WO2016146757A1 - Optimized liver-specific expression systems for fviii and fix - Google Patents
Optimized liver-specific expression systems for fviii and fix Download PDFInfo
- Publication number
- WO2016146757A1 WO2016146757A1 PCT/EP2016/055825 EP2016055825W WO2016146757A1 WO 2016146757 A1 WO2016146757 A1 WO 2016146757A1 EP 2016055825 W EP2016055825 W EP 2016055825W WO 2016146757 A1 WO2016146757 A1 WO 2016146757A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- promoter
- vector
- nucleic acid
- mvm
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/36—Blood coagulation or fibrinolysis factors
- A61K38/37—Factors VIII
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
- A61K38/482—Serine endopeptidases (3.4.21)
- A61K38/4846—Factor VII (3.4.21.21); Factor IX (3.4.21.22); Factor Xa (3.4.21.6); Factor XI (3.4.21.27); Factor XII (3.4.21.38)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/745—Blood coagulation or fibrinolysis factors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/745—Blood coagulation or fibrinolysis factors
- C07K14/755—Factors VIII, e.g. factor VIII C (AHF), factor VIII Ag (VWF)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/644—Coagulation factor IXa (3.4.21.22)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14311—Parvovirus, e.g. minute virus of mice
- C12N2750/14341—Use of virus, viral particle or viral elements as a vector
- C12N2750/14343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/15—Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/36—Vector systems having a special element relevant for transcription being a transcription termination element
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
- C12N2830/85—Vector systems having a special element relevant for transcription from vertebrates mammalian
Definitions
- the invention relates to nucleic acid expression cassettes and expression vectors for gene therapy with improved liver-specific expression capabilities, particularly for use as a gene therapy means for the treatment of hemophilia, more particularly for restoring coagulation factor IX (FIX) and/or coagulation factor VIII (FVIII) deficiency in liver-directed gene therapy of respectively, hemophilia B and hemophilia A.
- FIX coagulation factor IX
- FVIII coagulation factor VIII
- Hemophilia B is an X-linked, recessive bleeding disorder caused by deficiency of clotting factor IX (FIX).
- Hemophilia A is a serious bleeding disorder caused by a deficiency in, or complete absence of, the blood coagulation factor VIII (FVIII).
- the clinical presentation for hemophilia A and B is characterized by episodes of spontaneous and prolonged bleeding. There are an estimated 1 in 5,000 and 1 in 20,000 individuals suffer from hemophilia A and B, respectively.
- hemophilia A and B is treated with protein replacement therapy using either plasma- derived or recombinant FVIII or FIX.
- hemophilia A and hemophilia B has been classified by the subcommittee on Factor VIII and Factor IX of the Scientific and Standardization Committee of the International Society on Thrombosis and Haemostasis into three forms, depending on respectively, the FVIII level and the FIX level: 1 ) severe form (FVIII or FIX level less than 0.01 international units (IU)/ml, i.e. less than 1 % of normal FVIII or FIX level), 2) moderate form (FVIII or FIX level from 0.01 to 0.05 lU/ml, i.e.
- Hemophilia A is the most common hereditary coagulation disorder with an incidence approaching approximately 1 in 5000 males.
- Protein substitution therapy (PST) with purified or recombinant FVIII and FIX has significantly improved the patients' quality of life.
- PST is not curative and patients are still at risk of developing potentially life-threatening hemorrhages and crippling joint inflammation.
- many patients suffering from hemophilia A develop neutralizing antibodies to FVIII (i.e.
- inhibitors following PST.
- an estimated 10% of patients suffering from hemophilia B develop “inhibitors” to FIX.
- These inhibitors complicate the management of bleeding episodes and can render further PST ineffective.
- These limitations of PST justify the development of gene therapy as a potential alternative for hemophilia treatment.
- only a modest increase in FIX or FVIII plasma concentration is needed for therapeutic benefit, with levels of more than 1 % of normal levels able to achieve markedly reduced rates of spontaneous bleeding and long-term arthropathy.
- the liver is the main physiological site of FIX and FVIII synthesis and hence, hepatocytes are well suited target cells for hemophilia gene therapy. From this location, FIX or FVIII protein can easily enter into the circulation. Moreover, the hepatic niche may favor the induction of immune tolerance towards the transgene product (Annoni et al., 2007; Follenzi et al., 2004; Brown et al., 2007; Herzog et al., 1999; Matrai et al., 201 1 ; Matsui et al., 2009).
- Liver-directed gene therapy for hemophilia can be accomplished with different viral vectors including retroviral (Axelrod et al., 1990; Kay et al., 1992; VandenDriessche et al., 1999, Xu et al., 2003, 2005), lentiviral (Ward et al., 201 1 , Brown et al., 2007, Matrai et al., 201 1 ), adeno-associated viral (AAV) (Herzog et al., 1999) and adenoviral vectors (Brown et al., 2004; Ehrhardt & Kay, 2002).
- retroviral Anaxelrod et al., 1990; Kay et al., 1992; VandenDriessche et al., 1999, Xu et al., 2003, 2005
- lentiviral Ward et al., 201 1 , Brown et al., 2007, Matrai et al., 201 1
- AAV vectors have a favorable safety profile and are capable of achieving persistent transgene expression. Long-term expression is predominantly mediated by episomally retained AAV genomes. More than 90% of the stably transduced vector genomes are extra-chromosomal, mostly organized as high-molecular-weight concatamers. Therefore, the risk of insertional oncogenesis is minimal, especially in the context of hemophilia gene therapy where no selective expansion of transduced cells is expected to occur. Nevertheless, oncogenic events have been reported following AAV-based gene transfer (Donsante et al., 2007) but it has been difficult to reproduce these findings in other model systems (Li et al., 201 1 ).
- AAV vectors The major limitation of AAV vectors is the limited packaging capacity of the vector particles (i.e. approximately 5.0 kb, including the AAV inverted terminal repeats), constraining the size of the transgene expression cassette to obtain functional vectors (Jiang et al., 2006).
- Several immunologically distinct AAV serotypes have been isolated from human and non-human primates (Gao et al., 2002, Gao et al. 2004), although most vectors for hemophilia gene therapy were initially derived from the most prevalent AAV serotype 2.
- the first clinical success of AAV-based gene therapy for congenital blindness underscores the potential of this gene transfer technology (Bainbridge et al., 2008).
- AAV- mediated hepatic gene transfer is an attractive alternative for gene therapy of hemophilia for both liver and muscle-directed gene therapy (Herzog et al., 1997, 1999, 2002; Arruda et al., 2010; Fields et al., 2001 ; Buchlis et al., 2012; Jiang et al., 2006; Kay et al., 2000).
- AAV serotypes could be used (e.g. AAV8 or AAV5) that result in increased transduction into hepatocytes, improve intra-nuclear vector import and may reduce the risk of T cell activation (Gao et al., 2002; Vandenberghe et al., 2006) though it is not certain that this would necessarily also translate to human subjects since the epitopes are conserved between distinct AAV serotypes (Mingozzi et al., 2007).
- Liver-directed gene therapy for hemophilia B with AAV8 or AAV9 is more efficient than when lentiviral vectors are used, at least in mice, and resulted in less inflammation (VandenDriessche et al., 2007, 2002). Furthermore, recent studies indicate that mutations of the surface-exposed tyrosine residues allow the vector particles to evade phosphorylation and subsequent ubiquitination and, thus, prevent proteasome-mediated degradation, which resulted in a 10-fold increase in hepatic expression of FIX in mice (Zhong et al., 2008).
- liver-directed preclinical studies paved the way toward the use of AAV vectors for clinical gene therapy in patients suffering from severe hemophilia B.
- Hepatic delivery of AAV- FIX vectors resulted in transient therapeutic FIX levels (maximum 12% of normal levels) in subjects receiving AAV-FIX by hepatic artery catheterization (Kay et al., 2000).
- the transduced hepatocytes were able to present AAV capsid-derived antigens in association with MHC class I to T cells (Manno et al., 2006, Mingozzi et al., 2007). Although antigen presentation was modest, it was sufficient to flag the transduced hepatocytes for T cell- mediated destruction.
- AAV8 allows for a substantial increase in hepatic transduction compared to AAV2, though this advantage may be lost in higher species, like dog, rhesus monkeys and man.
- Subjects received escalating doses of the scAAV8-FIX vector, with two participants per dose. All of the treated subjects expressed FIX above the therapeutic 1 % threshold for several months after vector administration, yielding sustained variable expression levels (i.e. 2 to 1 1 % of normal levels).
- sustained variable expression levels i.e. 2 to 1 1 % of normal levels.
- the main difference with the previous liver-directed AAV trial is that for the first time sustained therapeutic FIX levels could be achieved after gene therapy.
- T-cell mediated clearance of AAV-transduced hepatocytes remains a concern consistent with elevated liver enzyme levels in some of the patients. Transient immune suppression using a short course of glucocorticoids was used in an attempt to limit this vector-specific immune response.
- FVIII constructs in which the B domain is deleted are used for gene transfer purposes since their smaller size is more easily incorporated into vectors. Furthermore, it has been shown that deletion of the B domain leads to a 17-fold increase in mRNA and primary translation product.
- FVIII wherein the B domain is deleted and replaced by a short 14-amino acid linker is currently produced as a recombinant product and marketed as Refacto® for clinical use (Wyeth Pharma) (Sandberg et al., 2001 ).
- Miao et al. added back a short B domain sequence to a B domain deleted FVIII, optimally 226 amino acids and retaining 6 sites for N-linked glycosylation, to improve secretion.
- Mcintosh et al. (2013) replaced the 226 amino-acid spacer of Miao et al. with a 17 amino-acid peptide in which six glycosylation triplets from the B-domain were juxtaposed. Yet, production was still not sufficient for therapeutic purposes.
- Non-viral vectors typically rely on a plasmid-based gene delivery system, where only the naked DNA is delivered, potentially in conjunction with physicochemical methods that facilitate transfection. Consequently, the non-viral approach may be less immunogenic and potentially safer than viral vectors, though innate immune response may still occur.
- the non-viral gene transfer method is simple, but the efficiency is generally low compared to most viral vector- mediated gene transfer approaches. Efficient in vivo gene delivery of non-viral vectors remains a bottleneck. Typically, for hepatic gene delivery, plasmids are administered by hydrodynamic injection.
- a hydrodynamic pressure is generated by rapid injection of a large volume of DNA solution into the circulation, in order to deliver the gene of interest in the liver (Miao et al., 2000).
- Efforts are being made to adapt hydrodynamic injection towards a clinically relevant modality by reducing the volume of injection along with maintaining localized hydrodynamic pressure for gene transfer.
- Alternative approaches based on targetable nanoparticles are being explored to achieve target specific delivery of FIX into hepatocytes. Expression could be prolonged by removing bacterial backbone sequences which interfere with long term expression (i.e. mini-circle DNA).
- transposons could be used that result in stable genomic transgene integration.
- transposons could be used to obtain stable clotting factor expression following in vivo gene therapy (Yant et al., 2000; Mates, Chuah et al., 2009, VandenDriessche et al., 2009; Kren et al.,2009; Ohlfest et al., 2004 ).
- FIX liver-specific expression of FIX
- WO 2009/130208 An exemplary state of the art vector for liver-specific expression of FIX is described in WO 2009/130208 and is composed of a single-stranded AAV vector that contains the TTR Serp regulatory sequences driving a factor cDNA.
- a FIX first intron was included in the vector, together with a poly-adenylation signal.
- Using said improved vector yielded about 25-30% stable circulating factor IX.
- FIX transgenes optimized for codon usage and carrying an R338L amino acid substitution associated with clotting hyperactivity and thrombophilia increase the efficacy of gene therapy using lentiviral vector up to 15-fold in hemophilia B mice, without detectable adverse effects, substantially reducing the dose requirement for reaching therapeutic efficacy and thus facilitating future scale up and its clinical translation (Cantore et al., 2012, Nair et al., 2014).
- codon optimization of human factor VIII cDNAs leads to high-level expression.
- the above objective is accomplished by providing a nucleic acid expression cassette and a vector, either a viral vector, in particular an AAV-based vector, or a non-viral vector, comprising specific regulatory elements that enhance liver-directed gene expression, while retaining tissue specificity, in conjunction with the use of a transgene, preferably a codon-optimized transgene, encoding human FIX, preferably human FIX containing a hyper-activating mutation.
- the resulting vector and nucleic acid expression cassette result in unexpectedly high expression levels of FIX in the liver, due to its unique combination of regulatory elements.
- the combined effect of these elements could not have been predicted.
- this objective is accomplished by providing a vector, either a viral vector, in particular an AAV- based vector, or a non-viral vector, comprising a nucleic acid expression cassette with specific regulatory elements that enhance liver-directed gene expression, while retaining tissue specificity, in conjunction with the use of a codon-optimized human FVIII construct, in particular a codon-optimized B domain deleted FVIII construct driven from a minimal transthyretin promoter.
- the resulting AAV-based vector and nucleic acid expression cassette resulted in unprecedented, supra-physiologic FVIII expression levels (cf. WO2014/064277).
- Said regulatory element is defined by SEQ ID NO: 13.
- Said regulatory element can further be combined with the transthyretin minimal promotor as defined by SEQ ID NO.6.
- SEQ ID NO:58 results in a regulatory element as defined by SEQ ID NO:58, which has been tested to increase the expression of both FVIII and FIX transgenes as shown herein.
- the invention therefore provides the following aspects:
- a nucleic acid expression cassette comprising a triple repeat, preferably a tandem repeat, of a liver-specific nucleic acid regulatory element comprising or consisting of the nucleic acid fragment defined by SEQ ID NO:5 or a sequence having at least 95% identity to said sequence, preferably a liver-specific nucleic acid regulatory element of 150 nucleotides or less, comprising or consisting of the nucleic acid fragment defined by SEQ ID NO:5 or a sequence having at least 95% identity to said sequence, more preferably the regulatory element (3xSERP) as defined by SEQ ID NO:1 1 , operably linked to a promoter and a transgene, preferably a codon-optimized transgene, wherein the promoter is a liver-specific promoter.
- a liver-specific nucleic acid regulatory element comprising or consisting of the nucleic acid fragment defined by SEQ ID NO:5 or a sequence having at least 95% identity to said sequence, preferably the regulatory element (3xSERP) as defined by SEQ ID NO
- said promoter is derived from the transthyretin (TTR) promoter, more preferably said promoter is the minimal TTR promotor (TTRm) as defined by SEQ ID NO:6.
- TTR transthyretin
- TTRm minimal TTR promotor
- said liver-specific promoter is derived from the AAT promoter, e.g. as defined by SEQ ID NO.64.
- the liver-specific promotor is selected from the group comprising: the transthyretin (TTR) promoter or TTR-minimal promoter (TTRm), the alpha 1 -antitrypsin (AAT) promoter, the albumin promotor (ALB) or minimal albumin promoter (ALBm), the apolipoprotein A1 (APOA1 ) promoter, the complement factor B (CFB) promoter, the ketohexokinase (KHK) promoter, the hemopexin (HPX) promoter, the nicotinamide N- methyltransferase (NNMT) promoter, the (liver) carboxylesterase 1 (CES1 ) promoter, the protein C (PROC) promoter, the apolipoprotein C3 (APOC3) promoter, the mannan-binding lectin serine protease 2 (MASP2) promoter, the hepcidin antimicrobial peptide (HAMP) promoter, or the serpin
- nucleic acid expression cassette according to aspect 1 further comprising a nucleic acid regulatory element comprising or consisting of the nucleic acid fragment defined by SEQ ID NO: 12 (TTRe), or a sequence having at least 95% identity to said sequence, preferably a nucleic acid regulatory element of 150 nucleotides or less comprising or consisting of the nucleic acid fragment defined by SEQ ID NO: 12, or a sequence having at least 95% identity to said sequence.
- TTRe nucleic acid regulatory element of 150 nucleotides or less comprising or consisting of the nucleic acid fragment defined by SEQ ID NO: 12, or a sequence having at least 95% identity to said sequence.
- the combination of the TTRe and TTRm nucleic acid modules is defined by SEQ ID NO.69.
- nucleic acid expression cassette comprising the nucleic acid regulatory element as defined by SEQ ID NO: 13, preferably the nucleic acid regulatory element as defined by SEQ ID NO:57, operably linked to a promotor and a transgene, or the nucleic acid regulatory element as defined by SEQ ID NO:58, operably linked to a transgene.
- Aspect 4 The nucleic acid expression cassette according to any one of aspects 1 to 3, wherein said transgene encodes for coagulation factor VIII or coagulation factor IX.
- Aspect 5 The nucleic acid expression cassette according to aspect 4, wherein said coagulation factor VIII has a deletion of the B domain.
- Aspect 6 The nucleic acid expression cassette according to aspect 5, wherein said B domain of said FVIII is replaced by a linker defined by SEQ ID NO:59.
- Aspect 7 The nucleic acid expression cassette according to any one of aspects 4 to 6, wherein said transgene encoding for coagulation factor VIII is defined by SEQ ID NO: 18.
- Aspect 8 The nucleic acid expression cassette according to aspect 4, wherein said coagulation factor IX contains a hyper-activating mutation.
- Aspect 9 The nucleic acid expression cassette according to aspect 8, wherein said hyper- activating mutation in coagulation factor IX corresponds to an R338L amino acid substitution.
- Aspect 10 The nucleic acid expression cassette according to any one of aspects 4, 8 or 9, wherein said transgene encoding for coagulation factor IX is defined by SEQ ID NO:9.
- Aspect 1 The nucleic acid expression cassette according to any one of aspects 1 to 10, wherein said promoter is a liver-specific promoter, preferably a promoter derived from the transthyretin (TTR) promoter, preferably the minimal TTR promotor as defined by SEQ ID NO:6.
- TTR transthyretin
- Aspect 12 The nucleic acid expression cassette according to any one of aspects 1 to 1 1 , further comprising a minute virus of mouse (MVM) intron, preferably the MVM intron as defined by SEQ ID NO:8.
- Aspect 13 The nucleic acid expression cassette according to any one of aspects 1 to 12, further comprising a transcriptional termination signal derived from the bovine growth hormone polyadenylation signal (BGHpA), preferably the BGHpA as defined by SEQ ID NO:10, or derived from the Simian virus 40 polyadenylation signal (SV40pA), preferably the SV40pA as defined by SEQ ID NO: 19, or a synthetic polyadenylation signal, preferably the synthetic polyadenylation signal as defined by SEQ ID NO: 56.
- BGHpA bovine growth hormone polyadenylation signal
- SV40pA Simian virus 40 polyadenylation signal
- SEQ ID NO: 19 a synthetic polyadenylation signal
- synthetic polyadenylation signal preferably
- Aspect 14 A vector comprising the nucleic acid expression cassette according to any one of aspects 1 to 13.
- Aspect 15 The vector according to aspect 14, wherein said vector is a viral vector.
- Aspect 16 The vector according to aspect 15, wherein said vector is derived from an adeno- associated virus (AAV).
- AAV adeno- associated virus
- Aspect 17 The vector according to aspect 16, wherein said vector is a single-stranded AAV vector, preferably a single-stranded AAV serotype 8 vector.
- Aspect 18 The vector according to any one of aspects 14 to 17, defined by SEQ ID NO: 16, SEQ ID NO:20, SEQ ID NO:21 , SEQ ID NO:22 or SEQ ID NO:23, preferably SEQ ID NO:22 or SEQ ID NO:23, more preferably SEQ ID NO:22.
- Aspect 19 The vector according to aspect 16, wherein said vector is a self-complementary AAV vector, preferably a self-complementary AAV serotype 9 vector.
- Aspect 20 The vector according to any one of aspects 14 to 16, or 19, defined by SEQ ID NO: 2, SEQ ID NO:4, or SEQ ID NO:25, preferably SEQ ID NO:4 or SEQ ID NO:25, more preferably SEQ ID NO:4, or the vector according to any one of aspects 14 to 16, or 19, defined by SEQ ID NO: 65, SEQ ID NO:66, or SEQ ID NO:68, preferably SEQ ID NO:65 or 68, more preferably SEQ ID NO:65.
- Aspect 21 The vector according to aspect 14, wherein said vector is a non-viral vector, such as a transposon-based vector (e.g. a PiggyBac(PB)-based vector or a Sleeping Beauty(SB)-based vector).
- a transposon-based vector e.g. a PiggyBac(PB)-based vector or a Sleeping Beauty(SB)-based vector.
- Aspect 23 The method according to aspect 22, wherein the transduction of the vector according to any one of aspects 14 to 18, or 21 into the subject is done at a dose lower than 2.5x10 11 vg/kg.
- Aspect 24 A method to obtain levels of factor IX in plasma equal to or higher than the therapeutic threshold concentration of 10mU/ml plasma in a subject, comprising the transduction or transfection of the vector according to any one of aspects 14 to 16, or 19 to 21 into a subject.
- Aspect 25 The method according to aspect 24, wherein the transduction of the vector according to any one of aspects 14 to 16, or 19 to 21 into the subject is done at a dose lower than 2x10 11 vg/kg.
- Aspect 26 The method according to any one of aspects 22 to 25, wherein said transduction or transfection is by intravenous administration.
- Aspect 27 The method according to any one of aspects 22 to 26, wherein said subject is a mammalian subject, preferably a human subject.
- Aspect 28 A method for treating hemophilia A in a mammalian subject, comprising performing the method according to any one of aspects 22, 23, 26 or 27.
- Aspect 29 The use of the vector according to any one of aspects 14 to 18, or 21 for the manufacture of a medicament to treat hemophilia A.
- Aspect 30 The vector according to any one of aspects 14 to 18, or 21 for use in the treatment of hemophilia A.
- a method for treating hemophilia B in a mammalian subject comprising performing the method according to any one of aspects 24 to 27.
- Aspect 32 The use of the vector according to any one of aspects 14 to 16, or 19 to 21 for the manufacture of a medicament to treat hemophilia B.
- Aspect 33 The vector according to any one of aspects 14 to 16, 19 to 21 for use in the treatment of hemophilia B.
- a pharmaceutical composition comprising a vector according to any one of aspects 14 to 18, or 21 and a pharmaceutically acceptable carrier, optionally further comprising an active ingredient for treating hemophilia A.
- Aspect 35 The pharmaceutical composition according to aspect 34 for use in treating hemophilia A.
- Aspect 36 The pharmaceutical composition for use according to aspect 35, or the vector for use according to aspect 30, wherein said treatment results in levels of factor VIII in plasma of the treated subject that are equal to or higher than the therapeutic threshold concentration of 10 mU/ml plasma in a subject.
- Aspect 37 The pharmaceutical composition for use according to any one of aspects 35 or 35, or the vector for use according to any one of aspects 30 or 36, wherein said treatment comprises the transduction of the vector according to any one of aspects 14 to 18 into the subject at a dose lower than or equal than 2.5x10 11 vg/kg.
- a pharmaceutical composition comprising a vector according to any one of aspects 14 to 16, 19 to 21 and a pharmaceutically acceptable carrier, optionally further comprising an active ingredient for treating hemophilia B.
- Aspect 39 The pharmaceutical composition according to aspect 38, for use in treating hemophilia B.
- Aspect 40 The pharmaceutical composition for use according to aspect 39, or the vector for use according to aspect 33, wherein said treatment results in levels of factor IX in plasma of the treated subject that are equal to or higher than the therapeutic threshold concentration of 10 mU/ml plasma in a subject, preferably equal to or higher than the therapeutic concentration of 50 mU/ml plasma in a subject, more preferably equal to or higher than the therapeutic concentration of 100 mU/ml plasma in a subject, even more preferably equal to or higher than the therapeutic concentration of 150 mU/ml plasma in a subject and even more preferably equal to or higher than the therapeutic concentration of 200 mU/ml plasma in a subject.
- the therapeutic threshold concentration of 10 mU/ml plasma in a subject preferably equal to or higher than the therapeutic concentration of 50 mU/ml plasma in a subject, more preferably equal to or higher than the therapeutic concentration of 100 mU/ml plasma in a subject, even more preferably equal to or higher than the therapeutic concentration of 150 mU/ml
- Aspect 41 The pharmaceutical composition for use according to aspect 39 or 40, or the vector for use according to aspect 33 or 40, wherein said treatment comprises the transduction of the vector according to any one of aspects 14 to 16, 19 or 20 into the subject at a dose lower than or equal than 2x10 12 vg/kg, preferably at a dose lower than or equal than 6x10 11 vg/kg, more preferably at a dose lower than or equal than 2x10 11 vg/kg.
- Figure 1 Design of the self-complementary (sc), double-stranded adeno-associated viral (AAV) vectors AAVsc-SerpEnh-TTRm-MVM-co-FIX-R338L-BGHpA (2510 bp) (A), AAVsc- 3xSerpEnh-TTRm-MVM-co-FIX-R338L-BGHpA (2683 bp) (B), AAVsc-TTREnh-TTRm-MVM- co-FIX-R338L-BGHpA (2540 bp) (C), AAVsc-3xSerpEnh-TTREnh-TTRm-MVM-co-FIX-R338L- BGHpA (2760 bp) (D), and AAVsc-3xSerpEnh-TTREnh-TTRm-MVM-co-FIX-R338L-Synt.pA (2519 bp)
- the minimal transthyretin promoter (TTRm) is driving the expression of the codon-optimized human factor IX (co-FIX-R338L) containing the hyper-activating, thrombophilic FIX mutation (R338L).
- TTRm codon-optimized human factor IX
- SERP Serpin enhancer
- 3xSERP triplet of the Serpin enhancer
- TTRe native TTR enhancer
- the minute virus of mouse intron (MVM), the bovine growth hormone polyadenylation site (BGHpA) or a synthetic polyadenylation site (Synt.pA), and the inverted terminal repeats (ITR) are indicated.
- MMV mouse intron
- BGHpA bovine growth hormone polyadenylation site
- Synynt.pA synthetic polyadenylation site
- ITR inverted terminal repeats
- Figure 2 Design of the single-stranded (ss) adeno-associated viral (AAV) vectors AAVss- TTRm-MVM-co-hFVIII-AB-Sv40pA (5160 bp) (A), AAVss-SerpEnh-TTRm-MVM-co-hFVIII- ⁇ - Sv40pA (5252 bp) (B), AAVss-3xSerpEnh-TTRm-MVM-co-hFVIII-AB-Sv40pA (5410 bp) (C), AAVss-TTREnh-TTRm-MVM-co-hFVIII-AB-Sv40pA (5272 bp) (D), AAVss-3xSerpEnh-TTRm- MVM-co-hFVIII-AB-Synt.pA (5325 bp) (E), AAVss-3xSerpEnh-TTRm-co-hFVIII
- the minimal transthyretin promoter (TTRm) is driving the expression of the human codon-optimized B-domain deleted factor VIII (cohFVIIIdeltaB).
- the native TTR enhancer (TTRe), the Serpin enhancer (SERP), a triplet of the Serpin enhancer (3xSERP), or a combination of a triplet of the Serpin enhancer (3xSERP) and the native TTR enhancer (TTRe) may be cloned upstream of TTRm.
- the minute virus of mouse intron (MVM), the Simian Virus 40 (SV40) polyadenylation site (SV40pA) or a synthetic polyadenylation site (Synt.pA), and the inverted terminal repeats (ITR) are indicated.
- the sequences flanking/linking the different elements are indicated.
- the indicated vector sizes include both ITR's.
- Figure 3 FIX protein levels upon transduction of the described SC-vectors.
- Figure 4 FVIII protein levels upon transduction of the described SS-vectors.
- Figure 5 Plasmid map of the pAAVsc-SerpEnh-TTRm-MVM-co-FIX-R338L-BGHpA vector
- Figure 7 Plasmid map of the pAAVsc-TTRe-TTRm-MVM-co-FIX-R338L-BGHpA vector
- Figure 8 Plasmid map of the pAAVsc-3xSerpEnh-TTRe-TTRm-MVM-co-FIX-R338L-BGHpA vector
- Figure 9 Plasmid map of the pAAVss-TTRm-MVM-coFVI I ldeltaB-Sv40pA vector
- Figure 10 Plasmid map of the pAAVss-SerpEnh-TTRm-MVM-coFVIIIdeltaB-Sv40pA vector
- Figure 11 Plasmid map of the pAAVss-3xSerpEnh-TTRm-MVM-coFVI I ldeltaB-Sv40pA vector
- Figure 12 Plasmid map of the pAAVss-TTRe-TTRm-MVM-coFVIIIdeltaB-Sv40pA vector
- Figure 13 Nucleotide sequence of pAAVsc-SerpEnh-TTRm-MVM-co-FIX-R338L-BGHpA (SEQ ID NO:1 ); pAAVsc-3xSerpEnh-TTRm-MVM-co-FIX-R338L-BGHpA (SEQ ID NO:2); pAAVsc-TTRe-TTRm-MVM-co-FIX-R338L-BGHpA (SEQ ID NO:3); pAAVsc-3xSerpEnh- TTRe-TTRm-MVM-co-FIX-R338L-BGHpA (SEQ ID NO:4); the Serpin enhancer (SerpEnh) (SEQ ID NO:5); the minimal transthyretin (TTRm)
- Figure 14 Nucleotide sequence of pAAVss-TTRm-MVM-coFVIIIdeltaB-Sv40pA (SEQ ID NO:14); pAAVss-SerpEnh-TTRm-MVM- coFVIIIdeltaB-Sv40pA (SEQ ID NO:15); pAAVss- 3xSerpEnh-TTRm-MVM- coFVIIIdeltaB-Sv40pA (SEQ ID NO:16); pAAVss-TTRe-TTRm-MVM- coFVIIIdeltaB-Sv40pA (SEQ ID NO:17); codon-optimized transgene encoding B domain deleted human factor VIII (coFVIIIdeltaB) (SEQ ID NO:18); Simian virus 40 polyadenylation signal (SV40polyA) (SEQ ID NO:19); pAAVss-3xSerpEnh-TTRm-MVM-coFVIIIdelta
- Figure 15 FVIII protein levels in C57BL6 mice injected with the pAAVss-3XSerpEnh-TTREnh- TTRm-MVM-co-hFVIII-deltaB-SV40pA and pAAVss-TTREnh-TTRm-MVM-co-hFVIII-deltaB- SV40pA plasmids as described in Figure 2.
- C57BL6 mice were injected with 300 ng of the respective plasmids.
- FVIII protein levels were measured by ELISA in plasma samples collected on day 1 (black bar) and day 2 (white bar) post injection.
- Figure 16 Plasmid map of the pAAVsc-3xSerpEnh-TTRe-TTRm-MVM-co-FIX-R338L-Synt.pA vector
- Figure 17 Plasmid map of the pAAVss-3xSerpEnh-TTRm-MVM-coFVIIIdeltaB-Synt.pA vector
- Figure 18 Plasmid map of the pAAVss-3xSerpEnh-TTRm-coFVIIIdeltaB-Synt.pA vector
- Figure 19 Plasmid map of the pAAVss-3xSerpEnh-TTRe-TTRm-MVM-coFVIIIdeltaB-Sv40pA vector
- Figure 20 Plasmid map of the pAAVss-3xSerpEnh-TTRe-TTRm-coFVIIIdeltaB-Synt.pA vector
- Figure 21 Plasmid map of the pAAVss-TTRe-TTRm-coFVI I IdeltaB-Synt. pA vector.
- Figure 22 Design of comparative example of self-complementary (sc), double-stranded adeno-associated viral (AAV) vectors expressing co-FVIII delta-B. The following vectors were compared for FVIII expression levels: pAAVss-TTRm-MVM-coFVIIIdeltaB-Sv40pA (SEQ ID NO.
- Figure 23 Design of comparative example of self-complementary (sc), double-stranded adeno-associated viral (AAV) vectors expressing co-FIX.
- the following vectors were compared for FIX expression: pAAVss-3xSerpEnh-TTRe-AAT-MVM-co-FIX-R338L-BGHpA (SEQ ID NO:65); pAAVss-3xSerpEnh-TTRe-AAT-MVM-co-FIX-R338L-BGHpA (SEQ ID NO:66); pAAVss-3xSerpEnh-TTRe-AAT-MVM-co-FIX-R338L-BGHpA (SEQ ID NO:67); and pAAVss-3xSerpEnh-TTRe-AAT-MVM-co-FIX-R338L-BGHpA (SEQ ID NO:68).
- Figure 24 Nucleotide sequence of AAT promotor (SEQ ID 64); pAAVss-3xSe rp E n h-TT Re- AAT-MVM-co-FIX-R338L-BGHpA (SEQ ID NO:65); pAAVss-3xSerpEnh-TTRe-AAT-MVM-co- FIX-R338L-BGHpA (SEQ ID NO:66); pAAVss-3xSerpEnh-TTRe-AAT-MVM-co-FIX-R338L- BGHpA (SEQ ID NO:67); and pAAVss-3xSerpEnh-TTRe-AAT-MVM-co-FIX-R338L-BGHpA (SEQ ID NO:68).
- Figure 25 a) Graph depicting the effect of the 3XSerp enhancer on the TTRenh-TTRm promoter in regulating the FVIII expression in C57BL6 mice injected with 300ng of respective plasmids. The FVIII expression profile was tested using the ELISA, in the plasma samples collected Day 1. The presence of 3XSerp enhancer seems to elevate the FVIII expression by 8 fold, b) Graph comparing different constructs tested on FVIII expression as outlined in example 2.
- the invention relates to nucleic acid expression cassettes and expression vectors comprising said nucleic acid expression cassettes for enhancing liver-specific expression of a (trans)gene.
- nucleic acid expression cassette refers to nucleic acid molecules that include one or more transcriptional control elements (such as, but not limited to promoters, enhancers and/or regulatory elements, polyadenylation sequences, and introns) that direct (trans)gene expression in one or more desired cell types, tissues or organs.
- transcriptional control elements such as, but not limited to promoters, enhancers and/or regulatory elements, polyadenylation sequences, and introns
- the nucleic acid expression cassettes described herein will contain the FIX transgene or the FVIII transgene as defined herein.
- the invention provides nucleic acid expression cassettes comprising one or more liver-specific nucleic acid regulatory elements, operably linked to a promoter and a transgene.
- operably linked refers to the arrangement of various nucleic acid molecule elements relative to each such that the elements are functionally connected and are able to interact with each other.
- Such elements may include, without limitation, a promoter, an enhancer and/or a regulatory element, a polyadenylation sequence, one or more introns and/or exons, and a coding sequence of a gene of interest to be expressed (i.e., the transgene).
- the nucleic acid sequence elements when properly oriented or operably linked, act together to modulate the activity of one another, and ultimately may affect the level of expression of the transgene. By modulate is meant increasing, decreasing, or maintaining the level of activity of a particular element.
- a "regulatory element” as used herein refers to transcriptional control elements, in particular non-coding cis-acting transcriptional control elements, capable of regulating and/or controlling transcription of a gene, in particular tissue-specific transcription of a gene.
- Regulatory elements comprise at least one transcription factor binding site (TFBS), more in particular at least one binding site for a tissue-specific transcription factor, most particularly at least one binding site for a liver-specific transcription factor.
- regulatory elements as used herein increase or enhance promoter-driven gene expression when compared to the transcription of the gene from the promoter alone, without the regulatory elements.
- regulatory elements particularly comprise enhancer sequences, although it is to be understood that the regulatory elements enhancing transcription are not limited to typical far upstream enhancer sequences, but may occur at any distance of the gene they regulate. Indeed, it is known in the art that sequences regulating transcription may be situated either upstream (e.g. in the promoter region) or downstream (e.g. in the 3'UTR) of the gene they regulate in vivo, and may be located in the immediate vicinity of the gene or further away.
- regulatory elements as disclosed herein typically are naturally occurring sequences, combinations of (parts of) such regulatory elements or several copies of a regulatory element, i.e. non-naturally occurring sequences, are themselves also envisaged as regulatory element.
- Regulatory elements as used herein may be part of a larger sequence involved in transcriptional control, e.g. part of a promoter sequence. However, regulatory elements alone are typically not sufficient to initiate transcription, but require a promoter to this end.
- the one or more regulatory elements contained in the nucleic acid expression cassettes and vectors disclosed herein are preferably liver-specific.
- liver-specific regulatory elements are disclosed in WO 2009/130208, which is specifically incorporated by reference herein.
- Another example of a liver-specific regulatory element is a regulatory element derived from the transthyretin (TTR) gene, such as the regulatory element defined by SEQ ID NO:12, also referred to herein as "TTRe” or "TTREnh”(Wu et al., 2008).
- TTR transthyretin
- liver-specific expression entails that there is no 'leakage' of expressed gene product to other organs, such as spleen, muscle, heart and/or lung. The same applies mutatis mutandis for hepatocyte-specific expression, which may be considered as a particular form of liver-specific expression.
- liver-specific is mentioned in the context of expression
- hepatocyte-specific expression is also explicitly envisaged.
- tissue-specific expression is used in the application
- cell-type specific expression of the cell type(s) predominantly making up the tissue is also envisaged.
- the one or more regulatory element in the nucleic acid expression cassettes and vectors disclosed herein is fully functional while being only of limited length. This allows its use in vectors or nucleic acid expression cassettes without unduly restricting their payload capacity.
- the one or more regulatory element in the expression cassettes and vectors disclosed herein is a nucleic acid of 1000 nucleotides or less, 800 nucleotides or less, or 600 nucleotides or less, preferably 400 nucleotides or less, such as 300 nucleotides or less, 200 nucleotides or less, 150 nucleotides or less, or 100 nucleotides or less (i.e.
- the nucleic acid regulatory element has a maximal length of 1000 nucleotides, 800 nucleotides, 600 nucleotides, 400 nucleotides, 300 nucleotides, 200 nucleotides, 150 nucleotides, or 100 nucleotides).
- the disclosed nucleic acid regulatory elements retain regulatory activity (i.e. with regard to specificity and/or activity of transcription) and thus they particularly have a minimum length of 20 nucleotides, 25 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, or 70 nucleotides.
- the one or more regulatory element in the nucleic acid expression cassettes and vectors disclosed herein comprises a sequence from SERPINA1 regulatory elements, i.e. regulatory elements that control expression of the SERPINA1 gene in vivo.
- Said regulatory element preferably comprises, consists essentially of or consists of the sequence as defined in SEQ ID NO:5, a sequence having at least 85%, preferably at least 90%, more preferably at least 95%, such as 96%, 97%, 98% or 99%, identity to said sequence, or a functional fragment thereof.
- said regulatory element has a maximal length of 150 nucleotides or less, preferably 100 nucleotides or less, and comprises, consists essentially of or consists of the sequence as defined in SEQ ID NO:5, a sequence having at least 85%, preferably at least 90%, more preferably at least 95%, such as 96%, 97%, 98% or 99%, identity to said sequence, or a functional fragment thereof.
- the liver-specific nucleic acid regulatory element consisting of SEQ ID NO:5 is herein referred to as "the Serpin enhancer", "SerpEnh", or "Serp".
- the nucleic acid expression cassettes and vectors disclosed herein comprise two or more, such as two, three, four, five or six, preferably three, (tandem) repeats of a liver-specific regulatory element comprising, consisting essentially of or consisting of SEQ ID NO:5, or a sequence having at least 85%, preferably at least 90%, more preferably at least 95%, such as 96%, 97%, 98% or 99%, identity to said sequence, more preferably a liver-specific regulatory element of 150 nucleotides or less, preferably 100 nucleotides or less, more preferably 80 nucleotides or less, comprising, consisting essentially of or consisting of SEQ ID NO:5, or a sequence having at least 85%, preferably at least 90%, more preferably at least 95%, such as 96%, 97%, 98% or 99%, identity to said sequence.
- a preferred nucleic acid regulatory element comprising three tandem repeats of SEQ ID NO:5 is herein referred to as "3xSerp
- the nucleic acid expression cassettes and vectors disclosed herein comprise two or more, such as two, three, four, five or six, more preferably three, (tandem) repeats of a liver-specific regulatory element comprising, consisting essentially of or consisting of SEQ ID NO:5, or a sequence having at least 85%, preferably at least 90%, more preferably at least 95%, such as 96%, 97%, 98% or 99%, identity to said sequence, preferably a liver- specific regulatory element of 150 nucleotides or less, preferably 100 nucleotides or less, more preferably 80 nucleotides or less, comprising, consisting essentially of or consisting of SEQ ID NO:5, or a sequence having at least 85%, preferably at least 90%, more preferably at least 95%, such as 96%, 97%, 98% or 99%, identity to said sequence; and a regulatory element comprising, consisting essentially of or consisting of SEQ ID NO: 12, preferably a regulatory element of 150 nucleot
- a preferred liver-specific nucleic acid regulatory element comprising three tandem repeats of SEQ ID NO:5, and SEQ ID NO: 12, is herein referred to as "3xSerp-flank-TTRe” and is defined by SEQ ID NO: 13
- a further preferred liver- specific nucleic acid regulatory element comprising three tandem repeats of SEQ ID NO:5, and SEQ ID NO:12, is herein referred to as "3xSerp-flank-TTRe-flank” and is defined by SEQ ID NO:57.
- the liver-specific nucleic acid regulatory element in the nucleic acid expression cassettes and vectors disclosed herein comprises three tandem repeats of SEQ ID NO:5, and SEQ ID NO: 12; more preferably SEQ ID NO: 13; even more preferably SEQ ID NO:57, such as SEQ ID NO:27 or SEQ ID NO:39. It has been shown herein that said specific combinations of liver-specific regulatory elements resulted in unexpectedly enhanced liver- specific expression of the transgene, in particular the FIX transgene or FVIII transgene described herein, operably linked thereto.
- said nucleic acid expression cassettes and vectors disclosed herein comprise three tandem repeats of SEQ ID NO:5 (such as SEQ ID NO.13), and a further enhancer element TTRe defined by SEQ ID NO: 12, for example as defined by SEQ ID NO: 13, in combination with a liver-specific promotor.
- said promotor is the TTRm minimal promoter as defined by SEQ ID NO.6.
- said liver- specific promoter is the AAT promoter, such as the promoter defined by SEQ ID NO.64.
- the terms “identity” and “identical” and the like refer to the sequence similarity between two polymeric molecules, e.g., between two nucleic acid molecules, e.g., two DNA molecules. Sequence alignments and determination of sequence identity can be done, e.g., using the Basic Local Alignment Search Tool (BLAST) originally described by Altschul et al.
- BLAST Basic Local Alignment Search Tool
- the percentage sequence identity is calculated over the entire length of the sequence.
- the term "substantially identical” denotes at least 90%, preferably at least 95%, such as 95%, 96%, 97%, 98% or 99%, sequence identity.
- fragments refers to fragments of the sequences disclosed herein that retain the capability of regulating liver-specific expression, i.e. they still confer tissue specificity and they are capable of regulating expression of a (trans)gene in the same way (although possibly not to the same extent) as the sequence from which they are derived.
- Fragments comprise at least 10 contiguous nucleotides from the sequence from which they are derived. In further particular embodiments, fragments comprise at least 15, at least 20, at least 25, at least 30, at least 35 or at least 40 contiguous nucleotides from the sequence from which they are derived.
- functional fragments may comprise at least 1 , more preferably at least 2, at least 3, or at least 4, even more preferably at least 5, at least 10, or at least 15, of the transcription factor binding sites (TFBS) that are present in the sequence from which they are derived.
- TFBS transcription factor binding sites
- promoter refers to nucleic acid sequences that regulate, either directly or indirectly, the transcription of corresponding nucleic acid coding sequences to which they are operably linked (e.g. a transgene or endogenous gene).
- a promoter may function alone to regulate transcription or may act in concert with one or more other regulatory sequences (e.g. enhancers or silencers).
- a promoter is typically operably linked to regulatory elements to regulate transcription of a transgene.
- the regulatory element when operably linked to both a promoter and a transgene, the regulatory element can (1 ) confer a significant degree of liver specific expression in vivo (and/or in hepatocytes/ hepatic cell lines in vitro) of the transgene, and/or (2) can increase the level of expression of the transgene in the liver (and/or in hepatocytes/hepatocyte cell lines in vitro).
- the promoter contained in the nucleic acid expression cassettes and vectors disclosed herein is a liver-specific promoter. This is to increase liver specificity and/or avoid leakage of expression in other tissues.
- the liver-specific promoter is from the transthyretin (TTR) gene or from the Alpha-1 -antitrypsin (AAT) gene.
- TTR transthyretin
- AAT Alpha-1 -antitrypsin
- the TTR promoter is a minimal promoter (also referred to as TTRm or TRRmin herein), most particularly the minimal TTR promoter as defined in SEQ ID NO: 6.
- the AAT promoter is as defined in SEQ ID NO: 64.
- the promoter in the nucleic acid expression cassettes and vectors disclosed herein is a minimal promoter.
- a 'minimal promoter' as used herein is part of a full-size promoter still capable of driving expression, but lacking at least part of the sequence that contributes to regulating (e.g. tissue- specific) expression.
- This definition covers both promoters from which (tissue-specific) regulatory elements have been deleted- that are capable of driving expression of a gene but have lost their ability to express that gene in a tissue-specific fashion and promoters from which (tissue-specific) regulatory elements have been deleted that are capable of driving (possibly decreased) expression of a gene but have not necessarily lost their ability to express that gene in a tissue-specific fashion.
- Minimal promoters have been extensively documented in the art, a non-limiting list of minimal promoters is provided in the specification.
- liver-specific promoter encompasses any promoter that confers liver-specific expression to a (trans)gene.
- liver-specific promoters are provided on the Liver Specific Gene Promoter Database (LSPD, http://rulai.cshl.edu/LSPD/), and include, for example, the transthyretin (TTR) promoter or TTR-minimal promoter (TTRm), the alpha 1- antitrypsin (AAT) promoter, the albumin (ALB) promotor or minimal promoter, the apolipoprotein A1 (APOA1 ) promoter or minimal promoter, the complement factor B (CFB) promoter, the ketohexokinase (KHK) promoter, the hemopexin (HPX) promoter or minimal promoter, the nicotinamide N-methyltransferase (NNMT) promoter or minimal promoter, the (liver) carboxylesterase 1 (CES1 ) promoter or minimal promoter, the protein C (
- the promoter is a mammalian liver-specific promoter, in particular a murine or human liver-specific promoter. More preferably, said promoters are the respective minimal promoters
- liver-specific expression refers to the preferential or predominant expression of a (trans)gene (as RNA and/or polypeptide) in the liver, in liver tissue or in liver cells, as compared to other (i.e. non-liver) tissues or cells.
- a (trans)gene as RNA and/or polypeptide
- at least 50%, more particularly at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% of the (trans)gene expression occurs within liver tissue or liver cells.
- liver-specific expression entails that there is no 'leakage' of expressed gene product to other organs or tissue than liver, such as lung, muscle, brain, kidney and/or spleen.
- organs or tissue such as lung, muscle, brain, kidney and/or spleen.
- hepatocyte-specific expression and hepatoblast-specific expression may be considered as particular forms of liver-specific expression.
- hepatocyte-specific expression and hepatoblast-specific expression are also explicitly envisaged.
- liver cells encompasses the cells predominantly populating the liver and encompasses mainly hepatocytes, oval cells, liver sinusoidal endothelial cells (LSEC) and cholangiocytes (epithelial cells forming the bile ducts).
- LSEC liver sinusoidal endothelial cells
- cholangiocytes epihelial cells forming the bile ducts
- hepatocyte refers to a cell that has been differentiated from a progenitor hepatoblast such that it is capable of expressing liver-specific phenotype under appropriate conditions.
- hepatocyte also refers to hepatocytes that are de- differentiated. The term includes cells in vivo and cells cultured ex vivo regardless of whether such cells are primary or passaged.
- hepatoblast refers to an embryonic cell in the mesoderm that differentiates to give rise to a hepatocyte, an oval cell, or a cholangiocyte.
- the term includes cells in vivo and cells cultured ex vivo regardless of whether such cells are primary or passaged.
- transgene refers to particular nucleic acid sequences encoding a polypeptide or a portion of a polypeptide to be expressed in a cell into which the nucleic acid sequence is inserted. However, it is also possible that transgenes are expressed as RNA, typically to lower the amount of a particular polypeptide in a cell into which the nucleic acid sequence is inserted.
- RNA molecules include but are not limited to molecules that exert their function through RNA interference (shRNA, RNAi), micro-RNA regulation (miRNA), catalytic RNA, antisense RNA, RNA aptamers, etc.
- nucleic acid sequence is introduced into a cell is not essential to the invention, it may for instance be through integration in the genome or as an episomal plasmid.
- expression of the transgene may be restricted to a subset of the cells into which the nucleic acid sequence is inserted.
- transgene' is meant to include (1 ) a nucleic acid sequence that is not naturally found in the cell (i.e., a heterologous nucleic acid sequence); (2) a nucleic acid sequence that is a mutant form of a nucleic acid sequence naturally found in the cell into which it has been introduced ; (3) a nucleic acid sequence that serves to add additional copies of the same (i.e., homologous) or a similar nucleic acid sequence naturally occurring in the cell into which it has been introduced ; or (4) a silent naturally occurring or homologous nucleic acid sequence whose expression is induced in the cell into which it has been introduced.
- the transgene may also include a sequence encoding a leader peptide or signal sequence such that the transgene product will be secreted from the cell.
- the transgenes in the expression cassettes and vectors described herein encode coagulation factor IX or coagulation factor VIII.
- coagulation factor IX has the meaning as known in the art. Synonyms of coagulation factor IX are “FIX” or “Christmas factor” or “F9” and can be used interchangeably. In particular, the term “coagulation factor IX” encompasses the human protein encoded by the mRNA sequence as defined in Genbank accession number NM_000133.
- said FIX is a mutated FIX, which is hyperactive or hyper-functional as compared to the wild type FIX.
- Modifying functional activity of human coagulation factor can be done by bioengineering e.g. by introduction of point mutations.
- a hyperactive R338A variant was reported, which showed a 3 fold increased clotting activity compared to the wild type human FIX in an in vitro activated partial thromboplastin time assay (APPT) (Chang et al., 1998) and a 2 to 6-fold higher specific activity in hemophilia B mice transduced with the mutant FIX gene (Schuettrumpf et al., 2005).
- APPT in vitro activated partial thromboplastin time assay
- FIX FIX
- EGF- 1 domain replaced with the EGF-1 domain from FVII, alone or in combination with a R338A point mutation
- R338A point mutation Brunnetti-Pierri et al., 2009
- V86A/E277A/R338A triple mutant Li et al., 2010
- Y259F, K265T, and/or Y345T single, double or triple mutants Milanov, et al., 2012
- G190V point mutant Karl, et al., 2010
- the FIX mutant is the one described by Simioni et al., in 2009 and denominated as the "factor IX Padua" mutant, causing X-linked thrombophilia. Said mutant factor IX is hyperactive and carries an R338L amino acid substitution.
- the FIX transgene used in nucleic acid expression cassettes and expression vectors described herein encodes the human FIX protein, most preferably the FIX transgene encodes for the Padua mutant of the human FIX protein.
- the transgene has SEQ ID NO:9 (i.e. codon-optimized transgene encoding for the Padua mutant of the human FIX protein).
- coagulation factor VIII has the meaning as known in the art. Synonyms of coagulation factor VIII are “FVIN” or “anti-hemophilic factor” or “AHF” and can be used interchangeably herein.
- coagulation factor VIII encompasses, for example, the human protein having the amino acid sequence as defined in Uniprot accession number P00451.
- said FVIII is a FVIII wherein the B domain is deleted (i.e. B domain deleted FVIII, also referred to as BDD FVIII or FVIIIAB or FVIIIdeltaB herein).
- B domain deleted FVIII encompasses for example, but without limitation, FVIII mutants wherein whole or a part of the B domain is deleted and FVIII mutants wherein the B domain is replaced by a linker.
- Non-limiting examples of B domain deleted FVIII are described in Ward et al. (201 1 ) and WO 201 1/005968, which are specifically incorporated by reference herein.
- said FVIII is B domain deleted FVIII wherein the B domain is replaced by a linker having the following sequence: SFSQNPPVLTRHQR (SEQ ID NO: 59) (i.e. SQ FVIII as defined in Ward et al. (201 1 )).
- said transgene encoding FVIII has SEQ ID NO:18 (i.e. codon-optimized transgene encoding B domain deleted human FVIII, also referred to herein as (h)FVIIIcopt or co(h)FVIIIdeltaB or co(h)FVIIIdeltaB transgene), as disclosed also in WO 201 1/005968.
- sequences may be incorporated in the nucleic acid expression cassette disclosed herein as well, typically to further increase or stabilize the expression of the transgene product (e.g. introns and/or polyadenylation sequences).
- any intron can be utilized in the expression cassettes described herein.
- the term "intron” encompasses any portion of a whole intron that is large enough to be recognized and spliced by the nuclear splicing apparatus. Typically, short, functional, intron sequences are preferred in order to keep the size of the expression cassette as small as possible which facilitates the construction and manipulation of the expression cassette.
- the intron is obtained from a gene that encodes the protein that is encoded by the coding sequence within the expression cassette. The intron can be located 5' to the coding sequence, 3' to the coding sequence, or within the coding sequence.
- the nucleic acid expression cassette disclosed herein further comprises an intron.
- suitable introns are Minute Virus of Mice (MVM) intron, beta-globin intron (betalVS-ll), factor IX (FIX) intron A, Simian virus 40 (SV40) small-t intron, and beta-actin intron.
- the intron is an MVM intron, more preferably the MVM mini-intron as defined by SEQ ID NO: 8. The cloning of the MVM intron into a nucleic acid expression cassette described herein was shown to result in unexpectedly high expression levels of the transgene operably linked thereto.
- polyadenylation signal that directs the synthesis of a polyA tail is useful in the expression cassettes described herein, examples of those are well known to one of skill in the art.
- Exemplary polyadenylation signals include, but are not limited to, polyA sequences derived from the Simian virus 40 (SV40) late gene, the bovine growth hormone (BGH) polyadenylation signal, the minimal rabbit ⁇ -globin (mRBG) gene, and the synthetic polyA (SPA) site as described in Levitt et al. (1989, Genes Dev 3:1019-1025) (SEQ ID NO:56).
- the polyadenylation signal is the bovine growth hormone (BGH) polyadenylation signal (SEQ ID NO:10) or the Simian virus 40 (SV40) polyadenylation signal (SEQ ID NO:19).
- the nucleic acid expression cassette according to the invention comprises a promotor, an enhancer, a (trans)gene, and a transcription terminator.
- a nucleic acid expression cassette is disclosed and comprises:
- a liver-specific nucleic acid regulatory element preferably a regulatory element comprising three tandem repeats of the Serpin enhancer (e.g. SEQ ID NO.5), such as a regulatory element comprising SEQ ID NO:1 1 and the transthyretin enhancer (TTRe) as defined by SEQ ID N0.12,
- a nucleic acid expression cassette is disclosed and comprises:
- a liver-specific nucleic acid regulatory element preferably a regulatory element comprising three tandem repeats of the Serpin enhancer (e.g. SEQ ID NO.5), such as a regulatory element comprising SEQ ID NO:1 1 and the transthyretin enhancer (TTRe) as defined by SEQ ID N0.12,
- liver-specific TTRm promoter e.g. defined by SEQ ID NO.6, and
- transgene preferably wherein the combination of the TTRe and TTRm nucleic acids is defined by SEQ ID N0.69.
- a nucleic acid expression cassette is disclosed and comprises:
- a liver-specific nucleic acid regulatory element preferably a regulatory element comprising three tandem repeats of the Serpin enhancer (e.g. SEQ ID NO.5), such as a regulatory element comprising SEQ ID NO:1 1 and the transthyretin enhancer (TTRe) as defined by SEQ ID NO.12,
- Serpin enhancer e.g. SEQ ID NO.5
- TTRe transthyretin enhancer
- liver-specific TTRm promoter e.g. as defined by SEQ ID NO.6,
- an intron preferably the MVM intron, e.g. as defined by SEQ ID NO.8, and - a transgene preferably wherein the combination of the TTRe and TTRm nucleic acids is defined by SEQ ID N0.69.
- a nucleic acid expression cassette is disclosed and comprises:
- a liver-specific nucleic acid regulatory element preferably a regulatory element comprising three tandem repeats of the Serpin enhancer (e.g. SEQ ID NO.5), such as a regulatory element comprising SEQ ID NO:1 1 and the transthyretin enhancer (TTRe) as defined by SEQ ID N0.12,
- liver-specific TTRm promoter e.g. as defined by SEQ ID NO.6,
- an intron preferably the MVM intron, e.g. as defined by SEQ ID NO.8, and
- transgene preferably the FIX or FVIII transgene as defined herein elsewhere and optionally a transcription terminator as defined herein elsewhere, preferably wherein the combination of the TTRe and TTRm nucleic acids is defined by SEQ ID NO.69.
- a nucleic acid expression cassette is disclosed and comprises:
- a liver-specific nucleic acid regulatory element preferably a regulatory element comprising three tandem repeats of the Serpin enhancer (e.g. SEQ ID NO.5), such as a regulatory element comprising SEQ ID NO:1 1 and the transthyretin enhancer (TTRe) as defined by SEQ ID N0.12,
- liver-specific AAT promoter e.g. as defined by SEQ ID NO.64 .
- a nucleic acid expression cassette is disclosed and comprises:
- a liver-specific nucleic acid regulatory element preferably a regulatory element comprising three tandem repeats of the Serpin enhancer (e.g. SEQ ID NO.5), such as a regulatory element comprising SEQ ID NO:1 1 and the transthyretin enhancer (TTRe) as defined by SEQ ID N0.12,
- liver-specific AAT promoter e.g. as defined by SEQ ID NO.64 .
- an intron preferably the MVM intron, e.g. as defined by SEQ ID NO.8, and
- a nucleic acid expression cassette comprises: - a liver-specific nucleic acid regulatory element, preferably a regulatory element comprising three tandem repeats of the Serpin enhancer (e.g. SEQ ID NO.5), such as a regulatory element comprising SEQ ID NO:1 1 and the transthyretin enhancer (TTRe) as defined by SEQ ID N0.12,
- liver-specific AAT promoter e.g. as defined by SEQ ID NO.64
- an intron preferably the MVM intron, e.g. as defined by SEQ ID NO.8, and
- transgene preferably the FIX or FVIII transgene as defined herein elsewhere and optionally a transcription terminator as defined herein elsewhere.
- said nucleic acid expression cassette disclosed herein comprises:
- liver-specific regulatory element preferably three tandem repeats of the Serpin enhancer (SEQ ID NO.5), e.g. a regulatory element as defined by SEQ ID NO:1 1 ,
- a promoter preferably the minimal TTR promoter
- an intron preferably the MVM intron
- transgene preferably codon-optimized factor IX cDNA, even more preferably codon- optimized factor IX Padua cDNA
- a transcription terminator preferably a polyadenylation signal such as the bovine growth hormone polyadenylation signal (BGHpA) e.g. as defined by SEQ ID NO.10, or the synthetic polyA site as defined by SEQ ID NO:56.
- BGHpA bovine growth hormone polyadenylation signal
- said nucleic acid expression cassette disclosed herein comprises:
- liver-specific regulatory element preferably three tandem repeats of the Serpin enhancer and the transthyretin enhancer (TTRe) (e.g. a regulatory element comprising SEQ ID NO: 13, preferably comprising SEQ ID NO:57),
- TRe transthyretin enhancer
- a promoter preferably the minimal TTR promoter
- an intron preferably the MVM intron
- said nucleic acid expression cassette disclosed herein comprises:
- a liver-specific regulatory element preferably a regulatory element comprising three tandem repeats of the Serpin enhancer (e.g. a regulatory element comprising SEQ ID NO:1 1 ), more preferably three tandem repeats of the Serpin enhancer and the transthyretin enhancer (TTRe) (e.g. a regulatory element comprising SEQ ID NO: 13, preferably comprising SEQ ID NO:57),
- a regulatory element comprising three tandem repeats of the Serpin enhancer e.g. a regulatory element comprising SEQ ID NO:1 1
- TTRe transthyretin enhancer
- a promoter preferably the minimal TTR promoter
- an intron preferably the MVM intron
- a transcription terminator preferably a polyadenylation signal such as the Simian vacuolating virus 40 or Simian virus 40 (SV40) polyadenylation signal or the synthetic polyA site as defined by SEQ ID NO:56.
- a polyadenylation signal such as the Simian vacuolating virus 40 or Simian virus 40 (SV40) polyadenylation signal or the synthetic polyA site as defined by SEQ ID NO:56.
- said nucleic acid expression cassette disclosed herein comprises:
- a liver-specific regulatory element preferably a regulatory element comprising three tandem repeats of the Serpin enhancer (e.g. SEQ ID NO.5), such as a regulatory element comprising SEQ ID NO:1 1 and the transthyretin enhancer (TTRe) as defined by SEQ ID NO.12, such as the regulatory element comprising SEQ ID NO: 13, preferably comprising SEQ ID NO:57,
- Serpin enhancer e.g. SEQ ID NO.5
- TRe transthyretin enhancer
- a promoter preferably the AAT promoter such as the promoter as defined by SEQ ID NO. 64,
- an intron preferably the MVM intron such as the MVM intron as defined by SEQ ID NO.8, a (trans)gene, preferably codon-optimized factor IX cDNA, even more preferably codon- optimized factor IX Padua cDNA,
- a transcription terminator preferably a polyadenylation signal such as the bovine growth hormone polyadenylation signal (BGHpA) as defined by SEQ ID NO.10, or the synthetic polyA site as defined by SEQ ID NO:56.
- BGHpA bovine growth hormone polyadenylation signal
- SEQ ID NO. 65 such a vector is defined by SEQ ID NO. 65 (cf. Figure 25).
- said nucleic acid expression cassette disclosed herein comprises: - a liver-specific regulatory element, preferably a regulatory element comprising three tandem repeats of the Serpin enhancer (e.g. SEQ ID NO.5), such as a regulatory element comprising SEQ ID NO: 1 1 ,
- a promoter preferably the AAT promoter such as the promoter as defined by SEQ ID NO. 64,
- an intron preferably the MVM intron such as the MVM intron as defined by SEQ ID NO.8 , a (trans)gene, preferably codon-optimized factor IX cDNA, even more preferably codon- optimized factor IX Padua cDNA,
- a transcription terminator preferably a polyadenylation signal such as the bovine growth hormone polyadenylation signal (BGHpA) as defined by SEQ ID NO.10, or the synthetic polyA site as defined by SEQ ID NO:56.
- BGHpA bovine growth hormone polyadenylation signal
- SEQ ID NO. 66 cf. Figure 25.
- said nucleic acid expression cassette disclosed herein comprises:
- liver-specific regulatory element preferably a regulatory element comprising the transthyretin enhancer (TTRe) as defined by SEQ ID NO.12, operably linked to three tandem repeats of the Serpin enhancer (e.g. SEQ ID NO.5), more preferably as defined by SEQ ID NO:1 1 ,
- TTR transthyretin enhancer
- a promoter preferably the AAT promoter such as the promoter as defined by SEQ ID NO. 64,
- an intron preferably the MVM intron such as the MVM intron as defined by SEQ ID NO.8, a (trans)gene, preferably codon-optimized factor IX cDNA, even more preferably codon- optimized factor IX Padua cDNA,
- a transcription terminator preferably a polyadenylation signal such as the bovine growth hormone polyadenylation signal (BGHpA) as defined by SEQ ID NO.10, or the synthetic polyA site as defined by SEQ ID NO:56.
- BGHpA bovine growth hormone polyadenylation signal
- SEQ ID N0.68 cf. Figure 25.
- the expression cassettes disclosed herein may be used as such, or typically, they may be part of a nucleic acid vector. Accordingly, a further aspect relates to the use of a nucleic acid expression cassette as described herein in a vector, in particular a nucleic acid vector.
- the invention also provides a vector comprising a nucleic acid expression cassette as disclosed herein.
- the term 'vector' as used in the application refers to nucleic acid molecules, usually double- stranded DNA, which may have inserted into it another nucleic acid molecule (the insert nucleic acid molecule) such as, but not limited to, a cDNA molecule.
- the vector is used to transport the insert nucleic acid molecule into a suitable host cell.
- a vector may contain the necessary elements that permit transcribing the insert nucleic acid molecule, and, optionally, translating the transcript into a polypeptide.
- the insert nucleic acid molecule may be derived from the host cell, or may be derived from a different cell or organism.
- the vector can replicate independently of, or coincidental with, the host chromosomal DNA, and several copies of the vector and its inserted nucleic acid molecule may be generated.
- the term "vector” may thus also be defined as a gene delivery vehicle that facilitates gene transfer into a target cell.
- This definition includes both non-viral and viral vectors.
- Non-viral vectors include but are not limited to cationic lipids, liposomes, nanoparticles, PEG, PEI, etc.
- Viral vectors are derived from viruses including but not limited to: retrovirus, lentivirus, adeno- associated virus, adenovirus, herpesvirus, hepatitis virus or the like.
- gene delivery systems can be used to combine viral and non-viral components, such as nanoparticles or virosomes (Yamada et al., 2003).
- viral vectors are replication-deficient as they have lost the ability to propagate in a given cell since viral genes essential for replication have been eliminated from the viral vector.
- some viral vectors can also be adapted to replicate specifically in a given cell, such as e.g. a cancer cell, and are typically used to trigger the (cancer) cell- specific (onco)lysis.
- Preferred vectors are derived from adeno-associated virus, adenovirus, retroviruses and Antiviruses.
- Retroviruses and Antiviruses are RNA viruses that have the ability to insert their genes into host cell chromosomes after infection. Retroviral and lentiviral vectors have been developed that lack the genes encoding viral proteins, but retain the ability to infect cells and insert their genes into the chromosomes of the target cell (Miller, 1990; Naldini et al., 1996, VandenDriessche et al., 1999). The difference between a lentiviral and a classical Moloney- murine leukemia-virus (MLV) based retroviral vector is that lentiviral vectors can transduce both dividing and non-dividing cells whereas MLV-based retroviral vectors can only transduce dividing cells.
- MLV Moloney- murine leukemia-virus
- Adenoviral vectors are designed to be administered directly to a living subject. Unlike retroviral vectors, most of the adenoviral vector genomes do not integrate into the chromosome of the host cell. Instead, genes introduced into cells using adenoviral vectors are maintained in the nucleus as an extrachromosomal element (episome) that persists for an extended period of time. Adenoviral vectors will transduce dividing and nondividing cells in many different tissues in vivo including airway epithelial cells, endothelial cells, hepatocytes and various tumors (Trapnell, 1993; Chuah et al., 2003). Another viral vector is derived from the herpes simplex virus, a large, double-stranded DNA virus. Recombinant forms of the vaccinia virus, another dsDNA virus, can accommodate large inserts and are generated by homologous recombination.
- Adeno-associated virus is a small ssDNA virus which infects humans and some other primate species, not known to cause disease and consequently causing only a very mild immune response. AAV can infect both dividing and non-dividing cells and may incorporate its genome into that of the host cell. These features make AAV a very attractive candidate for creating viral vectors for gene therapy, although the cloning capacity of the vector is relatively limited. Accordingly, in preferred embodiments of the invention, the vector used is derived from adeno-associated virus (i.e. AAV vector).
- AAV vectors that comprise a FIX transgene as disclosed herein are preferably AAV serotype 9 vectors
- AAV vectors that comprise a FVIII transgene as disclosed herein are preferably AAV serotype 8 vectors.
- the AAV vectors disclosed herein may be single-stranded (i.e. ssAAV vectors) or self- complementary (i.e. scAAV vectors).
- AAV vectors that comprise a FIX transgene as disclosed herein are preferably self-complementary, and AAV vectors that comprise a FVIII transgene as disclosed herein are preferably single-stranded.
- self- complementary AAV is meant herein a recombinant AAV-derived vector wherein the coding region has been designed to form an intra-molecular double-stranded DNA template.
- Gene therapy with adeno-associated viral vectors disclosed herein was shown to induce immune tolerance towards the transgene comprised in the vector.
- the vector according to the invention comprises the following elements (cfr. Fig. 6):
- ITR Inverted Terminal Repeat sequence
- a liver-specific regulatory element preferably a regulatory element comprising three tandem repeats of the Serpin enhancer ("Serp” or "SerpEnh”) (e.g. a regulatory element comprising the nucleic acid fragment defined by SEQ ID NO:1 1 ),
- TTRm minimal TTR promoter
- an intron preferably the MVM intron
- a (trans)gene preferably codon-optimized factor IX cDNA, even more preferably codon- optimized factor IX Padua cDNA, - a transcription terminator, preferably a polyadenylation signal such as the BGHpA or the synthetic polyA site as defined by SEQ ID NO:56,
- ITR Inverted Terminal Repeat sequence
- the vector is an adeno-associated virus-derived vector, more preferably a self- complementary AAV vector, even more preferably a self-complementary AAV serotype 9 vector, such as the vector as defined by SEQ ID NO:2.
- said vector comprises the following elements (cf. Fig. 8 and Fig. 16):
- ITR Inverted Terminal Repeat sequence
- a liver-specific regulatory element preferably a regulatory element comprising three tandem repeats of the Serpin enhancer ("Serp” or “SerpEnh”) and the transthyretin enhancer (TTRe) (e.g. a regulatory element comprising SEQ ID NO: 13, preferably comprising SEQ ID NO:57),
- TTRm minimal TTR promoter
- an intron preferably the MVM intron
- a transcription terminator preferably a polyadenylation signal such as the BGHpA or the synthetic polyA site as defined by SEQ ID NO:56, and
- ITR Inverted Terminal Repeat sequence
- the vector is an adeno-associated virus-derived vector, more preferably a self-complementary AAV vector, even more preferably a self-complementary AAV serotype 9 vector, such as the vector as defined by SEQ ID NO:4 or SEQ ID NO:25.
- said vector comprises the following elements (cfr. Fig. 1 1 , 17 or 18):
- ITR Inverted Terminal Repeat sequence
- a liver-specific regulatory element preferably a regulatory element comprising three tandem repeats of the Serpin enhancer (e.g. a regulatory element comprising SEQ ID NO:1 1 ), - a promoter, preferably the minimal TTR promoter,
- an intron preferably the MVM intron, - a (trans)gene, preferably codon-optimized factor VIII cDNA, even more preferably codon- optimized B domain deleted factor VIII cDNA,
- a transcription terminator preferably a polyadenylation signal such as the Simian vacuolating virus 40 or Simian virus 40 (SV40) polyadenylation signal or the synthetic polyA site as defined by SEQ ID NO:56, and
- a polyadenylation signal such as the Simian vacuolating virus 40 or Simian virus 40 (SV40) polyadenylation signal or the synthetic polyA site as defined by SEQ ID NO:56, and
- ITR Inverted Terminal Repeat sequence
- the vector is an adeno-associated virus(AAV)- derived vector, more preferably a single-stranded AAV vector, even more preferably a single- stranded AAV serotype 8 vector, such as the vector as defined by SEQ ID NO:16, SEQ ID NO:20 or SEQ ID NO:21 .
- AAV adeno-associated virus
- said vector comprises the following elements (cfr. Fig. 19 or 20):
- ITR Inverted Terminal Repeat sequence
- a liver-specific regulatory element preferably a regulatory element comprising three tandem repeats of the Serpin enhancer ("Serp” or “SerpEnh”) and the transthyretin enhancer (TTRe) (e.g. a regulatory element comprising SEQ ID NO: 13, preferably comprising SEQ ID NO:57),
- a promoter preferably the minimal TTR promoter
- an intron preferably the MVM intron
- a transcription terminator preferably a polyadenylation signal such as the Simian vacuolating virus 40 or Simian virus 40 (SV40) polyadenylation signal or the synthetic polyA site as defined by SEQ ID NO:56, and
- a polyadenylation signal such as the Simian vacuolating virus 40 or Simian virus 40 (SV40) polyadenylation signal or the synthetic polyA site as defined by SEQ ID NO:56, and
- ITR Inverted Terminal Repeat sequence
- the vector is an adeno-associated virus(AAV)- derived vector, more preferably a single-stranded AAV vector, even more preferably a single- stranded AAV serotype 8 vector, such as the vector as defined by SEQ ID NO:22 or SEQ ID NO:23.
- AAV adeno-associated virus
- Said regulatory element is defined by SEQ ID NO: 13.
- Said regulatory element can further be combined with the transthyretin minimal promotor as defined by SEQ ID NO.6.
- SEQ ID NO:58 results in a regulatory element as defined by SEQ ID NO:58, which has been tested to increase the expression of both FVIII and FIX transgenes as shown herein.
- the poly adenylation signal can be replaced by any other poly adenylation signal such as e.g. the synthetic polyA site as defined by SEQ ID NO:56 (Synth. pA).
- the vector is a non-viral vector, such as a transposon-based vector.
- said transposon-based vectors are derived from Sleeping Beauty (SB) or PiggyBac (PB).
- SB Sleeping Beauty
- PB PiggyBac
- a preferred SB transposon has been described in Ivies et al. (1997) and its hyperactive versions, including SB100X, as described in Mates et al. (2009).
- PiggyBac-based transposons are safe vectors in that they do no enhance the tumorigenic risk.
- liver-directed gene therapy with these vectors was shown to induce immune tolerance towards the transgene, in particular the hFIX or hFVIII transgene, comprised in the vector.
- the transposon-based vectors are preferably administered in combination with a vector encoding a transposase for gene therapy.
- the PiggyBac-derived transposon- based vector can be administered with wild-type PiggyBac transposase (Pbase) or mouse codon-optimized PiggyBac transposase (mPBase)
- said transposases are hyperactive transposases, such as, for example, hyperactive PB (hyPB) transposase containing seven amino acid substitutions (I30V, S103P, G165S, M282V, S509G, N538K, N570S) as described in Yusa et al. (201 1 ), which is specifically incorporated by reference herein.
- Transposon/transposase constructs can be delivered by hydrodynamic injection or using non- viral nanoparticles to transfect hepatocytes.
- nucleic acid regulatory elements can be used in gene therapy.
- Gene therapy protocols intended to achieve therapeutic gene product expression in target cells, in vitro, but also particularly in vivo, have been extensively described in the art. These include, but are not limited to, intramuscular injection of plasmid DNA (naked or in liposomes), interstitial injection, instillation in airways, application to endothelium, intra-hepatic parenchyme, and intravenous or intra-arterial administration (e.g. intra-hepatic artery, intra-hepatic vein).
- Various devices have been developed for enhancing the availability of DNA to the target cell.
- a simple approach is to contact the target cell physically with catheters or implantable materials containing DNA.
- Another approach is to utilize needle-free, jet injection devices which project a column of liquid directly into the target tissue under high pressure.
- These delivery paradigms can also be used to deliver viral vectors.
- Another approach to targeted gene delivery is the use of molecular conjugates, which consist of protein or synthetic ligands to which a nucleic acid-or DNA- binding agent has been attached for the specific targeting of nucleic acids to cells (Cristiano et al., 1993).
- the use of the nucleic acid expression cassettes and vectors as described herein is envisaged for gene therapy of liver cells (i.e. liver-directed gene therapy).
- the use of the regulatory elements, expression cassettes or vectors is for gene therapy, in particular liver-directed gene therapy, in vivo.
- the use is for a method of gene therapy, in particular liver-directed gene therapy, to treat hemophilia, in particular to treat hemophilia B or hemophilia A.
- Recent methods also include intraportal delivery of naked DNA (Budker et al., 1996) and hydrodynamic tail vein transfection (Liu et al., 1999; Zhang et al., 1999).
- methods for expressing a protein in liver cells comprising the steps of introducing in liver cells the nucleic acid expression cassette or a vector as described herein and expressing the transgene protein product in the liver cells. These methods may be performed both in vitro and in vivo.
- Methods of gene therapy for a subject in need thereof comprising the steps of introducing in the liver of the subject a nucleic acid expression cassette containing a transgene encoding a therapeutic protein, and expressing a therapeutic amount of the therapeutic protein in the liver.
- the method comprises the steps of introducing in the liver of the subject a vector comprising the nucleic acid expression cassette containing a transgene encoding a therapeutic protein, and expressing a therapeutic amount of the therapeutic protein in the liver.
- the therapeutic protein encoded by the transgene in the nucleic acid expression cassette or the vector is factor IX
- the method is a method for treating hemophilia B.
- factor IX By expressing factor IX in the liver via gene therapy, hemophilia B can be treated (Snyder et al., 1999).
- the therapeutic protein encoded by the transgene in the nucleic acid expression cassette or the vector is factor VIII, and the method is a method for treating hemophilia A.
- subject or “patient” are used interchangeably and refer to animals, preferably vertebrates, more preferably mammals, and specifically includes human patients and non-human mammals, such as e.g. mice.
- Preferred patients or subjects are human subjects.
- the terms “treat” or “treatment” refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological change or disorder, such as the development or spread of proliferative disease, e.g., cancer.
- beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilised (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
- Treatment can also mean prolonging survival as compared to expected survival if not receiving treatment.
- a phrase such as "a subject in need of treatment” includes subjects, such as mammalian subjects, that would benefit from treatment of a given condition, such as, hemophilia B or hemophilia A. Such subjects will typically include, without limitation, those that have been diagnosed with the condition, those prone to have or develop the said condition and/or those in whom the condition is to be prevented.
- terapéuticaally effective amount refers to an amount of a compound or pharmaceutical composition effective to treat a disease or disorder in a subject, i.e., to obtain a desired local or systemic effect and performance.
- the term implies that levels of factor IX in plasma equal to or higher than the therapeutic threshold concentration of 10mU/ml (milli-units per milliliter) plasma, 50mU/ml plasma, 100mU/ml plasma, 150mU/ml or 200mU/ml plasma in a subject can be obtained by transduction or transfection of the vector according to any one the embodiments described herein into a subject.
- the term implies that levels of factor VIII in plasma equal to or higher than the therapeutic threshold concentration of 10mU/ml (milli-units per milliliter) plasma, 50mU/ml plasma, 100mU/ml plasma, 150mU/ml plasma, 200mU/ml plasma or higher can be obtained by transduction or transfection of any of the vectors disclosed herein into a subject.
- these high physiological levels of factor VIII in the subject can be obtained even by administering relatively low doses of vector.
- the term thus refers to the quantity of compound or pharmaceutical composition that elicits the biological or medicinal response in a tissue, system, animal, or human that is being sought by a researcher, veterinarian, medical doctor or other clinician, which includes alleviation of the symptoms of the hemophilia being treated.
- these terms refer to the quantity of compound or pharmaceutical composition according to the invention which is necessary to prevent, cure, ameliorate, or at least minimize the clinical impairment, symptoms, or complications associated with hemophilia, in particular hemophilia B or hemophilia A, in either a single or multiple dose.
- the transduction of the vector according to any one of the embodiments defined herein into the subject can be done at a dose lower than 2x10 11 vg/kg (viral genomes per kilogram) to obtain a therapeutic factor IX level of 10mU/ml plasma or of 50mU/ml plasma in a subject.
- the transduction of the vector according to any one of the embodiments defined herein into the subject can be done at a dose lower than or equal to 6x10 11 vg/kg.
- the transduction of the vector according to any one of the embodiments defined herein into the subject can be done at a dose lower than or equal than 2x10 12 vg/kg.
- a level of factor IX of 200 mU/ml plasma or higher can be reached in a subject, when the transduction of the vector according to any one of the embodiments defined herein into the subject is done at a dose lower than or equal to 2x10 12 vg/kg.
- the transduction of the vector according to any one of the embodiments defined herein into the subject can be done at a dose lower than or equal to 2x10 12 vg/kg (viral genomes per kilogram), such as lower than or equal to 1x10 12 vg/kg, 5x10 11 vg/kg, 2.5x10 11 vg/kg, 1x10 11 vg/kg, 5x10 10 vg/kg, 1x10 10 vg/kg, 5x10 9 vg/kg, or 1x10 9 vg/kg preferably at a dose lower than or equal to 2.5x10 11 vg/kg, to obtain a therapeutic factor VIII level of 10 mU/ml plasma, 50 mU/ml plasma, 100 mU/ml plasma, 150 mU/ml plasma, 200 mU/ml plasma, or higher in a subject.
- efficacy of the treatment can, for example, be measured by assessing the hemophilia-caused bleeding in the subject.
- In vitro tests such as, but not limited to the in vitro activated partial thromboplastin time assay (APPT), test factor IX chromogenic activity assays, blood clotting times, factor IX or human factor Vlll-specific ELISAs are also available. Any other tests for assessing the efficacy of the treatment known in the art can of course be used.
- the nucleic acid expression cassette, the vector or the pharmaceutical composition of the invention may be used alone or in combination with any of the know hemophilia therapies, such as the administration of recombinant or purified clotting factors.
- the nucleic acid expression cassette, the vector or the pharmaceutical composition of the invention can thus be administered alone or in combination with one or more active compounds. The latter can be administered before, after or simultaneously with the administration of the said agent(s).
- a further object of the invention are pharmaceutical preparations which comprise a therapeutically effective amount of the nucleic acid expression cassette or the expression vector as defined herein, and a pharmaceutically acceptable carrier, i.e., one or more pharmaceutically acceptable carrier substances and/or additives, e.g., buffers, carriers, excipients, stabilisers, etc.
- a pharmaceutically acceptable carrier i.e., one or more pharmaceutically acceptable carrier substances and/or additives, e.g., buffers, carriers, excipients, stabilisers, etc.
- pharmaceutically acceptable as used herein is consistent with the art and means compatible with the other ingredients of a pharmaceutical composition and not deleterious to the recipient thereof.
- pharmaceutically acceptable salts as used herein means an inorganic acid addition salt such as hydrochloride, sulfate, and phosphate, or an organic acid addition salt such as acetate, maleate, fumarate, tartrate, and citrate.
- Examples of pharmaceutically acceptable metal salts are alkali metal salts such as sodium salt and potassium salt, alkaline earth metal salts such as magnesium salt and calcium salt, aluminum salt, and zinc salt.
- Examples of pharmaceutically acceptable ammonium salts are ammonium salt and tetramethylammonium salt.
- Examples of pharmaceutically acceptable organic amine addition salts are salts with morpholine and piperidine.
- Examples of pharmaceutically acceptable amino acid addition salts are salts with lysine, glycine, and phenylalanine.
- composition according to the invention can be administered orally, for example in the form of pills, tablets, lacquered tablets, sugar- coated tablets, granules, hard and soft gelatin capsules, aqueous, alcoholic or oily solutions, syrups, emulsions or suspensions, or rectally, for example in the form of suppositories.
- Administration can also be carried out parenterally, for example subcutaneously, intramuscularly or intravenously in the form of solutions for injection or infusion.
- suitable administration forms are, for example, percutaneous or topical administration, for example in the form of ointments, tinctures, sprays or transdermal therapeutic systems, or the inhalative administration in the form of nasal sprays or aerosol mixtures, or, for example, microcapsules, implants or rods.
- the pharmaceutical composition can be prepared in a manner known per se to one of skill in the art.
- the nucleic acid expression cassette or the expression vector as defined herein, one or more solid or liquid pharmaceutically acceptable excipients and, if desired, in combination with other pharmaceutical active compounds are brought into a suitable administration form or dosage form which can then be used as a pharmaceutical in human medicine or veterinary medicine.
- a pharmaceutical composition comprising a nucleic acid expression cassette containing a transgene encoding a therapeutic protein, and a pharmaceutically acceptable carrier.
- the pharmaceutical composition comprises a vector containing the nucleic acid expression cassette containing a transgene encoding a therapeutic protein, and a pharmaceutically acceptable carrier.
- the transgene encodes factor IX and the pharmaceutical composition is for treating hemophilia B or the transgene encodes factor VIII and the pharmaceutical composition is for treating hemophilia A.
- nucleic acid expression cassette preferably hemophilia B or hemophilia A
- vector components as disclosed herein for the manufacture of these pharmaceutical compositions for use in treating hemophilia, preferably hemophilia B or hemophilia A, is also envisaged.
- Example 1 Design of the AAV vectors used The design of the self-complementary (sc), double-stranded adeno-associated viral (AAV) vectors is depicted in Figure 1.
- the minimal transthyretin promoter (TTRm) is driving the expression of the human codon-optimized factor IX (co-FIX-R338L) containing the hyper- activating, thrombophilic FIX mutation (R338L).
- the minimal TTR promoter is used in conjunction with either the Serpin enhancer (SERP), a triple repeat of the Serpin enhancer (3xSERP), the native TTR enhancer (TTRe), or a combination of a triple repeat of the Serpin enhancer and the native TTR enhancer (3xSERP-TTRe).
- SERP Serpin enhancer
- 3xSERP triple repeat of the Serpin enhancer
- TTRe native TTR enhancer
- 3xSERP-TTRe The minute virus of mouse intron (MVM), the bovine growth hormone polyadenylation site (BGHpA) or a synthetic polyadenylation site (Synt.pA), and the inverted terminal repeats (ITR) are indicated; 3xSerpEnh means that this element was cloned as a triplet repeat upstream of the TTRm.
- the vector size (including both ITR's) is indicated.
- FIG. 2 shows the design of the single-stranded (ss) adeno-associated viral (AAV) vectors.
- the minimal transthyretin promoter (TTRm) is driving the expression of the human codon- optimized B-domain deleted factor VIII (cohFVIIIdeltaB).
- serpin enhancer SERP
- TTRe native TTR enhancer
- a combination of a triple repeat of the Serpin enhancer and the native TTR enhancer 3xSERP-TTRe
- the minute virus of mouse intron (MVM), the Simian Virus 40 (SV40) polyadenylation site (Sv40pA) or a synthetic polyadenylation site (Synt.pA), and the inverted terminal repeats (ITR) are indicated.
- the vector size (including both ITR's) is indicated.
- FIX constructs The basic AAVsc-SerpEnh-TTRm-MVM-co-FIX-R338L-BGHpA plasmid (Nair et al. Blood, 2014) was used to create the other AAV-FIX constructs.
- This plasmid contains the Serp enhancer (SerpEnh), a liver-specific transthyretin (TTRm) promoter, a minute virus of mouse (MVM) small intron, a codon optimized human FIX transgene containing a R338L mutation, and a bovine growth hormone poly A (BGHpA).
- the 3xSerpEnh-TTRm-MVM sequence was synthesized by GeneArt (Life Technologies, Regensburg, Germany) and cloned into the basic construct using Ascl and Nhel, thereby replacing SerpEnh-TTRm-MVM, creating pAAVsc-3xSerpEnh-TTRm-MVM-co-FIX-R338L-BGHpA.
- the 3xSerpEnh sequence was replaced by the TTR enhancer (TTREnh) or 3xSerpEnh-TTREnh (constructed by GeneArt), thereby respectively creating pAAVsc-TTREnh-TTRm-MVM-co-FIX- R338L-BGHpA and pAAVsc-3xSerpEnh-TTREnh-TTRm-MVM-co-FIX-R338L-BGHpA respectively.
- FVIII constructs The basic AAVss-SerpEnh-TTRm-MVM-FVIIIcopt-Sv40pA plasmid was used to create the other AAV-FVIII constructs.
- This plasmid contains the Serp enhancer (SerpEnh), a liver-specific transthyretin (TTRm) promoter, an MVM intron, a codon optimized human FVIII transgene (Di Matteo et al., 2014), and an SV40 poly A.
- SerpEnh was removed using Kpnl, followed by re-ligation of the backbone, thereby creating pAAVss-TTRm-MVM-FVIIIcopt- Sv40pA.
- the 3xSerpEnh was first cloned into a FVIIIcopt plasmid with a different backbone, after which the entire expression cassette (3xSerpEnh-TTRm-MVM-FVIIIcopt-Sv40pA) was cloned into the AAVss backbone using Notl and Xhol. From this final plasmid, 3xSerpEnh was removed and replaced with the TTREnh (constructed by GeneArt), thereby creating pAAVss-TTREnh-TTRm-MVM- FVIIIcopt-Sv40pA.
- pAAVss-3XSerpEnh-TTREnh-TTRm-MVM- cohFVIIIdeltaB-SV40pA (5493bp)
- pAAVss-TTREnh-TTRm-MVM-cohFVIIIdeltaB-SV40pA (the vector) was restricted with Notl-Acc65l.
- a fragment with 3XSerp flanked by Notl/Acc65l was synthesized by GenArt and ligated into the restricted vector.
- AAV vectors were produced by calcium phosphate (Invitrogen Corp, Carlsbad, CA) co- transfection of AAV-293 human embryonic kidney carcinoma cells (Stratagene, Carlsbad, CA, catalog No 240073; with the pAAV plasmid of interest, an adenoviral helper plasmid and a chimeric packaging constructs that delivers the AAV2 Rep gene together with the AAV8 or AAV9 Cap gene, as described previously (VandenDriessche et al, 2007, VandenDriessche et al; 2007, J. Thromb. Haemost. JTH 5:16-24).
- the AAV9 serotype was used and for the AAV-FVIII vectors the AAV8 serotype.
- the AAV-293 cells are free of microbial contamination as determined by PCR for detection of mycoplasma. Briefly, two days post transfection, cells were harvested and vector particles were purified using isopycnic centrifugation methods. Harvested cells were lysed by successive freeze/thaw cycles and sonication, treated with benzonase (Novagen, Madison, Wl) and deoxycholic acid (Sigma- Aldrich, St. Louis, MO) and subsequently subjected to 2 successive rounds of cesium chloride (Invitrogen Corp, Carlsbad, CA) density gradient ultracentrifugation.
- cesium chloride Invitrogen Corp, Carlsbad, CA
- Fractions containing the AAV vector were collected, concentrated in 1 mM MgC in Dulbecco's phosphate buffered saline (PBS) (Gibco, BRL) and stored at -80°C.
- the vector titers in viral genomes (vg)/ml) were determined by quantitative real-time PCR using specific primers.
- primers specific for the bovine growth hormone poly A sequence were used.
- the forward and reverse primers used were 5'-GCCTTCTAGTTGCCAGCCAT-3' (SEQ ID NO:60) and 5'- GGCACCTTCCAGGGTCAAG-3' (SEQ ID NO:61 ), respectively.
- FVIII vectors primers specific for the FVIII gene sequence were used.
- the forward and reverse primers used were 5'- AACGGCTACGTGAACAGAAG -3' (SEQ ID NO:62) and 5'- G ATAG G G CTG ATTTCCAG G C -3' (SEQ ID NO:63), respectively.
- Reactions were performed in SybrGreen PCR Master Mix (Applied Biosystems, Foster City,CA,USA), on an ABI 7500 Real-Time PCR System (Applied Biosystems, Foster City,CA,USA).
- Known copy numbers (102-107) of the respective vector plasmids used to generate the corresponding AAV vectors, carrying the appropriate cDNAs were used to generate the standard curves.
- AAV vector administration is carried out by tail vein injection on adult C57B6 mice at two different doses: 1x10 9 (low dose) and 5x10 9 (high dose) vector genomes (vg) per mouse as detailed below. Mice were bled at different time points after gene transfer in order to evaluate the FIX/FVIII gene expression.
- the pAAVss-TTREnh-TTRm-MVM-co-hFVIII-deltaB-SV40pA and pAAVss-3XSerpEnh-TTREnh-TTRm-MVM-co-hFVIII-deltaB-SV40pA plasmid constructs were administered by hydrodynamic delivery into C57BL/6 mice at a dose of 300 ng per mouse.
- FIX ELISA concentration of hFIX antigens in citrated plasma was measured by enzyme-linked immunosorbent assay (ELISA) using manufacturer's protocol (Diagnostica Stago, France).
- the hFIX standards (available in the kit) were serially diluted using the dilution buffer and used for calibration. Here the 100% of the standard corresponds to 5000ng of FIX protein.
- the aliquots of the plasma samples were thawed and diluted in order to make their reading fall in the linear range of standards. Standards and samples were then added to a 96 well plate pre- coated with primary anti-human FIX antibodies.
- the concentration of hFVIII antigens in citrated plasma was measured by enzyme-linked immunosorbent assay (ELISA) using manufacturer's protocol (Diagnostica Stago, France).
- the hFVIII standards (available in the kit) were serially diluted using the dilution buffer and used for calibration. Here the 100% of the standard corresponds to 200ng of FVIII protein.
- the aliquots of the plasma samples were thawed and diluted in order to make their reading fall in the linear range of standards. Standards and samples were then added to a 96 well plate pre- coated with primary anti-human FVIII antibodies.
- STATISTICS Data were analyzed using Microsoft Excel Statistics package. Values shown in Figures 3 and 4 are the mean + SEM. Significance values were obtained by comparison using t-test.
- mice Male adult C57BL/6 mice (18-20 grams) were administrated with AAV9 FIX vectors (see the table below) by tail vain injection at doses of 1 x10 9 vg/mouse and 5x10 9 vg/mouse.
- mice Male adult CB17SCID mice (18-20 grams) were administrated with AAV8 XVIII vectors (see the table below by tail vain injection at doses of 1 x10 9 vg/mouse and 5x10 9 vg/mouse.
- mice Male adult C57BL/6 mice (22-24 grams) were administrated with respective plasmids (see the table below) by hydrodynamic tail vein injection at doses of 300 ng.
- the FIX expression showed a continuous increase over time.
- the AAV vector containing the most robust 3XSerpEnh-TTREnh-TTRm regulatory elements showed about 11 to 6 fold (at low and high vector dose, respectively) higher FIX expression when compared to a control AAV vector that expressed FIX from the TTREnh-TTRm enhancer/promoter (i.e. lacking the SerpEnh enhancer).
- the AAV vector containing the most robust 3XSerpEnh-TTREnh-TTRm regulatory elements showed about 4 to 3 fold (low and high vector dose, respectively) higher FIX expression when compared to a vector that expressed FIX from the SerpEnh-TTRm enhancer/promoter, which contains only one instead of 3 copies of the Serp enhancer, and no TTRe enhancer.
- the AAV vector containing the most robust 3XSerpEnh-TTREnh-TTRm showed about 3 to 2 fold (low and high vector dose, respectively) higher expression when compared to a vector that expressed FIX from the 3XSerpEnh-TTRm enhancer/promoter which also 3 copies of the Serp enhancer, but is devoid of the TTR enhancer.
- the FVIII expression showed a continuous increase over time.
- the AAV vector containing the 3XSerpEnh-TTRm regulatory elements showed about 30 to 12 fold (low and high vector dose, respectively) higher FVIII expression when compared to a reference control cassette (TTRm) which consist of only the TTR minimal promoter and that do not contain any enhancer.
- TTRm reference control cassette
- the AAV vector containing the 3XSerpEnh-TTRm regulatory elements showed about 10 to 1.5-fold (low and high vector dose, respectively) higher FVIII expression when compared to an AAV vector containing SerpEnh-TTRm with only one copy of the Serp enhancer.
- the AAV vector containing the 3XSerpEnh-TTRm regulatory elements showed about 5 to 2 fold (low and high vector dose, respectively) higher expression when compared to an AAV vector containing the TTREnh-TTRm enhancer/promoter.
- the 3x SerpEnh regulatory element could further increase FVIII expression from the TTRenh-TTRm enhancer/promoter (Fig. 15).
- FVIII protein levels were about 8 to 5 fold higher in mice injected with the pAAVss-3XSerpEnh- TTREnh-TTRm-MVM-co-hFVIII-deltaB-SV40pA plasmid as compared to the pAAVss-TTREnh- TTRm-MVM-co-hFVIII-deltaB-SV40pA plasmid.
- Example 2 Studying the in vivo effect of 3xCRM8 and TTRenhancer on FVIII expression in various constructs by hydrodynamic injection (2ml) into CB17-SCID mice.
- the aim of this example was to study the in vivo effect of 3xCRM8 and TTRenhancer on FVIII expression in various constructs by hydrodynamic injection (2ml) into CB17-SCID mice.
- FIG. 25a example shows a graph depicting the effect of the 3XSerp enhancer on the TTRenh-TTRm promoter in regulating the FVIII expression in C57BL6 mice injected with 300ng of respective plasmids.
- the FVIII expression profile was tested using the ELISA, in the plasma samples collected Day 1. The presence of 3XSerp enhancer seems to elevate the FVIII expression by 8 fold.
- Mouse model CB17-SCID, male, adult mice of 18-20 grams
- Figure 25b shows the compiled data from comparing the 4 constructs (see table below for actual FVIII expression values). Addition of 3xSERP to the TTRm construct enhances FVIII expression 17 fold. Addition of 3xSERP to the TTRe-TTRm construct enhances FVIII expression 13 fold. Addition of TTRe to the 3xSERP-TTRm construct still enhances FVIII expression 4 fold.
- Example 3 Studying the in vivo effect of 3xCRM8 and TTRenhancer in combination with an AAT promoter on FIX expression in various constructs by hydrodynamic injection (2ml) into C57BL/6 mice.
- the TTRm minimal promotor is replaced by another liver-specific promotor to show the versatility of the regulator element.
- AAT liver-specific promoter As a first example, the AAT liver-specific promoter (AAT) is tested.
- albumin promotor is used to replace the TTRm promotor in said constructs, hence encompassing the following constructs:
- apolipoprotein A1 promotor (APOAI p) is used to replace the TTRm promotor in said constructs, hence encompassing the following construct:
- complement factor B promoter (CFBp) is used to replace the TTRm promotor in said constructs, hence encompassing the following construct:
- ketohexokinase promoter (KHKp) is used to replace the TTRm promotor in said constructs, hence encompassing the following construct:
- hemopexin promoter HPXp is used to replace the TTRm promotor in said constructs, hence encompassing the following construct:
- nicotinamide N-methyltransferase promoter (NNMTp) is used to replace the TTRm promotor in said constructs, hence encompassing the following construct: pAAVsc-3xCRM8-TTRe-NNMTp-MVM-FIXcoR338L-BGHpA,
- the (liver) carboxylesterase 1 promoter (CES1 p) is used to replace the TTRm promotor in said constructs, hence encompassing the following construct:
- the protein C promoter (PROCp) is used to replace the TTRm promotor said constructs, hence encompassing the following construct:
- APOC3p apolipoprotein C3 promoter
- MASP2p mannan-binding lectin serine protease 2
- the serpin peptidase inhibitor, clade C (antithrombin) promoter SERPINCI p
- SERPINCI p serpin peptidase inhibitor, clade C (antithrombin) promoter
- the serpin peptidase inhibitor promoter (HAMPp) is used to replace the TTRm promotor in said constructs, hence encompassing the following construct:
- ARRUDA VR ARRUDA VR
- STEDMAN HH STEDMAN HH
- HAURIGOT V BUCHLIS G. (2010).
- Helper-dependent adenoviral vectors mediate therapeutic factor VIII expression for several months with minimal accompanying toxicity in a canine model of severe hemophilia A. Blood 103, 804-10.
- a microRNA-regulated lentiviral vector mediates stable correction of hemophilia B mice. Blood 1 10, 4144-52.
- Bioengineered factor IX molecules with increased catalytic activity improve the therapeutic index of gene therapy vectors for hemophilia B. Hum Gene Ther. 2009 May;20(5):479-85.
- HERZOG RW, MOUNT JD, ARRUDA VR, HIGH KA, and LOTHROP CD Jr. (2001 ). Muscle- directed gene transfer and transient immune suppression result in sustained partial correction of canine hemophilia B caused by a null mutation. Mol Ther. 4, 192-200.
- KISTNER A GOSSEN M, ZIMMERMANN F, JERECIC J, ULLMER C, LYBBERT H, BUJARD H. (1996) Doxycycline- mediated quantitative and tissue-specific control of gene expression in transgenic mice. Proc Natl Acad Sci U S A. Oct 1 ;93(20): 10933-8. KREN BT, UNGER GM, SJEKLOCHA L, TROSSEN AA, KORMAN V, DIETHELEM-OKITA BM, REDING MT, and STEER CJ. (2009). Nanocapsule-delivered Sleeping Beauty mediates therapeutic Factor VIII expression in liver sinusoidal endothelial cells of hemophilia A mice. J Clin Invest. 19, 2086-99.
- a microRNA-regulated and GP64-pseudotyped lentiviral vector mediates stable expression of FVIII in a murine model of Hemophilia A. Mol Ther. 19, 723-30.
- Adeno-associated virus terminal repeat (TR) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther. 10, 21 12-8.
- VANDENDRIESSCHE T VANSLEMBROUCK V, GOOVAERTS I, ZWINNEN H, VANDERHAEGHEN ML, COLLEN D, and CHUAH MK. (1999). Long-term expression of human coagulation factor VIII and correction of hemophilia A after in vivo retroviral gene transfer in factor VII l-deficient mice. Proc Natl Acad Sci USA. 96, 10379-84.
- Lentiviral vectors containing the human immunodeficiency virus type-1 central polypurine tract can efficiently transduce nondividing hepatocytes and antigen-presenting cells in vivo. Blood 100, 813-22.
- VANDENDRIESSCHE T THORREZ L, ACOSTA-SANCHEZ A
- PETRUS I WANG L, MA L, DE WAELE L, IWASAKI Y, GILLIJNS V, WILSON JM, COLLEN D, and CHUAH MK.
- VANDENDRIESSCHE T IVICS Z, IZSVAK Z, and CHUAH MK. (2009). Emerging potential of transposons for gene therapy and generation of induced pluripotent stem cells. Blood 1 14, 1461-8. VANDENDRIESSCHE T, and CHUAH MK. (2012). Clinical progress in gene therapy: sustained partial correction of the bleeding disorder in patients suffering from severe hemophilia B. Hum Gene Ther. 23, 4-6.
- Neonatal or hepatocyte growth factor-potentiated adult gene therapy with a retroviral vector results in therapeutic levels of canine factor IX for hemophilia B. Blood 101 , 3924 - 3932.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Hematology (AREA)
- Epidemiology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Toxicology (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Diabetes (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/558,725 US11007280B2 (en) | 2015-03-17 | 2016-03-17 | Optimized liver-specific expression systems for FVIII and FIX |
| DK16713774.4T DK3270944T3 (da) | 2015-03-17 | 2016-03-17 | Optimerede leverspecifikke ekspressionssystemer til FVIII og FIX |
| JP2017549256A JP6879486B2 (ja) | 2015-03-17 | 2016-03-17 | Fviiiおよびfix用の最適化された肝臓特異的発現系 |
| ES16713774T ES2764453T3 (es) | 2015-03-17 | 2016-03-17 | Sistemas de expresión específica de hígado optimizados para FVIII y FIX |
| CA2979495A CA2979495A1 (en) | 2015-03-17 | 2016-03-17 | Optimized liver-specific expression systems for fviii and fix |
| AU2016232146A AU2016232146B2 (en) | 2015-03-17 | 2016-03-17 | Optimized liver-specific expression systems for FVIII and FIX |
| EP16713774.4A EP3270944B1 (en) | 2015-03-17 | 2016-03-17 | Optimized liver-specific expression systems for fviii and fix |
| US17/240,845 US20210369868A1 (en) | 2015-03-17 | 2021-04-26 | Optimized Liver-Specific Expression Systems for FVIII and FIX |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP15159395.1 | 2015-03-17 | ||
| EP15159395 | 2015-03-17 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/558,725 A-371-Of-International US11007280B2 (en) | 2015-03-17 | 2016-03-17 | Optimized liver-specific expression systems for FVIII and FIX |
| US17/240,845 Continuation US20210369868A1 (en) | 2015-03-17 | 2021-04-26 | Optimized Liver-Specific Expression Systems for FVIII and FIX |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016146757A1 true WO2016146757A1 (en) | 2016-09-22 |
Family
ID=52686196
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2016/055825 Ceased WO2016146757A1 (en) | 2015-03-17 | 2016-03-17 | Optimized liver-specific expression systems for fviii and fix |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US11007280B2 (enExample) |
| EP (1) | EP3270944B1 (enExample) |
| JP (1) | JP6879486B2 (enExample) |
| AU (1) | AU2016232146B2 (enExample) |
| CA (1) | CA2979495A1 (enExample) |
| DK (1) | DK3270944T3 (enExample) |
| ES (1) | ES2764453T3 (enExample) |
| WO (1) | WO2016146757A1 (enExample) |
Cited By (35)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9982248B2 (en) | 2008-09-15 | 2018-05-29 | Uniqure Biopharma B.V. | Factor IX polypeptide mutant, its uses and method for its production |
| WO2018178067A1 (en) | 2017-03-27 | 2018-10-04 | Vrije Universiteit Brussel | Diaphragm-specific nucleic acid regulatory elements and methods and use thereof |
| WO2018208973A1 (en) * | 2017-05-09 | 2018-11-15 | Emory University | Clotting factor variants and their use |
| WO2018217731A1 (en) | 2017-05-22 | 2018-11-29 | Baxalta Incorporated | Viral vectors encoding recombinant fix with increased expression for gene therapy of hemophilia b |
| US10189889B2 (en) | 2015-11-13 | 2019-01-29 | Baxalta Incorporated | Viral vectors encoding recombinant FVIII variants with increased expression for gene therapy of hemophilia A |
| US10189888B2 (en) | 2015-11-13 | 2019-01-29 | Baxalta Incorporated | Viral vectors encoding recombinant FVIII variants with increased expression for gene therapy of hemophilia A |
| US10413598B2 (en) | 2014-11-12 | 2019-09-17 | Ucl Business Plc | Factor IX gene therapy |
| WO2020020475A1 (en) * | 2018-07-27 | 2020-01-30 | Zentrum Für Forschungsförderung In Der Pädiatrie Gmbh | Improved concepts for the treatment of genetic disorders with high-capacity plal-generated gold nanoparticles |
| US10610606B2 (en) | 2018-02-01 | 2020-04-07 | Homology Medicines, Inc. | Adeno-associated virus compositions for PAH gene transfer and methods of use thereof |
| WO2020084162A1 (en) | 2018-10-26 | 2020-04-30 | Vrije Universiteit Brussel | Liver-specific nucleic acid regulatory elements and methods and use thereof |
| WO2020084161A1 (en) | 2018-10-26 | 2020-04-30 | Vrije Universiteit Brussel | New tools for improving gene therapy and use thereof |
| WO2020150375A1 (en) | 2019-01-16 | 2020-07-23 | Baxalta Incorporated | Viral vectors encoding recombinant fviii variants with increased expression for gene therapy of hemophilia a |
| US20200246437A1 (en) * | 2019-02-01 | 2020-08-06 | Baxalta Incorporated | Gene therapy of hemophilia b using viral vectors encoding recombinant fix variants with increased expression |
| JP2020526203A (ja) * | 2017-07-10 | 2020-08-31 | ユニキュアー アイピー ビー.ブイ. | ヒトにおけるaav遺伝子療法のための手段及び方法 |
| US10842885B2 (en) | 2018-08-20 | 2020-11-24 | Ucl Business Ltd | Factor IX encoding nucleotides |
| WO2020239964A1 (en) | 2019-05-28 | 2020-12-03 | Ospedale San Raffaele S.R.L. | Agents and methods for treating viral infections |
| WO2020252136A1 (en) * | 2019-06-11 | 2020-12-17 | Shire Human Genetic Therapies, Inc. | Adeno associated viral vector delivery of antibodies for the treatment of disease mediated dysregulated plasma kallikrein |
| GB202018657D0 (en) | 2020-11-26 | 2021-01-13 | Ospedale San Raffaele Srl | Agents and methods for increasing liver immune response |
| WO2021081280A1 (en) | 2019-10-23 | 2021-04-29 | Shire Human Genetic Therapies, Inc. | Adeno-associated virus vectors based gene therapy for hereditary angioedema |
| WO2021128692A1 (en) * | 2019-12-25 | 2021-07-01 | Brainvta (Wuhan) Co., Ltd | Liver-specific promoter and application thereof |
| WO2021084277A3 (en) * | 2019-11-01 | 2021-07-22 | Freeline Therapeutics Limited | Transcription regulatory elements |
| US20220009981A1 (en) * | 2018-11-19 | 2022-01-13 | Synpromics Limited | Liver-specific regulatory nucleic acid sequences |
| US11306329B2 (en) | 2018-02-19 | 2022-04-19 | City Of Hope | Adeno-associated virus compositions for restoring F8 gene function and methods of use thereof |
| US20220389450A1 (en) * | 2021-05-12 | 2022-12-08 | Fondazione Telethon | Vector system |
| WO2023006890A1 (en) | 2021-07-28 | 2023-02-02 | Vrije Universiteit Brussel | Improving the efficacy of muscle-targeted gene therapy |
| US11952585B2 (en) | 2020-01-13 | 2024-04-09 | Homology Medicines, Inc. | Methods of treating phenylketonuria |
| US12076420B2 (en) | 2020-05-27 | 2024-09-03 | Homology Medicines, Inc. | Adeno-associated virus compositions for restoring PAH gene function and methods of use thereof |
| US12091675B2 (en) | 2018-07-16 | 2024-09-17 | Takeda Pharmaceutical Company Limited | Gene therapy of hemophilia a using viral vectors encoding recombinant FVIII variants with increased expression |
| WO2025008774A1 (en) * | 2023-07-05 | 2025-01-09 | Takeda Pharmaceutical Company Limited | Viral vectors encoding recombinant fviii variants with increased expression for gene therapy of hemophilia a |
| US12203094B2 (en) | 2018-02-01 | 2025-01-21 | Homology Medicines, Inc. | Adeno-associated virus compositions for restoring PAH gene function and methods of use thereof |
| US12209262B2 (en) | 2018-08-20 | 2025-01-28 | Ucl Business Ltd | Factor IX encoding nucleotides |
| USRE50283E1 (en) | 2013-04-18 | 2025-01-28 | Fondazione Telethon Ets | Effective delivery of large genes by dual AAV vectors |
| EP4288549A4 (en) * | 2021-03-05 | 2025-06-25 | Joint Stock Company "Biocad" | Codon-optimized nucleic acid encoding the fix protein |
| EP4408997A4 (en) * | 2020-10-01 | 2025-11-19 | Oisin Biotechnologies Inc | COMPOSITIONS AND PROCESSES FOR THE SPECIFIC EXPRESSION OF FOLLISTATIN IN THE LIVER |
| EP4402267A4 (en) * | 2021-09-16 | 2025-11-26 | Generation Bio Co | Liver-specific expression cassettes, vectors, and their uses for expressing therapeutic proteins |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PT3313991T (pt) | 2015-06-23 | 2024-09-27 | Childrens Hospital Philadelphia | Fator ix modificado e composições, métodos e utilizações para transferência de genes para células, órgãos e tecidos |
| GB2611929B (en) | 2018-10-16 | 2023-11-22 | Blueallele Corp | Methods for targeted insertion of DNA in genes |
| US20210369870A1 (en) * | 2018-11-16 | 2021-12-02 | Encoded Therapeutics, Inc. | Compositions and methods for treating wilson's disease |
| WO2022012758A1 (en) * | 2020-07-17 | 2022-01-20 | Probiogen Ag | Hyperactive transposons and transposases |
| KR20230066615A (ko) * | 2020-09-16 | 2023-05-16 | 제너레이션 바이오 컴퍼니 | 폐쇄형 dna 벡터 및 페닐알라닌 히드록실라아제(pah) 발현을 위한 이의 용도 |
| CN112608921B (zh) * | 2020-12-23 | 2022-04-08 | 武汉枢密脑科学技术有限公司 | 用于肝脏中蛋白质表达的重组启动子、载体及其应用 |
| KR20230166039A (ko) | 2022-05-27 | 2023-12-06 | 주식회사 엔세이지 | 항응고인자 9 분비 유도만능줄기세포를 이용한 b형 혈우병 치료제 개발 |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001098482A2 (en) * | 2000-06-20 | 2001-12-27 | Board Of Trustees Of The Leland Stanford Junior University | Liver-specific gene expression cassettes, and methods of use |
| WO2007149852A2 (en) * | 2006-06-19 | 2007-12-27 | Asklepios Biopharmaceutical, Inc. | Modified factor viii and factor ix genes and vectors for gene therapy |
| WO2009130208A1 (en) | 2008-04-22 | 2009-10-29 | Vib Vzw | Liver-specific nucleic acid regulatory elements and methods and use thereof |
| WO2011005968A1 (en) * | 2009-07-08 | 2011-01-13 | Ucl Business Plc | Codon-optimized factor vi i i variants and synthetic liver-specific promoter |
| WO2014064277A1 (en) | 2012-10-26 | 2014-05-01 | Vrije Universiteit Brussel | Vector for liver-directed gene therapy of hemophilia and methods and use thereof |
| WO2014063753A1 (en) * | 2012-10-26 | 2014-05-01 | Vrije Universiteit Brussel | Hyper-active factor ix vectors for liver-directed gene therapy of hemophilia 'b' and methods and use thereof |
| US20150071883A1 (en) * | 2013-09-12 | 2015-03-12 | Biomarin Pharmaceutical Inc. | Adeno-Associated Virus Factor VIII Vectors |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8071740B2 (en) * | 2000-11-17 | 2011-12-06 | Vascular Biogenics Ltd. | Promoters exhibiting endothelial cell specificity and methods of using same for regulation of angiogenesis |
| WO2004083418A1 (en) * | 2003-03-17 | 2004-09-30 | Merck & Co., Inc. | Adenovirus serotype 24 vectors, nucleic acids and virus produced thereby |
| US8008468B2 (en) * | 2005-02-16 | 2011-08-30 | Benitec, Inc. | RNAi expression constructs with liver-specific enhancer/promoter |
| AR059371A1 (es) * | 2006-02-08 | 2008-03-26 | Genzyme Corp | Terapia genica para la enfermedad de niemann-pick tipo a |
| US8129510B2 (en) * | 2006-03-30 | 2012-03-06 | The Board Of Trustees Of The Leland Stanford Junior University | Minigene expression cassette |
-
2016
- 2016-03-17 JP JP2017549256A patent/JP6879486B2/ja active Active
- 2016-03-17 WO PCT/EP2016/055825 patent/WO2016146757A1/en not_active Ceased
- 2016-03-17 DK DK16713774.4T patent/DK3270944T3/da active
- 2016-03-17 CA CA2979495A patent/CA2979495A1/en active Pending
- 2016-03-17 EP EP16713774.4A patent/EP3270944B1/en active Active
- 2016-03-17 US US15/558,725 patent/US11007280B2/en active Active
- 2016-03-17 ES ES16713774T patent/ES2764453T3/es active Active
- 2016-03-17 AU AU2016232146A patent/AU2016232146B2/en not_active Ceased
-
2021
- 2021-04-26 US US17/240,845 patent/US20210369868A1/en not_active Abandoned
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001098482A2 (en) * | 2000-06-20 | 2001-12-27 | Board Of Trustees Of The Leland Stanford Junior University | Liver-specific gene expression cassettes, and methods of use |
| WO2007149852A2 (en) * | 2006-06-19 | 2007-12-27 | Asklepios Biopharmaceutical, Inc. | Modified factor viii and factor ix genes and vectors for gene therapy |
| WO2009130208A1 (en) | 2008-04-22 | 2009-10-29 | Vib Vzw | Liver-specific nucleic acid regulatory elements and methods and use thereof |
| WO2011005968A1 (en) * | 2009-07-08 | 2011-01-13 | Ucl Business Plc | Codon-optimized factor vi i i variants and synthetic liver-specific promoter |
| WO2014064277A1 (en) | 2012-10-26 | 2014-05-01 | Vrije Universiteit Brussel | Vector for liver-directed gene therapy of hemophilia and methods and use thereof |
| WO2014063753A1 (en) * | 2012-10-26 | 2014-05-01 | Vrije Universiteit Brussel | Hyper-active factor ix vectors for liver-directed gene therapy of hemophilia 'b' and methods and use thereof |
| US20150071883A1 (en) * | 2013-09-12 | 2015-03-12 | Biomarin Pharmaceutical Inc. | Adeno-Associated Virus Factor VIII Vectors |
Non-Patent Citations (100)
| Title |
|---|
| ALTSCHUL ET AL., J MOL BIOL, vol. 215, 1990, pages 403 - 10 |
| ANNONI A; BROWN BD; CANTORE A; SERGI LS; NALDINI L; RONCAROLO MG: "In vivo delivery of a microRNA-regulated transgene induces antigen-specific regulatory T cells and promotes immunologic tolerance", BLOOD, vol. 114, 2009, pages 5152 - 5161 |
| ARRUDA VR; STEDMAN HH; HAURIGOT V; BUCHLIS G: "Peripheral transvenular delivery of adeno-associated viral vectors to skeletal muscle as a novel therapy for hemophilia B", BLOOD, vol. 115, 2010, pages 4678 - 4688 |
| AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1999, JOHN WILEY & SONS |
| AXELROD JH; READ MS; BRINKHOUS KM; VERMA IM: "Phenotypic correction of factor IX deficiency in skin fibroblasts of hemophilic dogs", PROC NATL ACAD SCI USA, vol. 87, 1990, pages 5173 - 5177 |
| BAINBRIDGE J; SMITH AJ; BARKER S ET AL.: "Effect of Gene Therapy on Visual Function in Leber's Congenital Amaurosis", N ENGL J MED., vol. 358, 2008, pages 2231 - 2239 |
| BROWN BD; CANTORE A; ANNONI A; SERGI LS; LOMBARDO A; DELLA VALLE P; D'ANGELO A; NALDINI L: "A microRNA-regulated lentiviral vector mediates stable correction of hemophilia B mice", BLOOD, vol. 110, 2007, pages 4144 - 4152 |
| BROWN BD; SHI CX; POWELL S; HURLBUT D; GRAHAM FL; LILLICRAP D: "Helper-dependent adenoviral vectors mediate therapeutic factor VIII expression for several months with minimal accompanying toxicity in a canine model of severe hemophilia A", BLOOD, vol. 103, 2004, pages 804 - 810 |
| BRUNETTI-PIERRI N; GROVE NC; ZUO Y; EDWARDS R; PALMER D; CERULLO V; TERUYA J: "Ng P.Bioengineered factor IX molecules with increased catalytic activity improve the therapeutic index of gene therapy vectors for hemophilia B", HUM GENE THER., vol. 20, no. 5, May 2009 (2009-05-01), pages 479 - 485 |
| BUCHLIS G; PODSAKOFF GM; RADU A; HAWK SM; FLAKE AW; MINGOZZI F; HIGH KA: "Factor IX expression in skeletal muscle of a severe hemophilia B patient 10 years after AAV-mediated gene transfer", BLOOD, vol. 119, 2012, pages 3038 - 3041 |
| BUDKER V; ZHANG G; KNECHTLE S; WOLFF JA: "Naked DNA delivered intraportally expresses efficiently in hepatocytes", GENE THER., vol. 3, no. 7, July 1996 (1996-07-01), pages 593 - 598 |
| CANTORE A; NAIR N; DELLA VALLE P; DI MATTEO M; MATRAI J; SANVITO F; BROMBIN C; DI SERIO C; D'ANGELO A; CHUAH M: "Hyper-functional coagulation factor IX improves the efficacy of gene therapy in hemophilic mice", BLOOD, 4 October 2012 (2012-10-04) |
| CHANG, J.; JIN, J.; LOLLAR, P.; BODE, W.; BRANDSTETTER, H.; HAMAGUCHI, N.; STRAIGHT, D. L.; STAFFORD, D. W.: "Changing residue 338 in human factor IX from arginine to alanine causes an increase in catalytic activity", J BIOL CHEM, vol. 273, no. 20, 1998, pages 12089 - 12094 |
| CHOWDHURY JR; GROSSMAN M; GUPTA S; CHOWDHURY NR; BAKER JR JR; WILSON JM: "Long-term improvement of hypercholesterolemia after ex vivo gene therapy in LDLR-deficient rabbits", SCIENCE, vol. 254, no. 5039, 20 December 1991 (1991-12-20), pages 1802 - 1805 |
| CHUAH MK; NAIR N; VANDENDRIESSCHE T: "Recent progress in gene therapy for hemophilia.", HUM GENE THER., vol. 23, no. 6, pages 557 - 565 |
| CHUAH MK; SCHIEDNER G; THORREZ L; BROWN B; JOHNSTON M; GILLIJNS V; HERTEL S; VAN ROOIJEN N; LILLICRAP D; COLLEN D: "Therapeutic factor VIII levels and negligible toxicity in mouse and dog models of hemophilia A following gene therapy with high-capacity adenoviral vectors", BLOOD, vol. 101, 2003, pages 1734 - 1743 |
| CHUAH MK; VANDENDRIESSCHE T: "Platelet-directed gene therapy overcomes inhibitory antibodies to factor VIII", J THROMB HAEMOST., vol. 10, no. 8, August 2012 (2012-08-01), pages 1566 - 1569 |
| DATABASE Geneseq [online] 21 February 2008 (2008-02-21), "Transthyretin promoter (TTR) DNA, SEQ ID: 3.", XP002744828, retrieved from EBI accession no. GSN:AOG17642 Database accession no. AOG17642 * |
| DOBRZYNSKI E; FITZGERALD JC; CAO 0; MINGOZZI F; WANG L; HERZOG RW: "Prevention of cytotoxic T lymphocyte responses to factor IX-expressing hepatocytes by gene transfer-induced regulatory T cells", PROC NATL ACAD SCI USA, vol. 103, 2006, pages 4592 - 4597 |
| DONSANTE A; MILLER DG; LI Y; VOGLER C; BRUNT EM; RUSSELL DW; SANDS MS: "AAV vector integration sites in mouse hepatocellular carcinoma", SCIENCE, vol. 317, 2007, pages 477 |
| EHRHARDT A; KAY MA: "A new adenoviral helper-dependent vector results in long-term therapeutic levels of human coagulation factor IX at low doses in vivo", BLOOD, vol. 99, 2002, pages 3923 - 3930 |
| FIELDS PA; ARRUDA VR; ARMSTRONG E; KIRK CHU; MINGOZZI, F; HAGSTROM, J.; HERZOG R; HIGH KA: "Risk and prevention of anti-factor IX formation in AAV-mediated gene transfer in the context of a large deletion of F9", MOL. THER., vol. 4, 2001, pages 201 - 210 |
| FOLLENZI A; BATTAGLIA M; LOMBARDO A; ANNONI A; RONCAROLO MG; NALDINI L: "Targeting lentiviral vector expression to hepatocytes limits transgene-specific immune response and establishes long-term expression of human antihemophilic factor IX in mice", BLOOD, vol. 103, 2004, pages 3700 - 3709 |
| GAO G; VANDENBERGH LH; ALVIRA MR; LU Y; CALCEDO R; ZHOU X; WILSON JM: "Clades of Adeno- associated viruses are widely disseminated in human tissues", J. VIRO, vol. 178, 2004, pages 6381 - 6388 |
| GAO GP; ALVIRA MR; WANG L; JOHNSTON J; WILSON JM: "Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy", PROC NATL ACAD SCI USA, vol. 99, 2002, pages 11854 - 11859 |
| HERZOG RW; FIELDS PA; ARRUDA VR; BRUBAKER JO; ARMSTRONG E; MCCLINTOCK D; BELLINGER DA; COUTO LB; NICHOLS TC, HIGH KA: "Influence of vector dose on factor IX-specific T and B cell responses in muscle- directed gene therapy", HUM GENE THER, vol. 13, 2002, pages 1281 - 1291 |
| HERZOG RW; HAGSTROM JN; KUNG SH; TAI SJ; WILSON JM; FISHER KJ; HIGH KA: "Stable gene transfer and expression of human blood coagulation factor IX after intramuscular injection of recombinant adeno-associated virus", PROC NATL ACAD SCI USA., vol. 94, 1997, pages 5804 - 5809 |
| HERZOG RW; MOUNT JD; ARRUDA VR; HIGH KA; LOTHROP CD JR.: "Muscle-directed gene transfer and transient immune suppression result in sustained partial correction of canine hemophilia B caused by a null mutation", MOL THER., vol. 4, 2001, pages 192 - 200 |
| HERZOG RW; YANG EY; COUTO LB; HAGSTROM JN; ELWELL D; FIELDS PA; BURTON M; BELLINGER DA; READ MS; BRINKHOUS KM: "Long-term correction of canine hemophilia B by gene transfer of blood coagulation factor IX mediated by adeno-associated viral vector", NAT MED., vol. 5, 1999, pages 56 - 63 |
| HIGH KA: "Gene therapy for hemophilia: a long and winding road", J THROMB HAEMOST., vol. 9, no. 1, 2011, pages 2 - 11 |
| HIGH KA: "Gene Transfer as an approach to treating Hemophilia", CIRC RES., vol. 88, 2001, pages 137 - 144 |
| HUM GENE THER., vol. 23, no. 6, June 2012 (2012-06-01), pages 557 - 565 |
| JIANG H; LILLICRAP D; PATARROYO-WHITE S: "Multiyear therapeutic benefit of AAV serotypes 2, 6, and 8 delivering factor VIII to hemophilia A mice and dogs", BLOOD, vol. 108, 2006, pages 107 - 115 |
| KAO, C. Y.; LIN, C. N.; YU, . S.; TAO, M. H.; WU, H. L.; SHI, G. Y.; YANG, Y. L.; KAO, J. T.; LN, S. W.: "FIX-Triple, a gain-of-function factor IX variant, improves haemostasis in mouse models without increased risk of thrombosis", THROMB HAEMOST, vol. 104, no. 2, 2010, pages 355 - 365 |
| KAY MA; BALEY P; ROTHENBERG S; LELAND F; FLEMING L; PONDER KP; LIU T; FINEGOLD M; DARLINGTON G; POKORNY W: "Expression of human alpha 1 -antitrypsin in dogs after autologous transplantation of retroviral transduced hepatocytes", PROC NATL ACAD SCI USA., vol. 89, no. 1, 1 January 1992 (1992-01-01), pages 89 - 93 |
| KAY MA; MANNO CS; RAGNI MV; COUTO LB; MCCLELLAND A; GLADER B; CHEW AJ; TAI SJ; HERZOG RW; ARRUDA V: "Evidence for gene transfer and expression of factor IX in hemophilia B patients treated with an AAV vector", NAT GENET., vol. 24, 2000, pages 257 - 261 |
| KISTNER A; GOSSEN M; ZIMMERMANN F; JERECIC J; ULLMER C; LYBBERT H; BUJARD H: "Doxycycline- mediated quantitative and tissue-specific control of gene expression in transgenic mice", PROC NATL ACAD SCI USA., vol. 93, no. 20, 1 October 1996 (1996-10-01), pages 10933 - 10938 |
| KREN BT; UNGER GM; SJEKLOCHA L; TROSSEN AA; KORMAN V; DIETHELEM-OKITA BM; REDING MT; STEER CJ: "Nanocapsule-delivered Sleeping Beauty mediates therapeutic Factor VIII expression in liver sinusoidal endothelial cells of hemophilia A mice", J CLIN INVEST., vol. 19, 2009, pages 2086 - 2099 |
| KURIYAMA S; YOSHIKAWA M; ISHIZAKA S; TSUJII T; LKENAKA K; KAGAWA T; MORITA N; MIKOSHIBA K: "A potential approach for gene therapy targeting hepatoma using a liver-specific promoter on a retroviral vector", CELL STRUCT FUNCT., vol. 16, no. 6, pages 503 - 510 |
| LEVITT ET AL., GENES DEV, vol. 3, 1989, pages 1019 - 1025 |
| LI H; MALANI N; HAMILTON SR; SCHLACHTERMAN A; BUSSADORI G; EDMONSON SE; SHAH R; ARRUDA VR; MINGOZZI F; WRIGHT JF: "Assessing the potential for AAV vector genotoxicity in a murine model", BLOOD, vol. 117, 2011, pages 3311 - 3319 |
| LIN, C. N.; KAO, C. Y.; MIAO, C. H.; HAMAGUCHI, N.; WU, H. L.; SHI, G. Y.; LIU, Y. L.; HIGH, K. A.; LN, S. W.: "Generation of a novel factor IX with augmented clotting activities in vitro and in vivo", J THROMB HAEMOST, vol. 8, no. 8, 2010, pages 1773 - 1783 |
| LIU F; SONG Y; LIU D: "Hydrodynamics-based transfection in animals by systemic administration of plasmid DNA", GENE THER., vol. 6, no. 7, July 1999 (1999-07-01), pages 1258 - 1266 |
| MANNO CS; PIERCE GF; ARRUDA VR: "Successful transduction of liver in hemophilia by AAV-Factor IX and limitations imposed by the host immune response", NAT MED., vol. 12, 2006, pages 342 - 347 |
| MARIO DI MATTEO ET AL: "Hyperactive PiggyBac Transposons for Sustained and Robust Liver-targeted Gene Therapy", MOLECULAR THERAPY, vol. 22, no. 9, 18 July 2014 (2014-07-18), GB, pages 1614 - 1624, XP055276555, ISSN: 1525-0016, DOI: 10.1038/mt.2014.131 * |
| MATES L; CHUAH MK; BELAY E; JERCHOW B; MANOJ N; ACOSTA-SANCHEZ A; GRZELA DP; SCHMITT A; BECKER K; MATRAI J: "Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates", NAT GENET., vol. 41, 2009, pages 753 - 761 |
| MATRAI J; CANTORE A; BARTHOLOMAE CC; ANNONI A; WANG W; ACOSTA-SANCHEZ A; SAMARA-KUKO E; DE WAELE L; MA L; GENOVESE P: "Hepatocyte-targeted expression by integrase-defective lentiviral vectors induces antigen-specific tolerance in mice with low genotoxic risk", HEPATOLOGY, vol. 53, 2011, pages 1696 - 1707 |
| MATRAI J; CHUAH MK; VANDENDRIESSCHE T: "Pre clinical and clinical progress in hemophilia gene therapy", CURR OPIN HEMATOL., vol. 17, 2010, pages 387 - 392 |
| MATRAI J; CHUAH MK; VANDENDRIESSCHE T: "Recent advances in lentiviral vector development and applications", MOL THER., vol. 18, 2010, pages 477 - 490 |
| MATSUI H; HEGADORN C; OZELO M; BURNETT E; TUTTLE A; LABELLE A; MCCARY PB JR.; NALDINI L; BROWN B; HOUGH C: "A microRNA-regulated and GP64-pseudotyped lentiviral vector mediates stable expression of FVIII in a murine model of Hemophilia A", MOL THER., vol. 19, 2011, pages 723 - 730 |
| MATSUI H; SHIBATA M; BROWN B; LABELLE A; HEGADRON C; ANDREWS C; CHUAH M; VANDENDRIESSCHE T; MIAO CH; HOUGH C: "A murine model for induction of long-term immunologic tolerance to factor VIII does not require persistent detectable levels of plasma factor VIII and involves contributions from Foxp3+ T regulatory cells", BLOOD, vol. 114, 2009, pages 677 - 685 |
| MCCARTY DM; FU H; MONAHAN PE; TOULSON CE; NAIK P; SAMULSKI RJ: "Adeno-associated virus terminal repeat (TR) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo", GENE THER., vol. 10, 2003, pages 2112 - 2118 |
| MCCARTY DM; MONAHAN PE; SAMULSKI RJ: "Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis", GENE THER., vol. 8, 2001, pages 1248 - 1254 |
| MCINTOSH, J. ET AL.: "Therapeutic levels of FVIII following a single peripheral vein administration of rAAV vector encoding a novel human factor VIII variant", BLOOD, 2013 |
| MIAO C H ET AL: "INCLUSION OF THE HEPATIC LOCUS CONTROL REGION, AN INTRON, AND UNTRANSLATED REGION INCREASES AND STABILIZES HEPATIC FACTOR IX GENEEXPRESSION IN VIVO BUT NOT IN VITRO", MOLECULAR THERAPY, NATURE PUBLISHING GROUP, GB, vol. 1, no. 6, 1 June 2000 (2000-06-01), pages 522 - 532, XP001063991, ISSN: 1525-0016, DOI: 10.1006/MTHE.2000.0075 * |
| MIAO CH; OHASHI K; PATIJN GA; MEUSE L; YE X; THOMPSON AR; KAY MA: "Inclusion of the hepatic locus control region, an intron, and untranslated region increases and stabilizes hepatic factor IX gene expression in vivo but not in vitro", MOL THER., vol. 1, 2000, pages 522 - 532 |
| MIAO H.Z.; SIRACHAINAN N.; PALMER L. ET AL.: "Bioengineering of coagulation factor VIII for improved secretion", BLOOD, vol. 103, no. 9, 2004, pages 3412 - 3419 |
| MILANOV ET AL.: "Engineered factor IX variants bypass FVIII and correct hemophilia A phenotype in mice", BLOOD, vol. 119, 2012, pages 602 - 611 |
| MILLER AD: "Hum Gene Ther.", vol. 1, 1990, SPRING, article "Retrovirus packaging cells", pages: 5 - 14 |
| MINGOZZI F; LIU YL; DOBRZYNSKI E; KAUFHOLD A; LIU JH; WANG Y; ARRUDA VR; HIGH KA; HERZOG RW: "Induction of immune tolerance to coagulation factor IX antigen by in vivo hepatic gene transfer", J CLIN INVEST., vol. 111, 2003, pages 1347 - 1356 |
| MINGOZZI F; MAUS MV; HUI DJ; SABATINO DE; MURPHY SL; RASKO JE; RAGINI MV; MANNO CS; SOMMER J; JIANG H: "CD8(+) T-cell responses to adeno-associated virus capsid in humans", NAT MED., vol. 13, 2007, pages 419 - 422 |
| MOUNT JD; HERZOG RW; TILLSON DM; GOODMAN SA; ROBINSON N; MCCLELAND ML; BELLINGER D; NICHOLS TC; ARRUDA VR; LOTHROP CD JR: "Sustained phenotypic correction of hemophilia B dogs with a factor IX null mutation by liver-directed gene therapy", BLOOD, vol. 99, 2002, pages 2670 - 2676 |
| NAIR ET AL., BLOOD, 2014 |
| NAIR N; RINCON MY; EVENS H; SARCAR S; DASTIDAR S; SAMARA-KUKO E; GHANDEHARIAN 0; MAN VIECELLI H; THONY B; DE BLESER P: "Computationally designed liver-specific transcriptional modules and hyperactive factor IX improve hepatic gene therapy", BLOOD, vol. 123, 2014, pages 3195 - 3199 |
| NALDINI L; BLOMER U; GALLAY P; ORY D; MULLIGAN R; GAGE FH; VERMA IM; TRONO D: "In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector", SCIENCE, vol. 272, no. 5259, 12 April 1996 (1996-04-12), pages 263 - 267 |
| NATHWANI AC; DAVIDOFF AM; HANAWA H; YUNYU HU; HOFFER FA; NIKANOROV A; SLAUGHTER C; NG CYC; ZHOU J; LOZIER J: "Sustained high- level expression of human factor IX (hFIX) after liver-targeted delivery of recombinant adeno-associated virus encoding the hFIX gene in rhesus macaques", BLOOD, vol. 100, 2002, pages 1662 - 1669 |
| NATHWANI AC; GRAY JT; NG CY; ZHOU J; SPENCE Y; WADDINGTON SN; TUDDENHAM EG; KEMBALL COOK G; MCINTOSH J; BOON-SPIJKER M: "Self-complementary adeno-associated virus vectors containing a novel liver-specific human factor IX expression cassette enable highly efficient transduction of murine and nonhuman primate liver", BLOOD, vol. 107, 2006, pages 2653 - 2661 |
| NATHWANI AC; TUDDENHAM EG; RANGARAJAN S; ROSALES C; MCINTOSH J; LINCH DC; CHOWDARY P; RIDDELL A; PIE AJ; HARRINGTON C: "Adenovirus-associated virus vector-mediated gene transfer in hemophilia B", N ENGL J MED., vol. 365, 2011, pages 2357 - 2365 |
| OHLFEST JR; FRANDSEN JL; FRITZ S; LOBITZ PD; PERKINSON SG; CLARK KJ; NELSESTUEN G; KEY NS; MCLVOR RS; HACKETT PB: "Phenotypic correction and long-term expression of factor VIII in hemophilic mice by immunotolerization and nonviral gene transfer using the Sleeping Beauty transposon system", BLOOD, vol. 105, 2004, pages 2691 - 2698 |
| PETRUS, I.; CHUAH, M.; VANDENDRIESSCHE, T.: "Gene therapy strategies for hemophilia: benefits versus risks", J GENE MED, vol. 12, 2010, pages 797 - 809 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR PRESS |
| SANDBERG H; ALMSTEDT A; BRANDT J ET AL.: "Structural and functional characteristics of the B domain-deleted recombinant factor VIII proteint, r-VIII SQ", THROMB HAEMOST., vol. 85, no. 1, 2001, pages 93 - 100 |
| SCHUETTRUMPF, J.; HERZOG, R. W.; SCHLACHTERMAN, A.; KAUFHOLD, A.; STAFFORD, D. W.; ARRUDA, V. R.: "Factor IX variants improve gene therapy efficacy for hemophilia B", BLOOD, vol. 105, no. 6, 2005, pages 2316 - 2323 |
| SIMIONI, P.; TORMENE, D.; TOGNIN, G.; GAVASSO, S.; BULATO, C.; IACOBELLI, N. P.; FINN, J. D.; SPIEZIA, L.; RADU, C.; ARRUDA, V. R.: "X-linked thrombophilia with a mutant factor IX (factor IX Padua", N ENGL J MED, vol. 361, no. 17, 2009, pages 1671 - 1675 |
| SNYDER RO; MIAO C; MEUSE L; TUBB J; DONAHUE BA; HUI-FENG LIN; STAFFORD DW; PATEL S; THOMPSON AR; NICHOLS T: "Correction of hemophilia B in canine and murine models using recombinant adeno- associated viral vectors", NAT MED., vol. 5, 1999, pages 64 - 70 |
| SNYDER RO; MIAO CH; PATIJN GA; SPRATT SK; DANOS 0; NAGY D; GOWN AM; WINTHER B; MEUSE L; COHEN LK: "Persistent and therapeutic concentrations of human factor IX in mice after hepatic gene transfer of recombinant AAV vectors", NAT GENET., vol. 16, 1997, pages 270 - 276 |
| TATUSOVA; MADDEN, FEMS MICROBIOL LETT, vol. 174, 1999, pages 247 - 250 |
| TRAPNELL BC: "Adenoviral vectors for gene transfer", ADV. DRUG DEL. REV., vol. 12, 1993, pages 185 - 199 |
| VANDENBERGHE LH; WANG L; SOMANATHAN S; ZHI Y; FIGUEREDO J; CALCEDO R; SANMIGUEL J; DESAI RA; CHEN CS; JOHNSTON J: "Heparin binding directs activation of T cells against adeno-associated virus serotype 2 capsid", NAT MED., vol. 12, 2006, pages 967 - 971 |
| VANDENDRIESSCHE ET AL., J. THROMB. HAEMOST., vol. 5, 2007, pages 16 - 24 |
| VANDENDRIESSCHE T; CHUAH MK: "Clinical progress in gene therapy: sustained partial correction of the bleeding disorder in patients suffering from severe hemophilia B", HUM GENE THER., vol. 23, 2012, pages 4 - 6 |
| VANDENDRIESSCHE T; IVICS Z; IZSVAK Z; CHUAH MK: "Emerging potential of transposons for gene therapy and generation of induced pluripotent stem cells", BLOOD, vol. 114, 2009, pages 1461 - 1468 |
| VANDENDRIESSCHE T; THORREZ L; ACOSTA-SANCHEZ A; PETRUS; WANG L; MA L; DE WAELE L; IWASAKI Y; GILLIJNS V; WILSON JM: "Efficacy and safety of adeno-associated viral vectors based on serotype 8 and 9 vs. lentiviral vectors for hemophilia B gene therapy", J THROMB HAEMOST., vol. 5, 2007, pages 16 - 24 |
| VANDENDRIESSCHE T; THORREZ L; NALDINI L; FOLLENZI A; MOONS L; ZWI BERNEMAN; COLLEN D; CHUAH MK: "Lentiviral vectors containing the human immunodeficiency virus type-1 central polypurine tract can efficiently transduce nondividing hepatocytes and antigen-presenting cells in vivo", BLOOD, vol. 100, 2002, pages 813 - 822 |
| VANDENDRIESSCHE T; VANSLEMBROUCK V; GOOVAERTS; ZWINNEN H; VANDERHAEGHEN ML; COLLEN D; CHUAH MK: "Long-term expression of human coagulation factor VIII and correction of hemophilia A after in vivo retroviral gene transfer in factor Vl l l-deficient mice", PROC NATL ACAD SCI USA., vol. 96, 1999, pages 10379 - 10384 |
| WANG L; CAO 0; SWALM B; DOBRZYNSKI E; MINGOZZI F; HERZOG RW: "Major role of local immune responses in antibody formation to factor IX in AAV gene transfer", GENE THER, vol. 12, 2005, pages 1453 - 1464 |
| WANG L; NICHOLS TC; READ MS; BELLINGER DA; VERMA IM: "Sustained expression of therapeutic level of factor IX in hemophilia B dogs by AAV-mediated gene therapy in liver", MOL THER., vol. 1, 2000, pages 154 - 158 |
| WANG L; TAKABE K; BIDLINGMAIER SM; ILL CR; VERMA IM: "Sustained correction of bleeding disorder in hemophilia B mice by gene therapy", PROC NATL ACAD SCI USA, vol. 96, 1999, pages 3906 - 3910 |
| WARD NJ; BUCKLEY SM; WADDINGTON SN; VANDENDRIESSCHE T; CHUAH MK; NATHWANI AC; MCLNTOSH J; TUDDENHAM EG; KINNON C; THRASHER AJ: "Codon optimization of human factor VIII cDNAs leads to high-level expression", BLOOD, vol. 117, 2010, pages 798 - 807 |
| WARD, N.J. ET AL.: "Codon optimization of human factor VIII cDNAs leads to high-level expression", BLOOD, vol. 117, 2011, pages 798 - 807 |
| WU Z; SUN J; ZHANG T; YIN C; YIN F; VAN DYKE T; SAMULSKI RJ; MONAHAN PE: "Optimization of self-complementary AAV vectors for liver-directed expression results in sustained correction of hemophilia B at low vector dose", MOL THER., vol. 16, 2008, pages 280 - 289 |
| XU L; GAO C; SANDS MS: "Neonatal or hepatocyte growth factor-potentiated adult gene therapy with a retroviral vector results in therapeutic levels of canine factor IX for hemophilia B", BLOOD, vol. 101, 2003, pages 3924 - 3932 |
| XU L; NICHOLS TC; SARKAR R; MC CORQUODALE S; BELLINGER DA; PONDER KP: "Absence of a desmopressin response after therapeutic expression of factor VIII in hemophilia A dogs with liver-directed neonatal gene therapy", PROC NATL ACAD SCI USA, vol. 102, 2005, pages 6080 - 6085 |
| YAMADA T; IWASAKI Y; TADA H; IWABUKI H; CHUAH MK; VANDENDRIESSCHE T; FUKUDA H; KONDO A; UEDA M; SENO M: "Nanoparticles for the delivery of genes and drugs to human hepatocytes", NAT BIOTECHNOL., vol. 21, no. 8, August 2003 (2003-08-01), pages 885 - 890 |
| YANT SR; MEUSE L; CHIU W; IVICS Z; IZSVAK Z; KAY MA: "Somatic integration and long-term transgene expression in normal and haemophilic mice using a DNA transposon system", NAT GENET., vol. 25, 2000, pages 35 - 41 |
| YUSA ET AL.: "A hyperactive piggyBac transposase for mammalian applications", PROC NATL ACAD SCI U S A., vol. 108, no. 4, 2011, pages 1531 - 1536 |
| ZHANG G; BUDKER V; WOLFF JA: "High levels of foreign gene expression in hepatocytes after tail vein injections of naked plasmid DNA", HUM GENE THER., vol. 10, no. 10, 1 July 1999 (1999-07-01), pages 1735 - 1737 |
| ZHANG RU ET AL: "Optimized human factor IX expression cassettes for hepatic-directed gene therapy of hemophilia B", FRONTIERS OF MEDICINE, HIGHER EDUCATION PRESS, HEIDELBERG, vol. 9, no. 1, 7 February 2015 (2015-02-07), pages 90 - 99, XP035454344, ISSN: 2095-0217, [retrieved on 20150207], DOI: 10.1007/S11684-015-0390-2 * |
| ZHIJIAN WU ET AL: "Optimization of Self-complementary AAV Vectors for Liver-directed Expression Results in Sustained Correction of Hemophilia B at Low Vector Dose", MOLECULAR THERAPY, vol. 16, no. 2, 1 February 2008 (2008-02-01), pages 280 - 289, XP055097643, ISSN: 1525-0016, DOI: 10.1038/sj.mt.6300355 * |
| ZHONG L; LI B; MAH CS; GOVINDASAMY L; AGBANDJE-MCKENNA; COOPER M; HERZOG RW; ZOLOTUKHIN; WARRINGTON JR. KH; WEIGEL-VAN AKEN K: "Next generation of adeno-associated virus 2 vectors: point mutations in tyrosines lead to high-efficiency transduction at lower doses", PROC NATL ACAD SCI USA, vol. 105, 2008, pages 7827 - 7832 |
Cited By (61)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10465180B2 (en) | 2008-09-15 | 2019-11-05 | Uniqure Biopharma B.V. | Factor IX polypeptide mutant, its uses and method for its production |
| US9982248B2 (en) | 2008-09-15 | 2018-05-29 | Uniqure Biopharma B.V. | Factor IX polypeptide mutant, its uses and method for its production |
| USRE50288E1 (en) | 2008-09-15 | 2025-02-04 | Uniqure Biopharma B.V. | Factor IX polypeptide mutant, its uses and a method for its production |
| USRE50283E1 (en) | 2013-04-18 | 2025-01-28 | Fondazione Telethon Ets | Effective delivery of large genes by dual AAV vectors |
| US10413598B2 (en) | 2014-11-12 | 2019-09-17 | Ucl Business Plc | Factor IX gene therapy |
| US11344608B2 (en) | 2014-11-12 | 2022-05-31 | Ucl Business Ltd | Factor IX gene therapy |
| US10189888B2 (en) | 2015-11-13 | 2019-01-29 | Baxalta Incorporated | Viral vectors encoding recombinant FVIII variants with increased expression for gene therapy of hemophilia A |
| US10189889B2 (en) | 2015-11-13 | 2019-01-29 | Baxalta Incorporated | Viral vectors encoding recombinant FVIII variants with increased expression for gene therapy of hemophilia A |
| US11492388B2 (en) | 2015-11-13 | 2022-11-08 | Takeda Pharmaceutical Company Limited | Viral vectors encoding recombinant FVIII variants with increased expression for gene therapy of hemophilia A |
| US11254731B2 (en) | 2015-11-13 | 2022-02-22 | Takeda Pharmaceutical Company Limited | Viral vectors encoding recombinant FVIII variants with increased expression for gene therapy of hemophilia A |
| WO2018178067A1 (en) | 2017-03-27 | 2018-10-04 | Vrije Universiteit Brussel | Diaphragm-specific nucleic acid regulatory elements and methods and use thereof |
| CN111108196A (zh) * | 2017-05-09 | 2020-05-05 | 爱莫里大学 | 凝血因子变体及其用途 |
| WO2018208973A1 (en) * | 2017-05-09 | 2018-11-15 | Emory University | Clotting factor variants and their use |
| US11633504B2 (en) | 2017-05-09 | 2023-04-25 | Emory University | Nucleic acids encoding clotting factor variants and their use |
| CN110945127A (zh) * | 2017-05-22 | 2020-03-31 | 百深公司 | 用于血友病b的基因疗法的编码具有增加的表达的重组fix的病毒载体 |
| JP2020520662A (ja) * | 2017-05-22 | 2020-07-16 | バクスアルタ インコーポレイテッド | 血友病bの遺伝子治療のための、発現の増加を伴う組換えfixをコードするウイルスベクター |
| KR102551733B1 (ko) | 2017-05-22 | 2023-07-06 | 다케다 야쿠힌 고교 가부시키가이샤 | B형 혈우병 유전자 요법을 위한 증가된 발현을 가지는 재조합 fix 변이체를 암호화하는 바이러스 벡터 |
| CN110945127B (zh) * | 2017-05-22 | 2024-07-12 | 武田药品工业株式会社 | 用于血友病b的基因疗法的编码具有增加的表达的重组fix的病毒载体 |
| KR20200010443A (ko) * | 2017-05-22 | 2020-01-30 | 박스알타 인코퍼레이티드 | B형 혈우병 유전자 요법을 위한 증가된 발현을 가지는 재조합 fix 변이체를 암호화하는 바이러스 벡터 |
| WO2018217731A1 (en) | 2017-05-22 | 2018-11-29 | Baxalta Incorporated | Viral vectors encoding recombinant fix with increased expression for gene therapy of hemophilia b |
| KR20220050238A (ko) * | 2017-05-22 | 2022-04-22 | 다케다 야쿠힌 고교 가부시키가이샤 | B형 혈우병 유전자 요법을 위한 증가된 발현을 가지는 재조합 fix 변이체를 암호화하는 바이러스 벡터 |
| US10842853B2 (en) | 2017-05-22 | 2020-11-24 | Baxalta Incorporated | Viral vectors encoding recombinant fix with increased expression for gene therapy of hemophilia B |
| KR102386890B1 (ko) | 2017-05-22 | 2022-04-15 | 다케다 야쿠힌 고교 가부시키가이샤 | B형 혈우병 유전자 요법을 위한 증가된 발현을 가지는 재조합 fix 변이체를 암호화하는 바이러스 벡터 |
| JP2023123836A (ja) * | 2017-07-10 | 2023-09-05 | ユニキュアー アイピー ビー.ブイ. | ヒトにおけるaav遺伝子療法のための手段及び方法 |
| JP2020526203A (ja) * | 2017-07-10 | 2020-08-31 | ユニキュアー アイピー ビー.ブイ. | ヒトにおけるaav遺伝子療法のための手段及び方法 |
| US10610606B2 (en) | 2018-02-01 | 2020-04-07 | Homology Medicines, Inc. | Adeno-associated virus compositions for PAH gene transfer and methods of use thereof |
| US12203094B2 (en) | 2018-02-01 | 2025-01-21 | Homology Medicines, Inc. | Adeno-associated virus compositions for restoring PAH gene function and methods of use thereof |
| US12064486B2 (en) | 2018-02-01 | 2024-08-20 | Homology Medicines, Inc. | Adeno-associated virus compositions for PAH gene transfer and methods of use thereof |
| US11951183B2 (en) | 2018-02-01 | 2024-04-09 | Homology Medicines, Inc. | Adeno-associated virus compositions for PAH gene transfer and methods of use thereof |
| US11306329B2 (en) | 2018-02-19 | 2022-04-19 | City Of Hope | Adeno-associated virus compositions for restoring F8 gene function and methods of use thereof |
| US12091675B2 (en) | 2018-07-16 | 2024-09-17 | Takeda Pharmaceutical Company Limited | Gene therapy of hemophilia a using viral vectors encoding recombinant FVIII variants with increased expression |
| WO2020020475A1 (en) * | 2018-07-27 | 2020-01-30 | Zentrum Für Forschungsförderung In Der Pädiatrie Gmbh | Improved concepts for the treatment of genetic disorders with high-capacity plal-generated gold nanoparticles |
| US11517631B2 (en) | 2018-08-20 | 2022-12-06 | Ucl Business Ltd | Factor IX encoding nucleotides |
| US12209262B2 (en) | 2018-08-20 | 2025-01-28 | Ucl Business Ltd | Factor IX encoding nucleotides |
| US10842885B2 (en) | 2018-08-20 | 2020-11-24 | Ucl Business Ltd | Factor IX encoding nucleotides |
| WO2020084161A1 (en) | 2018-10-26 | 2020-04-30 | Vrije Universiteit Brussel | New tools for improving gene therapy and use thereof |
| CN112912112A (zh) * | 2018-10-26 | 2021-06-04 | Vrije布鲁塞尔大学 | 肝特异性核酸调节元件以及其方法及用途 |
| WO2020084162A1 (en) | 2018-10-26 | 2020-04-30 | Vrije Universiteit Brussel | Liver-specific nucleic acid regulatory elements and methods and use thereof |
| AU2019382955B2 (en) * | 2018-11-19 | 2025-09-25 | Askbio Uk Ltd | Liver-specific regulatory nucleic acid sequences |
| US20220009981A1 (en) * | 2018-11-19 | 2022-01-13 | Synpromics Limited | Liver-specific regulatory nucleic acid sequences |
| WO2020150375A1 (en) | 2019-01-16 | 2020-07-23 | Baxalta Incorporated | Viral vectors encoding recombinant fviii variants with increased expression for gene therapy of hemophilia a |
| US11596671B2 (en) | 2019-02-01 | 2023-03-07 | Takeda Pharmaceutical Company Limited | Gene therapy of hemophilia B using viral vectors encoding recombinant fix variants with increased expression |
| US20200246437A1 (en) * | 2019-02-01 | 2020-08-06 | Baxalta Incorporated | Gene therapy of hemophilia b using viral vectors encoding recombinant fix variants with increased expression |
| WO2020160303A1 (en) | 2019-02-01 | 2020-08-06 | Baxalta Incorporated | Gene therapy of hemophilia b using viral vectors encoding recombinant fix variants with increased expression |
| WO2020239964A1 (en) | 2019-05-28 | 2020-12-03 | Ospedale San Raffaele S.R.L. | Agents and methods for treating viral infections |
| WO2020252136A1 (en) * | 2019-06-11 | 2020-12-17 | Shire Human Genetic Therapies, Inc. | Adeno associated viral vector delivery of antibodies for the treatment of disease mediated dysregulated plasma kallikrein |
| CN114207135A (zh) * | 2019-06-11 | 2022-03-18 | 夏尔人类遗传性治疗公司 | 用于治疗由失调的血浆激肽释放酶介导的疾病的抗体的腺相关病毒载体递送 |
| WO2021081280A1 (en) | 2019-10-23 | 2021-04-29 | Shire Human Genetic Therapies, Inc. | Adeno-associated virus vectors based gene therapy for hereditary angioedema |
| WO2021084277A3 (en) * | 2019-11-01 | 2021-07-22 | Freeline Therapeutics Limited | Transcription regulatory elements |
| WO2021128692A1 (en) * | 2019-12-25 | 2021-07-01 | Brainvta (Wuhan) Co., Ltd | Liver-specific promoter and application thereof |
| US20230045478A1 (en) * | 2019-12-25 | 2023-02-09 | Jinfan Biomedical Technology (Wuhan) Co., Ltd. | Liver-specific promoter and application thereof |
| US11952585B2 (en) | 2020-01-13 | 2024-04-09 | Homology Medicines, Inc. | Methods of treating phenylketonuria |
| US12076420B2 (en) | 2020-05-27 | 2024-09-03 | Homology Medicines, Inc. | Adeno-associated virus compositions for restoring PAH gene function and methods of use thereof |
| EP4408997A4 (en) * | 2020-10-01 | 2025-11-19 | Oisin Biotechnologies Inc | COMPOSITIONS AND PROCESSES FOR THE SPECIFIC EXPRESSION OF FOLLISTATIN IN THE LIVER |
| GB202018657D0 (en) | 2020-11-26 | 2021-01-13 | Ospedale San Raffaele Srl | Agents and methods for increasing liver immune response |
| WO2022112522A1 (en) | 2020-11-26 | 2022-06-02 | Ospedale San Raffaele S.R.L. | Agents and methods for increasing liver immune response |
| EP4288549A4 (en) * | 2021-03-05 | 2025-06-25 | Joint Stock Company "Biocad" | Codon-optimized nucleic acid encoding the fix protein |
| US20220389450A1 (en) * | 2021-05-12 | 2022-12-08 | Fondazione Telethon | Vector system |
| WO2023006890A1 (en) | 2021-07-28 | 2023-02-02 | Vrije Universiteit Brussel | Improving the efficacy of muscle-targeted gene therapy |
| EP4402267A4 (en) * | 2021-09-16 | 2025-11-26 | Generation Bio Co | Liver-specific expression cassettes, vectors, and their uses for expressing therapeutic proteins |
| WO2025008774A1 (en) * | 2023-07-05 | 2025-01-09 | Takeda Pharmaceutical Company Limited | Viral vectors encoding recombinant fviii variants with increased expression for gene therapy of hemophilia a |
Also Published As
| Publication number | Publication date |
|---|---|
| US11007280B2 (en) | 2021-05-18 |
| JP6879486B2 (ja) | 2021-06-02 |
| EP3270944B1 (en) | 2019-10-23 |
| EP3270944A1 (en) | 2018-01-24 |
| US20210369868A1 (en) | 2021-12-02 |
| CA2979495A1 (en) | 2016-09-22 |
| AU2016232146A1 (en) | 2017-10-12 |
| ES2764453T3 (es) | 2020-06-03 |
| DK3270944T3 (da) | 2020-01-27 |
| JP2018513678A (ja) | 2018-05-31 |
| US20180071406A1 (en) | 2018-03-15 |
| AU2016232146B2 (en) | 2021-11-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210369868A1 (en) | Optimized Liver-Specific Expression Systems for FVIII and FIX | |
| US20230022390A1 (en) | Vectors for Liver-Directed Gene Therapy of Hemophilia and Methods and Use Thereof | |
| US12409236B2 (en) | Liver-specific nucleic acid regulatory elements and methods and use thereof | |
| EP3513802B1 (en) | Vector for liver-directed gene therapy of hemophilia and methods and use thereof | |
| US8168425B2 (en) | Expression of factor IX in gene therapy vectors | |
| US20210379203A1 (en) | New Tools for Improving Gene Therapy and Use Thereof | |
| WO2014063753A1 (en) | Hyper-active factor ix vectors for liver-directed gene therapy of hemophilia 'b' and methods and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16713774 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2979495 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15558725 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2017549256 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2016232146 Country of ref document: AU Date of ref document: 20160317 Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2016713774 Country of ref document: EP |