WO2017039144A1 - 성인성 질환 유발 세균 검출 키트 및 방법 - Google Patents

성인성 질환 유발 세균 검출 키트 및 방법 Download PDF

Info

Publication number
WO2017039144A1
WO2017039144A1 PCT/KR2016/007583 KR2016007583W WO2017039144A1 WO 2017039144 A1 WO2017039144 A1 WO 2017039144A1 KR 2016007583 W KR2016007583 W KR 2016007583W WO 2017039144 A1 WO2017039144 A1 WO 2017039144A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
consecutive nucleotides
kit
detecting
oligonucleotide
Prior art date
Application number
PCT/KR2016/007583
Other languages
English (en)
French (fr)
Inventor
임현숙
김유리
Original Assignee
주식회사 바이오세움
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 바이오세움 filed Critical 주식회사 바이오세움
Publication of WO2017039144A1 publication Critical patent/WO2017039144A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Definitions

  • the present invention relates to a kit for detecting adult disease-causing bacteria and a method for detecting adult disease-causing bacteria using the same.
  • STD sexually transmitted disease
  • STI sexually transmitted infection
  • VD venereal disease
  • STD sexually transmitted disease
  • adult disease was mostly considered STD or VD, but recently it is referred to as STI, meaning that anyone can be infected and potentially infect others.
  • STDs may be delivered through needles used by an infected person, as well as through childbirth or breastfeeding.
  • adult diseases are caused by bacteria, fungi, viruses, parasites or protists.
  • Non gonococcal urethritis is a disease in which male urethritis develops but no Neisseria gonorrhoeae is identified. Chlamydia trachomatis and ureaplasma urea plasma urealyticum) and Mycoplasma genitalium. All of these bacteria are common causes of anterior urethritis in men, can combine epididymitis and prostatitis, and become an important cause of infertility. It is also a major cause of cervicitis and pelvic inflammatory diseases in women, and can cause infertility and ectopic pregnancy by causing fallopian tube occlusion.
  • STD is latent asymptomatic and often worsens, and re-infection is easy. Therefore, it is important to develop a method for early detection of STD-causing bacteria to effectively diagnose asymptomatic carriers. For example, if urethritis is found in a patient, it must first be distinguished between gonococcal and non-gonococcus because of different treatment methods and procedures. However, in recent years, there is a tendency that the distinction between the two due to the misuse of the antimicrobial agent and the increase of mixed infection tend to be ambiguous, and more efficient molecular genetic testing is required for accurate diagnosis.
  • Methods for identifying the causative organism of STD (a) a method of confirming the specimen collected from the infected site through the culture / separation; (b) a method of directly smearing and staining epithelial cells of the infected area to identify bacteria; (c) separating and identifying the antibody in the serum of the patient; And (d) molecular genetic techniques such as polymerase chain reaction (PCR) and hybridization.
  • PCR polymerase chain reaction
  • the method of (a) takes a long time and has a disadvantage of low diagnostic sensitivity.
  • the method of (b) is simple but also has low diagnostic sensitivity.
  • the method of (c) has a relatively high sensitivity but has the disadvantage of high cost and dedicated equipment. Therefore, PCR-based molecular genetic methods are the main trend. PCR-based molecular genetic methods analyze sequences for specific genes in bacteria.
  • One aspect of the present invention provides a kit for detecting adult disease-causing bacteria.
  • Another aspect of the present invention provides a method for detecting adult disease-causing bacteria using a kit for detecting adult disease-causing bacteria.
  • Chlamydia comprising (a) a forward primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 1 and a reverse primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 2 oligonucleotide sets for detecting trachomatis ;
  • a Ureaplasma comprising a forward primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 4 and a reverse primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 5 oligonucleotide sets for detecting parvum ;
  • a Neisseria comprising a forward primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 7 and a reverse primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 8 oligonucleotide sets for detecting gonorrhoeae ;
  • Mycoplasma comprising a forward primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 10 and a reverse primer comprising at least 15 consecutive nucleotides of SEQ ID NO: oligonucleotide sets for detecting genitalium ;
  • Ureaplasma comprising a forward primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 13 and a reverse primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 14 oligonucleotide sets for detecting urealyticum ;
  • (f) Mycoplasma comprising a forward primer comprising at least 15 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 16 and a reverse primer comprising at least 15 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 17; oligonucleotide sets for detecting hominis ; And
  • Trichomonas comprising a forward primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 19 and a reverse primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 20
  • a kit for detecting a sexually transmitted disease (STD) -inducing bacterium comprising at least two oligonucleotide sets selected from the group consisting of oligonucleotide sets for detecting vaginalis .
  • the present inventors endeavored to develop a method for detecting adult diseases more quickly and efficiently.
  • the term “primer” may serve as an initiation point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerases) in a suitable temperature and buffer.
  • suitable conditions ie, four different nucleoside triphosphates and polymerases
  • Primers used in the present invention may include naturally occurring dNMPs (ie, dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides.
  • the primer may also comprise ribonucleotides. Suitable lengths of primers are typically 15 to 30 nucleotides, although varying with various factors, such as temperature and the use of the primer.
  • forward primer and reverse primer refer to primers that bind to the 3 'end and the 5' end, respectively, of a portion of the template that is amplified by a polymerase chain reaction.
  • the primer should be long enough to prime the synthesis of the extension product in the presence of the polymerizer. Suitable length of the primer can be determined depending on a number of factors, such as temperature, application and source of the primer.
  • annealing or “priming” refers to the placement of oligodioxynucleotides or nucleic acids in a template nucleic acid, where the polymerase polymerizes the nucleotides to the template nucleic acid or portion thereof. To form complementary nucleic acid molecules.
  • the sequence of the primer does not need to have a sequence that is completely complementary to some sequences of the template, and it is interpreted that it is sufficient to have complementarity within a range capable of hybridizing with the template to perform a primer-specific function. Therefore, the primer set provided in the present invention does not need to have a sequence that is perfectly complementary to the nucleotide sequence of a specific gene present in an adult disease-causing bacterium as a template, and is a range capable of hybridizing to this sequence to act as a primer. Complementarity within is enough.
  • the kit may comprise four or more sets of oligonucleotides.
  • the oligonucleotide set of (a) to (g) may each further comprise a probe coupled to a fluorescent labeling material at the 5 'end, and a fluorescent inhibitor (quencher) at the 3' end. have.
  • probe refers to a linear oligomer with natural or modified monomers or bonds, including deoxyribonucleotides and / or ribonucleotides that can hybridize to a specific polynucleotide sequence.
  • the probe may be single stranded for maximum efficiency in hybridization.
  • the probe according to one embodiment may be a sequence that is perfectly complementary to the polynucleotide sequence that is a template, but may be a sequence that is substantially complementary to the extent that it does not prevent specific hybridization. Conditions suitable for hybridization are as described above.
  • substantially complementary sequence means a sequence that can hybridize with a polynucleotide that is a template under stringent conditions known in the art.
  • stringent conditions refers to Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization , A Practical Approach, IRL Press, Washington, DC (1985), stringent conditions can be determined by controlling temperature, ionic strength (buffer concentration), the presence of compounds such as organic solvents, and the like, and can be determined differently depending on the sequence being hybridized. For example, stringent conditions may be a) washed with 50 ° C.
  • hybridization buffer 50% formamide, 2 ⁇ SSC and 10%. Hybridization to 55 ° C. in dextran sulfate), followed by washing at 55 ° C. with EDTA-containing 0.1 ⁇ SSC.
  • the 5 'end of the probe is labeled with one fluorescent labeling factor selected from the group consisting of FAM, VIC, TET, JOE, HEX, CY3, CY5, ROX, RED610, TEXAS RED, RED670 and NED Can be.
  • the 3 'end of the probe may be labeled with one fluorescent inhibitor (quencher) selected from the group consisting of 6-TAMRA, BHQ-1, BHQ-2, BHQ-3, DABYCL, IBFQ and MGBNFQ.
  • the fluorescent labeling factor and fluorescent inhibitors are currently commercially available in large numbers, and are readily available commercially.
  • the fluorescent labeling factor has different excitation and emission wavelengths depending on the type, and the method of use is also different.
  • the fluorescent labeling factor and fluorescence inhibitor may be labeled on the probe according to conventional methods known in the art.
  • the probe is an oligonucleotide comprising 10 or more consecutive nucleotides of the nucleotide sequence of SEQ ID NO: 3, an oligonucleotide comprising 10 or more consecutive nucleotides of the nucleotide sequence of SEQ ID NO: 6, SEQ ID NO: 9
  • An oligonucleotide comprising at least 10 consecutive nucleotides of the nucleotide sequence of, an oligonucleotide comprising at least 10 consecutive nucleotides of the nucleotide sequence of SEQ ID NO: 12, comprising at least 10 consecutive nucleotides of the nucleotide sequence of SEQ ID NO: 15 Is selected from the group consisting of oligonucleotides comprising at least 10 consecutive nucleotides of the nucleotide sequence of SEQ ID NO: 18 and oligonucleotides comprising at least 10 consecutive nucleotides of the nucleotide sequence of SEQ ID NO: 21.
  • the kit may be carried out by polymerase chain reaction.
  • amplification reaction means a reaction that amplifies a nucleic acid molecule.
  • Various amplification reactions are reported in the art, which include polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcriptase-polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al.
  • PCR polymerase chain reaction
  • RT-PCR reverse transcriptase-polymerase chain reaction
  • Kits according to one embodiment of the present invention can be carried out through a multiplex real-time polymerase chain reaction.
  • the kit comprises a mixture comprising dATP, dCTP, dGTP and dTTP; Buffer solution; And DNA polymerase.
  • DNA polymerases can be used for amplification of the present invention and include, for example, thermal stability obtained from Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu). DNA polymerase, "Clenau” fragment of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase.
  • Buffer solutions are compounds that are added to amplification reactions that modify the stability, activity, and / or lifetime of one or more components of the amplification reaction by adjusting the pH of the amplification reaction, and such buffer solutions are well known in the art, For example, it may be, but is not limited to, Tris, Tricine, MOPS, or HEPES.
  • the kit may comprise a dNTP mixture (dATP, dCTP, dGTP, dTTP) and a DNA polymerase cofactor.
  • the primer set and probe may be packaged in one reaction vessel, strip or microplate, and may be packaged by methods known in the art.
  • Another aspect of the present invention comprises the steps of adding a biological sample to the kit to perform a polymerase chain reaction (PCR); And it provides a method for detecting adult disease-causing bacteria comprising the step of confirming the presence of the adult disease-causing bacteria in the biological sample from the results of the PCR.
  • PCR polymerase chain reaction
  • the detection method of the adult disease-causing bacteria is described in detail for each step as follows.
  • the method may include adding a biological sample to the kit to perform a polymerase chain reaction.
  • the biological sample may be selected from the group consisting of vaginal discharge, urine, blood, serum, plasma, semen and feces, but is not limited thereto.
  • DNA of an adult disease-causing bacterium expected to be infected with the biological sample may be separated and used as a template to improve detection sensitivity.
  • the biological sample may be used as it is. desirable.
  • the DNA may be separated and used by various methods known in the art. Specific methods for this are disclosed in Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press (2001).
  • the polymerase chain reaction is preferably a multiplex real-time PCR (multiplex real-time PCR).
  • the real-time polymerase chain reaction method is a method for detecting and quantitating fluorescence appearing in real time every cycle of PCR by the principle of DNA polymerase and FRET using a device incorporating a thermal cycler and a spectral fluorescence photometer. to be. This method distinguishes specific amplification products from non-specific amplification products and makes it easy to obtain analysis results in an automated fashion.
  • Apparatuses that can be used in the real-time polymerase chain reaction method include, but are not limited to, Applied Biosystems' real-time PCR devices 7900, 7500, 7300, Stratagene's Mx3000p, BioRad's Chromo 4 and Roche Lightcycler 480 devices.
  • the laser of the real-time polymerase chain reaction device may implement a graph as shown in FIGS. 1 to 4 by detecting a fluorescent labeling factor labeled on a probe of the amplified PCR product.
  • real-time polymerase chain reaction may be carried out under conventional conditions known in the art, for example, initial denaturation at 95 ° C. After performing for minutes, denaturation (15 seconds at 95 °C), annealing reaction (10 seconds at 60 °C) and elongation (elongation, 35 seconds at 60 °C) can be carried out under the conditions for a total of 45 times.
  • the step of confirming the presence of adult disease-causing bacteria in the biological sample from the results of the PCR may include the step of confirming the presence of adult disease-causing bacteria in the biological sample from the results of the PCR.
  • the presence or absence of the adult disease-causing bacterium is a Ct value, which is the number of cycles when the PCR amplification product is amplified by a certain amount from a curve which is detected by detecting a fluorescent marker labeled on a probe of the PCR product amplified during the real-time polymerase chain reaction. It can be confirmed by calculating For example, the Ct value may be determined that the adult disease-causing bacterium exists when 15 to 50, or 20 to 40. Meanwhile, the calculation of the Ct value may be automatically performed by a program included in the real time polymerase chain reaction device.
  • the adult disease detected by the kit and the method is itching, discomfort, hypothermia, syphilis, gonorrhea, softness, inguinal granulomas, sexually transmitted lymphoblastoma, non-gonococcal urethritis, genital herpes, Superficial condyloms, quadriplegia and trichomoniasis.
  • the present invention can simultaneously and effectively detect various bacteria causing adult diseases.
  • Figure 2 Mycoplasma in the vaginal discharge sample using the kit for detecting adult disease-causing bacteria according to an embodiment genitalium , Ureaplasma urealyticum , Mycoplasma hominis , Trichomonas This shows the result of amplification curve by real-time PCR reaction of vaginalis .
  • FIG. 3 Chlamydia in urine samples using a kit for detecting adult disease-causing bacteria according to one embodiment trachomatis , Ureaplasma These results show amplification curves by real-time PCR of parvum , Neisseria gonorrhoeae , and Internal Control.
  • Figure 4 Mycoplasma in the urine sample using a kit for detecting adult disease-causing bacteria according to one embodiment genitalium , Ureaplasma urealyticum , Mycoplasma hominis, Trichomonas This shows the result of amplification curve by real-time PCR reaction of vaginalis .
  • Example 1 multiplex real-time PCR for Of primer design
  • Nucleotide sequences from seven strains of sexually Transmitted Disease were obtained from the NCBI database: Mycoplasma genitalium ( MG; ATCC 33530) , Neisseria gonorrhoeae , NG; 16s rRNA gene of ATCC 53420, Ureaplasma Ureaplasma urealyticum , UU; UreB gene of ATCC 27618, Chlamydia trachomatis , CT; Cryptic plasmid ORF1 gene of ATCC VR-1500, Ureaplasma parvum , UP; UreB gene of ATCC 27818), gap gene of Mycoplasma hominis (ATCC 23114) and btub1 gene of Trichomonas vaginalis ( TV; ATCC 30001).
  • Mycoplasma genitalium MG; ATCC 33530
  • Neisseria gonorrhoeae NG
  • 16s rRNA gene of ATCC 53420 Ureaplasma Ureaplasm
  • Vaginal secretions and urine were used as samples for simultaneously detecting seven adult diseases. Ten vaginal secretions or 10 urine samples from 20 suspected adult diseases were used as samples.
  • vaginal secretions 300 ⁇ l were centrifuged at 12,000 rpm for 3 minutes to remove supernatant, and vortexed by adding 50 ⁇ l of 1 ⁇ Dilution Buffer (HelixAmp Direct PCR) to the tube containing the precipitate. Thereafter, the mixture was left at room temperature for 3 minutes, centrifuged at 12,000 rpm for 2 minutes, and only 3 ⁇ l of the liquid portion of the upper layer was used for multiplex real-time PCR.
  • 1 ⁇ Dilution Buffer HelixAmp Direct PCR
  • the supernatant was removed by centrifuging 500 ⁇ l of urine at 12,000 rpm for 3 minutes, vortexing by adding 1000 ⁇ l of 1 ⁇ PBS, and then centrifuging at 12,000 rpm for 3 minutes to remove the supernatant. . 50 ⁇ l of 1x Dilution Buffer (HelixAmp Direct PCR, Nanohelix, Daejeon, Korea) was added to the tube containing the precipitate, followed by vortexing, and then allowed to stand at room temperature for 3 minutes and centrifuged at 12,000 rpm for 2 minutes. Only 3 portions were taken and used for multiplex real time PCR.
  • 1x Dilution Buffer HelixAmp Direct PCR, Nanohelix, Daejeon, Korea
  • Comparative example 1 Traditional STD test method and result (base sequence analysis test)
  • DNA was extracted from each of 10 kinds of vaginal secretions or urine collected from 20 suspected adult diseases used in Example 2.
  • QIAamp DNA Mini Kit (Qiagen, Germany) was used to extract DNA from vaginal secretion samples, and QIAamp Viral RNA Mini Kit (Qiagen, Germany) was used to extract DNA from urine samples.
  • PCR reaction was performed in a reaction solution containing 2 ⁇ l of extracted DNA, 22.5 PCR mixture (BioSewoom, Seoul, Korea), 12.5 ⁇ l of primer (10 nM) and distilled water without nuclease, and adjusted to a total volume of 25 ⁇ l. It was.
  • PCR reaction was 10 minutes at 95 °C; 45 cycles of 30 seconds at 95 ° C., 30 seconds at 60 ° C., 30 seconds at 72 ° C .; 5 minutes at 72 °C was performed on AB 2720 PCR equipment (Applied Biosystems). After the reaction, the PCR product was subjected to electrophoresis on 1.5% agarose gel, and the PCR product was confirmed by UV spectrophotometer (Thermo Scientific, USA).
  • the amplified PCR product was 0.2 ⁇ l of Exonuclease I (20 U / ⁇ l, NEB, UK), 0.8 ⁇ l Shrimp alkaline phosphatase (1 U / ⁇ l, NEB, UK), 10X Exo buffer (NEB, UK) and nuclease. 4.25 ⁇ l of distilled water without (nuclease) was added, followed by purification at 30 ° C. for 30 minutes at 85 ° C. for 15 minutes.
  • Each PCR reaction was prepared by the vaginal discharge prepared in Example 2, 3 ⁇ l each of the urine sample, 12.5 ⁇ l 2x Direct PCR 2 (Nanohelix, Daejeon, Korea), each primer (6-10 nM) set and probe (3-5 nM). 3 ⁇ l, 0.2 ⁇ l of internal control, and the reaction solution was prepared in a total volume of 25 ⁇ l with distilled water without nuclease. 25 ⁇ l of distilled water was used as a negative control (blank).
  • Real-time PCR was performed for 2 minutes at 50 ° C. using a DNA thermal cycler (7300 Real Time PCR system-Applied Biosystems); 10 minutes at 95 ° C; 45 cycles of 15 seconds at 95 ° C and 45 seconds at 60 ° C.
  • Real-time polymerase chain reaction was performed by dividing into a total of two sets, and the configuration of the reporter fluorescent labeling material and the set used were as shown in Table 3 below.
  • PCR products were detected by the 7300 real time PCR system (Applied Biosystems).
  • fluorescent Taqman probes are specifically annealed to complementary sequences between forward and reverse primer sites on template DNA and degraded by the 5 ' ⁇ 3' exonuclease activity of DNA polymerase.
  • the reporter dye Once separated from the quencher, the reporter dye emits fluorescence, which is recorded by the 7300 real time PCR system. By quantifying and comparing the fluorescence signals, the software will determine whether there is a specific gene for each bacterium on the plate.
  • Figure 1 is a set 1
  • Figure 2 shows the amplification curve by the real-time PCR reaction of the set 2, a result of showing the amplification pattern for each wavelength band for the vaginal discharge sample.
  • Table 4 is a result of calculating the Ct value (the number of cycles of the point where the PCR amplification product increases exponentially and meets the threshold line) from the amplification curves of FIGS. 1 and 2.
  • Figure 3 is a set 1
  • Figure 4 shows the amplification curve by the real-time PCR reaction of the set 2, a result of showing the amplification pattern for each wavelength band for the urine sample.
  • Table 5 shows the results of calculating the Ct value from the amplification curves of FIGS. 3 and 4. From these results, it was confirmed that the greater the degree of bacterial infection, the faster fluorescence amplification occurred, which can be confirmed by the Ct values in Tables 4 and 5.
  • the kit and method of the present invention can be applied directly to the vaginal discharge or urine sample without any DNA extraction, and the amplification pattern can be confirmed in real time, thereby greatly reducing the test time. There is an advantage that it can be reduced to efficiently detect bacteria derived from adult diseases.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Botany (AREA)
  • Mycology (AREA)

Abstract

본 발명은 성인성 질환 유발 세균 검출용 키트 및 이를 이용한 성인성 질환 유발 세균 검출 방법에 관한 것이다. 본 발명의 일 구체예에 따르면, 본 발명은 성인성 질환을 유발시키는 다양한 세균을 동시에 효과적이고 간편하게 검출할 수 있다.

Description

성인성 질환 유발 세균 검출 키트 및 방법
본 발명은 성인성 질환 유발 세균 검출용 키트 및 이를 이용한 성인성 질환 유발 세균 검출 방법에 관한 것이다.
성인성 질환(sexually transmitted disease, STD)은 성-매개 질환(sexually transmitted infection, STI) 또는 성병(venereal disease, VD)으로도 알려져 있으며, 인간의 성적 행위로 인해 전파되는 질병을 통틀어 지칭한다. 과거에는 성인성 질환은 대부분 STD 또는 VD로 간주되었으나, 최근에는 STI로 언급되고 있는데, 이는 누구나 감염될 수 있으며, 타인을 잠재적으로 감염시킬 수 있음을 포괄하는 의미이다. 또한, 일부 STD는 출산 또는 모유 수유 뿐 아니라, 감염된 사람이 이용한 주사바늘을 통해 전달될 수 있다. 일반적으로, 성인성 질환은 박테리아, 곰팡이, 바이러스, 기생충 또는 원생생물에 의해 발병된다.
비임균성 요도염은 남성에서 요도염이 발생하였으나 나이세리아 고노레아(Neisseria gonorrhoeae, 임균)이 확인되지 않는 질환으로, 비임균성 요도염의 원인균으로는 클라미디아 트라코마티스(Chlamydia trachomatis), 유레아플라즈마 유레아라이티쿰(Ureaplasma urealyticum), 마이코플라즈마 제니탈리움(Mycoplasma genitalium)이 있다. 이들 세균은 모두 공통적으로 남성에서 요도염(anterior urethritis)의 중요 원인이 되며, 부고환염 및 전립선염을 합병할 수 있으며, 불임의 중요한 원인이 된다. 또한, 여성에서는 자궁경부염(cervicitis)과 골반염증성질환(pelvic inflammatory diseases)의 주된 원인이며, 나팔관 폐쇄(fallopian tube occlusion)를 일으킴으로써 불임과 이소성 임신(ectopic pregnancy) 등의 합병증을 유발할 수 있다.
STD는 다른 질환과 달리 무증상으로 잠복되어 증세가 악화되는 경우가 많고, 재감염이 용이하므로 STD의 원인균을 조기에 검출하여 무증상의 보균자도 효과적으로 진단할 수 있는 방법의 개발이 중요하다. 예를 들어, 어떤 환자에서 요도염이 발견되면 그것이 임균성인지 비임균성인지를 먼저 감별해야 하는데, 그 이유는 치료 방법과 경과가 서로 다르기 때문이다. 그러나, 근래에는 항균제의 오남용에 따른 세균의 변이와 혼합감염의 증가로 인해 양자간의 구별이 애매한 경향이 많고, 정확한 진단을 위해서는 보다 효율적인 분자유전자적 검사법이 요구된다.
STD의 원인균을 확인하는 방법으로는, (a) 감염부위에서 채취된 가검물을 배양/분리를 통해 확인하는 방법; (b) 감염부위의 상피세포를 직접 도말하고 염색하여 균을 확인하는 방법; (c) 환자의 혈청에서 항체를 분리, 확인하는 방법; 및 (d) PCR(polymerase chain reaction) 및 혼성화(hybridization) 등의 분자 유전학적 기법을 이용하는 방법이 있다. 상기 (a)의 방법은 장시간이 소요되고, 진단 민감성이 낮다는 단점이 있으며, 상기 (b)의 방법은 간편하지만 역시 진단 민감도이 낮다. 또한, 상기 (c)의 방법은 민감성은 비교적 높으나 고비용과 전용 장비가 필요하다는 단점이 있다. 따라서, PCR-기반의 분자유전학적 방법이 주로 사용되는 추세이다. PCR-기반의 분자유전학적 방법은 세균의 특정 유전자에 대한 염기서열을 분석한다.
현재, 나이세리아 고노레아 감염 또는 클라미디아 감염만을 검사하는 진단 키트는 이미 상업화되어 이용되고 있다. 그러나, 신속하고 정확하며, 저비용으로 여러 STD 원인균을 동시에 분석하고, 항균제 내성 등의 정보도 실시간으로 동시에 확인할 수 있는 멀티플렉스 실시간 PCR 기술을 이용한 STD 진단 키트의 개발이 당업계에서는 여전히 요구되고 있는 실정이다.
본 발명의 일 양상은 성인성 질환 유발 세균 검출용 키트를 제공한다.
본 발명의 다른 양상은 성인성 질환 유발 세균 검출용 키트를 이용한 성인성 질환 유발 세균 검출 방법을 제공한다.
본 발명의 일 양상은 (a) 서열번호 1의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 정방향 프라이머 및 서열번호 2의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 역방향 프라이머를 포함하는 Chlamydia trachomatis를 검출하기 위한 올리고뉴클레오티드 세트;
(b) 서열번호 4의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 정방향 프라이머 및 서열번호 5의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 역방향 프라이머를 포함하는 Ureaplasma parvum를 검출하기 위한 올리고뉴클레오티드 세트;
(c) 서열번호 7의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 정방향 프라이머 및 서열번호 8의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 역방향 프라이머를 포함하는 Neisseria gonorrhoeae를 검출하기 위한 올리고뉴클레오티드 세트;
(d) 서열번호 10의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 정방향 프라이머 및 서열번호 11의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 역방향 프라이머를 포함하는 Mycoplasma genitalium를 검출하기 위한 올리고뉴클레오티드 세트;
(e) 서열번호 13의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 정방향 프라이머 및 서열번호 14의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 역방향 프라이머를 포함하는 Ureaplasma urealyticum를 검출하기 위한 올리고뉴클레오티드 세트;
(f) 서열번호 16의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 정방향 프라이머 및 서열번호 17의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 역방향 프라이머를 포함하는 Mycoplasma hominis를 검출하기 위한 올리고뉴클레오티드 세트; 및
(g) 서열번호 19의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 정방향 프라이머 및 서열번호 20의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 역방향 프라이머를 포함하는 Trichomonas vaginalis를 검출하기 위한 올리고뉴클레오티드 세트로 이루어진 군으로부터 선택되는 2 이상의 올리고뉴클레오티드 세트를 포함하는 성인성 질환(sexually transmitted disease, STD) 유발 세균 검출용 키트를 제공한다.
본 발명자들은 성인성 질환을 보다 신속하고 효율적으로 검출할 수 있는 방법을 개발하고자 노력한 결과, 성인성 질환 유발 세균에 특이적인 프라이머 및 프로브를 제작하고, 멀티플렉스 실시간 PCR(multiplex real-time polymerase chain reaction)을 실시하여 다양한 성인성 질환 유발 세균을 동시에 검출할 수 있는 최적의 방법을 확립하였다.
본 명세서에서, 용어 "프라이머(primer)"는 적합한 온도 및 완충액 내에서 적합한 조건(즉, 4종의 다른 뉴클레오사이드 트리포스페이트 및 중합반응 효소) 하에서 주형-지시 DNA 합성의 개시점으로 작용할 수 있는 단일-가닥 올리고뉴클레오티드를 의미한다. 본 발명에서 이용되는 프라이머는 자연(naturally occurring) dNMP(즉, dAMP, dGMP, dCMP 및 dTMP), 변형 뉴클레오티드 또는 비-자연 뉴클레오티드를 포함할 수 있다. 또한, 프라이머는 리보뉴클레오티드도 포함할 수 있다. 프라이머의 적합한 길이는 다양한 요소, 예를 들어, 온도와 프라이머의 용도에 따라 변화가 있지만 전형적으로 15 내지 30개의 뉴클레오티드이다. 짧은 프라이머 분자는 주형과 충분히 안정된 혼성 복합체를 형성하기 위하여 일반적으로 보다 낮은 온도를 요구한다. 용어 "전방향 프라이머(forward primer)" 및 "역방향 프라이머(reverse primer)"는 중합 효소 연쇄 반응에 의해 증폭되는 주형의 일정한 부위의 3' 말단 및 5' 말단에 각각 결합하는 프라이머를 의미한다.
프라이머는, 중합제의 존재 하에서 연장 산물의 합성을 프라이밍시킬 수 있을 정도로 충분히 길어야 한다. 프라이머의 적합한 길이는 다수의 요소, 예를 들어, 온도, 응용분야 및 프라이머의 소스(source)에 따라 결정될 수 있다. 용어 "어닐링(annealing)" 또는 "프라이밍(priming)"은 주형 핵산에 올리고디옥시뉴클레오티드 또는 핵산이 병치(apposition)되는 것을 의미하며, 상기 병치는 중합효소가 뉴클레오티드를 중합시켜 주형 핵산 또는 그의 일부분에 상보적인 핵산 분자를 형성하게 한다.
프라이머의 서열은 주형의 일부 서열과 완전하게 상보적인 서열을 가질 필요는 없으며, 주형과 혼성화 되어 프라이머 고유의 작용을 할 수 있는 범위 내에서의 상보성을 가지면 충분한 것으로 해석된다. 따라서, 본 발명에서 제공하는 프라이머 세트는 주형인 성인성 질환 유발 세균 내에 존재하는 특이적 유전자의 염기서열에 완벽하게 상보적인 서열을 가질 필요는 없으며, 이 서열에 혼성화되어 프라이머 작용을 할 수 있는 범위 내에서 상보성을 가지면 충분하다.
일 구체예에 따르면, 상기 키트는 4 이상의 올리고뉴클레오티드 세트를 포함할 수 있다.
일 구체예에 따르면, 상기 (a) 내지 (g)의 올리고뉴클레오티드 세트는 각각 5' 말단에 형광 표지 물질이 결합되고, 3' 말단에 형광 억제 물질(quencher)이 결합된 프로브를 더 포함할 수 있다.
용어 "프로브(probe)"는 특정 폴리뉴클레오티드 서열에 혼성화될 수 있는 디옥시리보뉴클레오티드 및/또는 리보뉴클레오티드를 포함하는 자연 또는 변형된 모노머(monomer) 또는 결합을 갖는 선형의 올리고머(oligomer)를 의미한다. 예를 들어, 프로브는 혼성화에서의 최대 효율을 위하여 단일 가닥일 수 있다.
일 구체예에 따른 프로브는 주형이 되는 폴리뉴클레오티드 서열에 완전하게 (perfectly) 상보적인 서열일 수 있으나, 특이적 혼성화를 방해하지 않는 범위 내에서 실질적으로 상보적인 서열일 수도 있다. 혼성화에 적합한 조건은 상술한 바와 같다. 용어 "실질적으로 상보적인 서열(substantially complementary sequence)"은 당업계에 공지된 엄격 조건 하에서 주형이 되는 폴리뉴클레오티드와 혼성화될 수 있는 서열을 의미한다. 용어 "엄격 조건(stringent conditions)"은 Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001) 및 Haymes, B. D., et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985)에 개시되어 있으며, 엄격 조건은 온도, 이온세기 (완충액 농도) 및 유기 용매와 같은 화합물의 존재 등을 조절하여 결정될 수 있고, 혼성화되는 서열에 따라 다르게 결정될 수 있다. 예를 들어, 엄격 조건은 a) 50℃ 온도 및 0.015 M 소듐 클로라이드/0.0015 M 소듐 시트레이트/0.1% 소듐 도데실 설페이트로 세척하거나, b) 혼성화 완충액 (50% 포름아미드, 2 x SSC 및 10% 덱스트란 설페이트 포함)에서 55℃로 혼성화한 다음, EDTA-함유 0.1 x SSC로 55℃에서 세척하는 조건으로 이루어질 수 있다.
일 구체예에 따르면, 상기 프로브의 5' 말단은 FAM, VIC, TET, JOE, HEX, CY3, CY5, ROX, RED610, TEXAS RED, RED670 및 NED로 이루어진 군으로부터 선택되는 하나의 형광 표지 인자로 표지될 수 있다. 또한, 상기 프로브의 3' 말단은 6-TAMRA, BHQ-1, BHQ-2, BHQ-3, DABYCL, IBFQ 및 MGBNFQ로 이루어진 군으로부터 선택되는 하나의 형광 억제 물질(quencher)로 표지된 것일 수 있다. 상기 형광 표지 인자 및 형광 억제 물질은 현재 시중에 다수 종이 시판되고 있으므로, 상업적으로 용이하게 입수 가능하다. 상기 형광 표지 인자는 종류에 따라 여기 및 방출 파장이 다르며, 사용 방법 또한 상이하다. 한편, 상기 형광 표지 인자 및 형광 억제 물질은 당업계에 알려진 통상의 방법에 따라 상기 프로브에 표지될 수 있다.
일 구체예에 따르면, 상기 프로브는 서열번호 3의 염기 서열 중 10개 이상의 연속적인 뉴클레오티드를 포함하는 올리고뉴클레오티드, 서열번호 6의 염기 서열 중 10개 이상의 연속적인 뉴클레오티드를 포함하는 올리고뉴클레오티드, 서열번호 9의 염기 서열 중 10개 이상의 연속적인 뉴클레오티드를 포함하는 올리고뉴클레오티드, 서열번호 12의 염기 서열 중 10개 이상의 연속적인 뉴클레오티드를 포함하는 올리고뉴클레오티드, 서열번호 15의 염기 서열 중 10개 이상의 연속적인 뉴클레오티드를 포함하는 올리고뉴클레오티드, 서열번호 18의 염기 서열 중 10개 이상의 연속적인 뉴클레오티드를 포함하는 올리고뉴클레오티드 및 서열번호 21의 염기 서열 중 10개 이상의 연속적인 뉴클레오티드를 포함하는 올리고뉴클레오티드로 이루어진 군으로부터 선택되는 것일 수 있다.
일 구체예에 따르면, 상기 키트는 중합효소 연쇄반응에 의해 실시될 수 있다.
본 명세서에 기재된 용어 "증폭 반응"은 핵산 분자를 증폭하는 반응을 의미한다. 다양한 증폭 반응들이 당업계에 보고 되어 있으며, 이는 중합효소 연쇄반응(PCR)(미국 특허 제4,683,195, 4,683,202, 및 4,800,159호), 역전사-중합효소 연쇄반응(RT-PCR)(Sambrook 등, Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001)), Miller, H. I.(WO 89/06700) 및 Davey, C. 등(EP 329,822)의 방법, 멀티플렉스 PCR(McPherson and Moller, 2000), 리가아제 연쇄 반응(ligase chain reaction; LCR), Gap-LCR(WO 90/01069), 복구 연쇄 반응(repair chain reaction; EP 439,182), 전사-중재 증폭(transcription-mediated amplification; TMA) (WO 88/10315), 자가 유지 염기서열 복제(self sustained sequence replication)(WO 90/06995), 타깃 폴리뉴클레오티드 염기서열의 선택적 증폭(selective amplification of target polynucleotide sequences)(미국 특허 제6,410,276호), 컨센서스 서열 프라이밍 중합효소 연쇄 반응(consensus sequence primed polymerase chain reaction; CP-PCR)(미국 특허 제4,437,975호), 임의적 프라이밍 중합효소 연쇄 반응(arbitrarily primed polymerase chain reaction; AP-PCR)(미국 특허 제5,413,909호 및 제5,861,245호), 핵산 염기서열 기반 증폭(nucleic acid sequence based amplification; NASBA)(미국 특허 제5,130,238호, 제5,409,818호, 제5,554,517호, 및 제6,063,603호), 가닥 치환 증폭(strand displacement amplification) 및 고리-중재 항온성 증폭(loop-mediated isothermal amplification; LAMP)를 포함하나, 이에 한정되지는 않는다. 사용 가능한 다른 증폭 방법들은 미국특허 제5,242,794, 5,494,810, 4,988,617호 및 미국 특허 제09/854,317호에 기술되어 있다. 가장 바람직하게는. 본 발명의 일 구체예에 따른 키트는 멀티플렉스 실시간 중합효소 연쇄반응을 통해 실시될 수 있다.
일 구체예에 따르면, 상기 키트는 dATP, dCTP, dGTP 및 dTTP를 포함하는 혼합물; 완충 용액; 및 DNA 중합 효소를 더 포함할 수 있다.
다양한 DNA 중합효소가 본 발명의 증폭에 이용될 수 있으며, 예를 들어, Thermus aquaticus(Taq), Thermus thermophilus(Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis 또는 Pyrococcus furiosus(Pfu)로부터 수득한 열 안정성 DNA 중합효소, E. coli DNA 중합효소 I의 "클레나우" 단편, 열안정성 DNA 중합효소 및 박테리오파아지 T7 DNA 중합효소를 포함한다. 완충 용액은 증폭 반응의 pH를 조절함으로써 증폭 반응의 하나 이상의 구성 요소의 안정성, 활성, 및/또는 수명을 변형시키는 증폭 반응에 첨가되는 화합물로서, 이러한 완충 용액들은 당업계에 잘 알려져 있으며, 예를 들어, Tris, Tricine, MOPS, 또는 HEPES일 수 있으나 이에 한정하지는 않는다. 이 외에도, 상기 키트는 dNTP 혼합물(dATP, dCTP, dGTP, dTTP) 및 DNA 중합 효소 조인자를 포함할 수 있다. 상기 프라이머 세트 및 프로브는 하나의 반응 용기, 스트립 또는 마이크로 플레이트에 패키징될 수 있으며, 당업계에 공지된 방법으로 패키징될 수 있다.
본 발명의 다른 양상은 생물학적 시료를 상기 키트에 첨가하여 중합효소 연쇄반응(polymerase chain reaction, PCR)을 수행하는 단계; 및 상기 PCR을 수행한 결과로부터 상기 생물학적 시료 중의 성인성 질환 유발 세균의 존재 여부를 확인하는 단계를 포함하는 성인성 질환 유발 세균의 검출 방법을 제공한다.
상기 성인성 질환 유발 세균의 검출 방법을 각각의 단계별로 상세하게 설명하면 다음과 같다.
먼저, 상기 방법은 생물학적 시료를 상기 키트에 첨가하여 중합효소 연쇄반응을 수행하는 단계를 포함할 수 있다.
일 구체예에 따르면, 상기 생물학적 시료는 질 분비물, 소변, 혈액, 혈청, 혈장, 정액 및 대변으로 이루어진 군으로부터 선택될 수 있으나, 이에 한정하지는 않는다. 중합효소 연쇄반응의 수행 시, 검출의 민감도를 향상시키기 위하여 상기 생물학적 시료에 감염되어 있을 것으로 예상되는 성인성 질환 유발 세균의 DNA를 분리하여 주형으로 사용할 수 있으나, 상기 생물학적 시료를 그대로 사용하는 것이 더욱 바람직하다. DNA를 분리하여 사용하는 경우, 당업계에 공지된 다양한 방법을 통해 DNA를 분리하여 사용할 수 있다. 이에 대한 구체적인 방법은 Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press (2001)에 개시되어 있다.
일 구체예에 따르면, 상기 중합효소 연쇄반응은 실시간 다중 중합효소 연쇄반응(multiplex real-time PCR)인 것이 바람직하다.
상기 실시간 중합효소 연쇄반응 방법은 열 순환기(thermal cycler) 및 분광 형광 광도계가 일체화된 장치를 이용하여, DNA 중합 효소와 FRET의 원리에 의해 PCR의 매 주기마다 실시간으로 나타나는 형광을 검출하고 정량하는 방법이다. 이러한 방법은 특이적인 증폭 산물을 비 특이적인 증폭 산물로부터 구별하여 확인할 수 있으며, 자동화된 양상으로 분석 결과를 쉽게 입수할 수 있다. 상기 실시간 중합효소 연쇄반응 방법에 사용할 수 있는 기기로는 Applied Biosystems 사의 실시간 PCR 기기 7900, 7500, 7300, Stratagene 사의 Mx3000p, BioRad 사의 Chromo 4 및 Roche Lightcycler 480 기기 등이 있으나, 이로 한정되는 것은 아니다. PCR 과정에서 상기 실시간 중합효소 연쇄반응 기기의 레이저는 증폭된 PCR 산물의 프로브에 표지된 형광 표지 인자를 감지하여 도 1 내지 도 4와 같은 그래프를 구현할 수 있다.
일 구체예에 따른 성인성 질환 유발 세균의 검출 방법에 있어서, 실시간 중합효소 연쇄반응은 당업계에 알려진 통상적인 조건으로 실시할 수 있으며, 예를 들어, 초기 변성(initial denaturation)을 95℃에서 10분 동안 수행한 후, 변성(denaturation, 95℃에서 15초), 어닐링 반응(60℃에서 10초) 및 신장(elongation, 60℃에서 35초)을 총 45회 실시하는 조건으로 수행할 수 있다.
마지막으로, 상기 PCR을 수행한 결과로부터 상기 생물학적 시료 중의 성인성 질환 유발 세균의 존재 여부를 확인하는 단계를 포함할 수 있다.
상기 성인성 질환 유발 세균의 존재 유무는 상기 실시간 중합효소 연쇄반응 과정에서 증폭된 PCR 산물의 프로브에 표지된 형광 표지 인자를 감지하여 나타나는 곡선으로부터, PCR 증폭 산물이 일정량 증폭되었을 때의 사이클 수인 Ct 값을 계산함으로써 확인할 수 있다. Ct 값은 예를 들어, 15 내지 50, 또는 20 내지 40인 경우에 상기 성인성 질환 유발 세균가 존재한다고 판단할 수 있다. 한편, 상기 Ct 값의 계산은 상기 실시간 중합효소 연쇄반응 기기 내에 포함된 프로그램에 의해 자동으로 수행될 수 있다.
본 발명의 일 구체예에 따르면, 상기 키트 및 방법에 의해 검출되는 성인성 질환은 가려움증, 불쾌감, 냉대하증, 매독, 임질, 연성하감, 서혜부 육아종, 성병성임파육아종, 비임균성요도염, 음부포진, 첨규 콘딜롬, 사면발이증 및 트리코모나스증을 포함하지만, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 본 발명은 성인성 질환을 유발시키는 다양한 세균을 동시에 효과적이고 간편하게 검출할 수 있다.
도 1은 일 구체예에 따른 성인성 질환 유발 세균 검출용 키트를 이용하여 질 분비물 샘플을 대상으로 Chlamydia trachomatis , Ureaplasma parvum , Neisseria gonorrhoeae, Internal Control의 실시간 PCR 반응에 의한 증폭 곡선을 나타낸 결과이다.
도 2는 일 구체예에 따른 성인성 질환 유발 세균 검출용 키트를 이용하여 질 분비물 샘플을 대상으로 Mycoplasma genitalium , Ureaplasma urealyticum , Mycoplasma hominis , Trichomonas vaginalis의 실시간 PCR 반응에 의한 증폭 곡선을 나타낸 결과이다.
도 3은 일 구체예에 따른 성인성 질환 유발 세균 검출용 키트를 이용하여 소변 샘플을 대상으로 Chlamydia trachomatis , Ureaplasma parvum , Neisseria gonorrhoeae, Internal Control의 실시간 PCR 반응에 의한 증폭 곡선을 나타낸 결과이다.
도 4는 일 구체예에 따른 성인성 질환 유발 세균 검출용 키트를 이용하여 소변 샘플을 대상으로 Mycoplasma genitalium , Ureaplasma urealyticum , Mycoplasma hominis, Trichomonas vaginalis의 실시간 PCR 반응에 의한 증폭 곡선을 나타낸 결과이다.
이하 하나 이상의 구체예를 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 하나 이상의 구체예를 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1: 멀티플렉스 실시간 PCR을 위한 프라이머의 설계
미국국립생명공학정보센터(NCBI)의 데이터베이스에서 하기 7종의 성인성 질환(Sexually Transmitted Disease) 관련 균주 유전자의 염기서열을 얻었다: 마이코플라즈마 제니탈리움(Mycoplasma genitalium, MG; ATCC 33530)의 gap 유전자, 나이세리아 고노레아(Neisseria gonorrhoeae , NG; ATCC 53420)의 16s rRNA 유전자, 유레아플라즈마 유레아라이티쿰(Ureaplasma urealyticum , UU; ATCC 27618)의 ureB 유전자, 클라미디아 트라코마티스(Chlamydia trachomatis , CT; ATCC VR-1500)의 cryptic plasmid ORF1 유전자, 유레아플라즈마 파르붐(Ureaplasma parvum , UP; ATCC 27818)의 ureB 유전자, 마이코플라즈마 호미니스(Mycoplasma hominis; ATCC 23114)의 gap 유전자 및 트리코모나스 바지날리스(Trichomonas vaginalis, TV; ATCC 30001)의 btub1 유전자. 상기 염기서열을 이용하여 Primer3 프로그램으로 프라이머를 디자인한 후, NCBI의 블라스트(Basic Local Alignment Search Tool)에서 특이적 서열을 선별하였다. 한편, 내적 대조군(internal control, IC)은 BCR-ABL 유전자의 염기서열로부터 프라이머를 디자인하였다. 이후, 상기 프라이머에 의한 PCR 증폭 결과물을 전기영동을 통해 확인하였으며, 멀티플렉스 실시간 PCR을 수행하는데 사용된 프라이머의 염기서열을 하기 표 1에 기재하였다.
Target Component Sequence Size(bp)
CT CT probe FAM 5'-TTATCAAATGACAAGCTTAGATC-3' MGBNFQ(서열번호 3) 81 bp
CT F 5'-AAATCGTATCTCGGGTTAATGTTGC-3'(서열번호 1)
CT-cryptic-R 5'-ATCGAGGAAAACCGTATGAGAAAC-3'(서열번호 2)
UP UP probe VIC 5'-CAGGTACTGCTATTCG-3' MGBNFQ(서열번호 6) 180 bp
UP F2 5'-GATCACATTTTCACTTGTTTGAAGTG-3'(서열번호 4)
UP R2 5'-GTGTTCCGGCTAAATCAATAAT-3'(서열번호 5)
NG NG probe TEXAS RED 5'-AGGGGACCTTCGGGCCTTGCGCT-3' BHQ-2(서열번호 9) 151 bp
NG-7F 5'-TATCGGAACGTACCGGGTAGC-3'(서열번호 7)
NG-1R 5'-TGGTGGGCCTTTATTATGCCAACC-3'(서열번호 8)
MG MG probe FAM 5'-CTTTTAGCACCTGCTTTT-3' MGBNFQ(서열번호 12) 62 bp
MG-gap-F 5'-GCGGGTGCGGAAATAATTAC-3'(서열번호 10)
MG-gap-R 5'-GAAGAGGGTGTTCTCTCCA-3'(서열번호 11)
UU UU probe VIC 5'-CAGGTACTGCTATTCG-3' MGBNFQ(서열번호 15) 125 bp
UU3 F 5'-AAAGGAAACGAAGACAAAGAACGT-3'(서열번호 13)
UU3 R 5'-CGTGTTCCGACTAAATCAATAAC-3'(서열번호 14)
MH MH probe TEXAS RED 5'-AAGAGCAGCTGCTTCAAACATGGTTCCA-3'BHQ-2(서열번호 18) 113 bp
MH-F 5'-CACTCATATACAGCAGACCAAAGATTACA-3'(서열번호 16)
MH-3R 5'-ATTGCTATTGCAGCACCAGTTGT-3'(서열번호 17)
TV TV probe CY5 5'-TGTCATCCGTAAGGAAGCTGAATCCTGC-3'IBRQ(서열번호 21) 71 bp
STDII-TV F 5'-GAACTTTGCGAATCCATCCTC-3'(서열번호 19)
STDII-TV-R 5'-TGGAAGCCCTGAAGGCAG-3'(서열번호 20)
IC IC Probe Cy5 5'-CCCTTCAGCGGCCAGTAGCATCTG-3' IBRQ(서열번호 24) 76 bp
NTM IC-F 5'-TCCGCTGACCATCAATAAGGAAGAA-3'(서열번호 22)
NTM IC-R 5'-TTCACTCAGACCCTGAGGCTCAAA-3'(서열번호 23)
실시예 2: 성인성 질환 검출을 위한 시료 준비
7종의 성인성 질환을 동시에 검출하기 위한 시료로서, 질 분비물 및 소변을 사용하였다. 성인성 질환이 의심되는 환자 20명으로부터 채취한 질 분비물 또는 소변 각각 10종을 샘플로 사용하였다.
300 ㎕의 질 분비물을 12,000 rpm에서 3분 동안 원심 분리하여 상층액을 제거하고, 침전물이 들어있는 튜브에 1x Dilution Buffer(HelixAmp Direct PCR) 50 ㎕를 첨가하여 볼텍싱하였다. 이후, 상온에서 3분 동안 방치한 다음, 12,000 rpm에서 2분 동안 원심 분리하여 상층의 액체 부분만 3 ㎕ 만큼 취하여 멀티플렉스 실시간 PCR에 사용하였다.
또한, 500 ㎕의 소변을 12,000 rpm, 3분 동안 원심 분리하여 상층액을 제거하고, 1000 ㎕의 1X PBS를 첨가하여 볼텍싱한 다음, 다시 12,000 rpm, 3분 동안 원심 분리하여 상층액을 제거하였다. 침전물이 들어있는 튜브에 1x Dilution Buffer(HelixAmp Direct PCR, Nanohelix, Daejeon, Korea) 50 ㎕를 첨가하여 볼텍싱한 다음, 상온에서 3분 동안 방치하고, 12,000 rpm에서 2분 동안 원심 분리하여 상층의 액체 부분만 3 ㎕ 만큼 취하여 멀티플렉스 실시간 PCR에 사용하였다.
비교예 1: 기존 STD 검사 방법 및 결과(염기서열 분석 검사)
실시예 2에서 사용한 성인성 질환이 의심되는 환자 20명으로부터 채취한 질 분비물 또는 소변 각각 10종으로부터 DNA를 추출하였다. 질 분비물 샘플로부터 DNA 추출 시에는 QIAamp DNA Mini Kit(Qiagen, Germany)를 사용하였고, 소변 샘플로부터 DNA 추출 시에는 QIAamp Viral RNA Mini Kit(Qiagen, Germany)를 사용하였으며, 각 키트의 사용설명서에 따라 DNA를 추출하였다. 추출한 DNA 2 ㎕, 2x PCR mixture(BioSewoom, Seoul, Korea) 12.5 ㎕, 프라이머(10 nM)를 포함하고, 핵산분해효소(nuclease)가 없는 증류수로 총 부피 25 ㎕로 맞춘 반응액에서 PCR 반응을 실시하였다. PCR 반응은 95℃에서 10분; 95℃에서 30초, 60℃ 30초, 72℃에서 30초의 45 사이클; 72℃에서 5분의 조건으로 AB 2720 PCR 장비(Applied Biosystems)에서 시행하였다. 반응이 끝난 후, PCR 산물은 1.5% agarose gel 상에서 전기영동을 실시하였으며, UV spectrophotometer(Thermo Scientific, USA)에서 PCR 산물을 확인하였다.
이후, 증폭된 PCR 산물에 Exonuclease I(20 U/㎕, NEB, UK) 0.2 ㎕, Shrimp alkaline phosphatase(1 U/㎕,NEB, UK) 0.8ul, 10X Exo buffer(NEB, UK) 그리고 핵산분해효소(nuclease)가 없는 증류수 4.25 ㎕를 첨가 후, 37℃에서 30분, 85℃ 15분 처리하여 정제하였다. 정제된 PCR 산물에 40 ㎕의 핵산분해효소(nuclease)가 없는 증류수를 첨가한 반응물 1~2.5 ㎕, Sequencing Primer 2 nM, 5X sequencing buffer(Applied Biosystems, USA) 3.2 ㎕, BigDye Terminator v3.1 Cycle Sequencing RR-100(Applied Biosystems, USA) 0.8 ㎕를 포함하고 핵산분해효소(nuclease)가 없는 증류수로 총 부피 10 ㎕로 맞추어 Sequencing reaction을 실시하였다. Sequencing reaction은 96℃에서 1분; 96℃에서 10초, 50℃ 5초, 60℃에서 4분의 25 사이클의 조건으로 AB 2720 PCR 장비(Applied Biosystems)에서 시행하였다. 반응이 끝난 후, Magbesil®GREEN(Promega, USA)의 사용법에 따라 정제를 진행한 다음, vacuum concentrator를 이용하여 정제된 DNA를 완전히 건조시킨 후, Elution Buffer 30 ㎕를 첨가하여 완전히 용해시켰다. 이 중 15 ㎕를 sequencing plate에 분주하여 3730xl DNA Analyzer(Applied biosystems, USA)로 반응을 진행하고, Sequencing Analysis 5.1.1 software(Applied biosystems, USA)를 사용하여 염기서열 분석을 실시하였다. 분석된 염기서열 정보는 NCBI의 BLAST analysis를 실시하여 성인성 질환 유발 세균의 종류를 확인하였다.
염기서열 분석을 위한 PCR 반응에 사용한 프라이머를 하기 표 2에 나타내었다.
Target Primer Sequence Size(bp)
CT CT-cryp CF 5’-CATGAAAACTCGTTCCGAAATAGAA-3’(서열번호 25) 498
CT-cryp R 5’-CGGCCTCTAG CGCTGCGAAT-3’(서열번호 26)
UP UP-CF2 5'-TGTCAGGATCATCAAATCAATT-3'(서열번호 27) 345
UP-CR 5’- GCCGTTTACACCTCAAACTTC-3’(서열번호 28)
NG NG-CF 5'-ACAGGGAAGCTTGCTTCTCG-3’(서열번호 29) 200
NG- CR-2 5’-TGGTGGGCCTTTACCCCG-3’(서열번호 30)
MG MG-CF 5’- AAATCGCTTCATGGCTTGAT-3’(서열번호 31) 487
MG-CR 5’-TGAAGAGGGTGCTTCTCTCCAT-3’(서열번호 32)
UU UU-CF 5’- AGGAGCAATTAACTTCGCTGA -3’(서열번호 33) 302
UU-CR 5’- GCCGTTTACACCTCAAACTTC-3’(서열번호 34)
MH MH-CF 5’-CCAGCTAAAAGCGAAGGTGT-3’(서열번호 35) 500
MH-CR 5'-GAGCCTGCTTTTGCACCAATA-3'(서열번호 36)
TV TV-CF 5'-AAATTGGTGCCAAGTTCTGG-3'(서열번호 37) 425
TV-CR 5'-ACGGAGCTTGTTGAGAAGGA-3'(서열번호 38)
실시예 3: 멀티플렉스 실시간 PCR 수행 및 결과
각 PCR 반응은 상기 실시예 2에서 준비한 질 분비물, 소변 시료 각각 3 ㎕, 2x Direct PCR 2(Nanohelix, Daejeon, Korea) 12.5 ㎕, 각각의 프라이머(6~10 nM) 세트 및 프로브(3~5 nM) 3 ㎕, 내적 대조군(internal control) 0.2 ㎕를 포함하고, 핵산분해효소(nuclease)가 없는 증류수로 총 부피 25 ㎕로 맞추어 제조한 반응 용액에서 수행하였다. 증류수 25 ㎕는 음성 대조군(blank)으로 사용하였다. 실시간 중합효소연쇄반응(Real-time PCR)은 DNA thermal cycler (7300 Real Time PCR system-Applied Biosystems)를 사용하여 50℃에서 2분; 95℃에서 10분; 95℃에서 15초 및 60℃에서 45초의 45 사이클로 수행하였다. 총 2개의 세트로 나누어 실시간 중합효소연쇄반응을 수행하였으며, 사용한 리포터 형광 표지 물질 및 세트의 구성은 하기 표 3와 같다.
SET FAM VIC TEXAS RED Cy5
1 CT UP NG IC
2 MG UU MH TV
각 세트에서 해당 성인성 질환 유발 세균 특이적인 유전자의 존재 여부를 나타내는 FAM, VIC, TEXAS RED 및 Cy5 리포터 형광 시그널의 증가 여부는 7300 System software(Applied Biosystems)를 사용하여 실시간으로 모니터링하였다. 각각의 분석결과에 대해, 음성 대조군의 형광값을 평균화하고 이를 기초 자료(raw data)로부터 차감하여 백그라운드 형광에 대해 보정하였다. 각각의 염료에 대한 형광의 말단 값을 2원 분산 플롯에서 각각에 대해 플롯팅하였다.
PCR 산물은 7300 real time PCR system (Applied Biosystems)에 의해 검출하였다. PCR 동안 형광 Taqman 프로브는 주형 DNA 상의 전방향 및 역방향 프라이머 자리 사이의 상보적 서열에 특이적으로 어닐링되고, DNA 중합효소의 5'→ 3' exonuclease 활성에 의해 분해된다. 켄쳐(quencher)로부터 분리되면, 리포터 염료는 형광을 방출하고, 이는 7300 real time PCR system에 의해 기록된다. 형광 시그널을 정량하고 비교하여, 소프트웨어가 플레이트 상의 각 세균의 특이적 유전자 존재 여부를 결정하게 된다.
도 1은 세트 1, 도 2는 세트 2의 실시간 PCR 반응에 의한 증폭 곡선을 나타낸 것으로, 질 분비물 샘플을 대상으로 증폭 양상을 각각의 파장대 별로 보여주는 결과이다. 또한, 하기 표 4는 상기 도 1 및 도 2의 증폭 곡선으로부터 Ct값(PCR 증폭 산물이 기하급수적으로 증가하여 한계치선과 만나는 지점의 사이클수)을 계산하여 나타낸 결과이다. 도 3은 세트 1, 도 4는 세트 2의 실시간 PCR 반응에 의한 증폭 곡선을 나타낸 것으로, 소변 샘플을 대상으로 증폭 양상을 각각의 파장대 별로 보여주는 결과이다. 상기 도 3 및 도 4의 증폭 곡선으로부터 Ct값을 계산하여 나타낸 결과를 하기 표 5에 나타내었다. 이러한 결과로부터 세균의 감염 정도가 클수록 보다 빠르게 형광 증폭이 발생하는 것을 확인할 수 있었으며, 이는 표 4 및 표 5의 Ct 값으로 확인할 수 있다.
비교예 1의 검사 방법과 비교할 때, 본 발명의 키트 및 방법은 DNA를 별도로 추출하지 않고 질 분비물 또는 소변 샘플을 바로 검사에 적용할 수 있으며, 실시간으로 증폭 양상을 확인할 수 있으므로, 검사 시간이 대폭 감소하여 효율적으로 성인성 질환 유래 세균을 검출할 수 있다는 장점이 있다.
Samplename SET 1 SET 2 실시예 3 비교예 1
FAM VIC Texas Red Cy5 FAM VIC Texas Red Cy5
CT UP NG IC MG UU MH TV
14 25.3 N/A N/A 30.3 33.1 N/A N/A N/A CT 양성 CT 양성
15 23.9 33.3 N/A 31.1 N/A N/A 43.3 N/A CT 양성 CT 양성
27 N/A 24.0 28.4 32.3 N/A N/A 38.4 N/A UP, NG 양성 UP, NG 양성
28 N/A 28.0 26.2 32.8 N/A 34.5 N/A N/A UP, NG, UU 양성 UP, NG, UU 양성
39 N/A 32.2 N/A 31.5 29.1 N/A N/A N/A UP, MG 양성 UP, MG 양성
40 36.8 23.8 N/A 31.2 29.6 N/A N/A N/A CT, UP, MG 양성 CT, UP, MG 양성
54 N/A 29.8 N/A 30.9 N/A 28.0 N/A N/A UP, UU 양성 UP, UU 양성
55 N/A N/A N/A 31.3 N/A 25.5 N/A N/A UU 양성 UU 양성
70 N/A N/A N/A 31.3 N/A N/A 29.7 N/A MH 양성 MH 양성
71 N/A 25.0 N/A 31.3 N/A N/A 19.0 N/A UP, MH 양성 UP, MH 양성
Sample name SET 1 SET 2 실시예 3 비교예 1
FAM VIC Texas Red Cy5 FAM VIC Texas Red Cy5
CT UP NG IC MG UU MH TV
7 30.8 N/A N/A 31.2 N/A N/A N/A N/A CT 양성 CT 양성
8 33.0 N/A N/A 31.1 N/A N/A N/A N/A CT 양성 CT 양성
22 N/A N/A 26.6 32.5 N/A N/A N/A N/A NG 양성 NG 양성
23 N/A N/A 32.3 31.4 N/A N/A 37.6 N/A NG MH 양성 NG MH 양성
29 N/A 42.0 N/A 31.5 26.9 N/A N/A N/A MG 양성 MG 양성
38 N/A N/A N/A 31.5 35.5 N/A N/A N/A MG 양성 MG 양성
42 N/A N/A N/A 31.6 N/A 36.1 N/A N/A UU 양성 UU 양성
43 N/A N/A N/A 31.3 N/A 37.2 N/A N/A UU 양성 UU 양성
59 N/A 35.4 N/A 31.2 N/A N/A 33.6 N/A MH 양성 MH 양성
60 N/A N/A N/A 31.4 N/A N/A 36.8 N/A MH 양성 MH 양성
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.

Claims (9)

  1. (a) 서열번호 1의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 정방향 프라이머 및 서열번호 2의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 역방향 프라이머를 포함하는 Chlamydia trachomatis를 검출하기 위한 올리고뉴클레오티드 세트;
    (b) 서열번호 4의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 정방향 프라이머 및 서열번호 5의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 역방향 프라이머를 포함하는 Ureaplasma parvum를 검출하기 위한 올리고뉴클레오티드 세트;
    (c) 서열번호 7의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 정방향 프라이머 및 서열번호 8의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 역방향 프라이머를 포함하는 Neisseria gonorrhoeae를 검출하기 위한 올리고뉴클레오티드 세트;
    (d) 서열번호 10의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 정방향 프라이머 및 서열번호 11의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 역방향 프라이머를 포함하는 Mycoplasma genitalium를 검출하기 위한 올리고뉴클레오티드 세트;
    (e) 서열번호 13의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 정방향 프라이머 및 서열번호 14의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 역방향 프라이머를 포함하는 Ureaplasma urealyticum를 검출하기 위한 올리고뉴클레오티드 세트;
    (f) 서열번호 16의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 정방향 프라이머 및 서열번호 17의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 역방향 프라이머를 포함하는 Mycoplasma hominis를 검출하기 위한 올리고뉴클레오티드 세트; 및
    (g) 서열번호 19의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 정방향 프라이머 및 서열번호 20의 염기 서열 중 15개 이상의 연속적인 뉴클레오티드를 포함하는 역방향 프라이머를 포함하는 Trichomonas vaginalis를 검출하기 위한 올리고뉴클레오티드 세트로 이루어진 군으로부터 선택되는 2 이상의 올리고뉴클레오티드 세트를 포함하는 성인성 질환(sexually transmitted disease, STD) 유발 세균 검출용 키트.
  2. 제1항에 있어서, 상기 키트는 4 이상의 올리고뉴클레오티드 세트를 포함하는 것인 키트.
  3. 제1항에 있어서, 상기 (a) 내지 (g)의 올리고뉴클레오티드 세트는 각각 5' 말단에 형광 표지 물질이 결합되고, 3' 말단에 형광 억제 물질(quencher)이 결합된 프로브를 더 포함하는 것인 키트.
  4. 제3항에 있어서, 상기 프로브는 서열번호 3의 염기 서열 중 10개 이상의 연속적인 뉴클레오티드를 포함하는 올리고뉴클레오티드, 서열번호 6의 염기 서열 중 10개 이상의 연속적인 뉴클레오티드를 포함하는 올리고뉴클레오티드, 서열번호 9의 염기 서열 중 10개 이상의 연속적인 뉴클레오티드를 포함하는 올리고뉴클레오티드, 서열번호 12의 염기 서열 중 10개 이상의 연속적인 뉴클레오티드를 포함하는 올리고뉴클레오티드, 서열번호 15의 염기 서열 중 10개 이상의 연속적인 뉴클레오티드를 포함하는 올리고뉴클레오티드, 서열번호 18의 염기 서열 중 10개 이상의 연속적인 뉴클레오티드를 포함하는 올리고뉴클레오티드 및 서열번호 21의 염기 서열 중 10개 이상의 연속적인 뉴클레오티드를 포함하는 올리고뉴클레오티드로 이루어진 군으로부터 선택되는 것인 키트.
  5. 제1항에 있어서, 상기 키트는 중합효소 연쇄반응에 의해 실시되는 것인 키트.
  6. 제1항에 있어서, 상기 키트는 dATP, dCTP, dGTP 및 dTTP를 포함하는 혼합물;완충 용액; 및 DNA 중합 효소를 더 포함하는 것인 키트.
  7. 생물학적 시료를 제1항 내지 제6항 중 어느 한 항의 키트에 첨가하여 중합효소 연쇄반응(polymerase chain reaction, PCR)을 수행하는 단계; 및
    상기 PCR을 수행한 결과로부터 상기 생물학적 시료 중의 성인성 질환 유발 세균의 존재 여부를 확인하는 단계를 포함하는 성인성 질환 유발 세균의 검출 방법.
  8. 제7항에 있어서, 상기 생물학적 시료는 질 분비물, 소변, 혈액, 혈청, 혈장, 정액 및 대변으로 이루어진 군으로부터 선택되는 것인 방법.
  9. 제7항에 있어서, 상기 중합효소 연쇄반응은 실시간 다중 중합효소 연쇄반응(multiplex real-time PCR)인 것인 방법.
PCT/KR2016/007583 2015-09-04 2016-07-13 성인성 질환 유발 세균 검출 키트 및 방법 WO2017039144A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2015-0125435 2015-09-04
KR1020150125435A KR101745132B1 (ko) 2015-09-04 2015-09-04 성인성 질환 유발 세균 검출 키트 및 방법

Publications (1)

Publication Number Publication Date
WO2017039144A1 true WO2017039144A1 (ko) 2017-03-09

Family

ID=58187901

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/007583 WO2017039144A1 (ko) 2015-09-04 2016-07-13 성인성 질환 유발 세균 검출 키트 및 방법

Country Status (2)

Country Link
KR (1) KR101745132B1 (ko)
WO (1) WO2017039144A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112501324A (zh) * 2020-11-26 2021-03-16 广州迪澳生物科技有限公司 一种基于环介导等温扩增检测结核分枝杆菌复合群及非结核分枝杆菌复合群的引物、试剂盒

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101969426B1 (ko) * 2017-05-30 2019-04-16 주식회사 퀀타매트릭스 Sti 원인균 또는 바이러스 검출용 조성물
KR102114469B1 (ko) * 2018-04-25 2020-05-25 주식회사 이원생명과학연구원 성매개 감염원인체 검출용 키트
KR20230150077A (ko) * 2022-04-21 2023-10-30 주식회사 팍스젠바이오 성 매개 감염증 유발 병원체 검출용 키트 및 이를 이용한 성 매개 감염증 유발 병원체의 검출방법

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100639783B1 (ko) * 2005-03-29 2006-10-30 주식회사 셀지노믹스 다중 성병 진단용 키트 및 이를 이용한 성병 원인균의검출방법
WO2007097582A1 (en) * 2006-02-23 2007-08-30 Seegene, Inc. Oligonucleotides for detecting nucleic acids of pathogen causing sexually transmitted diseases
KR20070099208A (ko) * 2006-04-03 2007-10-09 (주)우먼바이오텍 중합효소 연쇄 반응을 이용한 성병 검출방법 및 진단 키트
KR20100058919A (ko) * 2008-11-25 2010-06-04 굿젠 주식회사 성교전파성질환 원인균의 탐지, 유전자형 분석 및 항생제 내성 유전자형의 분석용의 ｄｎａ 칩, 키트, 및 이것을 이용한 탐지 및 유전자형의 분석방법
KR20110041829A (ko) * 2009-10-16 2011-04-22 (주)지노첵 성적인 접촉에 의해 감염되는 질병을 일으키는 병원성 미생물 검사용 프로브, 그리고 이를 이용한 병원성 미생물 검사 칩, 검사키트 및 검사방법
KR20120103801A (ko) * 2011-03-11 2012-09-20 (주)팸메드 성인성질환?유발 미생물 동시 검출방법

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100639783B1 (ko) * 2005-03-29 2006-10-30 주식회사 셀지노믹스 다중 성병 진단용 키트 및 이를 이용한 성병 원인균의검출방법
WO2007097582A1 (en) * 2006-02-23 2007-08-30 Seegene, Inc. Oligonucleotides for detecting nucleic acids of pathogen causing sexually transmitted diseases
KR20070099208A (ko) * 2006-04-03 2007-10-09 (주)우먼바이오텍 중합효소 연쇄 반응을 이용한 성병 검출방법 및 진단 키트
KR20100058919A (ko) * 2008-11-25 2010-06-04 굿젠 주식회사 성교전파성질환 원인균의 탐지, 유전자형 분석 및 항생제 내성 유전자형의 분석용의 ｄｎａ 칩, 키트, 및 이것을 이용한 탐지 및 유전자형의 분석방법
KR20110041829A (ko) * 2009-10-16 2011-04-22 (주)지노첵 성적인 접촉에 의해 감염되는 질병을 일으키는 병원성 미생물 검사용 프로브, 그리고 이를 이용한 병원성 미생물 검사 칩, 검사키트 및 검사방법
KR20120103801A (ko) * 2011-03-11 2012-09-20 (주)팸메드 성인성질환?유발 미생물 동시 검출방법

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112501324A (zh) * 2020-11-26 2021-03-16 广州迪澳生物科技有限公司 一种基于环介导等温扩增检测结核分枝杆菌复合群及非结核分枝杆菌复合群的引物、试剂盒

Also Published As

Publication number Publication date
KR20170028612A (ko) 2017-03-14
KR101745132B1 (ko) 2017-06-09

Similar Documents

Publication Publication Date Title
US20100203518A1 (en) Quantitative Assay for the Simultaneous Detection and Speciation of Bacterial Infections
US20220235401A1 (en) Multiplex diagnostic assays for lyme disease and other tick-borne diseases
US11326214B2 (en) Polynucleotides for the amplification and detection of chlamydia trachomatis
US11802317B2 (en) Kits for detecting Mycobacterium avium/intracellulare nucleic acid
WO2017039144A1 (ko) 성인성 질환 유발 세균 검출 키트 및 방법
US20240117447A1 (en) Polynucleotides for the amplification and detection of neisseria gonorrhoeae
US20190284617A1 (en) Polynucleotides for the amplification and detection of chlamydia trachomatis
US10954572B2 (en) Polynucleotides for the amplification and detection of Neisseria gonorrhoeae
KR20190124059A (ko) 성매개 감염원인체 검출용 키트
US20210348231A1 (en) Detection of drug-resistant mycoplasma genitalium
KR20190041314A (ko) 치쿤군야 바이러스 검출용 올리고뉴클레오티드 세트 및 이의 용도
US20240026465A9 (en) Polynucleotides for the amplification and detection of neisseria gonorrhoeae
JP4937911B2 (ja) ｏｐａ遺伝子の５’非翻訳領域を用いたナイセリア・ゴノレアの検出法
CA3188657A1 (en) Detection of macrolide-resistant mycoplasma genitalium
JP2021506274A (ja) 毒素産生Ｃｌｏｓｔｒｉｄｉｕｍ ｄｉｆｆｉｃｉｌｅを検出するための組成物および方法
AU2019365821A1 (en) Compositions and methods for amplifying, detecting or quantifying human polyomavirus BK virus

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16842110

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16842110

Country of ref document: EP

Kind code of ref document: A1