WO2015071759A1 - A molecular marker of plasmodium falciparum artemisinin resistance - Google Patents

A molecular marker of plasmodium falciparum artemisinin resistance Download PDF

Info

Publication number
WO2015071759A1
WO2015071759A1 PCT/IB2014/002910 IB2014002910W WO2015071759A1 WO 2015071759 A1 WO2015071759 A1 WO 2015071759A1 IB 2014002910 W IB2014002910 W IB 2014002910W WO 2015071759 A1 WO2015071759 A1 WO 2015071759A1
Authority
WO
WIPO (PCT)
Prior art keywords
propeller
nucleic acid
seq
plasmodium
mutant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2014/002910
Other languages
English (en)
French (fr)
Other versions
WO2015071759A9 (en
Inventor
Frédéric ARIEY
Odile Puijalon
Didier MENARD
Françoise BENOIT-VICAL
Johann BEGHAIN
Benoit WITKOWSKI
Jean-Christophe Barale
Christiane Bouchier
Nimol KHIM
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Institut Pasteur
Institut Pasteur du Cambodge
Original Assignee
Centre National de la Recherche Scientifique CNRS
Institut Pasteur
Institut Pasteur du Cambodge
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to KR1020167015777A priority Critical patent/KR102283408B1/ko
Priority to EP14833371.9A priority patent/EP3068903B1/en
Priority to CN201480062113.2A priority patent/CN105940115B/zh
Priority to BR112016011046A priority patent/BR112016011046A2/pt
Priority to CA2928014A priority patent/CA2928014C/en
Priority to ES14833371T priority patent/ES2720728T3/es
Priority to JP2016553749A priority patent/JP6667445B2/ja
Priority to AU2014349828A priority patent/AU2014349828B2/en
Application filed by Centre National de la Recherche Scientifique CNRS, Institut Pasteur, Institut Pasteur du Cambodge filed Critical Centre National de la Recherche Scientifique CNRS
Priority to US15/036,064 priority patent/US10900093B2/en
Publication of WO2015071759A1 publication Critical patent/WO2015071759A1/en
Priority to ZA2016/02703A priority patent/ZA201602703B/en
Anticipated expiration legal-status Critical
Publication of WO2015071759A9 publication Critical patent/WO2015071759A9/en
Priority to US17/124,478 priority patent/US11732312B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6893Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/44Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from protozoa
    • G01N2333/445Plasmodium
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the half-life parameter correlates strongly with results from the in vitro Ring- stage Survival Assay (RSA° "3h ) and the ex vivo RSA 13 , which measure the survival rate of young ring-stage parasites to a pharmacologically-relevant exposure (700 nM for 6 h) to dihydroartemisinin (DHA) - the major metabolite of all ARTs.
  • DHA dihydroartemisinin
  • the current lack of a molecular marker hampers containment efforts in the foci where resistance has been documented and hinders rapid detection of ART- resistance in other endemic areas where ART remains the most affordable and efficient antimalarial drug.
  • a molecular marker associated with ART-resistance is urgently needed.
  • the current invention fulfills this need in the art.
  • the invention encompasses methods, compositions, and kits for detecting and genotyping Plasmodium.
  • the method comprises providing a sample containing a Plasmodium; and detecting the presence of a mutated K-13 propeller nucleic acid or protein in the sample.
  • the Plasmodium is Plasmodium falciparum.
  • the presence of a mutated K-13 propeller nucleic acid in the sample is detected by sequencing. In one embodiment, the presence of a mutated K-13 propeller nucleic acid in the sample is detected by PCR.
  • the invention encompasses methods, compositions and kits for the detection of a Plasmodium infection in an infected patient.
  • the method comprises providing a blood sample from a patient and detecting the presence or absence of a wild-type or mutated K-13 propeller nucleic acid or protein in the blood sample.
  • the method can comprise determining whether the Plasmodiumhas a wild- type or mutant K-13 propeller nucleic acid or protein sequence.
  • the Plasmodium is Plasmodium falciparum.
  • the presence of a mutated K-13 propeller nucleic acid in the sample is detected by sequencing. In one embodiment, the presence or absence of a wild-type or mutated K-13 propeller nucleic acid in the sample is detected by PCR.
  • the kit for detecting a Plasmodium infection comprises primers for the amplification of a K-13 propeller nucleic acid and reagents for the detection of the amplified product.
  • the kit contains a probe for detecting a mutant K-13 propeller nucleic acid.
  • the probe is labeled with a fluorescent or enzymatic label.
  • the kit detects a mutant K-13 propeller nucleic acid encoding a Y493H, R539T, I543T, and C580Y allele.
  • the kit detects a mutant K-13 propeller nucleic acid encoding a Y493H, R539T, I543T or C580Y allele.
  • the kit comprises at least one of the following primers:
  • kit comprises at least one of the following primers:
  • the kit detects a mutant K13 propeller nucleic acid encoding a F446I, N458Y, C469Y, Y493H, K503N, R539T, I543T, P553L, P574L, A578S, C580Y, and D584V allele.
  • the kit detects a mutant K13 propeller nucleic acid encoding a F446I, G449A, N458Y, C469Y, W470stop, A481V, Y493H, K503N, S522C, V534A, R539T, I543T, G548D, P553L, V555A, A557S, R561 H, K563R, V568G, P574L, A578S, C580Y, F583L, D584V, V589I, Q613E, and D641 G allele.
  • the kit comprises at least one of the following pairs of primers:
  • the kit comprises at least one probe hybridizing with one of the following SNP:
  • the invention encompasses a method for detecting in a biological sample containing Plasmodium the presence of a wild-type K13 propeller nucleic acid or a mutant K13 propeller nucleic acid comprising:
  • determining the presence of a mutant allele or a wild type allele by analyzing the melting profile of the amplification products.
  • the method comprises detecting a mutant K13 propeller nucleic acid encoding a F446I, G449A, N458Y, C469Y, W470stop, A481V, Y493H, K503N, S522C, V534A, R539T, I543T, G548D, P553L, V555A, A557S, R561 H, K563R, V568G, P574L, A578S, C580Y, F583L, D584V, V589I, Q613E, and D641 G allele.
  • the invention encompasses a method for detecting in a biological sample containing Plasmodium the presence of a mutant K13 propeller nucleic acid comprising amplifying the mutant K13 propeller nucleic acid by PCR reaction, and contacting the amplified nucleic acid with a probe specific for a mutant K13 propeller nucleic acid.
  • the probe is bound to a fluorescent bead or biotin.
  • the method comprises binding the probe to the mutant K13 propeller domain nucleic acid and detecting the bound K13 propeller domain nucleic acid with a second probe that binds to the bound K13 propeller domain nucleic acid.
  • the presence of a mutated K13 propeller nucleic acid or protein indicates that the patient is infected with a Plasmodium resistant to artemisinin derivatives.
  • the method comprises administering to said patient infected with a Plasmodium resistant to artemisinin derivatives a treatment based on artemisinin derivatives longer than the routine protocol, and/or another anti-malarial drug, preferably quinine, chloroquine or mefloquine.
  • the method comprises administering to said patient infected with a Plasmodium resistant to artemisinin derivatives a treatment based on a new antimalarial drug, and repeating steps a) and b) after administring said treatment, wherein the absence of a mutated K13 propeller nucleic acid or protein indicates that the patient is no longer infected with a Plasmodium resistant to artemisinin derivatives and said treatment is efficient on a Plasmodium resistant to artemisinin derivatives.
  • Figure 3 Frequency of K13-propeller alleles in 886 parasite isolates in six Cambodian provinces in 2001 -2012. Genotypes were obtained by sequencing PCR products from archived blood samples. All mutant alleles carry a single non- synonymous SNP (color-coded, same color-codes as in Fig. 2 for wildtype, C580Y, R539T, Y493H and I543T). Significant reductions (Fisher's exact test) in wildtype allele frequencies were observed in Pailin, Battambang, Pursat and Kratie over time (see Examples).
  • Figure 5 SNP-calling algorithm of the whole-genome sequence comparison of F32-ART5 and F32-TEM (a), and sequence and coverage of SNPs in 7 candidate genes differing in F32-TEM and F-32 ART5 (b).
  • Figure 6 Geographic distribution of K13-propeller alleles in Cambodia in 2011 -2012.
  • Pie charts show K13-propeller allele frequencies among 300 parasite isolates in ten Cambodian provinces. Pie sizes are proportional to the number of isolates and the different alleles are color-coded as in Fig. 3.
  • Figure 7 Correlation between the frequency of wildtype K13-propeller alleles and the prevalence of day 3 positivity after ACT treatment in eight Cambodian provinces.
  • Figure 8 Schematic representation of homology between P. falciparum K13 and human KEAP1 proteins (A) and structural 3D-model of the K13-propeller domain (B).
  • PF3D7_1343700 contains a BTB/POZ domain and a C-terminal 6-blade propeller, which assembles kelch motifs consisting of four anti-parallel beta sheets.
  • B Structural 3D-model of the K13-propeller domain showing the six kelch blades numbered 1 to 6 from N- to C-terminus.
  • the accuracy of the K13-propeller 3D-model was confirmed by Modeller-specific model/fold criteria of reliability (see Examples).
  • the first domain has three beta sheets, the 4 th one being contributed by an extra C- terminal beta sheet called ⁇ '1 in Figure 9.
  • the human Keapl kelch propeller scaffold is destabilized by a variety of mutations affecting intra- or inter-blade interactions in human lung cancer 46 and hypertension 47 .
  • the positions of the various mutations are indicated by a sphere.
  • the M476 residue mutated in F32-ART5 is indicated in dark grey.
  • K13-propeller mutations are predicted to alter the structure of the propeller or modify surface charges, and as a consequence alter the biological function of the protein.
  • the two major mutations C580Y and R539T observed in Cambodia are both non-conservative and located in organized secondary structures: a ⁇ -sheet of blade 4 where it is predicted to alter the integrity of this scaffold and at the surface of blade 3, respectively.
  • Keapl is a negative regulator of the inducible Nrf2-dependent cytoprotective response, sequestering Nrf2 in the cytoplasm under steady state.
  • Nrf2/Keap1 complex Upon oxidative stress, the Nrf2/Keap1 complex is disrupted, Nrf2 translocates to the nucleus, where it induces transcription of cytoprotective ARE- dependent genes 49,50 .
  • Similar functions may be devoted to PF3D7_1343700 in P. falciparum, such that mutations of the K13-propeller impair its interactions with an unknown protein partner, resulting in a deregulated anti- oxidant/cytoprotective response.
  • the P. falciparum anti-oxidant response is maximal during the late trophozoite stage, when hemoglobin digestion and metabolism are highest 51 . Its regulation is still poorly understood and no Nrf2 ortholog could be identified in the Plasmodium genome.
  • Figure 9A and B - PF3D7_1343700 reference nucleic acid (SEQ ID NO: 1 ) and amino acid (SEQ ID NO:2) coding sequences (3D7-type) and mutant positions.
  • Figure 9A color code :dark grey, Plasmodium-spectf c (1 -225) and Apicomplexa-specific (225-345) positions; light grey, BTB/POZ domain.
  • Figure 9B the positions of the polymorphic codons reported in PlasmoDB version 9.3 (http://www.plasmodb.org/plasmo/) and those observed in the present study are boxed in black. Note that most reported polymorphisms are located in the N-terminal domain apart from E621 D observed in one isolate from The Gambia (ref. 44). Six individual kelch domains are localized from residue 443 to 473, 474 to 526, 527 to 573, 574 to 614, 615 to 666, and 667 to 726, respectively.
  • V-XP_001614215 P. vivax Sail (SEQ ID NO:3)
  • Polymorphic P. falciparum residues are shaded in grey.
  • Primer R 5'- gccaagctgccattcatttg -3' (SEQ ID NO: 13)
  • Light grey and dark grey are designed in order to detect Single Nucleotide Polymorphisms (SNP) in the K13 propeller domain.
  • Light grey probes are allele-specific and are bound to fluorescent beads. For each light grey position, there are two probes, one with the mutated nucleotide at 3' extremity and one with the wild-type nucleotide at 3' extremity.
  • Dark grey probes are designed in conserved sequence regions and are bound to biotin.
  • Table 1 Sequence of the primers used to amplify the genes containing non- synonymous single-nucleotide polymorphisms in F32-ART5. Forward primers (SEQ ID NOs 39-45) and reverse primers (SEQ ID NOs 46-52) are shown.
  • Table 2 Description of the eight non-synonymous, single-nucleotide polymorphisms acquired in the F32-ART5 compared to the F32-TEM lineage during an effective 5-year discontinuous exposure to increasing concentrations of artemisinin.
  • Table 4 Geographic origin and year of collection of archived blood samples studied for K13-propeller polymorphism.
  • Table 8 Fifty clinical P. falciparum isolates from Cambodia (collected in 2010 and 201 1 ) were adapted to in vitro culture as described by Witkowski et al b RSA and polymorphisms are indicated.
  • PF3D7_1343700 kelch propeller domain 'K13-propeller'
  • K13- propeller polymorphism constitutes a useful molecular marker for large-scale surveillance efforts to contain artemisinin resistance in the Greater Mekong Subregion and prevent its global spread.
  • the ART-resistant F32-ART5 parasite line was selected by culturing the ART- sensitive F32-Tanzania clone under a dose-escalating, 125-cycle regimen of artemisinin for 5 years 18 .
  • Whole-genome sequences were obtained for both F32- ART5 and F32-TEM (its sibling clone cultured without artemisinin) at 460x and 500x average nucleotide coverage, respectively. Compared to F32-TEM, no deleted genes were identified in F32-ART5.
  • exomes of F32-ART5 and F32-TEM were compared after excluding (i) genes from highly-variable, multi-gene families (var, rifin and stevor), (ii) positions with coverage lower than 25% of the mean coverage of the parasite line, (iii) single-nucleotide polymorphisms (SNPs) found to be mixed in F32- ART5, given that acquired ART-resistance mutation(s) could be expected to be fixed in the sample after 5 years of continuous pressure, (iv) SNPs shared between F32- ART5 and the ART-sensitive 3D7 parasite strain and (v) synonymous SNPs (Fig. 5).
  • SNPs single-nucleotide polymorphisms
  • K13-propeller polymorphism is a molecular marker of clinical ART resistance.
  • 163 patients from Pursat and Ratanakiri in whom we measured parasite clearance half-lives (range 1 .58-1 1 .53 h) 6 in 2009-2010 and for which parasites were previously assigned to a KH subpopulation (KH1 , KH2, KH3, KH4 or KHA) based on ancestry analysis of whole-genome sequence data 15 .
  • Thirteen patients with mixed genotypes (a wild-type and one or more mutant K13- propeller alleles) were excluded.
  • the parasite clearance half-life in patients with wildtype parasites is significantly shorter (median 3.30 h, IQR 2.59-3.95) than those with C580Y (7.19 h, 6.47-8.31 , P ⁇ 10 "6 , Mann-Whitney U test), R539T (6.64 h, 6.00-6.72, P ⁇ 10 "4 ) or Y493H (6.28 h, 5.37-7.14, P ⁇ 10 "6 ) parasites (Fig. 4A).
  • the F32-ART5 lineage acquired a K13-propeller mutation as it developed ART-resistance, as indicated by its ability to survive a pharmacologically-relevant exposure to DHA in the RSA° "3h .
  • Genes putatively associated with ART resistance (Pfcrf 23 ' 24 , Pftctp 25 ' 26 Pfmdr ' 21 ⁇ 28 , Pfmrpl 27'29 and ABC transporters 30 ) or encoding putative targets of ART ⁇ PfATPase6 31 ⁇ 32 and Pfubcth - the ortholog of P chabaudi ubpl 33 34 ) were not mutated during the 5-year selection of F32-ART5, and Pfmdrl amplification was not observed 35"40 .
  • K13-propeller polymorphism fulfills the definition of a molecular marker of ART resistance for several reasons: (i) there has been a progressive loss of wildtype parasites in Western Cambodia during the decade of emerging ART resistance in this region; (ii) mutant parasites cluster in Cambodian provinces where ART resistance is well established and are less prevalent where ART resistance is uncommon; (iii) PF3D7_1343700 is located 5.9 kb upstream of the 35-kb locus identified by Cheeseman et al.
  • PF3D7_1343700 encodes six kelch motifs, which are found in a large number of proteins with diverse cellular functions 43, Given that the toxicity of ART derivatives principally depends on their pro-oxidant activity, the reported role of some kelch-containing proteins in regulating cytoprotective and protein degradation responses to external stress is particularly interesting.
  • the K13- propeller shows homology with human KLHL12 and KLHL2 involved in ubiquitin- based protein degradation and KEAP1 involved in cell adaptation to oxidative stress (Fig. 8).
  • K13-propeller polymorphism is a useful molecular marker for tracking the emergence and spread of ART-resistant P. falciparum.
  • the invention encompasses methods for genotyping a Plasmodium, particularly Plasmodium falciparum.
  • the method performed in vitro, comprises the step of detecting the presence or absence of a wild-type or mutated K-13 propeller nucleic acid or protein, in a biological sample. Said sample has been previously obtained from a patient and is in particular a blood sample.
  • the method comprises providing a biological sample containing a Plasmodium and detecting the presence or absence of a wild-type or mutated K-13 propeller nucleic acid or protein in the sample.
  • the wild-type or mutated K-13 propeller nucleic acid or protein is detected by routine techniques in the art. For example, the techniques described in the Examples, or elsewhere herein, can be used.
  • the biological sample is advantageously a blood sample.
  • the wild-type or mutated K-13 propeller nucleic acid can be detected by numerous techniques known in the art, such as sequencing, hybridization, or amplification assays.
  • a wild-type P. falciparum K-13 propeller nucleic acid means a nucleic acid having the sequence of SEQ ID NO: 1 or a variant nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:2.
  • a wild-type P. falciparum K-13 propeller protein means a protein having the amino acid sequence of SEQ ID NO:2.
  • Other wild-type Plasmodium K-13 propeller proteins are shown in figure 10.
  • a "mutant P. falciparum K-13 propeller nucleic acid” is synonymous with a "mutated P.
  • falciparum K-13 propeller nucleic acid and means a nucleic acid sequence having one or more difference from the nucleic acid sequence of SEQ ID NO:1 that results in a difference of at least one amino acid from the amino acid sequence of SEQ ID NO:2.
  • a mutant P. falciparum K13-propeller nucleic acid according to the invention harbors a single non-synonymous Single Nucleotide Polymorphism (SNP) within a kelch repeat of the carboxy-terminal K13-propeller domain. More preferably the single non-synonymous SNP is one of the following SNPs :
  • a "mutant P. falciparum K-13 propeller protein” is synonymous with a “mutated P. falciparum K-13 propeller protein” and means an amino acid sequence having one or more difference from the amino acid sequence of SEQ ID NO:2.
  • the one or more difference from the amino acid sequence of SEQ ID NO:2 is one or more mutant amino acid within a kelch repeat of the carboxy-terminal K13-propeller domain of the P. falciparum K-13 propeller protein.
  • Preferred mutant P. falciparum K-13 propeller proteins have one or more of the mutations shown in Figure 9 or 13.
  • More preferred mutant P. falciparum K-13 propeller proteins have a single mutation chosen among the mutations shown in Figure 9 or 13.
  • the method comprises detecting the presence or absence of a wild-type or mutated K-13 propeller protein in the biological sample. This can be performed by using specific antibodies that discriminate between wild- type and mutant K-13 propeller proteins. These antibodies can be contacted with patient samples and the presence or absence of a wild-type or mutated K-13 propeller proteins can be determined by detecting the presence or absence of an immunological reaction.
  • the method comprises an ELISA assay.
  • the method comprises providing a sample containing a Plasmodium and detecting the presence of a mutated K-13 propeller nucleic acid or protein in the sample.
  • the presence of a mutated K-13 propeller nucleic acid in the sample is detected by sequencing or by PCR.
  • the Plasmodium is selected from Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale curtisi, Plasmodium ovale wallikeri, Plasmodium malariae, Plasmodium knowlesi, Plasmodium brasilianum, Plasmodium cynomolgi, Plasmodium cynomolgi bastianellii, Plasmodium inui, Plasmodium rhodiani, Plasmodium schweitzi, Plasmodium semiovale, Plasmodium simium, Plasmodium berghei, Plasmodium yoelii, and Plasmodium chabaudi.
  • the invention encompasses methods for genotyping a Plasmodium.
  • the method discriminates between artemisinin-susceptible Plasmodium (with a wild-type K13 allele) from artemisinin-resistant Plasmodium (with a mutant K13 allele).
  • the invention encompasses in vitro methods for detecting at least one mutation in the K13 propeller domain nucleic acid sequence.
  • the invention encompasses methods for detecting in a biological sample containing Plasmodium the presence of a mutant K13 propeller nucleic acid comprising contacting K13 propeller nucleic acid with a probe specific for a mutant K13 propeller and detecting the binding of the probe to the K13 propeller nucleic acid. Binding of the probe with the K13 propeller nucleic acid can be detected by routine techniques in the art. For example, any of the techniques described herein can be used. Exemplary mutants and probes are depicted in Example 15 and Figure 13. Preferably, probes are at least 15, 20, 25, or 30 bp in size. Most preferably, they are 15-20, 15-25, 15-30, 20- 25, or 25-30 nt in size.
  • the probe is bound to a fluorescent bead.
  • the method comprises binding the probe to the mutant K13 propeller domain nucleic acid and detecting the bound K13 propeller domain nucleic acid with a probe that binds to the bound K13 propeller domain nucleic acid.
  • the K13 propeller nucleic acid is amplified prior to detection.
  • the nucleic acids of a Plasmodium are subjected to an amplification of the K13 propeller domain nucleic acid sequence.
  • 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more fragments of the K13 propeller domain nucleic acid sequence are amplified.
  • the amplified fragments can be from at least 50, 75, 100, 125, 150, 175, or 200 nt in size to at least 75, 100, 125, 150, 175, 200, 250, or 300 nt in size.
  • Primers for this amplification can be any of the primers set forth herein.
  • the amplification method is PCR, most preferably real-time PCR, PCR-HRM (High-Resolution DNA Melting) (see Andriantsoanirina et al. Journal of Microbiological Methods, 78 : 165 (2009)), or PCR coupled to ligase detection reaction based on fluorescent microsphere (Luminex® microspheres).
  • PCR-HRM High-Resolution DNA Melting
  • Luminex® microspheres PCR coupled to ligase detection reaction based on fluorescent microsphere
  • LCR ligase chain reaction
  • LCR ligase chain reaction
  • Landegren et al. Science 241 , 1077 (1988) and Barringer et al. Gene 89: 1 17 (1990)
  • transcription amplification Kwoh et al., Proc. Natl. Acad. Sci. USA 86, 1 173 (1989) and WO88/10315
  • self- sustained sequence replication Guatelli et al., Proc. Nat. Acad. Sci. USA, 87, 1874 (1990) and WO90/06995
  • selective amplification of target polynucleotide sequences U.S. Pat. No.
  • nucleic acid based sequence amplification U.S. Pat. Nos. 5, 130,238, 5,409,818, 5,554,517, and 6,063,603.
  • Other amplification methods that may be used are described in U.S. Pat. Nos. 5,242,794, 5,494,810, 4,988,617 and 6,582,938.
  • the above references regarding amplification of nucleic acids are specifically incorporated by reference with respect to the disclosure therein of the specific reaction conditions used for amplification in each of the amplification methods.
  • the method comprises providing Plasmodium nucleic acid, PCR amplifying at least one fragment of the K13 propeller domain nucleic acid sequence in the Plasmodium nucleic acid, and detecting at least one mutation in the K13 propeller domain nucleic acid sequence.
  • the invention encompasses methods for detecting in a biological sample containing Plasmodium the presence of a mutant K13 propeller nucleic acid comprising amplifying the mutant K13 propeller nucleic acid by PCR reaction, and contacting the amplified nucleic acid with a probe specific for a mutant K13 propeller.
  • Exemplary mutants and probes are depicted in Example 15 and Figure 13.
  • probes are at least 15, 20, 25, or 30 bp in size.
  • the mutation is detected by High-Resolution DNA Melting.
  • 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more fragments of the K13 propeller domain nucleic acid sequence are amplified and assessed by High- Resolution DNA Melting for the presence of mutations.
  • Most preferably, 6 fragments of the K13 propeller domain nucleic acid sequence are amplified and assessed by High-Resolution DNA Melting for the presence of mutations.
  • the method comprises providing a biological sample containing DNA of Plasmodium; optionally extracting DNA from the biological sample; contacting the DNA of Plasmodium with at least one pair of primers which hybridize specifically with the K13 propeller nucleic acid, preferably at a distance ranging from 100 to 300 bp, and performing a PCR reaction, preferably in the presence of intercalating dye.
  • the amplification products are subjected to a melting step and a melting profile of the amplification products is generated. The melting step can allow the determination of the presence of a mutant allele or a wild type allele by analyzing the melting profile of the amplification products.
  • the mutation is detected by specific probes that are designed in order to detect Single Nucleotide Polymorphisms (SNP) in the K13 propeller domain.
  • allele-specific probes are bound to a solid substrate, preferably beads, most preferably fluorescent beads.
  • the probes can be specific for a mutation in the K13 propeller domain or for the wild-type K13 propeller domain.
  • the probes can bind to (i.e., capture) the mutant or wild-type K13 propeller domain nucleic acid.
  • the bound (i.e., captured) K13 propeller domain nucleic acid can then be detected with a probe that binds to the bound (i.e., captured) K13 propeller domain nucleic acid.
  • the assay is based on fluorescent microspheres (Luminex® microspheres).
  • Exemplary mutants and probes are depicted in Example 15 and Figure 13.
  • probes are at least 15, 20, 25, or 30 bp in size.
  • the probe spans one of the mutations listed in Example 15 and Figure 13.
  • At least one fragment of the K13 propeller domain nucleic acid sequence is amplified using at least a primer having a nucleotide sequence selected from SEQ ID NOs 15-26.
  • a primer having a nucleotide sequence selected from SEQ ID NOs 15-26 is amplified using at least a primer having a nucleotide sequence selected from SEQ ID NOs 15-26.
  • one or more primer sets used for amplification are selected from the following primer pairs:
  • 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more fragments of the K13 propeller domain nucleic acid sequence are amplified and assessed for the presence of mutations.
  • 6 fragments of the K13 propeller domain nucleic acid sequence are amplified and assessed by High-Resolution DNA Melting for the presence of mutations.
  • the mutation detected is selected from the following mutations (from/to):
  • the mutation detected is 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, or all of the following mutations:
  • the invention encompasses methods for monitoring ART-resistance of a Plasmodium.
  • the method comprises growing a Plasmodium, contacting the Plasmodium with an artemisinin, and detecting a mutation in a K-13 propeller nucleic acid or protein.
  • the Plasmodium is grown in vitro, preferably as in van Schalkwyk et al. Malaria Journal 2013, 12:320, which is hereby incorporated by reference.
  • the method comprises growing a Plasmodium, contacting the Plasmodium with an artemisinin, and sequencing a K-13 propeller nucleic acid or protein at multiple time points.
  • the method comprising providing multiple samples of Plasmodium, from a single or multiple geographic areas, and detecting a mutation in a K-13 propeller nucleic acid or protein.
  • the invention encompasses methods for the detection of a Plasmodium infection and diagnosis of the infection in an infected patient.
  • Patients can be diagnosed by providing a cell sample from a patient.
  • the method comprises providing a cell sample from a patient and detecting the presence or absence of a wild-type or mutated K-13 propeller nucleic acid or protein in the cell sample.
  • the wild-type or mutated K-13 propeller nucleic acid or protein is detected by routine techniques in the art. For example, the any of the techniques described herein can be used.
  • the cell sample can be any cell sample obtained from patient that contains Plasmodium.
  • the cell sample is generated by drawing blood.
  • the cell sample is preferably a blood sample.
  • the blood sample can be further processed to culture the Plasmodium in the sample in vitro. For example, the techniques described in van Schalkwyk et al. Malaria Journal 2013, 12:320 can be used.
  • the method comprises providing a blood sample from patient; optionally culture the Plasmodium in the sample in vitro, and detecting the presence or absence of a wild-type or mutated K-13 propeller nucleic acid or protein in the cell sample.
  • the method comprises providing a blood sample from a patient and detecting the presence or absence of a wild-type or mutated K-13 propeller nucleic acid or protein in the sample.
  • a wild-type or mutated K-13 propeller nucleic acid or protein in the sample.
  • the presence of a mutated K-13 propeller nucleic acid in the sample is detected by sequencing or by PCR.
  • nucleic acid sequencing is used to detect the presence or absence of a wild-type or mutated K-13 propeller nucleic acid in the cell sample.
  • Any sequencing method known in the art can be employed.
  • the term "sequencing" is used in a broad sense and refers to any technique known by the skilled person including but not limited to Sanger dideoxy termination sequencing, whole-genome sequencing, sequencing by hybridization, pyrosequencing, capillary electrophoresis, cycle sequencing, single-base extension sequencing, solid- phase sequencing, high-throughput sequencing, massively parallel signature sequencing (MPSS), sequencing by reversible dye terminator, paired-end sequencing, near-term sequencing, exonuclease sequencing, sequencing by ligation, short-read sequencing, single-molecule sequencing, sequencing-by-synthesis, real-time sequencing, reverse-terminator sequencing, nanopore sequencing, 454 sequencing, Solexa Genome Analyzer sequencing, SOLiD(R) sequencing, MS-PET sequencing, mass spectrometry, and
  • the method of the invention is adapted to run on ABI PRISM(R) 377 DNA Sequencer, an ABI PRISM(R) 310, 3100, 3100-Avant, 3730, or 3730x1 Genetic Analyzer, an ABI PRISM(R) 3700 DNA Analyzer, or an Applied Biosystems SOLiD(TM) System (all from Applied Biosystems), a Genome Sequencer 20 System (Roche Applied Science).
  • the K-13 propeller in the Plasmodium of the cell sample has one or more of the mutations shown in figure 9 or 13 or in Table 7.
  • the method comprises detecting any of the nucleic acid sequences encoding any of the mutations shown in figure 9 or 13 or in Table 7. These sequences can be specifically detected by numerous techniques known in the art, such as sequencing, hybridization, or amplification assays.
  • the amplification method can be RCA, MDA, NASBA, TMA, SDA, LCR, b-DNA, PCR (all forms including RT-PCR), RAM, LAMP, ICAN, SPIA, QB-replicase, or Invader.
  • a preferred amplification method is the polymerase chain reaction (PCR) amplification. See, e.g., PCR Technology: Principles and Applications for DNA Amplification (Ed. H. A. Erlich, Freeman Press, NY, N.Y., 1992); PCR Protocols: A Guide to Methods and Applications (Eds. linis, et al., Academic Press, San Diego, Calif., 1990); Mattila et al., Nucleic Acids Res.
  • PCR polymerase chain reaction
  • PCR-HRM High-Resolution DNA Melting
  • PCR-HRM High-Resolution DNA Melting
  • LCR ligase chain reaction
  • LCR ligase chain reaction
  • Landegren et al. Science 241 , 1077 (1988) and Barringer et al. Gene 89: 1 17 (1990)
  • transcription amplification Kwoh et al., Proc. Natl. Acad. Sci. USA 86, 1 173 (1989) and WO88/10315
  • self- sustained sequence replication Guatelli et al., Proc. Nat. Acad. Sci. USA, 87, 1874 (1990) and WO90/06995
  • selective amplification of target polynucleotide sequences U.S. Pat. No.
  • nucleic acid based sequence amplification U.S. Pat. Nos. 5, 130,238, 5,409,818, 5,554,517, and 6,063,603.
  • Other amplification methods that may be used are described in U.S. Pat. Nos. 5,242,794, 5,494,810, 4,988,617 and 6,582,938.
  • the above references regarding amplification of nucleic acids are specifically incorporated by reference with respect to the disclosure therein of the specific reaction conditions used for amplification in each of the amplification methods.
  • At least one of the following primers is used for amplification:
  • the nucleic acid can be RNA or DNA.
  • RNA is extracted and reverse-transcribed into cDNA. Amplification or sequencing is then performed on the cDNA.
  • the method can comprise isolating RNA from a sample from a patient, reverse-transcribing the RNA into cDNA, amplifying or sequencing the cDNA, and determining the presence or absence of a wild-type or mutated K-13 propeller nucleic acid.
  • the method comprises detecting the presence or absence of a wild-type or mutated K-13 propeller protein in the cell sample. This can be performed by using specific antibodies that discriminate between wild-type and mutant K-13 propeller proteins. These antibodies can be contacted with patient samples and the presence or absence of a wild-type or mutated K-13 propeller proteins can be determined by detecting the presence or absence of an immunological reaction.
  • the method comprises an ELISA assay.
  • Antibodies can be synthetic, monoclonal, or polyclonal and can be made by techniques well known in the art. Such antibodies specifically bind via the antigen- binding sites of the antibody (as opposed to non-specific binding). K-13 propeller polypeptides, fragments, variants, fusion proteins, etc., can be employed as immunogens in producing antibodies immunoreactive therewith. More specifically, the polypeptides, fragment, variants, fusion proteins, etc. contain antigenic determinants or epitopes that elicit the formation of antibodies. These antigenic determinants or epitopes can be either linear or conformational (discontinuous).
  • Linear epitopes are composed of a single section of amino acids of the polypeptide, while conformational or discontinuous epitopes are composed of amino acids sections from different regions of the polypeptide chain that are brought into close proximity upon protein folding (C. A. Janeway, Jr. and P. Travers, Immuno Biology 3:9 (Garland Publishing Inc., 2nd ed. 1996)). Because folded proteins have complex surfaces, the number of epitopes available is quite numerous; however, due to the conformation of the protein and steric hinderances, the number of antibodies that actually bind to the epitopes is less than the number of available epitopes (C. A. Janeway, Jr. and P. Travers, Immuno Biology 2: 14 (Garland Publishing Inc., 2nd ed. 1996)). Epitopes can be identified by any of the methods known in the art. Both polyclonal and monoclonal antibodies can be prepared by conventional techniques.
  • K-13 propeller peptides based on the amino acid sequence of wild-type and mutant K-13 propeller proteins can be utilized to prepare antibodies that specifically bind to wild-type and/or mutant K-13 propeller.
  • the term "antibodies” is meant to include polyclonal antibodies, monoclonal antibodies, fragments thereof, such as F(ab')2 and Fab fragments, single-chain variable fragments (scFvs), single-domain antibody fragments (VHHs or Nanobodies), bivalent antibody fragments (diabodies), as well as any recombinantly and synthetically produced binding partners.
  • Antibodies are defined to be specifically binding if they bind to wild-type and/or mutant K-13 propeller polypeptide with a Ka of greater than or equal to about 10 7 M-1 . Affinities of binding partners or antibodies can be readily determined using conventional techniques, for example those described by Scatchard et al., Ann. N.Y. Acad. Sci., 51 :660 (1949).
  • Polyclonal antibodies can be readily generated from a variety of sources, for example, horses, cows, goats, sheep, dogs, chickens, rabbits, mice, or rats, using procedures that are well known in the art.
  • purified K-13 propeller or a peptide based on the amino acid sequence of K-13 propeller that is appropriately conjugated is administered to the host animal typically through parenteral injection.
  • the immunogenicity of K-13 propeller can be enhanced through the use of an adjuvant, for example, Freund's complete or incomplete adjuvant. Following booster immunizations, small samples of serum are collected and tested for reactivity to K-13 propeller polypeptide.
  • Examples of various assays useful for such determination include those described in Antibodies: A Laboratory Manual, Harlow and Lane (eds.), Cold Spring Harbor Laboratory Press, 1988; as well as procedures, such as countercurrent immuno-electrophoresis (CIEP), radioimmunoassay, radio- immunoprecipitation, enzyme-linked immunosorbent assays (ELISA), dot blot assays, and sandwich assays. See U.S. Pat. Nos. 4,376, 1 10 and 4,486,530.
  • Monoclonal antibodies can be readily prepared using well known procedures. See, for example, the procedures described in U.S. Pat. Nos. RE 32,01 1 , 4,902,614, 4,543,439, and 4,41 1 ,993; Monoclonal Antibodies, Hybridomas: A New Dimension in Biological Analyses, Plenum Press, Kennett, McKeam, and Bechtol (eds.), 1980.
  • the host animals such as mice
  • Mouse sera are then assayed by conventional dot blot technique or antibody capture (ABC) to determine which animal is best to fuse.
  • ABSC antibody capture
  • mice are given an intravenous boost of protein or peptide.
  • Mice are later sacrificed and spleen cells fused with commercially available myeloma cells, such as Ag8.653 (ATCC), following established protocols.
  • ATCC Ag8.653
  • the myeloma cells are washed several times in media and fused to mouse spleen cells at a ratio of about three spleen cells to one myeloma cell.
  • the fusing agent can be any suitable agent used in the art, for example, polyethylene glycol (PEG). Fusion is plated out into plates containing media that allows for the selective growth of the fused cells. The fused cells can then be allowed to grow for approximately eight days. Supernatants from resultant hybridomas are collected and added to a plate that is first coated with goat anti- mouse Ig. Following washes, a label, such as a labeled K-13 propeller polypeptide, is added to each well followed by incubation. Positive wells can be subsequently detected. Positive clones can be grown in bulk culture and supernatants are subsequently purified over a Protein A column (Pharmacia).
  • PEG polyethylene glycol
  • the monoclonal antibodies of the invention can be produced using alternative techniques, such as those described by Alting-Mees et al., "Monoclonal Antibody Expression Libraries: A Rapid Alternative to Hybridomas", Strategies in Molecular Biology 3: 1 -9 (1990), which is incorporated herein by reference.
  • binding partners can be constructed using recombinant DNA techniques to incorporate the variable regions of a gene that encodes a specific binding antibody. Such a technique is described in Larrick et al., Biotechnology, 7:394 (1989).
  • Antigen-binding fragments of such antibodies which can be produced by conventional techniques, are also encompassed by the present invention.
  • fragments include, but are not limited to, Fab and F(ab')2 fragments.
  • Antibody fragments and derivatives produced by genetic engineering techniques are also provided.
  • the monoclonal antibodies of the present invention include chimeric antibodies, e.g., humanized versions of murine monoclonal antibodies.
  • Such humanized antibodies can be prepared by known techniques, and offer the advantage of reduced immunogenicity when the antibodies are administered to humans.
  • a humanized monoclonal antibody comprises the variable region of a murine antibody (or just the antigen binding site thereof) and a constant region derived from a human antibody.
  • a humanized antibody fragment can comprise the antigen binding site of a murine monoclonal antibody and a variable region fragment (lacking the antigen-binding site) derived from a human antibody.
  • Procedures for the production of chimeric and further engineered monoclonal antibodies include those described in Riechmann et al.
  • Antibodies produced by genetic engineering methods such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, can be used.
  • Such chimeric and humanized monoclonal antibodies can be produced by genetic engineering using standard DNA techniques known in the art, for example using methods described in Robinson et al. International Publication No. WO 87/02671 ; Akira, et al. European Patent Application 0184187; Taniguchi, M., European Patent Application 0171496; Morrison et al. European Patent Application 0173494; Neuberger et al. PCT International Publication No. WO 86/01533; Cabilly et al. U.S. Pat. No.
  • antibodies In connection with synthetic and semi-synthetic antibodies, such terms are intended to cover but are not limited to antibody fragments, isotype switched antibodies, humanized antibodies (e.g., mouse-human, human-mouse), hybrids, antibodies having plural specificities, and fully synthetic antibody-like molecules.
  • human monoclonal antibodies having human constant and variable regions are often preferred so as to minimize the immune response of a patient against the antibody.
  • Such antibodies can be generated by immunizing transgenic animals which contain human immunoglobulin genes. See Jakobovits et al. Ann NY Acad Sci 764:525-535 (1995).
  • Human monoclonal antibodies against K-13 propeller polypeptides can also be prepared by constructing a combinatorial immunoglobulin library, such as a Fab phage display library or a scFv phage display library, using immunoglobulin light chain and heavy chain cDNAs prepared from mRNA derived from lymphocytes of a subject. See, e.g., McCafferty et al. PCT publication WO 92/01047; Marks et al. (1991 ) J. Mol. Biol. 222:581 597; and Griffths et al. (1993) EMBO J 12:725 734.
  • a combinatorial immunoglobulin library such as a Fab phage display library or a scFv phage display library
  • a combinatorial library of antibody variable regions can be generated by mutating a known human antibody.
  • a variable region of a human antibody known to bind K-13 propeller can be mutated, by for example using randomly altered mutagenized oligonucleotides, to generate a library of mutated variable regions which can then be screened to bind to K-13 propeller.
  • Methods of inducing random mutagenesis within the CDR regions of immunoglobin heavy and/or light chains, methods of crossing randomized heavy and light chains to form pairings and screening methods can be found in, for example, Barbas et al. PCT publication WO 96/07754; Barbas et al. (1992) Proc. Nat'l Acad. Sci. USA 89:4457 4461 .
  • An immunoglobulin library can be expressed by a population of display packages, preferably derived from filamentous phage, to form an antibody display library.
  • Examples of methods and reagents particularly amenable for use in generating antibody display library can be found in, for example, Ladner et al. U.S. Pat. No. 5,223,409; Kang et al. PCT publication WO 92/18619; Dower et al. PCT publication WO 91/17271 ; Winter et al. PCT publication WO 92/20791 ; Markland et al. PCT publication WO 92/15679; Breitling et al. PCT publication WO 93/01288; McCafferty et al.
  • the antibody library is screened to identify and isolate packages that express an antibody that binds a K-13 propeller polypeptide.
  • a display package e.g., filamentous phage
  • the primary screening of the library involves panning with an immobilized K-13 propeller polypeptide and display packages expressing antibodies that bind immobilized K-13 propeller polypeptide are selected.
  • the method comprises detecting a Plasmodium infection.
  • the method can further comprise determining whether the Plasmodium has a wild-type or mutant K-13 propeller nucleic acid or protein sequence.
  • the invention encompasses methods for treating a Plasmodium infection, In one embodiment, the method comprises determining whether a patient is infected by a Plasmodium containing a wild-type or mutant K-13 propeller nucleic acid or protein sequence and adjusting the anti-parasitic treatment based on whether patient is infected by a Plasmodium containing a wild-type or mutant K-13 propeller.
  • the patient is infected by a Plasmodium containing a wild-type K-13 propeller, the patient is treated with an artemisinin derivative.
  • the patient is infected by a Plasmodium containing a mutant K-13 propeller, the patient is treated with an anti-parasitic treatment without an artemisinin, preferably with a malarial drug selected among quinine, chloroquine and mefloquine.
  • an anti-parasitic treatment without an artemisinin, preferably with a malarial drug selected among quinine, chloroquine and mefloquine.
  • the patient is infected by a Plasmodium containing a mutant K-13 propeller
  • the patient is treated with an artemisinin derivative for a period longer than the routinely-used period.
  • the invention also concerns artemisinin derivative for use in the treatment of patients infected with Plasmodium having a wild-type K-13 propeller, wherein an in vitro step of detecting whether Plasmodium contains a wild-type K-13 propeller is performed on a biological sample previously obtained from said patient
  • the invention further relates to artemisinin derivative for use in the treatment of patients infected with Plasmodium having a mutated K-13 propeller, wherein an in vitro step of detecting whether Plasmodium contains a mutated K-13 propeller is performed on a biological sample previously obtained from said patient and wherein the administration regime and/or the administered doses of artemisinin is(are) extended over time and/or doses are higher with respect to regime, respectively doses applied to infection by Plasmodium that contains a wild-type K-13 propeller.
  • the invention in addition concerns quinine, chloroquinine or mefloquine for use in the treatment of patients infected with Plasmodium having a mutated K-13 propeller, wherein an in vitro step of detecting whether Plasmodium contains a mutated K-13 propeller is performed on a biological sample previously obtained from said patient.
  • using said drugs in accordance with the infection's profile first encompasses the step of detecting and genotyping the Plasmodium infection as provided in the present invention in accordance with the various embodiments to determine whether Plasmodium carries a wild-type K-13 propeller or rather a mutated K-13 propeller.
  • kits for genotyping a Plasmodium or for detecting a Plasmodium infection contains primers for the amplification of a K-13 propeller nucleic acid.
  • the kit can contain reagents for the detection of the amplified product.
  • the kit can contain any primer or any combination of primers set forth herein.
  • the kit can contain at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, or more of the primers set forth herein.
  • the kit comprises at least one pair of primers which hybridize specifically with the K13 propeller nucleic acid at a distance ranging from 100 to 300 bp.
  • the at least one pair of primers which hybridize specifically with the K13 propeller nucleic acid at a distance ranging from 100 to 300 bp surrounds at least one single- nucleotide polymorphism (SNP).
  • the kit contains a probe for detecting a K-13 propeller nucleic acid, particularly an amplified K-13 propeller nucleic acid.
  • the probe is labeled with a fluorescent or enzymatic label.
  • the kit specifically detects a mutant K-13 propeller nucleic acid, particularly one encoding a Y493H, R539T, I543T, or C580Y allele. In one embodiment, the kit specifically detects a wild-type K-13 propeller nucleic acid.
  • the kit comprises at least one of the following primers:
  • the kit detects a mutant K13 propeller nucleic acid encoding a F446I, N458Y, C469Y, Y493H, K503N, R539T, I543T, P553L, P574L, A578S, C580Y, and D584V allele.
  • the kit detects a mutant K13 propeller nucleic acid encoding a F446I, G449A, N458Y, C469Y, W470stop, A481V, Y493H, K503N, S522C, V534A, R539T, I543T, G548D, P553L, V555A, A557S, R561 H, K563R, V568G, P574L, A578S, C580Y, F583L, D584V, V589I, Q613E, and D641 G allele.
  • the kit comprises at least one of the following pairs of primers:
  • the kit comprises at least one probe hybridizing with one of the following SNP:
  • the invention encompasses methods for screening new malarial drugs effective for the treatment of patients infected by an ART-resistant Plasmodium.
  • the method comprises the following steps :
  • the drug as a malarial drug effective for the treatment of patients infected by an ART-resistant Plasmodium, if the parasite clearance half-life and/or the survival rates of the Plasmodium is diminished after administration of the drug.
  • the method further comprises administrating the drug to be tested to the patient, if the Plasmodium infecting the patient has a mutant K13- propeller allele.
  • PF3D7_0110400 is a two-exon gene that codes for the RNA Polymerase II subunit 9 (RPB9), a small integral Pol II subunit, which is highly conserved among eukaryotes.
  • the yeast RPB9 ortholog has been shown to have a role in assuring the fidelity of transcription in vivo. Deletion of the gene results in error-prone transcription 52 .
  • the protein has a predicted zinc -ribbon domain similar to the zinc -ribbon domain of THIS (RNA Polymerase II elongation factor) that contains the essential catalytic Asp-Glu dipeptide 53 .
  • PF3D7_1343700 (PF13_0238) is a one-exon gene (called here K13) that codes for a putative kelch protein.
  • K13 has a predicted 3 -domain structure, with an approx. 225 residue-long, Plasmodium-speciiic and well conserved N-terminal domain, followed by a BTB/POZ domain and a 6-blade C-terminal propeller domain formed from canonical kelch motifs 43 ' 48 .
  • the M476I mutation is located between the first and second blade of propeller domain.
  • PF3D7_0213400 (PFB0605w) is a four-exon gene that codes for protein kinase 7 (PK7) expressed in asexual blood-stage parasites, gametocytes and ookinetes.
  • PK7 protein kinase 7
  • the E104 stop mutation two SNPs affecting the same codon
  • F32-ART5 interrupts the gene resulting in a truncated putative translation product lacking more than 2/3 of its sequence.
  • Studies with genetically inactivated 3D7 parasites have shown that PK7-KO P. falciparum parasites have an asexual growth defect due to a reduced number of merozoites per schizont 54 .
  • PK7 is important for mosquito transmission, with a collapsed number of ookinetes in PK7-KO P. falciparum 5 * and PK7-KO P. berghei, where no sporoblasts and consequently no sporozoites are formed 55 . This transmission defective phenotype is unlikely to survive in the field.
  • PF3D7_1115700 (PF11_0165) is a one-exon gene that codes for falcipain 2a, a cysteine proteinase produced by maturing blood-stage parasites (trophozoites and schizonts) and involved in hemoglobin degradation 56 .
  • the S69stop mutation located in the pro-enzyme region precludes expression of an active enzyme by F32-ART5 parasites.
  • Gene inactivation has shown to induce a transient reduction of hemoglobin degradation compensated by expression of other members of the cysteine proteinase family, with minimal impact on growth rate 57 ' 58 .
  • falcipain 2a is the only gene from the list of seven affected loci that has been associated with the in vitro response to artemisinin.
  • PF3D7_1302100 (PF13_0011) is a one-exon gene that codes for the gamete antigen 27/25 (Pfg27) produced at the onset of gametocytogenesis.
  • the gene is specific to P. falciparum and its close relatives such as P. venezowi. This is an abundant, dimeric phosphorylated cytoplasmic protein that binds RNA.
  • the various KO lines generated display conflicting phenotypes with some pfgHKO 3D7 lines being deficient in gametocytogenesis 60 while other Pfg27-defective 3D7 lines undergo unimpaired gametocytogenesis up to mature stage V gametocytes and subsequently produce oocysts-although absence of Pfg27 is associated with abnormalities in the intracellular architecture of gametocytes 61 .
  • the crystal structure shows that the protein forms a dimer, displays a particular RNA binding fold and possesses two Pro-X-X-Pro motifs (known ligands for various domains, including SH3 modules), which combine to form a receptacle for SH3 modules 62 .
  • the P201T mutation is located in the C-terminal Pro-X-X-Pro motif and predicted to alter the spatial structure of the interaction domain and thus have functional consequences.
  • PF3D7_1459600 (PF14_0569) is a two-exon gene that codes for a 806 residue-long, conserved protein of unknown function.
  • the P. yoelli ortholog has been annotated as the CAAT-box DNA binding subunit B. Close orthologs can be found only among the Plasmodium species.
  • Proteomics data indicate that the protein is present in asexual (merozoites, rings, trophozoites and schizonts) and sexual (gametocytes) blood-stages of P. falciparum parasites.
  • a predicted approx. 130 residue-long Interpro domain suggests the presence of an N-terminal multi-helical, alpha-alpha 2-layered structural VHS fold, possibly involved in intracellular membrane trafficking.
  • the rest of the coding sequence has no specific domain signature.
  • the S299T mutation is located in the "unknown" region.
  • PF3D7_1464500 (PF14_0603) is a five-exon gene that codes for a 3251 residue-long protein of unknown function, with 4 predicted trans-membrane domains, but otherwise no specific domain signature. Apart from proteomics data indicating its expression and phosphorylation in schizonts, with possible expression in gametocytes and sporozoites as well, little is known about its putative function. The N1629S mutation is located in the middle of the protein, with unpredictable phenotypic impact.
  • PfMRP Plasmodium falciparum multidrug resistance-associated protein
  • Keapl represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev 13, 76 (1999). 50. D. Zhang, M. Hannink, Distinct cysteine residues in Keapl are required for Keapl- dependent ubiquitination of Nrf2 and for stabilization of Nrf2 by chemopreventive agents and oxidative stress. Mol Cell Biol 23, 8137 (2003).
  • RNA polymerase II subunit Rpb9 is important for transcriptional fidelity in vivo. Proc Natl Acad Sci U S A 103, 3268 (2006).
  • Plasmodium falciparum cysteine protease falcipain-1 is not essential in erythrocytic stage malaria parasites. Proc Natl Acad Sci U S A 101 , 8721 (2004).
  • Plasmodium falciparum protein Pfg27 is dispensable for gametocyte and gamete production, but contributes to cell integrity during gametocytogenesis. Mol Microbiol 73, 180 (2009).
  • the ART-resistant F32-ART5 parasite line was selected by culturing the ART- sensitive F32-Tanzania clone under a dose-escalating regimen of artemisinin for 5 years.
  • the F32-TEM line was obtained by culturing F32-Tanzania in parallel without artemisinin exposure.
  • Reference DNA was extracted from P. falciparum lines 3D7, 89F5 Palo Alto Kenya and K1992.
  • the Ring-stage Survival Assay (RSA° "3h ) was performed as described 13 .
  • Mycoplasma-free F32-Tanzania parasites were maintained in human type O red blood cells (RBCs) (Etablisssement Frangais du Sang) diluted to 2.5% hematocrit in RPMI-1640 medium (Invitrogen, San Diego, CA) supplemented with 5% human serum.
  • RBCs human type O red blood cells
  • Parasite cultures were maintained at 37°C in an atmosphere of 5% CO2. Parasitemia was checked daily and maintained below 10%.
  • ART-resistant parasites asynchronous cultures were adjusted to 5-7% parasitemia and grown in the presence of escalating doses of artemisinin (from 10 nM to 9 ⁇ ) for 24 h for the first 3 years of drug pressure 18 .
  • each drug-pressure cycle was done for 48 h with doses ranging from 9 ⁇ to 18 ⁇ .
  • the medium was discarded and replaced by human serum-supplemented (20%) drug-free medium.
  • Parasitemia was monitored daily until it reached 5%.
  • drug pressure was reapplied.
  • the parasite line obtained after an effective 5 years of discontinuous ART pressure was named F32-ART5.
  • the parental F32-Tanzania line was kept as a control in continuous culture for the same time under the same conditions (i.e. RBCs, serum and media) but without artemisinin treatment.
  • the resulting control line was called F32-TEM.
  • Reference DNA was extracted from the laboratory-adapted P. falciparum lines 3D7 (MR4, Manassas, VA), 89F5 Palo Alto Kenya (a clone from the Palo Alto line, originating from Kenya in 1978, which displayed high susceptibility to artemether treatment in the Saimiri sciureus experimental host [0. Mercereau-Puijalon, H. Contamin, and J.C. Barale, unpublished data] and K1992, an isolate collected in Pailin in 1992 before the mass deployment of ART in that area (provided by the French National Reference Center of Malaria).
  • Parasite DNA was extracted from frozen blood aliquots (200 ⁇ ) using the Mini blood kit (Qiagen, Valencia, CA) according to the manufacturer's instructions.
  • the Ring-stage Survival Assay (RSA° "3h ) was carried out as described by Witkowski et al 13 using highly synchronous parasite cultures.
  • 0-3h post- invasion ring-stage parasites were exposed to 700nM DHA [dihydroartemisinin, obtained from WWARN (www.wwarn.org/research/tools/qaqc)] or its solvent DMSO for 6 h, washed and then cultivated for the next 66 h without drug. Survival rates were assessed microscopically by counting in Giemsa-stained thin smears the proportion of viable parasites that developed into second-generation rings or trophozoites with normal morphology.
  • Inserts were sized using Agencourt AMPure XP Beads ( ⁇ 500 bp; Beckman Coulter Genomics, Danvers, MA) and enriched using 10 cycles of PCR before library quantification and validation. Hybridization of the library to the flow cell and bridge amplification was performed to generate clusters, and paired-end reads of 100 cycles were collected on a HiSeq 2000 instrument (Illumina, San Diego, CA). After sequencing was complete, image analysis, base calling and error estimation were performed using Illumina Analysis Pipeline version 1 .7.
  • Raw sequence files were filtered using Fqquality tool, a read-quality filtering software developed by N. Joly (Biology IT Center, Institut Pasteur, Paris), which enables the trimming of the first and last low-quality bases in reads.
  • the trimmed reads from controlled Fastq files were mapped on a reference genome (P. falciparum 3D7) with the Burrows-Wheeler Alignment (BWA), generating a BAM file (a binary file of tab-delimited format SAM).
  • BWA Burrows-Wheeler Alignment
  • BAM file binary file of tab-delimited format SAM
  • Samtools to prepare a pileup file, which was formatted using in-house software to implement the data into the Wholegenome Data Manager (WDM) database (Beghain et al, in preparation).
  • WDM software is designed to compare and/or align partial or whole P. falciparum genomes.
  • PCR amplification of selected genes was performed using the primers listed in Table 1 .
  • Two ⁇ of DNA was amplified with 1 ⁇ of each primer, 0.2 mM dNTP (Solis Biodyne, Tartu, Estonia), 3 mM MgC ⁇ and 2 U Taq DNA polymerase (Solis Biodyne), using the following cycling program: 5 min at 94°C, then 40 cycles of 30 sec at 94°C, 90 sec at 60°C, 90 sec at 72°C and final extension 10 min at 72°C.
  • PCR products were detected by 2% agarose gel electrophoresis and ethidium bromide staining. Double-strand sequencing of PCR products was performed by Beckman Coulter Genomics, France. Sequences were analyzed with MEGA 5 software version 5.10 in order to identify specific SNP combinations.
  • the K13-propeller domain was amplified using the following primers: for the primary PCR (K13-1 5'-cggagtgaccaaatctggga-3' (SEQ ID NO:9) and K13-4 5'- gggaatctggtggtaacagc-3' (SEQ ID NO: 10)) and the nested PCR (K13-2 5'- gccaagctgccattcatttg -3' (SEQ ID NO: 13) and K13-3 5'-gccttgttgaaagaagcaga -3' (SEQ ID NO: 14)).
  • the F32-ART5 lineage was explored by whole-genome sequencing using samples collected at time 0 (original F32-Tanzania clonal line), Day 196 (0.2- ⁇ pressure cycle #23), Day 385 (1 .8- ⁇ pressure cycle #39), Day 618 (9- ⁇ pressure cycle #56) and Day 2250 (9- ⁇ pressure cycle #120).
  • the F32-TEM sample was collected on Day 2250. Additional samples collected at the time of the 30 th , 33 rd , 34 th , 36 th , 68 th and 98 th pressure cycles were studied by PCR. DNA from parasite cultures was extracted using the High Pure PCR Template Preparation Kit (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's instructions.
  • the F32-ART5 samples tested in the Ring-stage Survival Assay were collected at the time of the 17 th , 48 th and 122 nd pressure cycles (0.04, 2.7 and 9 ⁇ ART), respectively.
  • the F32-TEM sample was collected at the last mock pressure cycle.
  • the RSA0-3h survival rates were determined in triplicate experiments with different batches of red blood cells, and evaluated as above using Giemsa-stained thin smears read by two independent microscopists (B.W. and F. B - V.). Survival rates were compared using Mann-Whitney U test.
  • the K13-propeller was genotyped by sequencing PCR products amplified from 886 archived blood samples. The number of samples analyzed from each province each year is indicated in Fig.3. The Fisher's exact test was used to compare the frequency of isolates harboring a wildtype K13-propeller sequence in each province over time. A significant decrease of the frequency of the wildtype K13- propeller allele was observed in the western provinces during the decade.
  • the 3D-structural model of the kelch propeller domain of PF3D7_1343700 was obtained by homology modeling satisfying spatial restraints using Modeller v9.1 1 (Fiser A, Sali A (2003). "Modeller: generation and refinement of homology-based protein structure models”. Meth. Enzymol. 374: 461-91 .).
  • the 295 amino acids composing the K13-propeller are 22%, 25% and 25% identical to the kelch propeller domain of the human Keapl [Protein Data Bank (PDB) 2FLU], KLHL12 (PDB 2VPJ) and KLHL2 (PDB 2XN4) proteins, respectively, that were used as templates to model the 3D-structure of the K13-propeller.
  • Example 15 Additional SNPsAfter the first collection of 941 clinical P. falciparum from Cambodian patients as described in Example 5, further blood samples from P.falciparum infected patients were collected in several African countries as Benin, Angola and Cameroon, and in South America following the same experimental procedure as in Example 5. A total of 9523 blood samples was collected.
  • the K13-propeller domain was genotyped by sequencing PCR products amplified from parasite DNA as described in Example 9.
  • Example 16 method to detect simultaneously all the mutations in the K13 propeller domain ( Figure 13)
  • This example describes details relating to the method to detect simultaneously all the mutations in the K13 propeller domain (Figure 13).
  • SNP detection is performed in three steps : hybridization of all probes with amplified DNA (first step); ligation of the conserved pro with allele-specific probe (second step) and reading of the fluorescence issued from biot and from allele-specific fluorescence (third step)
  • primers are : K13_1_F 5'-CGGAGTGACCAAATCTGGGA-3' (SEQ ID NO:9)
  • K13_4_R 5'-GGGAATCTGGTGGTAACAGC-3' SEQ I D NO:10
  • primers are :
  • each SNP one conserved probe hybridizing with the conserved sequence downstream the position of the mutated nucleotide is used.
  • This probe has a phosphate [Phos] at the 5'extremity to permit ligation and a Biotin tag [BtnTg] at the 3' extremity; for each SNP two allele-specific probes hybridizing with the wildtype codon or the mutant codon were also used.
  • Each of allele-specific probe has a specific fluorescent tag (Tag WT for tag specific for wildtype codon and Tag MT for tag specific for mutant codon).
  • Tag_MT_T G STG G ATTTG ATG GTGTAG A AT ATTTAT (SEQ ID NO:61)
  • Tag_WT_T TGTTACGTCAAWTGGTASAATTTATTGTAT (SEQID NO:84)
  • Tag_MT_C TGTTACGTCAAWTGGTASAATTTATTGTAC (SEQID NO:85)
  • Tag_WT_G GCTTTTGATAATAAAATTTATG SEQ I D NO:127

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)
  • Heterocyclic Carbon Compounds Containing A Hetero Ring Having Oxygen Or Sulfur (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Quinoline Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)
PCT/IB2014/002910 2013-11-15 2014-11-14 A molecular marker of plasmodium falciparum artemisinin resistance Ceased WO2015071759A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
JP2016553749A JP6667445B2 (ja) 2013-11-15 2014-11-14 熱帯熱マラリア原虫アルテミシニン耐性の分子マーカー
CN201480062113.2A CN105940115B (zh) 2013-11-15 2014-11-14 恶性疟原虫青蒿素耐药性的分子标记物
BR112016011046A BR112016011046A2 (pt) 2013-11-15 2014-11-14 método para genotipagem, método para a detecção de uma infecção, kit para detectar uma infecção e método para detectar em uma amostra biológica.
CA2928014A CA2928014C (en) 2013-11-15 2014-11-14 Method for detecting a molecular marker of plasmodium falciparum artemisinin resistance
ES14833371T ES2720728T3 (es) 2013-11-15 2014-11-14 Un marcador molecular de Plasmodium falciparum de resistencia a artemisinina
AU2014349828A AU2014349828B2 (en) 2013-11-15 2014-11-14 A molecular marker of Plasmodium falciparum artemisinin resistance
US15/036,064 US10900093B2 (en) 2013-11-15 2014-11-14 Molecular marker of plasmodium falciparum artemisinin resistance
KR1020167015777A KR102283408B1 (ko) 2013-11-15 2014-11-14 플라스모듐 팔시파룸 아르테미시닌 내성의 분자 마커
EP14833371.9A EP3068903B1 (en) 2013-11-15 2014-11-14 A molecular marker of plasmodium falciparum artemisinin resistance
ZA2016/02703A ZA201602703B (en) 2013-11-15 2016-04-19 A molecular marker of plasmodium falciparum artemisinin resistance
US17/124,478 US11732312B2 (en) 2013-11-15 2020-12-16 Molecular marker of plasmodium falciparum artemisinin resistance

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201361904651P 2013-11-15 2013-11-15
US61/904,651 2013-11-15
US201462062439P 2014-10-10 2014-10-10
US62/062,439 2014-10-10

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/036,064 A-371-Of-International US10900093B2 (en) 2013-11-15 2014-11-14 Molecular marker of plasmodium falciparum artemisinin resistance
US17/124,478 Division US11732312B2 (en) 2013-11-15 2020-12-16 Molecular marker of plasmodium falciparum artemisinin resistance

Publications (2)

Publication Number Publication Date
WO2015071759A1 true WO2015071759A1 (en) 2015-05-21
WO2015071759A9 WO2015071759A9 (en) 2016-06-23

Family

ID=52440720

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2014/002910 Ceased WO2015071759A1 (en) 2013-11-15 2014-11-14 A molecular marker of plasmodium falciparum artemisinin resistance

Country Status (10)

Country Link
US (2) US10900093B2 (https=)
EP (1) EP3068903B1 (https=)
JP (2) JP6667445B2 (https=)
KR (1) KR102283408B1 (https=)
CN (1) CN105940115B (https=)
AU (1) AU2014349828B2 (https=)
BR (1) BR112016011046A2 (https=)
ES (1) ES2720728T3 (https=)
WO (1) WO2015071759A1 (https=)
ZA (1) ZA201602703B (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018029532A1 (en) 2016-08-10 2018-02-15 Institut Pasteur Methods and reagents for detecting piperaquine-resistant plasmodium falciparum malaria

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109504791A (zh) * 2018-12-29 2019-03-22 潮州市人民医院 用于检测疟原虫青蒿素耐药性相关k13基因突变的试剂盒
CN109897901A (zh) * 2019-02-27 2019-06-18 四川国际旅行卫生保健中心 检测恶性疟原虫k13基因突变位点的特异性引物组及其应用
CN109797207A (zh) * 2019-02-27 2019-05-24 四川国际旅行卫生保健中心 一种检测恶性疟原虫k13基因四个抗性突变位点的方法
CN112592395A (zh) * 2020-12-11 2021-04-02 中国疾病预防控制中心寄生虫病预防控制所(国家热带病研究中心) 一种恶性疟原虫RIFIN重组蛋白PfRIFIN-54的构建、制备及用途

Citations (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4376110A (en) 1980-08-04 1983-03-08 Hybritech, Incorporated Immunometric assays using monoclonal antibodies
US4411993A (en) 1981-04-29 1983-10-25 Steven Gillis Hybridoma antibody which inhibits interleukin 2 activity
EP0125023A1 (en) 1983-04-08 1984-11-14 Genentech, Inc. Recombinant immunoglobulin preparations, methods for their preparation, DNA sequences, expression vectors and recombinant host cells therefor
US4486530A (en) 1980-08-04 1984-12-04 Hybritech Incorporated Immunometric assays using monoclonal antibodies
US4543439A (en) 1982-12-13 1985-09-24 Massachusetts Institute Of Technology Production and use of monoclonal antibodies to phosphotyrosine-containing proteins
USRE32011E (en) 1981-12-14 1985-10-22 Scripps Clinic And Research Foundation Ultrapurification of factor VIII using monoclonal antibodies
EP0171496A2 (en) 1984-08-15 1986-02-19 Research Development Corporation of Japan Process for the production of a chimera monoclonal antibody
EP0173494A2 (en) 1984-08-27 1986-03-05 The Board Of Trustees Of The Leland Stanford Junior University Chimeric receptors by DNA splicing and expression
WO1986001533A1 (en) 1984-09-03 1986-03-13 Celltech Limited Production of chimeric antibodies
EP0184187A2 (en) 1984-12-04 1986-06-11 Teijin Limited Mouse-human chimaeric immunoglobulin heavy chain, and chimaeric DNA encoding it
WO1987002671A1 (en) 1985-11-01 1987-05-07 International Genetic Engineering, Inc. Modular assembly of antibody genes, antibodies prepared thereby and use
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
WO1988010315A1 (en) 1987-06-19 1988-12-29 Siska Diagnostics, Inc. Transcription-based nucleic acid amplification/detection systems
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US4902614A (en) 1984-12-03 1990-02-20 Teijin Limited Monoclonal antibody to human protein C
WO1990002809A1 (en) 1988-09-02 1990-03-22 Protein Engineering Corporation Generation and selection of recombinant varied binding proteins
WO1990006995A1 (en) 1988-12-16 1990-06-28 Siska Diagnostics, Inc. Self-sustained sequence replication system
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US4988617A (en) 1988-03-25 1991-01-29 California Institute Of Technology Method of detecting a nucleotide change in nucleic acids
WO1991017271A1 (en) 1990-05-01 1991-11-14 Affymax Technologies N.V. Recombinant library screening methods
WO1992001047A1 (en) 1990-07-10 1992-01-23 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
WO1992009690A2 (en) 1990-12-03 1992-06-11 Genentech, Inc. Enrichment method for variant proteins with altered binding properties
US5130238A (en) 1988-06-24 1992-07-14 Cangene Corporation Enhanced nucleic acid amplification process
WO1992015679A1 (en) 1991-03-01 1992-09-17 Protein Engineering Corporation Improved epitode displaying phage
WO1992018619A1 (en) 1991-04-10 1992-10-29 The Scripps Research Institute Heterodimeric receptor libraries using phagemids
WO1992020791A1 (en) 1990-07-10 1992-11-26 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
WO1993001288A1 (de) 1991-07-08 1993-01-21 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Phagemid zum screenen von antikörpern
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
US5242794A (en) 1984-12-13 1993-09-07 Applied Biosystems, Inc. Detection of specific sequences in nucleic acids
GB2272440A (en) 1990-08-29 1994-05-18 Genpharm Int Transgenic non-human animals capable of producing heterologous antibodies
US5333675A (en) 1986-02-25 1994-08-02 Hoffmann-La Roche Inc. Apparatus and method for performing automated amplification of nucleic acid sequences and assays using heating and cooling steps
US5409818A (en) 1988-02-24 1995-04-25 Cangene Corporation Nucleic acid amplification process
US5494810A (en) 1990-05-03 1996-02-27 Cornell Research Foundation, Inc. Thermostable ligase-mediated DNA amplifications system for the detection of genetic disease
WO1996007754A1 (en) 1994-09-02 1996-03-14 The Scripps Research Institute Methods for producing antibody libraries using universal or randomized immunoglobulin light chains
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
US5554517A (en) 1988-02-24 1996-09-10 Akzo Nobel N.V. Nucleic acid amplification process
US6410276B1 (en) 1987-07-31 2002-06-25 The Board Of Trustees Of The Leland Stanford Junior University Selective amplification of target polynucleotide sequences
US6582938B1 (en) 2001-05-11 2003-06-24 Affymetrix, Inc. Amplification of nucleic acids
WO2008146938A1 (en) * 2007-05-28 2008-12-04 Ehime University Primers for detecting plasmodium

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100535125C (zh) * 2007-06-28 2009-09-02 中国疾病预防控制中心寄生虫病预防控制所 用于扩增恶性疟原虫药物抗性相关基因的多重pcr引物及方法

Patent Citations (47)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4376110A (en) 1980-08-04 1983-03-08 Hybritech, Incorporated Immunometric assays using monoclonal antibodies
US4486530A (en) 1980-08-04 1984-12-04 Hybritech Incorporated Immunometric assays using monoclonal antibodies
US4411993A (en) 1981-04-29 1983-10-25 Steven Gillis Hybridoma antibody which inhibits interleukin 2 activity
USRE32011E (en) 1981-12-14 1985-10-22 Scripps Clinic And Research Foundation Ultrapurification of factor VIII using monoclonal antibodies
US4543439A (en) 1982-12-13 1985-09-24 Massachusetts Institute Of Technology Production and use of monoclonal antibodies to phosphotyrosine-containing proteins
EP0125023A1 (en) 1983-04-08 1984-11-14 Genentech, Inc. Recombinant immunoglobulin preparations, methods for their preparation, DNA sequences, expression vectors and recombinant host cells therefor
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
EP0171496A2 (en) 1984-08-15 1986-02-19 Research Development Corporation of Japan Process for the production of a chimera monoclonal antibody
EP0173494A2 (en) 1984-08-27 1986-03-05 The Board Of Trustees Of The Leland Stanford Junior University Chimeric receptors by DNA splicing and expression
WO1986001533A1 (en) 1984-09-03 1986-03-13 Celltech Limited Production of chimeric antibodies
US4902614A (en) 1984-12-03 1990-02-20 Teijin Limited Monoclonal antibody to human protein C
EP0184187A2 (en) 1984-12-04 1986-06-11 Teijin Limited Mouse-human chimaeric immunoglobulin heavy chain, and chimaeric DNA encoding it
US5242794A (en) 1984-12-13 1993-09-07 Applied Biosystems, Inc. Detection of specific sequences in nucleic acids
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (https=) 1985-03-28 1990-11-27 Cetus Corp
WO1987002671A1 (en) 1985-11-01 1987-05-07 International Genetic Engineering, Inc. Modular assembly of antibody genes, antibodies prepared thereby and use
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (https=) 1986-01-30 1990-11-27 Cetus Corp
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US5333675A (en) 1986-02-25 1994-08-02 Hoffmann-La Roche Inc. Apparatus and method for performing automated amplification of nucleic acid sequences and assays using heating and cooling steps
US5333675C1 (en) 1986-02-25 2001-05-01 Perkin Elmer Corp Apparatus and method for performing automated amplification of nucleic acid sequences and assays using heating and cooling steps
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
WO1988010315A1 (en) 1987-06-19 1988-12-29 Siska Diagnostics, Inc. Transcription-based nucleic acid amplification/detection systems
US6410276B1 (en) 1987-07-31 2002-06-25 The Board Of Trustees Of The Leland Stanford Junior University Selective amplification of target polynucleotide sequences
US6063603A (en) 1988-02-24 2000-05-16 Akzo Nobel N.V. Nucleic acid amplification process
US5554517A (en) 1988-02-24 1996-09-10 Akzo Nobel N.V. Nucleic acid amplification process
US5409818A (en) 1988-02-24 1995-04-25 Cangene Corporation Nucleic acid amplification process
US4988617A (en) 1988-03-25 1991-01-29 California Institute Of Technology Method of detecting a nucleotide change in nucleic acids
US5130238A (en) 1988-06-24 1992-07-14 Cangene Corporation Enhanced nucleic acid amplification process
WO1990002809A1 (en) 1988-09-02 1990-03-22 Protein Engineering Corporation Generation and selection of recombinant varied binding proteins
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
WO1990006995A1 (en) 1988-12-16 1990-06-28 Siska Diagnostics, Inc. Self-sustained sequence replication system
WO1991017271A1 (en) 1990-05-01 1991-11-14 Affymax Technologies N.V. Recombinant library screening methods
US5494810A (en) 1990-05-03 1996-02-27 Cornell Research Foundation, Inc. Thermostable ligase-mediated DNA amplifications system for the detection of genetic disease
WO1992001047A1 (en) 1990-07-10 1992-01-23 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
WO1992020791A1 (en) 1990-07-10 1992-11-26 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
GB2272440A (en) 1990-08-29 1994-05-18 Genpharm Int Transgenic non-human animals capable of producing heterologous antibodies
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
US5569825A (en) 1990-08-29 1996-10-29 Genpharm International Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
WO1992009690A2 (en) 1990-12-03 1992-06-11 Genentech, Inc. Enrichment method for variant proteins with altered binding properties
WO1992015679A1 (en) 1991-03-01 1992-09-17 Protein Engineering Corporation Improved epitode displaying phage
WO1992018619A1 (en) 1991-04-10 1992-10-29 The Scripps Research Institute Heterodimeric receptor libraries using phagemids
WO1993001288A1 (de) 1991-07-08 1993-01-21 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Phagemid zum screenen von antikörpern
WO1996007754A1 (en) 1994-09-02 1996-03-14 The Scripps Research Institute Methods for producing antibody libraries using universal or randomized immunoglobulin light chains
US6582938B1 (en) 2001-05-11 2003-06-24 Affymetrix, Inc. Amplification of nucleic acids
WO2008146938A1 (en) * 2007-05-28 2008-12-04 Ehime University Primers for detecting plasmodium

Non-Patent Citations (119)

* Cited by examiner, † Cited by third party
Title
"Antibodies: A Laboratory Manual", 1988, COLD SPRING HARBOR LABORATORY PRESS
"Monoclonal Antibodies, Hybridomas: A New Dimension in Biological Analyses", 1980, PLENUM PRESS
"PCR Protocols: A Guide to Methods and Applications", 1990, ACADEMIC PRESS
"PCR Technology: Principles and Applications for DNA Amplification", 1992, FREEMAN PRESS
"PCR", IRL PRESS
"WHO publications", 2011
ADAMS, J. ET AL.: "The kelch repeat superfamily of proteins: propellers of cell function", TRENDS CELL BIOL, vol. 10, 2000, pages 17 - 24, XP085016269, DOI: doi:10.1016/S0962-8924(99)01673-6
ALTING-MEES ET AL.: "Monoclonal Antibody Expression Libraries: A Rapid Alternative to Hybridomas", STRATEGIES IN MOLECULAR BIOLOGY, vol. 3, 1990, pages 1 - 9, XP001538956
AMAMBUA-NGWA, A. ET AL.: "Population genomic scan for candidate signatures of balancing selection to guide antigen characterization in malaria parasites", PLOS GENET, vol. 8, 2012, pages E1002992
AMARATUNGA, C. ET AL.: "Artemisinin-resistant Plasmodium falciparum in Pursat province, western Cambodia: a parasite clearance rate study", LANCET INFECT DIS, vol. 12, 2012, pages 851 - 8
ANDERSON, T. J. ET AL.: "Are transporter genes other than the chloroquine resistance locus (pfcrt) and multidrug resistance gene (pfmdr) associated with antimalarial drug resistance?", ANTIMICROB AGENTS CHEMOTHER, vol. 49, 2005, pages 2180 - 8
ANDRIANTSOANIRINA ET AL., JOURNAL OF MICROBIOLOGICAL METHODS, vol. 78, 2009, pages 165
ARJEN M DONDORP ET AL: "Artemisinin Resistance in Plasmodium falciparum Malaria", THE NEW ENGLAND JOURNAL OF MEDICINE, 30 July 2009 (2009-07-30), United States, pages 455 - 467, XP055183445, Retrieved from the Internet <URL:http://content.nejm.org/cgi/content/abstract/361/5/455> DOI: 10.1056/NEJMoa0808859 *
B. PADMANABHAN: "Structural basis for defects of Keap1 activity provoked by its point mutations in lung cancer", MOL CELL, vol. 21, 2006, pages 689
BARBAS ET AL., PNAS, vol. 88, 1991, pages 7978 - 7982
BARBAS ET AL., PROC. NAT'L ACAD. SCI. USA, vol. 89, 1992, pages 4457 - 4461
BARRINGER ET AL., GENE, vol. 89, 1990, pages 117
BEIDLER ET AL., J. LMMUNOL., vol. 141, 1988, pages 4053 - 4060
BETTER ET AL., SCIENCE, vol. 240, 1988, pages 1041 - 1043
BHISUTTHIBHAN, J. ET AL.: "The Plasmodium falciparum translationally controlled tumor protein homolog and its reaction with the antimalarial drug artemisinin", J BIOL CHEM, vol. 273, 1998, pages 16192 - 8, XP002997564, DOI: doi:10.1074/jbc.273.26.16192
BORGES, S. ET AL.: "Genome-wide scan reveals amplification of mdr1 as a common denominator of resistance to mefloquine, lumefantrine, and artemisinin in Plasmodium chabaudi malaria parasites", ANTIMICROB AGENTS CHEMOTHER, vol. 55, 2011, pages 4858 - 65
C. A. JANEWAY, JR.; P. TRAVERS: "Immuno Biology", 1996, GARLAND PUBLISHING INC.
C. A. JANEWAY, JR.; P. TRAVERS: "Immuno Biology", vol. 3, 1996, GARLAND PUBLISHING INC., pages: 9
C. A. LOBO; H. FUJIOKA; M. AIKAWA; N. KUMAR: "Disruption of the Pfg27 locus by homologous recombination leads to loss of the sexual phenotype in P. falciparum", MOL CELL, vol. 3, 1999, pages 793
CHAVCHICH, M. ET AL.: "Role of pfmdr1 amplification and expression in induction of resistance to artemisinin derivatives in Plasmodium falciparum", ANTIMICROB AGENTS CHEMOTHER, vol. 54, 2010, pages 2455 - 64
CHEESEMAN I.H. ET AL.,: "A mayor genome region underlying artemisinin resistance in Malaria", SCIENCE, vol. 336, 6 April 2012 (2012-04-06), pages 79 - 82, XP055183789, ISSN: 0036-8075, DOI: 10.1126/science.1215966 *
CHEESEMAN, . H. ET AL.: "A major genome region underlying artemisinin resistance in malaria", SCIENCE, vol. 336, 2012, pages 79 - 82
CHEN, N. ET AL.: "Deamplification of pfmdr1-containing amplicon on chromosome 5 in Plasmodium falciparum is associated with reduced resistance to artelinic acid in vitro", ANTIMICROB AGENTS CHEMOTHER, vol. 54, 2010, pages 3395 - 401
CLACKSON ET AL., NATURE, vol. 352, 1991, pages 624 - 628
CUI, L. ET AL.: "Mechanisms of in vitro resistance to dihydroartemisinin in Plasmodium falciparum", MOL MICROBIOL, vol. 86, 2012, pages 111 - 28
D. DORIN-SEMBLAT; A. SICARD; C. DOERIG; L. RANFORD-CARTWRIGHT; C. DOERIG: "Disruption of the PfPK7 gene impairs schizogony and sporogony in the human malaria parasite Plasmodium falciparum", EUKARYOT CELL, vol. 7, 2008, pages 279
D. ZHANG; M. HANNINK: "Distinct cysteine residues in Keap1 are required for Keap1-dependent ubiquitination of Nrf2 and for stabilization of Nrf2 by chemopreventive agents and oxidative stress", MOL CELL BIOL, vol. 23, 2003, pages 8137, XP055251345, DOI: doi:10.1128/MCB.23.22.8137-8151.2003
DONDORP, A. M. ET AL.: "Artemisinin resistance in Plasmodium falciparum malaria", N ENGL J MED, vol. 361, 2009, pages 455 - 67, XP055183445, DOI: doi:10.1056/NEJMoa0808859
ECKERT ET AL.: "PCR Methods and Applications", vol. 1, 1991, pages: 17
EICHHORN, T. ET AL.: "Molecular interaction of artemisinin with translationally controlled tumor protein (TCTP) of Plasmodium falciparum", BIOCHEM PHARMACOL, vol. 85, 2013, pages 38 - 45
ELIZABETH A. ASHLEY ET AL: "Spread of Artemisinin Resistance in Plasmodium falciparum Malaria", NEW ENGLAND JOURNAL OF MEDICINE, vol. 371, no. 5, 31 July 2014 (2014-07-31), pages 411 - 423, XP055183602, ISSN: 0028-4793, DOI: 10.1056/NEJMoa1314981 *
FISER A; SALI A: "Modeller: generation and refinement of homology-based protein structure models", METH. ENZYMOL., vol. 374, 2003, pages 461 - 91
FLEGG, J. A. ET AL.: "Standardizing the measurement of parasite clearance in falciparum malaria: the parasite clearance estimator", MALAR J, vol. 10, 2011, pages 339, XP021112024, DOI: doi:10.1186/1475-2875-10-339
FRÉDÉRIC ARIEY ET AL: "A molecular marker of artemisinin-resistant Plasmodium falciparum malaria", NATURE, vol. 505, no. 7481, 18 December 2013 (2013-12-18), pages 50 - 55, XP055183410, ISSN: 0028-0836, DOI: 10.1038/nature12876 *
FUCHS ET AL., BIO/TECHNOLOGY, vol. 9, 1991, pages 1370 - 1372
GARDNER M J ET AL: "GENOME SEQUENCE OF THE HUMAN MALARIA PARASITE PLASMODIUM FALCIPARUM", NATURE, NATURE PUBLISHING GROUP, UNITED KINGDOM, vol. 419, 1 January 2002 (2002-01-01), pages 498 - 511, XP001156336, ISSN: 0028-0836, DOI: 10.1038/NATURE01097 *
GARRAD ET AL., BIO/TECHNOLOGY, vol. 9, 1991, pages 1373 - 1377
GRAM ET AL., PNAS, vol. 89, 1992, pages 3576 - 3580
GRIFFTHS ET AL., EMBO J, vol. 12, 1993, pages 725 - 734
GUATELLI ET AL., PROC. NAT. ACAD. SCI. USA, vol. 87, 1990, pages 1874
H. KETTENBERGER; K. J. ARMACHE; P. CRAMER: "Architecture of the RNA polymerase 11-TFIIS complex and implications for mRNA cleavage", CELL, vol. 114, 2003, pages 347
HAWKINS ET AL., J MOL BIOL, vol. 226, 1992, pages 889 - 896
HAY ET AL., HUM ANTIBOD HYBRIDOMAS, vol. 3, 1992, pages 81 - 85
HOOGENBOOM ET AL., NUC ACID RES, vol. 19, 1991, pages 4133 - 4137
HUNT, P. ET AL.: "Experimental evolution, genetic analysis and genome re-sequencing reveal the mutation conferring artemisinin resistance in an isogenic lineage of malaria parasites", BMC GENOMICS, vol. 11, 2010, pages 499, XP021072796, DOI: doi:10.1186/1471-2164-11-499
HUNT, P. ET AL.: "Gene encoding a deubiquitinating enzyme is mutated in artesunate-and chloroquine-resistant rodent malaria parasites", MOL MICROBIOL, vol. 65, 2007, pages 27 - 40
HUSE ET AL., SCIENCE, vol. 246, 1989
IBRAHIM MAMAN LAMINOU ET AL: "Field-based evidence of fast and global increase of Plasmodium falciparum drug-resistance by DNA-microarrays and PCR/RFLP in Niger", MALARIA JOURNAL, BIOMED CENTRAL, LONDON, GB, vol. 8, no. 1, 23 February 2009 (2009-02-23), pages 32, XP021049964, ISSN: 1475-2875, DOI: 10.1186/1475-2875-8-32 *
JAKOBOVITS ET AL., ANN NY ACAD SCI, vol. 764, 1995, pages 525 - 535
JAMBOU, R. ET AL.: "Resistance of Plasmodium falciparum field isolates to in-vitro artemether and point mutations of the SERCA-type PfATPase6", LANCET, vol. 366, 2005, pages 1960 - 3, XP025277846, DOI: doi:10.1016/S0140-6736(05)67787-2
JONES ET AL., NATURE, vol. 321, 1986, pages 552 - 525
K. ITOH ET AL.: "Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain", GENES DEV, vol. 13, 1999, pages 76
KLONIS, N. ET AL.: "Artemisinin activity against Plasmodium falciparum requires hemoglobin uptake and digestion", PROC NATL ACAD SCI U S A, vol. 108, 2011, pages 11405 - 10
KRISHNA, S. ET AL.: "Artemisinins and the biological basis for the PfATP6/SERCA hypothesis", TRENDS PARASITOL, vol. 26, 2010, pages 517 - 23, XP027423340, DOI: doi:10.1016/j.pt.2010.06.014
KWOH ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 1173
KYAW, M. P. ET AL.: "Reduced susceptibility of Plasmodium falciparum to artesunate in southern Myanmar", PLOS ONE, vol. 8, 2013, pages E57689
L. M. BOYDEN ET AL.: "Mutations in kelch-like 3 and cullin 3 cause hypertension and electrolyte abnormalities", NATURE, vol. 482, 2012, pages 98
LANDEGREN ET AL., SCIENCE, vol. 241, 1988, pages 1077
LARRICK ET AL., BIO/TECHNOLOGY, vol. 7, 1989, pages 934
LARRICK ET AL., BIOTECHNOLOGY, vol. 7, 1989, pages 394
LEANG, R. ET AL.: "Efficacy of dihydroartemisinin-piperaquine for treatment of uncomplicated Plasmodium falciparum and Plasmodium vivax in Cambodia, 2008 to 2010", ANTIMICROB AGENTS CHEMOTHER, vol. 57, 2012, pages 818 - 26
LIU ET AL., J. IMMUNOL., vol. 139, 1987, pages 3521 - 3526
LIU ET AL., PNAS, vol. 84, 1987, pages 3439
LIU ET AL., PNAS, vol. 84, 1987, pages 3439 - 3443
LOPERA-MESA, T. M. ET AL.: "Plasmodium falciparum clearance rates in response to artesunate in Malian children with malaria: effect of acquired immunity", J INFECT DIS, vol. 207, 2013, pages 1655 - 63
MARKS ET AL., J. MOL. BIOL., vol. 222, 1991, pages 581 - 597
MATTILA ET AL., NUCLEIC ACIDS RES., vol. 19, 1991, pages 4967
MIOTTO, O. ET AL.: "Multiple populations of artemisinin-resistant Plasmodium falciparum in Cambodia", NAT GENET, vol. 45, 2013, pages 648 - 55
MITA, T. ET AL.: "Limited geographical origin and global spread of sulfadoxine-resistant dhps alleles in Plasmodium falciparum populations", J INFECT DIS, vol. 204, 2011, pages 1980 - 8
MORRISON, S. L., SCIENCE, vol. 229, 1985, pages 1202 - 1207
N. K. NESSER; D. O. PETERSON; D. K. HAWLEY: "RNA polymerase II subunit Rpb9 is important for transcriptional fidelity in vivo", PROC NATL ACAD SCI U S A, vol. 103, 2006, pages 3268
N. KLONIS ET AL.: "Altered temporal response of malaria parasites determines differential sensitivity to artemisinin", PROC NATL ACAD SCI U S A, vol. 110, 2013, pages 5157
NISHIMURA ET AL., CANC. RES., vol. 47, 1987, pages 999 - 1005
NKHOMA ET AL., JID, vol. 208, 2013, pages 346 - 349
NOEDL, H. ET AL.: "Evidence of artemisinin-resistant malaria in western Cambodia", N ENGL J MED, vol. 359, 2008, pages 2619 - 20
OI ET AL., BIOTECHNIQUES, vol. 4, pages 214
OLIVIERI ET AL.: "The Plasmodium falciparum protein Pfg27 is dispensable for gametocyte and gamete production, but contributes to cell integrity during gametocytogenesis", MOL MICROBIOL, vol. 73, 2009, pages 180
P. J. ROSENTHAL; J. H. MCKERROW; M. AIKAWA; H. NAGASAWA; J. H. LEECH: "A malarial cysteine proteinase is necessary for hemoglobin degradation by Plasmodium falciparum", J CLIN INVEST, vol. 82, 1988, pages 1560, XP009002183, DOI: doi:10.1172/JCI113766
P. S. SIJWALI ET AL.: "Plasmodium falciparum cysteine protease falcipain-1 is not essential in erythrocytic stage malaria parasites", PROC NATL ACAD SCI U S A, vol. 101, 2004, pages 8721
P. S. SIJWALI; J. KOO; N. SINGH; P. J. ROSENTHAL: "Gene disruptions demonstrate independent roles for the four falcipain cysteine proteases of Plasmodium falciparum", MOL BIOCHEM PARASITOL, vol. 150, 2006, pages 96, XP025032665, DOI: doi:10.1016/j.molbiopara.2006.06.013
PHYO, A. P. ET AL.: "Emergence of artemisinin-resistant malaria on the western border of Thailand: a longitudinal study", LANCET, vol. 379, 2012, pages 1960 - 6
PICOT, S. ET AL.: "A systematic review and meta-analysis of evidence for correlation between molecular markers of parasite resistance and treatment outcome in falciparum malaria", MALAR J, vol. 8, 2009, pages 89, XP021050025, DOI: doi:10.1186/1475-2875-8-89
PRAG, S.; ADAMS, J. C.: "Molecular phylogeny of the kelch-repeat superfamily reveals an expansion of BTB/kelch proteins in animals", BMC BIOINFORMATICS, vol. 4, 2003, pages 42, XP021000450, DOI: doi:10.1186/1471-2105-4-42
PRICE, R. N. ET AL.: "Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number", LANCET, vol. 364, 2004, pages 438 - 47, XP005066914, DOI: doi:10.1016/S0140-6736(04)16767-6
R. TEWARI ET AL.: "The systematic functional analysis of Plasmodium protein kinases identifies essential regulators of mosquito transmission", CELL HOST MICROBE, vol. 8, 2010, pages 377
RAJ, D. K. ET AL.: "Disruption of a Plasmodium falciparum multidrug resistance-associated protein (PfMRP) alters its fitness and transport of antimalarial drugs and glutathione", J BIOL CHEM, vol. 284, 2009, pages 7687 - 96, XP055133634, DOI: doi:10.1074/jbc.M806944200
RIECHMANN ET AL., NATURE, vol. 332, 1988, pages 323
ROPER, C. ET AL.: "Intercontinental spread of pyrimethamine-resistant malaria", SCIENCE, vol. 305, 2004, pages 1124
S. TAKALA-HARRISON ET AL: "Genetic loci associated with delayed clearance of Plasmodium falciparum following artemisinin treatment in Southeast Asia", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 110, no. 1, 17 December 2012 (2012-12-17), pages 240 - 245, XP055183437, ISSN: 0027-8424, DOI: 10.1073/pnas.1211205110 *
SANCHEZ, C. P. ET AL.: "Polymorphisms within PfMDR1 alter the substrate specificity for anti-malarial drugs in Plasmodium falciparum", MOL MICROBIOL, vol. 70, 2008, pages 786 - 98
SCATCHARD ET AL., ANN. N.Y. ACAD. SCI., vol. 51, 1949, pages 660
SHARMA, . SHARMA; D. KOGKASURIYACHAI; N. KUMAR: "Structure of a gametocyte protein essential for sexual development in Plasmodium falciparum", NAT, vol. 10, 2003, pages 197
SHAW ET AL., J. NATL. CANCER INST., vol. 80, 1988, pages 1553 - 1559
SIDHU, A. B. ET AL.: "Chloroquine resistance in Plasmodium falciparum malaria parasites conferred by pfcrt mutations", SCIENCE, vol. 298, 2002, pages 210 - 3
SIDHU, A. B. ET AL.: "Decreasing pfmdr1 copy number in Plasmodium falciparum malaria heightens susceptibility to mefloquine, lumefantrine, halofantrine, quinine, and artemisinin", J INFECT DIS, vol. 194, 2006, pages 528 - 35
SUN ET AL., PNAS, vol. 84, 1987, pages 214 - 218
TAKALA-HARRISON, S. ET AL.: "Genetic loci associated with delayed clearance of Plasmodium falciparum following artemisinin treatment in Southeast Asia", PROC NATL ACAD SCI USA, vol. 110, 2012, pages 240 - 5, XP055183437, DOI: doi:10.1073/pnas.1211205110
TRAN, T. H. ET AL.: "In vivo susceptibility of Plasmodium falciparum to artesunate", BINH PHUOC PROVINCE, vol. 11, 2012, pages 355, XP021121427, DOI: doi:10.1186/1475-2875-11-355
VALDERRAMOS, S. G. ET AL.: "Identification of a mutant PfCRT-mediated chloroquine tolerance phenotype in Plasmodium falciparum", PLOS PATHOG, vol. 6, 2010, pages E1000887
VAN SCHALKWYK ET AL., MALARIA JOURNAL, vol. 12, 2013, pages 320
VEIGA, M. ET AL.: "Novel polymorphisms in Plasmodium falciparum ABC transporter genes are associated with major ACT antimalarial drug resistance", PLOS ONE, vol. 6, 2011, pages E20212
VERHOEYAN ET AL., SCIENCE, vol. 239, 1988, pages 1534
VIGAN-WOMAS ET AL.: "An in vivo and in vitro model of Plasmodium falciparum rosetting and autoagglutination mediated by varO, a group A var gene encoding a frequent serotype", INFECT IMMUN., vol. 76, no. 12, December 2008 (2008-12-01), pages 5565 - 80
WHITE, N. J.: "The parasite clearance curve", MALAR J, vol. 10, 2011, pages 278, XP021110574, DOI: doi:10.1186/1475-2875-10-278
WINTER; HARRIS, TIPS, vol. 14, May 1993 (1993-05-01), pages 139
WITKOWSKI, B. ET AL.: "Increased tolerance to artemisinin in Plasmodium falciparum is mediated by a quiescence mechanism", ANTIMICROB AGENTS CHEMOTHER, vol. 54, 2010, pages 1872 - 7
WITKOWSKI, B. ET AL.: "Novel phenotypic assays for the detection of artemisinin-resistant Plasmodium falciparum malaria in Cambodia: in-vitro and ex-vivo drug-response studies", LANCET INFECT DIS, 2013, pages 13
WITKOWSKI, B. ET AL.: "Reduced artemisinin susceptibility of Plasmodium falciparum ring stages in western Cambodia", ANTIMICROB AGENTS CHEMOTHER, vol. 57, 2013, pages 914 - 23
WOOD ET AL., NATURE, vol. 314, 1985, pages 446 - 449
WOOTTON, J. C. ET AL.: "Genetic diversity and chloroquine selective sweeps in Plasmodium falciparum", NATURE, vol. 418, 2002, pages 320 - 3
WU; WALLACE, GENOMICS, vol. 4, 1989, pages 560
X. LI; D. ZHANG; M. HANNINK; L. J. BEAMER: "Crystal structure of the Kelch domain of human Keap1", J BIOL CHEM, vol. 279, 2004, pages 54750
YUAN, J. ET AL.: "Chemical genomic profiling for antimalarial therapies, response signatures, and molecular targets", SCIENCE, vol. 333, 2011, pages 724 - 9
Z. BOZDECH; H. GINSBURG: "Antioxidant defense in Plasmodium falciparum--data mining of the transcriptome", MALAR J, vol. 3, 2004, pages 23, XP021007453, DOI: doi:10.1186/1475-2875-3-23

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018029532A1 (en) 2016-08-10 2018-02-15 Institut Pasteur Methods and reagents for detecting piperaquine-resistant plasmodium falciparum malaria
US12168805B2 (en) 2016-08-10 2024-12-17 Institut Pasteur Methods and reagents for detecting piperaquine-resistant plasmodium falciparum malaria

Also Published As

Publication number Publication date
US10900093B2 (en) 2021-01-26
US11732312B2 (en) 2023-08-22
US20210198755A1 (en) 2021-07-01
JP2020043873A (ja) 2020-03-26
EP3068903A1 (en) 2016-09-21
CN105940115B (zh) 2021-07-06
US20160289774A1 (en) 2016-10-06
CA2928014A1 (en) 2015-05-21
ES2720728T3 (es) 2019-07-24
EP3068903B1 (en) 2019-02-13
JP2016537030A (ja) 2016-12-01
AU2014349828A1 (en) 2016-05-26
HK1225757A1 (en) 2017-09-15
JP6667445B2 (ja) 2020-03-18
KR102283408B1 (ko) 2021-07-29
ZA201602703B (en) 2019-12-18
WO2015071759A9 (en) 2016-06-23
BR112016011046A2 (pt) 2019-01-29
CN105940115A (zh) 2016-09-14
AU2014349828B2 (en) 2021-01-28
KR20160119753A (ko) 2016-10-14

Similar Documents

Publication Publication Date Title
US11732312B2 (en) Molecular marker of plasmodium falciparum artemisinin resistance
Ariey et al. A molecular marker of artemisinin-resistant Plasmodium falciparum malaria
Amambua-Ngwa et al. Population genomic scan for candidate signatures of balancing selection to guide antigen characterization in malaria parasites
Su et al. Genetic linkage and association analyses for trait mapping in Plasmodium falciparum
Silvestrini et al. Genome-wide identification of genes upregulated at the onset of gametocytogenesis in Plasmodium falciparum
Callaghan et al. Functional comparison of 45 naturally occurring isoforms of the Plasmodium falciparum chloroquine resistance transporter (PfCRT)
Lopez-Perez et al. Plasmodium falciparum field isolates from South America use an atypical red blood cell invasion pathway associated with invasion ligand polymorphisms
Tripathi et al. Stochastic expression of invasion genes in Plasmodium falciparum schizonts
Bordbar et al. Genetic diversity of VAR2CSA ID1-DBL2Xb in worldwide Plasmodium falciparum populations: impact on vaccine design for placental malaria
US20250092471A1 (en) Methods and reagents for detecting piperaquine-resistant plasmodium falciparum malaria
Meyer et al. Genetic diversity of Plasmodium falciparum: asexual stages.
Noranate et al. Population diversity and antibody selective pressure to Plasmodium falciparum MSP1 block2 locus in an African malaria-endemic setting
CA2928014C (en) Method for detecting a molecular marker of plasmodium falciparum artemisinin resistance
HK1225757B (en) A molecular marker of plasmodium falciparum artemisinin resistance
Barry Malaria epidemiology: Insights from the genome of the malaria parasite
Gomez et al. Patterns of nucleotide and haplotype diversity at ICAM-1 across global human populations with varying levels of malaria exposure
Tapaopong et al. Genetic signatures of Plasmodium vivax Circumsporozoite Surface Protein during malaria resurgence in Thailand
Bradley The Duffy antigen system and Plasmodium vivax: Immunological and epidemiological approaches to unconventional malaria in Sub-Saharan Africa
OA19184A (en) Methods and reagents for detecting piperaquine-resistant plasmodium falciparum malaria.
Wamae Genetic Epidemiology of Plasmodium falciparum Asymptomatic Infections and Antimalarial Drug-resistance Markers in Kilifi, Kenya.
Robinson et al. Drug-Resistant Genotypes and Multi-Clonality in Plasmodium falciparum Analysed
Bright Whole Genome Analysis of the Human Malaria Parasites Plasmodium vivax and P. falciparum
Suon et al. isolates reveals heterogeneity of expression of genes involved in host‑parasite interactions Sasha V. Siegel1, 9, Lia Chappell1, 9, Jessica B. Hostetler1, 2, 4, Chanaki Amaratunga2, 5, 6
Mangano Dissecting the complexity of human susceptibility to malaria: genetic approaches

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14833371

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2928014

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 15036064

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2016553749

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2014349828

Country of ref document: AU

Date of ref document: 20141114

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2014833371

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2014833371

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20167015777

Country of ref document: KR

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112016011046

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112016011046

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20160516