WO2015077473A1 - Methods and compositions for treating amyloid deposits - Google Patents
Methods and compositions for treating amyloid deposits Download PDFInfo
- Publication number
- WO2015077473A1 WO2015077473A1 PCT/US2014/066658 US2014066658W WO2015077473A1 WO 2015077473 A1 WO2015077473 A1 WO 2015077473A1 US 2014066658 W US2014066658 W US 2014066658W WO 2015077473 A1 WO2015077473 A1 WO 2015077473A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- apoe
- aav4
- aav
- amyloid
- mammal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
- G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5082—Supracellular entities, e.g. tissue, organisms
- G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0083—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the administration regime
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/775—Apolipopeptides
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
- G01N2333/4701—Details
- G01N2333/4709—Amyloid plaque core protein
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/28—Neurological disorders
- G01N2800/2814—Dementia; Cognitive disorders
- G01N2800/2821—Alzheimer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Definitions
- Gene transfer is now widely recognized as a powerful tool for analysis of biological events and disease processes at both the cellular and molecular level. More recently, the application of gene therapy for the treatment of human diseases, either inherited (e.g., ADA deficiency) or acquired (e.g., cancer or infectious disease), has received considerable attention. With the advent of improved gene transfer techniques and the identification of an ever expanding library of defective gene-related diseases, gene therapy has rapidly evolved from a treatment theory to a practical reality.
- gene therapy has been defined as a procedure in which an exogenous gene is introduced into the cells of a patient in order to correct an inborn genetic error. More recently, gene therapy has been broadly defined as the correction of a disease phenotype through the introduction of new genetic information into the affected organism.
- in vivo gene therapy a transferred gene is introduced into cells of the recipient organism in situ that is, within the recipient.
- In vivo gene therapy has been examined in animal models. The feasibility of direct gene transfer in situ into organs and tissues such as muscle, hematopoietic stem cells, the arterial wall, the nervous system, and lung has been reported. Direct injection of DNA into skeletal muscle, heart muscle and injection of DNA-lipid complexes into the vasculature also has been reported to yield a detectable expression level of the inserted gene product(s) in vivo.
- CNS central nervous system
- diseases of the central nervous system e.g., genetic diseases of the brain such as Alzheimer's disease
- a major problem with treating brain diseases is that therapeutic proteins when delivered intravenously do not cross the blood-brain barrier, or when delivered directly to the brain, are not widely distributed.
- therapies for treating Alzheimer's disease need to be developed.
- the present invention provides in certain embodiments a method of determining A- beta in a mammal before and after treatment of an amyloid disorder, comprising:
- the present invention further comprises calculating a ratio of the level of A-beta in the first sample to the level of A-beta in the second sample.
- the present invention further comprising comparing the level of A-beta in the first sample to the level of A-beta in the second sample, wherein an increased level of A-beta in the second blood sample as compared to the first blood sample is associated with or indicative of a decrease or a reduction of amyloid plaques or aggregates present in the brain of the mammal.
- the present invention further comprises comparing the level of A-beta in the first sample to the level of A-beta in the second sample, wherein an increased level of A-beta in the second blood sample as compared to the first blood sample is associated with or indicative of effective treatment of the amyloid disorder.
- the treatment comprises administering to cerebrospinal fluid
- CSF CSF of the mammal an rAAV particle comprising an AAV capsid protein and a vector comprising a nucleic acid encoding a protective ApoE isoform protein inserted between a pair of AAV inverted terminal repeats (ITRs) or adjacent to one or more AAV ITRs.
- ITRs AAV inverted terminal repeats
- protected ApoE isoform is used to distinguish ApoE isoforms that decrease the risk of Alzheimer's disease by at least 5%, such as 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more.
- the rAAV particle is an rAAV2 particle that infects the non-rodent ependymal cell at an rate of more than 20% than the infectivity rate of AAV4, such as at a rate of more than 50% or 100%, 1000%) or 2000% than the infectivity rate of AAV4.
- the treatment comprises delivering a nucleic acid encoding a protective ApoE isoform to mammal comprising administering to an ependymal cell from the mammal an rAAV particle comprising an AAV capsid protein and a vector comprising the nucleic acid inserted between a pair of AAV inverted terminal repeats (ITRs) or adjacent to one or more AAV ITRs, and returning the ependymal cell to the mammal, thereby delivering the nucleic acid to the mammal.
- ITRs inverted terminal repeats
- the treatment comprises delivering a nucleic acid encoding a protective ApoE isoform to an ependymal cell in a mammal comprising administering to the mammal an rAAV particle comprising an AAV capsid protein and a vector comprising the nucleic acid inserted between a pair of AAV inverted terminal repeats (ITRs) or adjacent to one or more AAV ITRs, thereby delivering the nucleic acid to an ependymal cell in the mammal.
- ITRs AAV inverted terminal repeats
- the rAAV particle transduces or transfects an ependymal cell in the mammal, wherein the transduced or transfected ependymal cell secretes the ApoE isoform protein.
- the rAAV particle comprises an AAVl , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVl 1, Rh74 or RhlO capsid or a variant AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAVl 1, Rh74 or RhlO capsid.
- the rAAV particle comprises an AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVIO, AAVl 1, Rh74 or RhlO inverted terminal repeat (ITR) or a variant AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVl 1, Rh74 or RhlO inverted terminal repeat (ITR).
- the AAV particle is an rAAV4 particle.
- the AAV particle is an rAAV2 particle.
- the rAAV2 capsid has at least 80% homology to AAV2 capsid protein VP1, VP2, and/or VP3. In certain embodiments, the rAAV2 capsid has 100% homology to AAV2 capsid VP1, VP2, and/or VP3.
- the nucleic acid encodes a mammalian ApoE isoform protein. In certain embodiments, the nucleic acid encodes a human ApoE isoform protein. In certain embodiments, the rAAV particle comprises a pharmaceutical composition.
- the level of A-beta in the first blood sample or in the second blood sample is quantified by an immunoassay.
- the mammal is a non-rodent mammal.
- the non-rodent mammal is a primate, horse, sheep, goat, pig, or dog.
- the primate is a human.
- the treatment comprises an increased level of the protective ApoE isoform protein in the brain of the mammal.
- the protective ApoE isoform has 80% homology to ApoE ⁇ 2.
- the protective ApoE isoform has 100% homology to ApoE ⁇ 2.
- the amyloid disorder comprises Alzheimer's Disease.
- the blood sample is whole blood, plasma or serum.
- FIGS 1A-1B Intraventricular injection of AAV4-ApoE leads to a stable expression of huAPOE and a sustained detection of recombinant huApoE protein in the brain.
- FIGS 4A-4B Post-mortem evaluation of amyloid load confirms the effects of ApoE2 and ApoE4 on amyloid deposition.
- FIG. 5A-5D Each ApoE isform differentially affects synaptic density around amyloid deposits.
- Figure 6A is an alignment of AAV2 (SEQ ID NO:l) and AAV4 (SEQ ID NO:2) proteins and Figure 6B is and alignment of AAV2 (SEQ ID NO:3) and AAV4 (SEQ ID NO :4) nucleotides based on the sequence from AA V2 (NC 001401 ) and AAV4
- Figure 7 shows elevated TPP1 activity in various brain regions.
- Figure 8 shows the results of T-maze performance of control and treated dogs. Light circles are for affected dogs; dark squares are for normal dogs, and dark circles are for a TPP- /- dog treated with AAV2-CLN2.
- Figures 9A-9B Figure 9A-9B.
- Figure 9A-9B Validation of the APOE gene transfer approach by intraventricular injection of an AAV serotype 4. Immunohistological labeling of GFP or ApoE revealed the presence of GFP or the human ApoE protein in the ependyma and in the choroid plexus.
- A Use of a species-specific ELISA assay to quantify the concentrations of recombinant human ApoE protein within the cerebral homogenates of injected mice.
- FIGS 10A-10D The levels of ⁇ peptides and the density of amyloid deposits are modulated by the overexpression of different APOE alleles.
- A Analysis of the density of amyloid deposits in the cortex (left panel) and hippocampus (right panel) of injected transgenic mice. A similar trend could be observed between both cerebral areas, but the data only reached statistical significance in the cortex.
- B Determination by ELISA of the concentrations of ⁇ 40 and ⁇ 42 peptides in the formic acid (FA) fraction.
- C C
- FIGS 11A-11B Overexpression of each APOE variant differentially modulates the progression of amyloidosis in vivo.
- two-photon images were developed of amyloid deposition in APP/PSl mice one week (TO), one month (Tl) and two months (T2) after intracerebroventricular injection with AAV-GFP, -APOE2, -3 or -4 vectors.
- An intravenous injection of Dextran, Texas red (70,000 Da) was performed prior imaging so that the same fields of view could be followed over time.
- Dextran, Texas red 7-day period of time, few new amyloid plaques could be detected, whereas occasional deposits initially visible were not detectable anymore after one or two months.
- FIGS 13A-13C The neuropathological changes associated with the amyloid deposits are differentially affected by each APOE variant. Images of array tomography sections immunostained for PSD95 (post-synaptic element) and amyloid deposits in APP/PSl mice 2 months after intraventricular injection of AAV-GFP, -APOE2, -APOE3 and -APOE4 were prepared. Amyloid deposits were labeled using the antibody NAB61 that was previously shown to preferentially label toxic ⁇ oligomeric species (A) A significantly higher loss of the synapsin-1 marker was observed in the vicinity of amyloid plaques when both APOE3 and APOE4 were expressed compared with GFP or APOE2.
- Figure 15A-15B Detection of human and endogenous murine APOE mRNA and protein after intraventricular injection of an AAV4 in APP/PSl mice.
- A Box blot graphs representing the amounts of endogenous murine apoE protein in the brains of injected mice.
- B Comparison of the levels of ApoE protein 2 and 5 months after
- Fig. 16A-16C Effects on ⁇ are associated with each ApoE isoform after a short (2 month) exposure. Images were prepared of amyloid deposition in APP/PS1 mice 2 months after injection. Both immunostaining using the Bam 10 antibody and ThioS were used to stain all amyloid deposits or dense-core plaques respectively.
- A Stereological analysis of the density of amyloid deposits in the cortex revealed that overexpression of APOE4 led to an increased number of plaques as early as 2 months after injection, whereas no difference could be observed between the other experimental groups.
- B The ratio between Bam 10 and ThioS staining, on the other hand, remain unchanged among all the different groups.
- C C
- Figures 17A-17B Changes in soluble and insoluble ⁇ species detected 3 months after injection in Tg2576 mice.
- A Quantification by ELISA of the ISF content in ⁇ 40 and ⁇ 42
- B shows that there is a tendency towards higher concentration of soluble amyloid ⁇ peptides after injection of AAV4-APOE4 compared with AAV4-APOE2, -APOE3 and -GFP.
- B As previously observed in APP/PS1 mice, the stronger effect was observed with ApoE4, which causes significantly higher amounts of AB 42 in the formic acid fraction of Tg2576 mice.
- n 3-5 animals per group. *p ⁇ 0.05.
- FIGS 18A-18B AAV4-APOE gene transfer by intracerebroventricular injection ofAPP/PSl mice.
- a species-specific ELISA assay was used to quantify the concentrations of human APOE protein in mouse brain homogenates after 2 and 5 months.
- B Percentage of human APOE compared to endogenous mouse Apoe after 2 or 5 months. The ratio between human and murine APOE was calculated for each animal.
- FIGS 19A-19D ⁇ peptides and amyloid deposits are modulated by different APOE alleles.
- A Analysis of the density of amyloid deposits in the cortex (left panel) and hippocampus (right panel) of APP/PS1 transgenic mice injected with AAV4-GFP or AAV4- APOE2/3/4.
- B Determination by ELISA assay of the concentrations of ⁇ 40 and ⁇ 42 in the formic acid (FA) fraction of mouse brain.
- C Quantification by ELISA assay of the
- Figures 20A-20B. Human APOE variants differentially modulate amyloidosis progression (A) Evaluation of the volumetric cortical density of amyloid deposits over a two- month period after intraventricular injection of AAV4-GFP, -APOE2, -APOE3 or APOE4. Six to eight fields of view were longitudinally imaged for each animal.
- APOE2 APOE2, APOE3 or APOE4.
- FIGS 22A-22C Neuropathological changes associated with amyloid deposits are differentially affected by the APOE variants.
- A Percentage of pre-synaptic (synapsin I) and
- B post-synaptic (PSD95) loss in the vicinity of amyloid plaques.
- Figures 24A-24D Detection of human and endogenous murine APOE mRNA and protein after intracerebroventricular injection of AAV4-APOE in APP/PSl mice.
- FIGS 26A-26B Changes in soluble and insoluble ⁇ species detected 3 months after injection in Tg2576 mice.
- A Quantification by ELISA of the ISF content in ⁇ 40 and ⁇ 42 shows that there is a tendency towards higher concentration of soluble amyloid ⁇ peptides after injection of AAV4-APOE4 compared with AAV4-APOE2, -APOE3 and -GFP.
- B As previously observed in APP/PS1 mice, the stronger effect was observed with ApoE4, which causes significantly higher amounts of AB42 in the formic acid fraction of Tg2576 mice.
- n 3 AAV4-GFP
- n 3 AAV4-APOE2
- ApoE apolipoprotein E
- AD Alzheimer's disease
- ApoE ⁇ 4 isoform a strong genetic risk factor for late-onset, sporadic AD.
- the ApoE ⁇ 4 allele strongly increases AD risk and decreases age of onset.
- the presence of the ApoE ⁇ 2 allele appears to decrease AD risk. It is suggested that human ApoE isoforms differentially affect the
- Adeno associated virus is a small nonpathogenic virus of the parvoviridae family. AAV is distinct from the other members of this family by its dependence upon a helper virus for replication. In the absence of a helper virus, AAV may integrate in a locus specific manner into the q arm of chromosome 19.
- the approximately 5 kb genome of AAV consists of one segment of single stranded DNA of either plus or minus polarity. The ends of the genome are short inverted terminal repeats which can fold into hairpin structures and serve as the origin of viral DNA replication. Physically, the parvovirus virion is non- enveloped and its icosohedral capsid is approximately 20 nm in diameter.
- AAV2 Adeno- Associated Virus Serotype 4
- J Vir., 80 (23):11556-11570 (2006) The genome of AAV2 is 4680 nucleotides in length and contains two open reading frames (ORFs).
- the left ORF encodes the non-structural Rep proteins, Rep 40, Rep 52, Rep 68 and Rep 78, which are involved in regulation of replication and transcription in addition to the production of single-stranded progeny genomes.
- Rep68/78 has also been shown to possess NTP binding activity as well as DNA and RNA helicase activities.
- ITR inverted terminal repeats
- GAGC GAGC repeat motif
- trs terminal resolution site
- the repeat motif has been shown to bind Rep when the ITR is in either a linear or hairpin conformation. This binding serves to position Rep68/78 for cleavage at the trs which occurs in a site- and strand-specific manner.
- Rep binding site is a Rep binding site with an adjacent trs.
- the AAV2 virion is a non-enveloped, icosohedral particle approximately 25 nm in diameter, consisting of three related proteins referred to as VPl, VP2 and VP3.
- the right ORF encodes the capsid proteins VPl , VP2, and VP3. These proteins are found in a ratio of 1 :1 :10 respectively and are all derived from the right-hand ORF.
- the capsid proteins differ from each other by the use of alternative splicing and an unusual start codon. Deletion analysis has shown that removal or alteration of VPl which is translated from an alternatively spliced message results in a reduced yield of infections particles.
- An AAV2 particle is a viral particle comprising an AAV2 capsid protein.
- An AAV2 capsid polypeptide can encode the entire VPl, VP2 and VP3 polypeptide.
- the particle can be a particle comprising AAV2 and other AAV capsid proteins (i.e., a chimeric protein, such as AAV4 and AAV2). Variations in the amino acid sequence of the AAV2 capsid protein are contemplated herein, as long as the resulting viral particle comprises the AAV2 capsid remains antigenically or immunologically distinct from AAV4, as can be routinely determined by standard methods. Specifically, for example, ELISA and Western blots can be used to determine whether a viral particle is antigenically or immunologically distinct from AAV4. Furthermore, the AAV2 viral particle preferably retains tissue tropism distinct from AAV4.
- An AAV2 particle is a viral particle comprising an AAV2 capsid protein.
- An AAV2 capsid polypeptide encoding the entire VP1, VP2, and VP3 polypeptide can overall have at least about 63% homology (or identity) to the polypeptide having the amino acid sequence encoded by nucleotides set forth in SEQ ID NO:l (AAV2 capsid protein).
- the capsid protein can have about 70% homology, about 75% homology, 80% homology, 85% homology, 90% homology, 95% homology, 98% homology, 99% homology, or even 100% homology to the protein set forth in SEQ ID NO: 1.
- the capsid protein can have about 70% identity, about 75% identity, 80% identity, 85% identity, 90% identity, 95% identity, 98% identity, 99% identity, or even 100% identity to the protein set forth in SEQ ID NO:l.
- the particle can be a particle comprising both AAV4 and AAV2 capsid protein, i.e., a chimeric protein. Variations in the amino acid sequence of the AAV2 capsid protein are contemplated herein, as long as the resulting viral particle comprising the AAV2 capsid remains antigenically or
- AAV2 viral particle preferably retains tissue tropism distinction from AAV4, such as that exemplified in the examples herein, though an AAV2 chimeric particle comprising at least one AAV2 coat protein may have a different tissue tropism from that of an AAV2 particle consisting only of AAV2 coat proteins.
- AAV2 capsid sequence and AAV4 capsid sequence are about 60% homologous.
- the AAV2 capsid comprises (or consists of) a sequence that is at least 65% homologous to the amino acid sequence set forth in SEQ ID NO:l.
- the invention further provides an AAV2 particle containing, i.e., encapsidating, a vector comprising a pair of AAV2 inverted terminal repeats.
- AAV2 particle containing, i.e., encapsidating, a vector comprising a pair of AAV2 inverted terminal repeats.
- the nucleotide sequence of AAV2 ITRs is known in the art.
- the particle can be a particle comprising both AAV4 and AAV2 capsid protein, i.e., a chimeric protein.
- the particle can be a particle encapsidating a vector comprising a pair of AAV inverted terminal repeats from other AAVs (e.g., AAV1-AAV8).
- the vector encapsidated in the particle can further comprise an exogenous nucleic acid inserted between the inverted terminal repeats.
- AAV vectors have been shown in vitro to stably integrate into the cellular genome; possess a broad host range; transduce both dividing and non dividing cells in vitro and in vivo and maintain high levels of expression of the transduced genes.
- Viral particles are heat stable, resistant to solvents, detergents, changes in pH, temperature, and can be concentrated on CsCl gradients. Integration of AAV provirus is not associated with any long term negative effects on cell growth or differentiation.
- the ITRs have been shown to be the only cis elements required for replication, packaging and integration and may contain some promoter activities.
- an AAV2 particle is a viral particle comprising an AAV2 capsid protein
- an AAV4 particle is a viral particle comprising an AAV4 capsid protein
- a recombinant AAV2 vector is a nucleic acid construct that comprises at least one unique nucleic acid of AAV2.
- a recombinant AAV2 virion is a particle containing a recombinant AAV2 vector.
- AAV2 ITRs the nucleotide sequence must retain one or both features described herein that distinguish the AAV2 ITR from the AAV4 ITR: ( 1 ) three (rather than four as in AAV4)
- the promoter can be any desired promoter, selected by known considerations, such as the level of expression of a nucleic acid functionally linked to the promoter and the cell type in which the vector is to be used. Promoters can be an exogenous or an endogenous promoter. Promoters can include, for example, known strong promoters such as SV40 or the inducible metallothionein promoter, or an AAV promoter, such as an AAV p5 promoter. Additional examples of promoters include promoters derived from actin genes,
- immunoglobulin genes cytomegalovirus (CMV), adenovirus, bovine papilloma virus, adenoviral promoters, such as the adenoviral major late promoter, an inducible heat shock promoter, respiratory syncytial virus, Rous sarcomas virus (RSV), etc.
- the promoter can be AAV2 p5 promoter or AAV4 p5 promoter.
- smaller fragments of p5 promoter that retain promoter activity can readily be determined by standard procedures including, for example, constructing a series of deletions in the p5 promoter, linking the deletion to a reporter gene, and determining whether the reporter gene is expressed, i.e., transcribed and/or translated.
- the AAV vector can further comprise an exogenous (heterologous) nucleic acid functionally linked to the promoter.
- heterologous nucleic acid is meant that any heterologous or exogenous nucleic acid can be inserted into the vector for transfer into a cell, tissue or organism.
- the heterologous nucleic acid encodes a protective ApoE isoform.
- functionally linked is meant such that the promoter can promote expression of the heterologous nucleic acid, as is known in the art, such as appropriate orientation of the promoter relative to the heterologous nucleic acid.
- the heterologous nucleic acid preferably has all appropriate sequences for expression of the nucleic acid, as known in the art, to functionally encode, i.e., allow the nucleic acid to be expressed.
- the nucleic acid can include, for example, expression control sequences, such as an enhancer, and necessary information processing sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences.
- the nucleic acid can encode more than one gene product, limited only by the size of nucleic acid that can be packaged.
- An AAV2 particle is a viral particle comprising an AAV2 capsid protein. Variations in the amino acid sequence of the AAV2 capsid protein are contemplated herein, as long as the resulting viral particle comprising the AAV2 capsid remains antigenically or
- AAV4 immunologically distinct from AAV4, as can be routinely determined by standard methods. Specifically, for example, ELISA and Western blots can be used to determine whether a viral particle is antigenically or immunologically distinct from other AAV serotypes.
- AAV4 is a unique member of the AAV family.
- a discussion of AAV4 is provided in US Patent No. 6,468,524, which is incorporated by reference herein.
- DNA hybridization data indicated a similar level of homology for AAV 1-4.
- only one ORF corresponding to the capsid proteins was identified in AAV4 and no ORF was detected for the Rep proteins.
- the present invention provides a vector comprising the AAV4 virus as well as AAV4 viral particles. While AAV4 is similar to AAV2, the two viruses are found herein to be physically and genetically distinct. These differences endow AAV4 with some unique advantages which better suit it as a vector for gene therapy.
- wildtype AAV4 genome is larger than AAV2, allowing for efficient encapsidation of a larger recombinant genome.
- wildtype AAV4 particles have a greater buoyant density than AAV2 particles and therefore are more easily separated from contaminating helper virus and empty AAV particles than AAV2-based particles.
- AAV4 is able to hemagglutinate human, guinea pig, and sheep erythrocytes.
- the present invention provides a vector comprising the AAV5 virus or a vector comprising subparts of the virus, as well as AAV5 viral particles.
- a discussion of AAV5 is provided in US Patent No. 6,855,314, which is incorporated by reference herein. While AAV5 is similar to AAV2, the two viruses are found herein to be physically and genetically distinct. These differences endow AAV5 with some unique properties and advantages which better suit it as a vector for gene therapy. For example, one of the limiting features of using AAV2 as a vector for gene therapy is production of large amounts of virus. Using standard production techniques, AAV5 is produced at a 10-50 fold higher level compared to AAV2. Because of its unique TRS site and rep proteins, AAV5 should also have a distinct integration locus compared to AAV2.
- AAV5 capsid protein again surprisingly, is distinct from AAV2 capsid protein and exhibits different tissue tropism, thus making AAV5 capsid-containing particles suitable for transducing cell types for which AAV2 is unsuited or less well-suited.
- AAV2 and AAV5 have been shown to be serologically distinct and thus, in a gene therapy application, AAV5, and AAV5-derived vectors, would allow for transduction of a patient who already possess neutralizing antibodies to AAV2 either as a result of natural
- AAV5 immunological defense or from prior exposure to AAV2 vectors. Another advantage of AAV5 is that AAV5 cannot be rescued by other serotypes. Only AAV5 can rescue the integrated AAV5 genome and effect replication, thus avoiding unintended replication of AAV5 caused by other AAV serotypes.
- polypeptide refers to a polymer of amino acids and includes full-length proteins and fragments thereof.
- protein polypeptide
- peptide are often used interchangeably herein. Substitutions can be selected by known parameters to be neutral.
- the invention also includes those polypeptides having slight variations in amino acid sequences or other properties. Such variations may arise naturally as allelic variations (e.g. due to genetic polymorphism) or may be produced by human intervention (e.g., by mutagenesis of cloned DNA sequences), such as induced point, deletion, insertion and substitution mutants.
- the present method provides a method of delivering a nucleic acid to a cell comprising administering to the cell an AAV particle containing a vector comprising the nucleic acid inserted between a pair of AAV inverted terminal repeats (ITRs) or adjacent to one or more AAV ITRs, thereby delivering the nucleic acid to the cell.
- AAV inverted terminal repeats ITRs
- Administration to the cell can be accomplished by any means, including simply contacting the particle, optionally contained in a desired liquid such as tissue culture medium, or a buffered saline solution, with the cells.
- the particle can be allowed to remain in contact with the cells for any desired length of time, and typically the particle is administered and allowed to remain indefinitely.
- the virus can be administered to the cell by standard viral transduction methods, as known in the art and as exemplified herein. Titers of virus to administer can vary, particularly depending upon the cell type, but will be typical of that used for AAV transduction in general. Additionally the titers used to transduce the particular cells in the present examples can be utilized.
- the cells can include any desired cell in humans as well as other large (non-rodent) mammals, such as primates, horse, sheep, goat, pig, and dog.
- the present invention provides a method of delivering a nucleic acid to an ependymal cell, comprising administering to the ependymal cell an AAV particle containing a vector comprising the nucleic acid inserted between a pair of AAV inverted terminal repeats (ITRs) or adjacent to one or more AAV ITRs, thereby delivering the nucleic acid to the ependymal cell.
- an AAV particle containing a vector comprising the nucleic acid inserted between a pair of AAV inverted terminal repeats (ITRs) or adjacent to one or more AAV ITRs
- the present invention also includes a method of delivering a nucleic acid to a subject comprising administering to a cell from the subject an AAV particle comprising the nucleic acid inserted between a pair of AAV inverted terminal repeats (ITRs) or adjacent to one or more AAV ITRs, and returning the cell to the subject, thereby delivering the nucleic acid to the subject.
- the AAV ITRs can be AAV2 ITRs.
- cells are isolated from a subject by standard means according to the cell type and placed in appropriate culture medium, again according to cell type. Viral particles are then contacted with the cells as described above, and the virus is allowed to transfect the cells. Cells can then be transplanted back into the subject's body, again by means standard for the cell type and tissue. If desired, prior to transplantation, the cells can be studied for degree of transfection by the virus, by known detection means and as described herein.
- the present invention further provides a method of delivering a nucleic acid to a cell in a subject comprising administering to the subject an AAV particle comprising the nucleic acid inserted between a pair of AAV inverted terminal repeats (ITRs) or adjacent to one or more AAV ITRs, thereby delivering the nucleic acid to a cell in the subject.
- Administration can be an ex vivo administration directly to a cell removed from a subject, such as any of the cells listed above, followed by replacement of the cell back into the subject, or administration can be in vivo administration to a cell in the subject.
- cells are isolated from a subject by standard means according to the cell type and placed in appropriate culture medium, again according to cell type.
- Viral particles are then contacted with the cells as described above, and the virus is allowed to transfect the cells.
- Cells can then be transplanted back into the subject's body, again by means standard for the cell type and tissue. If desired, prior to transplantation, the cells can be studied for degree of transfection by the virus, by known detection means and as described herein.
- Also provided is a method of delivering a nucleic acid to an ependymal cell in a subject comprising administering to the subject an AAV particle comprising the nucleic acid inserted between a pair of AAV inverted terminal repeats (ITRs) or adjacent to one or more AAV ITRs, thereby delivering the nucleic acid to an ependymal cell in the subject.
- an AAV particle comprising the nucleic acid inserted between a pair of AAV inverted terminal repeats (ITRs) or adjacent to one or more AAV ITRs
- the amino acid sequence that targets brain vascular endothelium targets brain vascular endothelium in a subject that has a disease, e.g. ,
- the amino acid sequence that targets brain vascular endothelium targets brain vascular endothelium in a subject that does not have Alzheimer's disease.
- the viral vector comprises a nucleic acid sequence encoding a therapeutic agent.
- the therapeutic agent is a protective ApoE isoform.
- Certain embodiments of the present disclosure provide a cell comprising a viral vector as described herein.
- the cell is a mammalian cell of a non-rodent mammal. In certain embodiments, the cell is a primate cell. In certain embodiments, the cell is a human cell. In certain embodiments, the cell is a non-human cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in vivo. In certain embodiments, the cell is an ependymal cell.
- Certain embodiments of the present disclosure provide a method of treating a disease in a mammal comprising administering a viral vector or the cell as described herein to the mammal.
- the mammal is human.
- Certain embodiments of the present disclosure provide a method to deliver an agent to the central nervous system of a subject, comprising administering to the CSF with a viral vector described herein so that the transduced ependymal cells express the therapeutic agent and deliver the agent to the central nervous system of the subject.
- the viral vector transduces ependymal cells.
- Certain embodiments of the present disclosure provide a viral vector or cell as described herein for use in medical treatments.
- Certain embodiments of the present disclosure provide a use of a viral vector or cell as described herein to prepare a medicament useful for treating a disease, e.g., Alzheimer's disease, in a mammal.
- a disease e.g., Alzheimer's disease
- the vector may further comprise a protective ApoE isoform protein.
- secreted protein includes any secreted protein, whether naturally secreted or modified to contain a signal sequence so that it can be secreted.
- Nucleic acid is "operably linked” when it is placed into a functional relationship with another nucleic acid sequence.
- “operably linked” means that the DNA sequences being linked are contiguous. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice. Additionally, multiple copies of the nucleic acid encoding enzymes may be linked together in the expression vector. Such multiple nucleic acids may be separated by linkers.
- the present disclosure also provides a mammalian cell containing a vector described herein.
- the cell may be human, and may be from brain.
- the cell type may be a stem or progenitor cell population.
- the present disclosure provides a method of treating a disease such as a genetic disease or cancer in a mammal by administering a polynucleotide, polypeptide, expression vector, or cell described herein.
- a disease such as a genetic disease or cancer in a mammal by administering a polynucleotide, polypeptide, expression vector, or cell described herein.
- the genetic disease may be a neurodegenerative disease, such as Alzheimer's disease.
- Certain aspects of the disclosure relate to polynucleotides, polypeptides, vectors, and genetically engineered cells (modified in vivo), and the use of them.
- the disclosure relates to a method for gene or protein therapy that is capable of both systemic delivery of a therapeutically effective dose of the therapeutic agent.
- a cell expression system for expressing a therapeutic agent in a mammalian recipient comprises a cell and an expression vector for expressing the therapeutic agent.
- Expression vectors include, but are not limited to, viruses, plasmids, and other vehicles for delivering heterologous genetic material to cells.
- the term "expression vector” as used herein refers to a vehicle for delivering heterologous genetic material to a cell.
- the expression vector is a recombinant adenoviral, adeno- associated virus, or lentivirus or retrovirus vector.
- the expression vector further includes a promoter for controlling transcription of the heterologous gene.
- the promoter may be an inducible promoter (described below).
- the expression system is suitable for administration to the mammalian recipient.
- the expression system may comprise a plurality of non-immortalized genetically modified cells, each cell containing at least one recombinant gene encoding at least one therapeutic agent.
- the cell expression system can be formed in vivo.
- a method for treating a mammalian recipient in vivo includes introducing an expression vector for expressing a heterologous gene product into a cell of the patient in situ, such as via intravenous administration.
- an expression vector for expressing the therapeutic agent is introduced in vivo into the mammalian recipient i.v., where the vector migrates via the vasculature to the brain.
- a method for treating a mammalian recipient in vivo includes introducing the target protein into the patient in vivo.
- the expression vector for expressing the heterologous gene may include an inducible promoter for controlling transcription of the heterologous gene product. Accordingly, delivery of the therapeutic agent in situ is controlled by exposing the cell in situ to conditions, which induce transcription of the heterologous gene.
- the mammalian recipient may have a condition that is amenable to gene replacement therapy.
- gene replacement therapy refers to administration to the recipient of exogenous genetic material encoding a therapeutic agent and subsequent expression of the administered genetic material in situ.
- condition amenable to gene replacement therapy embraces conditions such as genetic diseases (i.e., a disease condition that is attributable to one or more gene defects), acquired pathologies (i.e., a pathological condition which is not attributable to an inborn defect), cancers and prophylactic processes (i.e., prevention of a disease or of an undesired medical condition).
- the term “therapeutic agent” refers to any agent or material, which has a beneficial effect on the mammalian recipient.
- therapeutic agent embraces both therapeutic and prophylactic molecules having nucleic acid or protein components.
- the mammalian recipient has a genetic disease and the exogenous genetic material comprises a heterologous gene encoding a therapeutic agent for treating the disease.
- the mammalian recipient has an acquired pathology and the exogenous genetic material comprises a heterologous gene encoding a therapeutic agent for treating the pathology.
- the patient has a cancer and the exogenous genetic material comprises a heterologous gene encoding an anti-neoplastic agent.
- the patient has an undesired medical condition and the exogenous genetic material comprises a heterologous gene encoding a therapeutic agent for treating the condition.
- a protective ApoE isoform includes variants or
- a “variant” of one of the polypeptides is a polypeptide that is not completely identical to a native protein. Such variant protein can be obtained by altering the amino acid sequence by insertion, deletion or substitution of one or more amino acid.
- the amino acid sequence of the protein is modified, for example by substitution, to create a polypeptide having substantially the same or improved qualities as compared to the native polypeptide. The substitution may be a conserved substitution.
- a “conserved substitution” is a substitution of an amino acid with another amino acid having a similar side chain.
- a conserved substitution would be a substitution with an amino acid that makes the smallest change possible in the charge of the amino acid or size of the side chain of the amino acid (alternatively, in the size, charge or kind of chemical group within the side chain) such that the overall peptide retains its spacial conformation but has altered biological activity.
- common conserved changes might be Asp to Glu, Asn or Gin; His to Lys, Arg or Phe; Asn to Gin, Asp or Glu and Ser to Cys, Thr or Gly.
- Alanine is commonly used to substitute for other amino acids.
- the 20 essential amino acids can be grouped as follows: alanine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan and methionine having nonpolar side chains; glycine, serine, threonine, cystine, tyrosine, asparagine and glutamine having uncharged polar side chains; aspartate and glutamate having acidic side chains; and lysine, arginine, and histidine having basic side chains.
- amino acid changes are achieved by changing the codons of the corresponding nucleic acid sequence. It is known that such polypeptides can be obtained based on substituting certain amino acids for other amino acids in the polypeptide structure in order to modify or improve biological activity. For example, through substitution of alternative amino acids, small conformational changes may be conferred upon a polypeptide that results in increased activity. Alternatively, amino acid substitutions in certain polypeptides may be used to provide residues, which may then be linked to other molecules to provide peptide- molecule conjugates which, retain sufficient properties of the starting polypeptide to be useful for other purposes.
- hydropathic index of amino acids in conferring interactive biological function on a polypeptide, wherein it is found that certain amino acids may be substituted for other amino acids having similar hydropathic indices and still retain a similar biological activity.
- substitution of like amino acids may be made on the basis of hydrophilicity, particularly where the biological function desired in the polypeptide to be generated in intended for use in immunological embodiments.
- hydrophilicity index or hydropathic index which assigns values to each amino acid
- the variant protein has at least 50%, at least about 80%, or even at least about 90% but less than 100%, contiguous amino acid sequence homology or identity to the amino acid sequence of a corresponding native protein.
- the amino acid sequence of the variant polypeptide corresponds essentially to the native polypeptide's amino acid sequence.
- “correspond essentially to” refers to a polypeptide sequence that will elicit a biological response substantially the same as the response generated by the native protein. Such a response may be at least 60% of the level generated by the native protein, and may even be at least 80% of the level generated by native protein.
- a variant may include amino acid residues not present in the corresponding native protein or deletions relative to the corresponding native protein.
- a variant may also be a truncated "fragment" as compared to the corresponding native protein, i.e., only a portion of a full-length protein.
- Protein variants also include peptides having at least one D-amino acid.
- the variant protein may be expressed from an isolated DNA sequence encoding the variant protein.
- "Recombinant” is defined as a peptide or nucleic acid produced by the processes of genetic engineering. It should be noted that it is well-known in the art that, due to the redundancy in the genetic code, individual nucleotides can be readily exchanged in a codon and still result in an identical amino acid sequence.
- the terms "protein,” “peptide” and “polypeptide” are used interchangeably herein.
- the present disclosure provides methods of treating a disease in a mammal by administering an expression vector to a cell or patient.
- an expression vector to a cell or patient.
- a person having ordinary skill in the art of molecular biology and gene therapy would be able to determine, without undue experimentation, the appropriate dosages and routes of administration of the expression vector used in the novel methods of the present disclosure.
- the cells are transformed or otherwise genetically modified in vivo.
- the cells from the mammalian recipient are transformed (i.e., transduced or transfected) in vivo with a vector containing exogenous genetic material for expressing a heterologous (e.g., recombinant) gene encoding a therapeutic agent and the therapeutic agent is delivered in situ.
- a heterologous (e.g., recombinant) gene encoding a therapeutic agent and the therapeutic agent is delivered in situ.
- exogenous genetic material refers to a nucleic acid or an
- exogenous genetic material includes, for example, a non-naturally occurring nucleic acid that can be transcribed into anti-sense RNA, as well as a “heterologous gene” (i.e., a gene encoding a protein which is not expressed or is expressed at biologically insignificant levels in a naturally-occurring cell of the same type).
- the mammalian recipient has a condition that is amenable to gene replacement therapy.
- gene replacement therapy refers to administration to the recipient of exogenous genetic material encoding a therapeutic agent and subsequent expression of the administered genetic material in situ.
- condition amenable to gene replacement therapy embraces conditions such as genetic diseases (i.e. , a disease condition that is attributable to one or more gene defects), acquired pathologies (i.e., a pathological condition which is not attributable to an inborn defect), cancers and prophylactic processes (i.e., prevention of a disease or of an undesired medical condition).
- therapeutic agent refers to any agent or material, which has a beneficial effect on the mammalian recipient.
- therapeutic agent embraces both therapeutic and prophylactic molecules having nucleic acid (e.g., antisense RNA) and/or protein components.
- the condition amenable to gene replacement therapy is a prophylactic process, i.e., a process for preventing disease or an undesired medical condition.
- the instant disclosure embraces a cell expression system for delivering a therapeutic agent that has a prophylactic function (i.e., a prophylactic agent) to the mammalian recipient.
- the term "therapeutic agent” includes, but is not limited to, agents associated with the conditions listed above, as well as their functional equivalents.
- the term “functional equivalent” refers to a molecule (e.g. , a peptide or protein) that has the same or an improved beneficial effect on the mammalian recipient as the therapeutic agent of which is it deemed a functional equivalent.
- a viral vector of the disclosure is an AAV vector.
- An "AAV" vector refers to an adeno-associated virus, and may be used to refer to the naturally occurring wild-type virus itself or derivatives thereof. The term covers all subtypes, serotypes and pseudotypes, and both naturally occurring and recombinant forms, except where required otherwise.
- serotype refers to an AAV which is identified by and distinguished from other AAVs based on capsid protein reactivity with defined antisera, e.g., there are eight known serotypes of primate AAVs, AAV-1 to AAV-8.
- serotype AAV2 is used to refer to an AAV which contains capsid proteins encoded from the cap gene of AAV2 and a genome containing 5' and 3' ITR sequences from the same AAV2 serotype.
- rAAV may be used to refer an AAV having both capsid proteins and 5 '-3' ITRs from the same serotype or it may refer to an AAV having capsid proteins from one serotype and 5'-3' ITRs from a different AAV serotype, e.g., capsid from AAV serotype 2 and ITRs from AAV serotype 5.
- rAAV refers to recombinant adeno-associated virus, also referred to as a recombinant AAV vector (or "rAAV vector").
- AAV virus or "AAV viral particle” refers to a viral particle composed of at least one AAV capsid protein (preferably by all of the capsid proteins of a wild-type AAV) and an encapsidated polynucleotide. If the particle comprises heterologous polynucleotide (i.e., a polynucleotide other than a wild-type AAV genome such as a transgene to be delivered to a mammalian cell), it is typically referred to as "rAAV”.
- the AAV expression vectors are constructed using known techniques to at least provide as operatively linked components in the direction of transcription, control elements including a transcriptional initiation region, the DNA of interest and a transcriptional termination region. The control elements are selected to be functional in a mammalian cell. The resulting construct which contains the operatively linked components is flanked (5' and 3') with functional AAV ITR sequences.
- AAV ITRs adeno-associated virus inverted terminal repeats
- AAV ITRs the art-recognized regions found at each end of the AAV genome which function together in cis as origins of DNA replication and as packaging signals for the virus.
- AAV ITRs, together with the AAV rep coding region, provide for the efficient excision and rescue from, and integration of a nucleotide sequence interposed between two flanking ITRs into a mammalian cell genome.
- AAV ITR The nucleotide sequences of AAV ITR regions are known. As used herein, an "AAV ITR" need not have the wild-type nucleotide sequence depicted, but may be altered, e.g., by the insertion, deletion or substitution of nucleotides. Additionally, the AAV ITR may be derived from any of several AAV serotypes, including without limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AAV7, etc.
- 5' and 3' ITRs which flank a selected nucleotide sequence in an AAV vector need not necessarily be identical or derived from the same AAV serotype or isolate, so long as they function as intended, i.e., to allow for excision and rescue of the sequence of interest from a host cell genome or vector, and to allow integration of the heterologous sequence into the recipient cell genome when AAV Rep gene products are present in the cell.
- AAV ITRs can be derived from any of several AAV serotypes, including without limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AAV7, etc.
- 5' and 3' ITRs which flank a selected nucleotide sequence in an AAV expression vector need not necessarily be identical or derived from the same AAV serotype or isolate, so long as they function as intended, i.e. , to allow for excision and rescue of the sequence of interest from a host cell genome or vector, and to allow integration of the DNA molecule into the recipient cell genome when AAV Rep gene products are present in the cell.
- AAV capsids can be derived from AAV2.
- Suitable DNA molecules for use in AAV vectors will be less than about 5 kilobases (kb), less than about 4.5 kb, less than about 4kb, less than about 3.5 kb, less than about 3 kb, less than about 2.5 kb in size and are known in the art.
- the selected nucleotide sequence is operably linked to control elements that direct the transcription or expression thereof in the subject in vivo. Such control elements can comprise control sequences normally associated with the selected gene.
- heterologous control sequences can be employed.
- Useful heterologous control sequences generally include those derived from sequences encoding mammalian or viral genes. Examples include, but are not limited to, the SV40 early promoter, mouse mammary tumor virus LTR promoter; adenovirus major late promoter (Ad MLP); a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter region (CMVIE), a rous sarcoma virus (RS V) promoter, pol II promoters, pol III promoters, synthetic promoters, hybrid promoters, and the like.
- sequences derived from nonviral genes such as the murine metallothionein gene, will also find use herein.
- Such promoter sequences are commercially available from, e.g., Stratagene (San Diego, Calif).
- heterologous promoters and other control elements such as CNS-specific and inducible promoters, enhancers and the like, will be of particular use.
- heterologous promoters examples include the CMV promoter.
- CNS-specific promoters include those isolated from the genes from myelin basic protein (MBP), glial fibrillary acid protein (GFAP), and neuron specific enolase (NSE).
- MBP myelin basic protein
- GFAP glial fibrillary acid protein
- NSE neuron specific enolase
- inducible promoters include DNA responsive elements for ecdysone, tetracycline, hypoxia and aufin.
- the AAV expression vector which harbors the DNA molecule of interest bounded by AAV ITRs can be constructed by directly inserting the selected sequence(s) into an AAV genome which has had the major AAV open reading frames ("ORFs") excised therefrom.
- ORFs major AAV open reading frames
- Other portions of the AAV genome can also be deleted, so long as a sufficient portion of the ITRs remain to allow for replication and packaging functions.
- Such constructs can be designed using techniques well known in the art.
- AAV ITRs can be excised from the viral genome or from an AAV vector containing the same and fused 5' and 3 ' of a selected nucleic acid construct that is present in another vector using standard ligation techniques.
- ligations can be accomplished in 20 mM Tris-Cl pH 7.5, 10 mM MgCl 2 , 10 mM DTT, 33 ⁇ BSA, 10 mM-50 mM NaCl, and either 40 uM ATP, 0.01-0.02 (Weiss) units T4 DNA ligase at 0°C (for "sticky end” ligation) or 1 mM ATP, 0.3-0.6 (Weiss) units T4 DNA ligase at 14°C (for "blunt end” ligation).
- Intermolecular "sticky end” ligations are usually performed at 30-100 ⁇ g/ml total DNA concentrations (5-100 nM total end concentration).
- AAV vectors which contain ITRs.
- chimeric genes can be produced synthetically to include AAV ITR sequences arranged 5' and 3' of one or more selected nucleic acid sequences. Preferred codons for expression of the chimeric gene sequence in mammalian CNS cells can be used. The complete chimeric sequence is assembled from overlapping oligonucleotides prepared by standard methods.
- an AAV expression vector is introduced into a suitable host cell using known techniques, such as by transfection.
- transfection techniques are generally known in the art. See, e.g., Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York.
- Particularly suitable transfection methods include calcium phosphate co-precipitation, direct microinjection into cultured cells, electroporation, liposome mediated gene transfer, lipid-mediated transduction, and nucleic acid delivery using high-velocity microprojectiles.
- suitable host cells for producing rAAV virions include microorganisms, yeast cells, insect cells, and mammalian cells, that can be, or have been, used as recipients of a heterologous DNA molecule.
- the term includes the progeny of the original cell which has been transfected.
- a "host cell” as used herein generally refers to a cell which has been transfected with an exogenous DNA sequence. Cells from the stable human cell line, 293 (readily available through, e.g., the American Type Culture Collection under Accession Number ATCC CRL1573) can be used in the practice of the present disclosure.
- the human cell line 293 is a human embryonic kidney cell line that has been transformed with adenovirus type-5 DNA fragments, and expresses the adenoviral El a and Elb genes.
- the 293 cell line is readily transfected, and provides a particularly convenient platform in which to produce rAAV virions.
- AAV rep coding region is meant the art-recognized region of the AAV genome which encodes the replication proteins Rep 78, Rep 68, Rep 52 and Rep 40. These Rep expression products have been shown to possess many functions, including recognition, binding and nicking of the AAV origin of DNA replication, DNA helicase activity and modulation of transcription from AAV (or other heterologous) promoters. The Rep expression products are collectively required for replicating the AAV genome. Suitable homologues of the AAV rep coding region include the human herpesvirus 6 (HHV-6) rep gene, which is also known to mediate AAV2 DNA replication.
- HHV-6 human herpesvirus 6
- AAV cap coding region is meant the art-recognized region of the AAV genome which encodes the capsid proteins VP1, VP2, and VP3, or functional homologues thereof. These Cap expression products supply the packaging functions which are collectively required for packaging the viral genome.
- AAV helper functions are introduced into the host cell by transfecting the host cell with an AAV helper construct either prior to, or concurrently with, the transfection of the AAV expression vector.
- AAV helper constructs are thus used to provide at least transient expression of AAV rep and/or cap genes to complement missing AAV functions that are necessary for productive AAV infection.
- AAV helper constructs lack AAV IT s and can neither replicate nor package themselves. These constructs can be in the form of a plasmid, phage, transposon, cosmid, virus, or virion.
- a number of AAV helper constructs have been described, such as the commonly used plasmids pAAV/Ad and pIM29+45 which encode both Rep and Cap expression products.
- a number of other vectors have been described which encode Rep and/or Cap expression products.
- Methods of delivery of viral vectors include injecting the AAV into the CSF.
- rAAV virions may be introduced into cells of the CNS using either in vivo or in vitro transduction techniques. If transduced in vitro, the desired recipient cell will be removed from the subject, transduced with rAAV virions and reintroduced into the subject.
- syngeneic or xenogeneic cells can be used where those cells will not generate an inappropriate immune response in the subject.
- transduced cells can be transduced in vitro by combining recombinant AAV virions with CNS cells e.g., in appropriate media, and screening for those cells harboring the DNA of interest can be screened using conventional techniques such as Southern blots and/or PCR, or by using selectable markers.
- Transduced cells can then be formulated into pharmaceutical compositions, described more fully below, and the composition introduced into the subject by various techniques, such as by grafting, intramuscular, intravenous, subcutaneous and intraperitoneal injection.
- compositions will comprise sufficient genetic material to produce a therapeutically effective amount of the nucleic acid of interest, i.e., an amount sufficient to reduce or ameliorate symptoms of the disease state in question or an amount sufficient to confer the desired benefit.
- the pharmaceutical compositions will also contain a pharmaceutically acceptable excipient.
- excipients include any pharmaceutical agent that does not itself induce the production of antibodies harmful to the individual receiving the composition, and which may be administered without undue toxicity.
- Pharmaceutically acceptable excipients include, but are not limited to, sorbitol, Tween80, and liquids such as water, saline, glycerol and ethanol.
- Pharmaceutically acceptable salts can be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like.
- auxiliary substances such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles.
- an effective amount of viral vector which must be added can be empirically determined. Administration can be effected in one dose, continuously or intermittently throughout the course of treatment. Methods of determining the most effective means and dosages of administration are well known to those of skill in the art and will vary with the viral vector, the composition of the therapy, the target cells, and the subject being treated. Single and multiple administrations can be carried out with the dose level and pattern being selected by the treating physician.
- transgene could be expressed by the delivered viral vector.
- separate vectors, each expressing one or more different transgenes can also be delivered to the CNS as described herein.
- viral vectors delivered by the methods of the present disclosure be combined with other suitable compositions and therapies.
- the exogenous genetic material e.g., a cDNA encoding one or more therapeutic proteins
- the exogenous genetic material is introduced into the cell ex vivo or in vivo by genetic transfer methods, such as transfection or transduction, to provide a genetically modified cell.
- Various expression vectors i.e., vehicles for facilitating delivery of exogenous genetic material into a target cell
- transfection of cells refers to the acquisition by a cell of new genetic material by incorporation of added DNA.
- transfection refers to the insertion of nucleic acid into a cell using physical or chemical methods.
- transfection techniques are known to those of ordinary skill in the art including: calcium phosphate DNA co- precipitation; DEAE-dextran; electroporation; cationic liposome-mediated transfection; and tungsten particle-faciliated microparticle bombardment.
- Strontium phosphate DNA co- precipitation is another possible transfection method.
- transduction of cells refers to the process of transferring nucleic acid into a cell using a DNA or RNA virus.
- a R A virus i.e., a retrovirus
- a transducing chimeric retrovirus Exogenous genetic material contained within the retrovirus is incorporated into the genome of the transduced cell.
- a cell that has been transduced with a chimeric DNA virus e.g., an adenovirus carrying a cDNA encoding a therapeutic agent
- the exogenous genetic material includes the heterologous gene (usually in the form of a cDNA comprising the exons coding for the therapeutic protein) together with a promoter to control transcription of the new gene.
- the promoter characteristically has a specific nucleotide sequence necessary to initiate transcription.
- the exogenous genetic material further includes additional sequences (i.e., enhancers) required to obtain the desired gene transcription activity.
- enhancers i.e., enhancers
- an “enhancer” is simply any non-translated DNA sequence which works contiguous with the coding sequence (in cis) to change the basal transcription level dictated by the promoter.
- the exogenous genetic material may introduced into the cell genome immediately downstream from the promoter so that the promoter and coding sequence are operatively linked so as to permit transcription of the coding sequence.
- a retroviral expression vector may include an exogenous promoter element to control transcription of the inserted exogenous gene.
- exogenous promoters include both constitutive and inducible promoters.
- constitutive promoters control the expression of essential cell functions. As a result, a gene under the control of a constitutive promoter is expressed under all conditions of cell growth.
- exemplary constitutive promoters include the promoters for the following genes which encode certain constitutive or "housekeeping" functions:
- hypoxanthine phosphoribosyl transferase HPRT
- dihydrofolate reductase DHFR
- adenosine deaminase phosphoglycerol kinase
- PGK phosphoglycerol kinase
- pyruvate kinase phosphoglycerol mutase
- actin promoter many viral promoters function constitutively in eucaryotic cells.
- any of the above-referenced constitutive promoters can be used to control transcription of a heterologous gene insert.
- inducible promoters Genes that are under the control of inducible promoters are expressed only or to a greater degree, in the presence of an inducing agent, (e.g., transcription under control of the metallothionein promoter is greatly increased in presence of certain metal ions).
- Inducible promoters include responsive elements (REs) which stimulate transcription when their inducing factors are bound.
- REs responsive elements
- Promoters containing a particular RE can be chosen in order to obtain an inducible response and in some cases, the RE itself may be attached to a different promoter, thereby conferring inducibility to the recombinant gene.
- the appropriate promoter constitutive versus inducible; strong versus weak
- delivery of the therapeutic agent in situ is triggered by exposing the genetically modified cell in situ to conditions for permitting transcription of the therapeutic agent, e.g., by intraperitoneal injection of specific inducers of the inducible promoters which control transcription of the agent.
- in situ expression by genetically modified cells of a therapeutic agent encoded by a gene under the control of the metallothionein promoter is enhanced by contacting the genetically modified cells with a solution containing the appropriate (i.e., inducing) metal ions in situ.
- the amount of therapeutic agent that is delivered in situ is regulated by controlling such factors as: (1) the nature of the promoter used to direct transcription of the inserted gene, (i.e., whether the promoter is constitutive or inducible, strong or weak); (2) the number of copies of the exogenous gene that are inserted into the cell; (3) the number of transduced/transfected cells that are administered (e.g., implanted) to the patient; (4) the size of the implant (e.g., graft or encapsulated expression system); (5) the number of implants; (6) the length of time the transduced/transfected cells or implants are left in place; and (7) the production rate of the therapeutic agent by the genetically modified cell. Selection and optimization of these factors for delivery of a therapeutically effective dose of a particular therapeutic agent is deemed to be within the scope of one of ordinary skill in the art without undue experimentation, taking into account the above-disclosed factors and the clinical profile of the patient.
- the expression vector may include a selection gene, for example, a neomycin resistance gene, for facilitating selection of cells that have been transfected or transduced with the expression vector.
- the cells are transfected with two or more expression vectors, at least one vector containing the gene(s) encoding the therapeutic agent(s), the other vector containing a selection gene.
- a suitable promoter, enhancer, selection gene and/or signal sequence (described below) is deemed to be within the scope of one of ordinary skill in the art without undue experimentation.
- the therapeutic agent can be targeted for delivery to an extracellular, intracellular or membrane location.
- the expression vector is designed to include an appropriate secretion "signal" sequence for secreting the therapeutic gene product from the cell to the extracellular milieu. If it is desirable for the gene product to be retained within the cell, this secretion signal sequence is omitted.
- the expression vector can be constructed to include "retention" signal sequences for anchoring the therapeutic agent within the cell plasma membrane. For example, all membrane proteins have hydrophobic transmembrane regions, which stop translocation of the protein in the membrane and do not allow the protein to be secreted. The construction of an expression vector including signal sequences for targeting a gene product to a particular location is deemed to be within the scope of one of ordinary skill in the art without the need for undue experimentation.
- immunodetection methods include enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoradiometric assay, fluoroimmunoassay, chemiluminescent assay, bioluminescent assay, and Western blot, though several others are well known to those of ordinary skill.
- ELISA enzyme linked immunosorbent assay
- RIA radioimmunoassay
- immunoradiometric assay fluoroimmunoassay
- fluoroimmunoassay chemiluminescent assay
- bioluminescent assay bioluminescent assay
- Western blot Western blot, though several others are well known to those of ordinary skill.
- the steps of various useful immunodetection methods have been described in the scientific literature.
- the immunobinding methods include obtaining a sample suspected of containing ⁇ protein and contacting the sample with a first antibody, monoclonal or polyclonal specific for ⁇ , in accordance with the present invention, as the case may be, under conditions effective to allow the formation of immunocomplexes.
- the immunobinding methods include methods for detecting and quantifying the amount of ⁇ protein in a sample and the detection and quantification of any immune complexes formed during the binding process.
- a sample suspected of containing ⁇ protein one would obtain a sample suspected of containing ⁇ protein, and contact the sample with an antibody fragment of the invention and then detect and quantify the amount of immune complexes formed under the specific conditions.
- the chosen biological sample with the antibody under effective conditions and for a period of time sufficient to allow the formation of immune complexes is generally a matter of simply adding the antibody composition to the sample and incubating the mixture for a period of time long enough for the antibodies to form immune complexes with, i.e., to bind to, any antigens present.
- the sample- antibody composition such as a tissue section, ELISA plate, dot blot or western blot, will generally be washed to remove any non-specifically bound antibody species, allowing only those scFv molecules specifically bound within the primary immune complexes to be detected.
- a protein detection molecule i.e., binding ligand, such as an antibody or antibody fragment
- binding ligand such as an antibody or antibody fragment
- the first antibody that becomes bound within the primary immune complexes may be detected by means of a second binding ligand that has binding affinity for the antibody.
- the second binding ligand may be linked to a detectable label.
- the second binding ligand is itself often an antibody, which may thus be termed a "secondary" antibody.
- the primary immune complexes are contacted with the labeled, secondary binding ligand, or antibody, under effective conditions and for a period of time sufficient to allow the formation of secondary immune complexes.
- the secondary immune complexes are then generally washed to remove any non-specifically bound labeled secondary antibodies or ligands, and the remaining label in the secondary immune complexes is then detected.
- Further methods include the detection of primary immune complexes by a two-step approach.
- a second binding ligand such as an antibody, that has binding affinity for the first binding ligand is used to form secondary immune complexes, as described above.
- the secondary immune complexes are contacted with a third binding ligand or antibody that has binding affinity for the second antibody, again under effective conditions and for a period of time sufficient to allow the formation of immune complexes (tertiary immune complexes).
- the third ligand or antibody is linked to a detectable label, allowing detection of the tertiary immune complexes thus formed. This system may provide for signal amplification if this is desired.
- immunoassays in their most simple and/or direct sense, are binding assays.
- Certain preferred immunoassays are the various types of enzyme linked immunosorbent assays (ELISAs) and/or radioimmunoassays (RIA) known in the art.
- ELISAs enzyme linked immunosorbent assays
- RIA radioimmunoassays
- Immunohistochemical detection using tissue sections is also particularly useful. However, it will be readily appreciated that detection is not limited to such techniques, and/or western blotting, dot blotting, FACS analyses, and/or the like may also be used.
- antibodies are immobilized onto a selected surface exhibiting protein affinity, such as a well in a polystyrene microtiter plate. Then, a test composition suspected of containing ⁇ protein, such as a clinical sample (e.g., a biological sample obtained from the subject), is added to the wells. After binding and/or washing to remove non-specifically bound immune complexes, the bound antigen may be detected. Detection is generally achieved by the addition of another antibody that is linked to a detectable label.
- ELISA is a simple "sandwich ELISA.” Detection may also be achieved by the addition of a second antibody, followed by the addition of a third antibody that has binding affinity for the second antibody, with the third antibody being linked to a detectable label.
- the samples suspected of containing the antigen are immobilized onto the well surface and/or then contacted with binding agents. After binding and/or washing to remove non-specifically bound immune complexes, the bound anti-binding agents are detected. Where the initial binding agents are linked to a detectable label, the immune complexes may be detected directly. Again, the immune complexes may be detected using a second antibody that has binding affinity for the first binding agents, with the second antibody being linked to a detectable label.
- Another ELISA in which the antigens are immobilized involves the use of antibody competition in the detection.
- labeled antibodies against an antigen are added to the wells, allowed to bind, and/or detected by means of their label.
- the amount of an antigen in an unknown sample is then determined by mixing the sample with the labeled antibodies against the antigen during incubation with coated wells.
- the presence of an antigen in the sample acts to reduce the amount of antibody against the antigen available for binding to the well and thus reduces the ultimate signal.
- This is also appropriate for detecting antibodies against an antigen in an unknown sample, where the unlabeled antibodies bind to the antigen-coated wells and also reduces the amount of antigen available to bind the labeled antibodies.
- ELISAs have certain features in common, such as coating, incubating and binding, washing to remove non-specifically bound species, and detecting the bound immune complexes.
- a secondary or tertiary detection means rather than a direct procedure.
- the immobilizing surface is contacted with the biological sample to be tested under conditions effective to allow immune complex (antigen/antibody) formation. Detection of the immune complex then requires a labeled secondary binding ligand or antibody, and a secondary binding ligand or antibody in conjunction with a labeled tertiary antibody or a third binding ligand.
- Under conditions effective to allow immune complex (antigen/antibody) formation means that the conditions preferably include diluting the tau oligomers and/or scFv composition with solutions such as BSA, bovine gamma globulin (BGG) or phosphate buffered saline (PBS)/Tween. These added agents also tend to assist in the reduction of nonspecific background.
- suitable conditions also mean that the incubation is at a temperature or for a period of time sufficient to allow effective binding. Incubation steps are typically from about 1 to 2 to 4 hours or so, at temperatures preferably on the order of 25° C to 27°C, or may be overnight at about 4° C or so.
- the contacted surface is washed so as to remove non-complexed material.
- An example of a washing procedure includes washing with a solution such as PBS/Tween, or borate buffer. Following the formation of specific immune complexes between the test sample and the originally bound material, and subsequent washing, the occurrence of even minute amounts of immune complexes may be determined.
- the second or third antibody will have an associated label to allow detection.
- This may be an enzyme that will generate color development upon incubating with an appropriate chromogenic substrate.
- a urease glucose oxidase, alkaline phosphatase or hydrogen peroxidase-conjugated antibody for a period of time and under conditions that favor the development of further immune complex formation (e.g., incubation for 2 hours at room temperature in a PBS-containing solution such as PBS- Tween).
- the amount of label is quantified, e.g., by incubation with a chromogenic substrate such as urea, or bromocresol purple, or 2,2'-azino-di-(3-ethyl-benzthiazoline-6- sulfonic acid (ABTS), or H 2 0 2 , in the case of peroxidase as the enzyme label. Quantification is then achieved by measuring the degree of color generated, e.g., using a visible spectra spectrophotometer.
- This Example studied changes in the progression of amyloid deposition in app/ps mice after overexpression of different ApoE isoforms through intraventricular injection of an adeno-associated virus serotype 4 (AAV4).
- AAV4 adeno-associated virus serotype 4
- ApoE ⁇ 4 The epsilon 4 allele of ApoE (ApoE ⁇ 4) is the first genetic risk factor for Alzheimer disease (AD), whereas inheritance of the rare epsilon 2 allele of ApoE (ApoE ⁇ 2) reduces this risk by about half.
- AD Alzheimer disease
- ApoE ⁇ 2 the rare epsilon 2 allele of ApoE
- AAV4 vectors coding for each ApoE isoform were injected into the ventricle of 7 month-old APP/PS mice.
- populations of amyloid deposits were tracked at baseline and after exposure to ApoE over a two-month interval, thus allowing a dynamic view of amyloidosis progression in a living animal.
- GFP and huApoE were immunodetected in APP/PS mice injected with AAV4 vectors. GFP signal could be observed into the entire ventricle area (upper panel) and in the cells lining the ventricle, as well as human APOE.
- AAV4- Venus control
- -ApoE2, -ApoE3 and -ApoE4 were injected in the ventricle of wild-type mice.
- human ApoE proteins could be detected in the cortical parenchyma around amyloid deposits (note the 3H1 antibody; only nonspecific background was observed in AAV4-GFP injected mice).
- a significant level of human ApoE was detected by ELISA in the brain, and immunohistological stainings for Venus and ApoE confirmed the expression of the different transgenes by the cells lining the ventricle.
- qRT-PCR experiments were performed in order to evaluate the mRNA levels of the transgene.
- a standard curve lowed us to determine the concentrations of huApoE mRNA according to the level of endogenous GAPDH.
- Samples from mice that were exposed for 2 or 5 months were included.
- An ELISA assay designed to specifically detect human APOE was performed on brain homogenates (Fig. 1A). Low levels of recombinant proteins could be detected in AAV4-APOE injected mice compared with AAV4-GFP treated animals, as quantified by ELISA specific for human APOE (Fig. IB) and confirmed by Western blot.
- a complete analysis of in vivo images shows that the number of amyloid deposits increases significantly more rapidly in AAV4-ApoE4 injected APP/PS mice compared with both AAV4-ApoE3 and AAV4- Venus treated animals.
- a small but significant decrease density of plaques is measured when AAV4-ApoE2 was used (Fig. 2).
- a trend toward bigger plaques is observed in APP/PS mice injected with AAV4- ApoE4 (p ⁇ 0.06), but overall the size of the plaques remains constant.
- the summarized data of in vivo imaging shows that overexpression of each APOE isoform differentially affect the progression of amyloid deposition in vivo. Injection of AAV4-ApoE2 leads to a slight decrease of amyloid density over times, whereas injection of AAV4-ApoE4 aggravates the amyloidosis.
- amyloid plaques vary according to each ApoE isoform.
- Each ApoE isform differentially affects synaptic density around amyloid deposits.
- Array tomography was used to precisely determine the density of pre- and postsynaptic elements around amyloid deposits. This new imaging method offers capabilities for high-resolution imaging of tissue molecular architecture.
- Array tomography is based on ultrathin sectioning of the specimen (70nm), immunostaining and 3D reconstruction. Representative images of array tomography samples stained for amyloid plaque and the post-synaptic maker PSD95.
- Array tomography images show that a decreased number of the post-synaptic marker PSD95 is observed around the amyloid deposits, but this effect is abolished far from plaques.
- CSF Cerebral Spinal Fluid
- ependymal cells cells that lie the ventricles in the brain
- CSF cerebral spinal fluid
- AAV4 adeno-associated virus
- a vector needed to be found that could transduce ependymal cells (cells that line the ventricles) in the brain of larger mammals. Studies were performed in a dog model of LINCL and a non-human primate model of LINCL. The LINCL dogs are normal at birth, but develop neurological signs around 7 months, testable cognitive deficits at ⁇ 5-6 months, seizures at 10-11 months, and progressive visual loss.
- AAV adeno-associated virus
- Recombinant AAV4 vectors encoding beta-glucuronidase were injected unilaterally into the lateral ventricle of MPS VII mice with established disease. Transduced ependyma expressed high levels of recombinant enzyme, with secreted enzyme penetrating cerebral and cerebellar structures, as well as the brainstem. Immunohistochemical studies revealed close association of recombinant enzyme and brain micro vasculature, indicating that beta-glucuronidase reached brain parenchyma via the perivascular spaces lining blood vessels. Aversive associative learning was tested by context fear conditioning. Compared with age-matched heterozygous controls, affected mice showed impaired conditioned fear response and context discrimination.
- rAAV2 was generated encoding TPPl (AAV2-CLN2), and injected intraventricularly to transduce ependyma (Liu et al, J Neuroscience, 25(41):9321-9327, 2005).
- TPPl is the enzyme deficient in LINCL.
- AAV2/1 i.e., AAV2 ITR and AAV1 capsid
- AAV2/2, AAV2/4, AAV2/5, and AAV2/8 AAV2/2 worked much better in the large mammals (dogs and NHP), followed by AAV2/8, AAV2/5, AAV2/1 and AAV2/4.
- ventricular lining cells can be a source of recombinant enzyme in CSF for distribution throughout the brain, and that AAV2/2 is an effective vehicle for administering therapeutic agents, such as the gene encoding CLN2
- AD Alzheimer's disease
- APOE ⁇ 4 ⁇ APOE - gene
- ApoE - protein a protein that influences the risk of AD.
- the presence of one APOE ⁇ 4 copy substantially increases the risk to develop the disease by a factor of 3 compared with the most common APOE ⁇ 3 allele, whereas two copies lead to a 12-fold increase.
- APOE ⁇ 2 has an opposite impact and is a protective factor, so that inheritance of this specific allele decreases the age- adjusted risk of AD by about a half compared to APOE3/3.
- the average age of onset of dementia also corresponds to these risk profiles, with APOE4/4 carriers having an onset in their mid-60's and APOE2/3 carriers in their early 90's, a shift of almost 3 decades, whereas APOE3/3 individuals have an age of onset in between - in the mid 1970's.
- AD Alzheimer's disease
- ⁇ containing senile plaques in the hippocampus and cortex of patients is believed to play a central role in AD, because all the known genes responsible for the rare autosomal dominant forms of the disease participate in the production of ⁇ peptides.
- APOE genotype was shown to strongly affect the extent of amyloid deposition in patients with AD as well as the amount of neurotoxic soluble oligomeric ⁇ detected in autopsy samples.
- ApoE isoforms have been suggested to differentially influence cerebrovascular integrity and affect the efflux of ⁇ peptides through the blood brain barrier, thus modulating the buildup of amyloid aggregates around blood vessels (cerebral amyloid angiopathy or CAA).
- ApoE has also been implicated directly in neurodegeneration and in neuronal plasticity. The effects of ApoE2 have been relatively understudied in these contexts.
- AD mice treated with ApoE4 show an enhanced amount of soluble ⁇ , a higher density of fibrillar plaques, an exacerbation of synaptic element loss and an increased number of neuritic dystrophies around each deposit, whereas a relative protective effect was observed with ApoE2.
- Intraventricular injection of AA V4-APOE leads to stable APOE expression and to sustained production of human ApoE in the brain
- Apolipoprotein E is a naturally secreted protein, produced mainly by astrocytes and microglial cells and can diffuse throughout the cerebral parenchyma. We took advantage of this property by injecting an AAV serotype 4 coding for GFP (control) or each APOE allele into the lateral cerebral ventricles of 7 month-old APP/PSl mice. Considering the large cerebral areas affected by the characteristic lesions of AD, this strategy offered a great advantage compared with multiple intraparenchymal injections.
- biological pump to deliver potentially therapeutic proteins to the brain.
- APP/PS1 mice were transduced with vectors expressing GFP or the various ApoE isoforms for 5 months before euthanasia.
- An analysis of the amyloid plaque load revealed that, after 5 months, a significant increase in the density of amyloid deposits was observed in the cortex of animals injected with the AAV4-APOE4 compared with those expressing APOE2. Plaque density in AAV4-GFP and AAV4-APOE3 treated mice were not different from one another at an intermediate level (Fig. 16A).
- APOE4 carriers are more susceptible to neurovascular dysfunction, and blood brain barrier breakdown was recently shown to be favored in APOE4 transgenic mice even in the absence of amyloid deposition.
- post-mortem staining with Prussian blue was performed. Despite the presence of few hemosiderin positive focal areas sparsely spread across the brain in all groups, no obvious differences were observed between any of the experimental groups of animals.
- ApoE isoforms modulates the kinetics of the progression of amyloidosis
- ApoE4 was associated with an increased density of amyloid deposits, whereas the opposite effect was observed with ApoE2 after 5 months. This could reflect changes in the rates of amyloid ⁇ deposition, clearance, or both.
- ApoE variants affect the dynamic progression of amyloidosis.
- Mice received an intraventricular injection with an AAV4 vectors at 7 months of age and a cranial window was implanted one week after injection in order to perform the first imaging session (TO). After 1 (Tl) and 2 month(s) (T2), amyloid deposits were imaged in the same fields of view. Mice were euthanized for post-mortem analysis after the second imaging session.
- the ApoE2 changes reflect a decrease from baseline, showing directly, and for the first time, non-immune mediated active clearance of plaques.
- these results demonstrate that induction of a modest increase of the amount of ApoE can affect the ongoing amyloidogenic process even after amyloid deposition has already started.
- Synapse loss is a parameter that correlates best with cognitive impairment.
- ApoE4 is associated with higher levels of synaptic oligomeric ⁇ in the brains of human AD patients and leads to significantly decreased synapse density around amyloid plaques compared to ApoE3 (R. M. Koffie et al. , Apolipoprotein E4 effects in
- Alzheimer's disease are mediated by synaptotoxic oligomeric amyloid-beta. Brain 135, 2155 (Jul, 2012); T. Hashimoto et al, Apolipoprotein E, Especially Apolipoprotein E4, Increases the Oligomerization of Amyloid beta Peptide. JNeurosci 32, 15181 (Oct 24, 2012)).
- ApoE4 failed to protect against ⁇ induced synapse loss (M. Buttini et al., Modulation of Alzheimer-like synaptic and cholinergic deficits in transgenic mice by human apolipoprotein E depends on isoform, aging, and overexpression of amyloid beta peptides but not on plaque formation.
- the densities of pre- and post-synaptic elements were determined using array tomography, a high-resolution technique based on immunofluorescence staining of ultrathin tissue sections (K. D. Micheva, S. J. Smith, Array tomography: a new tool for imaging the molecular architecture and ultrastructure of neural circuits. Neuron 55, 25 (Jul 5, 2007); R. M. Koffie et al, Oligomeric amyloid beta associates with postsynaptic densities and correlates with excitatory synapse loss near senile plaques. Proc Natl Acad Sci USA 106, 4012 (Mar 10, 2009)).
- 82E1/82E1 ELISA assay was significantly higher (by 42 ⁇ 7%) after injection of the AAV4- APOE4 compared with AAV4-APOE2 (Fig. 14), suggesting that the presence of ApoE may modulate the nature of amyloid aggregates in this extracellular compartment.
- the total ⁇ 40 and ⁇ 42 were assessed in the ISF, the same trends were observed but did not reach significance (Fig. 17 A), suggesting that the presence of different ApoE isoforms in the ISF influences the aggregation state of amyloid peptides somewhat more than the total amount.
- APOE3, or APOE4 led to increasing amyloid deposits in the same order as in AD patients, which was postulated to occur via an effect on plaque initiation or fibril formation.
- Alternative hypotheses focus on differential effects on neuritic outgrowth, or even propose that the effect of APOE genotype on Alzheimer disease phenotype is a consequence of another gene in genetic disequilibrium with APOE on chromosome 19.
- ApoE has variously been suggested as a mechanism to clear ⁇ from the brain or as a retention molecule that increases clearance half-life; our current results show that introduction of modest amounts of ApoE into the ISF is sufficient to enhance retention of ⁇ in the CNS, unless it is ApoE2. 4) The mechanisms of APOE2's remarkable protective action in AD have long been unclear, in part since ApoE2 binds ApoE receptors relatively poorly. Our current data suggest that ApoE2 has a gain of function - able to actually reverse established ⁇ deposits, as well as support synaptic and neuritic plasticity - in addition to a likely neutral or null effect on ⁇ clearance into the plasma.
- oligomeric ⁇ is elevated in the CNS of ApoE4 >ApoE3 human patients with AD (even when plaque burden is normalized across cases).
- ApoE, especially ApoE4 mediates formation of neurotoxic oligomeric ⁇ , we predicted that enhanced ApoE4 would lead to increased synaptic and neuritic alterations, as appears to be the case in the current data. Based on these results, caution should be exercised with regard to agents that would increase ApoE levels in the brain in patients with AD who have inherited the APOE4 allele.
- APP/PSl mouse model overexpresses a variant of the Presenilin 1 gene deleted for the exon 9 (driven by the same promoter).
- the concomitant overexpression of APPswe and PSEN1 in APP/PSl mice leads to a more severe phenotype, with substantial amyloid deposition visible as soon as 6 months of age.
- the Tg2576 mouse line is a much milder model that only develops amyloid plaques around one year of age.
- APOE-deficient mice (ApoE-KO, the Jackson Laboratory, Bar Harbor, Maine) were also used. Experiments were performed in accordance with NIH and institutional guidelines.
- APOE-2, -3 and -4 cDNA were generously provided by Dr. LaDu at the University of
- AAV serotype 4 vectors (AAV4-APOE2, AAV4-APOE3, AAV4-APOE4 and AAV4-GFP) were produced using the baculovirus system by the Gene Transfer Vector Core at the University of Iowa, Iowa City. Viruses were titered using quantitative PCR.
- Stereotactic Intraventricular injections Stereotactic Intraventricular injections. Stereotactic intraventricular injections of AAV serotype 4 vectors were performed as described previously (T. L. Spires et al ,
- micropipette attached to a 10- ⁇ 1 Hamilton syringe (Hamilton Medical, Reno, NV) at a rate of 0.25 ⁇ /minute.
- Hamilton syringe Hamilton Medical, Reno, NV
- Stereotactic coordinates of injection sites were calculated from bregma (anteroposterior +0.3 mm, mediolateral ⁇ 1mm and dorsoventral -2mm).
- mice were anesthesized with isoflurane (1.5%) and a cranial window was implanted by removing a piece of skull and replacing it with a glass coverslip of 8mm diameter (as described previously, T. L. Spires et al, Dendritic spine abnormalities in amyloid precursor protein transgenic mice demonstrated by gene transfer and intravital multiphoton microscopy. JNeurosci 25, 7278 (Aug 3, 2005)).
- a wax ring was built along the border of the window to create a well of water for the objective (20 ⁇ objective, numerical aperture of 0.95, Olympus).
- transgenic animals received an intraperitoneal injection of methoxy-X0 4 (5mg/kg) 24hrs prior to surgery, a fluorescent compound that crosses the blood-brain barrier and binds to amyloid deposits (B. J. Bacskai, W. E. Klunk, C. A. Mathis, B. T. Hyman, Imaging amyloid- beta deposits in vivo. JCereb Blood Flow Metab 22, 1035 (Sep, 2002)).
- Texas Red dextran (70,000 Da molecular weight; 12.5 mg/ml in sterile PBS; Molecular Probes, Eugene, OR) was injected into a lateral tail vein to provide a fluorescent angiogram, so that the shape of the vasculature would be used as a landmark to follow the exact same fields of view over time. Mice were imaged one week after AAV injection in order to evaluate the baseline level of amyloid deposits, then one and two month(s) after injection.
- In vivo microdialysis sampling In vivo microdialysis sampling of brain interstitial ⁇ and ApoE was performed on Tg2576 mice, 3 months after intracerebroventricular injection of each AAV4 (S. Takeda et al, Novel microdialysis method to assess neuropeptides and large molecules in free-moving mouse. Neuroscience 186, 110 (Jul 14, 2011)).
- the microdialysis probe had a 4 mm shaft with a 3.0 mm, 1000 kDa molecular weight cutoff (MWCO) polyethylene (PE) membrane (PEP-4-03, Eicom, Kyoto, Japan).
- MWCO molecular weight cutoff
- the probe was conditioned by briefly dipping it in ethanol, and then washed with artificial cerebrospinal fluid (aCSF) perfusion buffer (in niM: 122 NaCl, 1.3 CaC12, 1.2 MgC12, 3.0 KH2P04, 25.0 NaHC03) that was filtered through a 0.2- ⁇ pore size membrane.
- aCSF cerebrospinal fluid
- the preconditioned probe's outlet and inlet were connected to a peristaltic pump (ERP-10, Eicom, Kyoto, Japan) and a microsyringe pump (ESP-32, Eicom, Kyoto, Japan), respectively, using fluorinated ethylene propylene (FEP) tubing ( ⁇ 250 ⁇ i.d.).
- Probe implantation was performed as previously described (S. Takeda et al, Novel microdialysis method to assess neuropeptides and large molecules in free-moving mouse. Neuroscience 186, 110 (Jul 14, 2011; J. R. Cirrito et al, In vivo assessment of brain interstitial fluid with microdialysis reveals plaque-associated changes in amyloid-beta metabolism and half-life. JNeurosci 23, 8844 (Oct 1, 2003)), with slight modifications.
- anesthetized animals (1.5% isoflurane) were stereotactically implanted whit a guide cannula (PEG-4, Eicom, Kyoto, Japan) in the hippocampus (bregma -3.1 mm, -2.5 mm lateral to midline, -1.2 mm ventral to dura).
- the guide was then fixed to the skull using binary dental cement.
- mice Four days after guide cannula implantation, the mice were placed in a standard microdialysis cage and a probe was inserted through the guide. After insertion of the probe, in order to obtain stable recordings, the probe and connecting tubes were perfused with aCSF for 240 min at a flow rate of 10 ⁇ /min before sample collection. Samples were collected a flow rate of 0.25 (for ⁇ quantification) and 0.1 ⁇ /min (for ApoE detection). Samples were stored at 4°C in polypropylene tubes.
- mice were awake and free-moving in the microdialysis cage designed to allow unrestricted movement of the animals without applying pressure on the probe assembly (AtmosLM microdialysis system, Eicom, Kyoto, Japan).
- APP/PS1 mice were euthanized by C0 2 inhalation 2 or 5 months after intraventricular injection (short and long term exposure), whereas Tg2576 animals were sacrificed after 3 months.
- One entire cerebral hemisphere was fixed in 4% paraformaldehyde in phosphate buffer saline for immunohistological analysis and embedded in paraffin wax.
- a 1mm coronal section through the frontal cortex was processed for the array tomography assay, whereas the rest of the hemibrain was snap frozen to perform biochemical and biomolecular analyses.
- paraffin-embedded sections were sequentially deparaffinized in xylene, rehydrated in ethanol, treated in citrate buffer (lOmM Sodium Citrate, 0.05% Tween 20, pH 6.0), permeabilized in PBS with 0.5% Triton and blocked in PBS with 3% BSA for 2 hours at room temperature.
- Incubation with primary antibodies was done overnight at 4°C: BamlO (SIGMA 1 :1000) and R1282 (1 :500, provided by Dr Dennis Selkoe) for amyloid plaques, mouse monoclonal antibody 3H1 (Ottawa Heart Institute) for human ApoE, Chicken anti-GFP (1 :500, Aves) and SMI-312 (Covance) for neuritic dystrophies.
- Incubation with the secondary antibody was done for 2hrs at room temperature the next day.
- Amyloid dense core plaques were labeled by incubating the slices for 8 minutes in a solution of Thio-S (Sigma, St Louis, MO) 0.05% in 50% ethanol before mounting.
- the concentrations of ⁇ 40 and ⁇ 42 in the TBS soluble fraction, formic acid fraction as well as in the microdialysate were determined by BNT-77/BA-27 (for ⁇ 40 ) and BNT- 77/BC-05 (for ⁇ 42 ) sandwich ELISA (Wako Pure Chemical Industries, Osaka, Japan), according to the manufacturer's instructions.
- the amount of oligomer ⁇ in the sample was determined by 82E1/82E1 sandwich ELISA (Immuno-Biological Laboratories, Inc,
- RNA from brain samples were extracted using TRIzol® Reagent (Life technologies; 15596-026) and cDNA were then synthesized according to the Superscript® III One-Step RT-PCR System (Life technologies; 12574-018) manufacturer instructions.
- PCR primers were specifically designed to amplify the recombinant human APOE mRNA and the endogenous Apoe and Gapdh mRNAs ⁇ Apoe Forward: 5 ' - AGCTCCC AAGTC AC AC AAGA ; Apoe Reverse : 5'- GTTGCGTAGATCCTCCATGT ; APOE Forward: 5'-
- CCAGCGACAATCACTGAAC CCAGCGACAATCACTGAAC ; APOE Reverse : 5'- GCGCGTAATACGACTCACTA; Gapdh Forward: 5'- ATGACATCAAGAAGGTGGTG and Gapdh Reverse: 5'- CATACCAGGAAATGAGCTTG).
- APOE proteins Briefly, ELISA plates were coated overnight with 1.5ug/ml of Goat anti- APOE antibody (to detect Murine APOE) or 1.5ug/ml WUE4 antibody (to detect Human APOE) and blocked with 1% non-fat milk diluted in PBS for 1.5h at 37°C. Human
- recombinant apoE proteins were used as standards (for human-specific assay, Biovision) or in-house mouse standards from brain extract (for the murine specific assay) and samples were diluted in ELISA buffer (0.5% BSA and 0.025% Tween-20 in PBS) and incubated overnight. After washing, detection antibodies specific for human (goat-apoe Millipore; 1 : 10,000) or mouse (Abeam ab20874 ; 1 :2,000) were respectively used, followed by 1.5h incubation with an appropriate HRP-conjugated secondary. Revelation of the signal was done using the TMB substrate before stopping the solution using H3PO4. The colorimetric results were measured at 450nm.
- imaging data of amyloid progression were analyzed using a mixed effects model, with a random effect for mouse, and fixed effects for vector, time and baseline volumetric density. An interaction between time and vector was considered in this analysis, but was not
- AD Alzheimer's disease
- APOE ⁇ 4 apolipoprotein E ⁇ 4 allele
- the presence of one APOE ⁇ 4 copy substantially increases the risk of developing the disease by a factor of 3 compared with the most common APOE ⁇ 3 allele, whereas two copies lead to a 12-fold increase.
- APOE ⁇ 2 has an opposite impact and decreases the age-adjusted risk of AD by about a half.
- the average age of onset of dementia corresponds to these risk profiles, with APOE4/4 carriers having an onset in their mid 60s and APOE2/3 carriers in their early 90s, a shift of almost 3 decades, whereas APOE3/3 individuals have an age of onset in between - in the mid 70s.
- APOE variants have also been suggested to modify the amount of neurotoxic soluble oligomeric ⁇ , and to differentially influence cerebrovascular integrity and ⁇ efflux through the blood brain barrier. Finally, APOE has been implicated directly in neurodegeneration and in synaptic integrity. How APOE2, which is protective against AD, influences these processes is unknown.
- AAV adeno-associated viral vectors
- GFP green fluorescent protein
- Intraventricular injection of AA V4-APOE leads to sustained production of human APOE in the brain
- APOE is a naturally secreted protein, produced mainly by astrocytes and microglial cells, which can diffuse throughout the cerebral parenchyma.
- this strategy might offer an advantage compared with multiple intraparenchymal injections.
- human protein remained readily detectable, suggesting that AAV4- mediated transduction provided a platform for sustained production of the secreted protein throughout the parenchyma. Indeed, human APOE protein was present around amyloid deposits throughout the cortical mantle, where APOE protein is known to accumulate.
- mice expressing APOE4 ⁇ 40 :1733 ⁇ 338 pMol/mg of protein and ⁇ 42 :8720 ⁇ 1155 pMol/mg of protein
- mice expressing APOE4 ⁇ 40 :1733 ⁇ 338 pMol/mg of protein and ⁇ 42 :8720 ⁇ 1155 pMol/mg of protein
- APOE2 ⁇ 40 : 468 ⁇ 105 pMol/mg of protein and ⁇ 42 : 5156+1318 pMol/mg of protein, p ⁇ 0.05.
- APOE4 ⁇ 40 :1733 ⁇ 338 pMol/mg of protein and ⁇ 42 :8720 ⁇ 1155 pMol/mg of protein
- APOE2 ⁇ 40 : 468 ⁇ 105 pMol/mg of protein and ⁇ 42 : 5156+1318 pMol/mg of protein, p ⁇ 0.05.
- Tris Buffer Saline (TBS)-soluble fraction The content of ⁇ peptides in the Tris Buffer Saline (TBS)-soluble fraction was similarly affected and higher concentrations of both soluble ⁇ 40 and ⁇ 42 were measured after APOE4 exposure ( ⁇ 40 :94 ⁇ 18 pMol/mg of protein and ⁇ 42 :12.9 ⁇ 1.5 pMol/mg of protein) compared with APOE2 ( ⁇ 40 :20 ⁇ 8 pMol/mg of protein and ⁇ 42 :2.3 ⁇ 0.8 pMol/mg of protein, p ⁇ 0.05. Fig. 19C).
- APOE affects the blood brain barrier (BBB) and alters efflux of ⁇ peptides.
- BBB blood brain barrier
- AAV4-APOE3 or AAV4-APOE4 was lower compared with AAV4-APOE2 and AAV4-G (AAV4-GEP:1167 ⁇ 213; AAV4-APOE2: ⁇ 247 ⁇ 60; AAV4-APOE3:736 ⁇ 78 and AAV4-APOE4 799 ⁇ 67 pMol/ml of plasma; p ⁇ 0.05.
- Fig. 19D suggesting that APOE3 and APOE4 helped to retain ⁇ in the CNS, consistent with the relative increased ⁇ brain concentrations and with previous data reporting a longer CNS half-life of ⁇ due to APOE.
- APOE4 carriers are more susceptible to neurovascular dysfunction, and BBB breakdown was shown to be favored in APOE4 transgenic mice, even in the absence of amyloid deposition.
- post-mortem staining with Prussian blue was performed. Despite the presence of a few hemosiderin positive focal areas, no effect was observed among any of the experimental groups.
- mice received an intraventricular injection of AAV4 carrying GFP or each APOE variant at 7 months of age and a cranial window was implanted one week thereafter (TO). After 1 month (Tl) or 2 months (T2), amyloid deposits were imaged, following the exact same cortical areas in the brain over time.
- amyloid deposits remained stable, although new plaques could occasionally be detected in the small viewing volume. However, on rare occasion, a methoxy- positive plaque that was imaged at the beginning could not be detected after one or two months, suggesting that some plaques could be cleared.
- the densities of pre- and post-synaptic elements were determined using array tomography, a high-resolution technique based on immunofluorescence staining of ultrathin tissue sections (K. D. Micheva, S. J. Smith, Array tomography: a new tool for imaging the molecular architecture and ultrastructure of neural circuits. Neuron 55, 25 (Jul 5, 2007); . M. Koffie et al. , Oligomeric amyloid beta associates with postsynaptic densities and correlates with excitatory synapse loss near senile plaques. Proc Natl Acad Sci USA 106, 4012 (Mar 10, 2009)).
- amyloid oligomeric species were shown to be highly concentrated in the vicinity of amyloid deposits, synapsin-1 and PSD95 puncta were quantified either far (> 50 ⁇ ) or close ( ⁇ 50 ⁇ ) to plaques. Loss of pre-synaptic elements near plaques was exacerbated when either APOE3 or APOE4 was expressed, which was not the case after injection of AAV4-APOE2 or AAV4-GFP (Fig. 22A).
- Human APOE proteins modify the amount of oligomeric ⁇ species in the interstitial fluid in Tg2576 mice
- Tg2576 mice present a much milder phenotype than APP/PSl mice of the same age.
- APOE binds to ⁇ and has been implicated in ⁇ clearance, but studies in Apoe knockout mice surprisingly show that ⁇ deposits are substantially lower in the absence of Apoe.
- Replacement of endogenous murine Apoe with human APOE2, APOE3, or APOE4 modifies amyloid deposits in the same order as in AD patients, presumably through effects on plaque initiation or fibril formation.
- Alternative hypotheses focus on differential effects on neuritic outgrowth, or the proposal that the effect of APOE genotype on AD phenotype is a consequence of another gene in genetic disequilibrium with APOE on chromosome 19.
- APOE has variously been suggested as a mechanism to clear ⁇ from the brain or as a retention molecule that decreases clearance half life; our current results show that introduction of modest amounts of APOE3/4 into the ISF is sufficient to enhance retention of ⁇ in the CNS.
- the mechanism of APOE2's remarkable protective action in AD have long been unclear, in part because APOE2 binds to APOE receptors relatively poorly.
- APPswe/PS 1 dE9 (APP/PS 1 ) (D. R. Borchelt et al. , Accelerated amyloid deposition in the brains of transgenic mice coexpressing mutant presenilin 1 and amyloid precursor proteins. Neuron 19, 939 (Oct, 1997)) (Jackson laboratory) and Tg2576 (K. Hsiao et al, Correlative memory deficits, Abeta elevation, and amyloid plaques in transgenic mice. Science 274, 99 (Oct 4, 1996)) mice express a human mutant amyloid precursor protein gene containing the Swedish mutation K594N/M595L, under the control of the prion promoter.
- the APP/PS 1 model also overexpresses the Presenilin 1 gene deleted for the exon 9, which leads to a severe phenotype with amyloid deposition at 6 months of age.
- the Tg2576 line is a milder model that develops amyloid plaques around one year of age.
- APOE-deficient mice the Jackson
- APOE-2, -3 and -4 cDNA were amplified by PCR, digested by BamHI and inserted into an AAV2-pCMV- hrGFP backbone.
- AAV serotype 4 vectors were produced by the Gene Transfer Vector Core at the University of Iowa, Iowa City. The AAV viral titers were determined by quantitative PCR.
- AAV intraventricular injections were performed as described previously (G. Liu, I. H. Martins, J. A. Chiorini, B. L. Davidson, Adeno-associated virus type 4 (AAV4) targets ependyma and astrocytes in the subventricular zone and RMS. Gene Ther 12, 1503 (Oct, 2005); T. L. Spires et al. , Dendritic spine abnormalities in amyloid precursor protein transgenic mice demonstrated by gene transfer and intravital multiphoton microscopy. JNeurosci 25, 7278 (Aug 3, 2005)).
- Animals were anesthetized (ketamine/xylazine: lOOmg/kg and 50mg/kg body weight, respectively) and positioned on a stereotactic frame (David Kopf Instruments). Injections were performed in each lateral ventricle with 5 ⁇ 1 of viral preparation (titer 2x 10 vg/ml) using a 33- gauge needle attached to a 10- ⁇ 1 Hamilton syringe (Hamilton Medical), at 0.25 ⁇ /minute.
- Stereotactic coordinates were calculated from bregma (anteroposterior +0.3 mm, mediolateral ⁇ lmm and dorso ventral -2mm).
- mice were anesthesized with isoflurane (1.5%) and a cranial window was implanted by replacing a piece of skull by a 5mm glass coverslip (T. L. Spires et al. , Dendritic spine abnormalities in amyloid precursor protein transgenic mice demonstrated by gene transfer and intravital multiphoton microscopy. JNeurosci 25, 7278 (Aug 3, 2005)).
- a wax ring was built to create a well of water for the objective (20x, numerical aperture of 0.95, Olympus).
- Amyloid deposits were visualized after intraperitoneal injection of methoxy-X0 4 (5mg/kg) 24hrs before surgery, a fluorescent compound that crosses the BBB and binds to plaques (B. J.
- Plaque density was quantified using Image J by reporting the number of amyloid deposits per volume of cortex imaged. We considered the cortical volume starting from the first slice of the z-stack at the surface to the last slice where an amyloid deposit could be detected.
- the size of amyloid deposits was evaluated over time by measuring their cross-sectional area from the maximal intensity after two-dimensional projection. For each plaque, the ratio of the area between the initial time point and the first month (T1/T0), or between the second and first months (T2/T1), was calculated.
- the settings of the multiphoton microscope (laser power and PMTs) were maintained throughout the imaging sessions.
- the microdialysis probe had a 4 mm shaft with a 3.0 mm, 1000 kDa molecular weight cutoff (MWCO)
- PE membrane polyethylene (PEP-4-03, Eicom).
- aCSF artificial cerebrospinal fluid
- the preconditioned probe's outlet and inlet were connected to a peristaltic pump (ERP-10, Eicom) and a microsyringe pump (ESP-32, Eicom, Kyoto, Japan), respectively, using fluorinated ethylene propylene (FEP) tubing ( ⁇ 250 ⁇ i.d.).
- EEP fluorinated ethylene propylene
- Probe implantation was performed as previously described (S. Takeda et al, Novel microdialysis method to assess neuropeptides and large molecules in free-moving mouse.
- mice Four days after surgery, the mice were placed in a microdialysis cage and a probe was inserted through the guide. The probe was perfused with aCSF for 240 min at a flow rate of 10 ⁇ /min before sample collection. Samples were collected at a flow rate of 0.25 (for ⁇ ) and 0.1 ⁇ /min (for ApoE). Mice were awake and free-moving in the microdialysis cage (AtmosLM microdialysis system, Eicom).
- mice were euthanized by C0 2 inhalation.
- One cerebral hemisphere was fixed in 4% paraformaldehyde in PBS and embedded in paraffin wax.
- a 1mm 3 piece of cortex was processed for array tomography, whereas the rest was snap frozen.
- Paraffin-embedded sections ( ⁇ ) were deparaffinized in xylene, rehydrated in ethanol, treated in citrate buffer (lOmM Sodium Citrate, 0.05% Tween 20, pH 6.0), permeabilized in PBS with 0.5% Triton and blocked in PBS with 3% BSA for 2 hours. Incubation with primary antibodies was done overnight at 4°C:
- BamlO (1:1000, SIGMA) and R1282 (1 :500, provided by Dr Dennis Selkoe) for amyloid plaques mouse monoclonal antibody 3H1 (1 :250, Ottawa Heart Institute) for human APOE, Chicken anti-GFP (1 :500, Aves), SMI-312 (1 :500, Covance) for neuritic dystrophies, IBA1 (1 :500, Wako) and GFAP (1 : 1000, SIGMA) respectively for microglial cells and astrocytes. Incubation with the secondary antibody was done for 2hrs. Amyloid dense core plaques were labeled by Thio-S (Sigma-Aldrich) 0.05% in 50% ethanol before mounting.
- ⁇ 40 and ⁇ 42 were determined by BNT-77/BA-27 (for ⁇ 40 ) and BNT-77/BC-05 (for ⁇ 42 ) sandwich ELISA (Wako), according to the manufacturer's instructions.
- ⁇ oligomers were quantified using the 82E1/82E1 sandwich ELISA (Immuno- Biological Laboratories), in which the same N-terminal (residues 1-16) antibodies were used for both capture and detection (W. Xia et al, A specific enzyme-linked immunosorbent assay for measuring beta-amyloid protein oligomers in human plasma and brain tissue of patients with Alzheimer disease. Arch Neurol 66, 190 (Feb, 2009)).
- APP proteolytic products sAPP: 22C11, 1 :4000, Millipore and C83/C99: APP Cter, 1 :4000, Sigma
- IDE Insulin degrading enzyme
- Incubation with HRP-conjugated goat IgG antibodies was done for 2 hours. Immunoreactive proteins were developed using ECL kit (Western Lightning, PerkinElmer) and detected on Hyperfilm ECL (GE healthcare).
- RNA from brain were extracted using TRIzol® Reagent (Life technologies; 15596- 026) and cDNA were then synthesized using the Superscript® III One-Step RT-PCR System (Life technologies; 12574-018).
- PCR primers were designed to amplify human APOE mRNA, endogenous apoE and Gapdh mRNAs (Apoe Forward: 5 '- AGCTCCC AAGTC AC AC AAGA ; Apoe Reverse : 5 ' - GTTGCGTAGATCCTCCATGT ; APOE Forward: 5 ' - CCAGCGACAATCACTGAAC ; APOE Reverse : 5 ' - GCGCGTAATACGACTCACTA; Gapdh Forward: 5 ' - ATGACATCAAGAAGGTGGTG and Gapdh Reverse: 5 ' - C AT ACC AGG AAATG AGCTTG) .
- ELISA plates were coated overnight with 1.5ug/ml of Goat anti- APOE antibody (Murine APOE) or 1.5ug/ml WUE4 antibody (Human APOE) and blocked with 1% milk in PBS for 1.5h.
- Human recombinant ApoE was used as standards (human assay, Biovision) or in-house mouse standards from brain extract (murine assay) and samples were incubated overnight in ELISA buffer (0.5% BSA and 0.025% Tween-20 in PBS).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Biochemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Genetics & Genomics (AREA)
- Epidemiology (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Toxicology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Biophysics (AREA)
- Marine Sciences & Fisheries (AREA)
- Tropical Medicine & Parasitology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| MX2016006584A MX2016006584A (es) | 2013-11-20 | 2014-11-20 | Métodos y composiciones para tratar los depósitos de amiloide. |
| ES14863892T ES2874704T3 (es) | 2013-11-20 | 2014-11-20 | Procedimiento para monitorizar la eficacia de un tratamiento de la enfermedad de Alzheimer con una isoforma de ApoE |
| AU2014352944A AU2014352944A1 (en) | 2013-11-20 | 2014-11-20 | Methods and compositions for treating amyloid deposits |
| JP2016532124A JP6592435B2 (ja) | 2013-11-20 | 2014-11-20 | アミロイド沈着を処置するための方法および組成物 |
| US15/038,367 US20170336395A1 (en) | 2013-11-20 | 2014-11-20 | Methods and compositions for treating amyloid deposits |
| BR112016011258-0A BR112016011258B1 (pt) | 2013-11-20 | 2014-11-20 | Métodos e composiçôes para o tratamento de depósitos de amiloide |
| IL245703A IL245703B (en) | 2013-11-20 | 2014-11-20 | Methods and compositions for treating amyloid deposits |
| KR1020167016073A KR20160079891A (ko) | 2013-11-20 | 2014-11-20 | 아밀로이드 침착의 치료를 위한 방법 및 조성물 |
| EP14863892.7A EP3071240B1 (en) | 2013-11-20 | 2014-11-20 | Method for monitoring efficacy of treatment of alzheimer's disease with an apoe isoform |
| CA2931220A CA2931220A1 (en) | 2013-11-20 | 2014-11-20 | Methods and compositions for treating amyloid deposits |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361906811P | 2013-11-20 | 2013-11-20 | |
| US61/906,811 | 2013-11-20 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015077473A1 true WO2015077473A1 (en) | 2015-05-28 |
Family
ID=53180142
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/066658 Ceased WO2015077473A1 (en) | 2013-11-20 | 2014-11-20 | Methods and compositions for treating amyloid deposits |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US20170336395A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP3071240B1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP6592435B2 (cg-RX-API-DMAC7.html) |
| KR (1) | KR20160079891A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2014352944A1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2931220A1 (cg-RX-API-DMAC7.html) |
| ES (1) | ES2874704T3 (cg-RX-API-DMAC7.html) |
| IL (1) | IL245703B (cg-RX-API-DMAC7.html) |
| MX (1) | MX2016006584A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2015077473A1 (cg-RX-API-DMAC7.html) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110121356A (zh) * | 2016-09-02 | 2019-08-13 | 星火治疗股份有限公司 | 治疗cns疾病的方法和载体 |
| JP2019537576A (ja) * | 2016-11-04 | 2019-12-26 | ザ・チルドレンズ・ホスピタル・オブ・フィラデルフィアThe Children’S Hospital Of Philadelphia | 神経変性疾患を処置するための遺伝子移入用組成物、遺伝子導入法、及び遺伝子導入の使用 |
| WO2021076941A1 (en) * | 2019-10-16 | 2021-04-22 | Cornell University | Gene therapy for alzheimer's disease |
| RU2805606C2 (ru) * | 2016-11-04 | 2023-10-20 | Дзе Чилдрен'З Хоспитал Оф Филадельфия | Композиции, способы и применения переноса генов для лечения нейродегенеративных заболеваний |
| US12611467B2 (en) | 2019-11-25 | 2026-04-28 | Cornell University | APOE gene therapy |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP7616995B2 (ja) * | 2018-11-28 | 2025-01-17 | プリベイル セラピューティクス,インコーポレーテッド | 神経変性疾患のための遺伝子治療 |
| WO2021026495A1 (en) * | 2019-08-07 | 2021-02-11 | Texas Tech University System | Ad36e40rf1: a therapeutic treatment for alzheimer's disease |
Citations (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3817837A (en) | 1971-05-14 | 1974-06-18 | Syva Corp | Enzyme amplification assay |
| US3850752A (en) | 1970-11-10 | 1974-11-26 | Akzona Inc | Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically |
| US3939350A (en) | 1974-04-29 | 1976-02-17 | Board Of Trustees Of The Leland Stanford Junior University | Fluorescent immunoassay employing total reflection for activation |
| US3996345A (en) | 1974-08-12 | 1976-12-07 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
| US4275149A (en) | 1978-11-24 | 1981-06-23 | Syva Company | Macromolecular environment control in specific receptor assays |
| US4277437A (en) | 1978-04-05 | 1981-07-07 | Syva Company | Kit for carrying out chemically induced fluorescence immunoassay |
| US4366241A (en) | 1980-08-07 | 1982-12-28 | Syva Company | Concentrating zone method in heterogeneous immunoassays |
| US6468524B1 (en) | 2000-03-22 | 2002-10-22 | The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services | AAV4 vector and uses thereof |
| US6855314B1 (en) | 2000-03-22 | 2005-02-15 | The United States Of America As Represented By The Department Of Health And Human Services | AAV5 vector for transducing brain cells and lung cells |
| WO2007022015A1 (en) * | 2005-08-12 | 2007-02-22 | Georgetown University | Methods to evaluate amyloid beta-lowering agents using wild-type mice |
| WO2012135857A1 (en) * | 2011-03-31 | 2012-10-04 | University Of Iowa Research Foundation | Methods and compositions for treating brain diseases |
| WO2012140296A1 (es) * | 2011-04-12 | 2012-10-18 | Araclon Biotech, S.L. | Anticuerpo, kit y metodo para la determinacion de peptidos amiloides |
| US20130052670A1 (en) * | 2011-07-13 | 2013-02-28 | Merck | Method for detection of amyloid beta oligomers in a fluid sample and uses thereof |
| US20130115716A1 (en) * | 2010-05-24 | 2013-05-09 | The Washington University | Methods of determining amyloid beta turnover in blood |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3002156A (en) * | 1961-09-26 | pumped solid state maser | ||
| PT1416965E (pt) * | 2001-08-17 | 2008-04-01 | Lilly Co Eli | Método de ensaio para a doença de alzheimer |
| WO2004108922A2 (en) * | 2003-04-25 | 2004-12-16 | The Trustees Of The University Of Pennsylvania | Use of aav comprising a capsid protein from aav7 or aav8 for the delivery of genes encoding apoprotein a or e genes to the liver |
| EP1865326B1 (en) * | 2006-06-08 | 2011-09-07 | FU Berlin | Assay for the diagnosis of Alzheimer's Disease based on the determination of the ratio of secretase Aß cleavage products |
| US20080234377A1 (en) * | 2007-03-23 | 2008-09-25 | Martek Biosciences Corporation | Polyunsaturated fatty acids for treatment of dementia and pre-dementia-related conditions |
-
2014
- 2014-11-20 IL IL245703A patent/IL245703B/en unknown
- 2014-11-20 AU AU2014352944A patent/AU2014352944A1/en not_active Abandoned
- 2014-11-20 CA CA2931220A patent/CA2931220A1/en not_active Abandoned
- 2014-11-20 WO PCT/US2014/066658 patent/WO2015077473A1/en not_active Ceased
- 2014-11-20 JP JP2016532124A patent/JP6592435B2/ja active Active
- 2014-11-20 EP EP14863892.7A patent/EP3071240B1/en active Active
- 2014-11-20 KR KR1020167016073A patent/KR20160079891A/ko not_active Ceased
- 2014-11-20 US US15/038,367 patent/US20170336395A1/en not_active Abandoned
- 2014-11-20 ES ES14863892T patent/ES2874704T3/es active Active
- 2014-11-20 MX MX2016006584A patent/MX2016006584A/es unknown
Patent Citations (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3850752A (en) | 1970-11-10 | 1974-11-26 | Akzona Inc | Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically |
| US3817837A (en) | 1971-05-14 | 1974-06-18 | Syva Corp | Enzyme amplification assay |
| US3939350A (en) | 1974-04-29 | 1976-02-17 | Board Of Trustees Of The Leland Stanford Junior University | Fluorescent immunoassay employing total reflection for activation |
| US3996345A (en) | 1974-08-12 | 1976-12-07 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
| US4277437A (en) | 1978-04-05 | 1981-07-07 | Syva Company | Kit for carrying out chemically induced fluorescence immunoassay |
| US4275149A (en) | 1978-11-24 | 1981-06-23 | Syva Company | Macromolecular environment control in specific receptor assays |
| US4366241A (en) | 1980-08-07 | 1982-12-28 | Syva Company | Concentrating zone method in heterogeneous immunoassays |
| US4366241B1 (cg-RX-API-DMAC7.html) | 1980-08-07 | 1988-10-18 | ||
| US6468524B1 (en) | 2000-03-22 | 2002-10-22 | The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services | AAV4 vector and uses thereof |
| US6855314B1 (en) | 2000-03-22 | 2005-02-15 | The United States Of America As Represented By The Department Of Health And Human Services | AAV5 vector for transducing brain cells and lung cells |
| WO2007022015A1 (en) * | 2005-08-12 | 2007-02-22 | Georgetown University | Methods to evaluate amyloid beta-lowering agents using wild-type mice |
| US20130115716A1 (en) * | 2010-05-24 | 2013-05-09 | The Washington University | Methods of determining amyloid beta turnover in blood |
| WO2012135857A1 (en) * | 2011-03-31 | 2012-10-04 | University Of Iowa Research Foundation | Methods and compositions for treating brain diseases |
| WO2012140296A1 (es) * | 2011-04-12 | 2012-10-18 | Araclon Biotech, S.L. | Anticuerpo, kit y metodo para la determinacion de peptidos amiloides |
| US20130052670A1 (en) * | 2011-07-13 | 2013-02-28 | Merck | Method for detection of amyloid beta oligomers in a fluid sample and uses thereof |
Non-Patent Citations (28)
| Title |
|---|
| "Remington's Pharmaceutical Sciences", 1991, MACK PUB. CO. |
| A. SEN; D. L. ALKON; T. J. NELSON: "Apolipoprotein E3 (ApoE3) but not ApoE4 protects against synaptic loss through increased expression of protein kinase C epsilon", J BIOL CHEM, vol. 287, 4 May 2012 (2012-05-04), pages 15947, XP002759927, DOI: doi:10.1074/jbc.M111.312710 |
| B. J. BACSKAI; W. E. KLUNK; C. A. MATHIS; B. T. HYMAN: "Imaging amyloid-beta deposits in vivo", J CEREB BLOOD FLOW METAB, vol. 22, September 2002 (2002-09-01), pages 1035, XP008031462, DOI: doi:10.1097/00004647-200209000-00001 |
| C. BACHMEIER; D. BEAULIEU-ABDELAHAD; F. CRAWFORD; M. MULLAN; D. PARIS: "Stimulation of the retinoid x receptor facilitates Beta-amyloid clearance across the blood-brain barrier", JMOL NEUROSCI, vol. 49, February 2012 (2012-02-01), pages 270 |
| CASELLANO ET AL., SCI TRANSL MED, vol. 3, no. 89, 29 June 2011 (2011-06-29), pages 89ra57 |
| D. R. BORCHELT ET AL.: "Accelerated amyloid deposition in the brains of transgenic mice coexpressing mutant presenilin 1 and amyloid precursor proteins", NEURON, vol. 19, October 1997 (1997-10-01), pages 939, XP000978986, DOI: doi:10.1016/S0896-6273(00)80974-5 |
| DAVIDSON ET AL., PNAS, vol. 28, 2000, pages 3428 - 3432 |
| DODART ET AL., PNAS, vol. 102, no. 4, 2005, pages 1211 - 1216 |
| E. B. LEE ET AL.: "Targeting amyloid-beta peptide (Abeta) oligomers by passive immunization with a conformation-selective monoclonal antibody improves learning and memory in Abeta precursor protein (APP) transgenic mice", JBIOL CHEM, vol. 281, 17 February 2006 (2006-02-17), pages 4292, XP003013340, DOI: doi:10.1074/jbc.M511018200 |
| G. LIU; I. H. MARTINS; J. A. CHIORINI; B. L. DAVIDSON: "Adeno-associated virus type 4 (AAV4) targets ependyma and astrocytes in the subventricular zone and RMS", GENE THER, vol. 12, October 2005 (2005-10-01), pages 1503, XP055452701, DOI: doi:10.1038/sj.gt.3302554 |
| G. LIU; I. MARTINS; J. A. WEMMIE; J. A. CHIORINI; B. L. DAVIDSON: "Functional correction of CNS phenotypes in a lysosomal storage disease model using adeno-associated virus type 4 vectors", JNEUROSCI, vol. 25, 12 October 2005 (2005-10-12), pages 9321, XP002632175, DOI: doi:10.1523/JNEUROSCI.2936-05.2005 |
| GOVINDASAMY ET AL.: "Structurally Mapping the Diverse Phenotype of Adeno-Associated Virus Serotype 4", J. VIR., vol. 80, no. 23, 2006, pages 11556 - 11570 |
| J. R. CIRRITO ET AL.: "In vivo assessment of brain interstitial fluid with microdialysis reveals plaque-associated changes in amyloid-beta metabolism and half-life", JNEUROSCI, vol. 23, 1 October 2003 (2003-10-01), pages 8844 |
| K. D. MICHEVA; S. J. SMITH: "Array tomography: a new tool for imaging the molecular architecture and ultrastructure of neural circuits", NEURON, vol. 55, 5 July 2007 (2007-07-05), pages 25 |
| K. HSIAO ET AL.: "Correlative memory deficits, Abeta elevation, and amyloid plaques in transgenic mice", SCIENCE, vol. 274, 4 October 1996 (1996-10-04), pages 99, XP055017958, DOI: doi:10.1126/science.274.5284.99 |
| LIU ET AL., J. NEUROSCIENCE, vol. 25, no. 41, 2005, pages 9321 - 9327 |
| M. BUTTINI ET AL.: "Modulation of Alzheimer-like synaptic and cholinergic deficits in transgenic mice by human apolipoprotein E depends on isoform, aging, and overexpression of amyloid beta peptides but not on plaque formation", J NEUROSCI, vol. 22, 15 December 2002 (2002-12-15), pages 10539 |
| P. E. CRAMER ET AL.: "ApoE-directed therapeutics rapidly clear beta-amyloid and reverse deficits in AD mouse models", SCIENCE, vol. 335, 23 March 2012 (2012-03-23), pages 1503, XP055159821, DOI: doi:10.1126/science.1217697 |
| R. M. KOFFIE ET AL.: "Apolipoprotein E4 effects in Alzheimer's disease are mediated by synaptotoxic oligomeric amyloid-beta", BRAIN, vol. 135, July 2012 (2012-07-01), pages 2155 |
| R. M. KOFFIE ET AL.: "Oligomeric amyloid beta associates with postsynaptic densities and correlates with excitatory synapse loss near senile plaques", PROC NATL ACAD SCI US A, vol. 106, 10 March 2009 (2009-03-10), pages 4012 |
| R. M. KOFFIE ET AL.: "Oligomeric amyloid beta associates with postsynaptic densities and correlates with excitatory synapse loss near senile plaques", PROC NATL ACAD SCI USA, vol. 106, 10 March 2009 (2009-03-10), pages 4012 |
| S. TAKEDA ET AL.: "Novel microdialysis method to assess neuropeptides and large molecules in free-moving mouse", NEUROSCIENCE, vol. 186, 14 July 2011 (2011-07-14), pages 110 |
| SAMBROOK ET AL.: "Molecular Cloning, a laboratory manual", 1989, COLD SPRING HARBOR LABORATORIES |
| See also references of EP3071240A4 |
| T. HASHIMOTO ET AL.: "Apolipoprotein E, Especially Apolipoprotein E4, Increases the Oligomerization of Amyloid beta Peptide", JNEUROSCI, vol. 32, 24 October 2012 (2012-10-24), pages 15181, XP055198388, DOI: doi:10.1523/JNEUROSCI.1542-12.2012 |
| T. L. SPIRES ET AL.: "Dendritic spine abnormalities in amyloid precursor protein transgenic mice demonstrated by gene transfer and intravital multiphoton microscopy", J NEUROSCI, vol. 25, 3 August 2005 (2005-08-03), pages 7278 |
| T. L. SPIRES ET AL.: "Dendritic spine abnormalities in amyloid precursor protein transgenic mice demonstrated by gene transfer and intravital multiphoton microscopy", JNEUROSCI, vol. 25, 3 August 2005 (2005-08-03), pages 7278 |
| W. XIA ET AL.: "A specific enzyme-linked immunosorbent assay for measuring beta-amyloid protein oligomers in human plasma and brain tissue of patients with Alzheimer disease", ARCH NEUROL, vol. 66, February 2009 (2009-02-01), pages 190, XP002619273, DOI: doi:10.1001/archneurol.2008.565 |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2022050574A (ja) * | 2016-09-02 | 2022-03-30 | スパーク セラピューティクス インコーポレイテッド | Cns障害を治療するための方法及びベクター |
| JP2019529385A (ja) * | 2016-09-02 | 2019-10-17 | スパーク セラピューティクス インコーポレイテッドSpark Therapeutics, Inc. | Cns障害を治療するための方法及びベクター |
| JP7610923B2 (ja) | 2016-09-02 | 2025-01-09 | スパーク セラピューティクス インコーポレイテッド | Cns障害を治療するための方法及びベクター |
| CN110121356A (zh) * | 2016-09-02 | 2019-08-13 | 星火治疗股份有限公司 | 治疗cns疾病的方法和载体 |
| EP3506930A4 (en) * | 2016-09-02 | 2020-09-23 | Spark Therapeutics, Inc. | METHODS AND VECTORS FOR THE TREATMENT OF CNS DISORDERS |
| AU2017318717B2 (en) * | 2016-09-02 | 2024-10-24 | Spark Therapeutics, Inc. | Methods and vectors for treating CNS disorders |
| EP3534892A4 (en) * | 2016-11-04 | 2020-05-27 | The Children's Hospital of Philadelphia | GENE TRANSFER COMPOSITIONS, METHODS AND USE FOR TREATING NEURODEGENERATIVE DISEASES |
| AU2017355502B2 (en) * | 2016-11-04 | 2023-08-31 | The Children's Hospital Of Philadelphia | Gene transfer compositions, methods and uses for treating neurodegenerative diseases |
| RU2805606C2 (ru) * | 2016-11-04 | 2023-10-20 | Дзе Чилдрен'З Хоспитал Оф Филадельфия | Композиции, способы и применения переноса генов для лечения нейродегенеративных заболеваний |
| JP2019537576A (ja) * | 2016-11-04 | 2019-12-26 | ザ・チルドレンズ・ホスピタル・オブ・フィラデルフィアThe Children’S Hospital Of Philadelphia | 神経変性疾患を処置するための遺伝子移入用組成物、遺伝子導入法、及び遺伝子導入の使用 |
| CN114761569A (zh) * | 2019-10-16 | 2022-07-15 | 康奈尔大学 | 阿尔茨海默氏病的基因疗法 |
| WO2021076941A1 (en) * | 2019-10-16 | 2021-04-22 | Cornell University | Gene therapy for alzheimer's disease |
| US12611467B2 (en) | 2019-11-25 | 2026-04-28 | Cornell University | APOE gene therapy |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2014352944A1 (en) | 2016-06-16 |
| IL245703A0 (en) | 2016-07-31 |
| JP6592435B2 (ja) | 2019-10-16 |
| JP2016540977A (ja) | 2016-12-28 |
| EP3071240B1 (en) | 2021-01-06 |
| EP3071240A4 (en) | 2017-10-11 |
| EP3071240A1 (en) | 2016-09-28 |
| BR112016011258A2 (pt) | 2017-09-26 |
| US20170336395A1 (en) | 2017-11-23 |
| ES2874704T3 (es) | 2021-11-05 |
| MX2016006584A (es) | 2016-09-06 |
| KR20160079891A (ko) | 2016-07-06 |
| CA2931220A1 (en) | 2015-05-28 |
| IL245703B (en) | 2022-07-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2850195B1 (en) | Methods and compositions for treating amyloid deposits | |
| AU2017318717B2 (en) | Methods and vectors for treating CNS disorders | |
| EP3071240B1 (en) | Method for monitoring efficacy of treatment of alzheimer's disease with an apoe isoform | |
| US10087224B2 (en) | Gene therapy for Alzheimer's and other neurodegenerative diseases and conditions | |
| US20240115736A1 (en) | Methods and materials for treating tdp-43 proteinopathies | |
| HK1229258B (en) | Method for monitoring efficacy of treatment of alzheimer's disease with an apoe isoform | |
| HK1229258A1 (en) | Method for monitoring efficacy of treatment of alzheimer's disease with an apoe isoform | |
| BR112016011258B1 (pt) | Métodos e composiçôes para o tratamento de depósitos de amiloide | |
| WO2025007194A1 (en) | Modulation of gene expression | |
| WO2024197271A1 (en) | Targeting lysosomal lipid in alzheimer's disease | |
| KR20250112089A (ko) | 퇴행성 뇌 질환의 예방 또는 치료를 위한 뇌혈관 특이적 유전자 치료용 조성물 | |
| JP2025504957A (ja) | アポリポタンパク質EのC末端フラグメント及びγ-セクレターゼ活性の阻害におけるその応用 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14863892 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2016532124 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 122020000276 Country of ref document: BR Ref document number: 245703 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2931220 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2016/006584 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112016011258 Country of ref document: BR |
|
| REEP | Request for entry into the european phase |
Ref document number: 2014863892 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2014863892 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2014352944 Country of ref document: AU Date of ref document: 20141120 Kind code of ref document: A Ref document number: 20167016073 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 112016011258 Country of ref document: BR Kind code of ref document: A2 Effective date: 20160518 |