WO2015144964A2 - Marcadores mitocondriales de enfermedades neurodegenerativas - Google Patents

Marcadores mitocondriales de enfermedades neurodegenerativas Download PDF

Info

Publication number
WO2015144964A2
WO2015144964A2 PCT/ES2015/070230 ES2015070230W WO2015144964A2 WO 2015144964 A2 WO2015144964 A2 WO 2015144964A2 ES 2015070230 W ES2015070230 W ES 2015070230W WO 2015144964 A2 WO2015144964 A2 WO 2015144964A2
Authority
WO
WIPO (PCT)
Prior art keywords
sites
loop region
disease
subject
chg
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/ES2015/070230
Other languages
English (en)
Spanish (es)
French (fr)
Other versions
WO2015144964A3 (es
Inventor
Marta Barrachina Castillo
Isidre Ferrer Abizanda
Marta BLANCH LOZANO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universitat de Barcelona UB
Fundacio Privada Institut dInvestigacio Biomedica de Bellvitge IDIBELL
Original Assignee
Universitat de Barcelona UB
Fundacio Privada Institut dInvestigacio Biomedica de Bellvitge IDIBELL
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=54150970&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2015144964(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to BR112016022582-1A priority Critical patent/BR112016022582B1/pt
Priority to ES15770042T priority patent/ES2744592T3/es
Priority to JP2016560431A priority patent/JP6687532B2/ja
Priority to CA2944281A priority patent/CA2944281C/en
Priority to DK15770042.8T priority patent/DK3124621T3/da
Application filed by Universitat de Barcelona UB, Fundacio Privada Institut dInvestigacio Biomedica de Bellvitge IDIBELL filed Critical Universitat de Barcelona UB
Priority to EP15770042.8A priority patent/EP3124621B9/en
Priority to AU2015238195A priority patent/AU2015238195C1/en
Priority to US15/300,248 priority patent/US11053549B2/en
Publication of WO2015144964A2 publication Critical patent/WO2015144964A2/es
Publication of WO2015144964A3 publication Critical patent/WO2015144964A3/es
Anticipated expiration legal-status Critical
Priority to US17/337,355 priority patent/US12065702B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the present invention falls within the diagnostic methods of neurological diseases.
  • AD Alzheimer's disease
  • PD Parkinson's disease
  • the pathophysiological characteristics of AD and PD are related to deposits of aggregate proteins.
  • AD is associated with the formation of intracellular aggregates of phosphorylated tau in the neurofibrillary tangles and extracellular aggregates of the ⁇ -amyloid peptide in senile plaques
  • PD is associated with the formation of abnormal ⁇ -synuclein aggregates that constitute the main component of the so-called Lewy bodies and Lewy neurites.
  • Alzheimer's patients show reduced levels of the ND4 subunit in brain tissue and that Parkinson's patients show reduced levels of ND6 in the black substance.
  • genetic studies have identified mutations in several COX genes and in the D-Loop region as well as deletions in the mtDNA of brains of subjects with AD and in the black substance in subjects with PD.
  • Different methods and strategies have been developed in the art for diagnosis, prediction of the onset and development of neurodegenerative diseases and, in particular of AD and PE.
  • methods of diagnosis of neurodegenerative diseases based on the identification of mutations in mitochondrial DNA have been described using the RFLP technique (restriction fragment length polymorphisms) or other related techniques.
  • WO98038334 describes a method of diagnosis of AD based on the identification of mutations in COX genes.
  • a method of diagnosing PD in a subject has also been proposed by identifying single nucleotide polymorphisms in mitochondrial DNA samples of a subject (WO 2000063441).
  • Other prior art documents describe methods for the diagnosis of Alzheimer's or Parkinson's based on the identification of polymorphisms in nuclear genes that encode proteins that control the mitochondrial transcription process.
  • the invention relates to an in vitro method for diagnosing or determining the risk of developing a neurodegenerative disease selected from Alzheimer's disease and Parkinson's disease in a subject that comprises determining in a sample of said subject comprising DNA mitochondrial, the methylation pattern in the D-loop region and / or in the ND1 gene, where the methylation pattern is determined in at least one site selected from the group consisting of:
  • hypermethylation in at least one of said CpG sites in the D-loop region, hypermethylation in at least one of said CHG sites in the D-loop region, hypermethylation in at least one of said CHH sites in region D -loop, a hypomethylation in at least one of said CpG sites of the ND1 gene and / or a hypomethylation in at least one of said CHG sites in the ND1 gene is indicative that the subject suffers from Alzheimer's disease or that the subject have a high risk of developing Alzheimer's disease or
  • a hypomethylation in at least one of said CpG sites in the D-loop region, a hypomethylation in at least one of said CHG sites in the D-loop region and / or a hypomethylation in at least one of said CHH sites in the D-loop region is indicative that the subject suffers from Parkinson's disease or that the subject has a high risk of developing Parkinson's disease.
  • the invention in a second aspect, relates to an in vitro method for selecting a subject to be subjected to a preventive treatment of a disease.
  • Selected neurodegenerative of Alzheimer's disease and Parkinson's disease in a subject that comprises determining in a sample of said subject comprising mitochondrial DNA, the methylation pattern in the D-loop region and / or in the ND1 gene, where the Methylation pattern is determined in at least one site selected from the group consisting of:
  • hypermethylation in at least one of said CpG sites in the D-loop region, hypermethylation in at least one of said CHG sites in the D-loop region, hypermethylation in at least one of said CHH sites in region D -loop, a hypomethylation in at least one of said CpG sites of the ND1 gene and / or a hypomethylation in at least one of said CHG sites in the ND1 gene is indicative that the subject is a candidate for treatment aimed at preventing disease of Alzheimer's or
  • a hypomethylation in at least one of said CpG sites in the D-loop region, a hypomethylation in at least one of said CHG sites in the D-loop region and / or a hypomethylation in at least one of said CHH sites in the D-loop region is indicative that the subject is a candidate for treatment aimed at preventing Parkinson's disease.
  • the invention relates to an in vitro method for monitoring the progression of a neurodegenerative disease selected from Alzheimer's disease or Parkinson's disease in a subject comprising:
  • a hypomethylation in at least one of said CpG sites in the D-loop region, a hypomethylation in at least one of said CHG sites in the D-loop region and / or a hypomethylation in at least one of said CHH sites in the D-loop region with respect to said methylation pattern determined at an earlier stage of the disease is indicative of the progression of Parkinson's disease.
  • the invention relates to an in vitro method for diagnosing or determining the risk of developing Alzheimer's disease in a subject that comprises determining in a sample comprising mitochondrial DNA of said subject the nucleotide in polymorphic position 16519 according to the sequence defined with the accession number NC_012920 in the NCBI database, wherein the detection of nucleotide C in said polymorphic position or the presence of nucleotide C in said polymorphic position in at least 60% of the mitochondrial DNA molecules of said subject is indicative that the subject suffers said disease or that the subject has a high risk of developing said disease.
  • the invention relates to an in vitro method for selecting a subject to be subjected to a preventive treatment of Alzheimer's disease which comprises determining in a sample comprising mitochondrial DNA of said subject the nucleotide in polymorphic position 16519 according to the sequence defined with the accession number NC_012920 in the NCBI database, wherein the detection of nucleotide C in said polymorphic position or the presence of nucleotide C in said polymorphic position in at least 60% of the mitochondrial DNA molecules of This subject is indicative that the subject is a candidate for treatment aimed at preventing Alzheimer's disease.
  • the invention relates to a nucleic acid selected from the group consisting of:
  • nucleic acid comprising at least 9 contiguous nucleotides of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the group consisting of:
  • nucleic acid comprising at least 9 contiguous nucleotides of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the group consisting of:
  • the invention relates to a kit comprising at least one oligonucleotide capable of specifically hybridizing and in a methylation-dependent manner with a sequence in the mitochondrial DNA comprising a methylation site selected from the group consisting of:
  • the invention relates to a kit comprising at least one oligonucleotide capable of specifically hybridizing with an area in position 5 ⁇ in 3 ' position with respect to a mitochondrial DNA methylation site selected from the group consisting of:
  • cytosine methylated in said position has been converted to uracil or another base that is distinguishable from cytosine in its hybridization properties.
  • kits defined in the seventh and eighth inventive aspects to determine the mitochondrial DNA methylation pattern or to determine the diagnosis of a neurodegenerative disease in a selected subject of the disease of Alzheimer's or Parkinson's disease.
  • Figure 1 Log2 (OR) graphs for the CpG (A) CHG (B) and CHH (C) sites in the D-Loop amplicon in the entorhinal cortex of cases related to EA pathology.
  • the methylation sites ordered from 5 'to 3' are represented on the x-axis.
  • Sites marked with a diamond are differentially methylated sites (FDR ⁇ 0.05).
  • the points are the OR estimation values, one for each site, and the band is the binding band of all 95% confidence intervals.
  • C control samples
  • AD Alzheimer's disease.
  • Figure 2 Log2 (OR) graphs for the CpG (A) CHG (B) and CHH (C) sites in the ND1 amplicon in the entorhinal cortex of cases related to EA pathology.
  • the methylation sites ordered from 5 'to 3' are represented on the x-axis.
  • Sites marked with a diamond are differentially methylated sites (FDR ⁇ 0.05).
  • the points are the OR estimation values, one for each site, and the band is the binding band of all 95% confidence intervals.
  • C control samples
  • AD Alzheimer's disease.
  • Figure 3 Log2 (OR) graphs for CpG and non-CpG sites (CHG and CHH) in the D-loop amplicon in the black substance of patients with PD. On the x-axis are represented methylation sites ordered from 5 'to 3'. Sites marked with a diamond are differentially methylated sites (FDR ⁇ 0.05). The points are the OR estimation values, one for each site, and the band is the binding band of all 95% confidence intervals.
  • C control samples
  • PD Parkinson's disease.
  • Figure 4 Log2 (OR) graphs for the CpG (A) and CHG (B) sites in the D-Loop amplicon in the frontal cortex of APP / PS1 mice and wild (WT) mice of three, six and twelve months.
  • the methylation sites ordered from 5 'to 3' are represented on the x-axis.
  • Sites marked with a diamond are differentially methylated sites (FDR ⁇ 0.05).
  • the points are the OR estimation values, one for each site, and the band is the binding band of all 95% confidence intervals.
  • C control samples
  • WT wild
  • TG transgenic.
  • Figure 5 Log2 (OR) graphs for the CG (A) CHG (B) and CHH (C) sites in the D-Loop amplicon in the frontal cortex of APP, PS1, three, six, and twelve month mice.
  • the methylation sites ordered from 5 'to 3' are represented on the x-axis.
  • Sites marked with a diamond are differentially methylated sites (FDR ⁇ 0.05).
  • the points are the OR estimation values, one for each site, and the band is the binding band of all 95% confidence intervals.
  • C control samples
  • TG transgenic.
  • the authors of the present invention have developed a method for diagnosing neurodegenerative diseases based on the determination of the methylation pattern in a mitochondrial DNA sample of a subject.
  • the authors of the invention have observed that, surprisingly, there are variations in the methylation pattern in the D-loop region and in the ND1 gene in subjects suffering from AD or PE when compared to healthy subjects as demonstrated in the examples. .
  • the authors of the invention have discovered differential methylation patterns associated with the evolution of said diseases.
  • the invention relates to an in vitro method for diagnosing or determining the risk of developing a neurodegenerative disease selected from Alzheimer's disease and Parkinson's disease in a subject (hereinafter, the first method of the invention) which comprises determining in a sample of said subject comprising mitochondrial DNA the methylation pattern in the D-loop region and / or in the ND1 gene, wherein the methylation pattern is determined in at least one site selected from the group consisting of:
  • hypermethylation in at least one of said CpG sites in the D-loop region, hypermethylation in at least one of said CHG sites in the D-loop region, hypermethylation in at least one of said CHH sites in region D -loop, a hypomethylation in at least one of said CpG sites of the ND1 gene and / or a hypomethylation in at least one of said CHG sites in the ND1 gene is indicative that the subject suffers from Alzheimer's disease or that the subject have a high risk of developing Alzheimer's disease or
  • a hypomethylation in at least one of said CpG sites in the D-loop region, a hypomethylation in at least one of said CHG sites in the D-loop region and / or a hypomethylation in at least one of said CHH sites in the D-loop region is indicative that the subject suffers from Parkinson's disease or that the subject has a high risk of developing Parkinson's disease.
  • diagnosis refers both to the process of trying to determine and / or identify a possible disease in a subject, that is to say the diagnostic procedure, and to the opinion reached by this process, that is to say , the diagnostic opinion. As such, it can also be considered as an attempt to classify the status of an individual into separate and distinct categories that allow medical decisions to be made about treatment and prognosis. As the person skilled in the art will understand, such a diagnosis may not be correct for 100% of the subjects to be diagnosed, although it is preferred that it be.
  • the term requires that a statistically significant part of the subjects can be identify how they suffer from a disease, particularly a neurodegenerative disease selected from Alzheimer's disease and Parkinson's disease in the context of the invention, or that has a predisposition to it.
  • the person skilled in the art can determine if a part is statistically significant using different well-known statistical evaluation tools, for example, by determining confidence intervals, determining the value of p, the Student's t-test, that of Mann-Whitney, etc. (see, Dowdy and Wearden, 1983).
  • Preferred confidence intervals are at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95%.
  • P values are preferably 0.05, 0.025, 0.001 or less.
  • risk of developing a neurodegenerative disease refers to the predisposition, susceptibility or propensity of a subject to develop a neurodegenerative disease.
  • the risk of developing a neurodegenerative disease generally implies that there is a high or low risk or a greater or lesser risk.
  • a subject at high risk of developing a neurodegenerative disease particularly Alzheimer's disease or Parkinson's disease, has a probability of developing said disease of at least 50%, or at least 60%, or at least 70 %, or at least 80%, or at least 90, or at least 95%, or at least 97%, or at least 98%, or at least 99%, or at least 100%.
  • a subject with a low risk of developing a neurodegenerative disease is a subject that has at least a probability of developing said disease of at least 0%, or at least one 1%, or at least 2%, or at least 3%, or at least 5%, or at least 10%, or at least 20%, or at least 30%, or at least 40 %, or at least 49%.
  • the term “predict risk”, “risk prediction”, or the like refers to the risk that a patient develops a neurodegenerative disease selected from Alzheimer's disease or Parkinson's disease, whether high or low.
  • the prediction (or risk) although preferable, does not have to be correct for 100% of the subjects to be evaluated, although it is preferable that it be.
  • the term requires that a statistically significant part of the subjects can be identified with a higher probability of having a certain result.
  • the expert in the matter can determine without major problem if a part is statistically significant using several well-known statistical evaluation tools, for example, the determination of confidence intervals, determination of p-value, cross validation with classification indices, etc (more details in " Statistics for research "Dowdy and Wearden, John Wiley & Sons, New York, 1983).
  • Preferred confidence intervals are at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95%.
  • P values are preferably 0.1, 0.05, 0.02, 0.01 or less.
  • the term "neurodegenerative disease", as used in the present invention includes chronic and progressive processes that are characterized by selective and symmetric losses of neurons in the sensory and cognitive motor systems.
  • Alzheimer's disease or "senile dementia” or AD refers to a mental impairment associated with a specific degenerative brain disease that is characterized by the appearance of senile plaques, neuritic tangles and progressive neuronal loss that manifests clinically in progressive deficiencies. memory, confusion, behavioral problems, inability to take care of oneself, gradual physical deterioration and, finally, death.
  • Alzheimer's disease is disease in any of the stages according to the Braak scale:
  • Stages l-ll the brain area affected by the presence of neurofibrillary tangles corresponds to the transentorrinal region of the brain
  • the affected brain area also extends to areas of the limbic region such as the hippocampus
  • Stages V-VI the affected brain area also implies the neocortical region
  • stages I to IV This classification by neuropathological stages is correlated with the clinical evolution of the disease, and there is a parallel between memory decline with neurofibrillar changes and the formation of neuritic plaques in the entorhinal cortex and the hippocampus (stages I to IV). Likewise, the isocortical presence of these changes (stages V and VI) correlates with clinically severe alterations.
  • the transentorrinal state (l-ll) corresponds to clinically silent periods of the disease.
  • the limbic state (lll-IV) corresponds to a clinically incipient EA.
  • the necortical state corresponds to a fully developed EA.
  • Parkinson's disease or "idiopathic parkinsonism” or “agitating paralysis” or EP as used herein refers to a chronic and degenerative disease that leads to problems with movement control, tremor, stiffness, bradykinesia in all kinds of movements such as walking, sitting, eating talk, etc., as well as postural instability.
  • the symptoms of the disease are clearly associated with the selective degeneration of dopaminergic neurons in the black substance.
  • the dopaminergic deficit induces a consequent loss of striatal neurons causing a variety of cytological changes that include aggregation of ⁇ -synuclein in the so-called Lewy bodies.
  • the "black substance” is a nucleus of the cerebral basal ganglia located in the upper portions of the middle brain, under the thalamus and takes its color from the neuromelanin.
  • the EP is in one of the stages according to the Braak scale:
  • Stage I the affected area is the dorsal motor nucleus and / or the intermediate reticular zone.
  • Stage II the affected area extends to the locus coreuleus and the nucleus of the raphe -
  • Stage III the affected area extends to the midbrain, in particular to the black substance pars compacta.
  • Stage IV the affected area extends to the transentorrinal region of the temporal mesocortex and to the alcortex.
  • Stage V the affected area extends to the insular cortex, the cingulate gyrus and the temporal gyrus.
  • Stage VI The affected area extends to the frontal and parietal area of the cerebral cortex.
  • the term "subject" as used herein refers to a person, such as a human being, a non-human primate (eg, chimpanzees and other apes and species of monkeys), farm animals, such as birds , fish, cattle, sheep, pigs, goats and horses; domestic mammals, such as dogs and cats; laboratory animals including rodents, such as mice, rats and guinea pigs.
  • the term does not denote a certain age or sex.
  • the Subject is a mammal.
  • the subject is a human.
  • sample comprising mitochondrial DNA refers to any sample that can be obtained from a subject in which there is genetic material from the mitochondria suitable for detecting the methylation pattern.
  • mitochondria DNA refers to the genetic material located in the mitochondria of living organisms. It is a double-stranded, circular, closed molecule with no ends. In humans it has a size of 16569 base pairs, containing a small number of genes, distributed between the H chain and the L chain. Mitochondrial DNA encodes 37 genes: two ribosomal RNAs, 22 transfer RNAs and 13 proteins that participate in oxidative phosphorylation.
  • the sample comprising mitochondrial DNA is selected from a biopsy of a solid tissue or a biofluid. Samples can be obtained by conventional methods known to those skilled in the art.
  • the biofluid is selected from peripheral blood or cerebrospinal fluid.
  • said solid tissue is brain tissue.
  • said brain tissue sample is a sample obtained from the black substance. If the material in which it is desired to determine the methylation pattern according to the present method, that is mtDNA, is found in a solid tissue or a biofluid preferably, a prior extraction of the nucleic acid from the sample is carried out using any technique appropriate for it. .
  • the fraction of DNA suitable for the implementation of the invention is the total DNA.
  • DNA extraction can be carried out using any method known to those skilled in the art (Sambrock et al., 2001. "Molecular cloning: a Laboratory Manual", 3rd ed., Cold Spring Harbor Laboratory Press, NY, Vol. 1-3) which include, without limitation, centrifugations in density gradients, two-phase extraction using aqueous phenol or chloroform with ethanol, column chromatography, methods based on the ability of DNA to bond on glass surfaces and / or silicates, such as diatomaceous earth preparations or glass beds, using kits commercial, for example, the "Q-Biogene fast DNA® kit” or the “QIAamp® (R) DNA Blood Mini Kit” (Qiagen, Hilden, Germany) the "G-Spin llp” (Intron Biotechnology, Korea) or the "Fast Prep System Bio 101" (Qbiogene®, Madrid, Spain) or the methods described in US5,057,426, US4,923,978 and European patent application EP0512767A1.
  • the present method can be carried out in samples where the mitochondrial fraction has previously been isolated and subsequently the DNA has been isolated from them.
  • Isolation of the mitochondrial fraction can be carried out using any known method of cell fractionation. Such methods include prior cell rupture by techniques that include physical disruption of membranes, ultrasound application, pressure application or enzymatic techniques, followed by differential centrifugation by applying density gradients (such as Ficoll or Percoll gradients).
  • Commercial kits can also be used, for example, Qproteome "Mitochondrial isolation kit” (Qiagen, Hilden, Germany) or “Mitochondrial isolation kit for culterd cells” (Thermo Scientific; United States).
  • the first method of the invention comprises determining in a sample of a subject the methylation pattern in a sample comprising mitochondrial DNA.
  • DNA methylation refers to a biochemical process that involves the addition of a methyl group (-CH 3 ) to the nucleotides of cytosine (C) or adenine (A) DNA. Methylation of DNA at position 5 of the cytosine has the specific effect of repression of gene expression and has been found in all vertebrates examined.
  • methylation pattern refers to but is not limited to the presence or absence of methylation of one or more nucleotides.
  • said one or more nucleotides are comprised in a single nucleic acid molecule.
  • Said one or more nucleotides have the ability to be methylated or not.
  • methylation state can also be used, when only a single nucleotide is considered.
  • a methylation pattern can be quantified, in which more than one nucleic acid molecule is considered.
  • D-loop or "control region” as used herein refers to a region of non-coding mitochondrial DNA that contains approximately 1100 base pairs, visible under electron microscopy, which is generated during H chain replication by the synthesis of a short segment of the heavy strand, 7S DNA.
  • ND1 or "NAHD dehydrogenase 1” or “ND1 mt”, as used herein, refers to the gene located in the mitochondrial genome that encodes the NADH dehydrogenase 1 or ND1 protein.
  • the sequence of the human ND1 gene is deposited in the GenBank database (January 2, 2014 version) under accession number NC_012920. (SEQ ID NO: 1).
  • the ND1 protein is part of the enzyme complex called complex I that is active in mitochondria and is involved in the oxidative phosphorylation process.
  • CpG site refers to regions of DNA, particularly regions of mitochondrial DNA, where a cytosine nucleotide is located next to a guanine nucleotide in the linear sequence of bases along its length.
  • CpG is the abbreviation of "C-phosphate-G", that is, cytosine and guanine separated by only one phosphate; Phosphate binds any two nucleosides together in the DNA.
  • CpG is used to distinguish this linear sequence from the pairing of cytosine and guanine CG bases. Cytosines in CpG dinucleotides may be methylated to form 5-methylcytosine.
  • CHG site refers to DNA regions, particularly regions of mitochondrial DNA, where a cytosine nucleotide and a guanine nucleotide are separated by a variable nucleotide (H) that can be adenine, cytosine or thymine.
  • H variable nucleotide
  • the cytosine of the CHG site may be methylated to form 5-methylcytosine.
  • CHH site refers to regions of DNA, particularly regions of mitochondrial DNA, where a cytosine nucleotide is followed by a first and second variable nucleotide (H) that can be adenine, cytosine or thymine.
  • the CHH site cytosine may be methylated to form 5- methylcytosine.
  • the first method of the invention comprises determining in a sample of a subject comprising mitochondrial DNA, the methylation pattern in at least one site selected from the CpG sites of the D-loop region, selected from the sites shown in Table 1.
  • Table 1 List of CpG sites between positions 16386 and 256 of the D-loop region.
  • the determination of the methylation pattern in a CpG site can be performed by multiple processes known to the person skilled in the art.
  • the first method of the invention comprises determining the methylation pattern in at least one CpG site of the D-loop region selected from the sites shown in Table 1.
  • the first method of the invention comprises determining the methylation pattern at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12 , at least 13, at least 14, at least 15 or at least 16 CpG sites selected from Table 1.
  • the first method of the invention comprises determining the methylation pattern at all CpG sites in the D-loop region shown in Table 1.
  • the first method of the invention comprises determining in a sample of a subject comprising mitochondrial DNA, the methylation pattern in at least one site selected from the CpG sites of the ND1 gene selected from the sites shown in Table 2 .
  • Table 2 List of CpG sites in the ND1 gene between positions 3313 and 3686.
  • the first method of the invention comprises determining the methylation pattern at a CpG site of the ND1 gene selected from the sites shown in Table 2. In another particular embodiment, the first method of the invention comprises determining the pattern of methylation in at least 2, at least 3, at least 4, at least 5 or at least 6 CpG sites selected from Table 2. In an even more particular and preferred embodiment of the invention, the first method of the invention comprises determining the methylation pattern at all CpG sites of the ND1 gene shown in Table 2. In another particular embodiment, the first method of the invention comprises determine in a sample of a subject comprising mitochondrial DNA, the methylation pattern in at least one site selected from the CHG sites of the D-loop region shown in Table 3.
  • Table 3 List of CHG sites between positions 16386 and 256 of the D-loop region.
  • determination of the methylation pattern at a CHG site refers to the determination of the methylation status of a particular CHG site.
  • the determination of the methylation pattern in a CHG site can be performed by multiple processes known to the person skilled in the art.
  • the first method of the invention comprises determining the methylation pattern in at least one CHG site of the D-loop region selected from the sites shown in Table 3. In another particular embodiment, the first method of the invention comprises determining the methylation pattern at least 2, at least 3, at minus 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 1 1, at least 12, at least 13 or at least 14 or at least 15 CHG sites selected from Table 3.
  • the first method of the invention comprises determining the methylation pattern at all CHG sites in the D-loop region shown in Table 3.
  • the first method of the invention comprises determining in a sample of a subject comprising mitochondrial DNA, the methylation pattern in at least one site selected from the CHG sites of the ND1 gene selected from the sites shown in Table 4 .
  • Table 4 List of CHG sites in the ND1 gene between positions 3313 and 3686.
  • the first method of the invention comprises determining the methylation pattern in at least one CHG site of the ND1 gene selected from the sites shown in Table 4. In another particular embodiment, the first method of the invention comprises determining the methylation pattern in at least 2, at least 3, at least 4, at least 5 or at least 6 CHG sites selected from Table 4.
  • the first method of the invention comprises determining the methylation pattern at all CHG sites of the ND1 gene shown in Table 4. In another particular embodiment, the first method of the invention comprises determining in a sample of a subject comprising mitochondrial DNA, the methylation pattern in at least one site selected from the CHH sites of the D-loop region, selected from the CHH sites shown in Table 5.
  • Table 5 List of CHH sites between positions 16386 and 256 of the D-loop region.
  • determination of the methylation pattern at a CHH site refers to the determination of the methylation status of a particular CHH site.
  • the determination of the methylation pattern in a CHH site can be performed by multiple processes known to the person skilled in the art.
  • the first method of the invention comprises determining the methylation pattern in at least one CHH site of the D-loop region selected from those shown in Table 5.
  • the first method of the invention comprises determine the methylation pattern at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, or at least 43 CHH sites selected from Table 5.
  • the first method of the invention comprises determining the methylation pattern at all CHH sites in the D-loop region shown in Table 5.
  • the first method of the invention comprises: (i) determine the methylation pattern at all CpG sites in the D-loop region shown in Table 1 and at all CpG sites of the ND1 gene shown in Table 2
  • the determination of the methylation pattern in at least one CpG site, at least one CHG site and / or at least one CHH site according to the first method of the invention is carried out in a whole blood sample, in in which case the determination can be made directly.
  • the sample comprising mitochondrial DNA preferably a total DNA sample, it is extracted from cells that are present in a biological fluid (e.g., whole blood, cerebrospinal fluid) as the initial stage and in such cases, the total nucleic acid extracted from said samples represents the appropriate work material for analysis later. Isolation of total DNA or mitochondrial DNA can be performed by conventional methods known to the person skilled in the art (cited at supra).
  • the methylation pattern of one or more CpG site (s), one or more CHG site (s) and / or one or more site (s) CHH is determined.
  • the analysis of the methylation pattern present in one or more of the CpG, CHG and / or CHH sites described herein present in the mitochondrial DNA of a subject can be performed by any method or technique capable of measure the methylation pattern present in these sites.
  • the first method of the invention comprises determining the methylation pattern at said CpG, CHG and / or CHH sites by a technique selected from the group consisting of specific methylation PCR (MSP), a method based on enrichment (eg MeDIP, MBD-seq and MethyICap), bisulfite sequencing and a bisulfite-based method (eg RRBS, Infinium, GoldenGate, Cobra, MSP, MethyLight) and a restriction digestion method (p.
  • MSP specific methylation PCR
  • a method based on enrichment eg MeDIP, MBD-seq and MethyICap
  • bisulfite sequencing and a bisulfite-based method eg RRBS, Infinium, GoldenGate, Cobra, MSP, MethyLight
  • p restriction digestion method
  • the methylation pattern of one or more CpG, CHG and / or CHH sites in the D-loop region and / or one or more CpG and / or CHG sites in the ND1 gene is determined by pyrosequencing.
  • said technique is based on the principle of sequencing by synthesis and on the detection of pyrophosphate released (PPi) during DNA synthesis.
  • This technique employs a series of four enzymes to detect nucleic acid sequences during the synthesis process; DNA polymerase, ATP sufurilase, luciferase and apyrase and uses as substrates adenosine 5 ' phosphosulfate (APS) and luciferin.
  • APS adenosine 5 ' phosphosulfate
  • modify means the conversion of an unmethylated cytosine to another nucleotide that will distinguish unmethylated cytosine from methylated cytosine.
  • the conversion of the unmethylated cytosine bases, but not the methylated ones, in the sample comprising mitochondrial DNA is carried out with a conversion agent.
  • conversion agent or “conversion reagent”, as used herein, refers to a reagent capable of converting an unmethylated cytosine into uracil or another base that is differentially detectable to cytosine in terms of hybridization properties.
  • the conversion agent is preferably a bisulfite such as bisulfite or hydrogen sulfite.
  • other agents that similarly modify unmethylated cytosine, but not methylated cytosine can also be used in the method of the invention, such as hydrogen sulphite.
  • the reaction is performed according to standard procedures (Frommer et al., 1992, Proc. Nati. Acad. Sci. USA 89: 1827-31; Olek, 1996, Nucleic Acids Res. 24: 5064-6; EP 1394172). It is also possible to carry out the conversion enzymatically, e.g. ex. through the use of specific methylation citidine deaminase.
  • the sample comprising mitochondrial DNA has been treated with a reagent capable of converting an unmethylated cytosine into uracil or another base that is detectably different from cytosine in terms of hybridization properties.
  • the sample comprising mitochondrial DNA is treated with bisulfite using an appropriate commercial kit for this, for example ⁇ Methylation Kit "(Zymo Research, Ecogen; Barcelona, Spain).
  • the D-loop region and / or the ND1 gene that contains one or more CpG, CHG and / or CHH site (s) shown in Tables 1 to 5 It can be amplified using primers that make it possible to distinguish the unmethylated sequence (in which the cytosine from the CpG site becomes uracil) from the methylated sequence (in which the cytosine from the CpG site remains cytosine).
  • amplification methods are based on an enzymatic chain reaction such as, for example, a polymerase chain reaction (PCR), ligase chain reaction (LCR), polymerase ligase chain reaction, Gap-LCR , chain reaction repair, 3SR and NASBA.
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • SDA chain shift amplification
  • TMA transcription-mediated amplification
  • C-amplification etc.
  • MSP methylation-specific PCR
  • US 5,786,146 combining bisulfite treatment and allele-specific PCR (see e.g., US 5,137,806, US 5,595,890, US 5,639.61 1).
  • Uracil is recognized as a thymine by Taq polymerase and therefore, after PCR, the resulting product contains cytosine only at the position where 5-methylcytosine exists in the starting template DNA.
  • the region containing one or more CpG, CHG and / or CHH site (s) can be amplified using primers that are not specific to the methylated sequence.
  • the preferred sequence of the primers does not correspond to a nucleotide sequence comprising a CpG dinucleotide.
  • the amplification products are detected according to standard procedures in the state of the art.
  • the amplified nucleic acid can be determined by standard analytical methods known to the person skilled in the art and described p. eg, in Sambrook et al., 2001 (cited et supra).
  • Detection methods may include but are not limited to the binding or interleaving of specific dyes such as ethidium bromide that is sandwiched into the double stranded DNA and changes its fluorescence after that.
  • the purified nucleic acids can also be separated by electrophoretic methods optionally after restriction digestion and then visualized.
  • probe-based assays that take advantage of the hybridization of oligonucleotides to specific sequences and the subsequent detection of the hybrid. It is also possible to sequence the target nucleic acid after further steps known to the person skilled in the art. Other methods use various nucleic acid sequences to a silicon chip to which specific probes are attached and produce a signal when they join complementary sequences.
  • pyrosequencing is used to determine in said sequence CpG, CHG and / or CHH sites modified after bisulfite treatment.
  • the cytosine / thymine ratio at each of the sites can be determined quantitatively based on the amount of cytosines and thymines incorporated during the sequence extension stage.
  • the methylation pattern of the at least one CpG, CHG and / or CHH site of the D-loop region or at least one CpG and / or CHG site of the ND1 gene can be confirmed by restriction enzyme digestion and analysis. Southern transfer.
  • methylation-sensitive restriction endonucleases that can be used include Smal, Sacll, Eagl, Mspl, Hpall, BstUI and BssHIl, for example.
  • hypomethylation refers to an altered methylation pattern wherein one or more nucleotides, preferably cytosines of the CpG, CHG and / or CHH sites, are methylated compared to a sample of reference.
  • Said reference sample is preferably a sample comprising mitochondrial DNA obtained from a subject that does not suffer from a neurodegenerative disease selected from AD or PE.
  • said term refers to a high number of 5-methylcytosines at one or more CpG sites of the D-loop region shown in Table 1, at one or more CpG sites of the ND1 gene shown in Table 2, at one or more CHG sites of the D-loop region shown in Table 3, at one or more CHG sites of the ND1 gene shown in Table 4 and / or at one or more CHH sites of the D-loop region shown in Table 5 , in a mitochondrial DNA sequence when compared to the relative amount of 5-methylcytosines present in said one or more sites in a reference sample.
  • hypomethylation refers to an altered methylation pattern wherein one or more nucleotides, preferably cytosines of the CpG, CHG and / or CHH sites, are not methylated compared to a sample. reference.
  • reference sample refers to a sample comprising mitochondrial DNA obtained from a subject who does not suffer from a neurodegenerative disease selected from AD or PE.
  • said term refers to a reduced number of 5-methylcytosines at one or more CpG sites of the D-loop region shown in Table 1, at one or more CpG sites of the ND1 gene shown in Table 2, at one or more CHG sites of the D-loop region shown in Table 3, at one or more CHG sites of the ND1 gene shown in Table 4 and / or at one or more CHH sites in the D-loop region shown in Table 5 in a DNA sequence mitochondrial when compared to the relative amount of 5-methylcytosines present in said one or more CpG sites, one or more CHG sites and / or one or more CHH sites in a reference sample.
  • said reference sample comprising mitochondrial DNA is selected from tissue samples, or biofluids, preferably blood or cerebrospinal fluid samples from subjects.
  • said reference sample is total DNA. Methods to obtain said samples as well as methods to isolate the total DNA or mitochondrial DNA from a sample have been detailed above.
  • the reference sample is a sample comprising mitochondrial DNA from age-matched subjects.
  • the invention provides some specific CpG, CHG and CHH site (s) that are related to the diagnosis or to the risk of developing a neurodegenerative disease selected from Alzheimer's disease and Parkinson's disease.
  • a neurodegenerative disease selected from Alzheimer's disease and Parkinson's disease.
  • the first method of the invention comprises determining the methylation pattern of all CpG sites, all CHG sites and all CHH sites in the D-loop region shown in Tables 1, 3 and 5, and the methylation pattern of all CpG sites and all CHG sites of the ND1 gene shown in Tables 2 and 4.
  • the authors of the present invention have found that the degree of methylation of the CpG, CHG and CHH sites in the D-loop region is higher in subjects suffering from Alzheimer's disease in stages l-ll than in subjects suffering from said disease in early stages. of the disease (stages lll-IV).
  • hypomethylation in at least one of the sites CpG of the D-loop region shown in Table 1 or a hypomethylation at one of said CHG sites of the D-loop region shown in Table 3, is indicative that the subject suffers from stage lll-IV Alzheimer's disease .
  • the invention relates to an in vitro method for selecting a subject to be subjected to a preventive treatment of a neurodegenerative disease selected from Alzheimer's disease and Parkinson's disease in a subject (hereinafter, second method of the invention) which comprises determining in a sample of said subject comprising DNA Mitochondrial methylation pattern in the D-loop region and / or in the ND1 gene, where the methylation pattern is determined in at least one site selected from the group consisting of:
  • hypermethylation in at least one of said CpG sites in the D-loop region, hypermethylation in at least one of said CHG sites in the D-loop region, hypermethylation in at least one of said CHH sites in region D -loop, a hypomethylation in at least one of said CpG sites of the ND1 gene and / or a hypomethylation in at least one of said CHG sites in the ND1 gene is indicative that the subject is a candidate for treatment aimed at preventing disease of Alzheimer's or
  • a hypomethylation in at least one of said CpG sites in the D-loop region, a hypomethylation in at least one of said CHG sites in the D-loop region and / or a hypomethylation in at least one of said CHH sites in the D-loop region is indicative that the subject is a candidate for treatment aimed at preventing Parkinson's disease.
  • prevention treatment refers to the prevention or set of prophylactic measures to prevent a disease to prevent or delay the onset of its symptoms as well as to reduce or alleviate the clinical symptomatology of it.
  • said term refers to the prevention or set of measures to prevent the onset, to delay or to alleviate the clinical symptomatology associated with a neurodegenerative disease selected from Alzheimer's disease and Parkinson's disease.
  • Desired clinical results associated with the administration of such treatment to a subject include but are not limited to, stabilization of the disease state of the disease, delay in disease progression or improvement in the physiological state of the subject.
  • Appropriate preventive treatments aimed at preventing or delaying the onset of Alzheimer's disease symptoms include but are not limited to, to choline esterase inhibitors such as donezepil hydrochloride (Arecept), rivastigmine (Exelon) and galantemine (Reminyl) or N-methyl D-aspartate (NMDA) receptor antagonists.
  • choline esterase inhibitors such as donezepil hydrochloride (Arecept), rivastigmine (Exelon) and galantemine (Reminyl) or N-methyl D-aspartate (NMDA) receptor antagonists.
  • Treatments aimed at preventing or delaying the onset of symptoms of Parkinson's disease include but are not limited to L-dopa, catechol-o-methyl transferase (COMT) inhibitors such as tolcapone (Tasmar) and entacapone (They ate), monoamine oxidase B (MAOB) inhibitors such as selegiline (Eldepryl) and rasagaline (Azilect) and dopamine agonists such as pramipexole, rotigotine and ropinirola.
  • CCT catechol-o-methyl transferase
  • MAOB monoamine oxidase B
  • MAOB monoamine oxidase B
  • Eldepryl and rasagaline
  • dopamine agonists such as pramipexole, rotigotine and ropinirola.
  • select refers to the action of choosing a subject to be subjected to a preventive treatment of a neurodegenerative disease selected from Alzheimer's disease and Parkinson's
  • the sample comprising mitochondrial DNA is selected from a biopsy of a solid tissue or a biofluid. Samples can be obtained by conventional methods known to those skilled in the art.
  • the biofluid is selected from peripheral blood or cerebrospinal fluid.
  • said solid tissue is brain tissue.
  • said brain tissue sample is a sample obtained from the black substance.
  • the second method of the invention comprises determining in a sample of a subject comprising mitochondrial DNA, the pattern of methylation in at least one site selected from the CpG sites of the D-loop region, shown in Table 1.
  • the second method of the invention comprises determining the methylation pattern in at least one CpG site of the D-loop region selected from the sites shown in Table 1.
  • the first method of the invention comprises determining the methylation pattern at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 1 1, at least 12, at least 13, at least 14, at least 15 or at least 16 CpG sites selected from Table 1.
  • the second method of the invention comprises determining the methylation pattern at all CpG sites in the D-loop region shown in Table 1.
  • the second method of the invention comprises determining in a sample of a subject comprising mitochondrial DNA, the methylation pattern in at least one site selected from the CpG sites of the ND1 gene, shown in Table 2.
  • the second method of the invention comprises determining the methylation pattern at a CpG site of the ND1 gene selected from the sites shown in Table 2. In another particular embodiment, the second method of the invention comprises determining the pattern of methylation in at least 2, at least 3, at least 4, at least 5 or at least 6 CpG sites selected from Table 2.
  • the second method of the invention comprises determining the methylation pattern at all CpG sites of the ND1 gene shown in Table 2.
  • the second method of the invention comprises determining in a sample of a subject comprising mitochondrial DNA, the methylation pattern in at least one site selected from the CHG sites of the D-loop region, shown in Table 3 .
  • the second method of the invention comprises determining the methylation pattern in at least one CHG site of the D-loop region selected from the sites shown in Table 3.
  • the second method of the invention comprises determining the methylation pattern at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 1 1, at least 12, at least 13 or at least 14 or at least 15 CHG sites selected from Table 3.
  • the second method of the invention comprises determining the methylation pattern at all CHG sites in the D-loop region shown in Table 3.
  • the second method of the invention comprises determining in a sample of a subject comprising mitochondrial DNA, the methylation pattern in at least one site selected from the CHG sites of the ND1 gene, shown in Table 4.
  • the second method of the invention comprises determining the methylation pattern in at least one CHG site of the ND1 gene selected from the sites shown in Table 4. In another particular embodiment, the second method of the invention comprises determining the methylation pattern in at least 2, at least 3, at least 4, at least 5 or at least 6 CpG sites selected from Table 4. In an even more particular and preferred embodiment of the invention, the second method of the invention comprises Determine the methylation pattern at all CHG sites of the ND1 gene shown in Table 4.
  • the second method of the invention comprises determining in a sample of a subject comprising mitochondrial DNA, the methylation pattern in at least one site selected from the CHH sites of the D-loop region, shown in Table 5 .
  • the second method of the invention comprises determining the methylation pattern in at least one CHH site of the D-loop region. selected from those shown in Table 5.
  • the second method of the invention comprises determining the methylation pattern in at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 at least 8, at least 9, at least 10, at least 1 1, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42 or at least 43 sites CHH selected from Table 5.
  • the second method of the invention comprises determining the methylation pattern at all CHH sites in the D-loop region shown in Table 5.
  • the second method of the invention comprises:
  • Suitable methods for determining the methylation pattern in a sample of a subject comprising mitochondrial DNA have been described in detail in the context of the first method of the invention.
  • the second method of the invention comprises determining the methylation pattern at said CpG, CHG and / or CHH sites by a technique selected from the group consisting of specific methylation PCR (MSP), a method based on enrichment (eg MeDIP, MBD-seq and MethyICap), bisulfite sequencing and a bisulfite-based method (eg RRBS, Infinium, GoldenGate, Cobra, MSP, MethyLight) and a restriction digestion method (p eg, MRE-seq, or HELP assay), pyrosequencing, ChIP-on-chip assay, or differential conversion, differential restriction, differential weight of the methylated CpG, CHG and / or CHH sites (s) of DNA.
  • MSP specific methylation PCR
  • a method based on enrichment eg MeDIP, MBD-seq and MethyICap
  • bisulfite sequencing and a bisulfite-based method eg
  • the methylation pattern of one or more CpG, CHG and / or CHH sites in the D-loop region and / or one or more CpG and / or CHH sites in the ND1 gene, of according to the second method of the invention is determined by pyrosequencing.
  • the subject is a candidate for treatment aimed at preventing Alzheimer's disease.
  • the second method of the invention comprises determining the methylation pattern of all CpG sites, all CHG sites and all CHH sites in the D-loop region shown in Tables 1, 3 and 5, and the methylation pattern of all CpG sites and all CHG sites of the ND1 gene shown in Tables 2 and 4.
  • the invention relates to an in vitro method for monitoring the progression of a neurodegenerative disease selected from Alzheimer's disease or Parkinson's disease in a subject (hereinafter, third method of the invention) comprising :
  • step b) compare the methylation pattern determined in step a) with said methylation pattern obtained in an earlier stage of the disease
  • a hypomethylation in at least one of said CpG sites in the D-loop region, a hypomethylation in at least one of said CHG sites in the D-loop region and / or a hypomethylation in at least one of said CHH sites in the D-loop region with respect to said methylation pattern determined at an earlier stage of the disease is indicative of the progression of Parkinson's disease.
  • the term "monitor progression,” which is equivalent to "determining prognosis,” refers to the determination of the evolution of a disease in a subject diagnosed with that disease. Particularly, said term refers to the determination of the progression of a neurodegenerative disease selected from Alzheimer's disease and Parkinson's disease in a subject diagnosed with said disease.
  • there are several suitable parameters to determine the evolution of a disease in a subject for example, the evolution of a neurodegenerative disease selected from AD and PD, it can be determined, for example, by determining survival global.
  • the subject under study has been diagnosed with AD in stages l-ll.
  • the subject under study has been diagnosed with PD in stages lll-V.
  • all survival refers to the percentage of subjects that survive, from the moment of diagnosis or treatment of a neurodegenerative disease selected from Alzheimer's disease and Parkinson's disease, to after a defined period of time.
  • the first stage of determining the prognosis of a neurodegenerative disease selected from AD and PE comprises determining in a sample comprising mitochondrial DNA of a subject diagnosed with said neurodegenerative disease, the methylation pattern in the D-loop region and / or in the ND1 gene in at least one site selected from the sites shown in Tables 1 to 5.
  • the third method of the invention comprises comparing the methylation pattern obtained in said first stage with said methylation pattern obtained in an earlier stage of the disease.
  • the third method of the invention comprises determining the methylation pattern in a sample comprising mitochondrial DNA (first sample) of a subject diagnosed with said neurodegenerative disease, the methylation pattern in the D-loop region and / or in the ND1 gene in at least one site selected from the CpG, CHG and / or CHH sites shown in Tables 1 to 5 and, after a suitable period of time, determine in a sample comprising mitochondrial DNA (second sample) of said subject diagnosed with said neurodegenerative disease, the methylation pattern in these sites.
  • Said second sample can be obtained after a period of one month, two months, three months, four months, five months, six months, one year, two years, three years, four years, five years, ten years or more after obtaining of the first sample.
  • said first sample is obtained from a subject who is not receiving any suitable treatment for said neurodegenerative disease selected from AE and EP and said second sample is obtained after a period of time after the treatment of said disease.
  • said first sample is obtained at the beginning of a suitable treatment for said neurodegenerative disease and the second sample is obtained during one or several points during the course of said treatment.
  • progression of Alzheimer's disease refers to the subject being in a more evolved stage of the disease with respect to the stage in which he was diagnosed. That is, if the subject was classified in a stage l-ll of the EA (according to the cerebral involvement and / or the symptomatology or clinical manifestations of the disease present in said subject) it is considered that the subject is in a more advanced stage of the disease if said subject becomes classified in a stage III-IV or in a stage V-VI or if the subject goes from being classified in a stage lll-IV to being classified in a stage V-VI of the EA.
  • progression of Parkinson's disease refers to the subject being in a more evolved stage of the disease with respect to the stage in which he was diagnosed. That is, if the subject was classified in a stage l-ll of PD (according to the cerebral affectation and / or the symptoms or clinical manifestations of the disease present in said subject) it is considered that the subject is in a stage more advanced disease if said subject happens to be classified in a stage lll-IV or in a stage V-VI or if the subject goes from being classified in a stage lll-IV to being classified in a stage V-VI of the EP.
  • the sample comprising mitochondrial DNA is selected from a biopsy of a solid tissue or a biofluid. Samples can be obtained by conventional methods known to those skilled in the art.
  • the biofluid is selected from peripheral blood or cerebrospinal fluid.
  • said solid tissue is brain tissue.
  • said brain tissue sample is a sample obtained from the black substance.
  • the third method of the invention comprises determining in a sample of a subject comprising mitochondrial DNA, the methylation pattern in at least one site selected from the CpG sites of the D-loop region, shown in Table 1 .
  • the third method of the invention comprises determining the methylation pattern in at least one CpG site of the D-loop region selected from the sites shown in Table 1.
  • the first method of the invention comprises determining the methylation pattern at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12 , at least 13, at least 14, at least 15 or at least 16 CpG sites selected from Table 1.
  • the third method of the invention comprises determining the methylation pattern at all CpG sites in the D-loop region shown in Table 1.
  • the third method of the invention comprises determining in a sample of a subject comprising mitochondrial DNA, the methylation pattern in at least one site selected from the CpG sites of the ND1 gene shown in Table 2.
  • the third method of the invention comprises determining the methylation pattern at a CpG site of the ND1 gene selected from the sites shown in Table 2. In another particular embodiment, the third method of the invention comprises determining the pattern of methylation in at least 2, at least 3, at least 4, at least 5 or at least 6 CpG sites selected from Table 2.
  • the third method of the invention comprises determining the methylation pattern at all CpG sites of the ND1 gene shown in Table 2.
  • the third method of the invention comprises determining in a sample of a subject comprising mitochondrial DNA, the methylation pattern in at least one site selected from the CHG sites of the D-loop region, shown in Table 3 .
  • the third method of the invention comprises determining the methylation pattern in at least one CHG site of the D-loop region selected from the sites shown in Table 3.
  • the third method of the The invention comprises determining the methylation pattern at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13 or at least 14 or 15 CHG sites selected from Table 3.
  • the third method of the invention comprises determining the methylation pattern at all CHG sites in the D-loop region shown in Table 3.
  • the third method of The invention comprises determining in a sample of a subject comprising mitochondrial DNA, the methylation pattern in at least one site selected from the CHG sites of the ND1 gene shown in Table 4.
  • the third method of the invention comprises determining the methylation pattern in at least one CHG site of the ND1 gene selected from the sites shown in Table 4.
  • the third method of the invention comprises determining the methylation pattern in at least 2, at least 3, at least 4, at least 5, or at least 6 CpG sites selected from Table 4.
  • the third method of the invention comprises determining the methylation pattern at all CHG sites of the ND1 gene shown in Table 4.
  • the third method of the invention comprises determine in a sample of a subject comprising mitochondrial DNA, the methylation pattern in at least one site selected from the CHH sites of the D-loop region, shown in Table 5.
  • the third method of the invention it comprises determining the methylation pattern in at least one CHH site of the D-loop region selected from the sites shown in Table 5.
  • the third method of the invention comprises determining the methylation pattern in at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at men os 16, at at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28 at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at minus 41, at least 42 or at least 43 CHH sites selected from Table 5.
  • the third method of the invention comprises determining the methylation pattern at all CHH sites in the D-loop region shown in Table 5.
  • the third method of the invention comprises:
  • the third method of the invention comprises determining the methylation pattern at said CpG, CHG and / or CHH sites by a technique selected from the group consisting of specific methylation PCR (MSP), a method based on enrichment (eg MeDIP, MBD-seq and MethyICap), bisulfite sequencing and a bisulfite-based method (eg RRBS, Infinium, GoldenGate, Cobra, MSP, MethyLight) and a restriction digestion method (p.
  • MSP specific methylation PCR
  • a method based on enrichment eg MeDIP, MBD-seq and MethyICap
  • bisulfite sequencing and a bisulfite-based method eg RRBS, Infinium, GoldenGate, Cobra, MSP, MethyLight
  • p restriction digestion method
  • the methylation pattern of one or more CpG, CHG and / or CHH sites in the D-loop region and / or one or more CpG and / or CHH sites in the ND1 gene, of according to the third method of the invention is determined by pyrosequencing.
  • the third method of the invention comprises determining the methylation pattern of all CpG sites, of all CHG sites and of all CHH sites of the D-loop region shown in Tables 1, 3 and 5, and the methylation pattern of all CpG sites and all CHG sites of the ND1 gene shown in Tables 2 and 4.
  • SNP simple nucleotide polymorphism
  • the invention relates to an in vitro method for diagnosing or determining the risk of developing Alzheimer's disease in a subject (hereinafter, the fourth method of the invention) comprising determining in a sample comprising mitochondrial DNA of said subject the nucleotide at polymorphic position 16519 according to the sequence defined with accession number NC_012920 (SEQ ID NO: 1) in the NCBI database, wherein the detection of nucleotide C in said polymorphic position or the presence of nucleotide C in said polymorphic position in at least 60% of the mitochondrial DNA molecules of said subject is indicative that the subject suffers from said disease or that the subject has a high risk of developing said disease.
  • the terms “diagnosis”, “determine the risk”, “sample” and “mitochondrial DNA” have been defined in the context of the first, second and third methods of the invention and are used with the same meaning in the fourth method of the invention .
  • the presence of a particular nucleotide in a polymorphic position can be defined as the percentage of DNA molecules that have said nucleotide in said polymorphic position with respect to the total DNA molecules present in the sample.
  • the subject suffers from Alzheimer's disease or that the subject has a high risk of developing said disease if the mtDNA of said subject has nucleotide C in polymorphic position 16519 according to the defined sequence with the accession number NC_012920 when at least the percentage of molecules presenting said nucleotide in said position is at least 60%, at least 65%, at least 70%, at least 75%, at least 80 %, at least 85%, at least 90% or more.
  • the subject suffers from Alzheimer's disease or that the subject has a high risk of developing said disease if the mtDNA of said subject has nucleotide C in polymorphic position 16519 according to the sequence defined with the number of NC_012920 access in 60% of mtDNA molecules.
  • the subject suffers from Alzheimer's disease or that the subject has a high risk of develop said disease if the mtDNA of said subject has nucleotide C in polymorphic position 16519 according to the sequence defined with accession number NC_012920 in 71% of mtDNA molecules.
  • the subject suffers from Alzheimer's disease or that the subject has a high risk of developing said disease if the mtDNA of said subject has nucleotide C in polymorphic position 16519 according to the sequence defined with the accession number NC_012920 in 74% of the mtDNA molecules.
  • a sample comprising mitochondrial DNA can be homoplasmic or heteroplasmic.
  • heteroplasmia or “heteroplasmic mitochondrial DNA” as used herein, refers to the fact that a subject's mitochondrial DNA is made up of a mixture of DNA from at least two different populations of mitochondria.
  • homoplasmia or “homoplasmic mitochondrial DNA” as used herein refers to the mitochondrial DNA of a subject being formed by a single population of DNA from a single mitochondrial population.
  • the mitochondrial DNA sample is homoplasmic, in which case all the mitochondria present in the subject contain identical genetic material so that all the mitochondria of a subject present in its genome the nucleotide C at polymorphic position 16519 according to the sequence defined with access number NC_012920.
  • the fourth method of the invention makes it possible to diagnose or determine the risk of developing Alzheimer's disease in a subject by detecting nucleotide C in polymorphic position 16519 according to the sequence defined with access number NC_012920 in said mitochondrial DNA sample; that is, the detection of nucleotide C in polymorphic position 16519 according to the sequence defined with accession number NC_012920 in a sample of homoplasmic mitochondrial DNA of a subject is indicative that the subject suffers from Alzheimer's disease or that the subject has a high risk of developing said disease.
  • nucleotide T in polymorphic position 16519 is indicative that the subject does not suffer from Alzheimer's disease or that the subject has a low risk of developing said disease.
  • the mitochondrial DNA sample is heteroplasmic, that is, the subject's mtDNA is from two mitochondrial populations whose genetic material is not identical to each other.
  • heteroplasmia refers to the fact that a percentage of the mitochondria of said subject have oligonucleotide C in its polymorphic position 16519 in its genome according to the sequence defined with the accession number NC_012920 and the remaining percentage of mitochondria of said subject has in its genome oligonucleotide T in polymorphic position 16519 according to the sequence defined with accession number NC_012920.
  • the identification of the presence of polymorphism in at least 60% of mtDNA molecules is equally useful for selecting a subject to be subjected to a preventive treatment of Alzheimer's disease in cases in which mtDNA of the subject present heteroplasmia as in the cases in the present homoplasmia.
  • all the molecules will present nucleotide T or nucleotide C at position 16519, in which case the percentage of mtDNA molecules with the polymorphisms indicative that the patient is a candidate for receiving a preventive treatment of Alzheimer's disease is 100% or 0%.
  • the patient is a candidate for preventive treatment of Alzheimer's disease when the percentage of ANDmt molecules that present nucleotide C at position 16519 is equal to or greater than 60%.
  • homoplasmia and heteroplasmia as well as the percentage of heteroplasmia or the "degree of heteroplasmia” can be determined by any technique known to the person skilled in the art.
  • Non-limiting illustrative examples of Techniques that allow you to determine if a mitochondrial DNA sample is heteroplasmic include but is not limited to southern blot, PCR-RFLP or mtDNA sequencing.
  • the PCR-RFLP technique is based on the fact that, normally, the presence of an SNP in a sample is associated with the creation or destruction of specific sequences or targets of one or more restriction enzymes.
  • the detection of heteroplasmia by means of the PCR-RFLP technique consists of a first stage, in the amplification of the region of the genetic material that contains the polymorphism that is desired to be detected, by using specific oligonucleotides, followed by a second stage where the amplified fragments undergo an enzymatic digestion reaction in the presence of an appropriate restriction enzyme. Since the presence or absence of polymorphism in the sample is associated with the presence or absence of the specific restriction target, the size pattern of the fragments obtained will determine if the sample is formed by a single band pattern, in which case the Sample is homoplasmic. If, on the contrary, the analysis determines the presence of two band patterns, corresponding to the DNA of two different mitochondrial populations, then the mitochondrial DNA sample is heteroplastic.
  • single nucleotide polymorphism or “single nucleotide polymorphism” or “SNP”, as used herein, refers to a variation in the nucleotide sequence of a nucleic acid that occurs in a single nucleotide ( A, C, T or G), where each possible sequence is present in a proportion equal to or greater than 1% of the population. These polymorphisms appear when a single nucleotide in the genome is altered (for example, by substitution, addition or deletion). Each version of the sequence with respect to the polymorphic site is referred to as an allele of the polymorphic site.
  • the polymorphic variant of the invention is position 16519 based on the numbering defined by the number NC_012920 in the NCBI database.
  • the polymorphic variant contains a C in said position.
  • sequence determination of a SNP or “detect a SNP” are used interchangeably in the present invention, and refer to the determination of the sequence of a particular SNP in the subject matter.
  • the determination of the sequence of SNPs can be carried out by means of several processes known to the person skilled in the art.
  • the sample comprising mitochondrial DNA is selected from a biopsy of a solid tissue or a biofluid. Samples can be obtained by conventional methods known to those skilled in the art.
  • the biofluid is selected from peripheral blood or cerebrospinal fluid.
  • said solid tissue is brain tissue. If the material in which it is desired to determine said SNP according to the present method is a solid tissue or a biofluid, preferably a prior extraction of the nucleic acid from the sample is carried out using any technique appropriate for it. In a preferred embodiment of the invention, the fraction of DNA suitable for the implementation of the invention is the total DNA. DNA extraction can be carried out using any method known to those skilled in the art as detailed for the first method of the invention.
  • the detection of said SNP according to the present method can be carried out in samples where the mitochondrial fraction has been previously isolated and subsequently the DNA thereof has been isolated. Isolation of the mitochondrial fraction can be carried out using any known method of cell fractionation and which have been detailed in the first method of the present invention.
  • the SNP sequence of the invention is detected by any method or technique capable of determining nucleotides present in an SNP or polymorphism.
  • an SNP can be detected by performing sequencing, mini-sequencing, hybridization, restriction fragment analysis, oligonucleotide ligation assay, allele-specific PCR, or a combination thereof.
  • systems and methods for the detection of SNPs generally include, but are not limit, nucleic acid sequencing, hybridization methods and matrix technology (for example, the technology available from Aclara BioSciences, Affymetrix, Agilent Technologies, lllumina Inc., etc); techniques based on the change of mobility of amplified nucleic acid fragments can also be used, such as Single Stranded Conformational Polymorphism (SSCP), denaturing gradient gel electrophoresis (DGGE), Chemical Mismatch Cleavage (CMC), Restriction Fragment Polymorphisms (RFLPs ), PCR-RFLP, WAVE analysis and the like (Methods Mol. Med. 2004; 108: 173-88).
  • SSCP Single Stranded Conformational Polymorphism
  • DGGE denaturing gradient gel electrophoresis
  • CMC Chemical Mismatch Cleavage
  • RFLPs Restriction Fragment Polymorphisms
  • PCR-RFLP WAVE analysis and the like
  • the sequence determination of said SNP is carried out by PCR-RFLP.
  • the fourth method of the invention relates to an in vitro method for diagnosing early stages of AD.
  • the term "early stages of Alzheimer's disease” as used in the present invention refers to Alzheimer's disease in stages l-ll according to the Braak scale defined in the context of the first method of the invention.
  • the invention relates to an in vitro method for selecting a subject to be subjected to a preventive treatment of Alzheimer's disease which comprises determining in a sample comprising mitochondrial DNA of said subject the nucleotide in polymorphic position 16519 according to the sequence defined with the accession number NC_012920 in the NCBI database, wherein the detection of nucleotide C in said polymorphic position or the presence of nucleotide C in said polymorphic position in at least 60% of the mitochondrial DNA molecules of This subject is indicative that the subject is a candidate for treatment aimed at preventing Alzheimer's disease.
  • the subject is a candidate to be subjected to a treatment aimed at preventing Alzheimer's disease if the mtDNA of said subject has nucleotide C in polymorphic position 16519 according to the sequence defined with the accession number NC_012920 when at least the percentage of mtDNA molecules presenting said nucleotide in said position is at least 60%, at least 65%, at least 70%, at least 75%, at least 80 %, at least 85%, at least 90% or more.
  • the subject is considered to be a candidate for preventive treatment of Alzheimer's disease if the mtDNA of said subject has nucleotide C at polymorphic position 16519 according to the sequence defined with accession number NC_012920 at 60 % of mtDNA molecules.
  • the identification of the presence of polymorphism in at least 60% of mtDNA molecules is equally useful for selecting a subject to be subjected to a preventive treatment of Alzheimer's disease in cases in which mtDNA of the subject present heteroplasmia as in the cases in the present homoplasmia.
  • all the molecules will present nucleotide T or nucleotide C at position 16519, in which case the percentage of mtDNA molecules with the polymorphisms indicative that the patient is a candidate for receiving a preventive treatment of Alzheimer's disease is 100% or 0%.
  • the patient is a candidate for preventive treatment of Alzheimer's disease when the percentage of ANDmt molecules that present nucleotide C at position 16519 is equal to or greater than 60%.
  • the sample comprising mitochondrial DNA is selected from a biopsy of a solid tissue or a biofluid. Samples can be obtained by conventional methods known to those skilled in the art.
  • the mitochondrial DNA sample is homoplasmic, in which case all the mitochondria present in the subject contain identical genetic material so that all the mitochondria of a subject present in its genome the nucleotide C at polymorphic position 16519 according to the sequence defined with access number NC_012920.
  • the fifth method of the invention allows a patient to be selected for a preventive treatment of Alzheimer's disease by detecting nucleotide C at polymorphic position 16519 according to the sequence defined with access number NC_012920 in said mitochondrial DNA sample; that is, the detection of nucleotide C in polymorphic position 16519 according to the sequence defined with the accession number NC_012920 in a sample of homoplasmic mitochondrial DNA of a patient is indicative that the subject is a candidate for preventive treatment of the disease of Alzhemier
  • the detection of nucleotide T in polymorphic position 16519 according to the sequence defined with accession number NC_012920 in a sample of homoplasmic mitochondrial DNA of a patient is indicative that said patient is not a candidate for preventive treatment of Alzheimer disease.
  • the mitochondrial DNA sample is heteroplasmic, that is, the subject's mtDNA is from two mitochondrial populations whose genetic material is not identical to each other.
  • heteroplasmia refers to a percentage of the mitochondria of said subject presenting oligonucleotide C in its polymorphic position 16519 in its genome according to the sequence defined with the accession number NC_012920 and the remaining percentage of mitochondria of said subject. subject present in their genome oligonucleotide T in polymorphic position 16519 according to the sequence defined with accession number NC_012920.
  • the biofluid is selected from peripheral blood or cerebrospinal fluid.
  • said solid tissue is brain tissue.
  • the material in which it is desired to determine said SNP according to the present method is a solid tissue or a biofluid
  • a prior extraction of the nucleic acid from the sample is carried out using any technique appropriate for it.
  • the fraction of DNA suitable for the implementation of the invention is the total DNA.
  • DNA extraction can be carried out using any method known to those skilled in the art as detailed for the first method of the invention.
  • sequence determination of said SNP is carried out by PCR-RFLP.
  • the present invention relates to a nucleic acid (hereinafter "first polynucleotide of the invention") comprising at least 9 contiguous polynucleotides of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the CpG sites of the D-loop region shown in Table 1.
  • first polynucleotide of the invention comprising at least 9 contiguous polynucleotides of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the CpG sites of the D-loop region shown in Table 1.
  • polynucleotide refers to single-stranded DNA or RNA molecules, more than 13 bases in length.
  • the polynucleotides of the invention are preferably DNA molecules of at least 14, at least 15, at least 16, at least 18, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50 , at least 60, at least 70, at least 80, at least 90, at least 100 or more bases in length.
  • the first polynucleotide of the invention comprises at least 9, at least 10, at least 1 1, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at at least 30 or more nucleotides adjacent to said at least one CpG site selected from Table 1.
  • the present invention relates to a nucleic acid (hereinafter “second polynucleotide of the invention”) comprising at least 9 contiguous polynucleotides of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the CpG sites of the ND1 gene shown in Table 2.
  • second polynucleotide of the invention comprising at least 9 contiguous polynucleotides of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the CpG sites of the ND1 gene shown in Table 2.
  • the second polynucleotide of the invention comprises at least 9, at least 10, at least 1 1, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at at least 30 or more nucleotides adjacent to said at least one CpG site selected from Table 2.
  • the present invention relates to a nucleic acid (hereinafter “third polynucleotide of the invention”) comprising at least 9 contiguous polynucleotides of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the CHG sites in the D-loop region shown in Table 3.
  • third polynucleotide of the invention comprising at least 9 contiguous polynucleotides of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the CHG sites in the D-loop region shown in Table 3.
  • the third polynucleotide of the invention comprises at least 9, at least 10, at least 1 1, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at at least 30 or more nucleotides adjacent to said at least one CHG site selected from Table 3.
  • the present invention relates to a nucleic acid (hereinafter “fourth polynucleotide of the invention”) comprising at least 9 contiguous polynucleotides of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the CHG sites of the ND1 gene shown in Table 4.
  • fourth polynucleotide of the invention comprising at least 9 contiguous polynucleotides of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the CHG sites of the ND1 gene shown in Table 4.
  • the fourth polynucleotide of the invention comprises at least 9, at least 10, at least 1 1, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at at least 30 or more nucleotides adjacent to said at least one CHG site selected from Table 4.
  • the present invention relates to a nucleic acid (hereinafter "fifth polynucleotide of the invention") comprising at least 9 contiguous polynucleotide of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the CHH sites of the D-loop region shown in Table 5.
  • the fifth polynucleotide of the invention comprises at least 9, at least 10, at least 1 1, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30 or more nucleotides adjacent to said at least one selected CHH site of Table 5.
  • the present invention relates to a nucleic acid (hereinafter "sixth polynucleotide of the invention”) comprising at least 9 contiguous polynucleotides of a region of mitochondrial DNA wherein said region comprises the less a methylation site selected from the CpG sites of the D-loop region shown in Table 1, where the position corresponding to the cytosine at said CpG site is uracil.
  • the sixth polynucleotide of the invention comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30 or more nucleotides adjacent to said at least one CpG site selected from Table 1 where the position corresponding to the cytosine at said CpG site is uracil.
  • the present invention relates to a nucleic acid (hereinafter "seventh polynucleotide of the invention”) comprising at least 9 contiguous polynucleotides of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the CpG sites of the ND1 gene shown in Table 2, wherein the position corresponding to the cytosine at said CpG site is uracil.
  • the seventh polynucleotide of the invention comprises at least 9, at least 10, at least 1 1, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at at least 30 or more nucleotides adjacent to said at least one CpG site selected from Table 2, wherein the position corresponding to the cytosine at said CpG site is uracil.
  • the present invention relates to a nucleic acid (hereinafter “eighth polynucleotide of the invention”) comprising at least 9 contiguous polynucleotides of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the CHG sites of the D-loop region shown in Table 3, where the position corresponding to the cytosine at said CHG site is uracil.
  • the eighth polynucleotide of the invention comprises at least 9, at least 10, at least 1 1, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at at least 30 or more nucleotides adjacent to said at least one CHG site selected from Table 3, wherein the position corresponding to the cytosine at said CHG site is uracil.
  • the present invention relates to a nucleic acid (hereinafter "ninth polynucleotide of the invention”) comprising at least 9 contiguous polynucleotides of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the CHG sites of the ND1 gene shown in Table 4, where the position corresponding to the cytosine at said CHG site is uracil.
  • first polynucleotide of the invention comprising at least 9 contiguous polynucleotides of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the CHG sites of the ND1 gene shown in Table 4, where the position corresponding to the cytosine at said CHG site is uracil.
  • the ninth polynucleotide of the invention comprises at least 9, at least 10, at least 1 1, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at at least 30 or more nucleotides adjacent to said at least one CHG site selected from Table 4, wherein the position corresponding to the cytosine at said CHG site is uracil.
  • the present invention relates to a nucleic acid (hereinafter "tenth polynucleotide of the invention”) comprising at least 9 contiguous polynucleotides of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the CHH sites in the D-loop region shown in Table 5, where the position corresponding to the cytosine at said CHH site is uracil.
  • tenth polynucleotide of the invention comprising at least 9 contiguous polynucleotides of a region of mitochondrial DNA wherein said region comprises at least one methylation site selected from the CHH sites in the D-loop region shown in Table 5, where the position corresponding to the cytosine at said CHH site is uracil.
  • the tenth polynucleotide of the invention comprises at least 9, at least 10, at least 1 1, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30 or more nucleotides adjacent to said at least one CHH site selected from Table 5, wherein the position corresponding to the cytosine at said CHH site is uracil.
  • the invention relates to a polynucleotide that specifically hybridizes with said first, second, third, fourth, fifth, sixth, seventh, eighth, ninth and tenth polynucleotides of the invention.
  • hybridization is the process of combining two single chain nucleic acid molecules or molecules with a high degree of similarity that results in a single double chain molecule through specific pairing between complementary bases. Normally hybridization occurs under very stringent conditions or moderately stringent conditions.
  • the "similarity" between two nucleic acid molecules is determined by comparing the nucleotide sequence of a molecule to the nucleotide sequence of a second molecule.
  • Variants according to the present invention include nucleotide sequences that are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% similar or identical to the sequence of said at least a CpG, CGH and CHH site selected from the sites shown in Tables 1 to 5.
  • the degree of identity between two nucleic acid molecules is determined using computer algorithms and methods that are widely known to those skilled in the art.
  • the identity between two amino acid sequences is preferably determined by the BLASTN algorithm (BLAST Manual, AltschuI et al, 1990, NCBI NLM NIH Bethesda, Md. 20894, AltschuI, S., et al, J. Mol Biol. 215: 403- 10).
  • the "stringency" of the hybridization reactions is readily determined by an ordinary person skilled in the art, and is generally an empirical calculation dependent on the length of the probe, washing temperature and salt concentration. In general, longer probes require higher temperatures for proper hybridization, while shorter probes need lower temperatures.
  • Hybridization generally depends on the ability of denatured DNA to be rehybridized when complementary chains are present in an environment below their melting temperature. The higher the degree of homology desired between the probe and the hybridizable sequence, the higher the relative temperature that can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures not so much.
  • Ausubel et al. Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).
  • stringent conditions typically: (1) uses a low ionic strength and an elevated washing temperature, for example 0.015 M sodium chloride / 0 , 0015M sodium citrate /0.1% sodium dodecyl sulfate at 50 0 C; (2) employ a denaturing agent during hybridization, such as formamide, for example, 50% (v / v) formamide with 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM buffer sodium phosphate at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42 0 C; or (3) employ 50% formamide, 5xSSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5x Denhardt solution, DNA of sonic salmon sperm (50 mg / mi), 0.1% SDS, and 10%
  • formamide for example, 50% (v / v)
  • Modely stringent conditions can be identified as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of wash solution and hybridization conditions (eg. , temperature, ionic strength and% SDS) less stringent than those described above.
  • moderately stringent conditions is overnight incubation at 37 0 C in a solution comprising: 20% formamide, 5x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt solution, 10% dextran sulfate and 20 mg / ml fragmented denatured salmon sperm DNA, followed by washing the filters in 1xSSC at approximately 37-50 ° C.
  • 5x SSC 150 mM NaCl, 15 mM trisodium citrate
  • 50 mM sodium phosphate pH 7.6
  • 5x Denhardt solution 10% dextran sulfate and 20 mg / ml fragmented denatured salmon sperm DNA
  • the present invention relates to a kit (hereinafter “first kit of the invention”), comprising at least one oligonucleotide capable of specifically hybridizing and in a methylation-dependent manner with a sequence in the mitochondrial DNA that It comprises a methylation site selected from the group consisting of:
  • the oligonucleotides that are part of the kit of the invention and that are capable of hybridizing specifically and in a methylation-dependent manner with a sequence in the mitochondrial DNA comprising a methylation site selected from the group consisting of
  • oligonucleotides constitute at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at minus 90% or at least 100% of the total amount of oligonucleotides that make up the kit.
  • said oligonucleotides constitute at least the 55% at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% of the total amount of oligonucleotides that make up the kit.
  • kits include various reagents for use in accordance with the present invention, in suitable containers and packaging materials, including tubes, vials, and shrink-wrapped and blow-molded packages.
  • the kits of the invention may contain instructions for the simultaneous, sequential or separate use of the various components found in the kit.
  • Said instructions may be in the form of printed material or in the form of an electronic support capable of storing instructions so that they can be read by a subject, such as electronic storage media (magnetic discs, tapes and the like), optical media ( CD-ROM, DVD) and the like.
  • the media may contain the Internet addresses provided by said instructions.
  • Materials suitable for inclusion in a kit sample according to the present invention comprise one or more of the following: reagents capable of amplifying a specific sequence of a domain either total DNA or mtDNA without the need for PCR; reagents required to discriminate between the various possible alleles in the sequence domains amplified by PCR or non-PCR amplification (e.g., restriction endonucleases, oligonucleotides that preferentially hybridize methylated or non-methylated CpG, CHG and / or CHH sites, including those modified to contain enzymes or fluorescent chemical groups that amplify the oligonucleotide signal and make discrimination between methylated or non-methylated CpG, CHG and / or CHH sites more robust); or reagents required to physically separate products derived from the various amplified regions (for example, agarose or polyacrylamide and a buffer to be used in electrophoresis, HPLC columns, SSCP gels, formamide gels or a matrix
  • oligonucleotide refers to a single-stranded short DNA or RNA molecule, up to 50 bases in length.
  • the oligonucleotides of the invention are preferably DNA molecules of at least 2, at least 3, at minus 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 30, at least 40, at least 45 or 50 bases of length.
  • the first kit of the invention comprises oligonucleotides capable of hybridizing specifically with all the CpG sites of the D-loop region shown in Table 1, with all the CpG sites of the ND1 gene shown in Table 2, with all CHG sites of the D-loop region shown in Table 3, with all CHG sites of the ND1 gene shown in Table 4 and / or with all CHH sites of the D-loop region shown in Table 5.
  • the first kit of the invention may comprise a first oligonucleotide capable of specifically hybridizing with a bisulfite treated oligonucleotide comprising at least one sequence of a CpG site of the D-loop region shown in Table 1 when said CpG site it is methylated, and at least one oligonucleotide or polynucleotide capable of specifically hybridizing with the same bisulfite-treated oligonucleotide comprising at least one sequence of a CpG site of the D-loop region when said CpG site is not methylated; and / or the kit may comprise a first oligonucleotide capable of specifically hybridizing with a bisulfite treated oligonucleotide comprising at least one sequence of a CpG site of the ND1 gene shown in Table 2 when said CpG site is methylated, and at least one oligonucleotide or polynucleotide capable of specifically hybridizing with the same
  • primers that hybridize with unmethylated DNA preferably have a T in the 3 'CG pair to distinguish it from the C retained in the methylated DNA. It is preferable that the primers contain relatively few Cs or Gs in the sequence since the Cs will be absent in the sense primer and the Gs absent in the antisense primer (cytosine is converted to uracil, which is amplified as thymidine in the amplification product) . Accordingly, for hybridization to a methylated CpG site, primers that specifically hybridize with methylated DNA preferably have a C at the 3 'end of the CG pair.
  • the invention relates to a kit (hereinafter “second kit of the invention"), comprising at least one oligonucleotide capable of hybridizing specifically with a zone in position 5 ' or in position 3 ' with respect to a site of methylation in mitochondrial DNA selected from the group consisting of:
  • cytosine methylated in said position has been converted to uracil or another base that is distinguishable from cytosine in its hybridization properties.
  • the oligonucleotides are part of the kit of the invention and which are capable of specifically hybridizing with a region 5 'or 3' position with respect to a methylation site in mitochondrial DNA selected from the group formed by
  • oligonucleotides constitute at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at minus 90% or at least 100% of the total amount of oligonucleotides that make up the kit.
  • said oligonucleotides constitute at least 55% at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% of the total amount of oligonucleotides that make up the kit.
  • the second kit of the invention further comprises one or more reagents for converting an unmethylated cytosine into uracil or another base that is differentially detectable to the cytosine in terms of hybridization properties.
  • the one or more reagents for converting an unmethylated cytosine to uracil or another base that is detectably different from the cytosine in terms of hybridization properties is a bisulfite, preferably sodium bisulfite.
  • the reagent capable of converting an unmethylated cytosine into uracil or On another basis that is cytosine differentially detectable in terms of hybridization properties is metabisulfite, preferably sodium metabisulfite.
  • the second kit of the invention comprises at least one oligonucleotide comprising a sequence selected from the sequences shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and / or SEQ ID NO: 5.
  • the invention relates to the use of the first and / or second kit of the invention to determine the pattern of mitochondrial DNA in a subject or to determine the diagnosis of a neurodegenerative disease in a selected subject of Alzheimer's disease and Parkinson's disease
  • the samples were processed on a plate divided into two lanes.
  • D-Loop and ND1 amplicons were analyzed in entorhinal cortex samples of cases of pathology related to AD and its corresponding controls (Table 7).
  • D-Loop amplicons were analyzed in samples of black EP substance and their corresponding controls (Table 7).
  • Methylation at CpG and non-CpG sites was analyzed using a 454 GS FLX Titanium de Roche pyrosequencer that generated 569,684 sequences in lane 1, whose lengths ranged from 40 to 1098 base pairs (bp) with an average length of about 417 bp.
  • the number of sequences obtained It was 513,579, whose length varied from 40 to 933 bp (average length of 466 bp).
  • the alignments of the sequences obtained for each MID, amplicon and lane against their respective reference sequences were noted and the percentages of identity between them were close to 100%.
  • the mean and median bisulfite conversion rates for each locus and MI D were analyzed.
  • the number of unmethylated sequences was greater than the number of methylated sequences at each identified site and a few methylation sites were not present. Those sequences that after alignment were found to have at least one site of the methylation pattern not present, were removed from the analysis to avoid any bias at the time of quantification. This approach avoids the analysis of putative mitochondrial pseudogenes whose amplicons have almost 100% identity with mitochondrial DNA when analyzed in NCBI BLAST. The majority of CpG, CHG, and CHH sites analyzed were unmethylated. However, different sites with differential methylation could be identified (Table 6).
  • Table 7 Summary of the main clinical and neuropathological characteristics of the human cases analyzed.
  • the stages of Braak for Alzheimer's disease (AD) indicate the degree of presence of neurons with fibrillar neurodegeneration (Roman numerals) and senile plaques (letters) following the Braak classification.
  • the stages of Braak for Parkinson's disease (PD) refer to the degree of presence of the ⁇ -synuclein protein (Lewy bodies).
  • Tissue samples were provided by the Neurological Tissue Bank, University of Barcelona - Clinical Hospital of Barcelona and the Bank of the Institute of Neuropathology, HUB-ICO-IDIBELL. The donation and obtaining of the samples was regulated by the ethical committee of both institutions. Half of each brain was kept in 4% formalin buffered solution for morphological and histological study, while the other half was processed in coronal sections to freeze at -80C to be available for biochemical studies.
  • the neuropathological examination in all the control and pathological cases was carried out in thirty standardized sections of the brain, cerebellum and brainstem, which were stained with hematoxylin and eosin, and Klüver Barrera, or processed for immunohistochemistry for fibrillar glial acid protein, microglial markers, ⁇ -amyloid, phosphorylated tau (AT8 antibody), ⁇ - synuclein, aB-crystalline, ubiquitin and TDP-43.
  • Cases with pathology related to AD and PE were classified according to current neuropathological criteria (Braak and Braak 1991, 1999; Braak et al, 2003, 2006). Cases with mixed pathology (including vascular lesions) were excluded from this study.
  • the average post-mortem interval of entorhinal cortex samples was 4.98 ⁇ 1, 57 hours in controls, 7.51 ⁇ 5, 13 hours in stages l-ll, and 5.70 ⁇ 2.85 hours in stages lll-IV; for the samples of the black substance the intervals were 5.59 ⁇ 2.46 hours in the controls and 9.23 ⁇ 7.07 hours in the cases of PD.
  • Murine brain samples were 5.59 ⁇ 2.46 hours in the controls and 9.23 ⁇ 7.07 hours in the cases of PD.
  • APP / PS1 transgenic mice and the wild strain were obtained from Jackson Laboratory (USA).
  • the transgenic model expresses a murine / human chimera of the APP molecule (Mo / HuAPP695swe: Swedish APP mutation) and the human variant of presenilin 1 (PS1-dE9), both with expression in the central nervous system neurons.
  • the animals were housed in standard conditions with 12-hour dark and light cycles, with unlimited access to food and water. The establishment was carried out following the ethical guidelines (European Communities Council Directive 86/609 / EEC) approved by the local ethical committee.
  • Total DNA extraction Total DNA from human samples was isolated from the entorhinal cortex and the black substance (Table 7) using the DNeasy Blood and Tissue Kit (Qiagen, Madrid, Spain) according to the manufacturer's instructions. The total DNA of murine samples was obtained from the frontal cortex following the same procedure. Bisulfite treatment
  • the primers for the FLX experiment were designed following the technical instructions for the Roche FLX sequencer "Amplicon Fusion Primer Design Guidelines for GS FLX Titanium Series Lib-A Chemistry".
  • the fusion primers for the amplicons contained a directional primer GS FLX Titanium primer A or primer B (including a key sequence of four bases) in the 5-prime portion of the oligonucleotide, in addition to a specific sequence for the template in the 3 - first end.
  • a MID sequence Multiplex / ctenf / T / er
  • primer A or primer B
  • the primers used contained the following components: Forward primer (First A -Key -MID - specific sequence of the mold), 5'- CGTATCGCCTCCCTCGCGCCA (SEQ ID NO: 33) - TCAG -MID - specific sequence of the mold -3 '; Reverse primer (Primer B- Key-MID - specific sequence of the mold): 5'- CTATGCGCCTTGCCAGCCCGC (SEQ ID NO: 34) - TCAG -MID - specific sequence mold -3 '.
  • Amplicon library preparation PCRs for D-Loop and ND1 amplicons were performed following the Roche Amplicon Library Preparation Method Manua ⁇ (GS FLX Titanium Series) manual. Twenty nanograms of total bisulfite treated DNA were used for the PCRs. The amplification of bisulfite treated DNA was carried out in a reaction volume of 25 ⁇ . Each PCR reaction consisted of: 1x FastStart 10x Buffer # 2, 0.051 ⁇ / ⁇ FastStart HiFi Polymerase (Roche) polymerase, 200 nM of each dNTP, and 200 nM of each concrete forward and reverse primer. The primers were synthesized with HPLC purification quality (Sigma-Aldrich, Madrid, Spain).
  • the amplifications were carried out in an Applied Biosystems Verity ® thermal cycler (Applied Biosystems, Madrid, Spain) using the following conditions: 94 ° C for 3 min and then 36 cycles of 94 ° C for 15s, banding temperature (61 ° C ND1 , and 62 ° C D-Loop) for 45s and 72 ° C for 1 min, followed by a final extension step at 72 ° C for 8 min and a final maintenance temperature at 4 ° C. Two microliters of each PCR product was checked on a 1.5% agarose gel stained with SYBR ® Safe DNA Gel Stain (Invitrogen, Madrid, Spain).
  • the purification of the PCR products was carried out using the Agencourt®AMPure®XP PCR Purification kit (Beckman Coulter, Madrid, Spain) following the instructions in the Roche Amplicon Library Preparation Method Manual (GS FLX Titanium Series).
  • the selection of differentially methylated sites was based on the calculation of the Fisher's Exact Test statistical test, considering those sites differentially methylated with a p-value adjusted with the method of Benjamini and Hochberg (1995) below 0.05.
  • Example 1 DNA methylation is increased in the D-Loop region and reduced in the ND1 gene in cases with early stages of AD-related pathology.
  • An increase in methylation was observed in CpG and non-CpG sites (CHG and CHH) in the D-Loop region in cases with pathology related to EA of stages l / ll and lll / IV of Braak (Fig. 1).
  • the degree of methylation was higher in cases of pathology related to AD with respect to control samples, and higher in stages l / ll versus stages lll / IV, as represented in the log2 (OR) graphs (Fig. 2).
  • no differences were found in the methylation of CHH sites between controls and cases with pathology related to AD in stages lll / IV.
  • ND1 analysis revealed the presence of some less methylated CpG and CHG sites in cases with pathology related to AD in stages l / ll and lll / IV with respect to control samples (log2 [0]> 0, Fig. 3). No differences were found for CHH sites.
  • Example 2 DNA methylation is reduced in the D-Loop region in the black substance of cases with PD.
  • the D-Loop region showed a loss of methylation in almost all CpG and non-CpG sites in the black substance of cases with PD with respect to control samples (Fig. 3 ).
  • the percentage of DNA methylation represents a small part of the total mitochondrial DNA.
  • Example 3 DNA methylation is increased in the D-Loop region in murine EA models.
  • Figure 4A the CpG sites showed hypermethylation in samples obtained from mice model of the pathology with respect to the control samples.
  • APP, PS1 mice three, six, and twelve months old were used. At three months, APP / APS1 mice have a low degree of accumulation of neuritic plaques, which increases in six-month-old APP / APS1 mice. The six-month-old model EA mice show cognitive and memory failures. Finally, the 12-month APP / APS1 animals show symptoms similar to those observed in humans in advanced stages of AD.
  • Example 4 The presence of polymorphic position 16519 in mitochondrial DNA is associated with the development of Alzheimer's disease.
  • Table 9 Presence of polymorphism in samples obtained from control individuals and individuals suffering from Alzheimer's disease (AD) in different stages (Roman numerals). The presence of heteroplasmia was observed in some cases and the genotyping of the samples was performed again using the PCR-RFLP technique. The presence of the C allele generates a restriction target for the Haelll restriction enzyme.
  • the sequence shown in SEQ ID NO: 30 was amplified using oligonucleotides with sequences SEQ ID NO: 31 and SEQ ID NO: 32.
  • Genotype T 183 bp, 318 bp
  • Genotype C 61 bp, 183 bp, 257 bp
  • Heteroplasmia 61 bp, 183 bp, 257 bp, 319 bp.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
PCT/ES2015/070230 2014-03-28 2015-03-27 Marcadores mitocondriales de enfermedades neurodegenerativas Ceased WO2015144964A2 (es)

Priority Applications (9)

Application Number Priority Date Filing Date Title
US15/300,248 US11053549B2 (en) 2014-03-28 2015-03-27 Mitochondrial markers of neurodegenerative diseases
AU2015238195A AU2015238195C1 (en) 2014-03-28 2015-03-27 Mitochondrial markers of neurodegenerative diseases
JP2016560431A JP6687532B2 (ja) 2014-03-28 2015-03-27 神経変性疾患のミトコンドリアマーカー
CA2944281A CA2944281C (en) 2014-03-28 2015-03-27 Mitochondrial markers of neurodegenerative diseases
DK15770042.8T DK3124621T3 (da) 2014-03-28 2015-03-27 Mitokondriemarkører af neurodegenerative sygdomme
BR112016022582-1A BR112016022582B1 (pt) 2014-03-28 2015-03-27 Marcadores mitocondriais de doenças neurodegenerativas
EP15770042.8A EP3124621B9 (en) 2014-03-28 2015-03-27 Mitochondrial markers of neurodegenerative diseases
ES15770042T ES2744592T3 (es) 2014-03-28 2015-03-27 Marcadores mitocondriales de enfermedades neurodegenerativas
US17/337,355 US12065702B2 (en) 2014-03-28 2021-06-02 Mitochondrial markers of neurodegenerative diseases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ESP201430444 2014-03-28
ES201430444A ES2546743B1 (es) 2014-03-28 2014-03-28 Marcadores mitocondriales de enfermedades neurodegenerativas

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/300,248 A-371-Of-International US11053549B2 (en) 2014-03-28 2015-03-27 Mitochondrial markers of neurodegenerative diseases
US17/337,355 Continuation US12065702B2 (en) 2014-03-28 2021-06-02 Mitochondrial markers of neurodegenerative diseases

Publications (2)

Publication Number Publication Date
WO2015144964A2 true WO2015144964A2 (es) 2015-10-01
WO2015144964A3 WO2015144964A3 (es) 2015-12-17

Family

ID=54150970

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2015/070230 Ceased WO2015144964A2 (es) 2014-03-28 2015-03-27 Marcadores mitocondriales de enfermedades neurodegenerativas

Country Status (10)

Country Link
US (2) US11053549B2 (https=)
EP (1) EP3124621B9 (https=)
JP (1) JP6687532B2 (https=)
AU (1) AU2015238195C1 (https=)
BR (1) BR112016022582B1 (https=)
CA (1) CA2944281C (https=)
DK (1) DK3124621T3 (https=)
ES (2) ES2546743B1 (https=)
PT (1) PT3124621T (https=)
WO (1) WO2015144964A2 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023170307A1 (en) 2022-03-11 2023-09-14 Admit Therapeutics Sl Methods of determining the risk of developing alzheimer's disease dementia
WO2024008759A1 (en) 2022-07-04 2024-01-11 Admit Therapeutics Sl Method for identifying dementia with lewy bodies in a subject

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107904667A (zh) * 2018-01-02 2018-04-13 上海美吉生物医药科技有限公司 一种新型甲基化建库试剂盒及其应用
CN108841928B (zh) * 2018-06-11 2021-11-23 河北医科大学 一种人类线粒体基因组甲基化检测试剂盒及其应用
CN109358194A (zh) * 2018-09-29 2019-02-19 中国海洋大学 凡纳滨对虾高血糖激素间接竞争酶联免疫检测方法
AU2020325690A1 (en) 2019-08-02 2022-03-03 Fundació De Recerca Clinic Barcelona-Institut D’Investigacions Biomèdiques August Pi I Sunyer CAR T-cells against BCMA for the treatment of Multiple myeloma
CN112813159B (zh) * 2021-03-23 2023-05-30 广州金域医学检验中心有限公司 帕金森病的生物标志物及其应用
CN119144600B (zh) * 2024-11-20 2025-04-01 天津赛萌生物技术有限公司 一种含鲑鱼线粒体基因克隆载体的构建及其应用

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE241018T1 (de) 1997-02-27 2003-06-15 Ingeneus Corp Untersuchung von nukleotiden in loesung mit hilfe von pna-sonden
EP1208225A2 (en) * 1999-04-20 2002-05-29 Mitokor Single nucleotide polymorphisms in mitochondrial genes that segregate with alzheimer's disease
US20040029133A1 (en) * 2001-11-26 2004-02-12 Mitokor, Inc. Mitochondrial DNA polymorphisms
JP2005000044A (ja) * 2003-06-10 2005-01-06 Masatsugu Tanaka ヒトミトコンドリア遺伝子変異に基づく遺伝子検出法
US20120232016A1 (en) * 2011-03-08 2012-09-13 Coleman Paul D Method and system to detect and diagnose alzheimer's disease

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023170307A1 (en) 2022-03-11 2023-09-14 Admit Therapeutics Sl Methods of determining the risk of developing alzheimer's disease dementia
WO2024008759A1 (en) 2022-07-04 2024-01-11 Admit Therapeutics Sl Method for identifying dementia with lewy bodies in a subject

Also Published As

Publication number Publication date
US11053549B2 (en) 2021-07-06
JP6687532B2 (ja) 2020-04-28
BR112016022582B1 (pt) 2024-03-12
US12065702B2 (en) 2024-08-20
DK3124621T3 (da) 2019-09-09
EP3124621A4 (en) 2018-02-14
ES2546743A1 (es) 2015-09-28
EP3124621A2 (en) 2017-02-01
AU2015238195B2 (en) 2019-07-18
CA2944281C (en) 2021-05-18
CA2944281A1 (en) 2015-10-01
BR112016022582A2 (pt) 2017-10-10
ES2546743B1 (es) 2016-07-07
WO2015144964A3 (es) 2015-12-17
ES2744592T3 (es) 2020-02-25
US20170137881A1 (en) 2017-05-18
US20220049307A1 (en) 2022-02-17
JP2017511138A (ja) 2017-04-20
AU2015238195C1 (en) 2022-03-10
EP3124621B9 (en) 2020-10-21
ES2744592T9 (es) 2020-12-15
PT3124621T (pt) 2019-09-23
EP3124621B1 (en) 2019-06-05
AU2015238195A1 (en) 2016-10-27

Similar Documents

Publication Publication Date Title
ES2744592T3 (es) Marcadores mitocondriales de enfermedades neurodegenerativas
US6475736B1 (en) Methods for genetic analysis of DNA using biased amplification of polymorphic sites
US20140193809A1 (en) Methods for genetic analysis of dna to detect sequence variances
KR101761801B1 (ko) 코 표현형 판단용 조성물
US20050191652A1 (en) Identification of genetic forms of a gene that leads to high risk for parkinson disease
BRPI0617341A2 (pt) processo para o diagnàstico de doenÇas tromboembàlicas e doenÇas coronarianas
JP2010515467A (ja) 心筋梗塞及び心不全における診断マーカー及び薬剤設計のためのプラットホーム
EP3233115A2 (en) Methods and compositions related to transplant-associated thrombotic microangiopathy
KR102095017B1 (ko) Col6a6 유전자 단일염기다형성을 이용한 아토피 피부염 진단용 조성물과 검출 방법
US20030082537A1 (en) Methods for genetic analysis of DNA to detect sequence variances
JP5897704B2 (ja) ブラキスパイナ突然変異の検出
KR20170049768A (ko) 피부 색상 및 흑화 민감도 진단용 단일염기다형성 마커 및 이의 용도
KR102281657B1 (ko) 지연성 허혈 진단을 위한 cdhr5 유전자 과메틸화 마커
KR101092580B1 (ko) 위암 감수성 예측용 vcan 다형성 마커 및 이를 이용한위암 감수성 예측 방법
KR102281644B1 (ko) 지연성 허혈 진단을 위한 insr 유전자 과메틸화 마커
JP4998874B2 (ja) 炎症性疾患の判定方法
JP2004159524A (ja) 核酸試料中のヒトセロトニン5−ht4受容体遺伝子の型を検出する方法
ES2351146T3 (es) Asociación de los polimorfismos en el gen frzb con la osteoporosis.
WO2013142286A1 (en) Genetic alterations associated with autism and the autistic phenotype in the israeli population and methods of use thereof for the diagnosis and treatment of autism
WO2008093343A2 (en) Schizophrenia associated genes and markers

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15770042

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2944281

Country of ref document: CA

Ref document number: 2016560431

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 15300248

Country of ref document: US

REEP Request for entry into the european phase

Ref document number: 2015770042

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2015770042

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2015238195

Country of ref document: AU

Date of ref document: 20150327

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112016022582

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112016022582

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20160928