WO2017053732A2 - Composition and method for treating complement-mediated disease - Google Patents

Composition and method for treating complement-mediated disease Download PDF

Info

Publication number
WO2017053732A2
WO2017053732A2 PCT/US2016/053347 US2016053347W WO2017053732A2 WO 2017053732 A2 WO2017053732 A2 WO 2017053732A2 US 2016053347 W US2016053347 W US 2016053347W WO 2017053732 A2 WO2017053732 A2 WO 2017053732A2
Authority
WO
WIPO (PCT)
Prior art keywords
scrl
hfh
variant
vector
complement
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/053347
Other languages
English (en)
French (fr)
Other versions
WO2017053732A3 (en
Inventor
Wenchao Song
Damodar GULLIPALLI
Takashi Miwa
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Pennsylvania Penn
Original Assignee
University of Pennsylvania Penn
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP16849709.7A priority Critical patent/EP3359663A4/en
Priority to AU2016326627A priority patent/AU2016326627B2/en
Priority to CN201680064219.5A priority patent/CN108291216B/zh
Priority to RU2018114907A priority patent/RU2727411C2/ru
Priority to KR1020187011034A priority patent/KR102773865B1/ko
Priority to CA2999299A priority patent/CA2999299A1/en
Priority to CN202211039079.XA priority patent/CN115976105A/zh
Priority to JP2018515539A priority patent/JP7261583B2/ja
Priority to IL258024A priority patent/IL258024B2/en
Priority to IL296929A priority patent/IL296929B2/en
Application filed by University of Pennsylvania Penn filed Critical University of Pennsylvania Penn
Priority to US15/762,721 priority patent/US10988519B2/en
Publication of WO2017053732A2 publication Critical patent/WO2017053732A2/en
Publication of WO2017053732A3 publication Critical patent/WO2017053732A3/en
Anticipated expiration legal-status Critical
Priority to US17/156,023 priority patent/US20210171592A1/en
Priority to AU2023201582A priority patent/AU2023201582B2/en
Priority to US18/494,883 priority patent/US12180254B1/en
Priority to US18/924,426 priority patent/US20250051408A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/472Complement proteins, e.g. anaphylatoxin, C3a, C5a
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6905Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion
    • A61K47/6911Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a liposome
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14145Special targeting system for viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14171Demonstrated in vivo effect

Definitions

  • the complement system is a part of innate immunity that plays a key role in host defense.
  • Complement can be activated by three different pathways, the classical, alternative and lectin pathways.
  • the alternative pathway is unique in that it not only represents an independent pathway by which complement is activated by the "tick-over" mechanism, but also it amplifies complement activation initiated by the other two pathways.
  • the alternative pathway requires the participation of C3, factor B (fB), factor D (fD) and properdin (fP). All pathways converge at the C3 activation step from where the alternative pathway amplification loop comes into play.
  • activated complement produces three types of effector functions: opsonization of targets with C3b/iC3b/C3d to facilitate phagocytosis and clearance, production of pro-inflammatory mediators C3a and C5a, and direct cellular attack by the terminal complement activation effector C5b-9, also known as membrane attack complex (MAC).
  • MAC membrane attack complex
  • complement receptors such as CR2 on B cells and follicular dendritic cells
  • anaphylatoxin receptors C3a receptor (C3aR) and C5a receptor (C5aR) on leuckocytes such as macrophages and monocytes
  • C3aR complement receptors
  • C5aR C5a receptor
  • a number of human diseases are caused by complement dysregulation, resulting in complement-mediated autologous tissue injury.
  • the complement dysregulation may arise from mutations, either somatic or germline, in complement regulator or regulator- related genes such that these regulators no longer function normally. Examples of this category include mutations in hematopoietic stem cells of the PIG-A gene that encodes for a key enzyme in the GPI anchor biosynthesis and such mutations result in the lack of expression of DAF and CD59 on blood cells of paroysmal nocturnal hemoglobinuria (PNH) patients.
  • PNH paroysmal nocturnal hemoglobinuria
  • a second example is mutation in the membrane regulator MCP or fluid phase regulators fH or fl which render over-activation of the alternative pathway of complement in the kidney, leading to the pathogenesis of C3 glomerulopathy or atypical hemolytic uremic syndrome (aHUS).
  • aHUS atypical hemolytic uremic syndrome
  • SNP single nucleotide polymorphisms
  • Complement dysregulation may arise not only from regulatory
  • C3 nephritic factors C3 nephritic factors
  • Eculizumab a humanized mAb against complement C5 which has been approved for the treatment of PNH and aHUS.
  • Other approaches that have been described include mAbs against fB, fD, or fP, and a cyclic peptide that binds and inhibits C3.
  • the limitation of these approaches is that they require repeated and inconvenient IV dosing of patients.
  • they block the alternative pathway or terminal pathway they run the risk of compromising host defense. Indeed, patients on Eculizumab therapy have to be vaccinated against bacteria strains that cause lethal meningitis and these patients are also put on prophylactic antibiotic therapy before being treated with the approved mAb drug.
  • recombinant regulatory proteins such as soluble DAF, CR1, CRIg and proteins comprising minimal domains of fH (N-terminal short consensus repeat [SCR] 1-5 and C-terminal SCR 19-20) or fusion proteins between fH and CR2 (TT30) have been tested.
  • SCR short consensus repeat
  • TT30 fusion proteins between fH and CR2
  • large scale heterologous expression of such proteins as therapeutic drugs requires significant effort, and animal studies have shown their in vivo clearance rate after administration to be fast (Nichols EM, Barbour TD, Papp worth IY, Wong EK, Palmer JM, Sheerin NS, Pickering MC, Marchbank KJ.
  • the invention provides a recombinant vector having packaged therein an expression cassette comprising an engineered human complement regulator factor H (fH) gene operably linked to expression control sequences which direct expression thereof, wherein said hfH gene encodes a soluble hfH protein variant that retains complement regulatory function, wherein said fH variant comprises short consensus repeat (SCR) 1, 2, 3, 4, 19 and 20 and at least one of SCR7, SCR17 and/ SCR18, wherein following administration of the vector to a subject and expression, detectable plasma levels of the hfH variant are present in the subject for at least a week.
  • SCR short consensus repeat
  • the invention provides a recombinant AAV vector having packaged therein an expression cassette comprising an engineered human complement regulator factor H (fH) gene operably linked to expression control sequences which direct expression thereof, wherein said hfH gene encodes a soluble hfH protein variant that retains complement regulatory function, wherein said fH variant comprises short consensus repeat (SCR) 1, 2, 3, 4, 19 and 20, wherein following administration of the vector to a subject and expression, detectable therapeutically useful plasma levels of the hfH variant are present in the subject for at least about a month.
  • fH human complement regulator factor H
  • a pharmaceutical composition which comprises a carrier and/or excipient and a recombinant vector as described herein which expresses an fH variant.
  • a method for treating a complement related disorder by delivering to the subject a vector as described herein.
  • the complement related disorder may be, among others, membranoproliferative glomerulonephritis, atypical hemolytic uremic syndrome (aHUS), age related macular degeneration (AMD), microangiopathic haemolytic anemia, thrombocytopenia, acute renal failure, paroxysmal nocturnal hemoglobinuria (PNH), schizophrenia, ischemic stroke, and/or bacterial infections caused by recruitment of bacterial pathogens.
  • an engineered hfH variant which comprises a leader sequence and human complement receptor SCRs consisting of: (a) SCRl-4, 7, and 19-20; (b) SCRl-4, 6, 7, and 19-20; (c) SCRl-4, 7, 8, and 19-20; er (d) SCRl-4, 6, 7, 8, and 19-20; (e) SCRl-4, 17, and 19-20; (f) SCRl-4, and 18-20; (g) SCRl-4, and 17-20.
  • SCRl-4, 7, and 18-20 SCRl-4, 6, 7, and 18-20; SCRl-4, 7, 8, and 18-20; or SCRl-4, 6, 7, 8, and 18-20, SCRl-4, 7, and 17-20; SCR1- 4, 6, 7, and 17-20; SCRl-4, 7, 8, and 17-20; or SCRl-4, 6, 7, 8, and 17-20.
  • at least one glycosylation site is engineered into at least one of the SCRs.
  • one of the engineered hfH variants is pegylated.
  • a pharmaceutical composition comprising at least one type of the engineered hfH variant, a carrier and/or an excipient.
  • a composition may be used on its own, or in combination with another therapy, particularly, e.g., the vector therapy described herein.
  • FIG 1 A provides a schematic of the domain structure of mature human factor H protein.
  • FIGs IB-IE provide the nucleic acid and amino acid sequences of the leader peptide and identifies the locations of the 20 Short Consensus Repeat (SCR) domains used in generating the fH variants illustrated in the examples below.
  • SEQ ID NO: 1 provides the nucleic acid sequences;
  • SEQ ID NO: 2 provides the amino acid sequence of the signal peptide.
  • the amino acid sequences of the SCRl-20 are provided in SEQ ID NO: 3 (SCR1), 5 (SCR2), 7 (SCR3), 9 (SCR4), 11 (SCR5), 13 (SCR6), 14 (SCR7), 16 (SCR8), 17 (SCR9), 19 (SCR10), 21 (SCR11), 23 (SCR12), 25(SCR13), 27 (SCR14), 29 (SCR15), 31 (SCR16), 33 (SCR17), 35 (SCR18), 37 (SCR19), and 38 (SCR20) respectively.
  • the locations of these domains in the fH isoform 1 are based on the convention described in C. Estaller et al, Eur J Immunol. 1991 Mar; 21(3):799-802.
  • amino acids sequences between the defined SCRs are linker sequences that afford fH flexibility [SEQ ID NO: 4, 6, 8, 10, 12, 15, 18, 20, 22, 24, 26, 28, 30, 32, 34, and 36], respectively] .
  • the linker between SCR19 and SCR20 is only three amino acids (Leu-His- Pro), and thus not generated by the features in the Sequence Listing.
  • FIG 2A provides a schematic domain structure of human factor H variant containing SCRl-4, 6-8, and 19-20.
  • FIGs 2B-2C provide the nucleic acid [nt 53 - 1804 of SEQ ID NO: 41] and amino acid sequences [SEQ ID NO: 42] of the leader peptide and 9 short consensus repeat (SCR) domains of the fH variant SCRl-4, 6-8 and 19-20.
  • FIGs 3A-3B are the complete cDNA [nt 53-1804 of SEQ ID NO: 41] and 5 '- [nt 1-52 of SEQ ID NO:41] and 3 '- UTR [nt 1805 - 2068 of SEQ ID NO: 41] sequences of the human factor H truncation construct containing the leader peptide and SCRl -4, 6-8, and 19-20 (hfHl -4.678.19-20).
  • FIG 4 is the amino acid sequence of the factor H truncation construct containing the leader peptide (underlined) and SCRl-4, 6-8, 19-20 (hfHl -4.678.19-20) [SEQ ID NO: 42].
  • FIGs 5A and 5B are gels which provide confirmation of protein expression and stability of hfHl -4.678.19-20.
  • the cDNA sequence shown in Fig 2 of human fH truncation variant containing SCRl -4, 6-8, and 19-20 [SEQ ID NO: 41] was cloned into eukaryotic expression vectors which were then used to transfect HEK cells. Cell culture supernatant was used for western blot analysis to detect truncated fH protein expression.
  • Panel A Lane 1, untransfected HEK cells; Lane 2 and 3, HEK cells transfected with a pCMV Sport6 vector containing the fH truncation variant cDNA; Lane 4-6, HEK cells transfected with a pCBARBG vector containing the fH variant cDNA.
  • the pCBARBG vector contains the same 5' and 3 ' regulatory elements as the pAAV vector construct shown in Fig 4.
  • Panel B Lane 1 , untransfected HEK cells; Lane 2, HEK cells transfected with a pCBARG vector containing the truncated fH variant cDNA as a control; Lane 3, HEK cells transfected with the AAV8 plasmid containing the truncated fH variant cDNA.
  • FIG 6 is an SDS-gel which shows purification of recombinant hfHl -4.678.19-20.
  • SDS-gel analysis was performed via Coomasie blue staining of human fH truncation variant containing SCRl-4, 6-8, and 19-20 that was expressed by transfecting HEK cells using the pCBARBG vector.
  • the recombinant fH truncation protein was purified from the supernatant by passing through an affinity column that was prepared using a mAb against human factor H (clone OX-23) that recognizes an epitope in SCR2-3. Size and location of protein molecular weight markers are shown on the left side.
  • FIG 7 is a gel showing recombinant hfHl -4.678.19-20 retains complement regulating activity (cofactor activity).
  • the human fH truncation variant containing SCRl-4, 6-8, and 19-20 was tested for cofactor activity for factor I-mediated C3b cleavage.
  • human C3b was mixed with factor I in the presence (Lane 1 -6) or absence (Lane 7) of full-length fH (hfH) or the truncated fH variant (hfHl -4.678.19- 20). The reaction mixture was incubated and then analyzed by SDS-PAGE and western blot analysis. Cofactor activity is indicated by the appearance of the iC3b a-chain fragment.
  • FIG 8 is a line graph showing that recombinant hfHl -4.678.19-20 (square, top line) has strong heparin-binding activity.
  • the human fH truncation variant containing SCRl-4, 6-8, and 19-20 retains heparin-binding activity. Its heparin-binding activity is dose-dependent, and when compared with full-length human fH (diamond, lower line) on a ⁇ g/ml basis, it showed higher activity.
  • Heparin-binding activity was assessed by ELISA using plate-coated heparin, overlay of a full-length or truncated fH protein solution and, after washing, detection of bound fH or truncated fH by the mAb OX-23 (against an epitope in SCR2-3).
  • FIG 9 is a line graph showing recombinant hfHl-4.678.19-20 (square, top line) has strong C3b-binding activity.
  • the human fH truncation variant containing SCRl-4, 6- 8, and 19-20 retains C3b-binding activity. Its C3b-binding activity is dose-dependent, and when compared with full-length human fH (diamond, bottom line) on a ⁇ g/mL basis, it showed higher activity.
  • C3b-binding activity was assessed by ELISA using plate- coated C3b, overlay of a full-length or truncated fH protein solution and, after washing, detection of bound fH or truncated fH by the mAb OX-23 (against an epitope in SCR2- 3).
  • FIG 10 is a line graph showing ELISA detection of hfHl-4.678.19-20 in the blood of 3 different fH mutant mice (fH 1 " 7 " 1 ; Fl , F2, F20) one week after AAV8-mediated fH gene therapy.
  • the fH 1 " 7 " 1 mouse is a strain of fH mutant mice that carry premature stop codons at the beginning of SCR19. These mice produce trace amount of truncated fH (lacking SCR19-20) and has uncontrolled fluid phase alternative pathway complement activation and consumption (secondary C3 and fB deficiency). Mice were infected by retro-orbital I.V.
  • mAb OX-23 was used as a capture antibody (recognizing an epitope in human fH SCR2-3) and biotinylated mAb L20/3 was used as a detection antibody (recognizing human fH SCR19).
  • FIG 1 1 is western blot analysis demonstrating that AAV8-mediated human fH gene therapy in fHTM 7 " 1 mice inhibits alternative pathway complement activation due to the lack of sufficient endogenous mouse fH expression, untreated fH 1 " 7 " 1 mice have uncontrolled fluid phase alternative pathway complement activation, and as a result they consume plasma C3 and fB (compare Lane 1 of WT with Lanes 2, 4, 6 of three fHTM 7 " 1 mice before gene therapy).
  • mice were treated with AAV8-hfHl- 4.678.19-20, plasma C3 and fB levels significantly increased compared with pre- treatment levels, suggesting that AAV8-mediated human fH gene therapy inhibited uncontrolled alternative pathway complement activation and C3 and fB consumption. All three mice (Fl , F2 and F20) received 3 x 10 11 gene copies each via retro-orbital I.V..
  • FIG 12A provides a schematic domain structure of human factor H variant containing SCRl-4, 6-8, and 17-20, with the locations of N-glycosylatioins sites illustrated by arrows.
  • FIGs 12B -12C provide the nucleic acid and amino acid sequences of the leader peptide and 1 1 short consensus repeat (SCR) domains of the fH variant SCRl-4, 6-8 and 17-20 [SEQ ID NO: 45 and 46, respectively].
  • FIG 13 is the complete cDNA and 5 'UTR sequences of the human factor H variant containing the leader peptide and SCRl-4, 6-8 and 17-20 (hfHl-4.678.17-20) (5 'UTR is in capital letters) [SEQ ID NO: 47] .
  • FIG 14 is the amino acid sequence of the factor H truncation construct containing the leader peptide (underlined) and SCRl -4, 6-8, and 17-20 (hfHl -4.678.17-20) [SEQ ID NO 48].
  • FIGs 15A-15C show ELISA detection of hfH 1-4.6-8.17-20 protein level in the plasma of 3 fH mutant mice treated with varying doses of AAV8- hfHl-4.678.17-20.
  • the fHTM 7 " 1 mouse is a strain of fH mutant mice that carry premature stop codons at the beginning of SCR19.
  • mice produce trace amount of truncated fH (lacking SCR19- 20) and has uncontrolled fluid phase alternative pathway complement activation and consumption (secondary C3 and fB deficiency).
  • Mice were infected by retro-orbital I.V. with a AAV8 virus containing hfHl-4.678.17-20 at three doses, 1 x 10 12 gene copies (GC)/mouse, 3 x 10 11 GC/mouse and 1 x 10 11 GC/mouse, respectively.
  • Plasma samples were collected for ELISA assay before AAV treatment (Pre) or at one week (Wl), two weeks (W2), one month (Ml), two months (M2) or 3 months (M3) after AAV treatment.
  • the mAb OX-23 was used as a capture antibody (recognizing an epitope in human fH SCR2-3) and biotinylated mAb L20/3 was used as a detection antibody (recognizing human fH SCR19).
  • a capture antibody recognizing an epitope in human fH SCR2-3
  • biotinylated mAb L20/3 was used as a detection antibody (recognizing human fH SCR19).
  • FIGs 16A-16C are western blot analysis demonstrating that treatment with AAV8- hfHl-4.678.17-20 gene therapy of fH 1 " 7 " 1 mice inhibits alternative pathway complement activation. Due to the lack of sufficient endogenous mouse fH expression, untreated fHTM 7 " 1 mice have uncontrolled fluid phase alternative pathway complement activation, and as a result they consume plasma C3 and fB (Lane 1). In three fH 1 " 7 " 1 mice treated with 1 xlO 12 gene copies (GC)/mouse (FIG 16A), 3 xlO 11 gene copies
  • FIGs 17A-17C show the nucleic acid and amino acid sequences of the leader peptide and the 20 Short Consensus Repeat (SCR) domains in mice [SEQ ID NO: 79 and 80, respectively]. Amino acid sequences between the defined SCRs are linker sequences that afford fH flexibility.
  • FIGs 18A-18B provide the nucleic acid and amino acid sequences of the leader peptide and 9 Short Consensus Repeat (SCR) domains of the mouse fH variant [SEQ ID NO: 81 and 82, respectively]. Amino acid sequences between the defined SCRs are linker sequences that afford fH protein flexibility. This variant of mouse fH is used as a surrogate for testing the in vivo function of hfHl-4.678.19-20 in subsequent studies.
  • SCR Short Consensus Repeat
  • FIG 19 provides the coding and 5' and 3'-UTR sequences of the mouse factor H truncation construct containing the leader peptide (underlined) and SCRl-4, 6-8, 19-20 (mfH 1-4.678.19-20) [SEQ ID NO: 43].
  • FIG 20 provides the amino acid sequence of the mouse factor H truncation construct containing the leader peptide (underlined) and SCRl-4, 6-8, and 19-20 (mfHl-
  • FIG 21 is a gel showing confirmation of protein expression and stability of mfHl-4.19-20 and mfHl-4.678.19-20.
  • the cDNA sequence of mouse fH truncation variant containing SCRl-4, 678, and 19-20 or that of another fH truncation variant containing SCRl-4, and 19-20 was cloned into a eukaryotic expression vector pCBARBG which was then used to transfect a mouse liver cell line, HepalClC7 cells.
  • FIG 22A is a flow chart showing how blood samples were collected and processed for fH protein detection.
  • the fH 1 " 7 " 1 mouse is a strain of fH mutant mice that carry premature stop codons at the beginning of SCR19. These mice produce trace amount of truncated fH (lacking SCR19-20) and has uncontrolled fluid phase alternative pathway complement activation and consumption (secondary C3 and fB deficiency).
  • FIG 22B is a western blot detection of mfHl-4.678.19-20 in the blood of a fH mutant mouse (fH 1 " 7 " 1 ) one week after AAV8-mediated fH gene therapy.
  • fH 1 " 7 " 1 a fH mutant mouse
  • M3, F10, F30 M indicates male and F indicates female
  • mfHl-4.678.19-20 was clearly detected.
  • FIG 23 is a western blot analysis demonstrating that AAV8-mediated fH gene therapy in fHTM 7 " 1 mice prevents uncontrolled alternative pathway complement activation. Due to the lack of sufficient endogenous fH expression, untreated fHm/m mice have uncontrolled fluid phase alternative pathway complement activation, and as a result they consume plasma C3 and fB (compare Lane 1 of WT with Lanes 2, 5, 8 of fHTM 7 " 1 mice before gene therapy).
  • mice were treated with AAV8-mfHl-4.678.19-20, at one week (1W, Lanes 3, 6, 9) and one month (1M, Lanes 4, 7, 10), plasma C3 and fB levels were recovered to WT levels, suggesting that AAV8-mediated fH gene therapy prevented uncontrolled alternative pathway complement activation and C3 and fB consumption, and that the therapeutic effect was evident as early as one week and last at least one month.
  • FIG 24 is a western blot analysis demonstrating that AAV8-mediated fH gene therapy prevents uncontrolled alternative pathway complement activation in a mouse model of lethal C3 glomerulopathy.
  • fHTM 7 " 1 mice that are also deficient in properdin (fH 1 " 7 " 1 ? “7” )
  • fHm/mP-/- mice develop a lethal form of C3G and they die by the age of 10-12 weeks old.
  • mice were treated with AAV8 (3x10 gene copies/mouse) via retro-orbital I.V. injection.
  • FIG 25 shows long term follow-up of an ⁇ "7" (M3 from Fig 24)-treated with AAV8-mfHl-4.678.19-20 gene therapy.
  • FIG 26 shows long term follow-up of an ⁇ "7" (M3 from Fig 24) treated with AAV8-mfHl-4.678.19-20 gene therapy.
  • FIG 27 shows the efficacy of AAV8-mfHl-4.678.19-20 gene therapy in preventing renal pathology in C3 glomerulopathy.
  • An fH 1 " 7 " 1 ? “7” mouse treated with control AAV8 vector (mouse Ml from Fig 24) was moribund within 2 weeks of treatment and immunostaining of its kidney showed strong glomerular C3 deposition as previously described for untreated fH 1 " 7 " 1 ? “7” mice (left panels).
  • a fHTM 7 " 1 ? "7” mouse treated with the AAV8-mfHl-4.678.19-20 vector (M3 from Fig 23) survived and was still healthy at 6 month after treatment, at which time it was sacrificed and analyzed for kidney histology. No glomerular C3 deposition was detected in this mouse (right panels), suggesting C3 glomerulopathy was prevented by AAV8-mfHl-4.678.19-20 gene therapy.
  • FIGs 28A and 28B demonstrate that AAV 8 -mfH 1 -4.678.19-20 gene therapy prevents alternative pathway complement activation caused by membrane regulator dysfunction.
  • mice deficient in two membrane regulators, DAF and Crry were treated with AAV 8 -mfH 1 -4.678.19-20 (retro-orbital route, I.V., 3 xl0 12 gene copies/mouse).
  • Plasma samples were collected before and 1 week (1W) after gene therapy to analyze plasma C3 (A) and ffl (B) levels by western blot.
  • the DAF/Crry double mutant mice had excessive alternative pathway complement activation with low C3 and ffl levels (Pre).
  • AAV8-mfHl-4.678.19-20 treatment After AAV8-mfHl-4.678.19-20 treatment, both C3 and ffi were restored to wild-type mouse levels, suggesting that AAV8-mfHl- 4.678.19-20 treatment can correct pathologies caused by membrane complement regulators. This data suggested that AAV8-mfHl-4.678.19-20 treatment was broadly effective for complement-mediated diseases caused by uncontrolled alternative pathway complement regulation, irrespective of the underlying regulatory mechanism defect.
  • DAF/Crry double mutant mice used in this study is a crossbreed species between DAF knockout mice and a Crry flox/flox -Tie-2Cre + mice. Because Tie-2-Cre is expressed in germ cells, it led to germline deletion of Crry gene in some progenies, leading to global Crry deletion.
  • FIGs 29A - 29B provide a dosage comparison of AAV8-mfHl -4.678.19-20 gene therapy using C3 recovery as a readout.
  • different doses of AAV8- mfHl-4.678.19-20 were administered to fH 1 " 7 " 1 mice (retro-orbital route, I.V.).
  • Two mice each was given the following dosages: 1 x 10 12 gene copies/mouse (M#l , M#2), 3 x 10 11 gene copies/mouse (M#3, M#6) and 1 x 10 11 gene copies/mouse (M#4, M#5).
  • Western blot was performed to analyze plasma C3 levels before (Pre) and one week (1W) or 1 month (1M) after gene therapy. As shown, all doses tested were able to increase plasma C3 levels when examined at 1W and 1M time points.
  • FIGs 30A-30B provide a dosage coparison of AAV8-mfHl -4.678.19-20 gene therapy using fB recovery as a readout.
  • the Western analysis was performed essentially as described in FIG 29A-B where C3 was used as a readout. As shown, all doses tested were able to increase plasma fB levels when examined at 1W and 1M time points.
  • FIG 31 is a schematic diagram showing the gene targeting strategy used to introduce a W to R mutation in SCR20 of mouse fH (position 1206, corresponding to position 1 183 in human fH).
  • FIG 32 shows the survival curves of wild-type littermate mice and mutant mice carrying W1206R mutation in fH.
  • the fH mutant mice developed characteristic pathologies of aHUS and close to half of them died by 30 weeks of age.
  • FIG 33A shows a comparison of platelet counts in wild-type, heterozygous, and homozygous mutant mice.
  • the homozygous mutant mice showed low platelet counts, suggesting that they were suffering from chronic thrombocytopenia.
  • FIG 33B shows a comparison of hemoglobin levels in wild-type, heterozygous, and homozygous mutant mice. The homozygous mutant mice show low hemoglobin levels, suggesting that they are suffering from chronic hemolytic anemia.
  • FIGs 34A-34C show kidney sections of W1206R mutant mice showed pathologies characteristic of aHUS.
  • the pathological features included mesangial expansion and narrowing of capillary lumens (Panel A), thrombi in small vessels as indicated by arrows in Panel A and Panel C. Electron microscopy showed that the glomerular capillary wall exhibited sub-endothelial expansion with fluffy granular electron-lucent material, and formation of double contours and new glomerular basement membrane.
  • FIGs 35A-35D show that mice carrying W1206R mutation in fH also developed retinal injury and blood clotting in the eye.
  • FIGs 35A-35D show that mice carrying W1206R mutation in fH also developed retinal injury and blood clotting in the eye.
  • FIGs 35A-35D show that mice carrying W1206R mutation in fH also developed retinal injury and blood clotting in the eye.
  • FIGs 35A-35D show that mice carrying W1206R mutation in fH also developed retinal injury and blood clotting in the eye.
  • FIGs 35A-35D show that mice carrying W1206R mutation in fH also developed retinal injury and blood clotting in the eye.
  • FIG 36 shows that mfHl-4.678.19-20 protein was detected by ELISA in the blood of fH wl206R/wl206R mice at 1 month and 2 months after treatment with AAV8- mfHl-4.678.19-20 vector at 3 x 10 n GC/mouse but not in the blood of these mice before AAV gene therapy.
  • FIGs 37A and 37B are line graphs showing the treatment of fH wl206R/wl206R mice with AAV8-mfHl-4.678.19-20 vector at 3 x 10 11 GC/mouse normalized their platelet counts. All 3 fH wl206R/wl206R mice treated with AAV8-mfHl-4.678.19-20 were alive and healthy. Their platelet counts (FIG 37A) and hemoglobin levels (Hb, FIG 37B), increased and were maintained at normal range.
  • Novel engineered factor H (fH) genes and protein variants are described herein. These variants are characterized by increased half-life and increased efficacy in treating conditions associated with factor H and other complement disorders.
  • compositions provided herein are useful for simultaneously targeting multiple pathways and/or treating or modulating uncontrolled alternative pathway complement regulation caused by a variety of factors.
  • treating complement factor H disorders may encompass alleviating, reducing, and/or ameliorating symptoms, and/or preventing the development of additional symptoms associated with complement factor H disorder, which can manifest as several different phenotypes, including asymptomatic, recurrent bacterial infections, and renal failure. This is typically characterized by decreased serum levels of factor H, complement component C3, and a decrease in other terminal complement components, indicating activation of the alternative complement pathway. This disorder is associated with a number of renal diseases with variable clinical presentation and progression, including C3 glomerulopathy and atypical hemolytic uremic syndrome.
  • compositions and methods for treating one or more of age related macular degeneration AMD
  • atypical hemolytic uremic including, e.g., syndrome microangiopathic haemolytic anemia, thrombocytopenia, acute renal failure), paroxysmal nocturnal hemoglobinuria (PNH), schizophrenia, ischemic stroke, and/or preventing or treating bacterial infections caused by recruitment of bacterial pathogens (e.g., Aspergillus spp. ; Borrelia burgdorferi; B. duttonii; B. recurrentis;
  • bacterial pathogens e.g., Aspergillus spp. ; Borrelia burgdorferi; B. duttonii; B. recurrentis;
  • Candida albicans Francisella tularensis; Haemophilus influenzae; Neisseria meningitidis; Streptococcus pyogenes, or one of the five factor H binding proteins of B.burgdorferi (CRASP-1, CRASP-2, CRASP-3, CRASP-4, or CRASP-5), among others.
  • CRASP-1, CRASP-2, CRASP-3, CRASP-4, or CRASP-5 one of the five factor H binding proteins of B.burgdorferi
  • the term "treating complement associated disorders” includes alleviating, reducing, and/or ameliorating symptoms, both of the complement factor H disorders identified above, but also other disorders associated with uncontrolled alternative pathway complement regulation. More particularly, the data provided herein suggests that at least one AAV-mediated fH variant is broadly effective for complement- mediated diseases caused by uncontrolled alternative pathway complement regulation, irrespective of the underlying regulatory mechanism defect. See, e.g, FIG 23.
  • Complement-mediated disorders may encompass symptoms associated with complement dysregulation which can manifest as several different phenotypes, including asymptomatic, recurrent bacterial infections, and various tissue injuries including but not limited to renal diseases. Unless otherwise specified, both homozygous subjects and heterozygous subjects are encompassed within this definition.
  • dysregulation is typically caused by loss of function mutations in, or auto-antibodies against, complement regulatory proteins including but not limited to fH, factor I (fl) and membrane cofactor protein (MCP) or by gain of function mutations in other complement proteins including but not limited to C3 and factor B (ffi).
  • complement regulatory proteins including but not limited to fH, factor I (fl) and membrane cofactor protein (MCP) or by gain of function mutations in other complement proteins including but not limited to C3 and factor B (ffi).
  • C3 and factor B ffi
  • Complement dysregulation is typically, though not always, characterized by decreased serum levels of factor H, complement component C3, ffi and a decrease in other terminal complement components, indicating activation of the alternative and/or the terminal complement pathway.
  • Complement- mediated pathologies that can be treated by the present invention of composition and method include but are not limited to the following diseases with variable clinical presentation and progression: C3 glomerulopathy (formally called membranoproliferative glomerulonephritis type II or MPGNII), of which there are two known forms - dense deposit disease (DDD) and C3 glomerulonephritis (C3GN);
  • C3 glomerulopathy formally called membranoproliferative glomerulonephritis type II or MPGNII
  • DDD dense deposit disease
  • C3GN C3 glomerulonephritis
  • TMA thrombotic microangiopathy
  • aHUS atypical hemolytic uremic syndrome
  • STEC-HUS Shiga-like toxin-producing E. coli HUS
  • TTP thrombotic thrombocytopenia purpura
  • retinal degenerative eye disease including age related macular degeneration (AMD), RPE degeneration, chorioretinal degeneration, photoreceptor degeneration, paroxysmal nocturnal hemoglobinuria (PNH), ischemia reperfusion injury of all organs and settings, rheumatoid arthritis, hemodialysis, diabetic nephropathy, diabetic vasculopathy, asthma, systemic lupus erythematosus (SLE), ischemic stroke, abdominal aortic aneurysm (AAA), anti-neutrophil cytoplasmic antibody (ANCA) mediated vasculitis (ANCA vasculitis), ANCA-mediated hemorrhagic lung injury and disease,
  • AMI age
  • Neisseria meningitidis Neisseria meningitidis; Streptococcus pyogenes. Other examples of such disorders are discussed in more details below.
  • the amino acid sequence of the mature "wild-type" human complement factor H (isoform 1) is provided herein as http://www.uniprot.org/uniprot/ P08603 and serves as a reference for the amino acid numbering of the hfH isoform 1 [reproduced in SEQ ID NO: 39].
  • the leader sequence is located at amino acids 1 to 18 of factor H, with reference to SEQ ID NO: 39.
  • the amino acid sequence of the leader is provided in SEQ ID NO: 2.
  • the mature (secreted) hfH protein is located at amino acids 19 to 1231 , with reference to SEQ ID NO: 39.
  • SEQ ID NO: 39 The amino acid sequence of the wild-type human complement factor H, isoform 1, is reproduced in SEQ ID NO: 39.
  • the features section of SEQ ID NO: 1 also illustrates an alternative system for identifying the start/stop of each of the 20 Short Consensus Repeat (SCR) domains. In this system, linker sequences are not present between each of the SCRs.
  • SCR Short Consensus Repeat
  • an engineered hfH variant provided herein may have a heterologous leader sequence substituted for the native hfH leader sequence.
  • another hfH isoform e.g., isoform 2
  • the sequence of which are available e.g., from http://www.uniprot.org/uniprot/ P08603, and/or one of the natural amino acid variants therein which are not associated with a disorder. See, SEQ ID NO: 40.
  • substitutions may be written as (first amino acid identified by single letter code)- residue position # - (second amino acid identified by single letter code) whereby the first amino acid is the substituted amino acid and the second amino acid is the substituting amino acid at the specified position with reference to isoform 1 ; however, by conventional alignment steps, the corresponding amino acid residues identified herein with respect to the numbering of isoform 1 can be located in isoform 2 and non-disease causing natural variants of the SCRs of isoform 1 or 2 of fH.
  • SCR #-## the domains are inclusive of the endpoints and is the same as "SCR#, . . . SCR##". In certain embodiments, periods are used between the domains.
  • SCRl-4 refers to "SCR1, SCR2, SCR3, and SCR4" and is the same as "SCR1,2,3,4" or "SCRl .2.3.4.”
  • SCR19-20 refers to SCR19 and SCR20 and is the same as “SCR19,20".
  • SCR6-8", “SCR6.7.8” and “SCR6,7,8” refer to the same domains.
  • the term "functional fH variant” includes fH variants which are characterized by having complement regulating activity (cofactor activity) located in SCRl-4 and optionally, a functional C3b-binding and GAG-binding ability (located within wild-type SCR7 and SCR19-20) characteristic of wild-type fH.
  • the engineered fH variants have more than 100% of wild-type fH cofactor activity and/or GAG-binding ability. See, e.g. , Figure 8 and the examples below which demonstrate that a fH variant described herein has GAG- and C3b-binding activity statistically higher than full-length human fH, e.g., about 10% to 40% higher.
  • the engineered fH variant has less than about 95% to about 100% of wild- type functional fH.
  • an engineered fH variant may have at least 50% of the cofactor activity present in functional wild-type fH, and more desirably at least about 60%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% , or at least about 99%.
  • the engineered fH variant may alternatively or additionally have at least at least 50% of the GAG-binding ability of functional fH, and more desirably at least about 60%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% , or at least about 99%.
  • Examples of functional fH variants include those having SCRl-4 and 19-20 of the fH protein, with one or more of an SCR7, SCR17 or SCR18 domain. Further variants include those having one or more of SCR6, SCR8, SCR16, SCR17, SCR18, or fragments thereof, and combinations thereof.
  • such variants may include, e.g., fH SCRl-4, 6-8,19-20; fH SCRl-4, 6-8,18-20; fH SCRl-4, 6-8,17-20; fH SCRl-4, 6-7,19- 20; fH SCR1 -4,6-7, 18-20; fH SCR1 -4,6-7,17-20; fH SCRl-4, 7- 8,19-20; fH SCRl-4,7- 8,18-20; fH SCRl-4,7-8,17-20; fH SCRl-4, 7,19-20; fH SCR1 -4,7, 18-20; fH SCR1- 4,7,17-20; SCRl-4, 17, 19-20; SCRl-4, 18-20; SCRl-4, 17-20 and/or fH SCR1 -4,7, 16- 20, among others.
  • the hfH variant further comprises additional hfH SCRs, e.g. , SCRs, e.
  • hfH SCR5 is absent. However, in certain embodiments, hfH SCR5 may be present in whole or a fraction thereof. In certain embodiments, hfH SCR9, SCR10,
  • SCR11, SCR12, SCR13, SCR14, and/or SCR15 are absent, or are at least functionally deleted.
  • one or more of the SCRs in these variants may be a "functional fragment" of the SCRs, rather than a full-length SCR as shown in FIG 1 or the features of SEQ ID NO: 1.
  • functional fragment is meant an amino acid sequence (or coding sequence therefor) less than the full-length SCR which is characterized by having one or more of complement inhibiting activity, the ability to bind, heparin, and/or C3b-binding activity.
  • the coding sequence of the fH variant when expressed from a viral vector the coding sequence of the fH variant also includes a leader sequence.
  • a leader sequence may be an fH leader.
  • the leader sequence can be from another source, e.g. , an IL-2 leader, [see, e.g., the index of mammalian leader sequences identified in http://www.signalpeptide.de/], incorporated by reference herein.
  • the leader sequence selected is less than about 26 amino acids in length (e.g., from about 1 to about 26 amino acids), more preferably less than 20 amino acids (from about 1 to about 20 amino acids), and most preferably, less than about 18 amino acids in length (from about 1 to about 18 amino acids).
  • “functional deletion” is meant an amino acid sequence (or coding sequence therefor) which lacks complement inhibiting activity, the C3b-binding activity, and optionally also further lacks heparin binding activity.
  • domains may be located immediately adjacent to one another
  • one or more of the SCR domains may have a linker composed of one to about 12 to 18 amino acids located between them.
  • a variant may contain SCRl-(Ll)- SCR2-(L2)-SCR3-(L3)-SCR4-(L4)-(SCR6- (L4'))-SCR7-(L5)-(SCR8-(L5'))-(SCR16-(L5"))-(SCR17-(L5"'))-(SCR18-(L5""))- SCR19-(L6)-SCR20, wherein the () indicate optional component, "L” refers to a linker, and each of LI, L2, L3, L4, L4', L5, L5', L5", L5'", L5"", and L6 may be absent or independently selected from an amino acid sequence of about 1 to about 12-18 amino acids.
  • each of the linkers may have the same sequence or a different sequence.
  • a variant contains at least one, at least two, at least three, at least four, at least five linkers, at least six linkers.
  • suitable linkers include the natural linkers identified in FIG1 or FIG17, SEQ ID NO: 4, 6, 8, 10, 12, 15, 18, 20, 22, 24, 26, 28, 30, 32, 34 and 36, or synthetic linkers.
  • Each of these wild-type linkers may be located in their native position. Alternatively, one or more of these wild-type linkers may be used in a different linker position, or in multiple different linker positions.
  • one or more of these linkers may be fH sequences and are independently selected.
  • one or more of the linkers may be heterologous to fH, e.g. , from a different source, whether artificial, synthetic, or from a different protein which confers suitable flexibility to the fH variant.
  • suitable linkers may include, e.g., a poly Gly linker and other linkers providing suitable flexibility (e.g., http://parts.igem.org/Protein_domains/Linker), which is incorporated by reference herein.
  • the linkers lack any fH function.
  • amino acid substitution and its synonyms described above are intended to encompass modification of an amino acid sequence by replacement of an amino acid with another, substituting, amino acid.
  • the substitution may be a conservative substitution. It may also be a non-conservative substitution.
  • conservative in referring to two amino acids, is intended to mean that the amino acids share a common property recognized by one of skill in the art. For example, amino acids having hydrophobic nonacidic side chains, amino acids having hydrophobic acidic side chains, amino acids having hydrophilic nonacidic side chains, amino acids having hydrophilic acidic side chains, and amino acids having hydrophilic basic side chains.
  • Common properties may also be amino acids having hydrophobic side chains, amino acids having aliphatic hydrophobic side chains, amino acids having aromatic hydrophobic side chains, amino acids with polar neutral side chains, amino acids with electrically charged side chains, amino acids with electrically charged acidic side chains, and amino acids with electrically charged basic side chains.
  • Both naturally occurring and non-naturally occurring amino acids are known in the art and may be used as substituting amino acids in embodiments.
  • Methods for replacing an amino acid are well known to the skilled in the art and include, but are not limited to, mutations of the nucleotide sequence encoding the amino acid sequence. Reference to "one or more" herein is intended to encompass the individual embodiments of, for example, 1, 2, 3, 4, 5, 6, or more.
  • nucleic acid sequences encoding these fH protein variants are provided.
  • the coding sequences for these variants may be from wild-type sequences of the leader sequence and/or one or more SCRs of isoform 1, isoform 2, or non-disease associated variants.
  • web-based or commercially available computer programs, as well as service based companies may be used to back translate the amino acids sequences of the leader sequence, and/or one or more of the SCRs to nucleic acid coding sequences, including both RNA and/or cDNA. See, e.g., backtranseq by EMBOSS,
  • RNA and/or cDNA coding sequences are designed for optimal expression in human cells.
  • Codon-optimized coding regions can be designed by various different methods. This optimization may be performed using methods which are available on-line, published methods, or a company which provides codon optimizing services.
  • One codon optimizing method is described, e.g., in WO 2015/012924 A2, which is incorporated by reference herein. Briefly, the nucleic acid sequence encoding the product is modified with synonymous codon sequences. Suitably, the entire length of the open reading frame (ORF) for the product is modified. However, in some embodiments, only a fragment of the ORF may be altered. By using one of these methods, one can apply the frequencies to any given polypeptide sequence, and produce a nucleic acid fragment of a codon- optimized coding region which encodes the polypeptide.
  • sequence identity refers to the bases in the two sequences which are the same when aligned for correspondence.
  • the length of sequence identity comparison may be over the full-length of the genome, the full-length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, or as desired. However, identity among smaller fragments, e.g. of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired.
  • Multiple sequence alignment programs are also available for nucleic acid sequences.
  • nucleotide sequence identity examples include, “Clustal W”, “CAP Sequence Assembly”, “BLAST”, “MAP”, and “MEME”, which are accessible through Web Servers on the internet. Other sources for such programs are known to those of skill in the art. Alternatively, Vector NTI utilities are also used. There are also a number of algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. As another example, polynucleotide sequences can be compared using FastaTM, a program in GCG Version 6.1. FastaTM provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. For instance, percent sequence identity between nucleic acid sequences can be determined using FastaTM with its default parameters (a word size of 6 and the NOP AM factor for the scoring matrix) as provided in GCG Version 6.1, herein incorporated by reference.
  • Percent identity refers to the residues in the two sequences which are the same when aligned for correspondence. Percent identity may be readily determined for amino acid sequences over the full-length of a protein, polypeptide, about 32 amino acids, about 330 amino acids, or a peptide fragment thereof or the corresponding nucleic acid sequence coding sequencers.
  • a suitable amino acid fragment may be at least about 8 amino acids in length, and may be up to about 700 amino acids.
  • aligned sequences or alignments refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence. Alignments are performed using any of a variety of publicly or commercially available Multiple Sequence Alignment Programs. Sequence alignment programs are available for amino acid sequences, e.g., the "Clustal X”, “MAP”, “PIMA”, “MSA”, “BLOCKMAKER”, “MEME”, and “Match-Box” programs.
  • any of these programs are used at default settings, although one of skill in the art can alter these settings as needed.
  • one of skill in the art can utilize another algorithm or computer program which provides at least the level of identity or alignment as that provided by the referenced algorithms and programs. See, e.g., J. D. Thomson et al, Nucl. Acids. Res., "A comprehensive comparison of multiple sequence alignments", 27(13):2682-2690 (1999).
  • the nucleic acid sequences encoding the fH variants (e.g., hfH variant gene) described herein are engineered into any suitable genetic element, e.g., naked DNA, phage, transposon, cosmid, RNA molecule (e.g., mRNA), episome, etc., which transfers the hfH sequences carried thereon to a host cell, e.g., for generating nanoparticles carrying DNA or RNA, viral vectors in a packaging host cell and/or for delivery to a host cells in subject.
  • the genetic element is a plasmid.
  • the selected genetic element may be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion.
  • suitable method including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion.
  • the methods used to make such constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).
  • an "expression cassette” refers to a nucleic acid molecule which comprises the hfH variant coding sequences, promoter, and may include other regulatory sequences therefor (e.g., 5' and/or 3' UTR sequences), which cassette may be engineered into a genetic element and/or packaged into the capsid of a viral vector (e.g., a viral particle).
  • a viral vector e.g., a viral particle.
  • such an expression cassette for generating a viral vector contains the hfH sequences described herein flanked by packaging signals of the viral genome and other expression control sequences such as those described herein.
  • the expression cassette typically contains a promoter sequence as part of the expression control sequences.
  • the illustrative plasmid and vector described herein uses the chicken beta-actin. Alternatively, another constitutive promoter may be selected. In certain embodiments, de-targeting of undesirable target cells may be achieved by use of appropriate vector elements, e.g., microRNAs. Additionally or alternatively, the vector selected may have preferential targeting for the desired tissue, e.g., an AAV8, AAV9, or AAVrhlO for liver, an AAV 8, AAV1, or other AAV for eye, or the like.
  • targeting the vector to a desired tissue may be desirable for maximizing expression of the protein.
  • a liver-specific promoter may be selected.
  • Suitable promoters include, thyroxin binding globulin (TBG), alpha 1 antitrypsin (A1AT); human albumin Miyatake et al, J. Virol, 71 :5124 32 (1997), humAlb; and hepatitis B virus core promoter, Sandig et al., Gene Ther., 3: 1002 9 (1996)].
  • TTR minimal enhancer/promoter, alpha-antitrypsin promoter, LSP (845 nt) 25 (requires intron-less scAAV).
  • other liver-specific promoters may be used [see, e.g., The Liver Specific Gene Promoter Database, Cold Spring Harbor,
  • tissue-specific promoter may be selected.
  • the promoter may be derived from any species. For example, for use in the eye, e.g. , a retinal pigmented epithelium (RPE) promoter or a photoreceptor promoter may be selected.
  • RPE retinal pigmented epithelium
  • the promoter is the human G-protein-coupled receptor protein kinase 1 (GRK1) promoter (Genbank Accession number AY327580).
  • the promoter is a 292 nt fragment (positions 1793-2087) of the GRK1 promoter (See also, Beltran et al, Gene Therapy 2010 17: 1162-74, which is hereby incorporated by reference herein).
  • the promoter is the human interphotoreceptor retinoid-binding protein proximal (IRBP) promoter.
  • IRBP human interphotoreceptor retinoid-binding protein proximal
  • promoter is the native promoter for the gene to be expressed.
  • the promoter is the RPGR proximal promoter (Shu et al, IOVS, May 2012, which is incorporated by reference herein).
  • promoters useful in the invention include, without limitation, the rod opsin promoter, the red-green opsin promoter, the blue opsin promoter, the cGMP- ⁇ - phosphodiesterase promoter, the mouse opsin promoter (Beltran et al 2010 cited above), the rhodopsin promoter (Mussolino et al, Gene Ther, July 2011, 18(7):637-45); the alpha-subunit of cone transducin (Morrissey et al, BMC Dev, Biol, Jan 2011, 11 :3); beta phosphodiesterase (PDE) promoter; the retinitis pigmentosa (RP1) promoter (Nicord et al, J.
  • photoreceptor specific promoters include, without limitation, the rod opsin promoter, the red-green opsin promoter, the blue opsin promoter, the inter photoreceptor binding protein (IRBP) promoter and the cGMP- -phosphodiesterase promoter.
  • IRBP inter photoreceptor binding protein
  • promoters such as viral promoters, constitutive promoters, regulatable promoters [see, e.g., WO 2011/126808 and WO 2013/04943], or a promoter responsive to physiologic cues may be used may be utilized in the vectors described herein.
  • an expression cassette and/or a vector may contain other appropriate transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (e.g., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
  • suitable polyA sequences include, e.g., SV40, bovine growth hormone (bGH), rabbit beta globulin, and TK poly A.
  • Suitable enhancers include, e.g., the alpha fetoprotein enhancer, the TTR minimal promoter/enhancer, LSP (TH-binding globulin promoter/alphal- microglobulin/bikunin enhancer), amongst others.
  • control sequences are "operably linked" to the fH gene sequences.
  • operably linked refers to both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
  • the expression cassette may be engineered onto a plasmid which is used for drug delivery or for production of a viral vector. Suitable viral vectors are preferably replication-defective and selected from amongst those which target ocular cells. Viral vectors may include any virus suitable for gene therapy may be used, including but not limited to adenovirus; herpes virus; lentivirus; retrovirus; parvovirus, etc.
  • replication-defective virus or “viral vector” refers to a synthetic or recombinant viral particle in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells.
  • the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be "gutless" - containing only the transgene of interest flanked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production. Therefore, it is deemed safe for use in gene therapy since replication and infection by progeny virions cannot occur except in the presence of the viral enzyme required for replication.
  • the viral vector is an adeno-associated virus (AAV).
  • AAV adeno-associated virus
  • An AAV viral vector is an AAV DNase-resistant particle having an AAV protein capsid into which is packaged nucleic acid sequences for delivery to target cells.
  • An AAV capsid is composed of 60 capsid protein subunits, VP1, VP2, and VP3, that are arranged in an icosahedral symmetry in a ratio of approximately 1 : 1 : 10 to 1 : 1 :20, depending upon the selected AAV.
  • AAV8 capsid refers to the AAV8 capsid having the encoded amino acid sequence of GenBank accession:YP_077180, which is incorporated by reference herein. Some variation from this encoded sequence is encompassed by the present invention, which may include sequences having about 99% identity to the referenced amino acid sequence in GenBank accession: YP_077180; US Patent 7,282,199,
  • the AAV8 capsid may have the VPl sequence of the AAV8 variant described in WO2014/124282, which is incorporated by reference herein. Methods of generating the capsid, coding sequences therefore, and methods for production of rAAV viral vectors have been described. See, e.g., Gao, et al, Proc. Natl. Acad. Sci. U.S.A. 100 (10), 6081-6086 (2003), US 2013/0045186A1, and WO 2014/124282.
  • an AAV8 variant which shows tropism for the desired target cell e.g., liver, photoreceptors, RPE or other ocular cells
  • an AAV8 capsid may have Y447F, Y733F and T494V mutations (also called “AAV8(C&G+T494V)" and M rep2-cap8(Y447F+733F+T494V)”), as described by Kay et al, Targeting Photoreceptors via Intravitreal Delivery Using Novel, Capsid-
  • AAV Vectors PLoS One. 2013; 8(4): e62097. Published online 2013 Apr 26, which is incorporated herein by reference.
  • Mowat et al Tyrosine capsid-mutant AAV vectors for gene delivery to the canine retina from a subretinal or intravitreal approach, Gene Therapy 21, 96-105 (January 2014), which is incorporated herein by reference.
  • the AAV capsid is an AAV8bp capsid, which preferentially targets bipolar cells. See, WO 2014/024282, which is incorporated herein by reference.
  • AAV serotypes may be selected as sources for capsids of AAV viral vectors (DNase resistant viral particles) including, e.g. , AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV 8, AAV9, rhlO, AAVrh64Rl, AAVrh64R2, rh8 [See, e.g., US Published Patent Application No. 2007-0036760-A1; US Published Patent Application No. 2009-0197338-A1; EP 1310571].
  • AAV viral vectors DNase resistant viral particles
  • AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV 8, AAV9, rhlO, AAVrh64Rl, AAVrh64R2, rh8 See, e.g., US Published Patent Application No. 2007-0036760-A1; US Published Patent Application No. 2009-0197338-A1; EP 1310571
  • an AAV cap for use in the viral vector can be generated by mutagenesis (i.e., by insertions, deletions, or substitutions) of one of the aforementioned AAV Caps or its encoding nucleic acid.
  • the AAV capsid is chimeric, comprising domains from two or three or four or more of the aforementioned AAV capsid proteins.
  • the AAV capsid is a mosaic of VP1, VP2, and VP3 monomers from two or three different AAVs or recombinant AAVs.
  • a rAAV composition comprises more than one of the aforementioned Caps.
  • the ITRs are the only AAV components required in cis in the same construct as the gene.
  • the coding sequences for the replication (rep) and/or capsid (cap) are removed from the AAV genome and supplied in trans or by a packaging cell line in order to generate the AAV vector.
  • a pseudotyped AAV may contain ITRs from a source which differs from the source of the AAV capsid.
  • a chimeric AAV capsid may be utilized.
  • Still other AAV components may be selected. Sources of such AAV sequences are described herein and may also be isolated or obtained from academic, commercial, or public sources (e.g.
  • AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank ® , PubMed ® , or the like.
  • the minimal sequences required to package an expression cassette into an AAV viral particle are the AAV 5' and 3' ITRs, which may be of the same AAV origin as the capsid, or which are of a different AAV origin (to produce an AAV pseudotype).
  • the ITR sequences from AAV2, or the deleted version thereof (AITR) are used for convenience and to accelerate regulatory approval.
  • ITRs from other AAV sources may be selected. Where the source of the ITRs is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be termed pseudotyped.
  • an expression cassette for an AAV vector comprises an AAV 5' ITR, the coding sequences and any regulatory sequences, and an AAV 3' ITR.
  • AITR D-sequence and terminal resolution site
  • sc refers to self-complementary.
  • Self-complementary AAV refers a plasmid or vector having an expression cassette in which a coding region carried by a recombinant AAV nucleic acid sequence has been designed to form an intramolecular double-stranded DNA template.
  • dsDNA double stranded DNA
  • a producer cell line is transiently transfected with a construct that encodes the transgene flanked by ITRs and a construct(s) that encodes rep and cap.
  • a packaging cell line that stably supplies rep and cap is transiently transfected with a construct encoding the transgene flanked by ITRs.
  • AAV virions are produced in response to infection with helper adenovirus or herpesvirus, requiring the separation of the rAAVs from contaminating virus.
  • helper adenovirus or herpesvirus More recently, systems have been developed that do not require infection with helper virus to recover the AAV - the required helper functions (i.e. , adenovirus El, E2a, VA, and E4 or herpesvirus UL5, UL8, UL52, and UL29, and herpesvirus polymerase) are also supplied, in trans, by the system.
  • helper functions can be supplied by transient transfection of the cells with constructs that encode the required helper functions, or the cells can be engineered to stably contain genes encoding the helper functions, the expression of which can be controlled at the transcriptional or posttranscriptional level.
  • the transgene flanked by ITRs and rep/cap genes are introduced into insect cells by infection with baculovirus-based vectors.
  • the fH genes described herein may be delivered via viral vectors other than rAAV.
  • viral vectors may include any virus suitable for gene therapy may be used, including but not limited to adenovirus; herpes virus; lentivirus; retrovims; etc.
  • adenovirus adenovirus
  • herpes virus lentivirus
  • retrovims a virus suitable for gene therapy
  • one of these other vectors is generated, it is produced as a replication- defective viral vector.
  • a “replication-defective virus” or “viral vector” refers to a synthetic or artificial viral particle in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells.
  • the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be "gutless" - containing only the transgene of interest flanked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production. Therefore, it is deemed safe for use in gene therapy since replication and infection by progeny virions cannot occur except in the presence of the viral enzyme required for replication.
  • compositions described herein are designed for delivery to subjects in need thereof by any suitable route or a combination of different routes, e.g. , direct delivery to the liver (optionally via intravenous, via the hepatic artery, or by transplant), oral, inhalation, intranasal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal, and other parental routes of administration.
  • the viral vectors described herein may be delivered in a single composition or multiple compositions.
  • two or more different AAV may be delivered, or multiple viruses [see, e.g., WO 2011/126808 and WO 2013/049493].
  • multiple viruses may contain different replication-defective viruses (e.g., AAV and adenovirus).
  • the replication-defective viruses can be formulated with a physiologically acceptable carrier for use in gene transfer and gene therapy applications.
  • quantification of the genome copies (GC) may be used as the measure of the dose contained in the formulation.
  • Any method known in the art can be used to determine the genome copy (GC) number of the replication-defective virus compositions of the invention.
  • One method for performing AAV GC number titration is as follows: purified AAV vector samples are first treated with DNase to eliminate un- encapsidated AAV genome DNA or contaminating plasmid DNA from the production process. The DNase resistant particles are then subjected to heat treatment to release the genome from the capsid. The released genomes are then quantitated by real-time PCR using primer/probe sets targeting specific region of the viral genome (usually poly A signal).
  • the replication-defective virus compositions can be formulated in dosage units to contain an amount of replication-defective virus that is in the range of about 1.0 x 10 9 GC to about 1.0 x 10 15 GC (to treat an average subject of 70 kg in body weight), and preferably 1.0 x 10 12 GC to 1.0 x 10 14 GC for a human patient.
  • the dose is less than about 1.5 x 10 11 GC/kg.
  • the dose of AAV virus may be about 1 x 10 9 GC, about 5 X 10 9 GC, about 1 X 10 10 GC, about 5 X 10 10 GC, or about 1 X 10 11 GC.
  • the variants may be delivered in an amount of about 0.001 mg to about 10 mg/kg.
  • the above-described recombinant vectors may be delivered to host cells according to published methods.
  • the rAAV preferably suspended in a physiologically compatible carrier, may be administered to a human or non-human mammalian subject.
  • Suitable carriers may be readily selected by one of skill in the art in view of the indication for which the transfer virus is directed.
  • one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline).
  • Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The selection of the carrier is not a limitation of the present invention.
  • compositions of the invention may contain, in addition to the rAAV and/or variants and carrier(s), excipients, including other non-active conventional pharmaceutical ingredients, such as preservatives, chemical stabilizers, suspending agents, and/or surfactants.
  • excipients include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol.
  • Suitable chemical stabilizers include gelatin and albumin.
  • excipients suitable for solid compositions may be selected, including, e.g., fillers, beads, bulking agents, disintegrants, glidants, flavorants, colorants, or other components.
  • the viral vectors and other constructs described herein may be used in preparing a medicament for delivering a fH variant to a subject in need thereof, supplying fH variant having an increased half-life to a subject, and/or for treating complement related disorders.
  • a course of treatment may optionally involve repeat administration of the same viral vector (e.g., an AAV8 vector) or a different viral vector (e.g., an AAV8 and an AAVrhlO).
  • repeat administration may be desirable over 18 months, 2 years, or a longer time period due to dilution of expression caused by natural hepatocyte proliferation.
  • Still other combinations of viral and protein- based treatment may be selected using the viral vectors described herein.
  • the composition described herein may be combined in a regimen involving other anti- complement drugs (e.g., monoclonal antibodies, etc), or protein-based therapies (including, e.g., delivery of a composition containing one or more fH variants as described herein).
  • an engineered hfH variant as described herein may be delivered in protein form.
  • a fH variant when delivered to a subject in protein form, a fH variant may have a leader sequence, or may lack all or a portion of the leader sequence.
  • protein-based therapy may be used in conjunction with administration of a viral- mediated hfH variant.
  • the fH protein can provide an immediate release form of the hfH to the subject, e.g., detectable plasma levels within 2 hours post- administration, which typically will begin to be cleared from the subject within about 24 hours to about 48 hours, or to about 72 hours, should any lag time in the onset of expression from the viral-mediated delivery system be found to exist.
  • the hfH variant is further modified to extend its half-life by engineering into the variant at least one glycosylation site is engineered into at least one of the SCRs present in the variant, at least two of the SCRs present in the variant, at least three of the SCRs present in the variant, or more.
  • the glycosylation site may be engineered into one or more of SCR1, SCR2, SCR3, SCR4, SCR19, and/or SCR20.
  • SCR17 and/or SCR18 are additionally or alternatively
  • a glycosylation site may be engineered into a linker.
  • the linker is preferably at least six amino acids in length up to about 18 amino acids in length, e.g., 8 - 18, 10-15, or 12 amino acids.
  • the engineered hfH protein variant may be pegylated, i.e., modified with a polyethylene glycol moiety using known techniques [see, e.g., Fee, Conan J.; Van Alstine, James M. (2006). "PEG-proteins: Reaction engineering and separation issues". Chemical
  • a glycosylation site refers to the point of attachment of oligosaccharides to a carbon atom (C-linked), nitrogen atom (N-linked), or oxygen atom (O-linked), or gly cation (non-enzymatic attachment of reducing sugars to the nitrogen atom of a protein (e.g., the nitrogen atom of an asparagine (Asn) side chain that is part of an Asn-X-Ser/Thr, wherein X is any amino acid except Pro).
  • N- glycosylation sites are desired.
  • a variety of techniques are known in the art for engineering N-glycosylation sites. See. e.g.
  • an engineered hfH variant as provided herein may be formulated with a suitable carrier and/or excipient for delivery to a subject by any suitable route.
  • the carrier may be a liposome or a nanocarrier.
  • Suitable doses of the hfH variant include those which achieve sufficient plasma levels to treat a complement related disorder. Examples of dosages of hfH variants include, but are not limited to, an effective amount within the dosage range of any of about 0.01 ⁇ g/kg to about 300 mg/kg, or within about 0.1 ⁇ g/kg to about 40 mg/kg, or with about 1 ⁇ g/kg to about 20 mg/kg, or within about 1 ⁇ g/kg to about 10 mg/kg.
  • the composition when administered intraocularly, may be administered at low microgram ranges, including for example about 0.1 ⁇ g/kg or less, about 0.05 ⁇ g/kg or less, or 0.01 ⁇ g/kg or less.
  • the amount of hfH variant administered to an individual is about 10 ⁇ g to about 500 mg per dose, or about 10 ⁇ g to about 50 ⁇ g, about 50 ⁇ g to about 100 ⁇ g, about 100 ⁇ g to about 200 ⁇ g, about 200 ⁇ g to about 300 ⁇ g, about 300 ⁇ g to about 500 ⁇ g, about 500 ⁇ g to about 1 mg, about 1 mg to about 10 mg, about 10 mg to about 50 mg, about 50 mg to about 100 mg, about 100 mg to about 200 mg, about 200 mg to about 300 mg, about 300 mg to about 400 mg, or about 400 mg to about 500 mg per dose.
  • compositions described herein may be administered alone.
  • compositions described herein may be administered in combination with other molecules known to have a beneficial effect.
  • useful cofactors include symptom- alleviating cofactors, including antiseptics, antibiotics, antiviral and antifungal agents and analgesics, anti-inflammatories, anesthetics.
  • molecules helpful for retinal attachment or treatment of damaged retinal tissue may be desired.
  • anti-VEGF agents such as an antibody against VEGF
  • basic fibroblast growth factor (bFGF) basic fibroblast growth factor (bFGF)
  • ciliary neurotrophic factor (CNTF) ciliary neurotrophic factor (CNTF), axokine (a mutein of CNTF), leukemia inhibitory factor (LIF), neutrotrophin 3 (NT-3), neurotrophin-4 (NT-4), nerve growth factor (NGF), insulin-like growth factor II, prostaglandin E2, 30 kD survival factor, taurine, and vitamin A.
  • LIF leukemia inhibitory factor
  • NT-3 neutrotrophin 3
  • NT-4 neurotrophin-4
  • nerve growth factor insulin-like growth factor II
  • prostaglandin E2 30 kD survival factor
  • taurine and vitamin A.
  • Another suitable therapeutic may include an anti- complement antibody, e.g., an anti-complement regulator C3 (e.g., such as is
  • compositions described herein may be administered to a subject via any route, including, but not limited to, intravenous (e.g., by infusion pumps), intraperitoneal, intraocular, intra-arterial, intrapulmonary, oral, inhalation, intravesicular, intramuscular, intra-tracheal, subcutaneous, intraocular (including, intravitreal, and intra-retinal), intrathecal, transdermal, transpleural, intraarterial, topical, inhalational (e.g.
  • compositions are administered systemically (for example by intravenous injection). In some embodiments, the compositions are administered locally (for example by intraarterial or intraocular injection).
  • a pharmaceutical composition in treating a complement related disorder including, e.g., a complement factor H associated disorder such as described herein and other complement related disorders, including, without limitation: tissue damage due to ischemia-reperfusion following acute myocardial infarction, aneurysm, stroke, hemorrhagic shock, crush injury, multiple organ failure, hypovolemic shock intestinal ischemia, spinal cord injury, and traumatic brain injury; inflammatory disorders, e.g., bums, endotoxemia and septic shock, adult respiratory distress syndrome, cardiopulmonary bypass, hemodialysis; anaphylactic shock, severe asthma, angioedema, Crohn's disease, sickle cell anemia, poststreptococcal
  • a complement related disorder including, e.g., a complement factor H associated disorder such as described herein and other complement related disorders, including, without limitation: tissue damage due to ischemia-reperfusion following acute myocardial infarction, aneurysm, stroke, hemorrhagic shock,
  • transplant rejection e.g., hyperacute xenograft rejection
  • pregnancy related diseases such as recurrent fetal loss and pre-eclampsia
  • adverse drug reactions e.g., drug allergy, IL-2 induced vascular leakage syndrome and radiographic contrast media allergy
  • autoimmune disorders including, but not limited to, myasthenia gravis, Alzheimer's disease, multiple sclerosis, emphysema, obesity, rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, insulin-dependent diabetes mellitus, acute disseminated encephalomyelitis, Addison's disease, antiphospholipid antibody syndrome, autoimmune hepatitis, Crohn's disease, Goodpasture's syndrome, Graves' disease, Guillain-Barre syndrome, Hashimoto's disease,
  • myocardial infarction myocardial infarction
  • ischemia/reperfusion injury stroke
  • ARDS acute respiratory distress syndrome
  • sepsis burn injury
  • inflammation associated with cardiopulmonary bypass and hemodialysis plasmapheresis
  • plateletpheresis plateletpheresis
  • ECMO membrane oxygenation
  • HELP heparin-induced extracorporeal LDL precipitation
  • regulation refers to the ability of a composition to inhibit one or more components of a biological pathway.
  • both homozygous subjects and heterozygous subjects are encompassed within the phrase subject having a complement mediated disorder.
  • a “subject” is a mammal, e.g., a human, mouse, rat, guinea pig, dog, cat, horse, cow, pig, or non-human primate, such as a monkey, chimpanzee, baboon or gorilla.
  • Truncation variants were generated by inverse PCR method using Phusion high- fidelity DNA polymerase (Cat# M0530S, New England Biolabs) according to manufacturer's protocol.
  • Full-length human complement factor H cDNA pCMV Sport6 used as template for inverse PCR was obtained from Thermo Fisher Scientific (Cat # MHS6278-202800294, clone ID 40148771).
  • PCR primers used for generation of hfHl - 4.678.19-20 are listed in Table 1.
  • This fragment was sub-cloned into the pCBABG vector (which has a chicken beta-actin promoter with CMV enhancer and a partial intron sequence of the same gene, and a rabbit beta-globulin gene polyadenylation signal sequence) at EcoR V site. Positive clones were selected by restriction digestion and PCR methods. Tablel :
  • Truncation variants were generated by inverse PCR method using Phusion high- fidelity DNA polymerase (Cat# M0530S, New England Biolabs) according to manufacturer's protocol.
  • Full length human complement factor H cDNA pCMV Sport6 (used as template for inverse PCR) was obtained from Thermo Fisher Scientific (Cat # MHS6278-202800294, clone ID 40148771).
  • PCR primers used for generation of hfHl- 4.678.17-20 are listed in Table 1.
  • Positive clones (hfHl-4.678.19-20 in pCBARBG vector) were transfected into HEK cells to assess the stability and functional activity of hfHl-4.678.19-20 protein.
  • About 80% confluent HEK cells in a 6-well plate (Falcon, Cat# 353046) were transfected with hfHl-4.678.19-20 cDNA in pCBARBG using Lipofectamine 2000 (Cat # 11668019, Invitrogen) according to manufacturer's instructions. Protein expression was confirmed by western blotting using goat anti-human factor H IgG (Cat # A237, Complement tech).
  • HEK cells in 150cm dishes were transfected with endotoxin free hfHl- 4.678.19-20 cDNA in pCBARBG plasmid with PEI (Cat# 23966, Polysciences) according to manufacturer's instructions.
  • PEI Cat# 23966, Polysciences
  • Truncation variants were generated by inverse PCR method using Phusion high- fidelity DNA polymerase according to manufacturer protocol.
  • Full-length mouse complement factor H cDNA in pBluescript SK(-) used as template for inverse PCR was kindly provided by Dr M. Nonaka (University of Tokyo, Japan, Nucleotide 110-4361 of NCBI NM 009888.3).
  • All PCR primers used for generation of mfHl-4.678.19-20 variant are listed in Table 3. After PCR fragments were separated on 0.8% agarose gel and extracted by AccuPrep gel extraction kit, 50 ng of gel purified fragment was used for ligation by Rapid DNA ligation Kit and transformed into DH5a competent cells.
  • Positive clones were confirmed either by restriction digestion or by PCR screening using specific primers. Then, mfHl-4.678. -19-20 insert from pBluescript SK(-) was released by Sma I and EcoR V digestion and gel purified. This fragment was sub-cloned into pCBARBG vector at EcoR V site. Positive clones were selected by restriction digestion and PCR methods.
  • HepalClC7 cells (mouse hepatoma cell line, ATCC ® CRL-2026) to assess stability and functional activity of mfHl-4.678.19-20 protein. About 80% confluent cells in a 6-well plate were transfected with mfHl-4.678.19-20 cDNA using Lipofectamine 2000 according to manufacturer's instructions. Protein expression was confirmed by western blotting using rabbit anti-mouse fH IgG (Ref #1). Blots were visualized using Pierce ECL plus Western Blotting substrate (Cat# 80196, Thermo Fisher Scientific).
  • Hinc II 5 'ITR F AAGTGCCACCTGGTCGACGCTGCGCGCTCGCTCGCT SEQ ID NO: 63
  • Pst I 3'ITR F GAAGATCCCTCGACCTGCAGATTAACTACAAGGAACCCCT SEQ ID NO: 65
  • Super-coiled endotoxin-free AAV plasmid was prepared by Endo free plasmid kit (cat# 12362, Qiagen), and was used for AAV virus production by the University of Pennsylvania Vector Core or the University of Massachusetts Gene Therapy Center Vector Core.
  • the packaging, purification, and titer determination of AAV encoding mfHl-4.678.19-20, hfHl-4.678.19-20 or hfHl-4.678.17-20 was accomplished by using standard procedures as described (http://www.med.upenn.edu/gtp/vectorcore/
  • mice were injected with 3 x 10 12 gene copies/mouse (for hfHl-4.678.19-20 ) or 1 x 10 11 - 1 x 10 12 gene copies/mouse (for hfHl-4.678.17-20 ) by retro-orbital route.
  • a control AAV vector pAAV.TBG.NULL.rBG was used as a control.
  • HRP-conjugated goat anti-mouse C3 Ab (1 :4000, MP Biomedicals Cat # 0855557) or affinity-purified goat anti-human fB Ab (cross-reacts with mouse fB; 1 :2500, cat#A235, Complement Technology) were used as primary antibodies, followed by HRP-conjugated rabbit anti-goat IgG (1 :4000, Cat # 1721034, Bio-Rad). Blots were visualized using Pierce ECL Plus Western Blotting substrate.
  • mice After washing, plates were then incubated with Avidin-HRP (1/1000, Cat 554058, BD Biosciences) at RT for 1 h, and developed using the TMB substrate reagent (Cat 51-2606KC and BD Cat 51-2607KC, BD Biosciences).
  • mice were infected with AAV vector containing the coding sequences for mfHl-4.678.19-20.
  • AAV vector containing the coding sequences for mfHl-4.678.19-20.
  • the double mutant fHTM 7 " 1 ? "7" mice (fH 1 " 7 " 1 mice that were rendered deficient in properdin) developed an exacerbated and lethal form of C3 glomerulopathy and died by 10-12 week old (Lesher et al 2013). Therefore, the fjj m/m p- / - jnicg would a i s0 allow us to use mortality as another readout for the therapeutic efficacy of mfHl-4.678.19-20 AAV. 7-week old N m/m or ⁇ "7" mice were injected with either control AAV (p AAV . TBG.NULL .
  • mice ⁇ was diluted with sample buffer and boiled before loading onto 4-20% gradient SDS-PAGE gels under reducing conditions. Samples were then transferred to PVDF membrane and probed with appropriate antibodies.
  • mice In experiments aimed at titrating the amount of mfHl-4.678.19-20 AAV copies needed to achieve therapeutic efficacy, 10-12 weeks old fH 1 " 7 " 1 mice (Lesher, 2013) were injected with 1 x 10 12 , 3 x 10 11 or 1 x 10 11 gene copies/mouse of AAV by retro orbital route. Blood was collected via retro-orbital bleeds prior to injection and at indicated time points (1 week and 1 month after injection). Mouse plasma ( ⁇ ) was diluted with sample buffer and boiled before loading onto 4-20% gradient SDS-PAGE gels under reducing conditions. Samples were then transferred to PVDF membrane and probed with appropriate antibodies.
  • HRP-conjugated goat anti-mouse C3 Ab (1 :4000, Cat # 0855557, MP Biomedicals) or affinity-purified goat anti-human fB Ab (cross-reacts with mouse fB; 1 :2500, cat#A235, Complement Technology, Inc.) were used as primary antibodies, followed by detection with HRP-conjugated rabbit anti-goat IgG (1 :4000, Cat # 1721034, Bio-Rad). Blots were visualized using Pierce ECL Plus Western Blotting substrate.
  • ELISA assay was developed and used. Briefly, 96-well plates were pre-coated with 2 ⁇ g/ml of mouse anti-mouse fH SCR19-20 mAb (clone-12, generated in-house by immunizing fHTM 7 " 1 mice with recombinant mouse fH SCR19-20 (Barata, L., et al, J. Immunol 190(6): 2886-95 (2013)) at 37°C for 1-2 hr at room temperature. Un-occupied binding sites on the plates were blocked with 1% BSA in PBS at RT for 1 hr.
  • mouse anti-mouse fH SCR19-20 mAb clone-12, generated in-house by immunizing fHTM 7 " 1 mice with recombinant mouse fH SCR19-20 (Barata, L., et al, J. Immunol 190(6): 2886-95 (2013)
  • Kidneys from control AAV- or mfHl-4.678.19-20 AAV-treated iH m/m or ⁇ " /_ mice were snap-frozen in OCT medium and stored at -80°C.
  • 4 ⁇ sections were cut and used for staining.
  • FITC-conjugated goat anti-mouse C3 Ab was used (1 :500, Cat # 855500, MP Biomedicals) and the experiment was performed as described (Lesher et al 2013).
  • mice The following Table provides a summary of survival data of fHTM 7 " 1 ? "7" mice treated with control AAV 8 vector or AAV8-mfHl-4.678.19-20 vector. All 8 ⁇ "7" mice treated with control AAV8 vector died within 2-3 weeks of treatment, whereas 7 out of 9 ⁇ "7" mice treated with the AAV8-mfHl-4.678.19-20 vector were rescued from lethal C3 glomerulopathy. All mice were injected with 3 x 10 12 gene copies/mouse of the respective AAV virus through retro-orbital I.V. routes. Survival of control AAV- or mfHl-4.678.19-20 AAV-treated ⁇ "7” mice was recorded after AAV treatment for 10 months. Data were categorized as being censored (euthanized) or natural death and analyzed by GraphPad Prism (La Jolla,CA).
  • 96-well plates were pre-coated with 100 ⁇ g of Heparin (Sigma, H3393) in bicarbonate buffer (pH9.6) at 37°C for lhr. The unoccupied binding sites on the plates were blocked with 1% BSA in PBS at RT for 1 hr. Different amounts of hfHl-4.678.19- 20 or mfHl-4.678.19-20 protein were added and incubated at RT for 1 hr, followed by 2 ⁇ g/ml of mouse anti-human fH mAb (OX-23) at RT for 1 hr. Plates were incubated with HRP-conjugated rabbit anti-mouse IgG (1/4000, Cat #A9044, Sigma) at RT for 1 hr, then developed using the TMB substrate reagent.
  • HRP-conjugated rabbit anti-mouse IgG (1/4000, Cat #A9044, Sigma
  • 96-well plates were pre-coated with 2 ⁇ g/ml human C3b (Cat # Al 14, CompTech) at 37°C for lhr. The unoccupied binding sites on the plates were blocked with 1% BSA in PBS at RT for 1 h. Different amounts of hfHl-4.678.19-20 or mfHl- 4.678.19-20 protein were added and incubated at RT for 1 h, followed by 2ug/ml of mouse anti-human fH mAb (OX-23) at RT for 1 hr. Plates were incubated with HRP- conjugated rabbit anti-mouse IgG at RT for 1 hr, then developed using the TMB substrate reagent.
  • HRP- conjugated rabbit anti-mouse IgG at RT for 1 hr
  • hfHl-4.678.19-20 and mfHl- 4.678.19-20 proteins in factor I-mediated cleavage of C3b 0.5 or 0.25 ⁇ g of purified hfHl-4.678.19-20 or mfHl-4.678.19-20 protein was mixed with 2 ⁇ g of human C3b in 15 ⁇ PBS, and ⁇ g of human factor I (Cat# A138, CompTech) was subsequently added and incubated at 37°C for 15 minutes. Reaction was stopped by adding 5x reducing SDS- PAGE sample buffer.
  • Proteolysis of C3b was determined by analyzing the cleavage of the a chain and the generation of the a41 and a39 fragments using 4-20% Gradient SDS- PAGE gels under reducing conditions, followed by western blot detection using HRP- conjugated goat anti-human C3 IgG (1/4000, Cat# 855237, MP biomedicals). Blots were visualized using Pierce ECL Plus Western Blotting substrate.
  • fHl-4.678.19-20 AAV treatment may also be effective in preventing AP complement activation caused by defects in membrane complement regulators
  • mfHl-4.678.19-20 was tested in a strain of mouse that is deficient in two membrane complement regulators DAF and Crry (DAF/Crry double mutant mice).
  • DAF/Crry double mutant mice The generation of DAF/Crry double mutant mice (DAF "/" -Crry flox/flox -Tie-2Cre + ) was previously described with a phenotype of secondary complement deficiency due to excessive AP complement activation (Barata et al, 2013).
  • DAF/Crry double mutant mice Like fH 1 " 7 " 1 mice, there was C3 and fB consumption in the DAF/Crry double mutant mice (Barata et al, 2013). DAF/Crry double mutant mice (10-week old) were injected with mfHl-4.678.19-20 AAV at 3 x 10 12 gene copies/mouse by retro orbital route. Blood was collected via retro-orbital bleeds prior to injection and at 1 week after injection. Therapeutic efficacy was assessed by measuring plasma C3 and fB levels before and after mfHl-4.678.19-20 AAV treatment using western blot analysis.
  • mouse plasma (1 ⁇ ) was diluted with sample buffer and boiled before loading onto 4-20% gradient SDS-PAGE gels under reducing conditions. Samples were then transferred to PVDF membrane and probed with appropriate antibodies.
  • HRP- conjugated goat anti-mouse C3 Ab (1 :4000, Cat # 0855557, MP Biomedicals) or affinity-purified goat anti-human fB Ab (Cat # A235, CompTech, Texas, across reacts with mouse fB) were used as primary antibodies, followed by detection with HRP- conjugated rabbit anti-goat IgG. Blots were visualized using Pierce ECL Plus Western Blotting substrate.
  • a mutant mouse strain carrying a fH point mutation in SCR20 corresponding to human fH Wl 183R mutation found in aHUS patients was created by homologous recombination-based gene targeting technique (Lesher et al, 2013;
  • the long arm of targeting vector was comprised of a 6 kb fragment containing the 21th exon and flanking intronic sequences of the mouse fH gene. It was amplified by PCR using the following primers: SEQ ID NO: 67: 5'- gcggccgccctatccattagtgagtgtgg-3' and SEQ ID NO: 68: 5'-ctcgaggacagcgatgtaagaacaatc- 3'.
  • the PCR product was ligated into PCR 2.1 vector (Invitrogen) and the insert was then released from PCR2.1 vector by with Not I and Xhol restriction digestion, purified and sub-cloned into the pNDl vector upstream of the NEO cassette.
  • pNDl vector has been described in previous publications of gene targeting experiments (Lesher et al (2013); Bisberger et al, 2012; Miwa et al, 2009; Kimura et al, 2008; Kimura et al 2012) and this vector contains neomycin (NEO) and diphtheria toxin (DT) cassettes for positive and negative selection, respectively (Lesher et al (2013); Bisberger et al, 2012; Miwa et al, 2009; Kimura et al, 2008; Kimura et al 2012).
  • NEO neomycin
  • DT diphtheria toxin
  • the pNDl vector also contains a loxP site and two flippase recognition target (FRT) sites flanking the NEO cassette for potential removal of NEO by FLPe recombinase (Rodriguez CI, et al, Nat Genet. 2000 Jun;25(2): 139-40.).
  • FLPe recombinase Rosriguez CI, et al, Nat Genet. 2000 Jun;25(2): 139-40.
  • the short arm sequence was comprised of a 3.85 kb fragment containing the 22 th exon encoding SCR20 and the flanking intronic sequences of the mouse fH gene. This sequence was PCR-amplified using the following primers: SEQ ID NO: 69: 5'- ggtaccaagcttattgaccagctacagacagta-3' and SEQ ID NO: 70: 5'- ggtaccctcactcaggtgtattactc-3'.
  • the PCR product was cloned into PCR 2.1 vector and subsequently a tryptophan (W) to arginine (R) mutation at position 1206 corresponding to Wl 183R mutation of human fH in SCR20 was made by site-directed mutagenesis using the Stratagene QuickChange Site-Directed Mutagenesis kit (Agilent Technologies, CA) with the following two primers, SEQ ID NO: 71 : 5'-
  • the targeting vector was then linearized by Not I digestion and transfected into C57BL/6 embryonic stem (ES) cells (EmbroMAX Embryonic stem cell line-strain C57BL/6, Cat # CMTI-2, Millipore) by electroporation-method.
  • Transfected ES cells were subjected to G418 selection starting from 48 hours after electroporation.
  • ES cells with homologous recombination were screened by Southern blot analysis of genomic DNA after HindlU digestion with a 480bp 3' probe amplified using SEQ ID NO: 73: 5'-ATAGCATGTGCCAGGAGACAC-3' and SEQ ID NO: 83: 5'-
  • AGTGTTGACTCGTGGAGACCA-3 ' as primers. Wild-type allele produced a 12.5kb fragment, whereas the targeted allele produced a 10.2kb fragment. Correctly targeted ES cells ( ⁇ * 120 ⁇ ⁇ 0 ⁇ 051 ⁇ ) were injected into 3.5-day post-coital C57BL/6J blastocysts to generate chimeras at the University of Pennsylvania School of Medicine Transgenic Core Facility.
  • Neo-4 primer SEQ ID NO: 74: 5- CTTGGGTGGAGAGGCTATTC-3 '
  • SEQ ID NO: 75 Neo-5 primer: 5'- AGGTGAGATGAC AGGAGATC-3 ' .
  • the neomycin-resistance cassette (NEO) in the targeting vector was flanked by 2 flippase (FLP) recombinase target (FRT) sites to allow its subsequent removal by FLP recombinase.
  • FLP flippase
  • FRT 2 flippase
  • Heterozygous FH-targeted mice (fH wl206R ( eo- os i t i ve)/+ ⁇ were crossed with FLPe transgenic mice (expressing the enhanced version of FLP, on C57BL/6 genetic background) to remove the NEO from the fH allele and generate a heterozygous fH mutant mouse without the NEO gene cassette (fH wl206R /+ ).
  • fH wl206R /+ mice were intercrossed to generate fH wl206R AV1206R homozygous mice on C57BL/6 genetic background.
  • fH wl206R AV1206R mice failed to thrive with significantly lower body weights as evidenced at 4-6 weeks of age and a near 50% mortality rate by 30 weeks.
  • All fH wl206R /wl206R m i ce showed one or more of the characteristic features of aHUS, i.e. renal injury (elevated blood urea nitrogen levels and/or histological signs of thrombotic microangiopathy in glomeruli), thrombocytopenia and anemia.
  • mice mice:
  • the fH wl206R AV1206R mice would also allow us to use mortality as another readout for the therapeutic efficacy of mfHl-4.678.19-20 AAV. Platelet counts in control AAV- and mfH 1 -4.678.19-20 AAV-treated fH w1206R
  • Serum BUN levels were measured using urea nitrogen reagents (Sigma- Aldrich) by following the manufacturer's instructions.
  • kidneys and other organs 0 f fH w1206R /w1206R mice: Paired kidneys and other organs were collected from fH wl206R /wl206R mice. One was fixed in formalin solution overnight and processed for paraffin embedding, and the other was snap-frozen in OCT compound (Sakura Finetek). Kidneys and other organs were evaluated histologically for signs of aHUS/ thrombotic microangiopathy using light microscopy and immunohistochemistry including immunofluorescence and immunoperoxidase.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Dispersion Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2016/053347 2015-09-24 2016-09-23 Composition and method for treating complement-mediated disease Ceased WO2017053732A2 (en)

Priority Applications (15)

Application Number Priority Date Filing Date Title
AU2016326627A AU2016326627B2 (en) 2015-09-24 2016-09-23 Composition and method for treating complement-mediated disease
CN201680064219.5A CN108291216B (zh) 2015-09-24 2016-09-23 用于治疗补体介导的疾病的组合物和方法
RU2018114907A RU2727411C2 (ru) 2015-09-24 2016-09-23 Композиция и способ для лечения заболевания, опосредованного комплементом
KR1020187011034A KR102773865B1 (ko) 2015-09-24 2016-09-23 보체 매개 질환 치료용 조성물 및 방법
CA2999299A CA2999299A1 (en) 2015-09-24 2016-09-23 Composition and method for treating complement-mediated disease
CN202211039079.XA CN115976105A (zh) 2015-09-24 2016-09-23 用于治疗补体介导的疾病的组合物和方法
JP2018515539A JP7261583B2 (ja) 2015-09-24 2016-09-23 補体媒介性疾患を処置するための組成物及び方法
IL296929A IL296929B2 (en) 2015-09-24 2016-09-23 Composition and method for treating complement-mediated disease
IL258024A IL258024B2 (en) 2015-09-24 2016-09-23 A preparation and method for the treatment of a complement-mediated disease
EP16849709.7A EP3359663A4 (en) 2015-09-24 2016-09-23 COMPOSITION AND METHOD FOR THE TREATMENT OF A COMPLEMENT-MEDIATED DISEASE
US15/762,721 US10988519B2 (en) 2015-09-24 2016-09-23 Composition and method for treating complement-mediated disease
US17/156,023 US20210171592A1 (en) 2015-09-24 2021-01-22 Composition and method for treating complement-mediated disease
AU2023201582A AU2023201582B2 (en) 2015-09-24 2023-03-14 Composition And Method For Treating Complement-Mediated Disease
US18/494,883 US12180254B1 (en) 2015-09-24 2023-10-26 Factor H variants for treatment of disease
US18/924,426 US20250051408A1 (en) 2015-09-24 2024-10-23 Factor h variants for treatment of disease

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562232008P 2015-09-24 2015-09-24
US62/232,008 2015-09-24

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/762,721 A-371-Of-International US10988519B2 (en) 2015-09-24 2016-09-23 Composition and method for treating complement-mediated disease
US17/156,023 Continuation US20210171592A1 (en) 2015-09-24 2021-01-22 Composition and method for treating complement-mediated disease

Publications (2)

Publication Number Publication Date
WO2017053732A2 true WO2017053732A2 (en) 2017-03-30
WO2017053732A3 WO2017053732A3 (en) 2017-05-11

Family

ID=58387476

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/053347 Ceased WO2017053732A2 (en) 2015-09-24 2016-09-23 Composition and method for treating complement-mediated disease

Country Status (11)

Country Link
US (4) US10988519B2 (OSRAM)
EP (1) EP3359663A4 (OSRAM)
JP (4) JP7261583B2 (OSRAM)
KR (1) KR102773865B1 (OSRAM)
CN (2) CN108291216B (OSRAM)
AU (2) AU2016326627B2 (OSRAM)
CA (1) CA2999299A1 (OSRAM)
HK (1) HK1251482A1 (OSRAM)
IL (2) IL296929B2 (OSRAM)
RU (1) RU2727411C2 (OSRAM)
WO (1) WO2017053732A2 (OSRAM)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018197873A1 (en) * 2017-04-28 2018-11-01 University Of Newcastle Upon Tyne Modified complement proteins and uses thereof
WO2019079718A1 (en) * 2017-10-20 2019-04-25 Gemini Therapeutics, Inc. COMPOSITIONS AND METHODS FOR TREATING AGE-RELATED MACULAR DEGENERATION
WO2019138137A1 (en) * 2018-01-15 2019-07-18 The University Of Manchester C3b binding polypeptide
WO2020128535A1 (en) * 2018-12-21 2020-06-25 Gyroscope Therapeutics Limited Complement factor i and complement factor i cofactor, vectors encoding therefor and therapeutic use
WO2020210480A3 (en) * 2019-04-10 2020-11-12 University Of Massachusetts Factor h vectors and uses thereof
WO2022165313A1 (en) 2021-02-01 2022-08-04 Regenxbio Inc. Gene therapy for neuronal ceroid lipofuscinoses
US20230048858A1 (en) * 2018-12-12 2023-02-16 Flagship Pioneering Innovations V, Inc. Anellosomes for delivering secreted therapeutic modalities
EP4048321A4 (en) * 2019-10-22 2023-11-22 Applied Genetic Technologies Corporation ADENO-ASSOCIATED VIRUS (AAV) VECTORS FOR THE TREATMENT OF AGE-RELATED MACULAR DEGENERATION AND OTHER EYE DISEASES AND DISORDERS
RU2809247C2 (ru) * 2018-12-21 2023-12-08 Джайроскоуп Терапьютикс Лимитед Фактор комплемента i и кофактор фактора комплемента i, кодирующие их векторы и применение в терапевтических целях

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108291216B (zh) * 2015-09-24 2022-09-16 宾夕法尼亚州大学信托人 用于治疗补体介导的疾病的组合物和方法
WO2021081401A1 (en) * 2019-10-23 2021-04-29 Gemini Therapeutics Inc. Methods for treating patients having cfh mutations with cfh-encoding vectors
CA3182800A1 (en) 2020-06-14 2021-12-23 Vertex Pharmaceuticals Inc. Complement factor i-related compositions and methods
GB202010009D0 (en) * 2020-06-30 2020-08-12 Syncona Investment Man Ltd Vector
KR20240112733A (ko) 2023-01-11 2024-07-19 포항공과대학교 산학협력단 조현병의 예방 또는 치료용 나노바디
CN120303303A (zh) * 2023-05-19 2025-07-11 合肥星眸生物科技有限公司 用于治疗补体旁路相关疾病的aav载体

Family Cites Families (44)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5139941A (en) 1985-10-31 1992-08-18 University Of Florida Research Foundation, Inc. AAV transduction vectors
US5436146A (en) 1989-09-07 1995-07-25 The Trustees Of Princeton University Helper-free stocks of recombinant adeno-associated virus vectors
US6268213B1 (en) 1992-06-03 2001-07-31 Richard Jude Samulski Adeno-associated virus vector and cis-acting regulatory and promoter elements capable of expressing at least one gene and method of using same for gene therapy
US5478745A (en) 1992-12-04 1995-12-26 University Of Pittsburgh Recombinant viral vector system
US5869305A (en) 1992-12-04 1999-02-09 The University Of Pittsburgh Recombinant viral vector system
US5679546A (en) 1993-09-24 1997-10-21 Cytomed, Inc. Chimeric proteins which block complement activation
US6204059B1 (en) 1994-06-30 2001-03-20 University Of Pittsburgh AAV capsid vehicles for molecular transfer
US5741683A (en) 1995-06-07 1998-04-21 The Research Foundation Of State University Of New York In vitro packaging of adeno-associated virus DNA
US6093570A (en) 1995-06-07 2000-07-25 The University Of North Carolina At Chapel Hill Helper virus-free AAV production
CA2287478C (en) 1997-04-14 2007-06-19 Richard J. Samulski Methods for increasing the efficiency of recombinant aav product
US6146874A (en) 1998-05-27 2000-11-14 University Of Florida Method of preparing recombinant adeno-associated virus compositions
US6491907B1 (en) 1998-11-10 2002-12-10 The University Of North Carolina At Chapel Hill Recombinant parvovirus vectors and method of making
WO2001011034A2 (en) 1999-08-09 2001-02-15 Targeted Genetics Corporation Enhancement of expression of a single-stranded, heterologous nucleotide sequence from recombinant viral vectors by designing the sequence such that it forms intrastrand base pairs
AU2001268149B2 (en) 2000-06-01 2005-08-18 University Of North Carolina At Chapel Hill Methods and compounds for controlled release of recombinant parvovirus vectors
ATE317916T1 (de) 2001-11-13 2006-03-15 Univ Pennsylvania Verfahren zur identifizierung von adeno- assoziiertem virus (aav) sequenzen sowie kit zur ausführung der methode
EP1453547B1 (en) 2001-12-17 2016-09-21 The Trustees Of The University Of Pennsylvania Adeno-associated virus (aav) serotype 8 sequences, vectors containing same, and uses therefor
US20070015238A1 (en) 2002-06-05 2007-01-18 Snyder Richard O Production of pseudotyped recombinant AAV virions
ES2874298T3 (es) 2003-09-30 2021-11-04 Univ Pennsylvania Clados de virus adenoasociados (AAV), secuencias, vectores que contienen el mismo, y usos de los mismos
EP2377951A1 (en) 2005-02-14 2011-10-19 University of Iowa Research Foundation Methods and reagents for treatment and diagnosis of age-related macular degeneration
ES2428218T3 (es) 2005-04-07 2013-11-06 The Trustees Of The University Of Pennsylvania Cápsides de AAV rh48 modificadas, composiciones que las contienen y usos de las mismas
EP1777906A1 (en) 2005-06-09 2007-04-25 Matsushita Electric Industrial Co., Ltd. Amplitude error compensating apparatus and orthogonality error compensating apparatus
KR20170002684A (ko) 2005-11-04 2017-01-06 제넨테크, 인크. 안질환 치료를 위한 보체 경로 억제제의 용도
US7588772B2 (en) 2006-03-30 2009-09-15 Board Of Trustees Of The Leland Stamford Junior University AAV capsid library and AAV capsid proteins
BRPI0712987A2 (pt) * 2006-06-21 2012-04-10 Musc Found For Res Dev tratamento de doenças direcionado ao fator h do complemento
GB0701213D0 (en) * 2007-01-23 2007-02-28 Univ Cardiff Factor H polymorphisms in the diagnosis and therapy of inflammatory diseases such as age-related macular degeneration
KR101010352B1 (ko) 2008-05-30 2011-01-25 삼성중공업 주식회사 전력 제어 장치 및 방법
GB0922659D0 (en) * 2009-12-24 2010-02-10 Univ Edinburgh Factor H
EP2542569B1 (en) * 2010-03-05 2020-09-16 Omeros Corporation Chimeric inhibitor molecules of complement activation
US20130023033A1 (en) 2010-03-29 2013-01-24 The Trustees Of The University Of Pennsylvania Pharmacologically induced transgene ablation system
US9315825B2 (en) 2010-03-29 2016-04-19 The Trustees Of The University Of Pennsylvania Pharmacologically induced transgene ablation system
CN103249432A (zh) * 2010-06-22 2013-08-14 科罗拉多大学董事会,法人团体 补体成分3的C3d片段的抗体
WO2013142362A1 (en) * 2012-03-19 2013-09-26 The Trustees Of The University Of Pennsylvania Regulator of complement activation and uses thereof
WO2014124282A1 (en) 2013-02-08 2014-08-14 The Trustees Of The University Of Pennsylvania Enhanced aav-mediated gene transfer for retinal therapies
WO2015012924A2 (en) 2013-04-29 2015-01-29 The Trustees Of The University Of Pennsylvania Tissue preferential codon modified expression cassettes, vectors containing same, and use thereof
ES2523016B1 (es) * 2013-05-20 2015-09-09 3P Biopharmaceuticals Vectores alfavirales y líneas celulares para la producción de proteínas recombinantes
FR3015484A1 (fr) * 2013-12-20 2015-06-26 Lab Francais Du Fractionnement Proteines recombinantes possedant une activite de facteur h
KR101591823B1 (ko) * 2013-12-27 2016-02-04 재단법인 목암생명공학연구소 증가된 유전자 발현능을 갖는 발현벡터
KR102745604B1 (ko) 2015-08-06 2024-12-23 더 트러스티스 오브 더 유니버시티 오브 펜실베니아 Glp-1 및 대사성 질환 치료용 조성물에서 이의 용도
CN108291216B (zh) * 2015-09-24 2022-09-16 宾夕法尼亚州大学信托人 用于治疗补体介导的疾病的组合物和方法
GB201519086D0 (en) * 2015-10-28 2015-12-09 Syncona Partners Llp Gene Therapy
KR102526506B1 (ko) * 2016-07-08 2023-05-03 더 트러스티스 오브 더 유니버시티 오브 펜실베니아 Rdh12가 연루된 장애 및 질환의 치료를 위한 방법 및 조성물
WO2020210480A2 (en) 2019-04-10 2020-10-15 University Of Massachusetts Factor h vectors and uses thereof
CN117947041A (zh) * 2022-10-28 2024-04-30 上海瑞宏迪医药有限公司 编码重组补体因子h多肽的核酸分子及用途
AU2024250682A1 (en) * 2023-04-07 2025-11-27 4D Molecular Therapeutics Inc. Aav variants for treatment of complement disorders

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12378292B2 (en) * 2017-04-28 2025-08-05 University Of Newcastle Upon Tyne Modified complement proteins and uses thereof
US20230101835A1 (en) * 2017-04-28 2023-03-30 University Of Newcastle Upon Tyne Modified complement proteins and uses thereof
WO2018197873A1 (en) * 2017-04-28 2018-11-01 University Of Newcastle Upon Tyne Modified complement proteins and uses thereof
EP3697920A4 (en) * 2017-10-20 2022-03-02 Gemini Therapeutics, Inc. COMPOSITIONS AND METHODS FOR THE TREATMENT OF AGE-RELATED MACULAR DEGENERATION
CN111788311A (zh) * 2017-10-20 2020-10-16 双子治疗公司 用于治疗年龄相关性黄斑变性的组合物和方法
WO2019079718A1 (en) * 2017-10-20 2019-04-25 Gemini Therapeutics, Inc. COMPOSITIONS AND METHODS FOR TREATING AGE-RELATED MACULAR DEGENERATION
CN111788219A (zh) * 2018-01-15 2020-10-16 曼彻斯特大学 C3b结合多肽
US12383600B2 (en) * 2018-01-15 2025-08-12 Complement Therapeutics Limited C3B binding polypeptide
JP2021511030A (ja) * 2018-01-15 2021-05-06 ザ・ユニバーシティ・オブ・マンチェスターThe University Of Manchester C3b結合ポリペプチド
EP4512822A3 (en) * 2018-01-15 2025-04-30 Complement Therapeutics Limited C3b binding polypeptide
WO2019138137A1 (en) * 2018-01-15 2019-07-18 The University Of Manchester C3b binding polypeptide
JP2024123077A (ja) * 2018-01-15 2024-09-10 コンプリメント・セラピューティクス・リミテッド C3b結合ポリペプチド
US11524050B2 (en) 2018-01-15 2022-12-13 Complement Therapeutics Limited C3B binding polypeptide
US20230048858A1 (en) * 2018-12-12 2023-02-16 Flagship Pioneering Innovations V, Inc. Anellosomes for delivering secreted therapeutic modalities
RU2809247C2 (ru) * 2018-12-21 2023-12-08 Джайроскоуп Терапьютикс Лимитед Фактор комплемента i и кофактор фактора комплемента i, кодирующие их векторы и применение в терапевтических целях
CN113286878A (zh) * 2018-12-21 2021-08-20 陀螺仪治疗有限公司 补体因子i和补体因子i辅因子、编码它们的载体和治疗用途
WO2020128535A1 (en) * 2018-12-21 2020-06-25 Gyroscope Therapeutics Limited Complement factor i and complement factor i cofactor, vectors encoding therefor and therapeutic use
WO2020210480A3 (en) * 2019-04-10 2020-11-12 University Of Massachusetts Factor h vectors and uses thereof
EP4048321A4 (en) * 2019-10-22 2023-11-22 Applied Genetic Technologies Corporation ADENO-ASSOCIATED VIRUS (AAV) VECTORS FOR THE TREATMENT OF AGE-RELATED MACULAR DEGENERATION AND OTHER EYE DISEASES AND DISORDERS
WO2022165313A1 (en) 2021-02-01 2022-08-04 Regenxbio Inc. Gene therapy for neuronal ceroid lipofuscinoses

Also Published As

Publication number Publication date
CN115976105A (zh) 2023-04-18
US20190177381A1 (en) 2019-06-13
AU2016326627A1 (en) 2018-04-05
KR102773865B1 (ko) 2025-03-04
WO2017053732A3 (en) 2017-05-11
AU2016326627B2 (en) 2022-12-15
AU2023201582B2 (en) 2025-11-13
AU2023201582A1 (en) 2023-04-13
RU2727411C2 (ru) 2020-07-21
KR20180055872A (ko) 2018-05-25
US20210171592A1 (en) 2021-06-10
JP2025029082A (ja) 2025-03-05
JP7261583B2 (ja) 2023-04-20
US12180254B1 (en) 2024-12-31
EP3359663A2 (en) 2018-08-15
RU2018114907A (ru) 2019-10-24
US20250051408A1 (en) 2025-02-13
HK1251482A1 (zh) 2019-02-01
EP3359663A4 (en) 2019-08-14
CN108291216A (zh) 2018-07-17
US10988519B2 (en) 2021-04-27
RU2018114907A3 (OSRAM) 2020-02-26
CN108291216B (zh) 2022-09-16
IL258024B2 (en) 2023-03-01
IL296929B1 (en) 2025-03-01
JP2022000017A (ja) 2022-01-04
JP2018527941A (ja) 2018-09-27
JP2023139256A (ja) 2023-10-03
IL296929B2 (en) 2025-07-01
CA2999299A1 (en) 2017-03-30
IL296929A (en) 2022-12-01
IL258024A (en) 2018-05-31
IL258024B (en) 2022-11-01
JP7324253B2 (ja) 2023-08-09

Similar Documents

Publication Publication Date Title
US12180254B1 (en) Factor H variants for treatment of disease
JP7280853B2 (ja) コレステロールレベルを低下させるためのldlr変異体および組成物中でのそれらの使用
US10781430B2 (en) Compositions useful in treatment of ornithine transcarbamylase (OTC) deficiency
KR20190019065A (ko) 보체-매개 장애의 치료
AU2024250682A1 (en) Aav variants for treatment of complement disorders
HK40086178A (zh) 用於治疗补体介导的疾病的组合物和方法
BR112018005684B1 (pt) Vetor viral recombinante, composição farmacêutica e seus usos
BR122021012149B1 (pt) Plasmídeo para expressão de uma variante da proteína fh com estabilidade melhorada
EP4410988A1 (en) An aav2-vector variant for targeted transfer of genes

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16849709

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 258024

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2999299

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 122021012149

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 2018515539

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112018005684

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2016326627

Country of ref document: AU

Date of ref document: 20160923

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20187011034

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2018114907

Country of ref document: RU

Ref document number: 2016849709

Country of ref document: EP

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16849709

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 112018005684

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20180322