WO2017030367A1 - 신규한 이소나이트라민 화합물 및 이를 포함하는 대사성 질환 예방 또는 치료용 조성물 - Google Patents

신규한 이소나이트라민 화합물 및 이를 포함하는 대사성 질환 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2017030367A1
WO2017030367A1 PCT/KR2016/009036 KR2016009036W WO2017030367A1 WO 2017030367 A1 WO2017030367 A1 WO 2017030367A1 KR 2016009036 W KR2016009036 W KR 2016009036W WO 2017030367 A1 WO2017030367 A1 WO 2017030367A1
Authority
WO
WIPO (PCT)
Prior art keywords
group
carbon atoms
carbon
allyl
halogen
Prior art date
Application number
PCT/KR2016/009036
Other languages
English (en)
French (fr)
Inventor
이효종
박요한
박형근
Original Assignee
인제대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 인제대학교 산학협력단 filed Critical 인제대학교 산학협력단
Priority to US15/752,592 priority Critical patent/US20180244624A1/en
Priority claimed from KR1020160104145A external-priority patent/KR101799793B1/ko
Publication of WO2017030367A1 publication Critical patent/WO2017030367A1/ko
Priority to US16/161,094 priority patent/US10537559B2/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/438—The ring being spiro-condensed with carbocyclic or heterocyclic ring systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4412—Non condensed pyridines; Hydrogenated derivatives thereof having oxo groups directly attached to the heterocyclic ring

Definitions

  • the present invention relates to a composition for preventing or treating metabolic diseases, including stereoisomers of isonitramine and derivatives thereof and racemic mixtures thereof.
  • the blood glucose response is normal in the cervical glucose test, which measures blood glucose before and after eating a certain amount of glucose as a method for diagnosing diabetes. This insulin resistance is observed from the beginning of obesity as one of the main symptoms of obesity and insulin-independent diabetes patients.
  • adipocytes increase insulin resistance by inhibiting the action of insulin in muscle and liver, the most of these factors.
  • FAA free fatty acids
  • TNF and leptin secreted from adipocytes have been suggested to increase insulin resistance (Hotamisligil GS. Et al., Tumor necrosis factor a, a key component of the obesity-diabetes link, Diabetes, 43, pp. 1271-1278, 1994).
  • lipids are the main energy metabolism, with both lipid degradation and lipid synthesis being increased. Increased lipolysis and thus increased use of free fatty acids are the most hallmarks of obesity, especially abdominal obesity, and a high correlation between fat volume and lipid oxidation is observed, which is why the increase in fat volume is the cause of increased free fatty acids and lipid oxidation in the blood Is considered.
  • the present inventors completed the present invention by confirming that the pharmaceutical composition and health food containing the stereoisomer of isonanitrine and derivatives thereof and racemic mixture thereof as an active ingredient have excellent metabolic disease treatment effects.
  • an object of the present invention is to provide a pharmaceutical composition and health food for preventing or treating metabolic diseases comprising stereoisomers of isonanitrine and derivatives thereof and racemic mixtures thereof as an active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating metabolic diseases, comprising a stereoisomer represented by the following Formula 1 or a racemic mixture thereof as an active ingredient, a health food for prevention or improvement.
  • X is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group and a benzyl group, and when X is an allyl group, at least one halogen may be substituted for an unsaturated carbon, and X is R 1 to Each R 5 independently represents a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, an alkoxy group having 1 to 3 carbon atoms, and a vinyl , An aryl group, a phenoxy group or a benzo group;
  • Y is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group, and a benzyl group, and when Y is an allyl group, at least one halogen may be substituted for unsaturated carbon, or Y is R 1 to R 5 are each independently a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, and 1 to 3 carbon atoms Alkoxy group, vinyl, aryl group, phenoxy group or benzo group;
  • Carbon 6 and carbon 7 are chiral centers.
  • the present invention provides a pharmaceutical composition for preventing or treating metabolic diseases, including a stereoisomer represented by Formula 2 or a racemic mixture thereof, as an active ingredient, a health food for prevention or improvement.
  • X is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group and a benzyl group, and when X is an allyl group, at least one halogen may be substituted for an unsaturated carbon, and X is R 1 to Each R 5 independently represents a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, an alkoxy group having 1 to 3 carbon atoms, and a vinyl , An aryl group, a phenoxy group or a benzo group;
  • Y is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group, and a benzyl group, and when Y is an allyl group, at least one halogen may be substituted for unsaturated carbon, or Y is R 1 to R 5 are each independently a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, and 1 to 3 carbon atoms Alkoxy group, vinyl, aryl group, phenoxy group or benzo group;
  • Carbon 6 and carbon 7 are chiral centers.
  • the present invention provides a pharmaceutical composition for preventing or treating metabolic diseases, including a stereoisomer represented by Formula 3 or a racemic mixture thereof, as an active ingredient, a health food for prevention or improvement.
  • X is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group and a benzyl group, and when X is an allyl group, at least one halogen may be substituted for an unsaturated carbon, and X is R 1 to Each R 5 independently represents a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, an alkoxy group having 1 to 3 carbon atoms, and a vinyl , An aryl group, a phenoxy group or a benzo group;
  • Y is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group, and a benzyl group, and when Y is an allyl group, at least one halogen may be substituted for unsaturated carbon, or Y is R 1 to R 5 are each independently a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, and 1 to 3 carbon atoms Alkoxy group, vinyl, aryl group, phenoxy group or benzo group;
  • Carbon 6 is a chiral center
  • the stereoisomers of the novel isonitramine and derivatives thereof and racemic mixtures thereof can inhibit fat content or adipocyte differentiation, inhibit the activity of carbohydrate metabolizing enzymes, protect the pancreas and blood glucose, and promote insulin secretion. Since it shows an effect, it can be usefully used as a pharmaceutical composition or health food for preventing or treating metabolic diseases.
  • Figure 2 shows the inhibitory effect on the fat content of (+)-isonitramine (1) according to another embodiment of the present invention.
  • Figure 3 shows the suppression mechanism for adipocyte differentiation of (+)-isonitramine (1) according to the embodiment of Figure 2.
  • Figure 4 is a bar graph showing the inhibitory effect on the activity of the carbohydrate metabolizing enzyme of (+)-isonitramine (1) or derivatives 2 to 6 according to another embodiment.
  • FIG. 6 is a bar graph showing a blood glucose inhibitory effect of (+)-isonitramine (1) according to the embodiment of FIG. 4.
  • FIG. 7 is a bar graph showing the insulin secretion promoting effect of (+)-isonitramine (1) according to another embodiment.
  • Figure 8 shows the insulin secretion promoting effect of (+)-isonitramine (1) according to another embodiment.
  • the inventors of the present invention synthesize and study isonitramine stereoisomers and derivatives thereof, the compounds inhibit fat content or adipocyte differentiation, inhibit the activity of carbohydrate metabolizing enzymes, protect the pancreas, inhibit blood glucose and The present invention was completed by confirming the effect of promoting insulin secretion.
  • the present invention provides a pharmaceutical composition for preventing or treating metabolic diseases, comprising the stereoisomer represented by Formula 1 or a racemic mixture thereof as an active ingredient:
  • X is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group and a benzyl group, and when X is an allyl group, at least one halogen may be substituted for an unsaturated carbon, and X is R 1 to Each R 5 independently represents a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, an alkoxy group having 1 to 3 carbon atoms, and a vinyl , An aryl group, a phenoxy group or a benzo group;
  • Y is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group, and a benzyl group, and when Y is an allyl group, at least one halogen may be substituted for unsaturated carbon, or Y is R 1 to R 5 are each independently a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, and 1 to 3 carbon atoms Alkoxy group, vinyl, aryl group, phenoxy group or benzo group;
  • Carbon 6 and carbon 7 are chiral centers.
  • the 'stereoisomers mean that the molecular formula and the method of connecting the constituent atoms are the same, but the spatial arrangement between the atoms is different. That is, the stereoisomers generated by the chiral centers present in carbon 6 and carbon 7 of Formula 1 are (6R, 7R), (6R, 7S), (6S, 7S), (6S , 7R).
  • the 'racemic mixture' means that the (+)-and (-)-forms are mixed in the same ratio, that is, 50:50.
  • the racemic mixture is a mixture in which stereoisomers (6R, 7R) and (6S, 7S) of Formula 1 are present at 50:50, respectively, or (6R, 7S) and (6S, 7R) are present at 50:50, respectively. It may be a mixture.
  • the present invention provides a health food for preventing or improving metabolic diseases comprising a stereoisomer represented by Formula 1 or a racemic mixture thereof as an active ingredient:
  • X is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group and a benzyl group, and when X is an allyl group, at least one halogen may be substituted for an unsaturated carbon, and X is R 1 to Each R 5 independently represents a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, an alkoxy group having 1 to 3 carbon atoms, and a vinyl , An aryl group, a phenoxy group or a benzo group;
  • Y is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group, and a benzyl group, and when Y is an allyl group, at least one halogen may be substituted for unsaturated carbon, or Y is R 1 to R 5 are each independently a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, and 1 to 3 carbon atoms Alkoxy group, vinyl, aryl group, phenoxy group or benzo group;
  • Carbon 6 and carbon 7 are chiral centers.
  • stereoisomers generated by the chiral centers present in carbon 6 and carbon 7 of Formula 1 are (6R, 7R), (6R, 7S), (6S, 7S), (6S , 7R).
  • racemic mixture is a mixture in which stereoisomers (6R, 7R) and (6S, 7S) of Formula 1 are present at 50:50, respectively, or (6R, 7S) and (6S, 7R) are each 50:50. May be a mixture present.
  • the present invention provides a pharmaceutical composition for preventing or treating metabolic diseases comprising the stereoisomer represented by Formula 2 or a racemic mixture thereof as an active ingredient:
  • X is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group and a benzyl group, and when X is an allyl group, at least one halogen may be substituted for an unsaturated carbon, and X is R 1 to Each R 5 independently represents a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, an alkoxy group having 1 to 3 carbon atoms, and a vinyl , An aryl group, a phenoxy group or a benzo group;
  • Y is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group, and a benzyl group, and when Y is an allyl group, at least one halogen may be substituted for unsaturated carbon, or Y is R 1 to R 5 are each independently a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, and 1 to 3 carbon atoms Alkoxy group, vinyl, aryl group, phenoxy group or benzo group;
  • Carbon 6 and carbon 7 are chiral centers.
  • stereoisomers generated by the chiral centers present in the carbon 6 and the carbon 7 of Formula 2 are (6R, 7R), (6R, 7S), (6S, 7S), (6S , 7R).
  • racemic mixture is a mixture in which stereoisomers (6R, 7R) and (6S, 7S) of Formula 2 are present at 50:50, respectively, or (6R, 7S) and (6S, 7R) are each 50:50. May be a mixture present.
  • the present invention provides a health food for preventing or improving metabolic diseases comprising a stereoisomer represented by Formula 2 or a racemic mixture thereof as an active ingredient:
  • X is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group and a benzyl group, and when X is an allyl group, at least one halogen may be substituted for an unsaturated carbon, and X is R 1 to Each R 5 independently represents a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, an alkoxy group having 1 to 3 carbon atoms, and a vinyl , An aryl group, a phenoxy group or a benzo group;
  • Y is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group, and a benzyl group, and when Y is an allyl group, at least one halogen may be substituted for unsaturated carbon, or Y is R 1 to R 5 are each independently a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, and 1 to 3 carbon atoms Alkoxy group, vinyl, aryl group, phenoxy group or benzo group;
  • Carbon 6 and carbon 7 are chiral centers.
  • stereoisomers generated by the chiral centers present in the carbon 6 and the carbon 7 of Formula 2 are (6R, 7R), (6R, 7S), (6S, 7S), (6S , 7R).
  • racemic mixture is a mixture in which stereoisomers (6R, 7R) and (6S, 7S) of Formula 2 are present at 50:50, respectively, or (6R, 7S) and (6S, 7R) are each 50:50. May be a mixture present.
  • the present invention provides a pharmaceutical composition for preventing or treating metabolic diseases comprising the stereoisomer represented by Formula 3 or a racemic mixture thereof as an active ingredient:
  • X is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group and a benzyl group, and when X is an allyl group, at least one halogen may be substituted for an unsaturated carbon, and X is R 1 to Each R 5 independently represents a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, an alkoxy group having 1 to 3 carbon atoms, and a vinyl , An aryl group, a phenoxy group or a benzo group;
  • Y is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group, and a benzyl group, and when Y is an allyl group, at least one halogen may be substituted for unsaturated carbon, or Y is R 1 to R 5 are each independently a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, and 1 to 3 carbon atoms Alkoxy group, vinyl, aryl group, phenoxy group or benzo group;
  • Carbon 6 is a chiral center
  • stereoisomer formed by the chiral center present in carbon 6 of Formula 3 may be of the (R) or (S) type.
  • racemic mixture may be a mixture in which stereoisomers (R) and (S) of Formula 3 are present in 50:50.
  • the present invention provides a health food for preventing or improving metabolic diseases comprising a stereoisomer represented by Formula 3 or a racemic mixture thereof as an active ingredient:
  • X is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group and a benzyl group, and when X is an allyl group, at least one halogen may be substituted for an unsaturated carbon, and X is R 1 to Each R 5 independently represents a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, an alkoxy group having 1 to 3 carbon atoms, and a vinyl , An aryl group, a phenoxy group or a benzo group;
  • Y is selected from the group consisting of hydrogen, an alkyl group having 1 to 10 carbon atoms, an acyl group, an allyl group, and a benzyl group, and when Y is an allyl group, at least one halogen may be substituted for unsaturated carbon, or Y is R 1 to R 5 are each independently a hydrogen atom, a nitro group, a halogen atom, a cyan group, a hydroxy group, a dimethylamino group, a methylsulfonylamide group, a trifluoromethyl group, an alkyl group having 1 to 3 carbon atoms, and 1 to 3 carbon atoms Alkoxy group, vinyl, aryl group, phenoxy group or benzo group;
  • Carbon 6 is a chiral center
  • stereoisomer formed by the chiral center present in carbon 6 of Formula 3 may be of the (R) or (S) type.
  • racemic mixture may be a mixture in which stereoisomers (R) and (S) of Formula 3 are present in 50:50.
  • the metabolic disease is selected from the group consisting of obesity, diabetes, hyperlipidemia, hypertriglyceridemia, liver disease, arteriosclerosis, stroke, myocardial infarction, cardiovascular disease, hyperglycemia, insulin resistance disease and hyperinsulinemia, but is not limited thereto. .
  • the pharmaceutical composition may be provided in one or more formulations selected from the group consisting of gels, emulsions, injections, powders, granules, aerosols, pastes, transdermal absorbents and patches according to conventional methods, but is not limited thereto.
  • the pharmaceutical composition is a suitable carrier, excipient, disintegrant, sweetener, coating agent, swelling agent, lubricant, lubricant, flavoring agent, antioxidant, buffer, bacteriostatic agent commonly used in the manufacture of pharmaceutical compositions. It may further comprise one or more additives selected from the group consisting of diluents, dispersants, surfactants, binders and lubricants.
  • the carriers, excipients and diluents are lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline Cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil can be used, and solid preparations for oral administration include tablets, pills, powders, granules, capsules.
  • solid preparations may be prepared by mixing at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin and the like in the composition.
  • excipients such as starch, calcium carbonate, sucrose or lactose, gelatin and the like
  • lubricants such as magnesium styrate and talc may also be used.
  • Oral liquid preparations include suspensions, solvents, emulsions, syrups, and the like, and may include various excipients such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories, and the like.
  • non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used.
  • Witsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like may be used as the base material of the suppository.
  • Preferred dosages of the stereoisomers or racemic mixtures thereof may vary depending on the condition and weight of the subject, the type and severity of the disease, drug form, route of administration and duration and may be appropriately selected by those skilled in the art. According to one embodiment of the present invention, but not limited thereto, the daily dosage may be 0.01 to 200 mg / kg, specifically 0.1 to 200 mg / kg, more specifically 0.1 to 100 mg / kg. Administration may be administered once a day or divided into several times, thereby not limiting the scope of the invention.
  • the 'subject' may be a mammal including a human, but is not limited thereto.
  • the health food may be provided in the form of powder, granules, tablets, capsules, syrups or beverages, which health foods are used with other foods or food additives in addition to the stereoisomers or racemic mixtures thereof as an active ingredient, and conventional methods. It can be suitably used according to.
  • the mixed amount of the active ingredient can be suitably determined depending on the purpose of use thereof, for example, prophylactic, health or therapeutic treatment.
  • the effective dose of the stereoisomer or racemic mixture thereof contained in the health food may be used in accordance with the effective dose of the pharmaceutical composition, but in the case of prolonged intake for health and hygiene purposes or for health control purposes, It may be less than the above range, it is clear that the active ingredient can be used in an amount above the above range because there is no problem in terms of safety.
  • (+)-isonitramine stereoisomer ((+)-isonitramine (1)) or derivative 2 thereof was synthesized according to the methods of the already known literature (Org. Lett. 2012, 14, 852-854).
  • isonanitramine derivatives 3 to 6 were synthesized according to the methods known in the art (Adv. Synth. Catal. 2011, 353, 3313-3318.).
  • Mouse 3T3-L1 preadipocytes were treated with 10% neonatal calf serum (Gibco BRL, NY, USA), antibiotics (100 U / ml penicillin and 100 ⁇ g / ml streptomycin, Gibco BRL, NY, USA). ) was cultured in a humidified 37 ° C., 5% CO 2 incubator using a medium (Dubecco's modified Eagle's medium, DMEM).
  • DMEM Dubecco's modified Eagle's medium
  • the cultured 3T3-L1 cells were then cultured with 0.5 mM 1-methyl-3-isobutylxanthine, 1 ⁇ M of dexamethasone purchased from Sigma, St. Louis, Mo. (dexamethasone), 1 ⁇ g / mL of insulin (insulin) and 10% fetal bovine serum (fetal bovine serum, FBS, Gibco BRL) was treated and incubated for 2 days to induce differentiation. After 2 days, the culture medium was replaced with fresh DMEM containing 10% FBS, 1 ⁇ g / mL of insulin and then replaced with fresh DMEM containing 10% FBS for 4 days.
  • RT-PCR Reverse transcription Polymerase Chain Reaction transcriptase -polymerase chain reaction
  • total zolRNA was extracted from undifferentiated or differentiated adipocytes using Trizol, Invitrogen.
  • RNA 4 ⁇ g was reverse transcribed into cDNA using M-MLV Reverse Transcriptase (Promega) followed by peroxisome proliferator activated receptor ⁇ (PPAR ⁇ ), CCAT / Confirmation of amplifier binding protein-alpha (CCAAT / enhancer binding protein- ⁇ , C / EBP ⁇ ), adipocyte protein 2 (aP2), lipoprotein Lipase (LPL) and adiponectin It was.
  • M-MLV Reverse Transcriptase Promega
  • PPAR ⁇ peroxisome proliferator activated receptor ⁇
  • CCAT CCAT / Confirmation of amplifier binding protein-alpha
  • CCAAT enhancer binding protein- ⁇
  • C / EBP ⁇ C adipocyte protein 2
  • LPL lipoprotein Lipase
  • the primers used are shown in Table 1 below, and were purchased from Bioneer.
  • variable number of cycles was used to identify the amplification that occurred in the linear phase.
  • ⁇ -actin was used as internal control in PCR amplification, and PCR products were separated using 2.0% agarose gel, redsafe nucleic acid staining (Intron, Korea) and UV irradiation (irradiation). ) To visualize.
  • Undifferentiated or differentiated cells were washed three times using phosphate-buffered saline (PBS) and fixed at room temperature for 1 hour with 4% 4-formaldehyde (4-formaldehyde, PFA). It was then washed three times with PBS and stained for 10 minutes using 0.5 ⁇ g / ml Nile Red (Sigma, St. Louis, Mo.). After staining, the cells were washed with PBS, and the nuclei were stained using 4'-6-diamidino-2-phenylindole (4'-6-Diamidino-2-phenylindole, DAPI, Invitrogen). Images were acquired using a phase difference microscope (Axiovert M200 microscope, Zeiss).
  • Intracellular triglyceride concentration was measured using a triglyceride reagent and free glycerol reagent purchased from Sigma.
  • Adipocytes were differentiated for 8 days with (+)-isonitramine (1) at 100 or 500 ⁇ M concentration in 6 well plates.
  • cells were washed with PBS, lysed with 100 ⁇ l of lysis buffer, then 20 ⁇ l of lysate was mixed with 20 ⁇ l of triglyceride reagent and incubated at 37 ° C. for 30 minutes. Thereafter, 30 ⁇ l of each mixture was transferred to a 96 well plate, and then 100 ⁇ l of free glycerol reagent was added and incubated at 37 ° C. for 5 minutes.
  • the absorbance was measured at 540 nm using a spectrophotometer.
  • (+)-isonitramine (1) is 3T3-L1 adipocytes
  • the differentiation process into mature adipocytes was suppressed, and as shown in B of FIG. 2, it was confirmed that the concentration of triglyceride was also reduced in a concentration-dependent manner.
  • overexpression of adipose cells in adipose cells without cytotoxicity is known to induce side effects such as obesity and fatty liver and PPAR ⁇ and C / EBP ⁇ that promotes fat biosynthesis and promotes the differentiation of fat cells mRNA expression was suppressed and mRNA expression of aP2, LPL, and adiponectin, both genes acting as transcription factors, regulate expression.
  • the isonanitrine stereoisomer according to the present invention has a prophylactic or therapeutic effect on obesity associated with the accumulation of fat.
  • Glucose assay kit was purchased from Youngdong Co. (Seoul, Korea). In sigma, porcine ⁇ -amylase, yeast ⁇ -glucosidase, 3, 5-dinitrosalicylic acid (3, 5-dinitrosalicylic acid (DNS), p-nitrophenol) Glucoside (p-nitrophenol glucoside (pNPG), rat intestinal acetone powder, sucrose and maltose were purchased. Soluble starch was obtained from Samchun Chemical Co., Seoul, Korea, and Acarbose was purchased from Tokyo chemical industry Co., Tokyo, Japan.
  • the mixtures were preincubated at 37 ° C. for 10 minutes, 25 ⁇ l of 0.5% starch solution was added and incubated at 37 ° C. for 10 minutes, followed by incubation at 100 ° C. for 5 minutes to stop the reaction and cool.
  • the inhibitory effect was calculated using the following equation.
  • Enzymatic inhibitory activity (1-A x / A 0 ) x 100%
  • the mixtures were preincubated at 37 ° C. for 10 minutes and 25 ⁇ l of pNPG were added and incubated at 60 ° C. for 10 minutes, followed by addition of 1N NaOH to stop the reaction.
  • the solution inducing color reaction was transferred to a 96 well plate and the absorbance was measured at 405 nm using a 96 well microplate reader.
  • reaction solution 5 ⁇ l was mixed with 500 ⁇ l of a glucose trinder kit solution and incubated at 37 ° C. for 5 minutes, and then the solution in which the color reaction was induced was stopped at 100 ° C. for 2 minutes and a 96 well plate The absorbance was measured at 570 nm.
  • D-glucose was diluted to various concentrations (0 to 480 mg / dL) using 0.1 M phosphate buffer (pH 7.0) to determine the glucose standard curve.
  • the pixel intensity of the pancreas was measured as a percentage of the EGFP fluorescent region using Image J, and statistically recorded and compared.
  • the zebrafish was anesthetized by placing in 8 ° C. water for 20 seconds.
  • Zebrafish was intraperitoneally injected (350 mg / kg) three times with STZ or PBS for a week and then fed commercial flake food (Commercial flake food, Tetrabits tropical flakes, Tetra, Germany) for 5 days after the final infusion.
  • commercial flake food Common flake food, Tetrabits tropical flakes, Tetra, Germany
  • Plasma blood was then measured enzymatically using a glucose blender kit solution.
  • (+)-isonitramine (1) and derivatives 2 to 6 synthesized in Example 1 As a result of confirming the anti-diabetic effect of (+)-isonitramine (1) and derivatives 2 to 6 synthesized in Example 1, as shown in FIG. 4, (+)-isonitramine (1) and derivative 2 are derivatives. Compared with 4 to 6 it was confirmed to have a selective inhibitory effect on the metabolase essential for carbohydrate absorption. In particular, while inhibiting ⁇ -glucosidase, but little inhibition of ⁇ -amylase, there was little concern about side effects such as bloating and diarrhea of the existing drug acarbose.
  • (+)-isonitramine (1) was confirmed to have no development and cardiovascular toxicity in the zebrafish model, and as shown in FIG. It was.
  • HIT-T15 cells which are a type of insulin cells, were distributed in Korean cell line bank and passaged. Specifically, the HIT-T15 cells were cultured in RPMI1640 (invitrogen. Co, USA) medium in 10% fetal bovine serum (FBS; invitrogen. Co, New Zealand 10091-148), penicillin 100 mu / ml and streptomycin ( streptomycin) was cultured under the condition of supplying 100 ⁇ g / ml at 37 ° C. and 5% CO 2 .
  • RPMI1640 invitrogen. Co, USA
  • FBS fetal bovine serum
  • penicillin 100 mu / ml penicillin 100 mu / ml
  • streptomycin streptomycin
  • Insulin secretion by (+)-isonitramine was measured using the Insulin ELISA kit (Cat. 10-1113-01) of Mercodia according to the recommended method.
  • HIT-T15 cells were dispensed in 96 well plates to 5 ⁇ 10 4 cells / well, and then cultured in a 37 ° C., CO 2 incubator until grown to 70-80%. Then, pretreatment with 500 ⁇ M alloxan (alloxan), which induces pancreatic specific toxic responses, was performed for 30 minutes. Thereafter, (+)-isonitramine was added to each well, followed by incubation for 24 hours, and the culture solution was collected to precipitate cells for 3 minutes at 15,000 rpm to prepare a supernatant.
  • Example 7 shows the effect of the (+)-isonitramine synthesized in Example 1 on the insulin secretion.
  • Zebrafish embryos are a widely used model system in the field of metabolic research, and they are widely used in the field of diabetes and glucose metabolism because they show metabolism in a form very similar to that of the human body.
  • zebrafish embryos were used to examine the effect of isonitramine on insulin expression and phosphoenol pyruvate carboxykinase (PEPCK), a key enzyme that regulates the first stages of the glycemic process. was used.
  • PEPCK phosphoenol pyruvate carboxykinase
  • zebrafish embryos were removed and treated with isonanitrine for 48 hours.
  • 100 mM cyclic AMP (cyclic AMP, cAMP) and 100 mM dexamethasone (DEX) were incubated for 48 hours with simultaneous treatment with isonanitramine.
  • ⁇ -actin was used as an internal control for PCR amplification, and PCR products were separated using 2.0% agarose gel, RedSafe nucleic acid staining (Intron, Korea) and UV irradiation (irradiation). ) To visualize.
  • the expression level of insulin increased as the concentration of isonanitrine increased.
  • the expression inhibitory effect of PEPCK was significantly increased in proportion to the concentration of isonanitramine.
  • a powder was prepared by mixing 20 mg of (+)-isonitramine, 100 mg of lactose and 10 mg of talc and filling into an airtight bag.
  • Tablets were prepared by mixing 1 mg of (+)-isonitramine, 100 mg of corn starch, 100 mg of lactose and 2 mg of magnesium stearate, followed by compression according to a conventional method for preparing tablets.
  • a capsule is prepared by mixing 10 mg of (+)-isonitramine, 100 mg of corn starch, 100 mg of lactose, and 2 mg of magnesium stearate, followed by mixing the above components according to a conventional capsule preparation method and filling into gelatin capsules. It was.
  • the ointment was prepared according to the preparation method of the ointment.
  • (+)-Isonitramine 1 mg, citric acid 1000 mg, oligosaccharide 100 g, plum concentrate 2 g, taurine 1 g and purified water are added to make a total of 900 ml, and the above ingredients are mixed according to a conventional healthy beverage manufacturing method. After stirring and heating at 85 ° C. for about 1 hour, the resulting solution was filtered, taken in a sterile 2 L container, sealed sterilized and then refrigerated.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 이소나이트라민(Isonitramine) 및 그 유도체의 입체이성질체와 라세미 혼합물을 포함하는 대사성 질환 예방 또는 치료용 약학 조성물 및 개선용 건강식품에 대한 것으로, 상기 화합물은 지방함량 또는 지방세포 분화 억제, 탄수화물 대사 효소의 활성 억제, 췌장보호, 혈당 저해 효과 및 인슐린 분비 촉진 효과를 보이므로, 비만, 당뇨병 또는 고지혈증과 같은 대사성 질환 치료에 유용하게 활용될 수 있다.

Description

신규한 이소나이트라민 화합물 및 이를 포함하는 대사성 질환 예방 또는 치료용 조성물
본 발명은 이소나이트라민(Isonitramine) 및 그 유도체의 입체이성질체와 이의 라세미 혼합물을 포함하는 대사성 질환 예방 또는 치료용 조성물에 대한 것이다.
경제의 발전에 따라 생활수준이 향상되면서 또한 대사성 질환의 주원인인 비만에 속하는 현대인들이 급속히 증가하고 있는 바, 특히 미국은 최근 미국 국민의 1/3, 어린이의 20%가 비만 환자라는 통계를 발표했다. 즉, 이러한 통계는 단순히 수치가 증가했다는 정도의 의미에 그치지 않고, 현대인의 건강을 위협하는 요소가 더욱 증가했음을 의미한다.
이와 관련하여, 비만한 사람에게서 탄수화물의 대사이상 및 인슐린 비의존형 당뇨병(제2형 당뇨)과 같은 질병이 함께 발병하는 확률이 높을 뿐만 아니라 체중증가가 기존의 당뇨병 상태를 악화시킨다는 사실이 보고되었다. 또한, 이외에 많은 연구를 통해서 비만이 내당 능력 장애 및 당뇨병에 선행한다는 사실이 관찰되었는데(Carey VJ. et al., Body fat distribution and risk of non-insulin-dependent diabetes mellitus in women, The nurses' health study, Am J Epidemiol, 145, pp.614-619, 1997), 프라밍함(Framingham)의 연구에서는 비만한 사람에게서 내당 능력 장애가 빈발함이 관찰되었고, 다른 대부분의 연구들에서 내당 능력 장애를 갖는 비만한 사람들이 인슐린 비의존형 당뇨병 발생의 고위험 군임이 관찰되었다.
많은 비만증에 걸린 환자들의 경우, 당뇨병을 진단하는 방법으로서 일정 양의 포도당을 먹기 전후의 혈당을 측정하는 경부 당 부하 검사에서 혈당 반응은 정상적으로 나타나지만, 인슐린 분비 반응이 정상보다 높게 나타나는 인슐린 저항성이 증가하는 양상을 보이는데, 이러한 인슐린 저항성은 비만 및 인슐린 비의존형 당뇨병 환자의 주된 증상의 하나로서 비만 초기부터 관찰된다.
이렇게 비만증에서 인슐린의 작용이 감소하는 기전에 관해서는 다양한 가설이 제시되고 있으나 아직 확실히 밝혀진 바는 없으며, 다만 인슐린 작용에 관련된 인슐린 수용체, 포도당 수송체, 당원 합성과 당 산화에 관련된 효소들 등의 기능 감소가 관찰되어, 인슐린 작용의 감소는 비만에 의한 이차적인 현상으로 이해되고 있다(Golay A. et al., Obesity and NIDDMP, the retrograde regulation concept, Diabetes Rev, 5, pp.69-82, 1997).
한편, 최근 발표된 보고서들에 의하면 지방세포에서 분비되는 인자들 또는 대사전달자(metabolic messenger)들이 근육 및 간에서 인슐린의 작용을 억제하여 인슐린 저항성을 높이는 것으로 밝혀지고 있는데, 이러한 인자(factor) 중 가장 대표적으로 알려진 것이 지방조직에 저장된 중성지방 중 지방산의 가수분해로 생성되는 유리 지방산(FAA)이다. 이 외에도 지방세포에서 분비되는 TNF 및 렙틴(leptin) 등도 인슐린 저항성을 높이는 원인으로 제시되고 있다(Hotamisligil GS. et al., Tumor necrosis factor a, a key component of the obesity-diabetes link, Diabetes, 43, pp.1271-1278, 1994).
비만증에서는 지질이 에너지 대사의 주를 이루는데, 지질 분해와 지질 합성이 모두 증가되는 형태로 나타난다. 지질 분해의 증가 및 그에 따른 유리 지방산의 이용 증가는 비만, 특히 복부 비만의 가장 큰 특징이며, 지방 용적과 지질 산화 간에 높은 상관관계가 관찰되어 지방 용적의 증가가 혈중 유리 지방산 및 지질 산화 증가의 원인으로 간주되고 있다.
더욱이 제2형 당뇨병 환자의 70% 이상이 비만에 속하며 이러한 비만으로부터 고혈압, 고지혈증 및 일부 암 등의 다른 질병이 발병하는 위험도 증가하는 것으로 보고되고 있다.
그러나 현재까지 대사성 질환의 치료를 위한 약제는 개발되지 못하고 있으며, 당뇨병, 고지혈증 및 고혈압 치료 약물을 이용하여 대사성 질환의 치료를 시도하고 있으나, 약제로서의 한계를 갖고 있다.
따라서 비만 및 비만으로 유도되는 대사성 질환들의 유발 기작을 보다 효율적으로 조절함으로써 대사성 질환을 효과적으로 예방 및 치료할 수 있는 기술들의 개발이 필요하다.
이에, 본 발명자들은 이소나이트라민 및 그 유도체의 입체이성질체와 이의 라세미 혼합물을 유효성분으로 포함하는 약학 조성물과 건강식품이 우수한 대사성 질환 치료 효과를 가짐을 확인함으로써 본 발명을 완성하였다.
따라서 본 발명의 목적은 이소나이트라민 및 그 유도체의 입체이성질체와 이의 라세미 혼합물을 유효성분으로 포함하는 대사성 질환 예방 또는 치료용 약학 조성물과 건강식품을 제공하는 데에 있다.
상기 목적을 달성하기 위하여, 본 발명은 하기 화학식 1로 표시되는 입체이성질체 또는 이의 라세미 혼합물을 유효성분으로 포함하는 대사성 질환 예방 또는 치료용 약학 조성물, 예방 또는 개선용 건강식품을 제공한다.
[화학식 1]
Figure PCTKR2016009036-appb-I000001
화학식 1에 있어서,
X는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, X가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, X가
Figure PCTKR2016009036-appb-I000002
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이고;
Y는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, Y가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, 또는 Y가
Figure PCTKR2016009036-appb-I000003
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이며;
상기 6번 탄소와 7번 탄소는 카이랄 중심임.
또한 본 발명은 하기 화학식 2로 표시되는 입체이성질체 또는 이의 라세미 혼합물을 유효성분으로 포함하는 대사성 질환 예방 또는 치료용 약학 조성물, 예방 또는 개선용 건강식품을 제공한다.
[화학식 2]
Figure PCTKR2016009036-appb-I000004
화학식 2에 있어서,
X는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, X가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, X가
Figure PCTKR2016009036-appb-I000005
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이고;
Y는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, Y가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, 또는 Y가
Figure PCTKR2016009036-appb-I000006
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이며;
상기 6번 탄소와 7번 탄소는 카이랄 중심임.
또한 본 발명은 하기 화학식 3으로 표시되는 입체이성질체 또는 이의 라세미 혼합물을 유효성분으로 포함하는 대사성 질환 예방 또는 치료용 약학 조성물, 예방 또는 개선용 건강식품을 제공한다.
[화학식 3]
Figure PCTKR2016009036-appb-I000007
화학식 3에 있어서,
X는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, X가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, X가
Figure PCTKR2016009036-appb-I000008
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이고;
Y는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, Y가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, 또는 Y가
Figure PCTKR2016009036-appb-I000009
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이며;
상기 6번 탄소는 카이랄 중심임.
본 발명에 따르면, 신규한 이소나이트라민(Isonitramine) 및 그 유도체의 입체이성질체와 이의 라세미 혼합물은 지방함량 또는 지방세포 분화 억제, 탄수화물 대사 효소의 활성 억제, 췌장보호 및 혈당 저해 효과 및 인슐린 분비 촉진 효과를 보이므로, 대사성 질환 예방 또는 치료용 약학 조성물 또는 건강식품으로 유용하게 사용될 수 있다.
도 1은 본 발명의 실시예에 따른 (+)-이소나이트라민 입체이성질체((+)-이소나이트라민 (1)) 또는 이의 유도체 2 내지 6의 구조식이다.
도 2는 본 발명의 다른 실시예에 따른 (+)-이소나이트라민 (1)의 지방함량에 대한 억제 효능을 나타낸 것이다.
도 3은 도 2의 실시예에 따른 (+)-이소나이트라민 (1)의 지방세포 분화에 대한 억제 기작을 나타낸 것이다.
도 4는 또 다른 실시예에 따른 (+)-이소나이트라민 (1) 또는 이의 유도체 2 내지 6의 탄수화물 대사 효소의 활성에 대한 억제 효능을 나타낸 막대그래프이다.
도 5는 도 4의 실시예에 따른 (+)-이소나이트라민 (1)의 췌장 보호 효과를 나타낸 결과이다.
도 6은 도 4의 실시예에 따른 (+)-이소나이트라민 (1)의 혈당 저해 효과를 나타낸 막대그래프이다.
도 7은 또 다른 실시예에 따른 (+)-이소나이트라민 (1)의 인슐린 분비 촉진 효과를 나타낸 막대그래프이다.
도 8은 또 다른 실시예에 따른 (+)-이소나이트라민 (1)의 인슐린 분비 촉진 효과를 나타낸 것이다.
도 9는 도 8의 실시예에 따른 (+)-이소나이트라민 (1)의 PEPCK 억제 효과를 나타낸 것이다.
본 발명의 발명자는 이소나이트라민(Isonitramine) 입체이성질체와 이의 유도체를 합성하고 이에 대해 연구하던 중, 상기 화합물이 지방함량 또는 지방세포 분화 억제, 탄수화물 대사 효소의 활성 억제, 췌장보호, 혈당 저해 효과 및 인슐린 분비 촉진 효과를 보이는 것을 확인하여 본 발명을 완성하였다.
따라서 본 발명은 하기 화학식 1로 표시되는 입체이성질체 또는 이의 라세미 혼합물을 유효성분으로 포함하는 대사성 질환 예방 또는 치료용 약학 조성물을 제공한다:
[화학식 1]
Figure PCTKR2016009036-appb-I000010
화학식 1에 있어서,
X는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, X가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, X가
Figure PCTKR2016009036-appb-I000011
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이고;
Y는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, Y가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, 또는 Y가
Figure PCTKR2016009036-appb-I000012
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이며;
상기 6번 탄소와 7번 탄소는 카이랄 중심임.
여기서, 상기 '입체 이성질체'는 분자식 및 구성 원자의 연결 방법도 같으나 원자 사이의 공간적 배치가 다른 것을 의미한다. 즉, 상기 화학식 1의 6번 탄소와 7번 탄소에 존재하는 입체 중심(chiral center)에 의해 생성되는 상기 입체 이성질체는 (6R, 7R), (6R, 7S), (6S, 7S), (6S, 7R)형일 수 있다.
상기 '라세미 혼합물'은 (+)-체와 (-)-체가 서로 같은 비율, 즉 50:50으로 혼합되어 있는 것을 의미한다. 따라서 상기 라세미 혼합물은 화학식 1의 입체 이성질체 (6R, 7R)과 (6S, 7S)가 각각 50:50으로 존재하는 혼합물 또는 (6R, 7S)과 (6S, 7R)가 각각 50:50으로 존재하는 혼합물일 수 있다.
또한 본 발명은 하기 화학식 1로 표시되는 입체이성질체 또는 이의 라세미 혼합물을 유효성분으로 포함하는 대사성 질환 예방 또는 개선용 건강식품을 제공한다:
[화학식 1]
Figure PCTKR2016009036-appb-I000013
화학식 1에 있어서,
X는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, X가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, X가
Figure PCTKR2016009036-appb-I000014
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이고;
Y는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, Y가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, 또는 Y가
Figure PCTKR2016009036-appb-I000015
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이며;
상기 6번 탄소와 7번 탄소는 카이랄 중심임.
즉, 상기 화학식 1의 6번 탄소와 7번 탄소에 존재하는 입체 중심(chiral center)에 의해 생성되는 상기 입체 이성질체는 (6R, 7R), (6R, 7S), (6S, 7S), (6S, 7R)형일 수 있다.
또한, 상기 라세미 혼합물은 화학식 1의 입체 이성질체 (6R, 7R)과 (6S, 7S)가 각각 50:50으로 존재하는 혼합물 또는 (6R, 7S)과 (6S, 7R)가 각각 50:50으로 존재하는 혼합물일 수 있다.
더불어 본 발명은 하기 화학식 2로 표시되는 입체이성질체 또는 이의 라세미 혼합물을 유효성분으로 포함하는 대사성 질환 예방 또는 치료용 약학 조성물을 제공한다:
[화학식 2]
Figure PCTKR2016009036-appb-I000016
화학식 2에 있어서,
X는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, X가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, X가
Figure PCTKR2016009036-appb-I000017
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이고;
Y는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, Y가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, 또는 Y가
Figure PCTKR2016009036-appb-I000018
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이며;
상기 6번 탄소와 7번 탄소는 카이랄 중심임.
즉, 상기 화학식 2의 6번 탄소와 7번 탄소에 존재하는 입체 중심(chiral center)에 의해 생성되는 상기 입체 이성질체는 (6R, 7R), (6R, 7S), (6S, 7S), (6S, 7R)형일 수 있다.
또한, 상기 라세미 혼합물은 화학식 2의 입체 이성질체 (6R, 7R)과 (6S, 7S)가 각각 50:50으로 존재하는 혼합물 또는 (6R, 7S)과 (6S, 7R)가 각각 50:50으로 존재하는 혼합물일 수 있다.
또한 본 발명은 하기 화학식 2로 표시되는 입체이성질체 또는 이의 라세미 혼합물을 유효성분으로 포함하는 대사성 질환 예방 또는 개선용 건강식품을 제공한다:
[화학식 2]
Figure PCTKR2016009036-appb-I000019
화학식 2에 있어서,
X는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, X가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, X가
Figure PCTKR2016009036-appb-I000020
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이고;
Y는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, Y가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, 또는 Y가
Figure PCTKR2016009036-appb-I000021
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이며;
상기 6번 탄소와 7번 탄소는 카이랄 중심임.
즉, 상기 화학식 2의 6번 탄소와 7번 탄소에 존재하는 입체 중심(chiral center)에 의해 생성되는 상기 입체 이성질체는 (6R, 7R), (6R, 7S), (6S, 7S), (6S, 7R)형일 수 있다.
또한, 상기 라세미 혼합물은 화학식 2의 입체 이성질체 (6R, 7R)과 (6S, 7S)가 각각 50:50으로 존재하는 혼합물 또는 (6R, 7S)과 (6S, 7R)가 각각 50:50으로 존재하는 혼합물일 수 있다.
더불어 본 발명은 하기 화학식 3으로 표시되는 입체이성질체 또는 이의 라세미 혼합물을 유효성분으로 포함하는 대사성 질환 예방 또는 치료용 약학 조성물을 제공한다:
[화학식 3]
Figure PCTKR2016009036-appb-I000022
화학식 3에 있어서,
X는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, X가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, X가
Figure PCTKR2016009036-appb-I000023
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이고;
Y는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, Y가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, 또는 Y가
Figure PCTKR2016009036-appb-I000024
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이며;
상기 6번 탄소는 카이랄 중심임.
즉, 상기 화학식 3의 6번 탄소에 존재하는 입체 중심(chiral center)에 의해 생성되는 상기 입체 이성질체는 (R), (S)형일 수 있다.
또한, 상기 라세미 혼합물은 화학식 3의 입체 이성질체 (R)형 및 (S)형이 각각 50:50으로 존재하는 혼합물일 수 있다.
또한 본 발명은 하기 화학식 3으로 표시되는 입체이성질체 또는 이의 라세미 혼합물을 유효성분으로 포함하는 대사성 질환 예방 또는 개선용 건강식품을 제공한다:
[화학식 3]
Figure PCTKR2016009036-appb-I000025
화학식 3에 있어서,
X는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, X가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, X가
Figure PCTKR2016009036-appb-I000026
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이고;
Y는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, Y가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, 또는 Y가
Figure PCTKR2016009036-appb-I000027
인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이며;
상기 6번 탄소는 카이랄 중심임.
즉, 상기 화학식 3의 6번 탄소에 존재하는 입체 중심(chiral center)에 의해 생성되는 상기 입체 이성질체는 (R), (S)형일 수 있다.
또한, 상기 라세미 혼합물은 화학식 3의 입체 이성질체 (R)형 및 (S)형이 각각 50:50으로 존재하는 혼합물일 수 있다.
상기 대사성 질환은 비만, 당뇨, 고지혈증, 고중성지방혈증, 간질환, 동맥경화, 뇌졸중, 심근경색, 심혈관 질환, 과혈당증, 인슐린 저항성 질환 및 과인슐린혈증으로 이루어진 군에서 선택되나, 이에 제한되는 것은 아니다.
상기 약학 조성물은 통상적인 방법에 따라 겔제, 유제, 주사제, 산제, 과립제, 에어로솔제, 페이스트제, 경피흡수제 및 패치제로 이루어진 군에서 선택된 하나 이상의 제형으로 제공될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 구체예에서, 상기 약학 조성물은 약학 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제, 붕해제, 감미제, 피복제, 팽창제, 윤활제, 활택제, 향미제, 항산화제, 완충액, 정균제, 희석제, 분산제, 계면활성제, 결합제 및 윤활제로 이루어진 군에서 선택되는 하나 이상의 첨가제를 추가로 포함할 수 있다.
구체적으로 담체, 부형제 및 희석제는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 사용할 수 있으며, 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 조성물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘카보네이트, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제할 수 있다. 또한 단순한 부형제 이외에 마그네슘 스티레이트, 탈크 같은 윤활제들도 사용할 수 있다. 경구를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 있으며 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제 등이 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기재로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
상기 입체이성질체 또는 이의 라세미 혼합물의 바람직한 투여량은 대상체의 상태 및 체중, 질환의 종류 및 정도, 약물 형태, 투여경로 및 기간에 따라 달라질 수 있으며 당업자에 의해 적절하게 선택될 수 있다. 본 발명의 일실시예에 따르면 이에 제한되는 것은 아니지만 1일 투여량이 0.01 내지 200 mg/kg, 구체적으로는 0.1 내지 200 mg/kg, 보다 구체적으로는 0.1 내지 100 mg/kg 일 수 있다. 투여는 하루에 한 번 투여할 수도 있고 수회로 나누어 투여할 수도 있으며, 이에 의해 본 발명의 범위가 제한되는 것은 아니다.
본 발명에 있어서, 상기 '대상체'는 인간을 포함하는 포유동물일 수 있으나, 이들 예에 한정되는 것은 아니다.
상기 건강식품은 분말, 과립, 정제, 캡슐, 시럽 또는 음료의 형태로 제공될 수 있으며, 상기 건강식품은 유효성분인 입체이성질체 또는 이의 라세미 혼합물 이외에 다른 식품 또는 식품 첨가물과 함께 사용되고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효성분의 혼합양은 그의 사용 목적 예를 들어 예방, 건강 또는 치료적 처치에 따라 적합하게 결정될 수 있다.
상기 건강식품에 포함된 입체이성질체 또는 이의 라세미 혼합물의 유효용량은 상기 약학조성물의 유효용량에 준해서 사용할 수 있으나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 범위 이하일 수 있으며, 유효성분은 안전성 면에서 아무런 문제가 없기 때문에 상기 범위 이상의 양으로도 사용될 수 있음은 확실하다.
상기 건강식품의 종류에는 특별한 제한이 없고, 예로는 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등을 들 수 있다.
이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이며, 본 발명의 내용을 예시하는 것일 뿐이므로 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다.
<실시예 1> 이소나이트라민 입체이성질체 또는 이의 유도체 합성
종전 본 발명의 발명자들이 공지한 문헌의 방법을 따라 도 1과 같은 이소나이트라민 입체이성질체 및 이의 유도체를 합성하였다.
(+)-이소나이트라민 입체이성질체 ((+)-이소나이트라민 (1)) 또는 이의 유도체 2는 이미 공지된 문헌(Org. Lett. 2012, 14, 852-854)의 방법을 따라 합성하였다.
더불어 이소나이트라민 유도체 3 내지 6은 이미 공지된 문헌(Adv. Synth. Catal. 2011, 353, 3313 - 3318.)의 방법을 따라 합성하였다.
<실시예 2> 이소나이트라민 유도체의 지방 축적 및 지방세포 분화 억제 효과
1. 세포 배양 및 분화
마우스 3T3-L1 지방전구세포(preadipocytes)를 10% 신생송아지혈청(newborn calf serum, Gibco BRL, NY, USA), 항생제(100 U/ml 페니실린과 100 μg/ml 스트렙토마이신, Gibco BRL, NY, USA)를 포함하는 배지(Dubecco's modified Eagle's medium, DMEM)를 이용하여 가습의 37℃, 5% CO2 배양기에서 배양하였다.
그 후, 배양한 3T3-L1 세포들에 시그마(sigma, St. Louis, MO)에서 구매한 0.5 mM의 1-메틸-3-이소뷰틸잔틴(1-methyl-3-isobutylxanthine), 1 μM의 덱사메타손(dexamethasone), 1 μg/mL의 인슐린(insulin) 및 10% 소태아혈청(fetal bovine serum, FBS, Gibco BRL)을 처리하고 2일 동안 배양하여 분화를 유도하였다. 2일이 지난 후, 배양 배지를 10% FBS, 1 μg/mL의 인슐린을 포함하는 신선한 DMEM으로 교체하였고, 그 후 4일 동안 10% FBS를 포함하는 신선한 DMEM으로 교체해주었다.
8일 후, 90%가 넘는 세포가 지방세포 표현형(adipocyte phenotype)을 보여주었다.
2. 역전사 중합효소 연쇄반응(Reverse transcriptase -polymerase chain reaction, RT-PCR)
제조사의 지침을 따라, 트리졸(Trizol, Invitrogen)을 이용하여 미분화 또는 분화된 지방세포에서 총 세포의 RNA를 추출하였다.
총 RNA(4 μg)는 M-MLV 역전사 효소(M-MLV Reverse Transcriptase, Promega)를 이용하여 cDNA로 역전사한 후, 퍼옥시좀 증식체 활성화 수용체 감마(peroxisome proliferator activated receptor γ, PPARγ), CCAT/증폭자 결합 단백질-알파(CCAAT/enhancer binding protein-α, C/EBPα), 지방세포 단백질 2(adipocyte Protein 2, aP2), 지방단백리파아제(Lipoprotein Lipase, LPL) 및 아디포넥틴(adiponectin)의 발현을 확인하였다.
이때, 사용한 프라이머는 하기 표 1과 같으며, 바이오니아(Bioneer)에서 구매하였다.
명칭 방향 시퀀스 서열번호
PPARγ forward(정방향) GTGATGGAAGACCACTCGCAT 1
reverse(역방향) ACCATTGGGTCAGCTCTTGTG 2
C/EBPα forward(정방향) AGGTGCTGGAGTTGACCAGTG 3
reverse(역방향) CCGGAATCTCCTAGTCCTGGC 4
aP2 forward(정방향) AAGGTGAAGAGCATCATAACCCT 5
reverse(역방향) TCACGCCTTTCATAACACATTCC 6
LPL forward(정방향) GGGAGTTTGGCTCCAGAGTTT 7
reverse(역방향) TGTGTCTTCAGGGGTCCTTAG 8
adiponectin forward(정방향) TGTTCCTCTTAATCCTGCCCA 9
reverse(역방향) CCAACCTGCACAAGTTCCCTT 10
β-actin forward(정방향) AGAGGGAAATCGTGCGTGAC 11
reverse(역방향) GGCCGTCAGGCAGCTCATAG 12
선형 위상(linear phase)에서 발생한 증폭을 확인하기 위하여 사이클의 가변수(variable number)를 이용하였다.
PCR 증폭에서 β-액틴을 내부 대조군으로 사용하였으며, PCR 생성물은 2.0% 아가로스 겔(agarose gel)을 이용하여 분리하였고, 레드세이프 핵산 염색(RedSafe nucleic acid staining, Intron, Korea)와 UV 조사(irradiation)를 이용하여 시각화하였다.
3. 나일 레드 염색(Nile Red staining)
미분화 또는 분화된 세포들은 인산완충식염수(phosphate-buffered saline, PBS)를 이용하여 세 번 세척하였고, 4% 4-포름알데히드(4-formaldehyde, PFA)로 1시간 동안 실온에서 고정하였다. 그 후 PBS로 세 번 세척하고, 0.5 μg/ml의 나일 레드(Sigma, St. Louis, MO)를 이용하여 10분 동안 염색하였다. 염색이 끝난 후 PBS로 세척하고, 핵을 4'-6-디아미디노-2-페닐인돌(4'-6-Diamidino-2-phenylindole, DAPI, Invitrogen)을 이용하여 염색하였다. 위상차 현미경(Axiovert M200 microscope, Zeiss)를 이용하여 이미지를 얻었다.
4. 트리글리세리드(Triglyceride) 농도 분석
세포내 트리글리세리드 농도는 시그마에서 구매한 트리글리세리드 시약과 자유 글리세롤 시약(free glycerol reagent)을 이용하여 측정하였다.
지방세포는 6 웰 플레이트에서 100 또는 500 μM 농도의 (+)-이소나이트라민 (1)과 함께 8일 동안 분화시켰다.
세포내 트리글리세리드의 농도를 분석하기 위해, 세포를 PBS로 세척하고, 100 μl의 용해 버퍼로 용해한 후, 20 μl의 용해물을 20 μl의 트리글리세리드 시약과 혼합하고 30분 동안 37℃에서 배양하였다. 이후, 30 μl의 각 혼합물을 96 웰 플레이트에 옮긴 후, 100 μl의 프리 글리세롤 시약을 첨가해주고 37℃에서 5분 동안 배양하였다.
배양이 끝나고, 분광광도계(spectrophotometer)를 이용하여 540 nm에서 흡광도를 측정하였다.
5. 실험 결과
상기 실시예 1에서 합성한 (+)-이소나이트라민 (1)의 지방 축적 및 분화 억제 효과를 확인한 결과 도 2 중 A와 같이, (+)-이소나이트라민 (1)은 3T3-L1 지방세포의 성숙한 지방세포로의 분화과정을 억제하였고, 도 2 중 B와 같이, 농도 의존적으로 트리글리세리드의 농도도 감소시킨 것을 확인하였다.
더불어 도 3과 같이, 세포 독성 없이 지방세포에서 지방분화를 담당하는 단백질로 과다 발현되면 비만 및 지방간 같은 부작용을 유도하는 것으로 알려진 PPARγ와 지방생합성을 촉진하고 지방세포의 분화를 촉진하는 C/EBPα의 mRNA 발현을 억제했으며, 두 유전자가 전사인자로 작용하여 발현을 조절하는 aP2, LPL, 아디포넥틴의 mRNA 발현도 약화시켰다.
따라서 본 발명에 따른 이소나이트라민 입체이성질체가 지방의 축적과 관련된 비만을 예방 또는 치료 효과를 갖는다는 것을 확인하였다.
<실시예 3> 이소나이트라민 유도체의 항 당뇨 효능
글루코스 분석 키트(glucose assay kit)는 영동상사(Youngdong Co, Seoul, Korea)로부터 구매하여 사용하였다. 더불어 시그마에서 돼지의 α-아밀라아제(Porcine α-amylase), 이스트 α-글루코시다아제(yeast α-glucosidase), 3, 5-디니트로살리실산(3, 5-dinitrosalicylic acid, DNS), p-니트로페놀 글루코시드(p-nitrophenol glucoside, pNPG), 랫트 창자의 아세톤 파우더(rat intestinal acetone powder), 수크로오스(sucrose) 및 말토오스(maltose)를 구매하였다. 가용성 전분(Soluble starch)은 삼전화학(Samchun Chemical Co., Seoul, Korea)에서 획득하였고 아카보즈(Acarbose)는 도쿄 화학 공업(Tokyo chemical industry Co., Tokyo, Japan)에서 구매하였다.
1. 돼지(Porine)의 α-아밀라아제 억제 효과 분석
5 μl의 α-아밀라아제(0.1 U/mL)를 50 mM의 인산완충액(phosphate buffer, pH 6.8)을 이용하여 희석하였고, 100 μM의 상기 실시예 1에서 합성한 (+)-이소나이트라민 (1) 또는 유도체 2 내지 6을 각각 혼합하였다. 더불어 양성 대조군으로 아카보즈를 같은 농도로 혼합하였다.
상기 혼합물들을 37℃에서 10분 동안 예비배양하고 0.5 % 전분 용액 25 μl을 첨가하고 37℃에서 10분 동안 배양한 후, 100℃에서 5분 동안 배양하여 반응을 정지시키고 냉각하였다.
25 μl의 DNS를 냉각된 반응 용액에 첨가하고, 100℃에서 5분 동안 정색 반응(Color reaction)을 유도한 후, 냉각시켰다. 그런 다음, 정색 반응이 유도된 용액을 96 웰 플레이트로 옮겨 96 웰 마이크로플레이트 리더기(96 well microplate reader)를 이용하여 540 nm에서 흡광도를 측정하였다.
억제 효과는 하기 수학식 1을 이용하여 산출하였다.
[수학식 1]
효소의 억제 활성(Enzymatic inhibitory activity)= (1-Ax/A0) x 100%
* Ax는 대조군의 흡광도 값
* A0는 본 발명에 따른 이소나이트라민 처리 시 흡광도 값
2. 이스트(Yeast)의 α-아밀라아제 억제 효과 분석
5 μl의 α-아밀라아제(0.1 U/mL)를 50 mM의 초산나트륨 완충액(Sodium acetate buffer, pH 5.6)을 이용하여 희석하였고, 100 μM의 상기 실시예 1에서 합성한 (+)-이소나이트라민 (1) 또는 유도체 2 내지 6을 각각 혼합하였다. 더불어 양성 대조군으로 아카보즈를 같은 농도로 혼합하였다.
상기 혼합물들을 37℃에서 10분 동안 예비배양하고 pNPG 25 μl을 첨가하고 60℃에서 10분 동안 배양한 후, 1N NaOH를 첨가하여 반응을 정지시켰다.
그런 후, 정색 반응이 유도된 용액을 96 웰 플레이트로 옮기고 96 웰 마이크로플레이트 리더기(96 well microplate reader)를 이용하여 405 nm에서 흡광도를 측정하였다.
3. 랫트 창자의 α-아밀라아제 억제 효과 분석
먼저 랫트 창자의 아세톤 파우더 100 mg을 0.9% NaCl 용액 3 ml에 첨가하고 아이스에서 5분 동안 균질화한 후, 12,000 rpm의 속도로 30분 동안 원심분리하여 상층액을 제거하고 침전물은 15 ml 튜브로 옮겼다.
그 후 효소 용액 50 μl를 10 μl의 (+)-이소나이트라민 (1)과 혼합하였고, 더불어 양성 대조군으로 아카보즈를 같은 농도로 혼합하여 37℃에서 5분 동안 배양하였다.
이에 1 mM의 pNPG, 56 mM의 수크로오스, 5 mM의 말토오스를 0.1M 인산완충액(pH 7.0)에 용해시킨 것을 기질로 사용하여, 기질 50 μl를 첨가하고 37℃에서 5분 동안 배양하였다.
상기 반응 용액 5 μl를 글루코스 트린더 키트(glucose trinder kit) 용액 500 μl에 혼합하고 37℃에서 5분 동안 배양한 후, 정색 반응이 유도된 용액을 100℃에서 2분 동안 정지시키고, 96 웰 플레이트로 이동시켜 570 nm에서 흡광도를 측정하였다.
글루코스 기준 곡선(glucose standard curve)를 측정하기 위해 D-글루코스(D-glucose)를 0.1M의 인산 완충액(pH 7.0)을 이용하여 다양한 농도(0 내지 480 mg/dL)로 희석하였다.
글루코스 기준 용액 5 μl를 글루코스 트린더 키트 용액 500 μl에 혼합한 후 37℃에서 5분 동안 배양하였다. 그런 다음, 정색 반응이 유도된 용액을 100℃에서 2분 동안 정지시킨 후, 96 웰 플레이트로 이동시키고 570 nm에서 흡광도를 측정하였다.
4. 제브라피쉬 췌장 독성 측정
5일된 제브라피쉬 유생(ins:EGFP larvae)를 96 웰 플레이트에 넣고 상기 실시예 1에서 합성한 (+)-이소나이트라민 (1)과 함께 27℃에서 24시간 반응시킨 후, 각 유생을 500 μM의 알록산(alloxan, Sigma, St. Louis, MO, USA)이 첨가된 또는 무첨가된 신선한 E3 용액에서 30분간 두었다.
30분이 지난 후, 모든 유생을 4% 파라-포름알데히드(para-formaldehyde, PFA)를 이용하여 실온에서 50분 동안 고정시켰다. 이를 PBS로 세척하고, 췌장 섬(islet)에서 발현을 보여주는 인슐린의 형광 이미지를 위상차 현미경(Axiovert M200 microscope, Zeiss)을 이용하여 얻었다.
그 후, 췌장의 화소 강도를 이미지 J(Image J)를 이용하여 EGFP 형광 영역의 백분율로 측정하였고, 통계적으로 비교하여 기록하였다.
5. 당뇨 유발 제브라피쉬의 식후 고혈당 관리 측정
제브라피쉬를 8℃의 물에 20초 동안 배치하여 마취시켰다.
복강 내 주입(intraperitoneal injection)을 위해 25 게이지 바늘(gauge needle, Trajan Scientific, Australia)를 포함한 주사기로 0.09%의 NaCl 용액의 0.9% 스트렙토조신(streptozocin, Sigma, St. Louis, MO) 용액을 350 mg/kg의 투여량으로 주입하였으며, 대조군 제브라피쉬에는 같은 양의 PBS를 복강 내 주입하였고, 주입이 끝난 후 24℃에서 사육하였다.
제브라피쉬는 일주일 동안 STZ 또는 PBS로 세 번 복강 주사(350 mg/kg)하였고 최종 주입 후, 5일 동안 상업 플레이크 사료(commercial flake food, Tetrabits tropical flakes, Tetra, Germany)를 공급하였다.
그리고 24시간 금식시킨 후, PBS를 주입한 제브라피쉬에게는 상업 플레이크 사료를 공급하고, STZ가 주입된 물고기에게는 다양한 농도의 (+)-이소나이트라민 (1)이 혼합된 플레이크를 1시간 동안 공급하였다. 그런 후, 플라즈마 혈액(plasma blood)을 글루코스 트린더 키트 용액을 사용하여 효소적으로 측정하였다.
6. 실험 결과
상기 실시예 1에서 합성한 (+)-이소나이트라민 (1)과 유도체 2 내지 6의 항 당뇨 효과를 확인한 결과, 도 4와 같이, (+)-이소나이트라민 (1)과 유도체 2는 유도체 4 내지 6에 비해 탄수화물 흡수에 필수적인 대사효소에 대해 선택적인 억제 효능을 갖는 것을 확인하였다. 특히 α-글루코시다제를 저해하면서도 α-아밀라아제는 거의 억제하지 않아 기존 약물인 아카보오스의 복부팽만, 설사 등의 부작용의 우려가 거의 없었다.
더불어 도 5와 같이, (+)-이소나이트라민 (1)은 제브라피쉬 모델에서 발생 및 심혈관계 독성이 없는 것을 확인하였고, 도 6과 같이, 농도 의존적으로 혈당을 저해하는 효과를 보인다는 것을 확인하였다.
<실시예 4> 이소나이트라민 유도체의 인슐린 분비에 대한 효능
1. 세포 배양
이소나이트라민 유도체의 인슐린 분비에 미치는 효과를 알아보기 위하여, 인슐린 세포의 일종인 HIT-T15 세포를 한국 세포주 은행에서 분양받아 계대 배양하였다. 구체적으로, 상기 HIT-T15 세포를 RPMI1640 (invitrogen. Co, USA) 배지에 10% 태아소혈청(FBS; invitrogen. Co, New Zealand 10091-148), 페니실린(penicillin) 100 mu/ml 및 스트렙토마이신(streptomycin) 100 μg/ml을 첨가한 배지를 이용하여 37 ℃ 및 5% CO2가 공급되는 조건 하에서 배양하였다.
2. 인슐린 분비량 측정
(+)-이소나이트라민에 의한 인슐린 분비량은 Mercodia사의 Insulin ELISA kit (Cat.10-1113-01)를 이용하여 권장법에 따라 측정하였다. 먼저 HIT-T15 세포를 96 웰 플레이트(well plate)에 5×104 cells/well이 되도록 분주한 후, 70-80 %로 자랄 때까지 37℃, CO2 배양기(incubator)에 배양하였다. 그런 다음, 췌장에 특이적인 독성반응을 유도하는 500 μM 알록산(alloxan)을 30분간 전 처리하였다. 그 후, 각 웰(well)에 (+)-이소나이트라민을 첨가하여 24시간 동안 배양한 후 배양액을 채취하여 15,000 rpm에서 3분 동안 세포를 침전시켜 상층액을 준비하였다. ELISA kit의 각 웰에 25 μl의 상기 상층액을 넣고, 100 μl의 효소 콘주게이트 용액(enzyme conjugate solution)을 첨가하여 플레이트 교반기(plate shaker)에 1시간 동안 방치하여 항원-항체반응을 유도하였다. 1시간 후 상층액을 제거하고, 세척 버퍼(wash buffer, 350 μl)를 이용하여 비특이적으로 결합된 단백질이나 결합되지 않은 단백질을 세척하였다. 여기에 200 μl의 기질(substrate, TMB)을 첨가하여 실온에서 15분 동안 효소반응을 유도한 뒤 50 μl의 종결 용액(stop solution)을 첨가하여 반응을 종결하였다. 반응 종결에 따라 나타난 변화를 ELISA-reader (VERSA max, micro-reader, MDS. Co, USA)를 이용하여 450 nm에서 측정하였다.
3. 실험 결과
상기 실시예 1에서 합성한 (+)-이소나이트라민의 인슐린 분비에 미치는 효과를 나타낸 결과를 도 7에 나타내었다.
도 7에 따르면, 정상 상태에서 분비되는 인슐린은 33.39 ± 1.12 ng/mL (n = 4)으로 측정되었고, 알록산 처리 시에 18.92 ± 0.43 ng/mL로 감소됨을 확인하였다. 즉, 이소나이트라민은 농도 의존적으로 인슐린 분비를 증가시키는 효과를 나타내었다.
<실시예 5> 이소나이트라민 유도체의 대사 호르몬 조절에 대한 효능
1. 세포 배양
제브라피쉬 배아는 대사 연구 분야에서 최근 널리 사용되기 시작한 모델시스템으로, 특히 당조절과 관련하여 인체와 상당히 유사한 형태의 대사를 나타내기 때문에 당뇨 및 당 대사 연구 분야에서 많이 활용되고 있다. 이에, 당 대사와 관련해, 당 신생 과정의 첫 단계를 조절하는 핵심 효소인 포스포에놀 피루브산 카르복시인산화효소(Phosphoenolpyruvate carboxykinase, PEPCK)와 인슐린 발현에 대한 이소나이트라민의 효과를 검증하기 위하여 제브라피쉬 배아를 사용하였다.
인슐린 분비량에 대한 효과를 보기 위한 실험에서는 수정 후 96 시간(96 hour post-fertilization, hpf)된 제브라피쉬 배아를 탈각하고 이소나이트라민을 48시간동안 처리하였고, 당 신생에 대한 효과를 보기 위한 실험에서는 100 mM 사이클릭 AMP(cyclic AMP, cAMP) 및 100 mM 덱사메타손(dexamethasone, DEX)을 이소나이트라민과 동시에 처리하여 48 시간동안 배양하였다.
2. 인슐린 분비 및 PEPCK 발현량 측정
상기에서 배양한 배아에서 TRIzol (Invitrogen)을 이용하여 mRNA를 분리하였고, 분리된 RNA는 iScript cDNA Synthesis Kit (Bio-Rad)를 이용하여 cDNA로 합성하였다. 이후 cDNA를 증폭시키기 위해 사용한 프라이머는 하기 표 2와 같으며, 각 프라이머들은 바이오니아(Bioneer)에서 구매하였다.
명칭 방향 시퀀스 서열번호
zf PEPCK forward(정방향) GAGAATTCTCACACACAC ACACGTGAGCAGTA 13
reverse(역방향) GTAAAAGCTTTCCGCCATAACATCTCCAGCAGAA 14
zf prepro-insulin (insa) forward(정방향) AGTGTAAGCACTAACCCAGGCACA 15
reverse(역방향) TGCAAAGTCAGCCACCTCAGTTTC 16
zf β-actin forward(정방향) CGAGCAGGAGATGGGAACC 17
reverse(역방향) CAACGGAAACGCTCATTGC 18
PCR 증폭 시 β-액틴을 내부 대조군으로 사용하였으며, PCR 생성물은 2.0% 아가로스 겔(agarose gel)을 이용하여 분리하였고, 레드세이프 핵산 염색(RedSafe nucleic acid staining, Intron, Korea)과 UV 조사(irradiation)를 이용하여 시각화하였다.
3. 실험 결과
상기 실시예 1에서 합성한 (+)-이소나이트라민의 인슐린 분비 및 PEPCK의 발현에 미치는 효과를 나타낸 결과를 도 8 및 도 9에 나타내었다.
도 8을 참조하면, 이소나이트라민의 농도가 증가할수록 인슐린의 발현량이 증가하였고, 도 9를 참조하면, 이소나이트라민의 농도와 비례하여 PEPCK의 발현 억제 효과가 현저하게 증가하였다.
즉, 상기 실시예 4 및 실시예 5의 결과를 종합해보면, 이소나이트라민 및 이을 포함하는 약학조성물 및 건강식품은 인슐린의 발현을 촉진하면서, 동시에 당 신생 과정을 억제하여 혈당을 감소시키는 효과가 있음을 알 수 있다.
하기에 본 발명에 따른 이소나이트라민 입체이성질체 또는 이의 라세미 혼합물을 포함하는 조성물의 제제예를 설명하나, 본 발명은 이를 한정하고자 함이 아닌 단지 구체적으로 설명하고자 함이다.
<처방예 1> 약학조성물의 처방예
<처방예 1-1> 산제의 제조
(+)-이소나이트라민 20 mg, 유당 100 mg 및 탈크 10 mg을 혼합하고 기밀포에 충진하여 산제를 제조하였다.
<처방예 1-2> 정제의 제조
(+)-이소나이트라민 1 mg, 옥수수전분 100 mg, 유당 100 mg 및 스테아린산 마그네슘 2 mg을 혼합한 후 통상의 정제의 제조방법에 따라서 타정하여 정제를 제조하였다.
<처방예 1-3> 캅셀제의 제조
(+)-이소나이트라민 10 mg, 옥수수전분 100 mg, 유당 100 mg 및 스테아린산 마그네슘 2 mg을 혼합한 후 통상의 캡슐제 제조방법에 따라 상기의 성분을 혼합하고 젤라틴 캡슐에 충전하여 캡슐제를 제조하였다.
<처방예 1-4> 주사제의 제조
(+)-이소나이트라민 10 mg, 주사용 멸균 증류수 적량 및 pH 조절제 적량을 혼합한 후 통상의 주사제의 제조방법에 따라 1 앰플당(2 ㎖) 상기의 성분 함량으로 제조하였다.
<처방예 1-5> 연고제의 제조
(+)-이소나이트라민 10 mg, PEG-4000 250 mg, PEG-400 650 mg, 백색바셀린 10 mg, 파라옥시안식향산메칠 1.44 mg, 파라옥시안식향산프로필 0.18 mg 및 잔량의 정제수를 혼합한 후 통상의 연고제의 제조방법에 따라서 연고제를 제조하였다.
<처방예 2> 건강보조식품
<처방예 2-1> 건강식품의 제조
(+)-이소나이트라민 1 ㎎, 비타민 혼합물 적량(비타민 A 아세테이트 70 ㎍, 비타민 E 1.0 ㎎, 비타민 B1 0.13 ㎎, 비타민 B2 0.15 ㎎, 비타민 B6 0.5 ㎎, 비타민 B12 0.2 ㎍, 비타민 C10 ㎎, 비오틴 10 ㎍, 니코틴산아미드 1.7 ㎎, 엽산 50 ㎍, 판토텐산 칼슘 0.5 ㎎) 및 무기질 혼합물 적량(황산 제1철 1.75 ㎎, 산화아연 0.82 ㎎, 탄산마그네슘 25.3 ㎎, 제1인산칼륨 15 ㎎, 제2인산칼슘 55 ㎎, 구연산칼륨 90 ㎎, 탄산칼슘 100 ㎎, 염화마그네슘 24.8 ㎎)을 혼합한 다음 과립을 제조하고 통상의 방법에 따라 건강식품을 제조하였다.
<처방예 2-2> 건강음료의 제조
(+)-이소나이트라민 1 ㎎, 구연산 1000 ㎎, 올리고당 100 g, 매실농축액 2 g, 타우린 1 g 및 정제수를 가하여 전체 900 ㎖가 되도록 하며, 통상의 건강음료 제조방법에 따라 상기의 성분을 혼합한 다음, 약 1시간 동안 85℃에서 교반 가열한 후, 만들어진 용액을 여과하여 멸균된 2 L 용기에 취득하여 밀봉 멸균한 뒤 냉장 보관하였다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시예일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.

Claims (9)

  1. 하기 화학식 1로 표시되는 입체이성질체 또는 이의 라세미 혼합물을 유효성분으로 포함하는 대사성 질환 예방 또는 치료용 약학 조성물:
    [화학식 1]
    Figure PCTKR2016009036-appb-I000028
    화학식 1에 있어서,
    X는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, X가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, X가
    Figure PCTKR2016009036-appb-I000029
    인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이고;
    Y는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, Y가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, 또는 Y가
    Figure PCTKR2016009036-appb-I000030
    인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이며;
    상기 6번 탄소와 7번 탄소는 카이랄 중심임.
  2. 제 1 항에 있어서,
    상기 대사성 질환은 비만, 당뇨, 고지혈증, 고중성지방혈증, 간질환, 동맥경화, 뇌졸중, 심근경색, 심혈관 질환, 과혈당증, 인슐린 저항성 질환 및 과인슐린혈증으로 이루어진 군에서 선택된 것을 특징으로 하는 대사성 질환 예방 또는 치료용 약학 조성물.
  3. 하기 화학식 1로 표시되는 입체이성질체 또는 이의 라세미 혼합물을 유효성분으로 포함하는 대사성 질환 예방 또는 개선용 건강식품:
    [화학식 1]
    Figure PCTKR2016009036-appb-I000031
    화학식 1에 있어서,
    X는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, X가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, X가
    Figure PCTKR2016009036-appb-I000032
    인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이고;
    Y는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, Y가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, 또는 Y가
    Figure PCTKR2016009036-appb-I000033
    인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이며;
    상기 6번 탄소와 7번 탄소는 카이랄 중심임.
  4. 하기 화학식 2로 표시되는 입체이성질체 또는 이의 라세미 혼합물을 유효성분으로 포함하는 대사성 질환 예방 또는 치료용 약학 조성물:
    [화학식 2]
    Figure PCTKR2016009036-appb-I000034
    화학식 2에 있어서,
    X는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, X가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, X가
    Figure PCTKR2016009036-appb-I000035
    인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이고;
    Y는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, Y가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, 또는 Y가
    Figure PCTKR2016009036-appb-I000036
    인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이며;
    상기 6번 탄소와 7번 탄소는 카이랄 중심임.
  5. 제 4 항에 있어서,
    상기 대사성 질환은 비만, 당뇨, 고지혈증, 고중성지방혈증, 간질환, 동맥경화, 뇌졸중, 심근경색, 심혈관 질환, 과혈당증, 인슐린 저항성 질환 및 과인슐린혈증으로 이루어진 군에서 선택된 것을 특징으로 하는 대사성 질환 예방 또는 치료용 약학 조성물.
  6. 하기 화학식 2로 표시되는 입체이성질체 또는 이의 라세미 혼합물을 유효성분으로 포함하는 대사성 질환 예방 또는 개선용 건강식품:
    [화학식 2]
    Figure PCTKR2016009036-appb-I000037
    화학식 2에 있어서,
    X는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, X가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, X가
    Figure PCTKR2016009036-appb-I000038
    인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이고;
    Y는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, Y가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, 또는 Y가
    Figure PCTKR2016009036-appb-I000039
    인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이며;
    상기 6번 탄소와 7번 탄소는 카이랄 중심임.
  7. 하기 화학식 3으로 표시되는 입체이성질체 또는 이의 라세미 혼합물을 유효성분으로 포함하는 대사성 질환 예방 또는 치료용 약학 조성물:
    [화학식 3]
    Figure PCTKR2016009036-appb-I000040
    화학식 3에 있어서,
    X는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, X가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, X가
    Figure PCTKR2016009036-appb-I000041
    인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이고;
    Y는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, Y가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, 또는 Y가
    Figure PCTKR2016009036-appb-I000042
    인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이며;
    상기 6번 탄소는 카이랄 중심임.
  8. 제 7 항에 있어서,
    상기 대사성 질환은 비만, 당뇨, 고지혈증, 고중성지방혈증, 간질환, 동맥경화, 뇌졸중, 심근경색, 심혈관 질환, 과혈당증, 인슐린 저항성 질환 및 과인슐린혈증으로 이루어진 군에서 선택된 것을 특징으로 하는 대사성 질환 예방 또는 치료용 약학 조성물.
  9. 하기 화학식 3으로 표시되는 입체이성질체 또는 이의 라세미 혼합물을 유효성분으로 포함하는 대사성 질환 예방 또는 개선용 건강식품:
    [화학식 3]
    Figure PCTKR2016009036-appb-I000043
    화학식 3에 있어서,
    X는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, X가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, X가
    Figure PCTKR2016009036-appb-I000044
    인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이고;
    Y는 수소, 탄소수 1 내지 10개의 알킬기, 아실기, 알릴기 및 벤질기로 이루어진 군에서 선택되고, Y가 알릴기인 경우 불포화탄소에 하나 이상의 할로겐이 치환될 수 있고, 또는 Y가
    Figure PCTKR2016009036-appb-I000045
    인 경우 R1 내지 R5는 각각 독립적으로 수소원자, 나이트로기, 할로겐원자, 시안기, 히드록시기, 디메틸아미노기, 메틸설포닐아미드기, 트리플루오르메틸기, 탄소수 1 내지 3개의 알킬기, 탄소수 1 내지 3개의 알콕시기, 비닐, 아릴기, 페녹시기 또는 벤족시기이며;
    상기 6번 탄소는 카이랄 중심임.
PCT/KR2016/009036 2015-08-17 2016-08-17 신규한 이소나이트라민 화합물 및 이를 포함하는 대사성 질환 예방 또는 치료용 조성물 WO2017030367A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US15/752,592 US20180244624A1 (en) 2015-08-17 2016-08-17 Novel isonitramine compound and composition containing same for preventing or treating metabolic diseases
US16/161,094 US10537559B2 (en) 2015-08-17 2018-10-16 Isonitramine compound and composition containing same for preventing or treating metabolic diseases

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20150115504 2015-08-17
KR10-2015-0115504 2015-08-17
KR1020160104145A KR101799793B1 (ko) 2015-08-17 2016-08-17 신규한 이소나이트라민 화합물 및 이를 포함하는 대사성 질환 예방 또는 치료용 조성물
KR10-2016-0104145 2016-08-17

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/752,592 A-371-Of-International US20180244624A1 (en) 2015-08-17 2016-08-17 Novel isonitramine compound and composition containing same for preventing or treating metabolic diseases
US16/161,094 Continuation US10537559B2 (en) 2015-08-17 2018-10-16 Isonitramine compound and composition containing same for preventing or treating metabolic diseases

Publications (1)

Publication Number Publication Date
WO2017030367A1 true WO2017030367A1 (ko) 2017-02-23

Family

ID=58051361

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/009036 WO2017030367A1 (ko) 2015-08-17 2016-08-17 신규한 이소나이트라민 화합물 및 이를 포함하는 대사성 질환 예방 또는 치료용 조성물

Country Status (1)

Country Link
WO (1) WO2017030367A1 (ko)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101059274B1 (ko) * 2006-03-10 2011-08-24 화이자 프로덕츠 인크. Ｃｅｔｐ 억제제로서 디벤질 아민 유도체

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101059274B1 (ko) * 2006-03-10 2011-08-24 화이자 프로덕츠 인크. Ｃｅｔｐ 억제제로서 디벤질 아민 유도체

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HELLBERG, L. H. ET AL.: "Synthesis of the Spirocyclic Alkaloid Nitramine", TETRAHEDRON LETTERS, vol. 27, no. 34, 1986, pages 3955 - 3956, XP055365499 *
KOZIKOWSKI, A. P. ET AL.: "The Intramolecular Nitrile Oxide Cycloaddition Route to Spirocyclic Alkaloids. A Total Synthesis of Isonitramine and Sibirine", JOURNAL OF THE CHEMICAL SOCIETY, CHEMICAL COMMUNICATIONS, vol. 13, 1985, pages 847 - 848, XP055365505 *
OSMANOV, Z. ET AL.: "Structure of Sibirine", CHEMISTRY OF NATURAL COMPOUNDS, vol. 18, no. 2, March 1982 (1982-03-01), pages 206 - 208, XP055365509 *
PARK, Y. ET AL.: "Highly Enantioselective Total Synthesis of (+)-isonitramine", ORGANIC LETTERS, vol. 14, no. 3, 3 February 2012 (2012-02-03), pages 852 - 854, XP055365495 *

Similar Documents

Publication Publication Date Title
WO2017078499A2 (ko) 단백질 타이로신 탈인산화효소 억제제를 포함하는 신경염증성 질환의 예방 또는 치료용 조성물
WO2012134126A2 (en) Use of compounds isolated from morus bark
WO2017007162A1 (ko) 지방조직 중성지질 분해 효능을 가지는 아젤라산 조성물
WO2020218720A1 (ko) 익모초 추출물 또는 레오누린을 함유하는 근육 질환 예방 또는 치료용 또는 근 기능 개선용 조성물
WO2016032249A1 (ko) 모새나무 추출물 또는 이의 분획물을 유효성분으로 포함하는 신경염증 또는 퇴행성 뇌신경 질환의 예방 또는 치료용 약학적 조성물
WO2016080796A2 (ko) 세스퀴테르펜 화합물을 포함하는, stat3 매개 질환의 예방 또는 치료용 약학적 조성물 및 이의 용도
WO2015111832A1 (ko) 지실 추출물을 포함하는 전립선 관련 질환의 예방 또는 치료용 조성물
WO2022005201A1 (ko) 티로신을 유효성분으로 함유하는 단백질 내 티로신의 니트로화에 의한 질환의 예방, 개선 또는 치료용 조성물
WO2012134172A2 (ko) 오미자 에틸아세테이트 분획물 또는 이로부터 분리한 우웨이지수 ｃ를 유효성분으로 포함하는 비만 예방 또는 치료용 조성물
WO2017030367A1 (ko) 신규한 이소나이트라민 화합물 및 이를 포함하는 대사성 질환 예방 또는 치료용 조성물
WO2021033995A1 (ko) 초과 추출물을 함유하는 근육 감소 관련 질병의 예방, 개선, 또는 치료용 조성물
WO2015108372A1 (ko) 오스모틴을 포함하는 흥분독성 또는 시냅스 기능 장애에 의한 신경 질환의 예방 또는 치료용 조성물, 및 이를 이용한 신경 질환의 예방 또는 치료 방법
WO2019198982A1 (ko) 구꼬아민 a 및 구꼬아민 b를 유효성분으로 함유하는 골격근 위축 예방 또는 개선용 조성물
WO2013111924A1 (ko) 넓패 유래 신규 화합물 및 이의 용도
WO2020106048A1 (ko) 퇴행성 신경질환의 예방 또는 치료용 약학 조성물
WO2022270760A1 (ko) 커큐민 유도체와 tgf-β 수용체 억제제의 병용투여를 통한 비알코올성 지방간염 치료 방법
WO2019078381A1 (ko) 엔테로코커스 패칼리스, 이의 배양액 또는 이의 사균체를 유효성분으로 함유하는 근육감퇴, 약화 및 근위축 예방, 개선 또는 치료용 약학 조성물, 식품 조성물 및 식품첨가제
WO2020040615A1 (ko) 강글리오사이드를 함유하는 근육 질환 예방 또는 치료용, 또는 근 기능 개선용 조성물
WO2021251602A1 (ko) Phf20을 억제하는 제제를 포함하는 근육 감소로 인한 질환의 예방 또는 치료용 조성물
WO2016032250A1 (ko) 채송화 추출물 또는 이의 분획물을 유효성분으로 포함하는 신경염증 또는 퇴행성 뇌신경 질환의 예방 또는 치료용 약학적 조성물
WO2022203395A1 (ko) 신규한 화합물 및 이를 포함하는 퇴행성 뇌질환 예방 또는 치료용 조성물
WO2022182141A1 (ko) 티로신이 말단에 위치하는 펩타이드를 유효성분으로 함유하는 단백질의 니트로화에 의해 발생하는 질환의 예방, 개선 또는 치료용 조성물
WO2021075818A1 (ko) 항염증 활성을 갖는 남극 지의류 움빌리카리아 안타티카 추출물 및 이를 함유하는 조성물
WO2022045668A1 (ko) 우유 엑소좀을 포함하는 갈색지방화 유도용 조성물
WO2020256397A1 (ko) 감초 추출물 또는 이로부터 분리된 화합물을 유효성분으로 함유하는 근육질환 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16837309

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 15752592

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 16837309

Country of ref document: EP

Kind code of ref document: A1