrient medium preferably comprises not more than 5% by weight, more preferably not more than 3% by weight, even more preferably not more than 2.5% by weight, particularly preferably not more than 2% by weight of xylose or mannitol as further carbon sources relative to the nutrient medium.
  • B. methanolicus preferably B. methanolicus strain MGA3, which comprises a vector comprising a promoter nucleotide sequence and an operatively linked nucleotide sequence coding for a HemA protein, can be achieved (see FIG ).
  • the concentration of zinc ions in a nutrient medium, more preferably Zn 2+ ions, in a nutrient medium at the beginning of the incubation period of a recombinant B. methanolicus in the sense of the present invention is in the range of 0.002 ⁇ and 0.2 ⁇ , more preferably in the range of 0.005 ⁇ and 0.15 ⁇ , such as. In the range of 0.01 ⁇ and 0.1 ⁇ (see Fig. 5).
  • a preferred embodiment is directed to a method or a recombinant B. methanolicus, wherein the recombinant nucleotide sequence encompassed by the genome of the recombinant B. methanolicus, a nucleic acid according to SEQ ID NO. 1, or a nucleotide sequence having at least 80% identity with SEQ ID NO. 1, more preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO.1, and their encoded amino acid sequence thereby has the activity of a glutamyl-tRNA reductase, or a nucleotide sequence encoding the completeness of SEQ ID NO.
  • a further preferred embodiment is directed to a method or a recombinant B. methanolicus, wherein the nucleotide sequence, which is comprised by the genome of the recombinant B. methanolicus, a nucleic acid according to SEQ ID NO. 3, or a nucleotide sequence having at least 80% identity with SEQ ID NO. 3, more preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO. 3, and whose encoded amino acid sequence in this case has the activity of a glutamyl-tRNA reductase, or a nucleotide sequence which is compatible with the completeness of SEQ ID NO.
  • the glutamyl-tRNA reductase is preferably of an amino acid sequence which is characterized by a nucleic acid sequence with at least 80%, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO. 1, at least 50%, more preferably at least 60%, of the activity of an amino acid sequence represented by a nucleotide sequence according to SEQ ID NO. 1 is encoded.
  • the glutamyl-tRNA reductase is preferably of an amino acid sequence which is characterized by a nucleic acid sequence with at least 80%, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO. 3, at least 50%, more preferably at least 60%, of the activity of an amino acid sequence represented by a nucleotide sequence according to SEQ ID NO. 3 is coded.
  • the glutamyl-tRNA reductase activity of an amino acid sequence which is at least 80%, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO. 2, in each case at least 50%, more preferably at least 60% of the activity of an amino acid sequence according to SEQ ID NO. Second
  • the glutamyl-tRNA reductase activity of an amino acid sequence which is at least 80%, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO. 4, in each case at least 50%, more preferably at least 60% of the activity of an amino acid sequence according to SEQ ID NO. 4th
  • a further preferred embodiment is directed to a recombinant B. methanolicus, wherein the recombinant nucleotide sequence encompassed by the genome of the recombinant B. methanolicus comprises, in addition to at least one of the nucleotide sequences SEQ ID No .: 1 or 3, a promoter nucleotide sequence, preferably one Nucleotide sequence according to SEQ ID No .: 18, 19, or 20.
  • the desired nucleotide sequences can be introduced into a desired bacterium, preferably B.methymicus, by methods of introducing genes or nucleotide sequences which are well known in the art and are widely described in the literature.
  • the gene (the nucleotide sequence) can be amplified using a vector that includes an autonomously-replicating vector or a vector that integrates the gene (the nucleotide sequence) into the host genome (eg, chromosome).
  • the gene (nucleotide sequence) to be expressed may first be introduced into an expression vector and the expression vector may then be introduced into the host cell.
  • Methods of constructing expression vectors and introducing these expression vectors into host cells are well known in the art.
  • a nucleotide sequence coding for a HemA protein can be transformed using a plasmid vector and a host microorganism, preferably B. methanolicus, for example by electroporation.
  • the host body may be prepared under
  • Conditions are increased and cultivated, which allow to produce ALA using a suitable starting material such as methanol.
  • the host cells can therefore be in
  • Presence of the substrate or a source of the substrate e.g. In one
  • the substrate or carbon source used for ALA production may be any suitable substrate of choice and will depend on the microorganism that is used.
  • the substrate is preferably not sugar but C1 compounds (eg.
  • Methanol or methane Methanol or methane
  • organic acids eg acetates
  • amino acids eg glutamate
  • complex starting materials such as molasses or protein hydrolysates.
  • Substrates replace the poly- or monosaccharides (e.g., glucose) known in the art.
  • the substrate may be in purified or "isolated” form or as part of a crude or unrefined or partially refined mixture, for example a byproduct of a other commercial or industrial process.
  • a methylotroph such as B. methanolicus
  • methanol can be used as a substrate.
  • B. methanolicus strain MGA3 can only utilize mannitol, glucose, arabitol and methanol. In another preferred embodiment, mixtures of methanol and mannitol may be used as the substrate.
  • another embodiment is also directed to a method according to the invention in which instead of methanol mannitol is used as a substrate.
  • the present invention also relates to a vector, preferably a pTH1 vector, comprising an insert, wherein the insert comprises a nucleotide sequence coding for a promoter according to the preferred promoters described herein and a nucleotide sequence coding for a HemA protein.
  • the present invention also encompasses a recombinant microorganism, preferably a Gram-positive bacterium, more preferably B. methanolicus, wherein the genome of the recombinant B. methanolicus comprises at least one recombinant nucleotide sequence of which a part of this recombinant nucleotide sequence encodes at least one HemA protein and which is expressed in the microorganism.
  • the recombinant nucleotide sequence comprises a promoter nucleotide sequence operably linked to the recombinant nucleotide sequence encoding at least one HemA protein. Most preferably, this is a preferred promoter nucleotide sequence as described herein.
  • Primer 1 used: No Name Primer Annealing Length Product
  • vector pTHI mp was used.
  • the vector is a modified pHP13
  • Plasmid. pHP13 is described in Haima et al., 1987.
  • the vector pTHI mp was z. In Markert et al. (BMC Microbiology, 2014, 14: 7: 1 -1 1).
  • the vector pTHI mp has a resistance gene against chloramphenicol.
  • E. coli DH5a Isolation of plasmid pTHI mp from E. coli DH5a cultures was performed by GeneJet Plasmid Miniprep Kit (Thermo Scientific) at 25 ° C.
  • E. coli DH5a with the appropriate plasmid were mixed with lysis solution of the miniprep kit and 5 min. incubated. The lysis was stopped by addition of neutralization solution of the miniprep kit, centrifuged at 13,000 rpm, and the supernatant was added to a spin column of the miniprep kit and centrifuged for 1 min. After washing twice with washing solution, the plasmid DNA was eluted with water. The concentration of DNA was determined by Nanodrop ND-1000 spectrophotometer.
  • a Biotechrabbit PCR kit was used to amplify the inserts for the plasmid constructs.
  • the following protocol for PCR 50 ⁇ reaction, 10 ⁇ 5 PCR Helper, 5 ⁇ 10 x Pfu Reaction buffer, 1 ⁇ 10 mM dNTP mix, each 1, 5 ⁇ forward / reverse primer, 1 ⁇ DNA template, 1 ⁇ Pfu DNA polymerase (2.5 ⁇ / ⁇ ), 29 ⁇ water) was used:
  • the plasmids were digested with restriction enzyme from Thermo Scientific (2 ⁇ buffer 10x, 2 ⁇ restriction enzyme, 1 ⁇ g plasmid DNA, 20 l water) at 37 ° C for 3 h.
  • restriction enzymes from Thermo Scientific (2 ⁇ buffer 10x, 2 ⁇ restriction enzyme, 1 ⁇ g plasmid DNA, 20 l water) at 37 ° C for 3 h.
  • the following restriction enzymes were used
  • the amplified PCR products, DNA extracted from agarose gels and digested DNA were purified using a kit from Macherey and Nagel GmbH, Germany, following a standard procedure.
  • the cells were incubated in 5 ml SOBsuc medium for 6 h and then transferred into 50 ml SOBsuc medium with 5 ⁇ g ml chloramphenicol and for a further 16 hr incubated. Thereafter, the cells are centrifuged and plated on SOBsuc plates with 5 ug ml chloramphenicol and incubated for 24-48 h at 50 ° C.
  • the overnight culture was further incubated in 50 ml MVcMY medium with 200 mM methanol until an OD 6 oo in the range of 1, 0 and 1, 5 was reached. 2 ml of glycerol (86%) were added to each 10 ml of culture, divided into 1 ml aliquots and frozen.
  • ALA concentration 1 ml of cell culture supernatant of a corresponding cell culture was admixed with 1 ml of acetate buffer and 0.2 ml of ethyl acetoacetate and incubated for 10 min. heated to 100 ° C.
  • ALA and ethyl acetoacetate condense to 2-methyl-3-carbethoxy-4- (3-propionic acid) -pyrrole.
  • 3 ml of ethyl acetate were added and the product was extracted.
  • the concentration of the pyrrole was determined calorimetrically at 552 nm after addition of a modified Ehrlich's reagent (P-dimethylaminobenzaldehyde).
  • a standard curve (1 mg / l, 5 mg / l, 10 mg / l, 15 mg / l, 20 mg / l) was prepared using an aqueous ALA solution (Sigma Company).
  • the calibration curve was linear in the range of 1 mg / L to 20 mg / L.
  • the concentration of pyrrole corresponded to the concentration of ALA in the respective samples.
  • constructs from the promoter and the GFPuv gene were used.
  • the fluorescence intensity of GFPuv in appropriately prepared cell cultures was determined by flow cytometry.
  • Recombinant B. methanolicus containing plasmids with the GFPuv gene were under the influence of different promoters each in 50 ml MVcMY medium at 5 ug / ml Chloramphenicol inoculated and incubated for 12 h. Then the cultures were transferred to fresh MVcMY medium. The volume of the cultures was then adjusted so that the final OD 6 oo was 0.15. After culturing at 50 ° C for 6 hours, it was then incubated at 37 ° C for two hours. Samples were at 13000 g for 5 min. centrifuged at 4 ° C, washed twice with ice-cold PBS and then resuspended therein until the OD 6 oo was 0.3.
  • the fluorescence emission signal was collected with a 450/50 BP bandpass filter (FL9) for GFPuv and with a 620/30 BP bandpass (FL3) for mCherry.
  • the subsequent data analysis was performed using Kaluza Analysis Software 1.3.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un procédé de production microbienne d'acide aminolévulinique à partir de méthanol. L'invention concerne également des microorganismes recombinants qui surexpriment HemA.
PCT/EP2017/072284 2016-09-08 2017-09-06 Procédés et agents de production microbienne d'acide aminolévulinique WO2018046512A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102016116794.0A DE102016116794A1 (de) 2016-09-08 2016-09-08 Verfahren und Mittel zur Herstellung von Aminolävulinsäure
DE102016116794.0 2016-09-08

Publications (1)

Publication Number Publication Date
WO2018046512A1 true WO2018046512A1 (fr) 2018-03-15

Family

ID=59858706

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/072284 WO2018046512A1 (fr) 2016-09-08 2017-09-06 Procédés et agents de production microbienne d'acide aminolévulinique

Country Status (2)

Country Link
DE (1) DE102016116794A1 (fr)
WO (1) WO2018046512A1 (fr)

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH05184376A (ja) 1992-01-17 1993-07-27 Shimizu Corp ５−アミノレブリン酸の生産方法
JPH0735984A (ja) 1993-07-26 1995-02-07 Mitsutoyo Corp 光学測定機の照明装置
JPH07135984A (ja) * 1993-06-24 1995-05-30 Chikyu Kankyo Sangyo Gijutsu Kenkyu Kiko ５−アミノレブリン酸の製法
WO1998008954A2 (fr) * 1996-08-30 1998-03-05 Somatogen, Inc. Production d'heme et d'hemoproteines de recombinaison
US6110713A (en) 1993-03-23 2000-08-29 Regents Of The University Of Minnesota Production of glutamic acid and lysine using auxotrophic mutants of Bacillus methanolicus
US20070134760A1 (en) * 2003-10-31 2007-06-14 Novozymes A/S Method for stable gene-amplification in a bacterial host cell
EP2297329A1 (fr) 2008-05-20 2011-03-23 Sinvent AS Procédé de production de l-lysine
WO2015165841A1 (fr) * 2014-04-28 2015-11-05 Novartis Ag Procédé sans antibiotique de sélection de bactéries transformées
DE112014000710T5 (de) * 2013-02-07 2015-11-12 Tianjin Institute Of Industrial Biotechnology, Chinese Academy Of Sciences Bakterienstamm mit hoher Ausbeute an 5-Aminolävulinsäure, Herstellungsverfahren und Verwendungen dafür

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH05184376A (ja) 1992-01-17 1993-07-27 Shimizu Corp ５−アミノレブリン酸の生産方法
US6110713A (en) 1993-03-23 2000-08-29 Regents Of The University Of Minnesota Production of glutamic acid and lysine using auxotrophic mutants of Bacillus methanolicus
JPH07135984A (ja) * 1993-06-24 1995-05-30 Chikyu Kankyo Sangyo Gijutsu Kenkyu Kiko ５−アミノレブリン酸の製法
JPH0735984A (ja) 1993-07-26 1995-02-07 Mitsutoyo Corp 光学測定機の照明装置
WO1998008954A2 (fr) * 1996-08-30 1998-03-05 Somatogen, Inc. Production d'heme et d'hemoproteines de recombinaison
US20070134760A1 (en) * 2003-10-31 2007-06-14 Novozymes A/S Method for stable gene-amplification in a bacterial host cell
EP2297329A1 (fr) 2008-05-20 2011-03-23 Sinvent AS Procédé de production de l-lysine
DE112014000710T5 (de) * 2013-02-07 2015-11-12 Tianjin Institute Of Industrial Biotechnology, Chinese Academy Of Sciences Bakterienstamm mit hoher Ausbeute an 5-Aminolävulinsäure, Herstellungsverfahren und Verwendungen dafür
WO2015165841A1 (fr) * 2014-04-28 2015-11-05 Novartis Ag Procédé sans antibiotique de sélection de bactéries transformées

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
BRAUTASET ET AL., APPL. MICROBIOL BIOTECHNOL, vol. 87, 2010, pages 951 - 964
BRAUTASET ET AL., APPL. MICROBIOL. BIOTECHNOL., vol. 74, 2007, pages 22 - 34
CUE ET AL., APPL. ENVIRON. MICROBIOL., vol. 63, 1997, pages 1406 - 1420
HEGGESET ET AL., APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 78, no. 15, August 2012 (2012-08-01), pages 5170 - 5181
HEGGESET TONJE M B ET AL: "Genome Sequence of Thermotolerant Bacillus methanolicus: Features and Regulation Related to Methylotrophy and Production of L-Lysine and L-Glutamate from Methanol", APPLIED AND ENVIRONMENTAL MICROBIOLOGY,, vol. 78, no. 15, 1 August 2012 (2012-08-01), pages 5170 - 5181, XP002694287, ISSN: 0099-2240, DOI: 10.1128/AEM.00703-12 *
JAKOBSEN ET AL., J. BACTERID., vol. 188, no. 8, 2006, pages 3063 - 3072
MARKERT ET AL., BMC MICROBIOLOGY, vol. 14, no. 7, 2014, pages 1 - 11
NAERDAL ET AL., MICROBIAL BIOTECHNOLOGY, 2015, pages 342 - 350
SCHAUER S ET AL: "Escherichia coli glutamyl-tRNA reductase. Trapping the thioester intermediate", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY, vol. 277, no. 50, 13 December 2002 (2002-12-13), pages 48657 - 48663, XP002729688, ISSN: 0021-9258, [retrieved on 20021004], DOI: 10.1074/JBC.M206924200 *
SCHENDEL ET AL., APPL. ENVIRON. MICROBIOL., vol. 58, no. 9, 1992, pages 2806 - 2814
TRYGVE BRAUTASET ET AL: "Plasmid-dependent methylotrophy in thermotolerant Bacillus methanolicus", vol. 186, no. 5, 1 March 2004 (2004-03-01), pages 1229 - 1238, XP002694286, ISSN: 0021-9193, Retrieved from the Internet <URL:http://jb.asm.org/content/186/5/1229> DOI: 10.1128/JB.186.5.1229-1238.2004 *
VERKAMP E ET AL: "ISOLATION, NUCLEOTIDE SEQUENCE, AND PRELIMINARY CHARACTERIZATION OFTHE ESCHERICHIA COLI K-12 HEMA GENE", JOURNAL OF BACTERIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 171, no. 9, 1 September 1989 (1989-09-01), pages 4728 - 4735, XP002054091, ISSN: 0021-9193 *
ZHANG ET AL., SCIENTIFIC REPORTS, vol. 8584, 2015

Also Published As

Publication number Publication date
DE102016116794A1 (de) 2018-03-08

Similar Documents

Publication Publication Date Title
DE60025976T2 (de) DNA die für eine mutierte Isopropylmalatsynthase kodiert, Microorganismus, das L-Leucin produziert, und Verfahren zur Herstellung von L-Leucin
DE69928845T2 (de) Methode zur Herstellung von L-Serin mittels Fermentation
EP2181195B1 (fr) Production d&#39;acétone par fermentation à partir de matières premières renouvelables, par nouvelle voie métabolique
DE19610984A1 (de) Alkohol-Dehydrogenase und deren Verwendung zur enzymatischen Herstellung chiraler Hydroxyverbindungen
WO2005010182A1 (fr) Transformant de bacterie coryneforme et procede de production d&#39;acide dicarboxylique au moyen de celui-ci
EP1700864A1 (fr) Procédé pour la production de S-adénosylméthionine par fermentation
WO2008148640A1 (fr) Production microbiologique d&#39;aldéhydes, notamment de 3-hydroxy propionaldéhyde
DE19818541C2 (de) Mikrobielle Herstellung von Substanzen aus dem aromatischen Stoffwechsel / III
DE19812004A1 (de) Dehydrogenasen mit verbesserter NAD-Abhängigkeit, deren Herstellung und Verwendung
EP2609207A1 (fr) Biotransformation de cellule entière d&#39;acides nucléiques pour obtenir des aldéhydes gras ayant un atome de carbone en moins
WO2010075960A2 (fr) Procédé de production de riboflavine
EP1924694B1 (fr) Procede de production d&#39;acides amines par des micro-organismes
DE102007021001A1 (de) Expressionssystem zur antibiotikafreien Produktion von Polypeptiden
US7696333B1 (en) Promoter in the presence of organic acid and utilization thereof
WO2018046512A1 (fr) Procédés et agents de production microbienne d&#39;acide aminolévulinique
DE112019000467T5 (de) Rekombinanter Mikroorganismus, Verfahren zu dessen Herstellung und seine Anwendung bei der Herstellung von Coenzym Q10
Tomiyama et al. Characteristics of newly isolated nitrifying bacteria from rhizoplane of paddy rice
DE102012216904A1 (de) Verfahren zur Isomerisierung von (R)-3-Hydroxycarbonsäuren zu 2-Hydroxy-2-methylcarbonsäuren
DE69920470T2 (de) Neuartiges gen und transformant, welcher dieses beinhaltet
DE69938427T2 (de) An der herstellung von homo-glutaminsäure beteiligtes gen und dessen verwendung
EP1104810A1 (fr) Procédé pour la préparation de L-lysine par fermentation en utilisant les bactéries corynéformes
DE102005049527B4 (de) Verfahren zur Herstellung von L-Serin, Gensequenz, Vektoren sowie Mikroorganismus
EP0792933A2 (fr) Enzyme ayant une activité LeuDH, séquence nucléotidique l&#39;encodant et procédé pour la préparation de cette enzyme
DE102021004449A1 (de) Protein-basierter Wachstumsinhibitor in Bakterien
WO2023111055A1 (fr) 3-désoxyarabinoheptulosonate-7-phosphate synthase particulièrement appropriée pour la production fermentative d&#39;acide ortho-aminobenzoïque

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17765396

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17765396

Country of ref document: EP

Kind code of ref document: A1