WO2015199387A2 - 가용성 단백질 발현량 및 활성이 증대된 헬리코박터 파일로리 유래 α-1,3 푸코실 전달효소의 유전자와 단백질 및 α-1,3 푸코실올리고당 생산에의 응용 - Google Patents

가용성 단백질 발현량 및 활성이 증대된 헬리코박터 파일로리 유래 α-1,3 푸코실 전달효소의 유전자와 단백질 및 α-1,3 푸코실올리고당 생산에의 응용 Download PDF

Info

Publication number
WO2015199387A2
WO2015199387A2 PCT/KR2015/006272 KR2015006272W WO2015199387A2 WO 2015199387 A2 WO2015199387 A2 WO 2015199387A2 KR 2015006272 W KR2015006272 W KR 2015006272W WO 2015199387 A2 WO2015199387 A2 WO 2015199387A2
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
substituted
leu
seq
asn
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2015/006272
Other languages
English (en)
French (fr)
Other versions
WO2015199387A3 (ko
Inventor
김병기
최윤희
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SNU R&DB Foundation
Original Assignee
Seoul National University R&DB Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seoul National University R&DB Foundation filed Critical Seoul National University R&DB Foundation
Priority to US15/322,072 priority Critical patent/US10336990B2/en
Publication of WO2015199387A2 publication Critical patent/WO2015199387A2/ko
Publication of WO2015199387A3 publication Critical patent/WO2015199387A3/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/18—Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/01—Hexosyltransferases (2.4.1)
    • C12Y204/01065—3-Galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase (2.4.1.65), i.e. alpha-1-3 fucosyltransferase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/91—Transferases (2.)
    • G01N2333/91091—Glycosyltransferases (2.4)
    • G01N2333/91097—Hexosyltransferases (general) (2.4.1)
    • G01N2333/91102—Hexosyltransferases (general) (2.4.1) with definite EC number (2.4.1.-)

Definitions

  • the present invention relates to a method for generating a variant of fucosyl transferase through an increase in soluble protein expression of an ⁇ -1,3 fucosyl transferase and a protein engineering enzyme mutation.
  • a method for generating a variant of fucosyl transferase through an increase in soluble protein expression of an ⁇ -1,3 fucosyl transferase and a protein engineering enzyme mutation For synthesizing fucosyl oligosaccharides using an optimized gene encoding a gene, an expression vector comprising the same, a method of expressing the gene, and a variant of ⁇ -1,3 fucosyl transferase with increased soluble protein expression and enzyme activity Invention.
  • Breast milk not only provides essential nutrients for infants, but also provides a variety of health benefits beyond the concept of nutrients.
  • Breast milk oligosaccharides consist of functional ingredients and contain 5-10 g oligosaccharides per liter, 100-200 times more than milk, and more than 130 breast milk oligosaccharides have been identified. The content and structural diversity of these oligosaccharides is very specific for breast milk, unlike milk.
  • breast milk oligosaccharides fucosyl oligosaccharides are contained in milk at less than 1%, while breast milk is present in large quantities at around 50-80%.
  • 3-fucosyllactose which has lactose at the reducing end and is connected to ⁇ -1,3 bonds to glucose by glucose, is not present in milk but 1.0 g / in milk. L level is contained.
  • breast milk-derived fucosyloligosaccharides it is the first prebiotics that promote the growth of useful intestinal microorganisms such as Lactobacillus and Bifidobacteria , while Clostridium and Prevents the growth of the same harmful pathogens.
  • useful intestinal microorganisms such as Lactobacillus and Bifidobacteria
  • Clostridium and Prevents the growth of the same harmful pathogens This is due to the bifidus bacteria, which can use short chains of fucosyloligosaccharides as carbon sources, and by balancing these useful microbial flora, such as treating and preventing infections, anticancer activity, stimulating host immune function, and increasing vitamin intake. It has been studied to be effective in promoting health.
  • fucosyloligosaccharides have been studied as inhibitors that prevent host cells from adhering to the intestinal epithelial surface during early bacterial or viral infections.
  • Recognition of 3-fucosyllactose (Gal ⁇ 1,4Glc ( ⁇ -1,3) Fuc) is a receptor for respiratory pathogens Pseudomonas aeruginosa and enterotoxic elements Escherichia coli, Clostridium and Salmonella fyris It has been studied to be a substance that can competitively inhibit their invasion.
  • Various breast milk-derived fucosyl oligosaccharides containing 3-fucosyllactose which play such a role, are capable of various industrial applications such as infant food and functional food, as well as pharmaceutical fields.
  • fucosaccharides are expressed on the surface of white blood cells in the form of sialyl LewisX (Neu5Ac ( ⁇ -2,3) Gal ⁇ 1,4GlcNAc ( ⁇ -1,3) Fuc, sialyl-lewisX)
  • sialyl LewisX Neuronal Activated Cells
  • lectin By binding to lectin expressed on the surface of epithelial cells of tissues, it plays a role in inducing leukocytes in the early stages of inflammation.
  • Sialyl LewisX which has clinical significance in the regulation of immune responses, can be used to treat immune-related diseases.
  • Sialyl LewisX can be used as an anti-inflammatory reagent by acting as an inhibitor for the binding of leukocytes and lectins.
  • ⁇ -1,3 fucosyl transferase used in the present invention is an enzyme that transfers fucose with ⁇ -1,3 bonds to carbon 3 of glucose or N - acetylglucosamine, and a Helicobacter pylori 26695 strain. Derived from the Bernard Priem group, one cytosine in polyC was removed to fit the frame to express active 3 - fucosyl transferase, lactose, N - acetyllactosamine and various oligosaccharides.
  • ⁇ -1,3 fucosyl transferase derived from Helicobacter pylori 26695 has 7 amino acid repeat sequences such as leucine-zipper at the C terminus, and the substrate specificity of the enzyme differs depending on the number of the repeat sequences. There is a report that occurs.
  • guanosine 5'-diphosphate-fucose a fucose donor of fucosyl transferase
  • FKP L-fucokinase / GDP-fucose pyrophosphorylase
  • the FKP enzyme has higher soluble protein expression and enzyme activity in E. coli compared to ⁇ -1,3 fucosyl transferase.
  • the fucosyl transferase reaction itself was found to be a rate determining step. In order to enhance the rate determining step of the fucosyl transfer reaction, it is very necessary to increase the soluble protein expression and enzyme activity in E. coli of ⁇ -1,3 fucosyl transferase.
  • Helicobacter pylori-derived ⁇ -1,3 fucosyl transferase has a low total protein expression and soluble protein expression in Escherichia coli, and particularly low enzymatic activity on lactose substrates. There has been a slow difficulty in the fucosyl transfer reaction.
  • ⁇ -1,3 fucosyl transferase used in the present invention is derived from the Helicobacter pylori 26695 strain and is a D (D / N repeating sequence of 7 amino acids in the form of leucine zipper at the C-terminus (heptad repeat, heptad repeat) ) Is an enzyme with two LR (V / I) NY.
  • ⁇ -1,3 fucosyl transferases derived from Helicobacter pylori strains have 2 to 10 heptad repeat structures and ⁇ -helix structures at the C-terminus, depending on the enzyme, and in all cases the soluble proteins in E. coli There was a problem that the expression level is very low.
  • ⁇ -1,3 fucosyl delivery is enhanced in the production of ⁇ -1,3 fucosyl oligosaccharides by increasing the soluble protein expression and enzyme activity through changes in the terminal structure, sequencing and protein engineering. It is aimed to increase the yield and productivity by making a variant of the enzyme and optimizing the enzyme reaction and applying it to ⁇ -1,3 fucosyl oligosaccharide production.
  • the present invention also provides a recombinant DNA vector comprising a DNA encoding ⁇ -1,3 fucosyl transferase variant, a DNA encoding ⁇ -1,3 fucosyl transferase variant, and a transformation with the recombinant DNA vector.
  • a recombinant DNA vector comprising a DNA encoding ⁇ -1,3 fucosyl transferase variant, a DNA encoding ⁇ -1,3 fucosyl transferase variant, and a transformation with the recombinant DNA vector.
  • the present invention provides a method for increasing the amount of soluble protein expression for a poorly expressed recombinant protein of ⁇ -1,3 fucosyl transferase derived from Helicobacter pylori, and an active type ⁇ -1,3 fucosyl transferase having increased expression.
  • the present invention provides a host cell transformed with an recombinant vector and an expression vector comprising an optimized gene encoding the ⁇ -1,3 fucosyl transferase with increased expression of the soluble protein.
  • the present invention provides a method for producing ⁇ -1,3 fucosyl oligosaccharides using ⁇ -1,3 fucosyl transferase with an increased amount of soluble protein. That is, by using the ⁇ -1,3 fucosyl transferase with an increased amount of soluble protein expression, the yield and productivity of ⁇ -1,3 fucosyl oligosaccharide production are improved.
  • the present invention also provides a method in which a semi-rational method and an iterative saturation mutagenesis are combined to generate variants of the fucosyl transferase.
  • the partial-logical method combines directed evolution and logical design, in order to ensure only a small number of variant libraries. This method involves selecting the target moiety of a protein and performing mutations by selecting residues of specific amino acids using the protein's sequence, structure and function, and computer programs. Repetitive saturation also refers to the search for an improved variant by causing a variant of another specific amino acid, with the variant found by the method as a template.
  • the present invention relates to variants of SEQ ID NOs: 6, 7, 8, and 9 having a single amino acid of ⁇ -1,3 fucosyl transferase and combinations thereof produced by repetitive saturation. Amino acid sequences 11, 12, 13, 14, 15, and 16. It also provides a gene of the fucosyl transferase encoding the variant, a recombinant DNA vector comprising the same, and a host cell transformed with the recombinant DNA vector.
  • the present invention provides a method for producing ⁇ -1,3 fucosyl oligosaccharides using a variant of ⁇ -1,3 fucosyl transferase having increased soluble protein expression and activity. That is, by using the improved ⁇ -1,3 fucosyl transferase derived from Helicobacter pylori 26695 through improved soluble protein expression and protein engineering mutations, the yield and productivity of ⁇ -1,3 fucosyl oligosaccharides are improved.
  • the present invention provides the following.
  • the present invention is an ⁇ -1,3 fucosyl transferase variant represented by any one sequence selected from (a) to (p) below:
  • the 128th amino acid is substituted with amino acids except for alanine and aspartic acid
  • the 129th amino acid is substituted with an acidic and hydrophilic amino acid
  • the 132th amino acid is substituted with Sequences substituted with amino acids except tyrosine and histidine;
  • the 128th amino acid is substituted with amino acids except for alanine and aspartic acid
  • the 129th amino acid is substituted with an acidic and hydrophilic amino acid
  • the 46th amino acid is substituted for Sequences substituted with hydrophobic amino acids
  • the 128th amino acid is substituted with amino acids except for alanine and aspartic acid
  • the 129th amino acid is substituted with an acidic and hydrophilic amino acid
  • the 132th amino acid is substituted with A sequence substituted with amino acids other than tyrosine and histidine and the 46 th amino acid is substituted with a hydrophobic amino acid;
  • the present invention also provides ⁇ -1,3 fucosyl transferase variants represented by the amino acid sequence of SEQ ID NO: 6 to 16.
  • the present invention provides a protein having the activity of fucosyl transfer, comprising a substituted site of the amino acid sequence of any one of SEQ ID NO: 6 to 16 and having at least 75% homology with the amino acid sequence.
  • the present invention is represented by the DNA represented by SEQ ID NO: 4, DNA having at least 77% homology with SEQ ID NO: 4, and the SEQ ID NO: 17 to 27, which encodes the ⁇ -1,3 fucosyl transferase variant Provide DNA.
  • the present invention also provides a recombinant DNA vector containing the DNA, a host cell transformed with the recombinant DNA vector and an extract of the host cell.
  • the present invention also provides a method for producing 3-fucosyl oligosaccharides using a host cell or a host cell transformed with a recombinant DNA vector as a biocatalyst.
  • the present invention also provides a method for preparing ⁇ -1,3 fucosyl transferase variant, comprising the following sequential steps.
  • the present invention provides a method for detecting variants of fucosyl transferase, characterized in that the reaction using the indicator by the pH change.
  • the ⁇ -1,3 fucosyl transferase significantly improved the expression level and enzyme activity of the soluble protein of the present invention, as well as 3-fucosyllactose, a milk-derived oligosaccharide, as well as Lewis X. Applicable to the production of fucosyl oligosaccharides.
  • the amount of enzyme that can be obtained per unit culture of ⁇ -1,3 fucosyl transferase was significantly increased (11 to 50 times), and the activity per unit enzyme was increased to reduce the material cost of enzyme use and increase the productivity of fucosyl oligosaccharides. It is possible to reduce the production time and reduce the production cost due to process improvement.
  • the production yield is increased from 95 to 100% relative to the concentration of GDP-fuc. Significantly improved, which enabled economic mass production in the future.
  • the yield of the relatively cheap receptor substrate was increased and the yield of the product was greatly increased. It can be created.
  • FIG. 1 is a schematic of the synthesis of ⁇ -1,3 fucosyl oligosaccharides using ⁇ -1,3 fucosyl transferase from guanosine 5′-diphosphate-fucose and a receptor substrate and production of fucosyl oligosaccharides through the present invention.
  • the yield increase graph is shown.
  • Figure 2 shows the relative activity (b) of each enzyme in the production of 3-fucosyllactose according to the systematic C-terminal removal (a) of the ⁇ -1,3 fucosyl transferase of the present invention
  • ⁇ 9 is hydrophobic
  • 9 amino acids were removed from the presumed positively charged ⁇ -helix
  • ⁇ 45 is a 45-amino acid removed from the presumed ⁇ -helix
  • ⁇ 52 is the presumed ⁇ -helix.
  • 52 amino acids of the heptad repeat structure were removed
  • ⁇ 59 was a form in which the amino acid was estimated to be ⁇ -helix and 59 amino acids of the two heptad repeat structures were removed.
  • Figure 3 (a) shows the total protein fraction (T) and soluble protein for each protein of the truncated form of Figure 2 according to the systematic C-terminal removal of ⁇ -1,3 fucosyl transferase of the present invention (soluble protein, S),
  • Figure 3 (b) shows the total protein and soluble protein after sequencing optimization after the C-terminal removal of the ⁇ -1,3 fucosyl transferase.
  • Figure 3 (b) shows the total protein and soluble protein expression after the C-terminal removal and sequencing of the ⁇ -1,3 fucosyl transferase and optimization of the culture medium of the host cell.
  • Figure 4 is a graph showing the production yield and production (g / L) increase of 3-fucosyllactose according to the increase in soluble protein and enzyme activity of ⁇ -1,3 fucosyl transferase of the present invention.
  • Production yield (%) of the graph represents the yield of 3-fucosyllactose produced according to the concentration of guanosine 5'-diphosphate-fucose at the beginning of the enzyme reaction.
  • 3FT is the original ⁇ -1,3 fucosyl transferase and C-terminus truncation is the ⁇ -1,3 fucosyl transfer in the form of the ⁇ -helix structure and one heptad repeat structure removed.
  • Codon optimized_truncation is an enzyme that is optimized for the nucleotide sequence of ⁇ -1,3 fucosyl transferase in which the ⁇ -helix structure and one heptad repeat structure are removed.
  • Rxn_optimization is a result of optimizing the sequencing of ⁇ -1,3 fucosyl transferase in a form in which the ⁇ -helix structure and one heptad repeat structure have been removed, optimizing the host substrate culture medium, and optimizing the receptor substrate concentration during the reaction. to be.
  • Enzyme engineering also results from protein engineering enzyme mutation of ⁇ -1,3 fucosyl transferase, in which soluble proteins have been enhanced by these steps.
  • Figure 5 is a graph showing the production yield of 3-fucosyllactose using wild strains and variants of the ⁇ -1,3 fucosyl transferase of the present invention.
  • Production yield (%) of the graph represents the yield of 3-fucosyllactose produced according to the concentration of guanosine 5'-diphosphate-fucose at the beginning of the enzyme reaction.
  • Figure 6 is a graph showing the yield of Lewis X using wild strains and variants of the ⁇ -1,3 fucosyl transferase of the present invention.
  • Production yield (%) of the graph represents the yield of Lewis X produced according to the concentration of guanosine 5′-diphosphate-fucose at the beginning of the enzyme reaction.
  • Fucosyl transferase means an enzyme that transfers fucose from the sugar donor guanosine 5'-diphosphate-fucose to the sugar receptor substance.
  • One of the receptor substrates, lactose is an oligosaccharide composed of Gal ⁇ 1,4Glc (galactose and glucose are linked by ⁇ 1,4 bonds), and one of the receptor substrates, N-acetyllactosamine, is Gal ⁇ 1,4GlcNAc (galactose and N Acetylglucosamine linked by ⁇ 1,4 bonds).
  • ⁇ -1,3 fucosyl oligosaccharides refer to oligosaccharides in which fucose is linked to the glucose or N-acetylglucosamine moiety by an ⁇ -1,3 bond, in addition to glucose or N-acetylglucosamine.
  • Other sugars can combine more.
  • 3-fucosyllactose refers to a tritane substance composed of Gal ⁇ 1,4Glc ( ⁇ -1,3) Fuc (fucose is linked to ⁇ -1,3 bonds to glucose of lactose), Lewis X means a trisaccharide substance composed of Gal ⁇ 1,4GlcNAc ( ⁇ -1,3) Fuc (fucose is linked by ⁇ -1,3 bond to N-acetylglucosamine of N-acetyllactosamine).
  • (5) 'Transformation means that DNA is introduced into a host so that the DNA can be replicated as an extrachromosomal factor or by chromosomal integration.
  • Cell extract means a microbial extract of the present invention expressing fucosyl transferase.
  • Reaction using cell extraction refers to a reaction using whole cells without disrupting and purifying cells containing specific enzymes or using cell contents.
  • Codon optimization of a protein does not change the amino acid sequence, but changes the nucleotide sequence encoding the amino acid. It is usually used to increase the protein expression in the desired host cell, and codon optimization may vary depending on the principle such as codon usage,% GC sequence, RNA secondary structure formation, elimination of repetitive sequence, tRNA preference, etc. However, it is not limited to any one principle.
  • Hydrophilic amino acid refers to an amino acid containing a large electronegative atom (oxygen, nitrogen, sulfur) in a functional group capable of forming a hydrogen bond with water.
  • Acidic Amino acids are amino acids that have a carboxyl group in the side chain, such as aspartic acid or glutamic acid, and which have a negative charge in a neutral solvent and which are acidic.
  • hydrophobic amino acids are hydrophobic in the side chain, i.e., have little or no affinity for water molecules and have insoluble properties in water, which are isoleucine, leucine, and valine. Methionine, phenylalainine, tryptophane, proline, glycine, alanine.
  • PCR is a polymerase chain reaction, and means a method of specifically amplifying a certain region of DNA.
  • Saturation mutagenesis refers to the introduction of changes in various nucleotide sequences at designated locations of genes.
  • Saturation mutation refers to inserting mutations through PCR by inserting NNN or NNK codons instead of the sequence to be mutated on primers of complementary sequences that bind to the template strand.
  • N in the NNK codon means A, T, G, C of the nucleotides and K means T, G.
  • a vector refers to a polynucleotide consisting of single-stranded, double-stranded, circular or ultra-stranded DNA or RNA, and may include components that are operably linked at a suitable distance to produce a recombinant protein. Such components may include replication origins, promoters, enhancers, 5'mRNA leader sequences, ribosomal binding sites, nucleic acid cassettes, termination and polyadenylation sites, or selectable label formats, and such components may be used for specific applications. So one or more may be missing.
  • the nucleic acid cassette may comprise restriction enzyme sites for insertion of the recombinant protein to be expressed.
  • the nucleic acid cassette contains a nucleic acid sequence to be expressed that includes a translation initiation and termination site, and may use a vector capable of inserting two kinds of cassettes into the vector, if necessary, and the functions mentioned above may be added. Can be sequenced.
  • E. coli strains BW25113 (DE3), BL21 (DE3), etc. may be used, but may vary depending on the type of the inserted vector.
  • Such vectors and expression strains can be readily selected by those skilled in the art.
  • pH indicator is used mainly to know the neutralization point while titrating or to know the concentration of hydrogen ion.
  • Indicators are acid-type and base-type according to the hydrogen ion index, and the color tone is different, and this area is called discoloration area.
  • the concentration of hydrogen ions according to the absorbance can be measured by spectrophotometry.
  • Specific activity refers to the activity per unit amount of pure protein from which impurities and other proteins have been removed through enzyme purification, usually 1 mg with an amount of enzyme that catalyzes 1 ⁇ mol substrate change in one minute. It is expressed in units of sugar.
  • the present invention is an ⁇ -1,3 fucosyl transferase variant represented by any one sequence selected from (a) to (p) below:
  • the 128th amino acid is substituted with amino acids except for alanine and aspartic acid
  • the 129th amino acid is substituted with an acidic and hydrophilic amino acid
  • the 132th amino acid is substituted with Sequences substituted with amino acids except tyrosine and histidine;
  • the 128th amino acid is substituted with amino acids except for alanine and aspartic acid
  • the 129th amino acid is substituted with an acidic and hydrophilic amino acid
  • the 46th amino acid is substituted for Sequences substituted with hydrophobic amino acids
  • the 128th amino acid is substituted with amino acids except for alanine and aspartic acid
  • the 129th amino acid is substituted with an acidic and hydrophilic amino acid
  • the 132th amino acid is substituted with A sequence substituted with amino acids other than tyrosine and histidine and the 46 th amino acid is substituted with a hydrophobic amino acid;
  • the ⁇ -1,3 fucosyl transferase variant of the present invention may be derived from ⁇ -1,3 fucosyl transferase obtained from Helicobacter pylori 26695.
  • ⁇ -1,3 fucosyl transferase protein obtained from Helicobacter pylori 26695.
  • the two heptad repeat structures contribute to the formation of dimers of ⁇ -1,3 fucosyl transferase, and the 45 hydrophobic or positively charged amino acids can form an ⁇ -helix that can bind to the cell membrane.
  • SEQ ID NO: 1 is a form in which the ⁇ -helix structure at the C-terminus of ⁇ -1,3 fucosyl transferase protein derived from Helicobacter pylori 26695 is removed
  • SEQ ID NO: 2 is an ⁇ -helix structure and one heptad The repeat structure is removed
  • SEQ ID NO: 3 is a form in which the ⁇ -helix structure and two heptad repeat structures are removed.
  • Enzymes have the effect of increasing total protein expression and increasing soluble protein expression in the cytosol.
  • the ⁇ -1,3 fucosyl transferase variant having 95% or more homology with the amino acid sequence of any one of SEQ ID NOS: 1 to 3 or SEQ ID NOs: 1 to 3 has higher activity, Certain amino acid sequences may be substituted to have them.
  • Substitution of the amino acid preferably the 128, 129, 132 or 46th amino acid may be substituted with another amino acid, one or more substitutions may occur. For example, two substitutions have occurred, for example, the 128th amino acid and the 129th amino acid, the 128th amino acid and the 132th amino acid, the 128th amino acid and the 46th amino acid, the 129th amino acid and the 132th amino acid, the 129th amino acid and the 46th amino acid. Amino acids, or the 132 th and 46 th amino acids, may be substituted.
  • the positions of the 128th, 129th, 132th, and 46th amino acids are amino acid positions represented by the enzymes of the present invention, and the positions of the other fucosyl transferases may change when the positions thereof may be changed, and thus may refer to amino acids having different numbers. . That is, the 128, 129, 132, and 46th amino acids mean the positions of the amino acids corresponding to the 128, 129, 132, and 46th amino acids of the fucosyl transferase of the present invention.
  • the 128 th amino acid is preferably substituted with an amino acid sequence excluding alanine and aspartic acid, and more preferably with asparagine.
  • the amino acid sequence of the ⁇ -1,3 fucosyl transferase variant in which the 128th amino acid is substituted with asparagine is preferably represented by the amino acid sequence of SEQ ID NO: 6.
  • the 129th amino acid is preferably acidic and substituted with a hydrophilic amino acid, more preferably with glutamic acid.
  • the amino acid sequence of the ⁇ -1,3 fucosyl transferase variant in which the 129th amino acid is substituted with glutamic acid is preferably represented by the amino acid sequence of SEQ ID NO.
  • the 132 th amino acid is preferably substituted with amino acids other than tyrosine and histidine, and more preferably with isoleucine.
  • the amino acid sequence of the ⁇ -1,3 fucosyl transferase variant in which the 132th amino acid is substituted with isoleucine is preferably represented by the amino acid sequence of SEQ ID NO: 8.
  • the 46th amino acid is preferably substituted with a hydrophobic amino acid, more preferably with phenylalanine.
  • the amino acid sequence of the ⁇ -1,3 fucosyl transferase variant in which the 46th amino acid is substituted with phenylalanine is preferably represented by the amino acid sequence of SEQ ID NO.
  • amino acid sequence which substituted asparagine at the 128th amino acid position and glutamic acid at the 129th amino acid position in the amino acid sequence of SEQ ID NO: 2 is represented by the amino acid sequence of SEQ ID NO: 10.
  • amino acid sequence which substituted asparagine at the 128th amino acid position and isoleucine at the 132th amino acid position in the amino acid sequence of SEQ ID NO: 2 is represented by the amino acid sequence of SEQ ID NO: 11.
  • amino acid sequence substituted with asparagine at the 128th amino acid position and phenylalanine at the 46th amino acid position in the amino acid sequence of SEQ ID NO: 2 is represented by the amino acid sequence of SEQ ID NO: 12.
  • amino acid sequence which substituted asparagine at the 128th amino acid position, glutamic acid at the 129th amino acid position, and isoleucine at the 132th amino acid position in the amino acid sequence of SEQ ID NO: 2 is represented by the amino acid sequence of SEQ ID NO: 13.
  • amino acid sequence of SEQ ID NO: 2 an amino acid sequence substituted with asparagine at the 128th amino acid position, glutamic acid at the 129th amino acid position, and phenylalanine at the 46th amino acid position is represented by the amino acid sequence of SEQ ID NO: 14.
  • amino acid sequence of SEQ ID NO: 2 an amino acid sequence substituted with asparagine at the 128th amino acid position, isoleucine at the 132th amino acid position, and phenylalanine at the 46th amino acid position is represented by the amino acid sequence of SEQ ID NO: 15.
  • amino acid sequence of SEQ ID NO: 2 the amino acid sequence in which asparagine is substituted at the 128th amino acid position, glutamic acid at the 129th amino acid position, isoleucine at the 132th amino acid position, and phenylalanine at the 46th amino acid position is It is represented by the amino acid sequence of number 16.
  • the present invention provides a DNA encoding the ⁇ -1,3 fucosyl transferase variant.
  • the DNA may be used without limitation as long as it corresponds to the DNA encoding the amino acid provided in the present invention, and includes the sequence obtained by optimizing the DNA, wherein the DNA is preferably SEQ ID NO: 4, SEQ ID NO: 4 and 77% DNA having the above homology, and any one DNA selected from the group consisting of SEQ ID NOs: 17 to 27.
  • the DNA sequence of SEQ ID NO: 4 is a DNA sequence encoding the amino acid sequence (SEQ ID NO: 2) of ⁇ -1,3 fucosyl transferase in which ⁇ -helix structure and one heptad repeat structure are removed. 5) is optimized sequence, and SEQ ID NO: 4 and SEQ ID NO: 5 has a homology of 76%.
  • the DNA sequence of SEQ ID NO: 17 is a sequence encoding an amino acid of SEQ ID NO: 6.
  • the DNA sequence of SEQ ID NO: 18 is a sequence encoding an amino acid of SEQ ID NO: 7.
  • the DNA sequence of SEQ ID NO: 19 is a sequence encoding an amino acid of SEQ ID NO: 8.
  • the DNA sequence of SEQ ID NO: 20 is a sequence encoding an amino acid of SEQ ID NO: 9.
  • the DNA sequence of SEQ ID NO: 21 is a sequence encoding an amino acid of SEQ ID NO: 10.
  • the DNA sequence of SEQ ID NO: 22 is a sequence encoding an amino acid of SEQ ID NO: 11.
  • the DNA sequence of SEQ ID NO: 23 is a sequence encoding an amino acid of SEQ ID NO: 12.
  • the DNA sequence of SEQ ID NO: 24 is a sequence encoding an amino acid of SEQ ID NO: 13.
  • the DNA sequence of SEQ ID NO: 25 is a sequence encoding an amino acid of SEQ ID NO: 14.
  • the DNA sequence of SEQ ID NO: 26 is a sequence encoding an amino acid of SEQ ID NO: 15.
  • the DNA sequence of SEQ ID NO: 27 is a sequence encoding an amino acid of SEQ ID NO: 16.
  • the present invention provides a recombinant DNA vector comprising a DNA encoding the ⁇ -1,3 fucosyl transferase variant.
  • the vector may use a strong promoter, and as an example of a strong promoter, a trc promoter, a tac promoter, a T7 promoter, a T5 promoter, a lac promoter, or a trp promoter may be used, but is not limited thereto.
  • a strong promoter a trc promoter, a tac promoter, a T7 promoter, a T5 promoter, a lac promoter, or a trp promoter may be used, but is not limited thereto.
  • the above strong promoter is used, the amount of soluble protein expression is increased.
  • the present invention provides host cells and extracts of host cells transformed with a recombinant DNA vector comprising DNA encoding the ⁇ -1,3 fucosyl transferase variant.
  • the present invention provides a method for producing 3-fucosyl oligosaccharides using the host cell or the extract of the host cell as a biocatalyst.
  • 3-fucosyloligosaccharides that may be prepared include, but are not limited to, 3-fucosyllactose, LewisX.
  • an inducer of 0.01 mM to 2 mM may be used at a temperature of 15 ° C. to 37 ° C., and when the above range is satisfied, the amount of soluble protein produced This has an increasing effect.
  • the inducer means a substance that promotes the expression of the protein.
  • lac operon there is IPTG (Isopropyl ⁇ -D-1-thiogalactopyranoside), and when using ara operon, arabinose (trbin), trp Indole acrylic acid may be used when using operon, but is not limited thereto.
  • a medium to which a carbon source or a nitrogen source is added can be used.
  • the present invention provides a method for preparing 3-fucosyl oligosaccharides, wherein the concentration of the sugar receptor substrate is used at least twice the concentration of the sugar donor substrate.
  • the sugar donor is preferably guanosine 5'-diphosphate fucose (GDP-fuc), but is not limited thereto.
  • the concentration of the sugar receptor substrate is 1.1 to 20 times, preferably 1.5 to 10 times, more preferably 2 to 5 times, the concentration of guanosine 5'-diphosphate-fucose.
  • concentration control increases the reaction rate and yield of the enzyme, thereby enabling economic production of 3-fucosyllactose.
  • the present invention provides a method for preparing ⁇ -1,3 fucosyl transferase variant, comprising the following sequential steps.
  • amino acid that can be changed evolutionarily from multiple sequence alignment through sequence information of the bioinformatics database the protein structure can be changed by evolutionary change without playing a direct role in the catalytic process of the enzyme
  • amino acid residues in certain positions within the conserved are meant.
  • the cluster is divided into a group of meaningful parts forming a substrate binding site, such as ⁇ -helix or ⁇ -sheet within 5 to 20 ms from the substrate binding site of ⁇ -1,3 fucosyl transferase. it means.
  • the present invention is a search method for the ⁇ -1,3 fucosyl transferase variant prepared by the ⁇ -1,3 fucosyl transferase variant production method, characterized in that for performing a reaction using an indicator by the pH change, Provided are methods for searching for variants of fucosyl transferase.
  • the reaction using the indicator by the pH change may be preferably carried out at pH 7 to 9.
  • ⁇ -1,3 fucosyl transferase derived from Helicobacter pylori 26695 of the present invention is very low in total protein expression and soluble protein expression level, even though temperature and inducer concentrations are regulated, 3-fucosyl oligosaccharides In production it was confirmed that the fucose transfer reaction was a rate determining step.
  • Removal of the heptad repeat structure and the presumed hydrophobic or positively charged ⁇ -helix increased the total protein expression of ⁇ -1,3 fucosyl transferase of the present invention and the amount of soluble protein expression in the cytosol. Can be increased. That is, in the ⁇ -1,3 fucosyl transferase derived from Helicobacter pylori 26695 of the present invention, by increasing the amount of soluble protein expressed as an enzyme form that can increase the production yield and productivity of 3-fucosyl oligosaccharides.
  • a structure without a structure may be used, preferably a form with an ⁇ -helix structure removed and a form with an ⁇ -helix structure and one heptad repeat structure removed, more preferably May be used in which the ⁇ -helix structure and one heptad repeat structure have been removed.
  • the ⁇ -1,3 fucosyl transferase in the form of the C-terminus was removed, as shown in FIG. 3 (a), and the amount of soluble protein was increased.
  • the base sequence of 1,3 fucosyl transferase was optimized.
  • the nucleotide sequence of the ⁇ -1,3 fucosyl transferase in the form of the ⁇ -helix structure and one heptad repeat structure is removed to a high level of acylated tRNA (tRNA having a charge bound to an amino acid). (DNA2.0, USA) sequence was optimized according to the principle of substitution with sustainable codons.
  • the template DNA of optimizing the nucleotide sequence of the present invention is not limited to the gene encoding the protein, but the C-terminal ⁇ -helix structure is removed, and the ⁇ -helix structure and two heptad repeat structures are removed. Genes encoding proteins may also be included.
  • the gene encoding the ⁇ -1,3 fucosyl transferase in a form in which the ⁇ -helix structure and one heptad repeat structure of the present invention has been removed is optimized and expressed in E. coli, as shown in FIG. 3 (b).
  • Total protein expression and soluble protein expression were significantly increased than before optimization, and the production yield of 3-fucosyllactose using the cell extract was increased by four times compared to the use of the cell extract before sequencing optimization (FIG. 4).
  • the expression of the optimized ⁇ -1,3 fucosyl transferase is enhanced by the addition of carbon or nitrogen sources, such as glycerol and casein digests, to the culture medium of the host cell expressing the gene, thereby increasing the number of E. coli cells.
  • carbon or nitrogen sources such as glycerol and casein digests
  • the increase in total protein and the amount of soluble protein as shown in Figure 3 (b) may be more than 90% of the total protein expression.
  • the yield of ⁇ -1,3 fucosyl transferase per 1 L E. coli culture was increased to 160 to 200 mg through the present invention compared to 4 to 15 mg according to the previous study, which is 11 times to the previous study. The result is an increase of up to 50 times.
  • the maximum amount of soluble protein is improved through the present invention (Fig. Silactose was produced.
  • the reaction conditions were optimized to further increase the productivity and yield of 3-fucosyllactose, and the concentration of guanosine 5'-diphosphate-fucose, a sugar donor substrate, was fixed at 5 mM in sodium phosphate buffer.
  • the concentration of lactose, the receptor substrate, to 10-20 mM the yield and reaction rate were more than doubled ( Figure 4).
  • the present invention shows an increase in the productivity of 3-fucosyllactose, and shows a productivity of 0.0053 g / L / h in the initial reaction before the invention of ⁇ -1,3 fucosyl transferase. Increased to 0.63 g / L / h resulting in a 120-fold increase in productivity.
  • the mutant was produced using ⁇ -1,3 fucosyl transferase as the template protein with the maximum amount of soluble protein.
  • the ⁇ -1,3 fucosyl transferase of the present invention is a guanosine 5'-diphosphate-fucose which is a sugar donor substrate from a model structure based on a crystal structure of another helicobacter-derived ⁇ -1,3 fucosyl transferase. It was confirmed that the substrate binding site is bound.
  • the homology between the template protein and ⁇ -1,3 fucosyl transferase of the present invention is 89%.
  • lactose a receptor substrate, glutamic acid 96 (E96), which is an essential key amino acid residue of the fucosyl transferase reaction, was searched by overlapping with the model structure to find a binding site.
  • the lactose form which shows a stable energy form centering on the OH of glucose 3 carbon of lactose from E96, was arranged through an autodock program, and the binding site of the lactose substrate was confirmed through this.
  • residues within 5 to 20 Hz from E96 which may include the distance at which a sugar transfer reaction can occur Selected.
  • the hot spot wizard (Pavelka A., HotSpot Wizard: a web server for identification of hot) to select a functional residue to perform the saturation mutation among the residues selected from the essential key amino acid residues spots in protein engineering, Nucleic Acids Research, 2009, 37, 376-83].
  • the program proceeds with multiple sequence alignments using sequence information through a database of bioinformatics, and despite evolutionary pressures, preserving amino acid residues at specific positions within the protein structure plays a very important role in the structure and function of the protein. In particular, since they are more likely to play a direct role in the catalysis process, they get lower scores as mutable scores.
  • residues selected from the essential main amino acids and residues having 'intersection' with respect to amino acid residues having a high variability score through the 'hot spot wizard' are selected as the mutation target portion, and the saturation variation is Was performed.
  • the variant libraries were screened by colorimetry using pH indicators. After the initial search for variants with increased changes in absorbance over time compared to wild strains, the culture volumes were increased for these variants, followed by production yield and initial reaction of 3-fucosyllactose using cell extracts. The rate was calculated in units per volume (mL) of cell extract.
  • A128 selected by this method is located on the ⁇ -helix near glucose of docked lactose.
  • the variants substituted with glycine, arginine, and glutamic acid showed similar or 20% higher activity than wild strains, and the asparagine substituted 2.9-fold increase in activity.
  • the intrinsic activity of A128N was the highest as 198% compared to the wild type, and the variant was selected as a 'hot spot'.
  • the present invention also provides a method in which a semi-rational method and an iterative saturation mutagenesis are combined to generate variants of the fucosyl transferase.
  • Repetitive saturation variation refers to the search for further improved variants by using a variant searched by the method as a template to cause another specific amino acid mutation.
  • ⁇ -helix having A128 is designated as Cluster 1
  • Cluster 2 the other ⁇ -helix is designated as Cluster 2.
  • the amino acid of the mutation candidate using the "hot spot wizard" on cluster 1 was selected, and repeated saturation was performed for the mutation candidate selected using the "hot spot” A128N as a template DNA.
  • mutation candidates using 'hot spot wizard' on cluster 2 were selected, and saturation mutations on cluster 1 and cluster 2 were performed.
  • Additional variants from A128N of cluster 1 may be generated from variants of H129.
  • a variant substituted with cysteine and serine showed a similar activity to A128N, and when substituted with an acidic and hydrophilic amino acid such as glutamic acid and aspartic acid, it showed a twofold increase in activity than A128N.
  • Additional variants from the combination of A128N and H129E / D of Cluster 1 may be generated from variants of Y132.
  • Y132 can accept a relatively wide variety of variants, the variants of Y132 substituted with glycine, serine, glutamic acid, cysteine, valine, etc. showed neutral activity and substituted with hydrophobic amino acids such as leucine, isoleucine, tryptophan Case showed 20% increased activity than the combination of A128N and H129E / D.
  • Variants of S46 can also be generated from Cluster 2 of the present invention.
  • threonine showed similar activity as wild type, and when substituted with phenylalanine, showed 1.5-fold increase in activity compared to wild type.
  • the single amino acid substitution variant A128N of A128 of ⁇ -1,3 fucosyl transferase represents the amino acid sequence of SEQ ID NO: 6, and the 128th amino acid position is substituted with any amino acid except alanine and aspartic acid.
  • the protein may include a protein having a sequence substituted with a hydrophilic amino acid.
  • all the enzymes having at least 75% homology including the variant sequence at the present amino acid position when aligning with other fucosyl transferases and having fucosyl transfer activity are possible.
  • the DNA encoding the protein of SEQ ID NO: 6 is SEQ ID NO: 17 and any DNA sequence encoding the amino acid may also be included.
  • the amino acid substitution variant H129E of H129 of ⁇ -1,3 fucosyl transferase represents the amino acid sequence of SEQ ID NO: 7, and the amino acid position of the 129th may include a protein having a sequence substituted with an acidic hydrophilic amino acid. have.
  • all the enzymes having at least 75% homology including the variant sequence at the present amino acid position when aligning with other fucosyl transferases and having fucosyl transfer activity are possible.
  • the DNA encoding the protein of SEQ ID NO: 7 is SEQ ID NO: 18 and any DNA sequence encoding the amino acid may also be included.
  • the amino acid substitution variant Y132I of Y132 of ⁇ -1,3 fucosyl transferase represents the amino acid sequence of SEQ ID NO: 8, and the amino acid position of the 132th is substituted with any other amino acid except tyrosine and histidine. May comprise a protein having a sequence substituted with a hydrophobic amino acid.
  • all the enzymes having at least 75% homology including the variant sequence at the present amino acid position when aligning with other fucosyl transferases and having fucosyl transfer activity are possible.
  • the DNA encoding the protein of SEQ ID NO: 8 is SEQ ID NO: 19, and any DNA sequence encoding the amino acid may also be included.
  • the amino acid substitution variant S46F of S46 of ⁇ -1,3 fucosyl transferase represents the amino acid sequence of SEQ ID NO: 9 and may include a protein having a sequence in which the 46th amino acid position is substituted with a hydrophobic amino acid.
  • all the enzymes having at least 75% homology including the variant sequence at the present amino acid position when aligning with other fucosyl transferases and having fucosyl transfer activity are possible.
  • the DNA encoding the protein of SEQ ID NO: 9 is SEQ ID NO: 20, and any DNA sequence encoding the amino acid may also be included.
  • the combination variant of A128N and H129E of ⁇ -1,3 fucosyl transferase shows the amino acid sequence of SEQ ID NO: 10, and in the two-position variation, the 128th amino acid position has any amino acid sequence except alanine and aspartic acid.
  • the 129th amino acid position is an acidic, hydrophilic amino acid protein and an enzyme having at least 75% homology including this variant sequence, and has an activity of fucosyl transfer.
  • the DNA encoding the protein of SEQ ID NO: 10 is SEQ ID NO: 21, and any DNA sequence encoding the amino acid may also be included.
  • A128N of ⁇ -1,3 fucosyl transferase can produce a combination variant with Y132I or S46F, similar to the combination variant above.
  • the combinational variant of A128N and Y132I of ⁇ -1,3 fucosyl transferase represents the amino acid sequence of SEQ ID NO: 11, and in the two-position variation, the 128th amino acid position has any amino acid sequence except alanine and aspartic acid.
  • the 132th amino acid position may be any protein other than tyrosine and histidine, and at least 75% homology including the variant sequence, and an enzyme having fucosyl transfer activity.
  • the combination variant of A128N and S46F of ⁇ -1,3 fucosyl transferase shows the amino acid sequence of SEQ ID NO: 12, and in the two-position variation, the 128th amino acid position has any amino acid sequence except alanine and aspartic acid. Or an enzyme having a hydrophobic amino acid at the 46th amino acid position and at least 75% homology including the variant sequence, and an enzyme having fucosyl transfer activity.
  • the DNAs encoding the SEQ ID NOS: 11 and 12 proteins are SEQ ID NOs: 22, 23, respectively, and all DNA sequences encoding the amino acids may also be included.
  • the combinational variant of A128N, H129E, and Y132 of ⁇ -1,3 fucosyl transferase represents the amino acid sequence of SEQ ID NO: 13, and in the three positional variation, the 128th amino acid position is any amino acid sequence except alanine and aspartic acid.
  • Foucault has a protein with at least 129 amino acid position an acidic and hydrophilic amino acid or a 132th amino acid position having any other amino acid except tyrosine and histidine and at least 75% homology including the variant sequence All enzymes with activity of yarn transfer are also possible.
  • the DNA encoding the protein of SEQ ID NO: 13 is SEQ ID NO: 24, and any DNA sequence encoding the amino acid may also be included.
  • the combination variant of A128N, H129E, and S46F of ⁇ -1,3 fucosyl transferase shows the amino acid sequence of SEQ ID NO: 14, and in the three positional variation, the 128th amino acid position is any amino acid sequence except alanine and aspartic acid.
  • the 129th amino acid position is acidic and has a hydrophilic amino acid
  • the 46th amino acid position is a hydrophobic amino acid and a protein having at least 75% homology including the variant sequence, and has the activity of fucosyl transfer All enzymes are possible.
  • the DNA encoding the protein of SEQ ID NO: 14 is SEQ ID NO: 25, and any DNA sequence encoding the amino acid may also be included.
  • Combination variants of A128N with Y132I and S46F of ⁇ -1,3 fucosyl transferase show the amino acid sequence of SEQ ID NO: 15, and in the three position variation, the 128th amino acid position is any amino acid sequence except alanine and aspartic acid. Or a 132th amino acid position with any other amino acid except for tyrosine and histidine, or a 46th amino acid position with a hydrophobic amino acid and at least 75% homology with this variant sequence, fucosyl transfer All enzymes having the activity of are also possible.
  • the DNA encoding the protein of SEQ ID NO: 15 is SEQ ID NO: 26, and any DNA sequence encoding the amino acid may also be included.
  • Combination variants of A128N, H129E, Y132I, and S46F of ⁇ -1,3 fucosyl transferase show the amino acid sequence of SEQ ID NO: 16, and in the four positional variation, the 128th amino acid position was any other than alanine and aspartic acid.
  • the DNA encoding the protein of SEQ ID NO: 16 is SEQ ID NO: 27, and any DNA sequence encoding the amino acid may also be included.
  • An example having at least 75% homology with the above-described variant of ⁇ -1,3 fucosyl transferase includes a mutated sequence of the variant and is named as having activity of ⁇ -1,3 fucosyl transferase, Or as predicted sequences, sequences from the genus Helicobacter, in particular pylori species, may be included.
  • a combination of A128N, A128N and H129E (A128N + H129E), a combination of A128N and H129E and Y132I (A128N + H129E) among the variants of the ⁇ -1,3 fucosyl transferase sought above along with the wild strain + Y132I), single and combination variants of A128N and combination variants of H129E and S46F (A128N + H129E + S46F) were selected to try 3-fucosyllactose and LewisX production.
  • the production yield of using the variants of A128N + H129E and A128N + H129E + Y132I and A128N + H129E + S46F was increased to 95% (FIG. 4), which was determined by the amount of soluble protein expression and It shows a 31-fold improvement in the production yield of the initial ⁇ -1,3 fucosyl transferase before increasing the enzyme activity, and the productivity was also increased 441 times compared to the previous one with a productivity of 2.33 g / L / h.
  • the production yield of 3-fucosyllactose as a cell extract of fucosyl transferase 50% less than the existing reaction in order to compare the activity of U / mL of the initial reaction rate with wild strain as an example of the use of the variant was compared.
  • the yield of 3-fucosyllactose production of the variant compared to wild type is shown in Figure 5, the initial reaction rate U / mL of the A128N + H129E + S46F variant was increased 15 times compared to the wild type.
  • ⁇ -1,3 fucosyl transferase having increased soluble protein expression and activity is not only produced 3-fucosyllactose and Lewis X, but also lactodifucotetraose (Fuc ( ⁇ -1, 2) Gal ⁇ 1,4Glc ( ⁇ -1,3) Fuc, Lactodifucotetraose), DFpLNnH (Difucosyl-para-lacto-N-neohexaose), LNFP III (Lacto-N-fucopentoseIII), TFLNH (Trifucosyllactose-N-hexH) II, LND (Lacto-N-difucohexoseII), and sialyl lewisX, can be applied to various ⁇ -1,3 fucosyl oligosaccharide production.
  • lactodifucotetraose Fuc ( ⁇ -1, 2) Gal ⁇ 1,4Glc ( ⁇ -1,3) Fuc, Lactodifu
  • a vector cloned with ⁇ -1,3 fucosyl transferase was used as template DNA and the NdeI restriction enzyme recognition sequence was used.
  • An antisense primer having a sense primer and an Xho I restriction enzyme recognition sequence were prepared, respectively.
  • a sense primer of GACCATATGTTCCAACCCCTATTAG was used, and the antisense primer of TCGACTCTCGAGCACCGCGCGCAACAAAGG was used to remove 9 amino acids in the C-terminal ⁇ -helix structure.
  • an antisense primer of TCGACTCTCGAGATAATTAACCCTCAAATCATCATAATTA was used, and 52 amino acids ( ⁇ -helix structure and 1 heptad repeat structure) were removed.
  • An antisense primer of TCGACTCTCGAGATAATTAACCCTCAAATCATCAATGGAT was used for the preparation, and an antisense primer of TCGACTCTCGAGAATGGATACTAACGGCTT was used to prepare a form in which 59 amino acids were removed (SEQ ID NO: 3), which is an ⁇ -helix structure and two heptad repeat structures.
  • PCR was performed by adding 100 pmol of the template DNA cloned in the DNA polymerase reaction buffer, 0.2 mM dNTP, 2.5 mM MgCl 2 , the pET vector, and the primer pairs described above, respectively, and then using pfu DNA polymerase. Was performed.
  • the reaction conditions were performed a total of 30 times after 95 °C 5 minutes, 95 °C / 30 seconds (denatured), 55 °C / 1 minutes (annealing), 72 °C / 1 minutes (extension).
  • the amplified PCR product was treated with restriction enzymes Nde I and Xho I, respectively, and inserted into pET24ma vector with T7 promoter.
  • the vector used in the present invention may also include all expression vectors having various promoters, including the T7 promoter.
  • the nucleotide sequence of ⁇ -1,3 fucosyl transferase was optimized according to the principle of substituting acylated tRNAs (tRNAs with charges bound to amino acids) with codons that can maintain high levels.
  • the template DNA for sequencing optimization includes a C-terminal ⁇ -helix structure, a ⁇ -helix structure and one heptad repeat structure, and an ⁇ -helix structure and two heptad repeat structures.
  • the optimized nucleotide sequence of ⁇ -1,3 fucosyl transferase in the form of the ⁇ -helix structure and one heptad repeat structure removed is SEQ ID NO: 4, which corresponds to the original sequence SEQ ID NO: 5 and 76% Homology.
  • the optimized gene encoding ⁇ -1,3 fucosyl transferase in a form in which the ⁇ -helix structure and the heptad repeat structure has been removed may be NdeI (sense primer) and an expression vector containing a strong promoter. It was cloned using XhoI (antisense primer) restriction enzyme and designed to have histidine tag at C-terminus.
  • the strong promoter may be selected from the group consisting of trc promoter, tac promoter, T7 promoter, T5 promoter, lac promoter and trp promoter.
  • a recombinant DNA vector cloned with the ⁇ -1,3 fucosyl transferase cloned from the C-terminus of the heptad repeat and the ⁇ -helix structure protein was transformed into E. coli BW25113 (DE3) strain, and the kanamycin antibiotic After inoculation into the included LB medium shaking culture for 5 to 10 hours at 30 to 37 °C, a portion of the culture was inoculated in 50 mL of LB medium containing 50 ⁇ g mL -1 kanamycin antibiotic. After incubation at 30 to 37 °C, when 0.5 to 1 at OD600, 0.01 to 2 mM of IPTG was added and expression was induced for 15 to 20 hours at a temperature of 15 to 37 °C.
  • kanamycin After inoculation into LB containing antibiotics or TB medium containing glycerol and casein digest, shaking culture for 5 to 10 hours at 30 to 37 ° C, and then a portion of the culture solution was LB or TB containing 50 ⁇ g mL -1 kanamycin antibiotic Inoculated in 50 mL of medium. After incubation at 30 to 37 °C, when 0.5 to 1 at OD600, 0.01 to 2 mM of IPTG was added and expression was induced for 15 to 20 hours at a temperature of 15 to 37 °C.
  • the cultured E. coli cells were centrifuged at 4000 rpm for 10 minutes to recover the cells, and the cells were resuspended in distilled water and centrifuged again for 10 minutes to distill water of the supernatant. Removed.
  • the recovered cell precipitate was suspended in 5 mL of 20 mM sodium phosphate buffer, and the cells were crushed by an acoustic wave crusher to obtain a total fraction of protein (aqueous protein + insoluble aggregate), centrifuged at 15000 rpm for 30 minutes, and then the supernatant was separated. Isolation yielded only water soluble protein.
  • Donor substrate of guanosine 5'-diphosphate-fucose and receptor substrate of lactose or N-acetyllactosamine using ⁇ -1,3 fucosyl transferase with increased soluble protein expression and enzyme activity through the present invention 3-fucosyllactose and LewisX were produced.
  • 3-fucosyllactose was produced as in the above reaction conditions using a mutant having increased activity from ⁇ -1,3 fucosyl transferase with the highest soluble protein expression, and the yield of 3-fucosyllactose was 95. Increased to% and was able to produce 2.3 g / L. This indicates that the production yield of the initial ⁇ -1,3 fucosyl transferase before the present invention was 31 times improved, and the productivity was 2.41 g / L / h, which was also 441 times higher than that of the present invention (FIG. 4).
  • the reaction was carried out at 37 °C using a cell extract of 10% (v / v) of the total reaction volume of 3-fucosyllactose Production yields were compared.
  • the yield of 3-fucosyllactose production of the variant compared to wild type is shown in FIG. 5, and as examples of the variants, single and combination variants of A128N, A128N + H129E, A128N + H129E + Y132I, and A128N + H129E + S46F are all wild-type. Yield and reaction rate were increased, and the initial reaction rate U / mL of the combination variant of A128N + H129E + S46F was 15 times higher than that of wild type.
  • Lewis X was produced using the variant of ⁇ -1,3 fucosyl transferase produced by the present invention.
  • As LewisX production reaction conditions 5 mM guanosine 5'-diphosphate-fucose, 5 mM N-acetyllactosamine, 5 mM MgCl 2 and 5% of the total reaction volume under 50 mM sodium phosphate buffer (v / v ) was added to the cell extract of ⁇ -1,3 fucosyl transferase was carried out at 37 °C.
  • Lewis X In the production of Lewis X using a variant of ⁇ -1,3 fucosyl transferase, the yield increased to 100% when using a variant compared to wild strain, which showed a yield of 63% after 3 hours of reaction, resulting in 2.65 g / L Lewis. X was produced.
  • the LewisX production yield of the variant relative to the wild type is shown in Figure 6, and as examples of the variants, single and combination variants of A128N, A128N + H129E, A128N + H129E + Y132I, and A128N + H129E + S46F all yield and yield higher than wild type.
  • the reaction rate was increased, and the initial reaction rate U / mL of the A128N + H129E + S46F variant was 5.2 times higher than that of the wild type.
  • a primer in which an NNK sequence (N is A, C, G or T, and K is G or T) is substituted with a sequence corresponding to amino acid position 128 of ⁇ -1,3 fucosyl transferase by an arbitrary sequence.
  • N is A, C, G or T
  • K is G or T
  • the entire vector was PCR to build a library.
  • ⁇ -1,3 fucosyl transferase of the present invention is the first methionine sequence from the first methionine (methionine) sequence number is methionine.
  • the amplified gene of the fucosyl transferase including the vector sequence was transformed into E. coli DH5 ⁇ after Dpn I enzyme treatment to remove the original plasmid. Mutant genes were extracted from all colonies generated and transformed into E. coli BW25113 (DE3). Each transformed colony was inoculated in 500 ⁇ L of TB medium containing kanamycin on 96-well and shaken for 18 to 24 hours at 30 to 37 ° C., and then a portion of the culture solution was diluted with 50 ⁇ g mL ⁇ 1 kanamycin and IPTG (Isopropyl ⁇ ).
  • reaction solution contains 1-10 mM Tris buffer (pH8.0), 1-5 mM guanosine 5′-diphosphate-fucose, 5-10 mM lactose, 0.1-1 mM pH indicator
  • the cell extract of the fucosyl transferase was added and the reaction proceeded at 37 ° C., and the absorbance was measured at a time interval of 15 to 30 minutes.
  • the colorimetric method of sugar transfer enzymes is a measure of pH change due to hydrogen ions generated when glycosidic bonds between sugar donors and receptors are formed, which is proportional to the productivity of fucosylactose.
  • the decrease in absorbance at 560 nm in which the red color of the indicator phenol red decreases was analyzed by using a spectral machine [Application No. 10-2013-0039938].
  • the A128N variant was searched as a 'hot spot', and then repeated saturation was performed using the above method for the positions 129 and 132 sequentially, and the combination variants of A128N and H129E, A128N, H129E, and Combination variants of Y132I were generated.
  • the variation of the 128th, 129th, and 132th amino acid positions is designated as Cluster 1
  • the variation of the 46th amino acid position is designated as Cluster 2 to generate a combination variant between clusters, thereby combining A128N, H129E, Y132I, and S46F. Variants were generated.
  • Examples of such combinatorial variants are not limited to the embodiments of the present invention, and can generate combinatorial variants in which two, three or four amino acids are substituted from cluster 1 and cluster 2.
  • the substituted amino acid is not limited to the embodiment of the present invention, and may be substituted with other amino acids.
  • ⁇ -1,3 fucosyl delivery is enhanced in the production of ⁇ -1,3 fucosyl oligosaccharides by increasing the soluble protein expression and enzyme activity through changes in the terminal structure, sequencing and protein engineering.
  • enzyme variants and optimizing enzyme reactions and applying them to the production of ⁇ -1,3 fucosyloligosaccharides to increase yields and productivity they are applicable to various industries such as infant foods and functional foods as well as pharmaceuticals. It is possible.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 가용성 단백질 발현량 및 활성이 증대된 α-1,3 푸코실 전달효소 변이체, α-1,3 푸코실 전달효소 변이체를 코딩하는 DNA, α-1,3 푸코실 전달효소 변이체를 코딩하는 DNA를 포함하는 재조합 DNA 벡터, 상기 재조합 DNA 벡터로 형질전환된 숙주세포 및 숙주세포의 추출물, 3-푸코실올리고당의 제조 방법, 푸코실 전달효소 변이체 제조방법 및 푸코실 전달효소의 변이체 탐색방법을 제공하는 것으로서, 본 발명의 α-1,3 푸코실 전달효소 변이체는 가용성 단백질의 발현량 및 효소 활성이 획기적으로 향상된 효과가 있다.

Description

가용성 단백질 발현량 및 활성이 증대된 헬리코박터 파일로리 유래 α-1,3 푸코실 전달효소의 유전자와 단백질 및 α-1,3 푸코실올리고당 생산에의 응용
본 발명은 α-1,3 푸코실 전달효소의 난발현성 재조합 단백질에 대한 가용성 단백질 발현의 증가와 단백질 공학적 효소 변이를 통한 푸코실 전달효소의 변이체 생성 방법에 관한 것으로, 활성형의 푸코실 전달효소를 코딩하는 최적화된 유전자와 이를 포함하는 발현벡터, 상기 유전자의 발현 방법 및 가용성 단백질 발현량과 효소 활성이 증대된 α-1,3 푸코실 전달효소의 변이체를 이용하여 푸코실올리고당을 합성하는 것에 관한 발명이다.
모유는 유아에게 필수적인 영양소를 제공하는 것뿐 아니라 단순한 영양소의 개념을 넘어 다양한 건강상의 이익을 제공한다. 모유 올리고당은 기능성 성분으로 구성되어 있으며 우유보다 100-200배 많은 1L당 5-10 g의 올리고당을 포함하며, 지금까지 130 종류 이상의 모유 올리고당이 확인되었다. 이들 올리고당의 함유량과 구조적 다양성은 우유와 달리 모유에 있어서 매우 특이적이다. 모유 올리고당 중, 푸코실올리고당은 우유에 1% 미만으로 함유되어있는 반면, 모유에는 50-80% 가량으로 대량 존재한다. 특히 환원 말단에 락토오스 (lactose)를 가지며 글루코오스 (glucose)에 푸코오스 (fucose)가 α-1,3 결합으로 연결된 3-푸코실락토오스 (3-fucosyllactose)는 우유에는 존재하지 않지만 모유에는 1.0 g/L 정도가 함유되어 있다.
모유 유래 푸코실올리고당의 인체 내 기능을 살펴보면, 첫 번째로 프리바이오틱스 (prebiotics)로서 젖산균 (Lactobacillus) 및 비피더스균 (Bifidobacteria)과 같은 장내 유용한 미생물의 생장을 촉진시키는 반면 클로스트리디움 (Clostridium)과 같은 유해 병원균의 생장을 막는 역할을 한다. 이는 짧은 길이 (chain)의 푸코실올리고당을 탄소원으로 사용할 수 있는 비피더스균에 기인하며, 이와 같은 유용한 미생물 균총의 균형을 유지함으로써 감염증 치료 및 예방, 항암작용, 숙주면역기능 자극, 비타민 섭취 증진과 같은 건강 증진에 효능이 있는 것으로 연구되어왔다.
두 번째로, 푸코실올리고당은 유해 박테리아나 바이러스 초기 감염 과정에서의 숙주세포의 장내 상피표면에의 부착을 막는 저해제로서 연구가 되어왔다. 3-푸코실락토오스 (Galβ1,4Glc(α-1,3)Fuc)는 호흡기 병원균인 녹농균 (Pseudomonas aeruginosa)과 장독성원소 대장균, 클로스트리디움, 살모넬라 피리스균 (Salmonella fyris)의 수용체에 대한 인식물질이 될 수 있어 이들의 침입을 경쟁적으로 저해할 수 있는 것으로 연구되었다. 이와 같은 역할을 하는 3-푸코실락토오스를 포함하는 다양한 모유 유래 푸코실올리고당은 유아식품과 기능성 식품 분야뿐 아니라 의약분야 등의 다양한 산업적 응용이 가능하다.
다양한 모유 유래 푸코실올리고당 뿐 아니라, 푸코당은 시알릴 루이스X (Neu5Ac(α-2,3)Galβ1,4GlcNAc(α-1,3)Fuc, sialyl-lewisX)의 형태로서 백혈구 세포 표면에 발현되어, 조직의 상피세포 표면에 발현된 렉틴 (lectin)과 결합함으로써 염증초기 단계에서 백혈구를 유도하는 역할을 한다. 면역 반응 조절에 있어 임상적 의의를 가지는 시알릴 루이스X는 면역 관련 질병의 치료에 사용 가능하며, 그 예로서 인체의 면역 시스템이 비정상적으로 염증반응을 유도하여 자가조직을 손상시키는 면역질병의 경우, 시알릴 루이스X가 백혈구와 렉틴의 결합에 대한 저해제의 역할을 함으로써 항염증제 (anti-inflammatory reagent)로서 이용될 수 있다.
모유 유래 푸코실올리고당은 초유에서 추출하여 공급하는 경우 대량생산을 하기 어려운 단점이 있으며, 푸코실올리고당의 화학적합성의 경우, 올리고당 입체구조의 조절 및 선택성 유지를 위하여 복잡한 보호-탈보호 (protection-deprotection) 반응을 거쳐야 하는 것과 독성시약을 사용해야 한다는 문제점으로 인해 식품 또는 제약산업에 있어서 일반화된 공정으로 개발되기 어렵다는 단점을 가지고 있다.
이러한 측면에서 생물공학적 공정을 통한 합성기술이 경제적 규모의 올리고당 생산을 위한 최선의 대안으로 인식되어, 이들에 대한 연구가 진행되고 있다. 푸코실올리고당의 생물공학적 공정은 푸코오스의 공여체인 구아노신 5'-이인산-푸코오스 (guanosine 5'-diphosphate fucose, GDP-fuc)라는 매우 고가의 기질이 필요하기 때문에, 구아노신 5'-이이산-만노오스 (GDP-mannose) 또는 푸코오스로부터 구아노신 5'-이인산-푸코오스를 생산하고 푸코실 전달효소를 이용하여 푸코실올리고당을 생산하는 연구가 진행되어왔다. 푸코오스의 공여체인 구아노신 5'-이인산-푸코오스로부터 수용체 기질로 푸코오스를 효율적으로 전달하기 위해서는 푸코실 전달효소의 촉매능력이 매우 중요하다고 볼 수 있다.
본 발명에 이용된 α-1,3 푸코실 전달효소는 글루코오스 또는 N-아세틸글루코사민 (N-acetylglucosamine)의 3번 탄소에 α-1,3 결합으로 푸코오스를 전달하는 효소로서, 헬리코박터 파일로리 26695 균주에서 유래하며, Bernard Priem 그룹에서 프레임에 맞도록 polyC 중 시토신 (cytosine)하나를 제거하여 활성형의 3-푸코실전달효소를 발현하였고, 락토오스, N-아세틸락토사민 (N-acetyllactosamine) 및 다양한 올리고당에 대해 기질특이성을 가지고 있음을 확인하였다 [Claire Dumon, Assessment of the two Helicobacter pylori α-1,3-fucosyltransferase ortholog genes for the large-scale synthesis of LewisX human milk oligosaccharides by metabolically engineered Escherichia coli, Biotechnology Progress, 2004, 20, 412-9p].
헬리코박터 파일로리 26695 유래의 α-1,3 푸코실 전달효소는 C 말단에 류신 지퍼 (leucine-zipper)와 같은 7개 아미노산의 반복서열이 존재하는데, 이 반복서열의 개수에 따라서 효소의 기질특이성에 차이가 발생한다는 보고가 있다.
한편, 푸코실올리고당을 합성하기 위해 푸코오스의 공여체인 구아노신 5'-이인산-푸코오스의 합성과 푸코실 전달효소 반응을 동시에 이용한 생체 내 (in vivo)와 생체 외 (in vitro) 반응이 시행되어왔다. 푸코실 전달효소의 푸코오스의 공여체인 구아노신 5'-이인산-푸코오스는 샐비지 경로 (salvage pathway)의 두 가지 효소활성을 가지는 FKP (L-fucokinase/GDP-fucose pyrophosphorylase) 효소에 의해 L-푸코오스로부터 생성될 수 있으며, 이로부터 푸코실 전달효소에 의해 푸코오스를 수용체 (예: 락토오스)로 전달할 수 있다. α-1,3 푸코실 전달효소를 이용한 상기 생체 내외 반응에 있어서, FKP 효소는 α-1,3 푸코실 전달효소에 비해 상대적으로 대장균에서의 가용성 단백질 발현량 및 효소 활성이 높기 때문에, 이 반응에 있어서 푸코실 전달효소반응 자체가 속도 결정 단계 (rate determining step)인 것으로 확인되었다. 속도 결정단계인 푸코실 전달반응을 증대시키기 위해서는 α-1,3 푸코실 전달효소의 대장균에서의 가용성 단백질 발현 및 효소 활성 증대가 매우 필요하다.
헬리코박터 파일로리 유래 α-1,3 푸코실 전달효소는 지금까지 대장균 내에서 전체 단백질 발현량 및 가용성 단백질의 발현량이 낮고 특히 락토오스 기질에 대한 효소 활성이 매우 낮아, 생체 내 및 생체 외 푸코실올리고당 생산 반응에 있어서 푸코실 전달반응이 느린 어려움이 있어왔다.
본 발명에서 사용된 α-1,3 푸코실 전달효소는 헬리코박터 파일로리 26695 균주에서 유래하며 C-말단에 류신 지퍼 형태의 7개 아미노산의 반복서열 (헵타드 리피트, heptad repeat)인 D(D/N)LR(V/I)NY을 2개 가지고 있는 효소이다. 헬리코박터 파일로리 균주 유래의 α-1,3 푸코실 전달효소들은 효소에 따라 C-말단에 2개 내지 10개의 헵타드 리피트 구조와 α-헬릭스 구조를 가지고 있으며, 모든 경우에 있어서 대장균 내에서 가용성 단백질의 발현량이 매우 낮은 문제점이 있었다. 이에 따라 기존에 헵타드 리피트를 8개 또는 10개 가지고 있는 α-1,3 푸코실 전달효소에 대해 융합단백질 도입 또는 드문 코돈 (rare codon)의 tRNA를 제공할 수 있는 발현 균주를 사용하거나, 세포막과 결합할 수 있는 부분을 절단 (truncation)하고자 하는 시도가 있었으나, 이들의 대장균 내 가용성 단백질의 양은 1 L 배양 당 4 내지 15 mg으 로, 여전히 낮은 수준에 머물러 있다.
본 발명에서는 N-아세틸락토사민 기질뿐 아니라 특히 락토오스 기질에 대한 특이성이 있는 헬리코박터 파일로리 26695 유래의 α-1,3 푸코실 전달효소의 대장균 내 가용성 단백질 발현량을 극대화하고자 하였다.
생체 내 또는 생체 외 반응에 있어서 α-1,3 푸코실올리고당을 경제적으로 대량생산하기 위해서는 수율 증대와 생산성 증가 면에서 가용성 단백질의 발현량 증가와 함께 효소활성 증가가 필요하다. 지금까지 밝혀진 α-1,3 푸코실 전달효소의 결정 구조는 헬리코박터 파일로리 NCTC11639 유래의 효소가 한 개 있으나, 현재까지 푸코실 전달효소는 낮은 가용성 단백질 발현량으로 인해 효율적인 스크리닝 (screening) 방법을 적용하기 어려웠을 뿐 아니라 단백질 공학적 변이를 통한 효소 변이의 시도가 전무하였다. 따라서 본 발명에서는 상기 가용성 단백질 발현량이 증대된 α-1,3 푸코실 전달효소를 이용하여 락토오스를 포함한 다양한 수용체 기질에 대해 야생주 대비 효소 활성이 증대된 변이체를 탐색하고자 하였다.
본 발명은, α-1,3 푸코실올리고당을 생산함에 있어서 단백질의 말단 구조의 변화 및 염기서열 치환과 단백질 공학 변이를 통하여 가용성 단백질 발현량 및 효소활성이 증대된 α-1,3 푸코실 전달효소의 변이체를 만들고, 효소 반응 최적화와 함께 이를 α-1,3 푸코실올리고당 생산에 적용하여 수율 및 생산성을 증가시키는 것을 골자로 하고 있다.
본 발명의 목적은 가용성 단백질 발현량 및 활성이 증대된 α-1,3 푸코실 전달효소 변이체를 제공하는 것이다.
또한, 본 발명의 목적은 α-1,3 푸코실 전달효소 변이체를 코딩하는 DNA, α-1,3 푸코실 전달효소 변이체를 코딩하는 DNA를 포함하는 재조합 DNA 벡터, 상기 재조합 DNA 벡터로 형질전환된 숙주세포 및 숙주세포의 추출물을 제공하는 것이다.
또한, 본 발명의 목적은 α-1,3 푸코실올리고당의 제조 방법을 제공하는 것이다.
또한, 본 발명의 목적은 푸코실 전달효소 변이체 제조방법 및 푸코실 전달효소의 변이체 탐색방법을 제공하는 것이다.
본 발명은 헬리코박터 파일로리 유래의 α-1,3 푸코실 전달효소의 난발현성 재조합 단백질에 대한 가용성 단백질 발현량을 증가시키는 방법과, 발현량이 증대된 활성형의 α-1,3 푸코실 전달효소의 단백질 및 이를 코딩하는 최적화된 유전자 서열정보를 제공한다.
또한, 상기 α-1,3 푸코실 전달효소의 가용성 단백질 발현량을 극대화하기 위해, 상기 유전자를 효과적으로 발현하는 방법을 제공한다.
또한, 상기 가용성 단백질 발현량이 증대된 α-1,3 푸코실 전달효소를 코딩하는, 최적화된 유전자를 포함하는 발현벡터와 재조합 DNA 벡터로 형질 전환된 숙주세포를 제공한다.
또한, 상기 가용성 단백질 발현량이 증대된 α-1,3 푸코실 전달효소를 이용하여 α-1,3 푸코실올리고당 제조 방법을 제공한다. 즉, 가용성 단백질 발현량이 증대된 α-1,3 푸코실 전달효소를 이용하여 α-1,3 푸코실올리고당 생산의 수율 및 생산성을 향상시키는 것이다.
또한, 본 발명은 푸코실 전달효소의 변이체를 생성하기 위한 부분-논리적 (semi-rational) 방법과 반복적 포화변이 (iterative saturation mutagenesis)가 결합된 방법을 제공한다. 부분-논리적 방법은 방향성 진화 (directed evolution)와 논리적 예측 (rational design) 방법을 결합한 것으로서, 양질의 적은 수의 변이체 라이브러리만을 확보하고자 하기 위함이다. 이 방법은 단백질의 목적이 되는 부분을 선택하고 단백질의 서열, 구조와 기능 및 컴퓨터 프로그램을 이용하여 특정 아미노산의 잔기를 선택하여 변이를 수행하는 것을 말한다. 또한 반복적 포화변이는 상기 방법에 의해 탐색된 변이체를 주형으로 하여 또 다른 특정 아미노산의 변이를 일으킴으로써 더 향상된 변이체를 탐색하는 것을 말한다.
또한, 본 발명은 α-1,3 푸코실 전달효소의 단일 아미노산이 변화한 서열번호 6, 7, 8 및 9의 변이체와 반복적 포화변이에 의해 생성된 이들의 조합적 변이체에 대한 서열번호 10, 11, 12, 13, 14, 15 및 16의 아미노산 서열을 제공한다. 또한 상기 변이체를 코딩하는 푸코실 전달효소의 유전자 및 이를 포함하는 재조합 DNA 벡터, 그리고 재조합 DNA 벡터로 형질 전환된 숙주세포를 제공한다.
또한, 상기 가용성 단백질 발현량 및 활성이 증대된 α-1,3 푸코실 전달효소의 변이체를 이용한 α-1,3 푸코실올리고당 생산방법을 제공한다. 즉, 가용성 단백질 발현량 향상 및 단백질 공학적 변이를 통해 개량된 헬리코박터 파일로리 26695 유래의 α-1,3 푸코실 전달효소를 이용하여 α-1,3 푸코실올리고당 생산의 수율 및 생산성을 향상시키는 것이다.
구체적으로 본 발명은 하기를 제공한다.
본 발명은 하기의 (a) 내지 (p) 에서 선택되는 어느 하나의 서열로 표시되는 α-1,3 푸코실 전달효소 변이체 :
(a) 서열번호 1 의 아미노산 서열;
(b) 서열번호 2 의 아미노산 서열;
(c) 서열번호 3 의 아미노산 서열;
(d) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열과 95% 이상의 상동성을 가지고 푸코실 전달의 활성을 갖는 아미노산 서열;
(e) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환된 서열;
(f) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 129 번째의 아미노산이 산성이며 친수성 아미노산으로 치환된 서열;
(g) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 132 번째의 아미노산이 타이로신 및 히스티딘을 제외한 아미노산으로 치환된 서열;
(h) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 46 번째의 아미노산이 소수성 아미노산으로 치환된 서열;
(i) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 129 번째의 아미노산이 산성이며 친수성 아미노산으로 치환된 서열;
(j) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 132 번째의 아미노산이 타이로신 및 히스티딘을 제외한 아미노산으로 치환된 서열;
(k) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 46 번째의 아미노산이 소수성 아미노산으로 치환된 서열;
(l) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 129 번째의 아미노산이 산성이며 친수성 아미노산으로 치환되고, 132 번째의 아미노산이 타이로신 및 히스티딘을 제외한 아미노산으로 치환된 서열;
(m) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 129 번째의 아미노산이 산성이며 친수성 아미노산으로 치환되고, 46 번째의 아미노산이 소수성 아미노산으로 치환된 서열;
(n) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 132 번째의 아미노산이 타이로신 및 히스티딘을 제외한 아미노산으로 치환되고, 46 번째의 아미노산이 소수성 아미노산으로 치환된 서열;
(o) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 129 번째의 아미노산이 산성이며 친수성 아미노산으로 치환되고, 132 번째의 아미노산이 타이로신 및 히스티딘을 제외한 아미노산으로 치환되고, 46 번째의 아미노산이 소수성 아미노산으로 치환된 서열;
(p) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산, 129 번째의 아미노산, 132 번째의 아미노산 및 46 번째의 아미노산으로 이루어진 군에서 선택된 하나 이상의 아미노산이 치환된 것을 특징으로 하는, 아미노산 서열;
또한, 본 발명은 서열번호 6 내지 16 의 아미노산 서열로 표시되는 α-1,3 푸코실 전달효소 변이체를 제공한다.
또한, 본 발명은 서열번호 6 내지 16 중 어느 하나의 아미노산 서열의 치환된 부위를 포함하며 해당 아미노산 서열과 75% 이상의 상동성을 갖는, 푸코실 전달의 활성을 가지는 단백질을 제공한다.
또한, 본 발명은 α-1,3 푸코실 전달효소 변이체를 코딩하는, 서열번호 4로 표시되는 DNA, 서열번호 4와 77% 이상의 상동성을 갖는 DNA, 및 17 내지 27의 서열번호로 표시되는 DNA를 제공한다.
또한, 본 발명은 상기 DNA를 포함하는 재조합 DNA 벡터, 상기 재조합 DNA 벡터로 형질전환된 숙주세포 및 숙주세포의 추출물을 제공한다.
또한, 본 발명은 재조합 DNA 벡터로 형질전환된 숙주세포 또는 숙주세포의 추출물을 생촉매로 사용한, 3-푸코실올리고당의 제조 방법을 제공한다.
또한, 본 발명은 하기의 순차적인 단계를 포함하는, α-1,3 푸코실 전달효소 변이체 제조 방법을 제공한다.
(1) 하기의 방법 중 어느 하나를 포함하는, 잔기 또는 아미노산을 선택하는 단계.
(a) 푸코실 전달효소의 결정 구조 또는 모델 구조에서의 필수 주요 아미노산으로부터 5 내지 20 Å 이내의 잔기들을 선택하는 방법.
(b) 상기 (a) 방법에 있어서, E96 아미노산으로부터 5 내지 20 Å 이내의 잔기들을 선택하는 방법.
(c) 상기 (a) 방법에 있어서, 단백질의 구조로부터 활성부위 (active site) 또는 기질 접근 터널에 위치한 아미노산들에 대하여 진화론적으로 변화를 줄 수 있는 아미노산을 선택하는 방법.
(d) 푸코실 전달효소의 결정 구조 또는 모델 구조에서의 두 개의 기질 결합 부위로부터 5 내지 20 Å 이내의 잔기들을 선택하는 방법.
(e) 상기 (d) 방법에 있어서, 단백질의 구조로부터 활성부위 (active site) 또는 기질 접근 터널에 위치한 아미노산들에 대하여 진화론적으로 변화를 줄 수 있는 아미노산을 선택하는 방법.
(2) 상기 선택된 잔기에 대해 반복적 포화변이를 수행하거나, 선택된 잔기에 대해 클러스터를 형성하여 조합적 변이체를 생성하는 단계.
또한 본 발명은 pH 변화에 의한 지시약을 이용하는 반응을 수행하는 것을 특징으로 하는, 푸코실 전달효소의 변이체 탐색 방법을 제공한다.
본 발명의 가용성 단백질의 발현량 및 효소 활성이 획기적으로 향상된 α-1,3 푸코실 전달효소는 모유 유래 올리고당인 3-푸코실락토오스 뿐만 아니라 루이스X를 포함하여 다양한 고부가가치의 α-1,3 푸코실올리고당 생산에 적용할 수 있다.
구체적으로, α-1,3 푸코실 전달효소의 단위 배양 당 획득 가능한 효소의 양이 대폭 증가 (11 내지 50배)하였고, 단위 효소 당 활성이 증대되어 효소 사용의 재료비 감소 및 푸코실올리고당 생산성 증가로 인한 생산 시간 단축과 공정개선에 따른 생산 비용 절감이 가능하게 되었다. 또한 5 mM 공여체 기질인 GDP-fuc를 이용한 반응에 있어, GDP-fuc 농도 대비 생산 수율이 95 내지 100%로 증대되어 기질의 효율성 면에서 사용한 기질 양 대비 생산물질이 증대하여, 효율성이 기존에 비해 월등히 향상되었으며, 이로 인해 향후 경제적 대량생산을 가능케 하였고, 3-푸코실올리고당의 대량 생산을 하고자 함에 있어서 상대적으로 값싼 수용체 기질의 양을 높이고 생산물의 수율은 대폭 올림으로써 기질 사용 비용 대비 생산물로 인한 고수익 창출이 가능하다.
또한, 상기 3-푸코실올리고당의 대량생산을 통해 식품, 의약품 등의 다양한 활용이 가능하다.
또한, 부분-논리적 (semi-rational) 방법과 반복적 포화변이 (iterative saturation mutagenesis)가 결합된 단백질 공학적 변이 방법을 통하여, 본 발명의 푸코실 전달효소뿐 만 아니라 다양한 효소의 변이체 생성에 적용할 수 있다.
도 1은 구아노신 5'-이인산-푸코오스와 수용체 기질로부터 α-1,3 푸코실 전달효소를 이용한 α-1,3 푸코실올리고당의 합성 도식도 및 본 발명을 통한 푸코실올리고당의 생산 수율 증대 그래프를 나타낸다.
도 2는 본 발명의 α-1,3 푸코실 전달효소의 체계적인 C-말단 제거 (a)에 따른 3-푸코실락토오스의 생산에 있어 각 효소의 상대적인 활성 (b)을 나타낸 것으로, Δ9는 소수성 또는 양전하를 띄는 α-헬릭스로 추정되는 부분 중 9개의 아미노산을 제거한 형태이며, Δ45는 α-헬릭스로 추정되는 부분인 45개의 아미노산을 제거한 형태이며, Δ52는 α-헬릭스로 추정되는 부분과 1개의 헵타드 리피트 구조인 52개의 아미노산을 제거한 형태이며, Δ59는 α-헬릭스로 추정되는 부분과 2개의 헵타드 리피트 구조인 59개의 아미노산을 제거한 형태이다.
도 3 (a)는 본 발명의 α-1,3 푸코실 전달효소의 체계적인 C-말단 제거에 따른 도 2의 절단된 형태의 각각의 단백질에 대한 전체 단백질 분획 (total protein, T)과 가용성 단백질 (soluble protein, S)을 나타내며, 도 3 (b)는 상기 α-1,3 푸코실 전달효소의 C-말단 제거 이후 염기서열 최적화 이후의 전체 단백질과 가용성 단백질을 나타낸다. 또한 도 3 (b)는 상기 α-1,3 푸코실 전달효소의 C-말단 제거 및 염기서열 최적화와 숙주세포의 배양 배지의 최적화 이후의 전체 단백질 및 가용성 단백질 발현량을 나타낸다.
도 4는 본 발명의 α-1,3 푸코실 전달효소의 가용성 단백질 및 효소 활성 증대에 따른 3-푸코실락토오스의 생산 수율 및 생산량 (g/L) 증대를 나타낸 그래프이다. 상기 그래프의 생산 수율 (%)은 효소 반응 초기의 구아노신 5'-이인산-푸코오스의 농도에 따른 생성된 3-푸코실락토오스의 수율을 나타낸다. 3FT는 본래의 α-1,3 푸코실 전달효소이며, C-말단 절단 (C-terminus truncation)은 α-헬릭스 구조와 1개의 헵타드 리피트 구조가 제거된 형태의 α-1,3 푸코실 전달효소이며, 코돈 최적화 및 절단 (Codon optimized_truncation)은 상기 α-헬릭스 구조와 1개의 헵타드 리피트 구조가 제거된 형태의 α-1,3 푸코실 전달효소의 염기서열이 최적화된 효소이며, 반응 최적화 (Rxn_optimization)는 상기 α-헬릭스 구조와 1개의 헵타드 리피트 구조가 제거된 형태의 α-1,3 푸코실 전달효소의 염기서열 최적화 및 숙주 세포의 배양 배지 최적화와 반응 시 수용체 기질 농도 최적화에 의한 결과이다. 또한, 효소 공학 (Enzyme engineering)은 상기 단계들에 의해 가용성 단백질이 증대된 α-1,3 푸코실 전달효소의 단백질 공학적 효소 변이에 의한 결과를 나타낸다.
도 5는 본 발명의 α-1,3 푸코실 전달효소의 야생주 및 변이체를 이용한 3-푸코실락토오스의 생산 수율을 나타낸 그래프이다. 상기 그래프의 생산 수율 (%)은 효소 반응 초기의 구아노신 5'-이인산-푸코오스의 농도에 따른 생성된 3-푸코실락토오스의 수율을 나타낸다.
도 6은 본 발명의 α-1,3 푸코실 전달효소의 야생주 및 변이체를 이용한 루이스X의 생산 수율을 나타낸 그래프이다. 상기 그래프의 생산 수율 (%)은 효소 반응 초기의 구아노신 5'-이인산-푸코오스의 농도에 따른 생성된 루이스X의 수율을 나타낸다.
본 발명에서 사용되는 용어는 당업계에서 통상적으로 사용되는 것으로 당업자라면 그 의미를 누구나 이해할 수 있을 것이나, 본 명세서에서 간략히 설명하면 다음과 같다:
(1) 푸코실 전달효소는 당 공여체인 구아노신 5'-이인산-푸코오스로부터 푸코오스를 당 수용체 물질에 전달하는 효소를 의미한다.
(2) 수용체 기질 중 하나인, 락토오스는 Galβ1,4Glc (갈락토오스와 글루코오스가 β1,4 결합으로 연결됨)로 구성된 올리고당이며, 또한 수용체 기질 중 하나인 N-아세틸락토사민은 Galβ1,4GlcNAc (갈락토오스와 N-아세틸글루코사민이 β1,4 결합으로 연결됨)으로 구성된 올리고당이다.
(3) α-1,3 푸코실올리고당 (3-푸코실올리고당)은 푸코오스가 글루코오스 또는 N-아세틸글루코사민 부분에 α-1,3 결합으로 연결된 올리고당을 의미하며, 글루코오스 또는 N-아세틸글루코사민 외에 다른 당이 더 결합할 수 있다.
(4) 3-푸코실락토오스는 Galβ1,4Glc(α-1,3)Fuc (푸코오스가 락토오스의 글루코오스에 α-1,3 결합으로 연결됨)로 구성된 삼탄당 (triose) 물질을 의미하며, 루이스X는 Galβ1,4GlcNAc(α-1,3)Fuc (푸코오스가 N-아세틸락토사민의 N-아세틸글루코사민에 α-1,3 결합으로 연결됨)로 구성된 삼탄당 물질을 의미한다.
(5) '형질전환'은 DNA를 숙주로 도입하여 DNA가 염색체 외 인자로서 또는 염색체 통합완성에 의해 복제 가능하게 되는 것을 의미한다.
(6) 세포추출물은 푸코실 전달효소가 발현된 본 발명의 미생물 추출물을 의미한다.
(7) 세포추출을 이용한 반응은 특정 효소를 포함하는 세포를 파쇄하여 세포 내용물을 이용하거나 또는 효소를 분리정제하지 않고 온전한 세포 전체를 이용한 반응을 의미한다.
(8) 단백질의 코돈 최적화란 아미노산 서열은 변화하지 않고, 해당 아미노산을 코딩하는 뉴클레오티드 서열을 변화시키는 것이다. 보통 원하는 숙주세포에서의 단백질 발현을 높이고자 사용되며, 코돈 최적화는 코돈 사용빈도, GC 서열 %, RNA 2차 구조 형성, 반복서열의 제거 유무, tRNA 선호도 등 그 원리가 필요에 따라 다양할 수 있으며, 어느 하나의 원리에 제한된 것은 아니다.
(9) 친수성 (hydrophilic) 아미노산은 물과 수소결합을 이룰 수 있는 전기음성도가 큰 원자 (산소, 질소, 황)를 기능기 (functional group)에 포함하고 있는 아미노산을 말하며, 세린 (serine), 트레오닌 (threonine), 시스테인 (cystein), 티로신 (tyrosine), 아스파르트산 (aspartic acid), 글루탐산 (glutamic acid), 아스파라긴 (asparagine), 글루타민 (glutamine), 히스티딘 (histidine), 라이신 (lysine), 아르기닌 (arginine)을 포함한다.
(10) 산성 (acidic) 아미노산은 아스파르트산이나 글루탐산과 같이 측쇄에 카르복실기가 있고, 중성용매 내에서 음전하를 띠며 산성을 나타내는 아미노산을 말한다.
(11) 소수성 (hydrophobic) 아미노산은 곁사슬에 소수성, 즉 물 분자에 대한 친화력이 없거나 거의 없는 성질로서 표면이 물에 불용성인 성질을 갖는 것으로서, 이소류신 (isoleucine), 류신 (leucine), 발린 (valine), 메티오닌 (methionine), 페닐알라닌 (phenylalainine), 트립토판 (tryptophane), 프롤린 (proline), 글리신 (glycine), 알라닌 (alanine)을 포함한다.
(12) PCR은 중합 효소 연쇄반응 (Polymerase Chain Reaction)으로서, DNA의 어떤 영역을 특이적으로 증폭시키는 방법을 의미한다.
(13) 포화 변이 (saturation mutagenesis)는 유전자의 지정된 위치에 다양한 염기배열의 변화를 도입하는 것을 말한다. 포화 변이는 주형가닥에 결합하는 상보적인 서열의 프라이머 (primer)상에 변이시키고자 하는 서열대신 NNN 또는 NNK 코돈 (codon) 등을 삽입하여 PCR을 통해 변이를 삽입시키는 것을 말한다. 이 때, NNK 코돈에서 N은 뉴클레오티드의 A, T, G, C를 의미하며 K는 T, G를 의미한다.
(14) 벡터는 단일가닥, 이중가닥, 원형 또는 초나선 DNA 또는 RNA로 이루어진 폴리뉴클레오티드를 의미하며, 재조합 단백질을 생산할 수 있도록 적절한 거리에 작동적으로 연결되어 있는 구성요소들을 포함할 수 있다. 이러한 구성요소에는 복제 오리진, 프로모터, 인핸서, 5'mRNA 리더 서열, 리보솜 결합부위, 핵산 카세트, 종결 및 폴리아데닐화 부위, 또는 선별 가능한 표지 서식 등이 포함될 수 있으며, 상기 구성요소들은 특이적인 용도에 따라 하나 또는 그 이상이 빠질 수도 있다. 핵산 카세트는 발현할 재조합 단백질의 삽입을 위한 제한효소 부위를 포함할 수 있다. 기능적 벡터에 있어서, 핵산 카세트는 번역 개시 및 종결 부위를 포함하는 발현될 핵산 서열을 함유하며, 필요에 따라 벡터에 내에 두 종류의 카세트를 삽입할 수 있는 벡터를 사용하기도 하며 상기 언급한 기능들이 부가적으로 서열화 될 수 있다.
(15) 재조합 DNA 벡터에 삽입된 유전자는 발현용 대장균 균주 BW25113(DE3), BL21(DE3) 등을 사용할 수 있으나, 삽입된 벡터의 종류에 따라 달라질 수 있다. 이러한 벡터 및 발현 균주는 당업자라면 용이하게 선택할 수 있다.
(16) pH 지시약 (pH indicator)은 적정을 하면서 중화점을 알기 위해, 혹은 수소이온의 농도를 알기 위해서 주로 사용되는 것을 말한다. 지시약은 수소이온 지수에 따라 산형 및 염기형으로 되어 색조가 다르며 이 영역을 변색영역이라 부른다. 분광광도법에 의해 흡광도에 따른 수소 이온의 농도를 측정할 수 있다.
(17) 고유활성도 (specific activity)는 효소정제를 통해 불순물 및 다른 단백질을 제거한 순수한 단백질의 단위량당 활성을 나타내는 것으로, 보통 1분간에 1 μmol의 기질 변화를 촉매하는 효소 양을 1단위로 하여 1mg당 단위수로 표시한다.
이하, 본 발명에 대하여 보다 상세히 설명한다.
본 발명은 하기의 (a) 내지 (p) 에서 선택되는 어느 하나의 서열로 표시되는 α-1,3 푸코실 전달효소 변이체 :
(a) 서열번호 1 의 아미노산 서열;
(b) 서열번호 2 의 아미노산 서열;
(c) 서열번호 3 의 아미노산 서열;
(d) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열과 95% 이상의 상동성을 가지고 푸코실 전달의 활성을 갖는 아미노산 서열;
(e) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환된 서열;
(f) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 129 번째의 아미노산이 산성이며 친수성 아미노산으로 치환된 서열;
(g) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 132 번째의 아미노산이 타이로신 및 히스티딘을 제외한 아미노산으로 치환된 서열;
(h) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 46 번째의 아미노산이 소수성 아미노산으로 치환된 서열;
(i) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 129 번째의 아미노산이 산성이며 친수성 아미노산으로 치환된 서열;
(j) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 132 번째의 아미노산이 타이로신 및 히스티딘을 제외한 아미노산으로 치환된 서열;
(k) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 46 번째의 아미노산이 소수성 아미노산으로 치환된 서열;
(l) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 129 번째의 아미노산이 산성이며 친수성 아미노산으로 치환되고, 132 번째의 아미노산이 타이로신 및 히스티딘을 제외한 아미노산으로 치환된 서열;
(m) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 129 번째의 아미노산이 산성이며 친수성 아미노산으로 치환되고, 46 번째의 아미노산이 소수성 아미노산으로 치환된 서열;
(n) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 132 번째의 아미노산이 타이로신 및 히스티딘을 제외한 아미노산으로 치환되고, 46 번째의 아미노산이 소수성 아미노산으로 치환된 서열;
(o) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 129 번째의 아미노산이 산성이며 친수성 아미노산으로 치환되고, 132 번째의 아미노산이 타이로신 및 히스티딘을 제외한 아미노산으로 치환되고, 46 번째의 아미노산이 소수성 아미노산으로 치환된 서열;
(p) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산, 129 번째의 아미노산, 132 번째의 아미노산 및 46 번째의 아미노산으로 이루어진 군에서 선택된 하나 이상의 아미노산이 치환된 것을 특징으로 하는, 아미노산 서열;
본 발명의 α-1,3 푸코실 전달효소 변이체는 헬리코박터 파일로리 26695에서 수득한 α-1,3 푸코실 전달효소에서 유래할 수 있다. 헬리코박터 파일로리 26695에서 유래한 α-1,3 푸코실 전달효소 단백질의 C-말단에는 2개의 헵타드 리피트 구조와 이후 소수성 또는 양전하를 띄는 45개의 아미노산이 존재한다. 2개의 헵타드 리피트 구조는 α-1,3 푸코실 전달효소의 이합체 형성에 기여하며, 소수성 또는 양전하를 띄는 45개의 아미노산은 세포막과 결합할 수 있는 α-헬릭스의 구조를 이룰 수 있다.
상기 서열번호 1는 헬리코박터 파일로리 26695에서 유래한 α-1,3 푸코실 전달효소 단백질의 C-말단의 α-헬릭스 구조가 제거된 형태이고, 상기 서열번호 2는 α-헬릭스 구조와 1개의 헵타드 리피트 구조가 제거된 형태이며, 상기 서열번호 3은 α-헬릭스 구조와 2개의 헵타드 리피트 구조가 제거된 형태이다.
α-헬릭스 구조가 제거된 형태, α-헬릭스 구조와 1개의 헵타드 리피트 구조가 제거된 형태, 또는 α-헬릭스 구조와 2개의 헵타드 리피트 구조가 제거된 형태의 α-1,3 푸코실 전달효소는 전체 단백질 발현량을 증가시키고 세포질 (cytosol)에서의 가용성 단백질 발현량을 증가시키는 효과가 있다.
상기 서열번호 1 내지 3, 또는 서열번호 1 내지 3 중 어느 하나의 아미노산 서열과 95% 이상의 상동성을 가지고 푸코실 전달의 활성을 갖는 α-1,3 푸코실 전달효소 변이체는, 보다 높은 활성을 갖기 위하여 특정 아미노산 서열이 치환될 수 있다.
아미노산의 치환은, 바람직하게는 128, 129, 132 또는 46 번째 아미노산이 다른 아미노산으로 치환될 수 있으며, 하나 이상의 치환이 일어날 수 있다. 예를 들어, 두 개의 치환이 일어난 예로서, 128 번째 아미노산 및 129 번째 아미노산, 128 번째 아미노산 및 132 번째 아미노산, 128 번째 아미노산 및 46 번째 아미노산, 129 번째 아미노산 및 132 번째 아미노산, 129 번째 아미노산 및 46 번째 아미노산, 또는 132 번째 아미노산 및 46 번째 아미노산이 치환될 수 있다.
상기 128, 129, 132, 46 번째 아미노산의 위치는 본 발명의 효소에서 나타나는 아미노산 위치이며, 다른 푸코실 전달효소의 서열 정렬시에는 상기의 위치가 변화할 수 있으므로 다른 번호의 아미노산을 의미할 수 있다. 즉, 상기 128, 129, 132, 46 번째 아미노산이란, 본 발명의 푸코실 전달효소의 128, 129, 132, 및 46 번째에 대응되는 아미노산의 위치를 의미하는 것이다.
상기 128 번째 아미노산은 바람직하게는 알라닌과 아스파르트산을 제외한 아미노산 서열로 치환되며, 보다 바람직하게는 아스파라긴으로 치환된다. 또한, 128 번째 아미노산이 아스파라긴으로 치환된 α-1,3 푸코실 전달효소 변이체의 아미노산 서열은, 바람직하게는 서열번호 6의 아미노산 서열로 표시된다.
상기 129 번째 아미노산은 바람직하게는 산성이며 친수성 아미노산으로 치환되며, 보다 바람직하게는 글루탐산으로 치환된다. 또한 129 번째 아미노산이 글루탐산으로 치환된 α-1,3 푸코실 전달효소 변이체의 아미노산 서열은, 바람직하게는 서열번호 7의 아미노산 서열로 표시된다.
상기 132 번째 아미노산은 바람직하게는 타이로신과 히스티딘을 제외한 아미노산으로 치환되며, 보다 바람직하게는 이소류신으로 치환된다. 또한 132 번째 아미노산이 이소류신으로 치환된 α-1,3 푸코실 전달효소 변이체의 아미노산 서열은, 바람직하게는 서열번호 8의 아미노산 서열로 표시된다.
상기 46 번째 아미노산은 바람직하게는 소수성 아미노산으로 치환되며, 보다 바람직하게는 페닐알라닌으로 치환된다. 또한 46 번째 아미노산이 페닐알라닌으로 치환된 α-1,3 푸코실 전달효소 변이체의 아미노산 서열은, 바람직하게는 서열번호 9의 아미노산 서열로 표시된다.
상기 서열번호 2의 아미노산 서열에서 128 번째의 아미노산 위치에 아스파라긴이, 129 번째의 아미노산 위치에 글루탐산이 치환된 아미노산 서열은, 서열번호 10의 아미노산 서열로 표시된다.
상기 서열번호 2의 아미노산 서열에서 128 번째의 아미노산 위치에 아스파라긴이, 132 번째의 아미노산 위치에 이소류신이 치환된 아미노산 서열은, 서열번호 11의 아미노산 서열로 표시된다.
상기 서열번호 2의 아미노산 서열에서 128 번째의 아미노산 위치에 아스파라긴이, 46 번째의 아미노산 위치에 페닐알라닌이 치환된 아미노산 서열은, 서열번호 12의 아미노산 서열로 표시된다.
상기 서열번호 2의 아미노산 서열에서 128 번째의 아미노산 위치에 아스파라긴이, 129 번째의 아미노산 위치에 글루탐산이, 132번째의 아미노산 위치에 이소류신이 치환된 아미노산 서열은, 서열번호 13의 아미노산 서열로 표시된다.
상기 서열번호 2의 아미노산 서열에서 128 번째의 아미노산 위치에 아스파라긴이, 129 번째의 아미노산 위치에 글루탐산이, 46 번째의 아미노산 위치에 페닐알라닌이 치환된 아미노산 서열은, 서열번호 14의 아미노산 서열로 표시된다.
상기 서열번호 2의 아미노산 서열에서 128 번째의 아미노산 위치에 아스파라긴이, 132번째의 아미노산 위치에 이소류신이, 46 번째의 아미노산 위치에 페닐알라닌이 치환된 아미노산 서열은, 서열번호 15의 아미노산 서열로 표시된다.
상기 서열번호 2의 아미노산 서열에서 128 번째의 아미노산 위치에 아스파라긴이, 129 번째의 아미노산 위치에 글루탐산이, 132번째의 아미노산 위치에 이소류신이, 46 번째의 아미노산 위치에 페닐알라닌이 치환된 아미노산 서열은, 서열번호 16의 아미노산 서열로 표시된다.
본 발명은 상기 α-1,3 푸코실 전달효소 변이체를 코딩하는 DNA를 제공한다.
상기 DNA는 본 발명에서 제공하는 아미노산을 코딩하는 DNA에 해당하면 제한 없이 사용될 수 있으며, 상기 DNA를 최적화 시켜 얻은 서열을 포함하고, 상기 DNA는 바람직하게는, 서열번호 4, 서열번호 4와 77% 이상의 상동성을 갖는 DNA, 및 17 내지 27의 서열번호로 이루어진 군에서 선택된 어느 하나의 DNA이다.
상기 서열번호 4의 DNA 서열은, α-헬릭스 구조와 1개의 헵타드 리피트 구조가 제거된 형태의 α-1,3 푸코실 전달효소의 아미노산 서열(서열번호 2)을 코딩하는 DNA 서열(서열번호 5)을 최적화 시켜 얻은 서열이며, 서열번호 4와 서열번호 5는 76%의 상동성을 갖는다.
상기 서열번호 17의 DNA 서열은, 서열번호 6의 아미노산을 코딩하는 서열이다.
상기 서열번호 18의 DNA 서열은, 서열번호 7의 아미노산을 코딩하는 서열이다.
상기 서열번호 19의 DNA 서열은, 서열번호 8의 아미노산을 코딩하는 서열이다.
상기 서열번호 20의 DNA 서열은, 서열번호 9의 아미노산을 코딩하는 서열이다.
상기 서열번호 21의 DNA 서열은, 서열번호 10의 아미노산을 코딩하는 서열이다.
상기 서열번호 22의 DNA 서열은, 서열번호 11의 아미노산을 코딩하는 서열이다.
상기 서열번호 23의 DNA 서열은, 서열번호 12의 아미노산을 코딩하는 서열이다.
상기 서열번호 24의 DNA 서열은, 서열번호 13의 아미노산을 코딩하는 서열이다.
상기 서열번호 25의 DNA 서열은, 서열번호 14의 아미노산을 코딩하는 서열이다.
상기 서열번호 26의 DNA 서열은, 서열번호 15의 아미노산을 코딩하는 서열이다.
상기 서열번호 27의 DNA 서열은, 서열번호 16의 아미노산을 코딩하는 서열이다.
본 발명은 상기 α-1,3 푸코실 전달효소 변이체를 코딩하는 DNA를 포함하는 재조합 DNA 벡터를 제공한다.
상기 벡터는 강력한 프로모터 (strong promoter)를 사용할 수 있으며, 강력한 프로모터의 일 예로서, trc 프로모터, tac 프로모터, T7 프로모터, T5 프로모터, lac 프로모터 또는 trp 프로모터를 사용할 수 있으나, 이에 제한되지 않는다. 상기의 강력한 프로모터를 사용하는 경우, 가용성 단백질 발현량이 증가하는 효과가 있다.
본 발명은 α-1,3 푸코실 전달효소 변이체를 코딩하는 DNA를 포함하는 재조합 DNA 벡터로 형질전환된 숙주세포 및 숙주세포의 추출물을 제공한다.
본 발명은 상기 숙주세포 또는 상기 숙주세포의 추출물을 생촉매로 사용한, 3-푸코실올리고당의 제조 방법을 제공한다. 제조할 수 있는 3-푸코실올리고당으로는 3-푸코실락토오스, 루이스X가 포함되나, 이에 제한되지 않는다.
상기 3-푸코실올리고당의 제조 방법에 있어서, 바람직하게는 15℃ 내지 37℃의 온도에서 0.01 mM 내지 2 mM의 유도인자 (inducer)를 사용할 수 있으며, 상기의 범위를 만족하는 경우 가용성 단백질의 생산량이 증가하는 효과가 있다.
상기 유도인자는 단백질의 발현을 촉진시키는 물질을 의미하며, 그 예로서, lac 오페론을 사용할 경우 IPTG(Isopropyl β-D-1-thiogalactopyranoside)가 있으며, ara 오페론을 사용할 경우 아라비노스 (arabinose), trp 오페론을 사용할 경우 인돌아크릴산 등이 사용될 수 있으나, 이에 제한되지 않는다.
상기 3-푸코실올리고당의 제조 방법에 있어서, 바람직하게는, 탄소원 또는 질소원이 추가된 배지를 사용할 수 있다.
본 발명은 당 수용체 기질의 농도를 당 공여체 기질 농도의 2배 이상으로 사용하는 것을 특징으로 하는, 3-푸코실올리고당의 제조 방법을 제공한다.
상기 당 공여체는, 바람직하게는 구아노신 5'-이인산-푸코오스 (guanosine 5'-diphosphate fucose, GDP-fuc)이나 이에 제한되지 않는다.
상기 당 수용체 기질의 농도는 구아노신 5'-이인산-푸코오스의 농도의 1.1배 내지 20배, 바람직하게는 1.5배 내지 10배, 보다 바람직하게는 2배 내지 5배 이다. 상기와 같은 농도 조절은, 효소의 반응 속도 및 수율을 증대시키므로, 3-푸코실락토오스의 경제적 생산을 가능케 하는 효과가 있다.
본 발명은 하기의 순차적인 단계를 포함하는, α-1,3 푸코실 전달효소 변이체 제조 방법을 제공한다.
(1) 하기의 방법 중 어느 하나를 포함하는, 잔기 또는 아미노산을 선택하는 단계.
(a) 푸코실 전달효소의 결정 구조 또는 모델 구조에서의 필수 주요 아미노산으로부터 5 내지 20 Å 이내의 잔기들을 선택하는 방법.
(b) 상기 (a) 방법에 있어서, E96 아미노산으로부터 5 내지 20 Å 이내의 잔기들을 선택하는 방법.
(c) 상기 (a) 방법에 있어서, 단백질의 구조로부터 활성부위 (active site) 또는 기질 접근 터널에 위치한 아미노산들에 대하여 진화론적으로 변화를 줄 수 있는 아미노산을 선택하는 방법.
(d) 푸코실 전달효소의 결정 구조 또는 모델 구조에서의 두 개의 기질 결합 부위로부터 5 내지 20 Å 이내의 잔기들을 선택하는 방법.
(e) 상기 (d) 방법에 있어서, 단백질의 구조로부터 활성부위 (active site) 또는 기질 접근 터널에 위치한 아미노산들에 대하여 진화론적으로 변화를 줄 수 있는 아미노산을 선택하는 방법.
(2) 상기 선택된 잔기에 대해 반복적 포화변이를 수행하거나, 선택된 잔기에 대해 클러스터를 형성하여 조합적 변이체를 생성하는 단계.
상기 진화론적으로 변화를 줄 수 있는 아미노산은 생물정보학 데이터베이스의 서열정보를 통해 다수 서열 정렬 (multiple sequence alignment)로부터, 효소의 촉매과정에 직접적인 역할을 하지 않고 진화론적인 변화에 의해서 변이가 가능한, 단백질 구조 내에 특정 위치의 아미노산 잔기가 보존되지 않은 아미노산을 의미한다.
또한, 상기 클러스터는 α-1,3 푸코실 전달효소의 기질 결합 부위로부터 5 내지 20 Å 이내에 있는 α-헬릭스 또는 β-시트 등의 기질 결합 부위를 형성하고 있는 의미 있는 부분을 묶음 단위로 나눈 것을 의미한다.
본 발명은 상기 α-1,3 푸코실 전달효소 변이체 제조 방법으로 제조된 α-1,3 푸코실 전달효소 변이체의 탐색 방법으로서, pH 변화에 의한 지시약을 이용하는 반응을 수행하는 것을 특징으로 하는, 푸코실 전달효소의 변이체 탐색 방법을 제공한다.
상기 pH 변화에 의한 지시약을 이용하는 반응은, 바람직하게 pH 7 내지 9에서 수행할 수 있다.
이하, 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
푸코실 전달효소 가용성 단백질 발현량 증대
본 발명의 헬리코박터 파일로리 26695 유래의 α-1,3 푸코실 전달효소는 온도와 유도인자의 농도를 조절함에도 불구하고 전체 단백질 발현량 및 가용성 단백질 (soluble protein) 발현량이 매우 적어, 3-푸코실올리고당 생산에 있어서 푸코오스 전달반응이 속도 결정단계임이 확인되었다.
이에 있어서, α-1,3 푸코실 전달효소의 가용성 단백질 발현량을 증대시키고자, 도 2(a)와 같이 헵타드 리피트와 α-헬릭스 구조를 이룰 수 있는 단백질의 C-말단에 대한 체계적인 절단을 수행하였으며, 각각의 C-말단이 절단된 형태의 α-1,3 푸코실 전달효소의 세포추출물을 이용하여 3-푸코실락토오스의 생산 수율을 확인한 결과 절단 전의 야생주에 비해 9개의 아미노산이 절단된 경우를 제외하고 모두 2배 내지 2.5배의 수율 증대가 나타났다 (도 2(b)).
소수성 또는 양전하를 띄는 α-헬릭스로 추정되는 부분과 헵타드 리피트 구조의 제거는 본 발명의 α-1,3 푸코실 전달효소의 전체 단백질 발현량을 증가시키고 세포질 (cytosol)에서의 가용성 단백질 발현량을 증가시킬 수 있다. 즉, 본 발명의 헬리코박터 파일로리 26695 유래의 α-1,3 푸코실 전달효소에 있어서, 가용성 단백질의 발현량을 증가시킴으로 인해 3-푸코실올리고당의 생산 수율 및 생산성을 증가시킬 수 있는 효소의 형태로서, C-말단의 α-헬릭스 구조가 제거된 형태 (서열번호 1), α-헬릭스 구조와 1개의 헵타드 리피트 구조가 제거된 형태 (서열번호 2) 및 α-헬릭스 구조와 2개의 헵타드 리피트 구조가 제거된 형태 (서열번호 3)가 사용될 수 있으며, 바람직하게는 α-헬릭스 구조가 제거된 형태 및 α-헬릭스 구조와 1개의 헵타드 리피트 구조가 제거된 형태가 사용될 수 있으며, 더 바람직하게는 α-헬릭스 구조와 1개의 헵타드 리피트 구조가 제거된 형태가 사용될 수 있다.
상기 C-말단이 제거된 형태의 α-1,3 푸코실 전달효소는 도 3(a)에서와 같이 가용성 단백질의 발현량이 증가되었으며, 이를 더욱 극대화하기 위해 C-말단이 제거된 형태의 α-1,3 푸코실 전달효소의 염기서열을 최적화하였다. 본 발명에서는 α-헬릭스 구조와 1개의 헵타드 리피트 구조가 제거된 형태의 α-1,3 푸코실 전달효소의 염기서열을 아실화 tRNA (아미노산에 결합되어 있는 전하를 가진 tRNA)를 높은 수준으로 유지할 수 있는 코돈으로 치환시키는 원리에 따라 (DNA2.0, USA) 염기서열을 최적화 하였다.
본 발명의 염기서열 최적화의 주형 DNA는 상기 단백질을 코딩하는 유전자에 한정된 것이 아니며, C-말단의 α-헬릭스 구조가 제거된 형태와 α-헬릭스 구조와 2개의 헵타드 리피트 구조가 제거된 형태의 단백질을 코딩하는 유전자도 포함될 수 있다.
본 발명의 α-헬릭스 구조와 1개의 헵타드 리피트 구조가 제거된 형태의 α-1,3 푸코실 전달효소를 코딩하는 유전자가 최적화되어 대장균에서의 발현된 것은, 도 3(b)에서와 같이 전체 단백질 발현량 및 가용성 단백질의 발현량이 최적화 전보다 현저히 증가되었으며, 세포추출물을 이용한 3-푸코실락토오스의 생산 수율이 염기 서열 최적화 전의 세포추출물 사용에서보다 4배 가량 증가하였다 (도4).
또한 염기서열이 최적화된 α-1,3 푸코실 전달효소의 발현은 글리세롤 및 카제인 분해물과 같은 탄소원 또는 질소원이 본 유전자를 발현하는 숙주 세포의 배양 배지에 추가적으로 첨가되어 대장균의 세포 수를 증대시킴으로 인해, 배양 당 가용성 단백질의 발현량을 더욱 극대화 시킬 수 있으며, 도 3(b)에서와 같이 전체 단백질의 증가 및 가용성 단백질의 발현량이 전체 단백질 발현량의 90% 이상이 될 수 있다. 또한 1 L 대장균 배양 당 얻을 수 있는 α-1,3 푸코실 전달효소의 수율은 기존 연구에 따른 4 내지 15 mg에 비하여 본 발명을 통하여 160 내지 200 mg까지 증가하였으며 이는 기존 연구 결과보다 11배 내지 50배까지 증가한 결과를 나타낸다.
가용성 단백질 발현량이 증대된 α-1,3 푸코실 전달효소를 이용한 푸코실락토오스 생산
본 발명을 통해 가용성 단백질의 양이 최대로 향상된 (도 3 (b)) 상기 α-1,3 푸코실 전달효소의 세포추출물을 이용하여, 모유 유래 α-1,3 푸코실 올리고당인 3-푸코실락토오스를 생산하였다. 본 발명에서는 3-푸코실락토오스의 생산성 및 수율을 더욱 높이고자 반응 조건을 최적화하였으며, 인산 나트륨 완충용액 하에서 당 공여체 기질인 구아노신 5'-이인산-푸코오스의 농도를 5 mM로 고정하고, 수용체 기질인 락토오스의 농도를 10 내지 20 mM까지 증가시킴으로써 생산 수율 및 반응 속도를 2배 이상 향상시켰다 (도4).
5 mM 구아노신 5'-이인산-푸코오스를 기질로 하여 본 발명의 가용성 단백질의 양이 최대로 향상된 α-1,3 푸코실 전달효소의 세포추출물을 이용하여 상기 최적화한 방법으로 3-푸코실락토오스의 생산 시, 도 4에서와 같이 생산 수율이 52%로 증가하였으며 1.3 g/L의 3-푸코실락토오스를 생산할 수 있다. 이는 본 발명 이전의 초기 α-1,3 푸코실 전달효소의 생산 수율 대비 17배가 향상된 것을 나타낸다. 또한 본 발명은 3-푸코실락토오스의 생산성 (productivity)증가를 나타내며, α-1,3 푸코실 전달효소의 발명 전 초기 반응에 있어 0.0053 g/L/h 의 생산성을 나타낸 것에 반해, 본 발명을 통해 0.63 g/L/h까지 증가함으로써 120 배의 생산성 증가를 나타냈다.
α-1,3 푸코실 전달효소의 변이 목적 부분의 선택 및 변이 수행
본 발명에서는 상기 가용성 단백질의 양이 최대로 향상된 α-1,3 푸코실 전달효소를 주형 단백질로 하여 변이체를 생성하였다. 본 발명의 α-1,3 푸코실 전달효소는 다른 헬리코박터 유래의 α-1,3 푸코실 전달효소의 결정구조를 주형으로 한 모델구조로부터 당 공여체 기질인 구아노신 5'-이인산-푸코오스가 결합된 기질 결합 부위를 확인하였다. 주형 단백질과 본 발명의 α-1,3 푸코실 전달효소와의 상동성은 89%이다. 수용체 기질인 락토오스의 경우, 결합자리를 찾기 위해 모델구조와의 겹침을 통하여 푸코실 전달효소 반응의 필수 주요 아미노산 잔기 (key residue)인 글루탐산 96번 (E96)을 탐색하였다. E96으로부터 락토오스의 글루코오스 3번 탄소의 OH를 중심으로 안정한 에너지 형태를 나타내는 락토오스의 형태를 오토독 (autodock) 프로그램을 통하여 배치하였으며, 이를 통해 락토오스 기질의 결합부위를 확인하였다. 글루코오스 3번 탄소로부터 구아노신 5'-이인산-푸코오스의 푸코오스 1번 탄소까지의 거리를 측정함으로써 당 전이 반응이 일어날 수 있는 거리를 포함할 수 있는 E96으로부터 5 내지 20 Å 이내의 잔기들을 선택하였다.
본 발명에서는 상기 필수 주요 아미노산 잔기로부터 선택된 잔기들 중, 포화 변이를 수행할 기능적 잔기를 선택하기 위해 '핫 스팟 위자드' (Hot spot wizard) [Pavelka A., HotSpot Wizard: a web server for identification of hot spots in protein engineering, Nucleic Acids Research, 2009, 37, 376-83]라는 생물정보학 프로그램을 사용하였다. 이는 여러 가지 생물정보학 데이터베이스와 컴퓨터 프로그램을 이용함으로써, 단백질의 구조로부터 활성부위 (active site) 또는 기질 접근 터널에 위치한 아미노산들에 대하여 진화론적으로 변화를 줄 수 있는 아미노산을 선택하는 것을 말한다. 상기 프로그램은 생물정보학의 데이터베이스를 통해 서열정보를 이용한 다수 서열 정렬이 진행되며, 진화론적인 압력에도 불구하고 단백질 구조 내에 특정 위치의 아미노산 잔기를 보존하고 있는 것은 그 단백질에 있어서 구조와 기능상 매우 중요한 역할을 하고, 특히 촉매과정에 있어서 직접적인 역할을 할 가능성이 높기 때문에 이들은 변이 가능한 점수로서 낮은 점수를 얻게 된다.
본 발명에서는, 상기 필수 주요 아미노산으로부터 선택된 잔기들과, '핫 스팟 위자드'를 통해 변이 가능점수가 높은 아미노산 잔기들에 대해 '교집합'을 가지는 잔기들을 변이 목적 부분으로 선택하고, 이들에 대해 포화변이를 수행하였다.
푸코실 전달효소의 기능적 잔기에 대한 포화 변이 및 반복적 포화변이를 통한 변이체 생산
상기 변이 목적 부분으로 선택된 기능적 잔기들에 대해 NNK 코돈을 사용하여 PCR 을 통해 포화 변이 수행 이후, 변이체 라이브러리에 대해 pH 지시약을 이용한 비색법을 통해 스크리닝을 수행하였다. 야생주에 비해 시간에 따른 흡광도의 변화가 증가한 변이체를 1차적으로 탐색한 이후에 이들 변이체에 대해 배양 부피를 증가시켜 배양한 이후, 세포 추출물을 이용하여 3-푸코실락토오스의 생산 수율 및 초기 반응 속도를 세포 추출물의 부피 (mL)당 unit으로 계산하였다.
상기 방법에 의해 선택된 A128은 도킹한 락토오스의 글루코오스 근처의 α-헬릭스상에 위치하고 있다. A128의 변이체들에 대해, 글리신, 아르기닌, 글루탐산으로 치환된 변이체는 야생주와 비슷하거나 야생주보다 20% 높은 활성을 나타냈으며, 아스파라긴으로 치환된 변이체는 야생주대비 2.9배의 활성증가를 나타냈다. A128 변이체에 대해 야생형 대비 상대적인 고유활성도를 비교한 결과, A128N의 고유활성도가 야생형 대비 198%로서 가장 높았으며 이 변이체를 '핫 스팟'으로 선정하였다.
본 발명에서는 또한, 푸코실 전달효소의 변이체를 생성하기 위한 부분-논리적 (semi-rational) 방법과 반복적 포화변이 (iterative saturation mutagenesis)가 결합된 방법을 제공한다. 반복적 포화변이는 상기 방법에 의해 탐색된 변이체를 주형으로 하여 또 다른 특정 아미노산의 변이를 일으킴으로써, 더 향상된 변이체를 탐색하는 것을 말한다. 본 발명에서는 상기 선택된 A128의 변이체의 위치를 기반으로, 또한 A128N의 변이체를 주형으로 또 다른 특정 아미노산의 변이를 일으킴으로써 더 향상된 변이체를 탐색하고자 하였다.
도킹한 락토오스 주변의 5 내지 20 Å 이내에는 두 개의 α-헬릭스가 존재하며, A128 잔기의 위치는 이 중 하나의 헬릭스상에 존재한다. 본 발명에서는 A128이 존재하는 α-헬릭스를 클러스터 1로 지정, 나머지 한 개의 α-헬릭스를 클러스터 2로 지정하였다. 클러스터 1 상에서의 상기 '핫 스팟 위자드'를 이용한 변이 후보의 아미노산을 선정하였으며, '핫 스팟'인 A128N을 주형 DNA로 하여 선택된 변이 후보 아미노산에 대하여 반복적 포화변이를 진행하였다. 또한, 클러스터 2 상에서의 '핫 스팟 위자드'를 이용한 변이 후보를 선정하였으며, 클러스터 1과 클러스터 2 상에서의 포화변이를 각각 수행하였다.
클러스터 1의 A128N으로부터 추가적인 변이체는 H129의 변이체로부터 생성될 수 있다. H129의 변이체로서 시스테인, 세린으로 치환된 변이체는 A128N과 비슷한 활성을 나타냈으며, 글루탐산과 아스파르트산과 같이 산성이며 친수성인 아미노산으로 치환된 경우 A128N 보다 2배 이상의 활성 증가를 나타냈다.
클러스터 1의 A128N과 H129E/D 의 조합적 변이체로부터 추가적인 변이체는 Y132의 변이체로부터 생성될 수 있다. Y132는 상대적으로 다양한 변이체들을 받아들일 수 있으며, Y132의 변이체로서 글리신, 세린, 글루탐산, 시스테인, 발린 등으로 치환된 변이체는 중립적인 활성을 나타냈으며, 류신, 이소류신, 트립토판과 같은 소수성 아미노산으로 치환된 경우 A128N과 H129E/D의 조합적 변이체보다 20%의 증가된 활성을 나타냈다.
또한 본 발명의 클러스터 2로부터 S46의 변이체가 생성될 수 있다. S46의 변이체로서 트레오닌은 야생형과 비슷한 활성을 나타냈고, 페닐알라닌으로 치환된 경우 야생형 대비 1.5배의 활성증가를 나타냈다.
또한 본 발명을 통해 클러스터 1과 클러스터 2로부터 3개 또는 4개의 아미노산이 치환된 조합적 변이체를 생성할 수 있다. 이들 조합적 변이체의 아미노산 변이는 A128+H129+Y132 또는 A128+H129+S46 또는 A128+Y132+S46 또는 H129+Y132+S46 또는 A128+H129+Y132+S46 위치의 치환으로 나타나는 변이가 될 수 있다.
또한 본 발명을 통해 클러스터 1과 클러스터 2로부터 2개의 아미노산이 치환된 조합적 변이체를 생성할 수 있다. 이들 조합적 변이체의 아미노산 변이는 A128+H129, A128+Y132, A128+S46, H129+Y132, H129+S46, Y132I+S46 중에서 선택될 수 있는 위치의 치환으로 나타나는 변이가 될 수 있다.
α-1,3 푸코실 전달효소의 변이체 특성 분석 및 푸코실올리고당 생산에의 응용
본 발명에서 α-1,3 푸코실 전달효소의 A128의 단일 아미노산 치환 변이체 A128N은 서열번호 6의 아미노산 서열을 나타내며, 128 번째의 아미노산 위치가 알라닌 및 아스파르트산을 제외한 어떤 아미노산으로 치환된, 더 바람직하게는 친수성 아미노산으로 치환된 서열을 갖는 단백질을 포함할 수 있다. 또한 다른 푸코실 전달효소와의 서열 정렬시에 본 아미노산 위치에 상기 변이체 서열이 포함된 75% 이상의 상동성을 가지고, 푸코실 전달의 활성을 가지는 효소도 모두 가능하다. 서열번호 6의 단백질을 코딩하는 DNA는 서열번호 17이며 상기의 아미노산을 코딩하는 모든 DNA 서열 또한 포함될 수 있다.
본 발명에서 α-1,3 푸코실 전달효소의 H129의 아미노산 치환 변이체 H129E는 서열번호 7의 아미노산 서열을 나타내며, 129 번째의 아미노산 위치가 산성이며 친수성 아미노산으로 치환된 서열을 갖는 단백질을 포함할 수 있다. 또한 다른 푸코실 전달효소와의 서열 정렬시에 본 아미노산 위치에 상기 변이체 서열이 포함된 75% 이상의 상동성을 가지고, 푸코실 전달의 활성을 가지는 효소도 모두 가능하다. 서열번호 7의 단백질을 코딩하는 DNA는 서열번호 18이며 상기의 아미노산을 코딩하는 모든 DNA 서열 또한 포함될 수 있다.
본 발명에서 α-1,3 푸코실 전달효소의 Y132의 아미노산 치환 변이체 Y132I는 서열번호 8의 아미노산 서열을 나타내며, 132 번째의 아미노산 위치가 타이로신과 히스티딘을 제외한 다른 어떤 아미노산으로 치환된, 더 바람직하게는 소수성 아미노산으로 치환된 서열을 갖는 단백질을 포함할 수 있다. 또한 다른 푸코실 전달효소와의 서열 정렬시에 본 아미노산 위치에 상기 변이체 서열이 포함된 75% 이상의 상동성을 가지고, 푸코실 전달의 활성을 가지는 효소도 모두 가능하다. 서열번호 8의 단백질을 코딩하는 DNA는 서열번호 19이며 상기의 아미노산을 코딩하는 모든 DNA 서열 또한 포함될 수 있다.
본 발명에서 α-1,3 푸코실 전달효소의 S46의 아미노산 치환 변이체 S46F는 서열번호 9의 아미노산 서열을 나타내며, 46 번째의 아미노산 위치가 소수성 아미노산으로 치환된 서열을 갖는 단백질을 포함할 수 있다. 또한 다른 푸코실 전달효소와의 서열 정렬시에 본 아미노산 위치에 상기 변이체 서열이 포함된 75% 이상의 상동성을 가지고, 푸코실 전달의 활성을 가지는 효소도 모두 가능하다. 서열번호 9의 단백질을 코딩하는 DNA는 서열번호 20이며 상기의 아미노산을 코딩하는 모든 DNA 서열 또한 포함될 수 있다.
α-1,3 푸코실 전달효소의 A128N 과 H129E의 조합적 변이체는 서열번호 10의 아미노산 서열을 나타내며, 두 위치의 변이에 있어서 128번째의 아미노산 위치가 알라닌 및 아스파르트산을 제외한 어떤 아미노산 서열을 갖거나 129번째의 아미노산 위치가 산성이며 친수성 아미노산을 갖는 단백질 및 이 변이체 서열이 포함된 75% 이상의 상동성을 가지고, 푸코실 전달의 활성을 가지는 효소도 모두 가능하다. 서열번호 10의 단백질을 코딩하는 DNA는 서열번호 21이며, 상기의 아미노산을 코딩하는 모든 DNA 서열 또한 포함될 수 있다.
α-1,3 푸코실 전달효소의 A128N 는 상기 조합적 변이체와 마찬가지로, Y132I 또는 S46F와 조합적 변이체를 생성할 수 있다.
α-1,3 푸코실 전달효소의 A128N 과 Y132I의 조합적 변이체는 서열번호 11의 아미노산 서열을 나타내며, 두 위치의 변이에 있어서 128번째의 아미노산 위치가 알라닌 및 아스파르트산을 제외한 어떤 아미노산 서열을 갖거나 132번째의 아미노산 위치가 타이로신과 히스티딘을 제외한 다른 어떤 아미노산을 갖는 단백질 및 이 변이체 서열이 포함된 75% 이상의 상동성을 가지고, 푸코실 전달의 활성을 가지는 효소도 모두 가능하다.
α-1,3 푸코실 전달효소의 A128N 과 S46F의 조합적 변이체는 서열번호 12의 아미노산 서열을 나타내며, 두 위치의 변이에 있어서 128번째의 아미노산 위치가 알라닌 및 아스파르트산을 제외한 어떤 아미노산 서열을 갖거나 46번째의 아미노산 위치가 소수성 아미노산을 갖는 단백질 및 이 변이체 서열이 포함된 75% 이상의 상동성을 가지고, 푸코실 전달의 활성을 가지는 효소도 모두 가능하다. 상기 서열번호 11과 12 단백질을 코딩하는 DNA는 각각 서열번호 22, 23이며, 상기의 아미노산을 코딩하는 모든 DNA 서열 또한 포함될 수 있다.
α-1,3 푸코실 전달효소의 A128N 과 H129E및 Y132의 조합적 변이체는 서열번호 13의 아미노산 서열을 나타내며, 세 위치의 변이에 있어서 128번째의 아미노산 위치가 알라닌 및 아스파르트산을 제외한 어떤 아미노산 서열을 갖거나 129번째의 아미노산 위치가 산성이며 친수성 아미노산을 갖거나, 132번째의 아미노산 위치가 타이로신과 히스티딘을 제외한 다른 어떤 아미노산을 갖는 단백질 및 이 변이체 서열이 포함된 75% 이상의 상동성을 가지고, 푸코실 전달의 활성을 가지는 효소도 모두 가능하다. 서열번호 13의 단백질을 코딩하는 DNA는 서열번호 24이며, 상기의 아미노산을 코딩하는 모든 DNA 서열 또한 포함될 수 있다.
α-1,3 푸코실 전달효소의 A128N 과 H129E및 S46F의 조합적 변이체는 서열번호 14의 아미노산 서열을 나타내며, 세 위치의 변이에 있어서 128번째의 아미노산 위치가 알라닌 및 아스파르트산을 제외한 어떤 아미노산 서열을 갖거나 129번째의 아미노산 위치가 산성이며 친수성 아미노산을 갖거나, 46번째의 아미노산 위치가 소수성 아미노산을 갖는 단백질 및 이 변이체 서열이 포함된 75% 이상의 상동성을 가지고, 푸코실 전달의 활성을 가지는 효소도 모두 가능하다. 서열번호 14의 단백질을 코딩하는 DNA는 서열번호 25이며, 상기의 아미노산을 코딩하는 모든 DNA 서열 또한 포함될 수 있다.
α-1,3 푸코실 전달효소의 A128N 과 Y132I및 S46F의 조합적 변이체는 서열번호 15의 아미노산 서열을 나타내며, 세 위치의 변이에 있어서 128번째의 아미노산 위치가 알라닌 및 아스파르트산을 제외한 어떤 아미노산 서열을 갖거나 132번째의 아미노산 위치가 타이로신과 히스티딘을 제외한 다른 어떤 아미노산을 갖거나, 46번째의 아미노산 위치가 소수성 아미노산을 갖는 단백질 및 이 변이체 서열이 포함된 75% 이상의 상동성을 가지고, 푸코실 전달의 활성을 가지는 효소도 모두 가능하다. 서열번호 15의 단백질을 코딩하는 DNA는 서열번호 26이며, 상기의 아미노산을 코딩하는 모든 DNA 서열 또한 포함될 수 있다.
α-1,3 푸코실 전달효소의 A128N, H129E, Y132I 및 S46F의 조합적 변이체는 서열번호 16의 아미노산 서열을 나타내며, 네 위치의 변이에 있어서 128번째의 아미노산 위치가 알라닌 및 아스파르트산을 제외한 어떤 아미노산 서열을 갖거나 129번째의 아미노산 위치가 산성이며 친수성 아미노산을 갖거나 132번째의 아미노산 위치가 타이로신과 히스티딘을 제외한 다른 어떤 아미노산을 갖거나, 46번째의 아미노산 위치가 소수성 아미노산을 갖는 단백질 및 이 변이체 서열이 포함된 75% 이상의 상동성을 가지고, 푸코실 전달의 활성을 가지는 효소도 모두 가능하다. 서열번호 16의 단백질을 코딩하는 DNA는 서열번호 27이며, 상기의 아미노산을 코딩하는 모든 DNA 서열 또한 포함될 수 있다.
상기 명시한 α-1,3 푸코실 전달효소의 변이체와 75% 이상의 상동성을 가지는 예로서는, 상기 변이체의 변이된 서열을 포함하고 있으며, α-1,3 푸코실 전달효소의 활성을 갖는다고 명명, 또는 예측되는 서열로서, 헬리코박터 속 (genus), 특히 그 중 파일로리 종 (species) 유래의 서열이 포함될 수 있다.
본 발명에서는, 야생주와 함께 상기 탐색한 α-1,3 푸코실 전달효소의 변이체 중, A128N, A128N과 H129E의 조합 변이체 (A128N+H129E), A128N과 H129E 및 Y132I의 조합 변이체 (A128N+H129E+Y132I), A128N과 H129E 및 S46F의 조합 변이체 (A128N+H129E+S46F)의 단일 및 조합적 변이체를 선택하여 3-푸코실락토오스와 루이스X 생산을 시도하였다.
본 발명의 3-푸코실락토오스 생산에 있어서, A128N+H129E와 A128N+H129E+Y132I 및 A128N+H129E+S46F 의 변이체 사용에 따른 생산 수율이 95%까지 증가하였으며 (도 4) 이는 가용성 단백질 발현량 및 효소 활성 증대 이전의 초기 α-1,3 푸코실 전달효소의 생산 수율 대비 31배가 향상된 것을 나타내며, 2.33 g/L/h의 생산성으로서 생산성 또한 본 발명의 이전보다 441배 향상되었다.
또한, 본 발명에서는 변이체 사용의 예시로서, 야생주와의 초기 반응속도의 U/mL의 활성을 비교하고자, 기존 반응보다 50% 적은 푸코실 전달효소의 세포추출물로서 3-푸코실락토오스의 생산 수율을 비교하였다. 야생형 대비 변이체의 3-푸코실락토오스 생산 수율은 도 5와 같으며, A128N+H129E+S46F 변이체의 초기 반응속도 U/mL은 야생형 대비 15배 증가하였다.
또한 본 발명의 루이스X 생산에 있어서, A128N+H129E+Y132I 및 A128N+H129E+S46F 의 변이체 사용에 따른 생산 수율이 100%까지 증가하였으며, 야생주의 생산성 (0.56 g/L/h)대비 4.7배 향상된 2.65 g/L/h를 나타냈다.
또한, 본 발명에서는 변이체 사용의 예시로서, 야생주와의 초기 반응속도의 U/mL의 활성을 비교하고자, 기존 반응의 푸코실 전달효소 사용양의 25%에 해당하는 푸코실 전달효소의 세포추출물로서 루이스X의 생산 수율을 비교하였다. 야생형 대비 변이체의 루이스X 생산 수율은 도 6와 같으며, A128N+H129E+S46F 변이체의 초기 반응속도 U/mL은 야생형 대비 5.2배 증가하였다.
본 발명을 통해 가용성 단백질 발현량 및 활성이 증대된 α-1,3 푸코실 전달효소는 상기 언급한 3-푸코실락토오스, 루이스X 생산뿐 만 아니라 락토디푸코테트라오스 (Fuc(α-1,2)Galβ1,4Glc(α-1,3)Fuc, Lactodifucotetraose), DFpLNnH (Difucosyl-para-lacto-N-neohexaose), LNFP Ⅲ (Lacto-N-fucopentoseⅢ), TFLNH (Trifucosyllactose-N-hexose), LNDFHⅡ (Lacto-N-difucohexoseⅡ), 및 시알릴 루이스X (sialyl lewisX)와 같이 다양한 α-1,3 푸코실 올리고당 생산에 적용할 수 있다.
[실시예 1]: α-1,3푸코실 전달효소의 유전자를 포함하는 발현 벡터의 제조 및 가용성 단백질 발현량 증대
α-1,3푸코실 전달효소의 C-말단의 체계적 절단
헵타드 리피트와 α-헬릭스 구조를 이룰 수 있는 단백질의 C-말단에 대한 체계적인 절단을 수행하고자, α-1,3 푸코실 전달효소를 클로닝한 벡터를 주형 DNA로 사용하고 NdeⅠ 제한효소 인식서열을 갖는 센스 프라이머와 XhoⅠ 제한효소 인식서열을 갖는 안티센스 프라이머를 각각 제작하였다. 모든 경우에 있어서는, GACCATATGTTCCAACCCCTATTAG의 센스 프라이머를 사용하였으며, C-말단의 α-헬릭스 구조를 이룰 수 있는 부분 중 9개의 아미노산을 제거하기 위함으로써 TCGACTCTCGAGCACCGCGCGCAACAAAGG의 안티센스 프라이머를, C-말단의 α-헬릭스 구조를 이룰 수 있는 45개의 아미노산이 제거된 형태 (서열번호 1)를 제작하기 위해서 TCGACTCTCGAGATAATTAACCCTCAAATCATCATAATTA의 안티센스 프라이머를, α-헬릭스 구조와 1개의 헵타드 리피트 구조인 52개의 아미노산이 제거된 형태 (서열번호 2)를 제작하기 위해서 TCGACTCTCGAGATAATTAACCCTCAAATCATCAATGGAT의 안티센스 프라이머를, α-헬릭스 구조와 2개의 헵타드 리피트 구조인 59개의 아미노산이 제거된 형태 (서열번호 3)를 제작하기 위해서 TCGACTCTCGAGAATGGATACTAACGGCTT의 안티센스 프라이머를 사용하였다. PCR은 DNA 중합효소 반응용 완충용액, 0.2 mM dNTP, 2.5 mM MgCl2, pET 벡터에 클로닝 되어있는 주형 DNA 50-100 ng 및 상기 기재된 프라이머 쌍을 각각 100 pmol을 넣은 다음 pfu DNA 중합효소를 이용하여 수행되었다. 반응 조건은 95℃ 5분 이후, 95℃/30초 (변성), 55℃/1분 (어닐링), 72℃/1분 (신장)으로 총 30회를 수행하였다. 증폭된 PCR 산물은 제한효소 NdeⅠ과 XhoⅠ으로 각각 처리하여 T7 프로모터를 갖는 pET24ma 벡터에 삽입하였다. 본 발명에서 사용된 벡터는 T7 프로모터를 포함한 다양한 프로모터를 갖는 발현벡터 또한 모두 포함될 수 있다.
α-1,3푸코실 전달효소의 염기서열 최적화 및 발현 벡터의 제조
α-1,3 푸코실 전달효소의 염기서열은 아실화 tRNA (아미노산에 결합되어 있는 전하를 가진 tRNA)를 높은 수준으로 유지할 수 있는 코돈으로 치환시키는 원리에 따라 (DNA2.0, USA) 최적화 하였다. 염기서열 최적화의 주형 DNA는, C-말단의 α-헬릭스 구조가 제거된 형태, α-헬릭스 구조와 1개의 헵타드 리피트 구조가 제거된 형태 및 α-헬릭스 구조와 2개의 헵타드 리피트 구조가 제거된 형태의 단백질을 코딩하는 유전자가 될 수 있다.
예시로서, α-헬릭스 구조와 1개의 헵타드 리피트 구조가 제거된 형태의 α-1,3 푸코실 전달효소의 최적화된 염기서열은 서열번호 4이며 이는 본래 염기 서열인 서열번호 5과 76%의 상동성을 나타낸다.
또한 상기 α-헬릭스 구조 및 헵타드 리피트 구조가 제거된 형태의 α-1,3 푸코실 전달효소를 코딩하는 최적화된 유전자는 강력한 프로모터 (strong promoter)를 함유하는 발현벡터에 NdeⅠ (센스 프라이머)과 XhoⅠ (안티센스 프라이머) 제한효소를 이용하여 클로닝 하였으며, C-말단에 히스티딘 태그를 갖도록 디자인하였다. 상기 강력한 프로모터의 예는 trc promoter, tac promoter, T7 promoter, T5 promoter, lac promoter 및 trp promoter로 구성된 군에서 선택될 수 있다.
α-1,3 푸코실 전달효소의 가용성으로 생산된 단백질 확인
헵타드 리피트와 α-헬릭스 구조를 이룰 수 있는 단백질의 C-말단이 절단된 α-1,3 푸코실 전달효소가 클로닝 된 재조합 DNA 벡터를 대장균 BW25113 (DE3) 균주에 형질전환 하였고, 카나마이신 항생제가 포함되어있는 LB 배지에 접종하여 30 내지 37℃에서 5 내지 10시간 동안 진탕 배양 후, 배양액 일부를 50 μg mL-1 카나마이신 항생제가 포함되어있는 LB 배지 50 mL에 접종하였다. 이후 30 내지 37℃에서 배양한 이후, OD600에서 0.5 내지 1이 되었을 때, 0.01 내지 2 mM의 IPTG를 첨가하였고 15 내지 37℃의 온도에서 15 내지 20시간 동안 발현을 유도하였다.
또한, 헵타드 리피트와 α-헬릭스 구조를 이룰 수 있는 단백질의 C-말단이 절단된 α-1,3 푸코실 전달효소의 염기서열을 최적화한 α-1,3 푸코실 전달효소의 경우, 카나마이신 항생제가 포함되어있는 LB 또는 글리세롤과 카제인 분해물이 포함된 TB배지에 접종하여 30 내지 37℃에서 5 내지 10시간 동안 진탕 배양 후, 배양액 일부를 50 μg mL-1 카나마이신 항생제가 포함되어있는 LB 또는 TB배지 50 mL에 접종하였다. 이후 30 내지 37℃에서 배양한 이후, OD600에서 0.5 내지 1이 되었을 때, 0.01 내지 2 mM의 IPTG를 첨가하였고 15 내지 37℃의 온도에서 15 내지 20시간 동안 발현을 유도하였다.
상기 α-1,3푸코실 전달효소의 발현 이후에, 배양한 대장균 세포를 4000 rpm으로 10분간 원심 분리하여 균체를 회수한 후 증류수로 세포를 재 부유 시키고 다시 10 분간 원심 분리하여 상등액의 증류수를 제거하였다. 회수한 균체 침전물을 5 mL의 20 mM 인산나트륨 완충용액으로 현탁하여 음파 파쇄기로 세포를 파쇄한 후 단백질의 전체 분획 (수용성 단백질+불용성 응집체)을 얻고, 15000 rpm으로 30 분간 원심 분리한 후 상등액을 분리하여 수용성 단백질만을 얻었다. 이들 전체 분획과 수용성 단백질 6 μL 각각을 3×SDS dye 3 μL와 섞어 100℃에서 10 분간 끓였다. 끓인 시료를 10% 아크릴아미드 SDS 겔에 주입하여 전개한 다음 겔을 쿠마시 염색용액으로 염색한 후 탈색하여 발현된 단백질의 양을 확인하였다.
[실시예 2]: 가용성 단백질 및 활성이 증대된 α-1,3푸코실 전달효소를 이용한 푸코실락토오스의 합성
본 발명을 통해 가용성 단백질 발현량 및 효소 활성이 증대된 α-1,3 푸코실 전달효소를 이용하여 구아노신 5'-이인산-푸코오스의 공여체 기질 및 락토오스 또는 N-아세틸락토사민의 수용체 기질을 이용하여 3-푸코실락토오스 및 루이스X를 생산하였다.
3-푸코실락토오스의 생산성 및 수율을 더욱 높이고자 최적화한 반응 조건에서, 50 mM 인산 나트륨 완충용액 하에서 5 mM 구아노신 5'-이인산-푸코오스, 10 내지 20 mM의 락토오스, 5 mM MgCl2 및 전체 반응 부피의 20% (v/v)인 α-1,3 푸코실 전달효소의 세포추출물을 넣어 37℃에서 반응을 진행하였다. 상기 반응 속도는 5 mM의 락토오스를 사용한 반응에서보다 2배 이상 빠른 것으로 확인되었다. 가용성 단백질 발현량이 최대로 향상된 α-1,3 푸코실 전달효소를 이용할 경우, 생산 수율이 52%로 증가하였으며 1.3 g/L의 3-푸코실락토오스를 생산할 수 있었다. 이는 본 발명 이전의 초기 α-1,3 푸코실 전달효소의 생산 수율 대비 17배가 향상된 것을 나타내며, 0.63 g/L/h의 생산성으로서 생산성 또한 본 발명의 이전보다 120배 향상되었다 (도 4).
또한 가용성 단백질 발현량이 최대로 향상된 α-1,3 푸코실 전달효소로부터 활성이 증가한 변이체를 이용하여 3-푸코실락토오스를 상기 반응 조건에서와 같이 생산하였으며, 3-푸코실락토오스의 생산 수율이 95%까지 증가하였으며 2.3 g/L를 생산할 수 있었다. 이는 본 발명 이전의 초기 α-1,3 푸코실 전달효소의 생산 수율 대비 31배가 향상된 것을 나타내며, 2.33 g/L/h의 생산성으로서 생산성 또한 본 발명의 이전보다 441배 향상되었다 (도 4).
또한 활성이 증가한 α-1,3 푸코실 전달효소 변이체의 활성을 비교하고자, 전체 반응 부피의 10% (v/v)인 세포추출물을 이용하여 37℃에서 반응을 진행하였으며 3-푸코실락토오스의 생산 수율을 비교하였다. 야생형 대비 변이체의 3-푸코실락토오스 생산 수율은 도 5와 같으며, 변이체 중 예시로서, A128N, A128N+H129E, A128N+H129E+Y132I, 및 A128N+H129E+S46F의 단일 및 조합적 변이체는 모두 야생형보다 수율 및 반응속도가 증대하였으며, 이 중 A128N+H129E+S46F 의 조합 변이체의 초기 반응속도 U/mL은 야생형 대비 15배 증가하였다.
또한 본 발명을 통해 생성된 상기 α-1,3 푸코실 전달효소의 변이체를 이용하여 루이스X를 생산하였다. 루이스X 생산 반응 조건으로서, 50 mM 인산 나트륨 완충용액 하에서 5 mM 구아노신 5'-이인산-푸코오스, 5 mM N-아세틸락토사민, 5 mM MgCl2 및 전체 반응 부피의 5% (v/v)인 α-1,3 푸코실 전달효소의 세포추출물을 넣어 37℃에서 반응을 진행하였다. α-1,3 푸코실 전달효소의 변이체를 이용한 루이스X 생산에 있어서, 3시간 반응 시에 63%의 수율을 나타내는 야생주 대비 변이체 사용시에 생산 수율이 100%로 증가하여 2.65 g/L의 루이스X를 생산하였다. 야생형 대비 변이체의 루이스X 생산 수율은 도 6와 같으며, 변이체 중 예시로서, A128N, A128N+H129E, A128N+H129E+Y132I, 및 A128N+H129E+S46F의 단일 및 조합적 변이체는 모두 야생형보다 수율 및 반응속도가 증대하였으며, 이 중 A128N+H129E+S46F 변이체의 초기 반응속도 U/mL은 야생형 대비 5.2배 증가하였다.
[실시예 3]: 포화 변이 수행 및 비색법을 이용한 변이체 탐색
α-1,3 푸코실 전달효소의 아미노산 위치 128에 해당하는 서열을 임의의 서열로 치환한 NNK 서열 (N은 A, C, G 또는 T이고, K는 G 또는 T인 서열)이 도입된 프라이머를 이용하여, 벡터 전체를 PCR하여 라이브러리를 구축하였다. 본 발명의 α-1,3 푸코실 전달효소는 첫 메티오닌 (methionine)서열부터 헤아릴 경우 메티오닌이 1번이 된다.
벡터 서열을 포함한 푸코실 전달효소의 증폭된 유전자는 본래의 플라스미드를 제거하기 위해 DpnⅠ효소 처리 후, 대장균 DH5α에 형질전환 시켰다. 발생된 모든 콜로니 (colony)로부터 변이 유전자를 추출하여 이를 대장균 BW25113 (DE3)에 형질전환 하였다. 형질전환된 각각의 콜로니를 96-정 상에서 카나마이신이 포함된 TB 배지 500 μL에 접종하여 30 내지 37℃에서 18 내지 24시간 동안 진탕 배양 후, 배양액 일부를 50 μg mL-1 카나마이신과 IPTG (Isopropyl β-D-a-thiogalactpyranoside)가 포함된 새로운 TB 배지 500 μL에 접종하여 30 내지 37℃에서 15 내지 20 시간을 배양하였다. 배양된 세포들은 원심분리 후, 세포를 50 μL의 버그 부스터 (BugBuster) 단백질 추출 시약으로 재 부유 시켜 원심분리 후에 세포 추출물을 얻어 이 중 10 내지 20 μL를 변이체 탐색 반응에 사용하였다. 80 내지 90 μL의 반응 용액은 1 내지 10 mM 트리스 완충용액 (pH8.0), 1 내지 5 mM 구아노신 5'-이인산-푸코오스와 5 내지 10 mM 락토오스, 0.1 내지 1 mM pH 지시약을 포함하며 푸코실 전달효소의 세포 추출액을 첨가함과 동시에 37℃에서 반응을 진행하여 15 내지 30분의 시간간격으로 흡광도를 측정하였다. 당 전이 효소의 비색법 (colorimetric method)을 통한 활성 측정은 당 공여체와 수용체간의 글리코시드 결합이 형성될 때 발생하는 수소이온에 의한 pH의 변화를 측정하는 방법으로서 푸코실락토오스의 생산성과 비례한다. 본 발명에서는 지시약인 페놀 레드의 붉은 색이 감소하는 560 nm에서의 흡광도의 감소를 스펙트럼 기계를 이용하여 분석하였다 [출원번호 10-2013-0039938].
본 발명에서는 탐색한 A128N 변이체를 '핫 스팟'으로 하여, 이후 순차적으로 129, 132 위치에 대해 상기의 방법을 이용하여 반복적 포화변이를 수행하였으며, 순차적으로 A128N와 H129E의 조합 변이체와 A128N와 H129E 및 Y132I의 조합 변이체를 생성하였다. 또한 본 발명에서는 128, 129, 132 번째 아미노산 위치의 변이를 클러스터 1로 지정하였으며, 46 번째 아미노산 위치의 변이를 클러스터 2로 지정하여 클러스터간의 조합 변이체를 생성하여 A128N, H129E와 Y132I 및 S46F의 조합적 변이체를 생성하였다.
상기 조합적 변이체의 예는 본 발명의 실시예에 한정된 것이 아니며, 클러스터 1과 클러스터 2로부터 2개 또는 3개 또는 4개의 아미노산이 치환된 조합적 변이체를 생성할 수 있다. 또한, 상기 치환된 아미노산은 본 발명의 실시예에 한정된 것이 아니며, 다른 아미노산으로의 치환도 가능하다.
본 발명은, α-1,3 푸코실올리고당을 생산함에 있어서 단백질의 말단 구조의 변화 및 염기서열 치환과 단백질 공학 변이를 통하여 가용성 단백질 발현량 및 효소활성이 증대된 α-1,3 푸코실 전달효소의 변이체를 만들고, 효소 반응 최적화와 함께 이를 α-1,3 푸코실올리고당 생산에 적용하여 수율 및 생산성을 증가시키는 것으로서, 유아식품과 기능성 식품 분야뿐 아니라 의약분야 등의 다양한 산업분야에 응용이 가능하다.
<110> SNU R&DB FOUNDATION
<120> HELICOBACTER PYLORI ALPHA-1,3 FUCOSYLTRANSFERASE GENE AND PROTEIN
WITH IMPROVED SOLUBLE PROTEIN EXPRESSION AND ACTIVITY, AND
THEREOF APPLICATION FOR SYNTHESIS OF ALPHA-1,3
FUCOSYLOLIGOSACCHARIDE
<130> Y14KP-025
<160> 27
<170> KopatentIn 2.0
<210> 1
<211> 380
<212> PRT
<213> truncated alpha-1,3 fucosyltransferase amino acid sequence
<400> 1
Met Phe Gln Pro Leu Leu Asp Ala Phe Ile Glu Ser Ala Ser Ile Glu
1 5 10 15
Lys Met Ala Ser Lys Ser Pro Pro Pro Pro Leu Lys Ile Ala Val Ala
20 25 30
Asn Trp Trp Gly Asp Glu Glu Ile Lys Glu Phe Lys Lys Ser Val Leu
35 40 45
Tyr Phe Ile Leu Ser Gln Arg Tyr Ala Ile Thr Leu His Gln Asn Pro
50 55 60
Asn Glu Phe Ser Asp Leu Val Leu Ser Asn Pro Leu Gly Ala Ala Arg
65 70 75 80
Lys Ile Leu Ser Tyr Gln Asn Thr Lys Arg Val Phe Tyr Thr Gly Glu
85 90 95
Asn Glu Ser Pro Asn Phe Asn Leu Phe Asp Tyr Ala Ile Gly Phe Asp
100 105 110
Glu Leu Asp Phe Asn Asp Arg Tyr Leu Arg Met Pro Leu Tyr Tyr Ala
115 120 125
His Leu His Tyr Lys Ala Glu Leu Val Asn Asp Thr Thr Ala Pro Tyr
130 135 140
Lys Leu Lys Asp Asn Ser Leu Tyr Ala Leu Lys Lys Pro Ser His His
145 150 155 160
Phe Lys Glu Asn His Pro Asn Leu Cys Ala Val Val Asn Asp Glu Ser
165 170 175
Asp Leu Leu Lys Arg Gly Phe Ala Ser Phe Val Ala Ser Asn Ala Asn
180 185 190
Ala Pro Met Arg Asn Ala Phe Tyr Asp Ala Leu Asn Ser Ile Glu Pro
195 200 205
Val Thr Gly Gly Gly Ser Val Arg Asn Thr Leu Gly Tyr Lys Val Gly
210 215 220
Asn Lys Ser Glu Phe Leu Ser Gln Tyr Lys Phe Asn Leu Cys Phe Glu
225 230 235 240
Asn Ser Gln Gly Tyr Gly Tyr Val Thr Glu Lys Ile Leu Asp Ala Tyr
245 250 255
Phe Ser His Thr Ile Pro Ile Tyr Trp Gly Ser Pro Ser Val Ala Lys
260 265 270
Asp Phe Asn Pro Lys Ser Phe Val Asn Val His Asp Phe Asn Asn Phe
275 280 285
Asp Glu Ala Ile Asp Tyr Ile Lys Tyr Leu His Thr His Pro Asn Ala
290 295 300
Tyr Leu Asp Met Leu Tyr Glu Asn Pro Leu Asn Thr Leu Asp Gly Lys
305 310 315 320
Ala Tyr Phe Tyr Gln Asp Leu Ser Phe Lys Lys Ile Leu Asp Phe Phe
325 330 335
Lys Thr Ile Leu Glu Asn Asp Thr Ile Tyr His Lys Phe Ser Thr Ser
340 345 350
Phe Met Trp Glu Tyr Asp Leu His Lys Pro Leu Val Ser Ile Asp Asp
355 360 365
Leu Arg Val Asn Tyr Asp Asp Leu Arg Val Asn Tyr
370 375 380
<210> 2
<211> 373
<212> PRT
<213> truncated alpha-1,3 fucosyltransferase amino acid sequence
<400> 2
Met Phe Gln Pro Leu Leu Asp Ala Phe Ile Glu Ser Ala Ser Ile Glu
1 5 10 15
Lys Met Ala Ser Lys Ser Pro Pro Pro Pro Leu Lys Ile Ala Val Ala
20 25 30
Asn Trp Trp Gly Asp Glu Glu Ile Lys Glu Phe Lys Lys Ser Val Leu
35 40 45
Tyr Phe Ile Leu Ser Gln Arg Tyr Ala Ile Thr Leu His Gln Asn Pro
50 55 60
Asn Glu Phe Ser Asp Leu Val Leu Ser Asn Pro Leu Gly Ala Ala Arg
65 70 75 80
Lys Ile Leu Ser Tyr Gln Asn Thr Lys Arg Val Phe Tyr Thr Gly Glu
85 90 95
Asn Glu Ser Pro Asn Phe Asn Leu Phe Asp Tyr Ala Ile Gly Phe Asp
100 105 110
Glu Leu Asp Phe Asn Asp Arg Tyr Leu Arg Met Pro Leu Tyr Tyr Ala
115 120 125
His Leu His Tyr Lys Ala Glu Leu Val Asn Asp Thr Thr Ala Pro Tyr
130 135 140
Lys Leu Lys Asp Asn Ser Leu Tyr Ala Leu Lys Lys Pro Ser His His
145 150 155 160
Phe Lys Glu Asn His Pro Asn Leu Cys Ala Val Val Asn Asp Glu Ser
165 170 175
Asp Leu Leu Lys Arg Gly Phe Ala Ser Phe Val Ala Ser Asn Ala Asn
180 185 190
Ala Pro Met Arg Asn Ala Phe Tyr Asp Ala Leu Asn Ser Ile Glu Pro
195 200 205
Val Thr Gly Gly Gly Ser Val Arg Asn Thr Leu Gly Tyr Lys Val Gly
210 215 220
Asn Lys Ser Glu Phe Leu Ser Gln Tyr Lys Phe Asn Leu Cys Phe Glu
225 230 235 240
Asn Ser Gln Gly Tyr Gly Tyr Val Thr Glu Lys Ile Leu Asp Ala Tyr
245 250 255
Phe Ser His Thr Ile Pro Ile Tyr Trp Gly Ser Pro Ser Val Ala Lys
260 265 270
Asp Phe Asn Pro Lys Ser Phe Val Asn Val His Asp Phe Asn Asn Phe
275 280 285
Asp Glu Ala Ile Asp Tyr Ile Lys Tyr Leu His Thr His Pro Asn Ala
290 295 300
Tyr Leu Asp Met Leu Tyr Glu Asn Pro Leu Asn Thr Leu Asp Gly Lys
305 310 315 320
Ala Tyr Phe Tyr Gln Asp Leu Ser Phe Lys Lys Ile Leu Asp Phe Phe
325 330 335
Lys Thr Ile Leu Glu Asn Asp Thr Ile Tyr His Lys Phe Ser Thr Ser
340 345 350
Phe Met Trp Glu Tyr Asp Leu His Lys Pro Leu Val Ser Ile Asp Asp
355 360 365
Leu Arg Val Asn Tyr
370
<210> 3
<211> 366
<212> PRT
<213> truncated alpha-1,3 fucosyltransferase amino acid sequence
<400> 3
Met Phe Gln Pro Leu Leu Asp Ala Phe Ile Glu Ser Ala Ser Ile Glu
1 5 10 15
Lys Met Ala Ser Lys Ser Pro Pro Pro Pro Leu Lys Ile Ala Val Ala
20 25 30
Asn Trp Trp Gly Asp Glu Glu Ile Lys Glu Phe Lys Lys Ser Val Leu
35 40 45
Tyr Phe Ile Leu Ser Gln Arg Tyr Ala Ile Thr Leu His Gln Asn Pro
50 55 60
Asn Glu Phe Ser Asp Leu Val Leu Ser Asn Pro Leu Gly Ala Ala Arg
65 70 75 80
Lys Ile Leu Ser Tyr Gln Asn Thr Lys Arg Val Phe Tyr Thr Gly Glu
85 90 95
Asn Glu Ser Pro Asn Phe Asn Leu Phe Asp Tyr Ala Ile Gly Phe Asp
100 105 110
Glu Leu Asp Phe Asn Asp Arg Tyr Leu Arg Met Pro Leu Tyr Tyr Ala
115 120 125
His Leu His Tyr Lys Ala Glu Leu Val Asn Asp Thr Thr Ala Pro Tyr
130 135 140
Lys Leu Lys Asp Asn Ser Leu Tyr Ala Leu Lys Lys Pro Ser His His
145 150 155 160
Phe Lys Glu Asn His Pro Asn Leu Cys Ala Val Val Asn Asp Glu Ser
165 170 175
Asp Leu Leu Lys Arg Gly Phe Ala Ser Phe Val Ala Ser Asn Ala Asn
180 185 190
Ala Pro Met Arg Asn Ala Phe Tyr Asp Ala Leu Asn Ser Ile Glu Pro
195 200 205
Val Thr Gly Gly Gly Ser Val Arg Asn Thr Leu Gly Tyr Lys Val Gly
210 215 220
Asn Lys Ser Glu Phe Leu Ser Gln Tyr Lys Phe Asn Leu Cys Phe Glu
225 230 235 240
Asn Ser Gln Gly Tyr Gly Tyr Val Thr Glu Lys Ile Leu Asp Ala Tyr
245 250 255
Phe Ser His Thr Ile Pro Ile Tyr Trp Gly Ser Pro Ser Val Ala Lys
260 265 270
Asp Phe Asn Pro Lys Ser Phe Val Asn Val His Asp Phe Asn Asn Phe
275 280 285
Asp Glu Ala Ile Asp Tyr Ile Lys Tyr Leu His Thr His Pro Asn Ala
290 295 300
Tyr Leu Asp Met Leu Tyr Glu Asn Pro Leu Asn Thr Leu Asp Gly Lys
305 310 315 320
Ala Tyr Phe Tyr Gln Asp Leu Ser Phe Lys Lys Ile Leu Asp Phe Phe
325 330 335
Lys Thr Ile Leu Glu Asn Asp Thr Ile Tyr His Lys Phe Ser Thr Ser
340 345 350
Phe Met Trp Glu Tyr Asp Leu His Lys Pro Leu Val Ser Ile
355 360 365
<210> 4
<211> 1119
<212> DNA
<213> truncated and optimized alpha-1,3 fucosyltransferase DNA sequence
<400> 4
atgttccaac cacttttaga cgcatttatc gagtcggcat caattgagaa aatggcatcg 60
aagagcccgc caccgccgtt gaagatcgcc gtcgctaact ggtggggcga cgaagagatc 120
aaagagttca agaaatctgt gctgtatttc atcctgtccc agcgctatgc gattacgctg 180
caccaaaatc cgaacgagtt cagcgacctg gttctgtcta acccgctggg cgcagcgcgt 240
aagattctga gctaccagaa taccaaacgt gttttctaca ccggtgaaaa cgaaagcccg 300
aacttcaact tgtttgatta cgctatcggt tttgatgaac tggatttcaa tgatcgctat 360
ctgcgtatgc cgctgtacta cgcgcatctg cactataaag ccgagctggt caacgacact 420
accgcgccat ataagctgaa agataatagc ctgtatgcct tgaagaaacc tagccaccac 480
ttcaaagaaa accacccgaa tctgtgcgca gtggttaatg atgaaagcga tctgctgaaa 540
cgtggttttg cgagctttgt cgcaagcaac gccaatgccc cgatgcgtaa cgctttttac 600
gacgcgctga acagcattga gccggtgacc ggtggcggta gcgtgcgcaa tacgttgggc 660
tacaaagtcg gtaataagag cgagttcctg agccagtaca agtttaatct gtgttttgag 720
aacagccaag gctatggtta cgttaccgag aagatcctgg acgcgtactt ctctcacacc 780
attccgatct attggggcag cccgtccgtt gcgaaagact tcaatccgaa atcctttgtg 840
aatgtccacg acttcaataa ctttgatgag gcgattgatt acattaagta tctgcacacg 900
catccgaatg cgtacttgga catgctgtat gaaaacccgc tgaacaccct ggacggtaag 960
gcgtactttt accaggacct gagcttcaag aaaatcctgg actttttcaa aaccatcctg 1020
gaaaacgata cgatttacca caagttcagc acgagcttta tgtgggaata tgatttgcat 1080
aagccgctgg ttagcattga cgatctgcgt gtgaattac 1119
<210> 5
<211> 1119
<212> DNA
<213> truncated alpha-1,3 fucosyltransferase DNA sequence
<400> 5
atgttccaac ccctattaga cgcctttata gaaagcgctt ccattgaaaa aatggcctct 60
aaatctcccc ccccccccct aaaaatcgct gtggcgaatt ggtggggaga tgaagaaatt 120
aaagaattta aaaagagcgt tctttatttt atcctaagcc aacgctacgc aatcaccctc 180
caccaaaacc ccaatgaatt ttcagatcta gttcttagca atcctcttgg agcggctaga 240
aagattttat cttatcaaaa cactaaacga gtgttttaca ccggtgaaaa cgaatcacct 300
aatttcaacc tctttgatta cgccataggc tttgatgaat tggattttaa tgatcgttat 360
ttgagaatgc ctttgtatta tgcccatttg cactataaag ccgagcttgt taatgacacc 420
actgcgccct acaaactcaa agacaacagc ctttatgctt taaaaaaacc ctctcatcat 480
tttaaagaaa accaccctaa tttgtgcgca gtagtgaatg atgagagcga tcttttaaaa 540
agagggtttg ccagttttgt agcgagcaac gctaacgctc ctatgaggaa cgctttttat 600
gacgctctaa attccataga gccagttact gggggaggaa gtgtgagaaa cactttaggc 660
tataaggttg gaaacaaaag cgagttttta agccaataca agttcaatct ctgttttgaa 720
aactcgcaag gttatggcta tgtaaccgaa aaaatccttg atgcgtattt tagccatacc 780
attcctattt attgggggag tcccagcgtg gcgaaagatt ttaaccctaa aagttttgtg 840
aatgtgcatg atttcaacaa ctttgatgaa gcgattgatt atatcaaata cctgcacacg 900
cacccaaacg cttatttaga catgctctat gaaaaccctt taaacaccct tgatgggaaa 960
gcttactttt accaagattt gagttttaaa aaaatcctag atttttttaa aacgatttta 1020
gaaaacgata cgatttatca caaattctca acatctttca tgtgggagta cgatctgcat 1080
aagccgttag tatccattga tgatttgagg gttaattat 1119
<210> 6
<211> 373
<212> PRT
<213> A128N truncated alpha-1,3 fucosyltransferase amino acid sequence
<400> 6
Met Phe Gln Pro Leu Leu Asp Ala Phe Ile Glu Ser Ala Ser Ile Glu
1 5 10 15
Lys Met Ala Ser Lys Ser Pro Pro Pro Pro Leu Lys Ile Ala Val Ala
20 25 30
Asn Trp Trp Gly Asp Glu Glu Ile Lys Glu Phe Lys Lys Ser Val Leu
35 40 45
Tyr Phe Ile Leu Ser Gln Arg Tyr Ala Ile Thr Leu His Gln Asn Pro
50 55 60
Asn Glu Phe Ser Asp Leu Val Leu Ser Asn Pro Leu Gly Ala Ala Arg
65 70 75 80
Lys Ile Leu Ser Tyr Gln Asn Thr Lys Arg Val Phe Tyr Thr Gly Glu
85 90 95
Asn Glu Ser Pro Asn Phe Asn Leu Phe Asp Tyr Ala Ile Gly Phe Asp
100 105 110
Glu Leu Asp Phe Asn Asp Arg Tyr Leu Arg Met Pro Leu Tyr Tyr Asn
115 120 125
His Leu His Tyr Lys Ala Glu Leu Val Asn Asp Thr Thr Ala Pro Tyr
130 135 140
Lys Leu Lys Asp Asn Ser Leu Tyr Ala Leu Lys Lys Pro Ser His His
145 150 155 160
Phe Lys Glu Asn His Pro Asn Leu Cys Ala Val Val Asn Asp Glu Ser
165 170 175
Asp Leu Leu Lys Arg Gly Phe Ala Ser Phe Val Ala Ser Asn Ala Asn
180 185 190
Ala Pro Met Arg Asn Ala Phe Tyr Asp Ala Leu Asn Ser Ile Glu Pro
195 200 205
Val Thr Gly Gly Gly Ser Val Arg Asn Thr Leu Gly Tyr Lys Val Gly
210 215 220
Asn Lys Ser Glu Phe Leu Ser Gln Tyr Lys Phe Asn Leu Cys Phe Glu
225 230 235 240
Asn Ser Gln Gly Tyr Gly Tyr Val Thr Glu Lys Ile Leu Asp Ala Tyr
245 250 255
Phe Ser His Thr Ile Pro Ile Tyr Trp Gly Ser Pro Ser Val Ala Lys
260 265 270
Asp Phe Asn Pro Lys Ser Phe Val Asn Val His Asp Phe Asn Asn Phe
275 280 285
Asp Glu Ala Ile Asp Tyr Ile Lys Tyr Leu His Thr His Pro Asn Ala
290 295 300
Tyr Leu Asp Met Leu Tyr Glu Asn Pro Leu Asn Thr Leu Asp Gly Lys
305 310 315 320
Ala Tyr Phe Tyr Gln Asp Leu Ser Phe Lys Lys Ile Leu Asp Phe Phe
325 330 335
Lys Thr Ile Leu Glu Asn Asp Thr Ile Tyr His Lys Phe Ser Thr Ser
340 345 350
Phe Met Trp Glu Tyr Asp Leu His Lys Pro Leu Val Ser Ile Asp Asp
355 360 365
Leu Arg Val Asn Tyr
370
<210> 7
<211> 373
<212> PRT
<213> H129E truncated alpha-1,3 fucosyltransferase amino acid sequence
<400> 7
Met Phe Gln Pro Leu Leu Asp Ala Phe Ile Glu Ser Ala Ser Ile Glu
1 5 10 15
Lys Met Ala Ser Lys Ser Pro Pro Pro Pro Leu Lys Ile Ala Val Ala
20 25 30
Asn Trp Trp Gly Asp Glu Glu Ile Lys Glu Phe Lys Lys Ser Val Leu
35 40 45
Tyr Phe Ile Leu Ser Gln Arg Tyr Ala Ile Thr Leu His Gln Asn Pro
50 55 60
Asn Glu Phe Ser Asp Leu Val Leu Ser Asn Pro Leu Gly Ala Ala Arg
65 70 75 80
Lys Ile Leu Ser Tyr Gln Asn Thr Lys Arg Val Phe Tyr Thr Gly Glu
85 90 95
Asn Glu Ser Pro Asn Phe Asn Leu Phe Asp Tyr Ala Ile Gly Phe Asp
100 105 110
Glu Leu Asp Phe Asn Asp Arg Tyr Leu Arg Met Pro Leu Tyr Tyr Ala
115 120 125
Glu Leu His Tyr Lys Ala Glu Leu Val Asn Asp Thr Thr Ala Pro Tyr
130 135 140
Lys Leu Lys Asp Asn Ser Leu Tyr Ala Leu Lys Lys Pro Ser His His
145 150 155 160
Phe Lys Glu Asn His Pro Asn Leu Cys Ala Val Val Asn Asp Glu Ser
165 170 175
Asp Leu Leu Lys Arg Gly Phe Ala Ser Phe Val Ala Ser Asn Ala Asn
180 185 190
Ala Pro Met Arg Asn Ala Phe Tyr Asp Ala Leu Asn Ser Ile Glu Pro
195 200 205
Val Thr Gly Gly Gly Ser Val Arg Asn Thr Leu Gly Tyr Lys Val Gly
210 215 220
Asn Lys Ser Glu Phe Leu Ser Gln Tyr Lys Phe Asn Leu Cys Phe Glu
225 230 235 240
Asn Ser Gln Gly Tyr Gly Tyr Val Thr Glu Lys Ile Leu Asp Ala Tyr
245 250 255
Phe Ser His Thr Ile Pro Ile Tyr Trp Gly Ser Pro Ser Val Ala Lys
260 265 270
Asp Phe Asn Pro Lys Ser Phe Val Asn Val His Asp Phe Asn Asn Phe
275 280 285
Asp Glu Ala Ile Asp Tyr Ile Lys Tyr Leu His Thr His Pro Asn Ala
290 295 300
Tyr Leu Asp Met Leu Tyr Glu Asn Pro Leu Asn Thr Leu Asp Gly Lys
305 310 315 320
Ala Tyr Phe Tyr Gln Asp Leu Ser Phe Lys Lys Ile Leu Asp Phe Phe
325 330 335
Lys Thr Ile Leu Glu Asn Asp Thr Ile Tyr His Lys Phe Ser Thr Ser
340 345 350
Phe Met Trp Glu Tyr Asp Leu His Lys Pro Leu Val Ser Ile Asp Asp
355 360 365
Leu Arg Val Asn Tyr
370
<210> 8
<211> 373
<212> PRT
<213> Y132I truncated alpha-1,3 fucosyltransferase amino acid sequence
<400> 8
Met Phe Gln Pro Leu Leu Asp Ala Phe Ile Glu Ser Ala Ser Ile Glu
1 5 10 15
Lys Met Ala Ser Lys Ser Pro Pro Pro Pro Leu Lys Ile Ala Val Ala
20 25 30
Asn Trp Trp Gly Asp Glu Glu Ile Lys Glu Phe Lys Lys Ser Val Leu
35 40 45
Tyr Phe Ile Leu Ser Gln Arg Tyr Ala Ile Thr Leu His Gln Asn Pro
50 55 60
Asn Glu Phe Ser Asp Leu Val Leu Ser Asn Pro Leu Gly Ala Ala Arg
65 70 75 80
Lys Ile Leu Ser Tyr Gln Asn Thr Lys Arg Val Phe Tyr Thr Gly Glu
85 90 95
Asn Glu Ser Pro Asn Phe Asn Leu Phe Asp Tyr Ala Ile Gly Phe Asp
100 105 110
Glu Leu Asp Phe Asn Asp Arg Tyr Leu Arg Met Pro Leu Tyr Tyr Ala
115 120 125
His Leu His Ile Lys Ala Glu Leu Val Asn Asp Thr Thr Ala Pro Tyr
130 135 140
Lys Leu Lys Asp Asn Ser Leu Tyr Ala Leu Lys Lys Pro Ser His His
145 150 155 160
Phe Lys Glu Asn His Pro Asn Leu Cys Ala Val Val Asn Asp Glu Ser
165 170 175
Asp Leu Leu Lys Arg Gly Phe Ala Ser Phe Val Ala Ser Asn Ala Asn
180 185 190
Ala Pro Met Arg Asn Ala Phe Tyr Asp Ala Leu Asn Ser Ile Glu Pro
195 200 205
Val Thr Gly Gly Gly Ser Val Arg Asn Thr Leu Gly Tyr Lys Val Gly
210 215 220
Asn Lys Ser Glu Phe Leu Ser Gln Tyr Lys Phe Asn Leu Cys Phe Glu
225 230 235 240
Asn Ser Gln Gly Tyr Gly Tyr Val Thr Glu Lys Ile Leu Asp Ala Tyr
245 250 255
Phe Ser His Thr Ile Pro Ile Tyr Trp Gly Ser Pro Ser Val Ala Lys
260 265 270
Asp Phe Asn Pro Lys Ser Phe Val Asn Val His Asp Phe Asn Asn Phe
275 280 285
Asp Glu Ala Ile Asp Tyr Ile Lys Tyr Leu His Thr His Pro Asn Ala
290 295 300
Tyr Leu Asp Met Leu Tyr Glu Asn Pro Leu Asn Thr Leu Asp Gly Lys
305 310 315 320
Ala Tyr Phe Tyr Gln Asp Leu Ser Phe Lys Lys Ile Leu Asp Phe Phe
325 330 335
Lys Thr Ile Leu Glu Asn Asp Thr Ile Tyr His Lys Phe Ser Thr Ser
340 345 350
Phe Met Trp Glu Tyr Asp Leu His Lys Pro Leu Val Ser Ile Asp Asp
355 360 365
Leu Arg Val Asn Tyr
370
<210> 9
<211> 373
<212> PRT
<213> S46F truncated alpha-1,3 fucosyltransferase amino acid sequence
<400> 9
Met Phe Gln Pro Leu Leu Asp Ala Phe Ile Glu Ser Ala Ser Ile Glu
1 5 10 15
Lys Met Ala Ser Lys Ser Pro Pro Pro Pro Leu Lys Ile Ala Val Ala
20 25 30
Asn Trp Trp Gly Asp Glu Glu Ile Lys Glu Phe Lys Lys Phe Val Leu
35 40 45
Tyr Phe Ile Leu Ser Gln Arg Tyr Ala Ile Thr Leu His Gln Asn Pro
50 55 60
Asn Glu Phe Ser Asp Leu Val Leu Ser Asn Pro Leu Gly Ala Ala Arg
65 70 75 80
Lys Ile Leu Ser Tyr Gln Asn Thr Lys Arg Val Phe Tyr Thr Gly Glu
85 90 95
Asn Glu Ser Pro Asn Phe Asn Leu Phe Asp Tyr Ala Ile Gly Phe Asp
100 105 110
Glu Leu Asp Phe Asn Asp Arg Tyr Leu Arg Met Pro Leu Tyr Tyr Ala
115 120 125
His Leu His Tyr Lys Ala Glu Leu Val Asn Asp Thr Thr Ala Pro Tyr
130 135 140
Lys Leu Lys Asp Asn Ser Leu Tyr Ala Leu Lys Lys Pro Ser His His
145 150 155 160
Phe Lys Glu Asn His Pro Asn Leu Cys Ala Val Val Asn Asp Glu Ser
165 170 175
Asp Leu Leu Lys Arg Gly Phe Ala Ser Phe Val Ala Ser Asn Ala Asn
180 185 190
Ala Pro Met Arg Asn Ala Phe Tyr Asp Ala Leu Asn Ser Ile Glu Pro
195 200 205
Val Thr Gly Gly Gly Ser Val Arg Asn Thr Leu Gly Tyr Lys Val Gly
210 215 220
Asn Lys Ser Glu Phe Leu Ser Gln Tyr Lys Phe Asn Leu Cys Phe Glu
225 230 235 240
Asn Ser Gln Gly Tyr Gly Tyr Val Thr Glu Lys Ile Leu Asp Ala Tyr
245 250 255
Phe Ser His Thr Ile Pro Ile Tyr Trp Gly Ser Pro Ser Val Ala Lys
260 265 270
Asp Phe Asn Pro Lys Ser Phe Val Asn Val His Asp Phe Asn Asn Phe
275 280 285
Asp Glu Ala Ile Asp Tyr Ile Lys Tyr Leu His Thr His Pro Asn Ala
290 295 300
Tyr Leu Asp Met Leu Tyr Glu Asn Pro Leu Asn Thr Leu Asp Gly Lys
305 310 315 320
Ala Tyr Phe Tyr Gln Asp Leu Ser Phe Lys Lys Ile Leu Asp Phe Phe
325 330 335
Lys Thr Ile Leu Glu Asn Asp Thr Ile Tyr His Lys Phe Ser Thr Ser
340 345 350
Phe Met Trp Glu Tyr Asp Leu His Lys Pro Leu Val Ser Ile Asp Asp
355 360 365
Leu Arg Val Asn Tyr
370
<210> 10
<211> 373
<212> PRT
<213> A128N and H129E truncated alpha-1,3 fucosyltransferase amino acid sequence
<400> 10
Met Phe Gln Pro Leu Leu Asp Ala Phe Ile Glu Ser Ala Ser Ile Glu
1 5 10 15
Lys Met Ala Ser Lys Ser Pro Pro Pro Pro Leu Lys Ile Ala Val Ala
20 25 30
Asn Trp Trp Gly Asp Glu Glu Ile Lys Glu Phe Lys Lys Ser Val Leu
35 40 45
Tyr Phe Ile Leu Ser Gln Arg Tyr Ala Ile Thr Leu His Gln Asn Pro
50 55 60
Asn Glu Phe Ser Asp Leu Val Leu Ser Asn Pro Leu Gly Ala Ala Arg
65 70 75 80
Lys Ile Leu Ser Tyr Gln Asn Thr Lys Arg Val Phe Tyr Thr Gly Glu
85 90 95
Asn Glu Ser Pro Asn Phe Asn Leu Phe Asp Tyr Ala Ile Gly Phe Asp
100 105 110
Glu Leu Asp Phe Asn Asp Arg Tyr Leu Arg Met Pro Leu Tyr Tyr Asn
115 120 125
Glu Leu His Tyr Lys Ala Glu Leu Val Asn Asp Thr Thr Ala Pro Tyr
130 135 140
Lys Leu Lys Asp Asn Ser Leu Tyr Ala Leu Lys Lys Pro Ser His His
145 150 155 160
Phe Lys Glu Asn His Pro Asn Leu Cys Ala Val Val Asn Asp Glu Ser
165 170 175
Asp Leu Leu Lys Arg Gly Phe Ala Ser Phe Val Ala Ser Asn Ala Asn
180 185 190
Ala Pro Met Arg Asn Ala Phe Tyr Asp Ala Leu Asn Ser Ile Glu Pro
195 200 205
Val Thr Gly Gly Gly Ser Val Arg Asn Thr Leu Gly Tyr Lys Val Gly
210 215 220
Asn Lys Ser Glu Phe Leu Ser Gln Tyr Lys Phe Asn Leu Cys Phe Glu
225 230 235 240
Asn Ser Gln Gly Tyr Gly Tyr Val Thr Glu Lys Ile Leu Asp Ala Tyr
245 250 255
Phe Ser His Thr Ile Pro Ile Tyr Trp Gly Ser Pro Ser Val Ala Lys
260 265 270
Asp Phe Asn Pro Lys Ser Phe Val Asn Val His Asp Phe Asn Asn Phe
275 280 285
Asp Glu Ala Ile Asp Tyr Ile Lys Tyr Leu His Thr His Pro Asn Ala
290 295 300
Tyr Leu Asp Met Leu Tyr Glu Asn Pro Leu Asn Thr Leu Asp Gly Lys
305 310 315 320
Ala Tyr Phe Tyr Gln Asp Leu Ser Phe Lys Lys Ile Leu Asp Phe Phe
325 330 335
Lys Thr Ile Leu Glu Asn Asp Thr Ile Tyr His Lys Phe Ser Thr Ser
340 345 350
Phe Met Trp Glu Tyr Asp Leu His Lys Pro Leu Val Ser Ile Asp Asp
355 360 365
Leu Arg Val Asn Tyr
370
<210> 11
<211> 373
<212> PRT
<213> A128N and Y132I truncated alpha-1,3 fucosyltransferase amino acid sequence
<400> 11
Met Phe Gln Pro Leu Leu Asp Ala Phe Ile Glu Ser Ala Ser Ile Glu
1 5 10 15
Lys Met Ala Ser Lys Ser Pro Pro Pro Pro Leu Lys Ile Ala Val Ala
20 25 30
Asn Trp Trp Gly Asp Glu Glu Ile Lys Glu Phe Lys Lys Ser Val Leu
35 40 45
Tyr Phe Ile Leu Ser Gln Arg Tyr Ala Ile Thr Leu His Gln Asn Pro
50 55 60
Asn Glu Phe Ser Asp Leu Val Leu Ser Asn Pro Leu Gly Ala Ala Arg
65 70 75 80
Lys Ile Leu Ser Tyr Gln Asn Thr Lys Arg Val Phe Tyr Thr Gly Glu
85 90 95
Asn Glu Ser Pro Asn Phe Asn Leu Phe Asp Tyr Ala Ile Gly Phe Asp
100 105 110
Glu Leu Asp Phe Asn Asp Arg Tyr Leu Arg Met Pro Leu Tyr Tyr Asn
115 120 125
His Leu His Ile Lys Ala Glu Leu Val Asn Asp Thr Thr Ala Pro Tyr
130 135 140
Lys Leu Lys Asp Asn Ser Leu Tyr Ala Leu Lys Lys Pro Ser His His
145 150 155 160
Phe Lys Glu Asn His Pro Asn Leu Cys Ala Val Val Asn Asp Glu Ser
165 170 175
Asp Leu Leu Lys Arg Gly Phe Ala Ser Phe Val Ala Ser Asn Ala Asn
180 185 190
Ala Pro Met Arg Asn Ala Phe Tyr Asp Ala Leu Asn Ser Ile Glu Pro
195 200 205
Val Thr Gly Gly Gly Ser Val Arg Asn Thr Leu Gly Tyr Lys Val Gly
210 215 220
Asn Lys Ser Glu Phe Leu Ser Gln Tyr Lys Phe Asn Leu Cys Phe Glu
225 230 235 240
Asn Ser Gln Gly Tyr Gly Tyr Val Thr Glu Lys Ile Leu Asp Ala Tyr
245 250 255
Phe Ser His Thr Ile Pro Ile Tyr Trp Gly Ser Pro Ser Val Ala Lys
260 265 270
Asp Phe Asn Pro Lys Ser Phe Val Asn Val His Asp Phe Asn Asn Phe
275 280 285
Asp Glu Ala Ile Asp Tyr Ile Lys Tyr Leu His Thr His Pro Asn Ala
290 295 300
Tyr Leu Asp Met Leu Tyr Glu Asn Pro Leu Asn Thr Leu Asp Gly Lys
305 310 315 320
Ala Tyr Phe Tyr Gln Asp Leu Ser Phe Lys Lys Ile Leu Asp Phe Phe
325 330 335
Lys Thr Ile Leu Glu Asn Asp Thr Ile Tyr His Lys Phe Ser Thr Ser
340 345 350
Phe Met Trp Glu Tyr Asp Leu His Lys Pro Leu Val Ser Ile Asp Asp
355 360 365
Leu Arg Val Asn Tyr
370
<210> 12
<211> 373
<212> PRT
<213> A128N and S46F truncated alpha-1,3 fucosyltransferase amino acid sequence
<400> 12
Met Phe Gln Pro Leu Leu Asp Ala Phe Ile Glu Ser Ala Ser Ile Glu
1 5 10 15
Lys Met Ala Ser Lys Ser Pro Pro Pro Pro Leu Lys Ile Ala Val Ala
20 25 30
Asn Trp Trp Gly Asp Glu Glu Ile Lys Glu Phe Lys Lys Phe Val Leu
35 40 45
Tyr Phe Ile Leu Ser Gln Arg Tyr Ala Ile Thr Leu His Gln Asn Pro
50 55 60
Asn Glu Phe Ser Asp Leu Val Leu Ser Asn Pro Leu Gly Ala Ala Arg
65 70 75 80
Lys Ile Leu Ser Tyr Gln Asn Thr Lys Arg Val Phe Tyr Thr Gly Glu
85 90 95
Asn Glu Ser Pro Asn Phe Asn Leu Phe Asp Tyr Ala Ile Gly Phe Asp
100 105 110
Glu Leu Asp Phe Asn Asp Arg Tyr Leu Arg Met Pro Leu Tyr Tyr Asn
115 120 125
His Leu His Tyr Lys Ala Glu Leu Val Asn Asp Thr Thr Ala Pro Tyr
130 135 140
Lys Leu Lys Asp Asn Ser Leu Tyr Ala Leu Lys Lys Pro Ser His His
145 150 155 160
Phe Lys Glu Asn His Pro Asn Leu Cys Ala Val Val Asn Asp Glu Ser
165 170 175
Asp Leu Leu Lys Arg Gly Phe Ala Ser Phe Val Ala Ser Asn Ala Asn
180 185 190
Ala Pro Met Arg Asn Ala Phe Tyr Asp Ala Leu Asn Ser Ile Glu Pro
195 200 205
Val Thr Gly Gly Gly Ser Val Arg Asn Thr Leu Gly Tyr Lys Val Gly
210 215 220
Asn Lys Ser Glu Phe Leu Ser Gln Tyr Lys Phe Asn Leu Cys Phe Glu
225 230 235 240
Asn Ser Gln Gly Tyr Gly Tyr Val Thr Glu Lys Ile Leu Asp Ala Tyr
245 250 255
Phe Ser His Thr Ile Pro Ile Tyr Trp Gly Ser Pro Ser Val Ala Lys
260 265 270
Asp Phe Asn Pro Lys Ser Phe Val Asn Val His Asp Phe Asn Asn Phe
275 280 285
Asp Glu Ala Ile Asp Tyr Ile Lys Tyr Leu His Thr His Pro Asn Ala
290 295 300
Tyr Leu Asp Met Leu Tyr Glu Asn Pro Leu Asn Thr Leu Asp Gly Lys
305 310 315 320
Ala Tyr Phe Tyr Gln Asp Leu Ser Phe Lys Lys Ile Leu Asp Phe Phe
325 330 335
Lys Thr Ile Leu Glu Asn Asp Thr Ile Tyr His Lys Phe Ser Thr Ser
340 345 350
Phe Met Trp Glu Tyr Asp Leu His Lys Pro Leu Val Ser Ile Asp Asp
355 360 365
Leu Arg Val Asn Tyr
370
<210> 13
<211> 373
<212> PRT
<213> A128N and H129E and Y132I truncated alpha-1,3 fucosyltransferase amino acid sequence
<400> 13
Met Phe Gln Pro Leu Leu Asp Ala Phe Ile Glu Ser Ala Ser Ile Glu
1 5 10 15
Lys Met Ala Ser Lys Ser Pro Pro Pro Pro Leu Lys Ile Ala Val Ala
20 25 30
Asn Trp Trp Gly Asp Glu Glu Ile Lys Glu Phe Lys Lys Ser Val Leu
35 40 45
Tyr Phe Ile Leu Ser Gln Arg Tyr Ala Ile Thr Leu His Gln Asn Pro
50 55 60
Asn Glu Phe Ser Asp Leu Val Leu Ser Asn Pro Leu Gly Ala Ala Arg
65 70 75 80
Lys Ile Leu Ser Tyr Gln Asn Thr Lys Arg Val Phe Tyr Thr Gly Glu
85 90 95
Asn Glu Ser Pro Asn Phe Asn Leu Phe Asp Tyr Ala Ile Gly Phe Asp
100 105 110
Glu Leu Asp Phe Asn Asp Arg Tyr Leu Arg Met Pro Leu Tyr Tyr Asn
115 120 125
Glu Leu His Ile Lys Ala Glu Leu Val Asn Asp Thr Thr Ala Pro Tyr
130 135 140
Lys Leu Lys Asp Asn Ser Leu Tyr Ala Leu Lys Lys Pro Ser His His
145 150 155 160
Phe Lys Glu Asn His Pro Asn Leu Cys Ala Val Val Asn Asp Glu Ser
165 170 175
Asp Leu Leu Lys Arg Gly Phe Ala Ser Phe Val Ala Ser Asn Ala Asn
180 185 190
Ala Pro Met Arg Asn Ala Phe Tyr Asp Ala Leu Asn Ser Ile Glu Pro
195 200 205
Val Thr Gly Gly Gly Ser Val Arg Asn Thr Leu Gly Tyr Lys Val Gly
210 215 220
Asn Lys Ser Glu Phe Leu Ser Gln Tyr Lys Phe Asn Leu Cys Phe Glu
225 230 235 240
Asn Ser Gln Gly Tyr Gly Tyr Val Thr Glu Lys Ile Leu Asp Ala Tyr
245 250 255
Phe Ser His Thr Ile Pro Ile Tyr Trp Gly Ser Pro Ser Val Ala Lys
260 265 270
Asp Phe Asn Pro Lys Ser Phe Val Asn Val His Asp Phe Asn Asn Phe
275 280 285
Asp Glu Ala Ile Asp Tyr Ile Lys Tyr Leu His Thr His Pro Asn Ala
290 295 300
Tyr Leu Asp Met Leu Tyr Glu Asn Pro Leu Asn Thr Leu Asp Gly Lys
305 310 315 320
Ala Tyr Phe Tyr Gln Asp Leu Ser Phe Lys Lys Ile Leu Asp Phe Phe
325 330 335
Lys Thr Ile Leu Glu Asn Asp Thr Ile Tyr His Lys Phe Ser Thr Ser
340 345 350
Phe Met Trp Glu Tyr Asp Leu His Lys Pro Leu Val Ser Ile Asp Asp
355 360 365
Leu Arg Val Asn Tyr
370
<210> 14
<211> 373
<212> PRT
<213> A128N and H129E and S46F truncated alpha-1,3 fucosyltransferase amino acid sequence
<400> 14
Met Phe Gln Pro Leu Leu Asp Ala Phe Ile Glu Ser Ala Ser Ile Glu
1 5 10 15
Lys Met Ala Ser Lys Ser Pro Pro Pro Pro Leu Lys Ile Ala Val Ala
20 25 30
Asn Trp Trp Gly Asp Glu Glu Ile Lys Glu Phe Lys Lys Phe Val Leu
35 40 45
Tyr Phe Ile Leu Ser Gln Arg Tyr Ala Ile Thr Leu His Gln Asn Pro
50 55 60
Asn Glu Phe Ser Asp Leu Val Leu Ser Asn Pro Leu Gly Ala Ala Arg
65 70 75 80
Lys Ile Leu Ser Tyr Gln Asn Thr Lys Arg Val Phe Tyr Thr Gly Glu
85 90 95
Asn Glu Ser Pro Asn Phe Asn Leu Phe Asp Tyr Ala Ile Gly Phe Asp
100 105 110
Glu Leu Asp Phe Asn Asp Arg Tyr Leu Arg Met Pro Leu Tyr Tyr Asn
115 120 125
Glu Leu His Tyr Lys Ala Glu Leu Val Asn Asp Thr Thr Ala Pro Tyr
130 135 140
Lys Leu Lys Asp Asn Ser Leu Tyr Ala Leu Lys Lys Pro Ser His His
145 150 155 160
Phe Lys Glu Asn His Pro Asn Leu Cys Ala Val Val Asn Asp Glu Ser
165 170 175
Asp Leu Leu Lys Arg Gly Phe Ala Ser Phe Val Ala Ser Asn Ala Asn
180 185 190
Ala Pro Met Arg Asn Ala Phe Tyr Asp Ala Leu Asn Ser Ile Glu Pro
195 200 205
Val Thr Gly Gly Gly Ser Val Arg Asn Thr Leu Gly Tyr Lys Val Gly
210 215 220
Asn Lys Ser Glu Phe Leu Ser Gln Tyr Lys Phe Asn Leu Cys Phe Glu
225 230 235 240
Asn Ser Gln Gly Tyr Gly Tyr Val Thr Glu Lys Ile Leu Asp Ala Tyr
245 250 255
Phe Ser His Thr Ile Pro Ile Tyr Trp Gly Ser Pro Ser Val Ala Lys
260 265 270
Asp Phe Asn Pro Lys Ser Phe Val Asn Val His Asp Phe Asn Asn Phe
275 280 285
Asp Glu Ala Ile Asp Tyr Ile Lys Tyr Leu His Thr His Pro Asn Ala
290 295 300
Tyr Leu Asp Met Leu Tyr Glu Asn Pro Leu Asn Thr Leu Asp Gly Lys
305 310 315 320
Ala Tyr Phe Tyr Gln Asp Leu Ser Phe Lys Lys Ile Leu Asp Phe Phe
325 330 335
Lys Thr Ile Leu Glu Asn Asp Thr Ile Tyr His Lys Phe Ser Thr Ser
340 345 350
Phe Met Trp Glu Tyr Asp Leu His Lys Pro Leu Val Ser Ile Asp Asp
355 360 365
Leu Arg Val Asn Tyr
370
<210> 15
<211> 373
<212> PRT
<213> A128N and Y132I and S46F truncated alpha-1,3 fucosyltransferase amino acid sequence
<400> 15
Met Phe Gln Pro Leu Leu Asp Ala Phe Ile Glu Ser Ala Ser Ile Glu
1 5 10 15
Lys Met Ala Ser Lys Ser Pro Pro Pro Pro Leu Lys Ile Ala Val Ala
20 25 30
Asn Trp Trp Gly Asp Glu Glu Ile Lys Glu Phe Lys Lys Phe Val Leu
35 40 45
Tyr Phe Ile Leu Ser Gln Arg Tyr Ala Ile Thr Leu His Gln Asn Pro
50 55 60
Asn Glu Phe Ser Asp Leu Val Leu Ser Asn Pro Leu Gly Ala Ala Arg
65 70 75 80
Lys Ile Leu Ser Tyr Gln Asn Thr Lys Arg Val Phe Tyr Thr Gly Glu
85 90 95
Asn Glu Ser Pro Asn Phe Asn Leu Phe Asp Tyr Ala Ile Gly Phe Asp
100 105 110
Glu Leu Asp Phe Asn Asp Arg Tyr Leu Arg Met Pro Leu Tyr Tyr Asn
115 120 125
His Leu His Ile Lys Ala Glu Leu Val Asn Asp Thr Thr Ala Pro Tyr
130 135 140
Lys Leu Lys Asp Asn Ser Leu Tyr Ala Leu Lys Lys Pro Ser His His
145 150 155 160
Phe Lys Glu Asn His Pro Asn Leu Cys Ala Val Val Asn Asp Glu Ser
165 170 175
Asp Leu Leu Lys Arg Gly Phe Ala Ser Phe Val Ala Ser Asn Ala Asn
180 185 190
Ala Pro Met Arg Asn Ala Phe Tyr Asp Ala Leu Asn Ser Ile Glu Pro
195 200 205
Val Thr Gly Gly Gly Ser Val Arg Asn Thr Leu Gly Tyr Lys Val Gly
210 215 220
Asn Lys Ser Glu Phe Leu Ser Gln Tyr Lys Phe Asn Leu Cys Phe Glu
225 230 235 240
Asn Ser Gln Gly Tyr Gly Tyr Val Thr Glu Lys Ile Leu Asp Ala Tyr
245 250 255
Phe Ser His Thr Ile Pro Ile Tyr Trp Gly Ser Pro Ser Val Ala Lys
260 265 270
Asp Phe Asn Pro Lys Ser Phe Val Asn Val His Asp Phe Asn Asn Phe
275 280 285
Asp Glu Ala Ile Asp Tyr Ile Lys Tyr Leu His Thr His Pro Asn Ala
290 295 300
Tyr Leu Asp Met Leu Tyr Glu Asn Pro Leu Asn Thr Leu Asp Gly Lys
305 310 315 320
Ala Tyr Phe Tyr Gln Asp Leu Ser Phe Lys Lys Ile Leu Asp Phe Phe
325 330 335
Lys Thr Ile Leu Glu Asn Asp Thr Ile Tyr His Lys Phe Ser Thr Ser
340 345 350
Phe Met Trp Glu Tyr Asp Leu His Lys Pro Leu Val Ser Ile Asp Asp
355 360 365
Leu Arg Val Asn Tyr
370
<210> 16
<211> 373
<212> PRT
<213> A128N, H129E, Y132I and S46F truncated alpha-1,3 fucosyltransferase amino acid sequence
<400> 16
Met Phe Gln Pro Leu Leu Asp Ala Phe Ile Glu Ser Ala Ser Ile Glu
1 5 10 15
Lys Met Ala Ser Lys Ser Pro Pro Pro Pro Leu Lys Ile Ala Val Ala
20 25 30
Asn Trp Trp Gly Asp Glu Glu Ile Lys Glu Phe Lys Lys Phe Val Leu
35 40 45
Tyr Phe Ile Leu Ser Gln Arg Tyr Ala Ile Thr Leu His Gln Asn Pro
50 55 60
Asn Glu Phe Ser Asp Leu Val Leu Ser Asn Pro Leu Gly Ala Ala Arg
65 70 75 80
Lys Ile Leu Ser Tyr Gln Asn Thr Lys Arg Val Phe Tyr Thr Gly Glu
85 90 95
Asn Glu Ser Pro Asn Phe Asn Leu Phe Asp Tyr Ala Ile Gly Phe Asp
100 105 110
Glu Leu Asp Phe Asn Asp Arg Tyr Leu Arg Met Pro Leu Tyr Tyr Asn
115 120 125
Glu Leu His Ile Lys Ala Glu Leu Val Asn Asp Thr Thr Ala Pro Tyr
130 135 140
Lys Leu Lys Asp Asn Ser Leu Tyr Ala Leu Lys Lys Pro Ser His His
145 150 155 160
Phe Lys Glu Asn His Pro Asn Leu Cys Ala Val Val Asn Asp Glu Ser
165 170 175
Asp Leu Leu Lys Arg Gly Phe Ala Ser Phe Val Ala Ser Asn Ala Asn
180 185 190
Ala Pro Met Arg Asn Ala Phe Tyr Asp Ala Leu Asn Ser Ile Glu Pro
195 200 205
Val Thr Gly Gly Gly Ser Val Arg Asn Thr Leu Gly Tyr Lys Val Gly
210 215 220
Asn Lys Ser Glu Phe Leu Ser Gln Tyr Lys Phe Asn Leu Cys Phe Glu
225 230 235 240
Asn Ser Gln Gly Tyr Gly Tyr Val Thr Glu Lys Ile Leu Asp Ala Tyr
245 250 255
Phe Ser His Thr Ile Pro Ile Tyr Trp Gly Ser Pro Ser Val Ala Lys
260 265 270
Asp Phe Asn Pro Lys Ser Phe Val Asn Val His Asp Phe Asn Asn Phe
275 280 285
Asp Glu Ala Ile Asp Tyr Ile Lys Tyr Leu His Thr His Pro Asn Ala
290 295 300
Tyr Leu Asp Met Leu Tyr Glu Asn Pro Leu Asn Thr Leu Asp Gly Lys
305 310 315 320
Ala Tyr Phe Tyr Gln Asp Leu Ser Phe Lys Lys Ile Leu Asp Phe Phe
325 330 335
Lys Thr Ile Leu Glu Asn Asp Thr Ile Tyr His Lys Phe Ser Thr Ser
340 345 350
Phe Met Trp Glu Tyr Asp Leu His Lys Pro Leu Val Ser Ile Asp Asp
355 360 365
Leu Arg Val Asn Tyr
370
<210> 17
<211> 1119
<212> DNA
<213> A128N truncated alpha-1,3 fucosyltransferase DNA sequence
<400> 17
atgttccaac cacttttaga cgcatttatc gagtcggcat caattgagaa aatggcatcg 60
aagagcccgc caccgccgtt gaagatcgcc gtcgctaact ggtggggcga cgaagagatc 120
aaagagttca agaaatctgt gctgtatttc atcctgtccc agcgctatgc gattacgctg 180
caccaaaatc cgaacgagtt cagcgacctg gttctgtcta acccgctggg cgcagcgcgt 240
aagattctga gctaccagaa taccaaacgt gttttctaca ccggtgaaaa cgaaagcccg 300
aacttcaact tgtttgatta cgctatcggt tttgatgaac tggatttcaa tgatcgctat 360
ctgcgtatgc cgctgtacta caatcatctg cactataaag ccgagctggt caacgacact 420
accgcgccat ataagctgaa agataatagc ctgtatgcct tgaagaaacc tagccaccac 480
ttcaaagaaa accacccgaa tctgtgcgca gtggttaatg atgaaagcga tctgctgaaa 540
cgtggttttg cgagctttgt cgcaagcaac gccaatgccc cgatgcgtaa cgctttttac 600
gacgcgctga acagcattga gccggtgacc ggtggcggta gcgtgcgcaa tacgttgggc 660
tacaaagtcg gtaataagag cgagttcctg agccagtaca agtttaatct gtgttttgag 720
aacagccaag gctatggtta cgttaccgag aagatcctgg acgcgtactt ctctcacacc 780
attccgatct attggggcag cccgtccgtt gcgaaagact tcaatccgaa atcctttgtg 840
aatgtccacg acttcaataa ctttgatgag gcgattgatt acattaagta tctgcacacg 900
catccgaatg cgtacttgga catgctgtat gaaaacccgc tgaacaccct ggacggtaag 960
gcgtactttt accaggacct gagcttcaag aaaatcctgg actttttcaa aaccatcctg 1020
gaaaacgata cgatttacca caagttcagc acgagcttta tgtgggaata tgatttgcat 1080
aagccgctgg ttagcattga cgatctgcgt gtgaattac 1119
<210> 18
<211> 1119
<212> DNA
<213> H129E truncated alpha-1,3 fucosyltransferase DNA sequence
<400> 18
atgttccaac cacttttaga cgcatttatc gagtcggcat caattgagaa aatggcatcg 60
aagagcccgc caccgccgtt gaagatcgcc gtcgctaact ggtggggcga cgaagagatc 120
aaagagttca agaaatctgt gctgtatttc atcctgtccc agcgctatgc gattacgctg 180
caccaaaatc cgaacgagtt cagcgacctg gttctgtcta acccgctggg cgcagcgcgt 240
aagattctga gctaccagaa taccaaacgt gttttctaca ccggtgaaaa cgaaagcccg 300
aacttcaact tgtttgatta cgctatcggt tttgatgaac tggatttcaa tgatcgctat 360
ctgcgtatgc cgctgtacta cgcggagctg cactataaag ccgagcttgt caacgacact 420
accgcgccat ataagctgaa agataatagc ctgtatgcct tgaagaaacc tagccaccac 480
ttcaaagaaa accacccgaa tctgtgcgca gtggttaatg atgaaagcga tctgctgaaa 540
cgtggttttg cgagctttgt cgcaagcaac gccaatgccc cgatgcgtaa cgctttttac 600
gacgcgctga acagcattga gccggtgacc ggtggcggta gcgtgcgcaa tacgttgggc 660
tacaaagtcg gtaataagag cgagttcctg agccagtaca agtttaatct gtgttttgag 720
aacagccaag gctatggtta cgttaccgag aagatcctgg acgcgtactt ctctcacacc 780
attccgatct attggggcag cccgtccgtt gcgaaagact tcaatccgaa atcctttgtg 840
aatgtccacg acttcaataa ctttgatgag gcgattgatt acattaagta tctgcacacg 900
catccgaatg cgtacttgga catgctgtat gaaaacccgc tgaacaccct ggacggtaag 960
gcgtactttt accaggacct gagcttcaag aaaatcctgg actttttcaa aaccatcctg 1020
gaaaacgata cgatttacca caagttcagc acgagcttta tgtgggaata tgatttgcat 1080
aagccgctgg ttagcattga cgatctgcgt gtgaattac 1119
<210> 19
<211> 1119
<212> DNA
<213> Y132I truncated alpha-1,3 fucosyltransferase DNA sequence
<400> 19
atgttccaac cacttttaga cgcatttatc gagtcggcat caattgagaa aatggcatcg 60
aagagcccgc caccgccgtt gaagatcgcc gtcgctaact ggtggggcga cgaagagatc 120
aaagagttca agaaatctgt gctgtatttc atcctgtccc agcgctatgc gattacgctg 180
caccaaaatc cgaacgagtt cagcgacctg gttctgtcta acccgctggg cgcagcgcgt 240
aagattctga gctaccagaa taccaaacgt gttttctaca ccggtgaaaa cgaaagcccg 300
aacttcaact tgtttgatta cgctatcggt tttgatgaac tggatttcaa tgatcgctat 360
ctgcgtatgc cgctgtacta cgcgcatctg cacattaaag ccgagctggt caacgacact 420
accgcgccat ataagctgaa agataatagc ctgtatgcct tgaagaaacc tagccaccac 480
ttcaaagaaa accacccgaa tctgtgcgca gtggttaatg atgaaagcga tctgctgaaa 540
cgtggttttg cgagctttgt cgcaagcaac gccaatgccc cgatgcgtaa cgctttttac 600
gacgcgctga acagcattga gccggtgacc ggtggcggta gcgtgcgcaa tacgttgggc 660
tacaaagtcg gtaataagag cgagttcctg agccagtaca agtttaatct gtgttttgag 720
aacagccaag gctatggtta cgttaccgag aagatcctgg acgcgtactt ctctcacacc 780
attccgatct attggggcag cccgtccgtt gcgaaagact tcaatccgaa atcctttgtg 840
aatgtccacg acttcaataa ctttgatgag gcgattgatt acattaagta tctgcacacg 900
catccgaatg cgtacttgga catgctgtat gaaaacccgc tgaacaccct ggacggtaag 960
gcgtactttt accaggacct gagcttcaag aaaatcctgg actttttcaa aaccatcctg 1020
gaaaacgata cgatttacca caagttcagc acgagcttta tgtgggaata tgatttgcat 1080
aagccgctgg ttagcattga cgatctgcgt gtgaattac 1119
<210> 20
<211> 1119
<212> DNA
<213> S46F truncated alpha-1,3 fucosyltransferase DNA sequence
<400> 20
atgttccaac cacttttaga cgcatttatc gagtcggcat caattgagaa aatggcatcg 60
aagagcccgc caccgccgtt gaagatcgcc gtcgctaact ggtggggcga cgaagagatc 120
aaagagttca agaaatttgt gctgtatttc atcctgtccc agcgctatgc gattacgctg 180
caccaaaatc cgaacgagtt cagcgacctg gttctgtcta acccgctggg cgcagcgcgt 240
aagattctga gctaccagaa taccaaacgt gttttctaca ccggtgaaaa cgaaagcccg 300
aacttcaact tgtttgatta cgctatcggt tttgatgaac tggatttcaa tgatcgctat 360
ctgcgtatgc cgctgtacta cgcgcatctg cactataaag ccgagctggt caacgacact 420
accgcgccat ataagctgaa agataatagc ctgtatgcct tgaagaaacc tagccaccac 480
ttcaaagaaa accacccgaa tctgtgcgca gtggttaatg atgaaagcga tctgctgaaa 540
cgtggttttg cgagctttgt cgcaagcaac gccaatgccc cgatgcgtaa cgctttttac 600
gacgcgctga acagcattga gccggtgacc ggtggcggta gcgtgcgcaa tacgttgggc 660
tacaaagtcg gtaataagag cgagttcctg agccagtaca agtttaatct gtgttttgag 720
aacagccaag gctatggtta cgttaccgag aagatcctgg acgcgtactt ctctcacacc 780
attccgatct attggggcag cccgtccgtt gcgaaagact tcaatccgaa atcctttgtg 840
aatgtccacg acttcaataa ctttgatgag gcgattgatt acattaagta tctgcacacg 900
catccgaatg cgtacttgga catgctgtat gaaaacccgc tgaacaccct ggacggtaag 960
gcgtactttt accaggacct gagcttcaag aaaatcctgg actttttcaa aaccatcctg 1020
gaaaacgata cgatttacca caagttcagc acgagcttta tgtgggaata tgatctgcat 1080
aagccgctgg ttagcattga cgatctgcgt gtgaattac 1119
<210> 21
<211> 1119
<212> DNA
<213> A128N and H129E truncated alpha-1,3 fucosyltransferase DNA sequence
<400> 21
atgttccaac cacttttaga cgcatttatc gagtcggcat caattgagaa aatggcatcg 60
aagagcccgc caccgccgtt gaagatcgcc gtcgctaact ggtggggcga cgaagagatc 120
aaagagttca agaaatctgt gctgtatttc atcctgtccc agcgctatgc gattacgctg 180
caccaaaatc cgaacgagtt cagcgacctg gttctgtcta acccgctggg cgcagcgcgt 240
aagattctga gctaccagaa taccaaacgt gttttctaca ccggtgaaaa cgaaagcccg 300
aacttcaact tgtttgatta cgctatcggt tttgatgaac tggatttcaa tgatcgctat 360
ctgcgtatgc cgctgtacta caatgagctg cactataaag ccgagcttgt caacgacact 420
accgcgccat ataagctgaa agataatagc ctgtatgcct tgaagaaacc tagccaccac 480
ttcaaagaaa accacccgaa tctgtgcgca gtggttaatg atgaaagcga tctgctgaaa 540
cgtggttttg cgagctttgt cgcaagcaac gccaatgccc cgatgcgtaa cgctttttac 600
gacgcgctga acagcattga gccggtgacc ggtggcggta gcgtgcgcaa tacgttgggc 660
tacaaagtcg gtaataagag cgagttcctg agccagtaca agtttaatct gtgttttgag 720
aacagccaag gctatggtta cgttaccgag aagatcctgg acgcgtactt ctctcacacc 780
attccgatct attggggcag cccgtccgtt gcgaaagact tcaatccgaa atcctttgtg 840
aatgtccacg acttcaataa ctttgatgag gcgattgatt acattaagta tctgcacacg 900
catccgaatg cgtacttgga catgctgtat gaaaacccgc tgaacaccct ggacggtaag 960
gcgtactttt accaggacct gagcttcaag aaaatcctgg actttttcaa aaccatcctg 1020
gaaaacgata cgatttacca caagttcagc acgagcttta tgtgggaata tgatttgcat 1080
aagccgctgg ttagcattga cgatctgcgt gtgaattac 1119
<210> 22
<211> 1119
<212> DNA
<213> A128N and Y132I truncated alpha-1,3 fucosyltransferase DNA sequence
<400> 22
atgttccaac cacttttaga cgcatttatc gagtcggcat caattgagaa aatggcatcg 60
aagagcccgc caccgccgtt gaagatcgcc gtcgctaact ggtggggcga cgaagagatc 120
aaagagttca agaaatctgt gctgtatttc atcctgtccc agcgctatgc gattacgctg 180
caccaaaatc cgaacgagtt cagcgacctg gttctgtcta acccgctggg cgcagcgcgt 240
aagattctga gctaccagaa taccaaacgt gttttctaca ccggtgaaaa cgaaagcccg 300
aacttcaact tgtttgatta cgctatcggt tttgatgaac tggatttcaa tgatcgctat 360
ctgcgtatgc cgctgtacta caatcatctg cacattaaag ccgagctggt caacgacact 420
accgcgccat ataagctgaa agataatagc ctgtatgcct tgaagaaacc tagccaccac 480
ttcaaagaaa accacccgaa tctgtgcgca gtggttaatg atgaaagcga tctgctgaaa 540
cgtggttttg cgagctttgt cgcaagcaac gccaatgccc cgatgcgtaa cgctttttac 600
gacgcgctga acagcattga gccggtgacc ggtggcggta gcgtgcgcaa tacgttgggc 660
tacaaagtcg gtaataagag cgagttcctg agccagtaca agtttaatct gtgttttgag 720
aacagccaag gctatggtta cgttaccgag aagatcctgg acgcgtactt ctctcacacc 780
attccgatct attggggcag cccgtccgtt gcgaaagact tcaatccgaa atcctttgtg 840
aatgtccacg acttcaataa ctttgatgag gcgattgatt acattaagta tctgcacacg 900
catccgaatg cgtacttgga catgctgtat gaaaacccgc tgaacaccct ggacggtaag 960
gcgtactttt accaggacct gagcttcaag aaaatcctgg actttttcaa aaccatcctg 1020
gaaaacgata cgatttacca caagttcagc acgagcttta tgtgggaata tgatttgcat 1080
aagccgctgg ttagcattga cgatctgcgt gtgaattac 1119
<210> 23
<211> 1119
<212> DNA
<213> A128N and S46F truncated alpha-1,3 fucosyltransferase DNA sequence
<400> 23
atgttccaac cacttttaga cgcatttatc gagtcggcat caattgagaa aatggcatcg 60
aagagcccgc caccgccgtt gaagatcgcc gtcgctaact ggtggggcga cgaagagatc 120
aaagagttca agaaatttgt gctgtatttc atcctgtccc agcgctatgc gattacgctg 180
caccaaaatc cgaacgagtt cagcgacctg gttctgtcta acccgctggg cgcagcgcgt 240
aagattctga gctaccagaa taccaaacgt gttttctaca ccggtgaaaa cgaaagcccg 300
aacttcaact tgtttgatta cgctatcggt tttgatgaac tggatttcaa tgatcgctat 360
ctgcgtatgc cgctgtacta caatcatctg cactataaag ccgagctggt caacgacact 420
accgcgccat ataagctgaa agataatagc ctgtatgcct tgaagaaacc tagccaccac 480
ttcaaagaaa accacccgaa tctgtgcgca gtggttaatg atgaaagcga tctgctgaaa 540
cgtggttttg cgagctttgt cgcaagcaac gccaatgccc cgatgcgtaa cgctttttac 600
gacgcgctga acagcattga gccggtgacc ggtggcggta gcgtgcgcaa tacgttgggc 660
tacaaagtcg gtaataagag cgagttcctg agccagtaca agtttaatct gtgttttgag 720
aacagccaag gctatggtta cgttaccgag aagatcctgg acgcgtactt ctctcacacc 780
attccgatct attggggcag cccgtccgtt gcgaaagact tcaatccgaa atcctttgtg 840
aatgtccacg acttcaataa ctttgatgag gcgattgatt acattaagta tctgcacacg 900
catccgaatg cgtacttgga catgctgtat gaaaacccgc tgaacaccct ggacggtaag 960
gcgtactttt accaggacct gagcttcaag aaaatcctgg actttttcaa aaccatcctg 1020
gaaaacgata cgatttacca caagttcagc acgagcttta tgtgggaata tgatctgcat 1080
aagccgctgg ttagcattga cgatctgcgt gtgaattac 1119
<210> 24
<211> 1119
<212> DNA
<213> A128N and H129E and Y132I truncated alpha-1,3 fucosyltransferase DNA sequence
<400> 24
atgttccaac cacttttaga cgcatttatc gagtcggcat caattgagaa aatggcatcg 60
aagagcccgc caccgccgtt gaagatcgcc gtcgctaact ggtggggcga cgaagagatc 120
aaagagttca agaaatctgt gctgtatttc atcctgtccc agcgctatgc gattacgctg 180
caccaaaatc cgaacgagtt cagcgacctg gttctgtcta acccgctggg cgcagcgcgt 240
aagattctga gctaccagaa taccaaacgt gttttctaca ccggtgaaaa cgaaagcccg 300
aacttcaact tgtttgatta cgctatcggt tttgatgaac tggatttcaa tgatcgctat 360
ctgcgtatgc cgctgtacta caatgagctg cacattaaag ccgagcttgt caacgacact 420
accgcgccat ataagctgaa agataatagc ctgtatgcct tgaagaaacc tagccaccac 480
ttcaaagaaa accacccgaa tctgtgcgca gtggttaatg atgaaagcga tctgctgaaa 540
cgtggttttg cgagctttgt cgcaagcaac gccaatgccc cgatgcgtaa cgctttttac 600
gacgcgctga acagcattga gccggtgacc ggtggcggta gcgtgcgcaa tacgttgggc 660
tacaaagtcg gtaataagag cgagttcctg agccagtaca agtttaatct gtgttttgag 720
aacagccaag gctatggtta cgttaccgag aagatcctgg acgcgtactt ctctcacacc 780
attccgatct attggggcag cccgtccgtt gcgaaagact tcaatccgaa atcctttgtg 840
aatgtccacg acttcaataa ctttgatgag gcgattgatt acattaagta tctgcacacg 900
catccgaatg cgtacttgga catgctgtat gaaaacccgc tgaacaccct ggacggtaag 960
gcgtactttt accaggacct gagcttcaag aaaatcctgg actttttcaa aaccatcctg 1020
gaaaacgata cgatttacca caagttcagc acgagcttta tgtgggaata tgatttgcat 1080
aagccgctgg ttagcattga cgatctgcgt gtgaattac 1119
<210> 25
<211> 1119
<212> DNA
<213> A128N and H129E and S46F truncated alpha-1,3 fucosyltransferase DNA sequence
<400> 25
atgttccaac cacttttaga cgcatttatc gagtcggcat caattgagaa aatggcatcg 60
aagagcccgc caccgccgtt gaagatcgcc gtcgctaact ggtggggcga cgaagagatc 120
aaagagttca agaaatttgt gctgtatttc atcctgtccc agcgctatgc gattacgctg 180
caccaaaatc cgaacgagtt cagcgacctg gttctgtcta acccgctggg cgcagcgcgt 240
aagattctga gctaccagaa taccaaacgt gttttctaca ccggtgaaaa cgaaagcccg 300
aacttcaact tgtttgatta cgctatcggt tttgatgaac tggatttcaa tgatcgctat 360
ctgcgtatgc cgctgtacta caatgagctg cactataaag ccgagcttgt caacgacact 420
accgcgccat ataagctgaa agataatagc ctgtatgcct tgaagaaacc tagccaccac 480
ttcaaagaaa accacccgaa tctgtgcgca gtggttaatg atgaaagcga tctgctgaaa 540
cgtggttttg cgagctttgt cgcaagcaac gccaatgccc cgatgcgtaa cgctttttac 600
gacgcgctga acagcattga gccggtgacc ggtggcggta gcgtgcgcaa tacgttgggc 660
tacaaagtcg gtaataagag cgagttcctg agccagtaca agtttaatct gtgttttgag 720
aacagccaag gctatggtta cgttaccgag aagatcctgg acgcgtactt ctctcacacc 780
attccgatct attggggcag cccgtccgtt gcgaaagact tcaatccgaa atcctttgtg 840
aatgtccacg acttcaataa ctttgatgag gcgattgatt acattaagta tctgcacacg 900
catccgaatg cgtacttgga catgctgtat gaaaacccgc tgaacaccct ggacggtaag 960
gcgtactttt accaggacct gagcttcaag aaaatcctgg actttttcaa aaccatcctg 1020
gaaaacgata cgatttacca caagttcagc acgagcttta tgtgggaata tgatctgcat 1080
aagccgctgg ttagcattga cgatctgcgt gtgaattac 1119
<210> 26
<211> 1119
<212> DNA
<213> A128N and Y132I and S46F truncated alpha-1,3 fucosyltransferase DNA sequence
<400> 26
atgttccaac cacttttaga cgcatttatc gagtcggcat caattgagaa aatggcatcg 60
aagagcccgc caccgccgtt gaagatcgcc gtcgctaact ggtggggcga cgaagagatc 120
aaagagttca agaaatttgt gctgtatttc atcctgtccc agcgctatgc gattacgctg 180
caccaaaatc cgaacgagtt cagcgacctg gttctgtcta acccgctggg cgcagcgcgt 240
aagattctga gctaccagaa taccaaacgt gttttctaca ccggtgaaaa cgaaagcccg 300
aacttcaact tgtttgatta cgctatcggt tttgatgaac tggatttcaa tgatcgctat 360
ctgcgtatgc cgctgtacta caatcatctg cacattaaag ccgagctggt caacgacact 420
accgcgccat ataagctgaa agataatagc ctgtatgcct tgaagaaacc tagccaccac 480
ttcaaagaaa accacccgaa tctgtgcgca gtggttaatg atgaaagcga tctgctgaaa 540
cgtggttttg cgagctttgt cgcaagcaac gccaatgccc cgatgcgtaa cgctttttac 600
gacgcgctga acagcattga gccggtgacc ggtggcggta gcgtgcgcaa tacgttgggc 660
tacaaagtcg gtaataagag cgagttcctg agccagtaca agtttaatct gtgttttgag 720
aacagccaag gctatggtta cgttaccgag aagatcctgg acgcgtactt ctctcacacc 780
attccgatct attggggcag cccgtccgtt gcgaaagact tcaatccgaa atcctttgtg 840
aatgtccacg acttcaataa ctttgatgag gcgattgatt acattaagta tctgcacacg 900
catccgaatg cgtacttgga catgctgtat gaaaacccgc tgaacaccct ggacggtaag 960
gcgtactttt accaggacct gagcttcaag aaaatcctgg actttttcaa aaccatcctg 1020
gaaaacgata cgatttacca caagttcagc acgagcttta tgtgggaata tgatctgcat 1080
aagccgctgg ttagcattga cgatctgcgt gtgaattac 1119
<210> 27
<211> 1119
<212> DNA
<213> A128N, H129E, Y132I, S46F truncated alpha-1,3 fucosyltransferase DNA sequence
<400> 27
atgttccaac cacttttaga cgcatttatc gagtcggcat caattgagaa aatggcatcg 60
aagagcccgc caccgccgtt gaagatcgcc gtcgctaact ggtggggcga cgaagagatc 120
aaagagttca agaaatttgt gctgtatttc atcctgtccc agcgctatgc gattacgctg 180
caccaaaatc cgaacgagtt cagcgacctg gttctgtcta acccgctggg cgcagcgcgt 240
aagattctga gctaccagaa taccaaacgt gttttctaca ccggtgaaaa cgaaagcccg 300
aacttcaact tgtttgatta cgctatcggt tttgatgaac tggatttcaa tgatcgctat 360
ctgcgtatgc cgctgtacta caatgagctg cacattaaag ccgagcttgt caacgacact 420
accgcgccat ataagctgaa agataatagc ctgtatgcct tgaagaaacc tagccaccac 480
ttcaaagaaa accacccgaa tctgtgcgca gtggttaatg atgaaagcga tctgctgaaa 540
cgtggttttg cgagctttgt cgcaagcaac gccaatgccc cgatgcgtaa cgctttttac 600
gacgcgctga acagcattga gccggtgacc ggtggcggta gcgtgcgcaa tacgttgggc 660
tacaaagtcg gtaataagag cgagttcctg agccagtaca agtttaatct gtgttttgag 720
aacagccaag gctatggtta cgttaccgag aagatcctgg acgcgtactt ctctcacacc 780
attccgatct attggggcag cccgtccgtt gcgaaagact tcaatccgaa atcctttgtg 840
aatgtccacg acttcaataa ctttgatgag gcgattgatt acattaagta tctgcacacg 900
catccgaatg cgtacttgga catgctgtat gaaaacccgc tgaacaccct ggacggtaag 960
gcgtactttt accaggacct gagcttcaag aaaatcctgg actttttcaa aaccatcctg 1020
gaaaacgata cgatttacca caagttcagc acgagcttta tgtgggaata tgatctgcat 1080
aagccgctgg ttagcattga cgatctgcgt gtgaattac 1119

Claims (29)

  1. 하기의 (a) 내지 (p) 에서 선택되는 어느 하나의 서열로 표시되는 α-1,3 푸코실 전달효소 변이체 :
    (a) 서열번호 1 의 아미노산 서열;
    (b) 서열번호 2 의 아미노산 서열;
    (c) 서열번호 3 의 아미노산 서열;
    (d) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열과 95% 이상의 상동성을 가지고 푸코실 전달의 활성을 갖는 아미노산 서열;
    (e) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환된 서열;
    (f) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 129 번째의 아미노산이 산성이며 친수성 아미노산으로 치환된 서열;
    (g) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 132 번째의 아미노산이 타이로신 및 히스티딘을 제외한 아미노산으로 치환된 서열;
    (h) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 46 번째의 아미노산이 소수성 아미노산으로 치환된 서열;
    (i) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 129 번째의 아미노산이 산성이며 친수성 아미노산으로 치환된 서열;
    (j) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 132 번째의 아미노산이 타이로신 및 히스티딘을 제외한 아미노산으로 치환된 서열;
    (k) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 46 번째의 아미노산이 소수성 아미노산으로 치환된 서열;
    (l) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 129 번째의 아미노산이 산성이며 친수성 아미노산으로 치환되고, 132 번째의 아미노산이 타이로신 및 히스티딘을 제외한 아미노산으로 치환된 서열;
    (m) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 129 번째의 아미노산이 산성이며 친수성 아미노산으로 치환되고, 46 번째의 아미노산이 소수성 아미노산으로 치환된 서열;
    (n) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 132 번째의 아미노산이 타이로신 및 히스티딘을 제외한 아미노산으로 치환되고, 46 번째의 아미노산이 소수성 아미노산으로 치환된 서열;
    (o) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산이 알라닌 및 아스파르트산을 제외한 아미노산으로 치환되고, 129 번째의 아미노산이 산성이며 친수성 아미노산으로 치환되고, 132 번째의 아미노산이 타이로신 및 히스티딘을 제외한 아미노산으로 치환되고, 46 번째의 아미노산이 소수성 아미노산으로 치환된 서열;
    (p) 서열번호 1 내지 3 중 어느 하나의 아미노산 서열에서, 128 번째의 아미노산, 129 번째의 아미노산, 132 번째의 아미노산 및 46 번째의 아미노산으로 이루어진 군에서 선택된 하나 이상의 아미노산이 치환된 것을 특징으로 하는, 아미노산 서열;
  2. 제 1 항에 있어서, 상기 128 번째의 아미노산이 아스파라긴으로 치환된 것을 특징으로 하는, α-1,3 푸코실 전달효소 변이체.
  3. 제 2 항에 있어서, 상기 α-1,3 푸코실 전달효소 변이체가 서열번호 6 의 아미노산 서열로 표시되는, α-1,3 푸코실 전달효소 변이체
  4. 제 1 항에 있어서, 상기 129 번째의 아미노산이 글루탐산으로 치환된 것을 특징으로 하는, α-1,3 푸코실 전달효소 변이체.
  5. 제 4 항에 있어서, 상기 α-1,3 푸코실 전달효소 변이체가 서열번호 7 의 아미노산 서열로 표시되는, α-1,3 푸코실 전달효소 변이체
  6. 제 1 항에 있어서, 상기 132 번째의 아미노산이 이소류신으로 치환된 것을 특징으로 하는, α-1,3 푸코실 전달효소 변이체.
  7. 제 6 항에 있어서, 상기 α-1,3 푸코실 전달효소 변이체가 서열번호 8 의 아미노산 서열로 표시되는, α-1,3 푸코실 전달효소 변이체
  8. 제 1 항에 있어서, 상기 46 번째의 아미노산이 페닐알라닌으로 치환된 것을 특징으로 하는, α-1,3 푸코실 전달효소 변이체.
  9. 제 8 항에 있어서, 상기 α-1,3 푸코실 전달효소 변이체가 서열번호 9 의 아미노산 서열로 표시되는, α-1,3 푸코실 전달효소 변이체
  10. 제 1 항에 있어서, 상기 128 번째의 아미노산이 아스파라긴으로 치환되고, 129 번째의 아미노산이 글루탐산으로 치환된, 서열번호 10의 아미노산 서열로 표시되는 α-1,3 푸코실 전달효소 변이체.
  11. 제 1 항에 있어서, 상기 128 번째의 아미노산이 아스파라긴으로 치환되고, 132 번째의 아미노산이 이소류신으로 치환된, 서열번호 11의 아미노산 서열로 표시되는 α-1,3 푸코실 전달효소 변이체.
  12. 제 1 항에 있어서, 상기 128 번째의 아미노산이 아스파라긴으로 치환되고, 46 번째의 아미노산이 페닐알라닌으로 치환된, 서열번호 12의 아미노산 서열로 표시되는 α-1,3 푸코실 전달효소 변이체.
  13. 제 1 항에 있어서, 상기 128 번째의 아미노산이 아스파라긴으로 치환되고, 129 번째의 아미노산이 글루탐산으로 치환되고, 132 번째의 아미노산이 이소류신으로 치환된, 서열번호 13의 아미노산 서열로 표시되는 α-1,3 푸코실 전달효소 변이체.
  14. 제 1 항에 있어서, 상기 128 번째의 아미노산이 아스파라긴으로 치환되고, 129 번째의 아미노산이 글루탐산으로 치환되고, 46 번째의 아미노산이 페닐알라닌으로 치환된, 서열번호 14의 아미노산 서열로 표시되는 α-1,3 푸코실 전달효소 변이체.
  15. 제 1 항에 있어서, 상기 128 번째의 아미노산이 아스파라긴으로 치환되고, 132 번째의 아미노산이 이소류신으로 치환되고, 46 번째의 아미노산이 페닐알라닌으로 치환된, 서열번호 15의 아미노산 서열로 표시되는 α-1,3 푸코실 전달효소 변이체.
  16. 제 1 항에 있어서, 상기 128 번째의 아미노산이 아스파라긴으로 치환되고, 129 번째의 아미노산 글루탐산으로 치환되고, 132 번째의 아미노산이 이소류신으로 치환되고, 46 번째의 아미노산이 페닐알라닌으로 치환된, 서열번호 16의 아미노산 서열로 표시되는 α-1,3 푸코실 전달효소 변이체.
  17. 제 1 항에 따른 α-1,3 푸코실 전달효소 변이체를 코딩하는 DNA.
  18. 제 17 항에 있어서, 하기의 (a) 내지 (m) 에서 선택되는 어느 하나의 서열로 표시되는 DNA:
    (a) 서열번호 4 의 DNA 서열;
    (b) 서열번호 4 와 77% 이상의 상동성을 갖는 DNA 서열;
    (c) 서열번호 17 의 DNA 서열;
    (d) 서열번호 18 의 DNA 서열;
    (e) 서열번호 19 의 DNA 서열;
    (f) 서열번호 20 의 DNA 서열;
    (g) 서열번호 21 의 DNA 서열;
    (h) 서열번호 22 의 DNA 서열;
    (i) 서열번호 23 의 DNA 서열;
    (j) 서열번호 24 의 DNA 서열;
    (k) 서열번호 25 의 DNA 서열;
    (l) 서열번호 26 의 DNA 서열;
    (m) 서열번호 27 의 DNA 서열;
  19. 제 17 항 또는 제 18 항에 따른 DNA 를 포함하는 재조합 DNA 벡터.
  20. 제 19 항에 있어서, 상기 벡터의 프로모터는 강력한 프로모터를 사용하는 것을 특징으로 하는, 재조합 DNA 벡터.
  21. 제 19 항에 따른 재조합 DNA 벡터로 형질전환된 숙주세포.
  22. 제 19 항에 따른 재조합 DNA 벡터로 형질전환된 숙주세포의 추출물.
  23. 제 19 항에 따른 재조합 DNA 벡터로 형질전환된 숙주세포 또는 상기 숙주세포의 추출물을 생촉매로 사용한, 3-푸코실올리고당의 제조 방법.
  24. 제 23 항에 있어서, 15℃ 내지 37℃의 온도에서 0.01 mM 내지 2 mM의 유도인자 (inducer)를 사용하는 것을 특징으로 하는, 3-푸코실올리고당의 제조 방법.
  25. 제 23 항에 있어서, 탄소원 또는 질소원이 추가된 배지를 사용하는 것을 특징으로 하는, 3-푸코실올리고당의 제조 방법.
  26. 제 23 항에 있어서, 당 수용체 기질의 농도를 당 공여체 기질 농도의 2배 이상으로 사용하는 것을 특징으로 하는, 3-푸코실올리고당의 제조 방법.
  27. 하기의 순차적인 단계를 포함하는, α-1,3 푸코실 전달효소 변이체 제조 방법:
    (1) 하기의 방법 중 어느 하나를 포함하는, 잔기 또는 아미노산을 선택하는 단계.
    (a) 푸코실 전달효소의 결정 구조 또는 모델 구조에서의 필수 주요 아미노산으로부터 5 내지 20 Å 이내의 잔기들을 선택하는 방법.
    (b) 상기 (a) 방법에 있어서, E96 아미노산으로부터 5 내지 20 Å 이내의 잔기들을 선택하는 방법.
    (c) 상기 (a) 방법에 있어서, 단백질의 구조로부터 활성부위 (active site) 또는 기질 접근 터널에 위치한 아미노산들에 대하여 진화론적으로 변화를 줄 수 있는 아미노산을 선택하는 방법.
    (d) 푸코실 전달효소의 결정 구조 또는 모델 구조에서의 두 개의 기질 결합 부위로부터 5 내지 20 Å 이내의 잔기들을 선택하는 방법.
    (e) 상기 (d) 방법에 있어서, 단백질의 구조로부터 활성부위 (active site) 또는 기질 접근 터널에 위치한 아미노산들에 대하여 진화론적으로 변화를 줄 수 있는 아미노산을 선택하는 방법.
    (2) 상기 선택된 잔기에 대해 반복적 포화변이를 수행하거나, 선택된 잔기에 대해 클러스터를 형성하여 조합적 변이체를 생성하는 단계.
  28. 제 27 항에 따른 α-1,3 푸코실 전달효소 변이체 제조 방법으로 제조된 α-1,3 푸코실 전달효소 변이체의 탐색 방법으로서, pH 변화에 의한 지시약을 이용하는 반응을 수행하는 것을 특징으로 하는, 푸코실 전달효소의 변이체 탐색 방법
  29. 제 28 항에 있어서, 상기 반응은 pH 7 내지 9에서 수행하는 것을 특징으로 하는, 푸코실 전달효소의 변이체 탐색 방법.
PCT/KR2015/006272 2014-06-23 2015-06-22 가용성 단백질 발현량 및 활성이 증대된 헬리코박터 파일로리 유래 α-1,3 푸코실 전달효소의 유전자와 단백질 및 α-1,3 푸코실올리고당 생산에의 응용 Ceased WO2015199387A2 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/322,072 US10336990B2 (en) 2014-06-23 2015-06-22 Helicobacter pylori α-1,3 fucosyltransferase gene and protein with improved soluble protein expression and activity, and thereof application for synthesis of α-1,3 fucosyloligosaccharide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020140076720A KR101718681B1 (ko) 2014-06-23 2014-06-23 가용성 단백질 발현량 및 활성이 증대된 헬리코박터 파일로리 유래 α-1,3 푸코실 전달효소의 유전자와 단백질 및 α-1,3 푸코실올리고당 생산에의 응용
KR10-2014-0076720 2014-06-23

Publications (2)

Publication Number Publication Date
WO2015199387A2 true WO2015199387A2 (ko) 2015-12-30
WO2015199387A3 WO2015199387A3 (ko) 2016-03-10

Family

ID=54938900

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/006272 Ceased WO2015199387A2 (ko) 2014-06-23 2015-06-22 가용성 단백질 발현량 및 활성이 증대된 헬리코박터 파일로리 유래 α-1,3 푸코실 전달효소의 유전자와 단백질 및 α-1,3 푸코실올리고당 생산에의 응용

Country Status (3)

Country Link
US (1) US10336990B2 (ko)
KR (1) KR101718681B1 (ko)
WO (1) WO2015199387A2 (ko)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108103039A (zh) * 2016-11-25 2018-06-01 上海交通大学 一组岩藻糖基转移酶突变体及其筛选方法和应用
US10336990B2 (en) 2014-06-23 2019-07-02 Seoul National University R&Db Foundation Helicobacter pylori α-1,3 fucosyltransferase gene and protein with improved soluble protein expression and activity, and thereof application for synthesis of α-1,3 fucosyloligosaccharide
WO2022136337A3 (en) * 2020-12-22 2022-10-06 Glycom A/S A dfl-producing strain
EP4458961A4 (en) * 2021-12-02 2025-10-22 Glyco Therapy Biotechnology Co Ltd ISOLATED POLYPEPTIDE AND ITS USE

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101731263B1 (ko) * 2016-04-25 2017-05-02 서울대학교 산학협력단 코리네박테리움 글루타미쿰을 이용한 2'-푸코실락토오스의 생산방법
US11162133B2 (en) * 2016-06-03 2021-11-02 New England Biolabs, Inc. Detection of an amplification product using pH-sensitive dye
EP4289958A4 (en) 2021-02-08 2025-07-02 Kyowa Hakko Bio Co Ltd PROTEIN HAVING 1,3-FUCOSYLTRANSFERASE ACTIVITY, AND METHOD FOR PRODUCING FUCOSE-CONTAINING SUGAR
DK182292B1 (en) * 2022-12-22 2026-02-24 Dsm Ip Assets Bv Genetically engineered cells comprising new fucosyltransferases for in vivo synthesis of complex fucosylated human milk oligosaccharides mixtures comprising lndfh-iii and methods, uses, and mixtures produced using the same
CN116103261B (zh) * 2023-03-23 2026-02-03 北京睿脉医药科技有限公司 幽门螺杆菌岩藻糖基转移酶突变体
WO2025183209A1 (ja) * 2024-03-01 2025-09-04 協和発酵バイオ株式会社 １，３－フコシルトランスフェラーゼ活性を有する蛋白質及びフコース含有糖質の製造法
CN118834856B (zh) * 2024-07-25 2025-08-08 合肥中科健康生物产业技术研究院有限公司 一种α-L-岩藻糖苷酶突变体及其应用

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU8005098A (en) 1997-06-06 1998-12-21 Governors Of The University Of Alberta, The Alpha1,3-fucosyltransferase of helicobacter pylori
ATE468391T1 (de) 2001-08-24 2010-06-15 Kyowa Hakko Bio Co Ltd Alpha-1,2-fucosyl-transferase und diese codierende dna
US7326770B2 (en) 2004-01-22 2008-02-05 Neose Technologies, Inc. H. pylori fucosyltransferases
EP2944690B1 (en) 2010-10-11 2017-12-20 Jennewein Biotechnologie GmbH Novel fucosyltransferases and their applications
DE12746649T1 (de) * 2011-02-16 2016-09-29 Glycosyn LLC Biosynthese menschlicher milcholigosaccaride in manipulierten Bakterien
KR101718681B1 (ko) 2014-06-23 2017-03-22 서울대학교산학협력단 가용성 단백질 발현량 및 활성이 증대된 헬리코박터 파일로리 유래 α-1,3 푸코실 전달효소의 유전자와 단백질 및 α-1,3 푸코실올리고당 생산에의 응용

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10336990B2 (en) 2014-06-23 2019-07-02 Seoul National University R&Db Foundation Helicobacter pylori α-1,3 fucosyltransferase gene and protein with improved soluble protein expression and activity, and thereof application for synthesis of α-1,3 fucosyloligosaccharide
CN108103039A (zh) * 2016-11-25 2018-06-01 上海交通大学 一组岩藻糖基转移酶突变体及其筛选方法和应用
CN108103039B (zh) * 2016-11-25 2021-10-22 上海交通大学 一组岩藻糖基转移酶突变体及其筛选方法和应用
WO2022136337A3 (en) * 2020-12-22 2022-10-06 Glycom A/S A dfl-producing strain
EP4458961A4 (en) * 2021-12-02 2025-10-22 Glyco Therapy Biotechnology Co Ltd ISOLATED POLYPEPTIDE AND ITS USE

Also Published As

Publication number Publication date
KR101718681B1 (ko) 2017-03-22
US10336990B2 (en) 2019-07-02
KR20150146301A (ko) 2015-12-31
WO2015199387A3 (ko) 2016-03-10
US20170247668A1 (en) 2017-08-31

Similar Documents

Publication Publication Date Title
WO2015199387A2 (ko) 가용성 단백질 발현량 및 활성이 증대된 헬리코박터 파일로리 유래 α-1,3 푸코실 전달효소의 유전자와 단백질 및 α-1,3 푸코실올리고당 생산에의 응용
WO2019009682A2 (ko) 표적 특이적 crispr 변이체
WO2017217768A1 (ko) 온타겟 및 오프타겟의 다중 타겟 시스템을 이용하는, 표적 특이적 유전자 가위 스크리닝 방법 및 이의 용도
WO2021086083A2 (ko) CRISPR/Cas12f1 시스템 효율화를 위한 엔지니어링 된 가이드 RNA 및 그 용도
WO2015199386A1 (ko) 가용성 단백질 발현량이 증대된 헬리코박터 파일로리 유래 α-1,2 푸코실 전달효소의 유전자와 단백질 및 α-1,2 푸코실올리고당 생산에의 응용
WO2016021973A1 (ko) 캄필로박터 제주니 crispr/cas 시스템 유래 rgen을 이용한 유전체 교정
WO2014193183A1 (ko) 시알산 유도체의 제조방법
WO2011158998A1 (ko) 비타민 ｋ2 생성능이 높은 바실러스 아미로리퀴파시엔스 균주
WO2014084672A1 (ko) 전자동 무세포 단백질 제조장비 및 이를 이용한 단백질의 제조방법
WO2010064764A1 (en) Method of preparing piceatannol using bacterial cytochrome p450 and composition therefor
WO2020235974A9 (ko) 단일염기 치환 단백질 및 이를 포함하는 조성물
WO2022065913A1 (ko) 요산산화효소-알부민 접합체, 그 제조방법 및 용도
WO2020076079A2 (ko) 락토바실러스 카제이 유래의 두 종류 프로모터를 이용한 두 가지 목적단백질의 동시 표면발현벡터 및 이를 이용한 단백질의 미생물표면 발현 방법
WO2023075496A1 (ko) 자일라나제 활성을 갖는 변이형 폴리펩티드
WO2016122058A1 (ko) 세포성점균을 이용한 인간 페닐알라닌 수산화효소의 활성분석 방법
WO2020218657A1 (ko) 표적 특이적 crispr 변이체
WO2023229222A1 (ko) 확장된 표적 범위를 갖는 엔지니어링된 cas12f 단백질 및 이의 용도
WO2011159092A9 (ko) 신규 토양 미생물과 상기 토양 미생물로부터 분리된 신규한 산화환원효소, 상기 산화환원 효소를 암호화하는 유전자 및 이들을 이용한 비당체의 생산방법
WO2018182361A1 (ko) CRISPR/Cas 시스템과 재조합 효소 및 단일가닥 올리고디옥시리보핵산을 이용한 코리네박테리움 변이균주 제조방법
WO2024167317A1 (ko) 신규 CRISPR/Cas12a 조성물 및 이의 표적 핵산 검출 용도
WO2024155111A1 (ko) 염기 에디터의 염기 교정 능력을 측정하는 세포외 시험법
WO2019022520A1 (ko) 핵산 복합체 페어, 경쟁 구조체, 이를 이용한 pcr 키트
WO2023132543A1 (ko) 포토박테리움 레이오그나티 유래의 우라실-ｄｎａ 글리코실라제를 사용하여 핵산 증폭 반응에서의 캐리오버 오염을 제거하는 방법
WO2024248531A1 (ko) 아커만시아 뮤시니필라 tars를 발현 및 분비하도록 설계된 프로바이오틱스 및 이의 제조를 위한 벡터
WO2022164226A1 (ko) C-글리코실전이효소 변이체 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15811155

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 15322072

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 15811155

Country of ref document: EP

Kind code of ref document: A2