WO2018021805A1 - 자궁 유래 성체줄기세포 분리 및 제조 방법 - Google Patents

자궁 유래 성체줄기세포 분리 및 제조 방법 Download PDF

Info

Publication number
WO2018021805A1
WO2018021805A1 PCT/KR2017/008012 KR2017008012W WO2018021805A1 WO 2018021805 A1 WO2018021805 A1 WO 2018021805A1 KR 2017008012 W KR2017008012 W KR 2017008012W WO 2018021805 A1 WO2018021805 A1 WO 2018021805A1
Authority
WO
WIPO (PCT)
Prior art keywords
stem cells
medium
adult stem
cells
uterine
Prior art date
Application number
PCT/KR2017/008012
Other languages
English (en)
French (fr)
Inventor
유승권
박정현
조금준
송권화
장지훈
전은경
홍원준
Original Assignee
고려대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 고려대학교 산학협력단 filed Critical 고려대학교 산학협력단
Publication of WO2018021805A1 publication Critical patent/WO2018021805A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/32—Amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/34—Sugars
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/38—Vitamins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2509/00—Methods for the dissociation of cells, e.g. specific use of enzymes

Definitions

  • the present invention relates to a method for isolating multipotent mesenchymal stem cells (MSCs) from cells collected from a woman's uterus using a PAP-smear test.
  • MSCs multipotent mesenchymal stem cells
  • Stem cells are cells that have the ability to form parts of the body by differentiating them into various cells that make up the body in response to a specific stimulus, and are capable of self-proliferating cells.
  • Embryonic stem cells ES cells
  • EG cells embryonic germ cells isolated from embryonic primordial germ cells
  • MAPC cells multipotent adult progenitors isolated from adult bone marrow and fat. cell, MAPC cells
  • Stem cells have the ability to develop into cells with specialized functions specific to organs, and thus are being studied as cell and tissue resources for the treatment of lost organs. Previous studies to date, for example, adult stem cells are known to have the ability to differentiate into a variety of cells.
  • Adult stem cells include bone marrow (Science 276, 71-74, 1997; Science 284, 143-147, 1999; Science 287, 1442-1446, 2000), skeletal muscle (Proc. Natl Acad. Sci USA 96, 14482-14486,1999; Nature 401, 390-394, 1999) and Fat tissue (Tissue Eng 7, 211-228, 2001; J. Cell. Physiol. 206, 229-237, 2006 ) And amniotic fluid (Hum Reprod 18: 1489-1493, 2003), each of which can differentiate into similar lines.
  • Mesenchymal stem cells derived from bone marrow a type of adult stem cell, have been used for a long time and various effects have been demonstrated. It has also been found that cells isolated from adipose tissue or amniotic fluid have similar properties to bone marrow-derived mesenchymal stem cells.
  • Another object of the present invention is to provide a method for separating adult stem cells from cells obtained from the uterus.
  • Still another object of the present invention is to provide a method for differentiating uterine derived adult stem cells into adipocytes, osteocytes or chondrocytes.
  • the present invention provides uterine derived adult stem cells comprising the following features:
  • (b) has the ability to differentiate into mesodermal derived cells.
  • the uterine derived adult stem cells may be mesenchymal stem cells (MSCs) isolated from cells obtained from the mother's cervix, endometrium or vagina, but are not limited thereto.
  • MSCs mesenchymal stem cells
  • MSCs meenchymal stem cells
  • the present inventors have tried to develop a new source of adult stem cells, allogeneic cells having the same shape as the fibroblasts, which are characteristic of mesenchymal stem cells, from cell samples taken through the PAP-smear test from the female uterus. (homogenous) mesenchymal stem cells were identified and separated.
  • the mesenchymal stem cells isolated from the cell sample collected from the uterus in the present specification is “medium-derived mesenchymal stem cells” or mesenchymal stem cells obtained using PAP SMEAR TEST, so "PAP-MSC (PAP smear mesenchymal stem) cells) ".
  • PAP-smear test is referred to as Papanicolo test, Pap smear, Pap test, Papanicolo test.
  • tests are performed to detect and diagnose various conditions such as cancer of the sexual system and precancerous conditions (cancer of the vagina, cervix, endometrium) by collecting cells from the cervix, endometrium or vagina of women.
  • mesenchymal stem cells have surface antigen markers that distinguish them from other cells. According to the International Society of Cellular Therapy, human mesenchymal stem cells are positive for CD29, CD44, CD71, CD90 and CD120a and negative for hematopoietic lineage or endothelial lineage markers such as CD31, CD34 and CD45. It is known to look. Uterine-derived mesenchymal stem cells of the present invention also confirmed that having the immunophenotyping characteristics of the mesenchymal stem cells of the general human was confirmed that the cells isolated from the uterus is mesenchymal stem cells.
  • Uterine-derived adult stem cells or mesenchymal stem cells of the present invention may have a differentiation capacity of mesoderm-derived cells, and more specifically, may have differentiation ability into adipocytes, osteocytes or chondrocytes.
  • DMEM Dulbecco's Modified Eagle's medium
  • FBS Fat bovine serum
  • antibiotics antibiotics
  • L-Glutamine growth factors and vitamins
  • It provides a, uterine derived adult stem cells or mesenchymal stem cells isolation method.
  • Uterine-derived adult stem cells or mesenchymal stem cells isolated by the above method may exhibit the following characteristics.
  • (ii) has the ability to differentiate into mesodermal derived cells.
  • Obtaining a sample from the uterus in step (a) can easily obtain a cell sample from the cervix, endometrium or vagina using the PAP-smear test, but is not limited thereto.
  • the low glucose Dulbecco's Modified Eagle's medium (DMEM) medium of step (b) may be more specifically composed of 10% Fat bovine serum (FBS), 2% penicillin / straptomycin / amphotericin and 1% L-Glutamine. have.
  • FBS Fat bovine serum
  • penicillin / straptomycin / amphotericin 1% L-Glutamine. have.
  • RPMI 1640 medium of the step (d) may be more specifically composed of 10% FBS, 2% penicillin / streptomycin / amphotericin and 1% L-glutamine.
  • Low glucose DMEM (Dulbecco's Modified Eagle's medium) medium of step (e) is more specifically 10% FBS (Fatal bovine serum), 2% penicillin / streptomycin / amphotericin, 1% L-Glutamine, 20ng / ml It can be composed of bFGF and 50ug / ml Vitamin C.
  • the mesoderm-derived somatic cells may be adipocytes, osteocytes or chondrocytes, but is not limited thereto.
  • the uterine derived adult stem cells or mesenchymal stem cells can be cultured in adipocyte differentiation induction medium for 5 to 10 days to differentiate into adipocytes.
  • the adipocyte differentiation induction medium is FBS, dexamethasone, insulin, 3- Low glucose DMEM medium composed of isobutyl-1-methylxanthine, biotin and pantothenate.
  • the uterine derived adult stem cells or mesenchymal stem cells comprising 10% FBS, 5uM dexamethasone, 10ug / ml insulin, 0.5mM 3-isobutyl-1-methylxanthine, 33uM biotin and 17uM pantothenate
  • the medium is changed every 2 days and cultured for 7 days to differentiate into adipocytes.
  • the adult uterine stem cells or mesenchymal stem cells can be cultured in osteoblast differentiation induction medium for 10-20 days to differentiate into osteocytes.
  • the osteoblast differentiation induction medium is FBS, dexamethasone and beta-gly It may be a low glucose DMEM medium composed of serophosphate. More specifically, the uterine-derived adult stem cells or mesenchymal stem cells are changed to medium once every 2 days in low glucose DMEM medium conditions containing 10% FBS, 5 mM dexamethasone, 10 mM beta- glycerophosphate 14 days Can be differentiated into bone cells.
  • the uterine-derived adult stem cells or mesenchymal stem cells can be cultured in chondrocyte differentiation inducing medium for 15 to 25 days to differentiate into chondrocytes.
  • the chondrocyte differentiation inducing medium is ITS premix, dexamethasone, and TGF- ⁇ . It may be a high glucose DMEM medium. More specifically, the uterine-derived adult stem cells or mesenchymal stem cells are changed to the medium once every two days under high glucose DMEM medium conditions containing 10% ITS premix, 100 nM dexamethasone, and 10 ng / ml TGF- ⁇ . Can be cultured for differentiation into chondrocytes.
  • the present invention by culturing the cells obtained from the uterus or vagina using the PAP-smear test in vitro can be expected to be utilized as adult multipotent stem cells, it is possible to secure a large amount of resources through continuous in vitro culture
  • the composition of the medium has been established, and in particular, the growth and differentiation ability is excellent, which will be useful for treating various diseases.
  • Figure 1 illustrates the overall process for separating PAP-MSC and morphology of the attached cells by incubating cells derived from the initial PAP-smear Test for 72h in a cell culture dish.
  • Figure 2 shows the yield of PAP-MSC from cell samples taken from 29 maternal uterus via PAP-smear TEST.
  • Figure 3 shows the result of comparing the morphology of AF-MSC and PAP-MSC and accumulated PDL up to 12 passages to confirm the self-renewal ability.
  • Figure 4 is to determine whether the expression of HLA-G cell surface markers specifically expressed in the chromosome karyotype and fetal cells of the cell line to determine whether the PAP-MSC derived from the mother's womb is derived from the fetus or mother.
  • Figure 5 shows the results of performing Colony forming assay for comparing the stem cell capacity of AF-MSC and PAP-MSC.
  • Figure 6a-c shows the results of FACS analysis to confirm the immunophenotypic characteristics of AF-MSC and PAP-MSC.
  • Figure 7 shows the differentiation of fat cells through oil-red-O staining and RT-PCR after differentiation into adipocytes from PAP-MSC: LPL, aP2 is a unique marker of adipocytes.
  • Figure 8 shows the differentiation of bone cells through Von Kossa staining and RT-PCR after differentiation into osteoblasts from PAP-MSC: Osteopontin, Osteocalcin is a unique marker of osteocyte.
  • Figure 9 shows the differentiation of cartilage cells through Alcian blue staining and RT-PCR after differentiation into chondrocytes from PAP-MSC: Collagen type I, Aggrecan is a unique marker of chondrocyte.
  • Cell samples were taken from the uterus (including the cervix, endometrium and vagina) using the PAP-smear TEST from the mother.
  • the obtained cell samples were prepared using low glucose DMEM (Dulbecco's Modified Eagle's medium) medium with 10% Fat bovine serum (FBS), 2% penicillin / straptomycin / amphotericin, and 1% L-Glutamine (A ) Was suspended. Thereafter, the cells were washed with PBS containing 2% penicillin / straptomycin / amphotericin and then centrifuged at 1000 rpm for 5 minutes to obtain cell pellets. The obtained pellets were then used as a medium composition used in primary cell culture, i.e.
  • DMEM Denbecco's Modified Eagle's medium
  • FBS Fat bovine serum
  • penicillin / straptomycin / amphotericin 1% L-Glutamine
  • 20ng / ml bFGF 20ng / ml bFGF
  • medium 20ng / ml bFGF
  • FIG. 1 Low glucose DMEM (Dulbecco's Modified Eagle's medium) medium, 10% Fat bovine serum (FBS), 2% penicillin / straptomycin / amphotericin, 1% L-Glutamine, 20ng /
  • the medium is changed once every two days using the medium condition (C) to induce cell growth, and when the cell confluence is grown to 100%, passaging with another cell culture dish is performed. Proceeded. The passage was washed with PBS, treated with Trypsin / EDTA 0.05% or accutase, followed by incubation for 1 minute, followed by the addition of 10% FBS, (A) or (C) medium. After inactivation, centrifugation was performed at 1000 rpm for 3 minutes, the cell pellet was separated by 1/3, and then seeded with 100 mm cell culture dish.
  • C medium condition
  • PAP-smear TEST was performed in mothers of various gestational ages and ages.
  • the present inventors performed a total of 29 mothers and were able to obtain PAP-MSC from six samples of the collected cell samples.
  • two groups of enzymatic digestion and two groups of enzymatic digestion and two groups of enzymatic digestion and four of 15 samples that did not enzymatic digestion were identified.
  • In vitro culture confirmed that enzymatic digestion did not significantly affect (FIG. 2).
  • the cell samples obtained through the PAP-smear TEST may contain cells from both the mother and the fetus, it was necessary to confirm whether the cells are from the mother or the fetus.
  • one of the cell lines used in Example 3 was randomly identified with a karyotype (FIG. 4).
  • the sex chromosome was identified as XX, indicating the possibility of being a mother-derived cell.
  • HLA-G a cell surface marker expressed only in fetal cells, was confirmed in each cell (FIG. 4).
  • the absence of HLA-G expression was confirmed by FACS analysis and immunofluorescence, demonstrating that the origin of the cell is the parent.
  • CFU Coldy forming unit
  • MSCs mesenchymal stem cells
  • BD FACS calibur analysis BD Biosciences, San Jose, CA
  • PAP-MSC PAP-MSC obtained in Example 2 was removed from the plate, and then each 1st antibody was attached, followed by attaching 2nd antibody (Fluorescence antibody).
  • the 2nd antibody used IGG of origin of each antibody and Cy3 tagged.
  • adipogenic ability of general MSC was identified. To do this, cell culture was performed in a medium capable of differentiating into a specific lineage, and AF-MSC was used as a positive control. In detail, after incubation with 100% confluence cells according to Example 1 adipocyte differentiation induction medium (Low glucose DMEM, 10% FBS, 5uM dexamethasone, 10ug / ml insulin, 0.5mM 3-isobutyl-1-methylxanthine , 33uM biotin, 17uM pantothenate) medium was changed every 2 days and cultured for 7 days (1 week).
  • adipocyte differentiation induction medium Low glucose DMEM, 10% FBS, 5uM dexamethasone, 10ug / ml insulin, 0.5mM 3-isobutyl-1-methylxanthine , 33uM biotin, 17uM pantothenate
  • Adipose cell detection was detected by Oil-red-O staining, a fat-soluble dye (Refer to Yoon et al. (Stem cells and development, 19 (6), 2010)) and fat-specific expression via RT-PCR. Markers (LPL (Forward: TTGCCACCTCATTCCCGGAGTA, SEQ ID NO: 1; Reverse: TGATAAACCGGGCCACATCCTG, SEQ ID NO: 2), aP2 (Forward: GGGTGTCCTGGTACATGTGC, SEQ ID NO: 3; Reverse: CATGACGCATTCCACCACCA, SEQ ID NO: 4)) were identified. As a result, the oil-red-O staining was confirmed that the fat droplets were colored as in the positive control, and it was confirmed that the fat-specific expression markers were normally expressed (FIG. 7).
  • the Osteogenic ability of general MSC was identified. To do this, cell culture was performed in a medium capable of differentiating into a specific lineage, and AF-MSC was used as a positive control. Specifically, cultured with 100% confluence cells according to Example 1, and then cultured once every two days under the condition of osteoblast differentiation induction medium (Low glucose DMEM, 10% FBS, 5mM dexamethasone, 10mM beta-glycererophosphate) Cultivated for 14 days (2 weeks).
  • osteoblast differentiation induction medium Low glucose DMEM, 10% FBS, 5mM dexamethasone, 10mM beta-glycererophosphate
  • the Chondrogenic ability of general MSC was identified. To do this, cell culture was performed in a medium capable of differentiating into a specific lineage, and AF-MSC was used as a positive control.
  • the PAP-MSC obtained according to Example 1 was dispensed into 15 ml polypropylene tubes and centrifuged to form pellets. Pellet had a white opaque appearance and changed the medium every 2 days under the condition of chondrocyte differentiation induction medium (High glucose DMEM, 10% ITS premix, 100nM dexamethasone, 10ng / ml TGF- ⁇ ). Cultured for 1 week).

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Microbiology (AREA)
  • Rheumatology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 자궁 경부 유래 성체줄기세포 및 이를 분리/배양하는 방법에 관한 것이다. 보다 구체적으로는 PAP-smear TEST를 이용하여 자궁 경부 및 질로부터 다량의 세포를 획득하고 이로부터 성체줄기세포를 분리하고 특정 배지 조성을 통해 체외 배양이 가능하도록 한다.

Description

자궁 유래 성체줄기세포 분리 및 제조 방법
본 발명은 PAP-smear test를 이용하여 여성의 자궁으로부터 채취한 세포로부터 다분화 중간엽 줄기세포(Multipotent mesenchymal stem cell, MSC)를 분리하고 그 제조방법에 관한 것이다.
줄기세포(stem cell)는 특정 자극에 대해 반응하여 신체를 구성하는 각종 세포로 분화하여 신체의 부분을 구성할 수 있는 능력을 갖추고 있으며, 세포 자가증식 능력을 갖추고 있는 세포로, 초기 배아에서 분리한 배아 줄기세포(embryonic stem cell, ES 세포), 배아기의 원시 생식세포에서 분리한 배아 생식세포(embryonic germ cell. EG 세포), 및 성체의 골수 및 지방에서 분리한 다능성 성체줄기세포(multipotent adult progenitor cell, MAPC 세포)등이 잘 알려져 있는 줄기세포 종류이다.
줄기세포는 장기 고유의 특화된 기능을 가지는 세포로 발달할 수 있는 능력을 가지고 있으므로, 손실된 장기의 치료를 위한 세포 및 조직자원으로서 연구의 대상이 되고 있다. 현재까지의 선행 연구를 예를 들면 성체줄기세포는 여러 가지 세포로 분화할 수 있는 능력을 가지고 있다고 알려져 있다. 성체줄기세포는 골수(bone marrow) (Science 276, 71-74, 1997; Science 284, 143-147, 1999;Science 287, 1442-1446, 2000), 골격근(skeletal muscle) (Proc. Natl Acad. Sci. USA 96, 14482-14486,1999; Nature 401, 390-394, 1999)과 지방조직(Fat tissue) (Tissue Eng 7, 211-228, 2001; J. Cell.Physiol. 206, 229-237, 2006), 양수(Amniotic fluid) (Hum Reprod 18:1489-1493, 2003)에서 분리하였으며, 이들은 각각 유사한 계통으로 분화가 가능하다.
성체 줄기세포의 종류인 골수에서 유래한 중간엽 줄기세포는 오래전부터 사용되어 오고 있고 다양한 효과도 입증이 되었다. 또 지방조직이나 양수에서 분리한 세포들도 골수유래 중간엽 줄기세포와 유사한 특성을 가지고 있다는 것이 밝혀지고 있다.
채취하기 쉬운 조직으로부터 중간엽 줄기세포를 얻기 위한 연구를 계속적으로 시도하여 오고 있으며, 본 발명자들은 여성의 자궁 경부암을 진단하기 위한 PAP SMEAR TEST를 이용하여 자궁으로부터 채취한 세포로부터 다분화 성체줄기세포를 분리함으로써 본 발명을 완성하였다.
Science 276, 71-74, 1997; Science 284, 143-147, 1999;Science 287, 1442-1446, 2000
Proc. Natl Acad. Sci. USA 96, 14482-14486,1999; Nature 401, 390-394, 1999
Tissue Eng 7, 211-228, 2001; J. Cell.Physiol. 206, 229-237, 2006
본 발명의 목적은 자궁 유래 성체줄기세포를 제공하는데 있다.
본 발명의 다른 목적은 자궁으로부터 수득한 세포로부터 성체줄기세포를 분리하는 방법을 제공하는데 있다.
본 발명의 또 다른 목적은 자궁 유래 성체줄기세포를 지방세포, 골세포 또는 연골세포로 분화시키는 방법을 제공하는데 있다.
본 발명은, 다음의 특징을 포함하는 자궁 유래 성체줄기세포를 제공한다:
(a) CD29, CD44, CD71, CD90 및 CD120a 에 대하여 양성의 면역학적 특성을 나타내고, CD31, CD34 및 CD45 에 대하여 음성의 면역학적 특성을 나타냄; 및
(b) 중배엽 유래 세포로 분화하는 능력을 가짐.
상기 자궁 유래 성체줄기세포는 산모의 자궁 경부, 자궁 내막 또는 질에서 수득한 세포로부터 분리된 중간엽 줄기세포(mesenchymal stem cells; MSCs)일 수 있고, 이제 제한되는 것은 아니다.
본 발명에서 용어, "중간엽 줄기세포(mesenchymal stem cells; MSCs)"라 함은 연골, 뼈, 지방, 골수간질, 근육, 신경 등을 만드는데 원조가 되는 세포로서, 성인에서는 일반적으로 골수에 머물러 있지만 제대혈, 말초혈액, 기타 조직 등에도 존재하며, 이들로부터 수득할 수 있는 세포를 의미한다.
본 발명자들은 성체줄기세포의 새로운 소스(source)를 개발하고자 노력한 결과, 여성의 자궁으로부터 PAP-smear test를 통해 채취한 세포 샘플로부터 그 중에서 중간엽 줄기세포의 특징인 섬유아세포와 같은 모양을 가지는 동종(homogenous)의 중간엽 줄기세포를 확인하여 분리하였다. 이와 같이 자궁으로부터 채취한 세포 샘플로부터 분리된 중간엽 줄기세포를 본 명세서에서는 "자궁 유래 중간엽 줄기세포" 또는 PAP SMEAR TEST를 이용하여 수득한 중간엽 줄기세포이므로 "PAP-MSC(PAP smear mesenchymal stem cells)"로 지칭될 수 있다.
본 명세서에서 사용되는 용어 "PAP-smear test"는 파파니콜로검사, 자궁경부질세포진검사, 팝시험, 파파니콜로시험로 지칭된다. 특히 여성의 자궁 경부, 자궁 내막 또는 질로부터 세포를 채취하여 성기계(性器系)의 암과 전암상태 등의 각종 상태(질, 자궁 경부, 자궁내막의 암)를 검출 및 진단하기 위해 행하는 테스트를 말한다.
일반적으로 알려진 중간엽 줄기세포는 다른 세포와 구별되는 표면항원마커를 보유하고 있다. 세포치료국제협회(International society of cellular therapy)에 따르면 인간의 중간엽 줄기세포는 CD29, CD44, CD71, CD90 및 CD120a에 양성 발현을 보이며 CD31, CD34 및 CD45와 같이 hematopoietic lineage나 endothelial lineage 마커에는 음성 발현을 보이는 것으로 알려져 있다. 본 발명의 자궁 유래 중간엽 줄기세포 역시 상기 일반적인 인간의 중간엽 줄기세포의 면역표현형 특성을 가짐을 확인함으로써 자궁으로부터 분리된 세포가 중간엽 줄기세포임을 확인할 수 있었다.
본 발명의 자궁 유래 성체줄기세포 또는 중간엽 줄기세포는 중배엽 유래 세포의 분화능을 가질 수 있고, 보다 구체적으로는 지방세포, 골세포 또는 연골세포로의 분화 능력을 가질 수 있다.
또한, 본 발명은
(a) 자궁으로부터 샘플을 수득하는 단계;
(b) 상기 수득된 샘플을 FBS(Fatal bovine serum), 항생제 및 L-Glutamine로 조성된 Low glucose DMEM(Dulbecco’s Modified Eagle’s medium) 배지에서 배양하는 단계;
(c) 상기 배양한 샘플을 원심분리하여 세포 펠렛을 확보하는 단계;
(d) FBS, 항생제 및 L-glutamine이 포함된 RPMI 1640 배지에서 상기 확보된 세포 펠렛을 재현탁한 후, 재현탁한 세포를 시딩(seeding)하는 단계; 및
(e) 상기 시딩된 세포를 배양한 후, FBS(Fatal bovine serum), 항생제, L-Glutamine, 성장인자 및 비타민을 포함하는 DMEM(Dulbecco’s Modified Eagle’s medium) 배지로 트랜스퍼하여 배양하는 단계;
를 포함하는, 자궁 유래 성체줄기세포 또는 중간엽 줄기세포 분리방법을 제공한다.
상기 방법에 의해 분리된 자궁 유래 성체줄기세포 또는 중간엽 줄기세포는 다음과 같은 특성을 나타낼 수 있다.
(i) CD29, CD44, CD71, CD90 및 CD120a 에 대하여 양성의 면역학적 특성을 나타내고, CD31, CD34 및 CD45 에 대하여 음성의 면역학적 특성을 나타냄; 및
(ii) 중배엽 유래 세포로 분화하는 능력을 가짐.
상기 (a) 단계에서 자궁으로부터 샘플을 수득하는 것은 PAP-smear test를 이용하여 자궁 경부, 자궁 내막 또는 질로부터 세포 샘플을 손쉽게 얻을 수 있고, 이에 제한되는 것은 아니다.
상기 (b) 단계의 Low glucose DMEM(Dulbecco’s Modified Eagle’s medium) 배지는 보다 구체적으로 10% FBS(Fatal bovine serum), 2% 페니실린/스트랩토마이신/암포테라신 및 1% L-Glutamine로 조성될 수 있다.
상기 (d) 단계의 RPMI 1640 배지는 보다 구체적으로 10% FBS, 2% 페니실린/스트랩토마이신/암포테라신 및 1% L-glutamine로 조성될 수 있다.
상기 (e) 단계의 Low glucose DMEM(Dulbecco’s Modified Eagle’s medium) 배지는 보다 구체적으로 10% FBS(Fatal bovine serum), 2% 페니실린/스트랩토마이신/암포테라신, 1% L-Glutamine, 20ng/ml bFGF 및 50ug/ml Vitamin C로 조성될 수 있다.
상기 방법에 의해 분리된 성체줄기세포에 대한 특성에 대한 구체적인 사항은 상술한 바와 같다.
아울러 본 발명은,
자궁 유래 성체줄기세포 또는 중간엽 줄기세포를 중배엽 유래 체세포로 분화시키는 방법을 제공한다.
보다 구체적으로, 상기 중배엽 유래 체세포는 지방세포, 골세포 또는 연골세포일 수 있고, 이에 제한되는 것은 아니다.
상기 자궁 유래 성체줄기세포 또는 중간엽 줄기세포를 지방세포 분화 유도 배지에서 5 내지 10일간 배양하여 지방세포로 분화시킬 수 있고, 구체적으로, 상기 지방세포 분화 유도 배지는 FBS, 덱사메타손, 인슐린, 3-이소부틸-1-메틸잔틴, 바이오틴 및 판토테네이트로 조성된 Low glucose DMEM 배지일 수 있다. 보다 구체적으로, 상기 자궁 유래 성체줄기세포 또는 중간엽 줄기세포를 10% FBS, 5uM 덱사메타손, 10ug/ml 인슐린, 0.5mM 3-이소부틸-1-메틸잔틴, 33uM 바이오틴 및 17uM 판토테네이트를 포함하는 Low glucose DMEM 배지 조건에서 2일에 1번씩 배지를 바꿔주며 7일동안 배양하여 지방세포로 분화시킬 수 있다.
상기 자궁 유래 성체줄기세포 또는 중간엽 줄기세포를 골세포 분화 유도 배지에서 10 내지 20일간 배양하여 골세포로 분화시킬 수 있고, 구체적으로, 상기 골세포 분화 유도 배지는 FBS, 덱사메타손 및 베타-글라이세로포스페이트로 조성된 Low glucose DMEM 배지일 수 있다. 보다 구체적으로, 상기 자궁 유래 성체줄기세포 또는 중간엽 줄기세포를 10% FBS, 5mM 덱사메타손, 10mM 베타-글라이세로포스페이트를 포함하는 Low glucose DMEM 배지 조건에서 2일에 1번씩 배지를 바꿔주며 14일동안 배양하여 골세포로 분화시킬 수 있다.
상기 자궁 유래 성체줄기세포 또는 중간엽 줄기세포를 연골세포 분화 유도 배지에서 15 내지 25일간 배양하여 연골세포로 분화시킬 수 있고, 구체적으로, 상기 연골세포 분화 유도 배지는 ITS premix, 덱사메타손 및 TGF-β로 조성된 High glucose DMEM 배지일 수 있다. 보다 구체적으로, 상기 자궁 유래 성체줄기세포 또는 중간엽 줄기세포를 10% ITS premix, 100nM 덱사메타손, 10ng/ml TGF-β를 포함하는 High glucose DMEM 배지 조건에서 2일에 1번씩 배지를 바꿔주며 21일동안 배양하여 연골세포로 분화시킬 수 있다.
본 발명에 따르면, PAP-smear test이용하여 자궁 또는 질로부터 획득한 세포들을 체외에서 배양함으로써 성체 다분화능 줄기세포로의 활용을 기대할 수 있음을 확인하였고, 지속적인 체외 배양을 통해 자원의 다량 확보가 가능한 배지의 조성을 확립하였으며 특히 성장능 및 분화능이 뛰어나 각종 질병의 치료에 유용할 것이다.
도 1은 PAP-MSC를 분리하기 위한 전반적인 과정의 모식화 및 초기 PAP-smear Test에서 유래한 세포를 Cell culture dish에 72h 동안 배양하여 attachment된 세포의 morphology를 나타낸 것이다.
도 2는 PAP-smear TEST를 통해 29명의 산모의 자궁으로부터 채취한 세포 샘플로부터 PAP-MSC의 수득률을 나타낸 것이다.
도 3은 AF-MSC와 PAP-MSC의 morphology적 비교와 자가재생능을 확인하기 위한 12계대까지의 accumulated PDL 비교한 결과를 나타낸 것이다.
도 4는 산모의 자궁으로부터 유래한 PAP-MSC가 태아 유래인지 산모 유래인지 확인하기 위해 세포주의 염색체 karyotype 및 태아세포에서 특이적으로 발현되는 세포 표면 마커인 HLA-G의 발현여부를 확인한 것이다.
도 5는 AF-MSC와 PAP-MSC의 줄기세포능을 비교하기 위한 Colony forming assay를 수행한 결과를 나타낸 것이다.
도 6a-c는 AF-MSC와및 PAP-MSC의 면역표현형 특징을 확인하기 위한 FACS analysis 결과를 나타낸 것이다.
도 7은 PAP-MSC로부터 지방세포로의 분화 후 Oil-red-O staining과 RT-PCR을 통한 지방세포로의 분화능을 확인한 것이다: LPL, aP2는 adipocyte의 고유 마커.
도 8은 PAP-MSC로부터 골세포로의 분화 후 Von Kossa staining과 RT-PCR을 통한 골세포로의 분화능을 확인한 것이다: Osteopontin, Osteocalcin은 osteocyte의 고유 마커.
도 9는 PAP-MSC로부터 연골세포로의 분화 후 Alcian blue staining과 RT-PCR을 통한 연골세포로의 분화능을 확인한 것이다: Collagen type I, Aggrecan은 chondrocyte의 고유 마커.
이하, 본 발명을 실시예에 의거하여 보다 구체적으로 설명하고자 한다. 그러나 하기 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐 본 발명이 하기 실시예에 한정되는 것은 아니다.
<실시예 1> 자궁 유래 중간엽 줄기세포(PAP-MSC)의 분리
산모로부터 PAP-smear TEST를 이용하여 자궁(자궁 경부, 자궁 내막 및 질 포함)으로부터 세포 샘플을 채취하였다. 수득된 세포 샘플을 Low glucose DMEM(Dulbecco’s Modified Eagle’s medium) 배지를 기본으로 10% FBS(Fatal bovine serum), 2% 페니실린/스트랩토마이신/암포테라신, 1% L-Glutamine로 조성된 배지(A)에 현택시켰다(suspension). 이 후 2% 페니실린/스트랩토마이신/암포테라신이 포함되어 있는 PBS로 세포 Washing을 진행한 후 1000rpm에서 5분간 원심분리를 진행하여 세포 펠렛(pellet) 확보하였다. 그 다음 확보된 펠렛을 Primary 세포 배양에서 사용되는 배지 조성물, 즉 RPMI 1640 배지를 기본으로 10% FBS, 2% 페니실린/스트랩토마이신/암포테라신, 1% L-glutamine이 포함된 배지(B)로 세포 펠렛을 재현탁(re-suspension)하고 재현탁된 샘플을 100mm cell culture dish에 같은 조성의 배지 10ml에 세포를 seeding하였다. 그 후 5% CO2, 37℃ 조건에서 72h동안 배양을 진행하였고, cell culture dish에 부착되어 성장하는 세포들을 확인할 수 있었다. 이를 확인한 후의 세포 배양은 Low glucose DMEM(Dulbecco’s Modified Eagle’s medium) 배지를 기본으로 10% FBS(Fatal bovine serum), 2% 페니실린/스트랩토마이신/암포테라신, 1% L-Glutamine, 20ng/ml bFGF 및 50ug/ml Vitamin C 조건의 배지(C)에서 배양하였다(도 1).
아울러, 지속적인 세포 배양을 위해서 상기 배지 조건(C)을 이용하여 2일에 1번씩 배지 교체를 진행하여 세포 성장을 유도하며 세포의 confluence가 100%로 성장된 경우, 다른 Cell culture dish로 계대 배양을 진행하였다. 상기 계대 배양은 세포를 PBS로 Washing을 진행한 후 Trypsin/EDTA 0.05% 또는 accutase를 처리한 후 1분간 incubation을 진행한 후 10% FBS가 첨가된 배지, (A) 또는 (C) 배지를 이용하여 inactivation을 유도한 뒤 1000rpm에서 3분간 원심분리를 행한 후 세포 pellet을 1/3으로 분리한 후 100mm cell culture dish로 seeding하여 진행하였다.
< 실시예 2> PAP-smear TEST를 통한 자궁 유래 중간엽 줄기세포(PAP- MSC ) 수득률 확인
PAP-MSC의 수득률을 확인하기 위해서 다양한 임신 주수 및 연령의 산모에게서 PAP-smear TEST를 시행하였다. 본 발명자가 시행한 산모는 총 29명이며 이렇게 채취한 세포 샘플 중 6개의 샘플에서 PAP-MSC를 획득할 수 있었다. 샘플을 체외 배양하는데 최적화 할 수 있도록 enzymatic digestion을 시도하는 그룹과 그렇지 않은 그룹으로 나누어 확인한 결과 enzymatic digestion을 시도한 그룹은 14개 샘플 중 2개, enzymatic digestion을 시도하지 않은 그룹은 15개 샘플 중 4개의 체외 배양이 되는 것을 보아 enzymatic digestion은 크게 영향을 미치지 않는다는 것을 확인하였다(도 2).
< 실시예 3> PAP-smear TEST를 이용하여 산모의 자궁으로부터 획득한 세포의 morphology 및 자가재생능력의 검증
지속적인 세포 성장을 상기 (C) 조성의 배지를 이용하여 배양, 섬유아세포(Fibroblast)와 닮은 중간엽 줄기세포 유사 형태의 세포를 획득하였으며 Yoon et al. (Stem cells and development, 19(6), 2010)에서 기존 확립된 양수 유래 중간엽 줄기세포(AF-MSC)와 세포 형태가 유사함을 확인하였다(도 3). 이 후 자가재생능력을 확인하기 위해서 지속적인 증식율을 APDL(accumulated population doubling level)로 측정하였다. 구체적으로, 상기 (C) 조성의 배지 배양 조건으로 획득한 세포를 12well에 3.0 X 104 세포수를 3일 간격으로 12번을 계대배양하여 증식률을 확인하였다. 그 결과 AF-MSC와 유사한 자가재생능력을 보유하고 있음을 확인할 수 있었다(도 3).
<실시예 4> PAP-MSC의 origin 확인을 위한 분석
PAP-smear TEST를 통해 수득한 세포 샘플 내에는 모체와 태아 두 개체의 세포가 모두 포함될 수 있기 때문에 모체 유래의 세포인지 태아 유래의 세포인지를 확인할 필요가 있었다. 이를 확인하기 위해 실시예 3에서 사용된 세포주 중 무작위로 1개의 세포주의 karyotype을 확인하였다(도 4). 그 결과 성 염색체가 XX로 확인되어 모체 유래의 세포일 가능성을 나타냈다. 더 정확한 유래를 확인하기 위해 태아 세포에서만 발현되는 세포 표면 마커인 HLA-G의 발현을 각 세포에서 확인하였다(도 4). 분리된 PAP-MSC에서는 HLA-G의 발현이 없음을 FACS analysis와 immunofluorescence로 확인함으로써 세포의 origin이 모체라는 것을 증명하였다.
<실시예 5> PAP-MSC의 Colony forming ability의 증명
기존 줄기세포로 알려진 대부분의 세포들은 자가재생능력과 더불어 하나의 세포에서부터 colony를 형성할 수 있는 능력이 있는 것으로 알려져 있다. 따라서 이러한 능력을 확인하기 위해서 CFU(Colony forming unit) assay를 진행하였다. 100개의 세포 수를 6well에 seeding을 진행한 후 14일 (약 2주)동안 상기 (C) 조성의 배지에서 배양을 지속한 결과, AF-MSC와 유사한 colony forming ability를 보유하고 있다는 것을 확인할 수 있었다(도 5). 이를 미루어 보았을 때 줄기세포가 가지고 있는 특성을 동일하게 PAP-MSC도 가지고 있음을 확인할 수 있었다.
< 실시예 6> FACS (Fluorescence-Activated Cell Sorting) analysis를 통한 PAP-MSC의 면역표현형 특성 확인
일반적인 중간엽 줄기세포(MSC)는 구별되는 표면항원마커를 보유하고 있다. 세포치료국제협회(International society of cellular therapy)에 따르면 인간의 MSC는 CD29, CD44, CD71, CD90, CD120a에 양성 발현을 보이며 CD31, CD34, CD45와 같이 hematopoietic lineage나 endothelial lineage 마커는 음성 발현한다. 따라서, PAP-MSC에 대해서 BD FACS calibur analysis(BD Biosciences, San Jose, CA)를 진행하여 면역표현형을 알아보았다. 실시예 2에서 획득한 PAP-MSC를 plate에서 제거한 뒤 각각의 1st antibody를 부착시킨 뒤 2nd antibody (Fluorescence antibody)를 부착하였다. 2nd antibody는 각 antibody별 origin의 IGG를 사용하였으며 Cy3가 tagging된 것을 사용하였다. Fluorescence는 FL2-H로 detection하였으며 Negative 값은 1st antibody 없이 2nd antibody만을 부착시킨 양수 유래 중간엽 줄기세포를 사용하였다. 그 결과 CD29, CD44, CD71, CD90, CD120a 면역표현형의 양성 발현을 확인하였으며 CD31, CD34, CD45는 음성 발현을 확인하였다(도 6a-c).
<실시예 7> PAP-MSC의 분화 능력 확인
7-1 : 지방세포로의 분화 가능 여부
PAP-MSC의 특성을 검증하기 위해서, 일반적인 MSC가 가지고 있는 adipogenic ability를 확인하였다. 이를 수행하기 위해서 특정 계통으로 분화가 가능한 배지에서 세포 배양을 진행하였으며, 이에 대한 양성 대조군으로써 AF-MSC를 사용하였다. 자세하게는, 실시예 1에 따라 100% confluence한 세포로 배양한 후 지방세포 분화 유도 배지(Low glucose DMEM, 10% FBS, 5uM 덱사메타손, 10ug/ml 인슐린, 0.5mM 3-이소부틸-1-메틸잔틴, 33uM 바이오틴, 17uM 판토테네이트) 조건에서 2일에 1번씩 배지를 바꿔주어 7일(1주일)동안 배양하였다.
지방세포 검출은 지용성 염색약인 Oil-red-O 염색(염색법은 Yoon et al. (Stem cells and development, 19(6), 2010)를 참조함)을 통하여 검출하였으며 RT-PCR을 통하여 지방 특이적 발현 마커(LPL(Forward : TTGCCACCTCATTCCCGGAGTA, 서열번호 1; Reverse : TGATAAACCGGGCCACATCCTG, 서열번호 2), aP2(Forward : GGGTGTCCTGGTACATGTGC, 서열번호 3; Reverse : CATGACGCATTCCACCACCA, 서열번호 4))를 확인하였다. 그 결과, Oil-red-O staining은 양성 대조군과 같이 지방 방울이 착색되는 것을 확인할 수 있었으며, 지방 특이적 발현 마커들이 정상적으로 발현하고 있는 것을 확인하였다(도 7).
7-2 : 골세포로의 분화 가능 여부
PAP-MSC의 특성을 검증하기 위해서, 일반적인 MSC가 가지고 있는 Osteogenic ability를 확인하였다. 이를 수행하기 위해서 특정 계통으로 분화가 가능한 배지에서 세포 배양을 진행하였으며, 이에 대한 양성 대조군으로써 AF-MSC를 사용하였다. 자세하게는, 실시예 1에 따라 100% confluence한 세포로 배양한 후 골세포 분화 유도 배지(Low glucose DMEM, 10% FBS, 5mM 덱사메타손, 10mM 베타-글라이세로포스페이트) 조건에서 2일에 1번씩 배지를 바꿔주어 14일(2주일)동안 배양하였다.
칼슘염 축적을 가시적으로 확인하기 위해 Von Kossa staining을 진행(Moon et al. (Stem Cells Dev 17:713-724. 2008)하였으며 PAP-MSC 세포주에서 염색된다는 것을 확인할 수 있었다. 또한 골세포 특이적인 발현 마커인 Osteopontin(Forward : AACGCGCCTTCTGATTGGGA, 서열번호 5; Reverse : TGCTTGTGGCTGTGGGTTTCA, 서열번호 6), Osteocalcin(Forward : GCAGCCTTTGTGTCCAAGCA, 서열번호 7; Reverse : AAAGCCGATGTGGTCAGCCA, 서열번호 8)을 mRNA 수준에서 확인해 본 결과 기존의 양수 유래 중간엽 줄기세포와 유사하게 분화하여 정상적으로 마커가 발현한다는 것을 확인할 수 있었다(도 8).
7-3 : 연골세포로의 분화 가능 여부
PAP-MSC의 특성을 검증하기 위해서, 일반적인 MSC가 가지고 있는 Chondrogenic ability를 확인하였다. 이를 수행하기 위해서 특정 계통으로 분화가 가능한 배지에서 세포 배양을 진행하였으며, 이에 대한 양성 대조군으로써 AF-MSC를 사용하였다. 자세하게는, 실시예 1에 따라 수득한 PAP-MSC를 15ml polypropylene tube에 분주하고 원심분리하여 pellet을 형성하였다. Pellet은 하얀 불투명한 외관을 가졌으며 이를 연골세포 분화 유도 배지(High glucose DMEM, 10% ITS premix, 100nM 덱사메타손, 10ng/ml TGF-β) 조건에서 2일에 1번씩 배지를 바꿔주어 21일(3주일)동안 배양하였다.
연골 분화를 확인하기 위해 Alcian blue staining을 진행(Yoon et al. (Stem cells and development, 19(6), 2010)하였으며 모든 세포주에서 염색된다는 것을 확인할 수 있었다. 또한 연골세포 특이적인 발현 마커인 Collagen type I(Forward : TGCTTGAATGTGCTGATGACAGGG, 서열번호 9; Reverse : TCCCCTCACCCTCCCAGTAT, 서열번호 10), Aggrecan(Forward : GGAGCATTCTGGATTTCTGG, 서열번호 11; Reverse : GACTCAAAAAGCTGGGGTGT, 서열번호 12)을 mRNA 수준에서 확인해 본 결과 기존의 양수 유래 중간엽 줄기세포와 유사하게 분화하여 정상적으로 마커가 발현한다는 것을 확인할 수 있었다(도 9).

Claims (14)

  1. 다음과 같은 특성을 포함하는, 자궁 유래 성체줄기세포:
    (a) CD29, CD44, CD71, CD90 및 CD120a 에 대하여 양성의 면역학적 특성을 나타내고, CD31, CD34 및 CD45 에 대하여 음성의 면역학적 특성을 나타냄; 및
    (b) 중배엽 유래 세포로 분화하는 능력을 가짐.
  2. 제 1항에 있어서,
    상기 자궁 유래 성체줄기세포는 산모의 자궁 경부, 자궁 내막 또는 질에서 분리된 세포로부터 유래된 중간엽 줄기세포인 것인, 자궁 유래 성체줄기세포.
  3. 제 1항에 있어서,
    상기 중배엽 유래 세포는 지방세포, 골세포 또는 연골세포인, 자궁 유래 성체줄기세포.
  4. (a) 자궁으로부터 샘플을 수득하는 단계;
    (b) 상기 수득된 샘플을 FBS(Fatal bovine serum), 항생제 및 L-Glutamine로 조성된 Low glucose DMEM(Dulbecco’s Modified Eagle’s medium) 배지에서 배양하는 단계;
    (c) 상기 배양한 샘플을 원심분리하여 세포 펠렛을 확보하는 단계; 및
    (d) FBS, 항생제 및 L-glutamine이 포함된 RPMI 1640 배지에서 상기 (c) 단계에서 확보된 세포 펠렛을 재현탁한 후, 재현탁한 세포를 시딩(seeding)하는 단계;
    를 포함하는 자궁 유래 성체줄기세포 분리방법.
  5. 제 4항에 있어서,
    (e) 상기 시딩된 세포를 배양한 후, FBS(Fatal bovine serum), 항생제, L-Glutamine, 성장인자 및 비타민을 포함하는 DMEM(Dulbecco’s Modified Eagle’s medium) 배지로 트랜스퍼하여 배양하는 단계를 더 포함하는, 자궁 유래 성체줄기세포 분리방법
  6. 제 4항에 있어서,
    상기 (b) 단계의 Low glucose DMEM(Dulbecco’s Modified Eagle’s medium) 배지는 10% FBS(Fatal bovine serum), 2% 페니실린/스트랩토마이신/암포테라신 및 1% L-Glutamine로 조성된 것인, 자궁 유래 성체줄기세포 분리방법.
  7. 제 4항에 있어서,
    상기 (d) 단계의 RPMI 1640 배지는 10% FBS, 2% 페니실린/스트랩토마이신/암포테라신 및 1% L-glutamine로 조성된 것인, 자궁 유래 성체줄기세포 분리방법.
  8. 제 5항에 있어서,
    상기 (e) 단계의 Low glucose DMEM(Dulbecco’s Modified Eagle’s medium) 배지는 10% FBS(Fatal bovine serum), 2% 페니실린/스트랩토마이신/암포테라신, 1% L-Glutamine, 20ng/ml bFGF 및 50ug/ml Vitamin C로 조성된 것인, 자궁 유래 성체줄기세포 분리방법.
  9. 제1항 또는 제2항의 자궁 경부 유래 성체줄기세포를 지방세포 분화 유도 배지에서 5 내지 10일간 배양하는 단계를 포함하는, 자궁 유래 성체줄기세포로부터 지방세포로 분화시키는 방법.
  10. 제 9항에 있어서,
    상기 지방세포 분화 유도 배지는 10% FBS, 덱사메타손, 인슐린, 3-이소부틸-1-메틸잔틴, 바이오틴 및 판토테네이트로 조성된 Low glucose DMEM 배지인 것인, 자궁 유래 성체줄기세포로부터 지방세포로 분화시키는 방법.
  11. 제1항 또는 제2항의 자궁 유래 성체줄기세포를 골세포 분화 유도 배지에서 10 내지 20일간 배양하는 단계를 포함하는, 자궁 유래 성체줄기세포로부터 골세포로 분화시키는 방법.
  12. 제 11항에 있어서,
    상기 골세포 분화 유도 배지는 10% FBS, 덱사메타손 및 베타-글라이세로포스페이트로 조성된 Low glucose DMEM 배지인 것인, 자궁 유래 성체줄기세포로부터 골세포로 분화시키는 방법.
  13. 제1항 또는 제2항의 자궁 유래 성체줄기세포를 연골세포 분화 유도 배지에서 15 내지 25일간 배양하는 단계를 포함하는, 자궁 유래 성체줄기세포로부터 연골세포로 분화시키는 방법.
  14. 제 13항에 있어서,
    상기 연골세포 분화 유도 배지는 ITS premix, 덱사메타손 및 TGF-β로 조성된 High glucose DMEM 배지인 것인, 자궁 유래 성체줄기세포로부터 연골세포로 분화시키는 방법.
PCT/KR2017/008012 2016-07-25 2017-07-25 자궁 유래 성체줄기세포 분리 및 제조 방법 WO2018021805A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20160094171 2016-07-25
KR10-2016-0094171 2016-07-25

Publications (1)

Publication Number Publication Date
WO2018021805A1 true WO2018021805A1 (ko) 2018-02-01

Family

ID=61017570

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/008012 WO2018021805A1 (ko) 2016-07-25 2017-07-25 자궁 유래 성체줄기세포 분리 및 제조 방법

Country Status (2)

Country Link
KR (1) KR20180012223A (ko)
WO (1) WO2018021805A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102312361B1 (ko) 2020-01-10 2021-10-13 박정원 자궁내막조직 수집용 카테터 및 이를 이용하여 자궁내막조직으로부터 줄기세포를 수득하는 방법

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110022759A (ko) * 2009-08-28 2011-03-08 충남대학교산학협력단 개과 동물의 양수 유래 중간엽 줄기세포 및 이를 함유하는 세포치료제
KR101138091B1 (ko) * 2011-08-31 2012-04-24 세원셀론텍(주) 중간엽 줄기세포 기본 배양 배지 조성방법, 중간엽 줄기세포 기본 배양 배지 및 이를 이용하여 배양분화된 세포치료제
US20140086887A1 (en) * 2011-05-23 2014-03-27 Ajou University Industry-Academic Cooperation Foundation Adult stem cell line introduced with hepatocyte growth factor gene and neurogenic transcription factor gene with basic helix-loop-helix motif and uses thereof
KR20150133722A (ko) * 2013-02-22 2015-11-30 푼다시온 파라 라 인베스티게이션 콘 셀루라스 매드레 유테리나스 인간 자궁 경부 줄기세포 집단 및 이의 용도
KR20150141812A (ko) * 2014-06-10 2015-12-21 메디포스트(주) 작은 크기의 줄기세포의 미백능 및 이의 용도

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110022759A (ko) * 2009-08-28 2011-03-08 충남대학교산학협력단 개과 동물의 양수 유래 중간엽 줄기세포 및 이를 함유하는 세포치료제
US20140086887A1 (en) * 2011-05-23 2014-03-27 Ajou University Industry-Academic Cooperation Foundation Adult stem cell line introduced with hepatocyte growth factor gene and neurogenic transcription factor gene with basic helix-loop-helix motif and uses thereof
KR101138091B1 (ko) * 2011-08-31 2012-04-24 세원셀론텍(주) 중간엽 줄기세포 기본 배양 배지 조성방법, 중간엽 줄기세포 기본 배양 배지 및 이를 이용하여 배양분화된 세포치료제
KR20150133722A (ko) * 2013-02-22 2015-11-30 푼다시온 파라 라 인베스티게이션 콘 셀루라스 매드레 유테리나스 인간 자궁 경부 줄기세포 집단 및 이의 용도
KR20150141812A (ko) * 2014-06-10 2015-12-21 메디포스트(주) 작은 크기의 줄기세포의 미백능 및 이의 용도

Also Published As

Publication number Publication date
KR20180012223A (ko) 2018-02-05

Similar Documents

Publication Publication Date Title
Techawattanawisal et al. Isolation of multipotent stem cells from adult rat periodontal ligament by neurosphere-forming culture system
WO2018182356A1 (ko) 중간엽줄기세포 유래 고순도, 고농도 엑소좀을 포함하는 배양액 및 이의 제조방법
Sung et al. Stemness evaluation of mesenchymal stem cells from placentas according to developmental stage: comparison to those from adult bone marrow
WO2012008813A2 (ko) 양막유래 중간엽 줄기세포 배양을 위한 배지조성물 및 이를 이용한 양막유래 중간엽 줄기세포의 배양방법
WO2010107286A2 (ko) 양수 내 태아 유래 중간엽줄기세포를 이용한 피부 상태개선용 조성물
WO2015088288A1 (ko) 트롬빈을 이용한 줄기세포 유래 엑소좀의 생성 촉진 방법
US20050118712A1 (en) Two-stage culture protocol for isolating mesenchymal stem cells from amniotic fluid
WO2015105356A1 (ko) 순수 영양막층으로부터 유래된 줄기세포 및 이를 포함하는 세포치료제
WO2013162199A1 (ko) 줄기세포 배양 배지 및 이를 이용한 줄기세포의 배양방법
WO2010126194A1 (ko) 누공 치료를 위한 자가 및 동종의 지방 유래 스트로마 줄기세포 조성물
WO2011025179A2 (en) Method of inducing the differentiation of human embryonic stem cells into mesenchymal stem cells
US20160145577A1 (en) Human multipotent embryonic stem cell-like progenitor cells
WO2016068596A1 (ko) 줄기세포 배양을 위한 배지조성물
WO2019088480A2 (ko) 에티오나마이드를 이용한 줄기세포 이동성 향상 방법
WO2010013906A2 (ko) 인간 줄기세포에서 고활성 줄기세포를 분리하는 방법 및 상기 방법에 의해 분리된 고활성 줄기 세포
CN115011553A (zh) 一种躯干神经嵴来源骨髓间充质干细胞的制备方法及用途
WO2010107285A2 (ko) 양수 내 태아 유래 중간엽줄기세포를 이용한 성장인자의 대량생산 방법
WO2012173358A2 (ko) 정소의 체세포-유래의 다능성 줄기세포, 이의 제조방법 및 이를 포함하는 발기부전 치료용 약학 조성물
WO2018021805A1 (ko) 자궁 유래 성체줄기세포 분리 및 제조 방법
WO2012008733A2 (ko) 1기 태반조직 유래 줄기세포 및 이를 함유하는 세포치료제
WO2019103528A2 (ko) 무혈청 배지 조성물
WO2012033352A2 (ko) 말과동물 양수 유래 다분화능 줄기세포 및 그 제조방법
WO2024049158A1 (ko) 말초혈액유래 줄기세포의 분리 및 배양조건과 이를 활용한 전구세포로의 분화유도
WO2013077639A1 (ko) 말과동물 양막-유래 중간엽 줄기세포
CN110592007B (zh) 一种间充质干细胞及其制备方法和应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17834747

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17834747

Country of ref document: EP

Kind code of ref document: A1