WO2015061858A1 - Viral vector manufacture - Google Patents

Viral vector manufacture Download PDF

Info

Publication number
WO2015061858A1
WO2015061858A1 PCT/AU2014/050330 AU2014050330W WO2015061858A1 WO 2015061858 A1 WO2015061858 A1 WO 2015061858A1 AU 2014050330 W AU2014050330 W AU 2014050330W WO 2015061858 A1 WO2015061858 A1 WO 2015061858A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
cells
cho
virus
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2014/050330
Other languages
English (en)
French (fr)
Inventor
Paul Michael Howley
Liang Liu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SEMENTIS Ltd
Segmentis Ltd
Original Assignee
SEMENTIS Ltd
Segmentis Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2013904242A external-priority patent/AU2013904242A0/en
Priority to KR1020167014693A priority Critical patent/KR102047030B1/ko
Priority to SM20180267T priority patent/SMT201800267T1/it
Priority to DK14858802.3T priority patent/DK3063278T3/en
Priority to NO14858802A priority patent/NO3063278T3/no
Priority to CN201480071836.9A priority patent/CN106255758B/zh
Priority to NZ72024114A priority patent/NZ720241A/en
Priority to RU2016121425A priority patent/RU2658487C2/ru
Priority to EP18154084.0A priority patent/EP3375882B1/en
Priority to RS20180588A priority patent/RS57290B1/sr
Priority to EP14858802.3A priority patent/EP3063278B1/en
Priority to PL14858802T priority patent/PL3063278T3/pl
Priority to SG11201603919XA priority patent/SG11201603919XA/en
Priority to CA2931518A priority patent/CA2931518C/en
Priority to LTEP14858802.3T priority patent/LT3063278T/lt
Priority to JP2016550897A priority patent/JP6682443B2/ja
Priority to HRP20180789TT priority patent/HRP20180789T1/hr
Priority to AU2014344738A priority patent/AU2014344738B2/en
Priority to ES14858802.3T priority patent/ES2670034T3/es
Priority to SI201430731T priority patent/SI3063278T1/sl
Priority to HK16111526.2A priority patent/HK1223395B/en
Priority to US15/033,541 priority patent/US10544397B2/en
Application filed by SEMENTIS Ltd, Segmentis Ltd filed Critical SEMENTIS Ltd
Publication of WO2015061858A1 publication Critical patent/WO2015061858A1/en
Priority to IL245363A priority patent/IL245363B/en
Anticipated expiration legal-status Critical
Priority to CY20181100533T priority patent/CY1121414T1/el
Priority to US16/711,184 priority patent/US20200190482A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24111Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24111Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24141Use of virus, viral particle or viral elements as a vector
    • C12N2710/24143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24111Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24151Methods of production or purification of viral material
    • C12N2710/24152Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to the development of cells and cell lines suitable for propagating and therefore manufacturing pox virus-based medicaments.
  • the specification relates to recombinant modified cellular substrates for propagating such poxviruses for the manufacture of therapeutic or prophylactic agents.
  • the pox virus family comprises two subfamilies, the Chordopoxvirinae and the Entomopaxvirmae
  • the Chordopoxvirinae comprises eight genera including the Orthopoxviridae comprising species which infect man (for example, variola virus, the causative agent of smallpox, eowpox virus (which formed the original smallpox vaccine reported by Jermer in 1796), vaccinia virus (used as a second generation smallpox vaccine) and monkeypox virus), and the Avipoxviridae viruses comprising species that infect birds, such as fowjpox and eanarypox viruses, in addition to their use as antigens in smallpox vaccines, there is much interest in the use of recombinant vaccinia-based viruses and avipox viruses as a "backbone" vectors.
  • the Orihopoxviridae are able inter alia to deliver foreign antigens to the host cytoplasm and antigen processing pathways that, process antigens to peptides for presentation on the cell surface.
  • Such vectors expressing foreign antigens are used in the development of vaccines for diseases such as AIDS, tuberculosis, malaria and cancer which have proven difficult to treat by other vaccination strategies.
  • the Chordopoxvirinae have linear double- stranded DNA genomes ranging in size from 130kb in parapoxviruses to over 3O0kb in. avipoxviruses and their life cycle in the host is spent entirely in the host cell cytoplasm.
  • the poxviruses operate substantially independently of their host cell and host cell molecules, especially for processes involved, in early m RNA synthesis. However, host molecules appear to be used for the initiation or termination of intermediate and late viral transcription.
  • the poxviruses produce structurally diverse "host range factors" which specifically target and manipulate host signaling pathways to permit cellular conditions allowing viral replication.
  • poxviruses can bind and infect mammalian cells * but whether or not the subsequent infection is permissive (able to produce infectious virions) or non-permissive (substantially unable to produce infectious virions) is dependent upon the specific poxvirus and specific cell type involved.
  • host-range genes There is currently a relatively poor understanding at the molecular level of pox virus-host interactions, in particular host-range genes, and which factors are necessary to modulate the relationship to facilitate both viral and cellular propagation. For a review of host range genes reference may be made to Werden et al. 2008 incorporated herein in its entirety.
  • M.VA Modified Vaccinia Ankara
  • passage number as viruses with different passage numbers were found to be genetically and phenolypically distinct. However, by passage number 5.15 MVA51.5 was understood to be genetically stable.
  • MVA strains such MVA572, and its derivative, MVA F6 were able to express vaccinia proteins and heterologous (recombinant) proteins at high levels in non- permissive cells (in which the vims will not propagate), enabling the development of MVA as a vector for heterologous molecules of interest, such as those encoding antigens for vaccine or therapy delivery.
  • the poxviruses constitute a large family of viruses characterized by a. large, linear dsDNA genome, a cytoplasmic site of propagation and a complex virion morphology.
  • Vaccinia virus is the representative virus of this group of virus and the most studied in terms of viral morphogenesis.
  • Vaccinia virus virions appear as "brick shaped" or "ovoid" membrane-bound particles with a complex internal structure featuring a. walled, biconcave core flanked by "lateral bodies”.
  • the virion assembly pathway involves a .fabrication of membrane containing crescents which develop into immature virions (IV s), and then evolve into mature virions (MVs), Over 70 specific gene products are contained within the vaccinia virus virion, where the effects of mutations in over 50 specific genes on vaccinia virus assembly are now described.
  • Vaccinia vims enter cells by fusion of its surface membranes with the plasma membrane of the host cell, releasing the core (and lateral bodies) into the .cytoplasm, and activating the virus' transcriptional program.
  • the virion cores contain the full complement of virus-coded enzymes required for synthesis and modification of early mRNA.
  • Early genes encode enzymes required for DNA propagation, and thus as early gene expression peaks, viral DNA propagation ensues in cytoplasmic sites termed "factories. " Early genes also encode intermediate transcription factors, and intermediate genes, in turn, encode late transcription factors, so that intermediate and late genes are expressed in succession after the prerequisite initiation of viral DNA propagation.
  • the full complement of viral genes are transcribed in a temporal cascade, with the early, intermediate and late classes being distinguished by class-specific transcriptional promoters and virally encoded transcription factors. Furthermore, only propagated genomes are competent templates for intermediate and late transcription. These two classes of genes together encode virion, structural proteins, virion enzymes, and assembly factors and are required for assembly of new progeny virus particles.
  • cytoplasmic domains form within the ceil that are uniform in density and are sometimes surrounded by endoplasmic reticulum (ER) derived cisternae which increase in size with time. These domains represent sites of viral DNA propagation and are often called "viral factories",
  • IVs that contain nucleoids of condensed DNA that are often referred, to as "IVN.” Maturation of several virion protein precursors via, proteolytic cleavage is required for the morphogenesis of IVN to mature virions (MV). The majority of mature virions are found outside, factories and may exist in clusters either at the periphery of a factory or apparently separated by a significant distance from the nearest factory.
  • Poxvirus virions exist in. three infectious forms: mature virions (MV), wrapped virions (WV), and extracellular virions (E V).
  • MV mature virions
  • WV wrapped virions
  • E V extracellular virions
  • MV the simplest form of the virus, are membraned particles containing a biconcave, DNA-containing core flanked by lateral bodies, which fill the concavities of the core. MV are normally found exclusively inside cells and are liberated only by cell lysis.
  • WV consist of MV which are surrounded by two additional lipid bilayers. derived from trans-Goigi cisternae.
  • WV whose outer membranes contain characteristic viral proteins, are precursors of EV and are also found within the cell.
  • EV consist of WV which have been exocytosed via fusion of the outermost WV membrane with the plasma membrane, leaving an MV wrapped in one additional membrane. A fraction of EV are found attached to the cell surface, while some are found free in the extracellular medium, EV are thought to be important for spread of the virus within an organism.
  • a number of inammalian cell lines are used for tile manufacture of recombinant proteins for research purposes. These include, rabbit, hamster, primate and human derived cell lines such as, without limitation, and as known in the art, HEK293, 293T, 143B, CHO, H eLa , Vero and BHK, HepG2, and 3T3 cells. Notably, however, the GMP manufacture of the majority of recombinant therapeutic proteins have been made in CHO cells making this cell line the most well studied and approved cell line for human therapeutics. CHO cells can grow to very high densities in suspension cultures, and down stream processes for purifying products are very well developed. Of relevance, is that neither vaccinia, such as vaccinia-COP or vaccinia- WR nor its derivatives such as MVA and NY VAC will propagate in CHO cells.
  • the present specification describes in vitro cultured mammalian cells, transformed to express a poxviral host range factor and a method for propagating viral vectors, comprising culturing such cells.
  • the present invention provides a modified mammalian cell in which the genome of the c ell is modified to comprise a sequence encoding CP77 under the control, of a promoter such that the modified cell line sustains propagation of a poxvirus that is less able or unable to propagate in the unmodified ceil.
  • the present invention provides a process for propagating an orthopoxvirus that does not propagate in CHO ceils, the process comprising propagating the poxvirus in vitro in a mammalian cell line wherein the cell line is modified to encode and express CP77 under the control of a promoter.
  • the modified cells are further modified to compri se a sequence encoding D13L under the control of a promoter and/or to compri se a sequence encoding KIL under the control of a promoter
  • Attenuation or "attenuated” as used herein means a reduction of viral vector virulence. Virulence is defined as the ability of a virus to cause disease in a particular host, A poxviral vector that is unable to produce infectious viruses may initially infect cells but is unable substantially to replicate itself fully or propagate within the host or cause a condition. This is desirable as the vector delivers its protein or nucleic acid to the host cell cytoplasm, but does not harm the subject,
  • control element or "control sequence.” is meant nucleic acid sequences
  • Control sequences that are suitable for eukaryotie cells include transcriptional control sequences such as promoters, polyadenylatkm signals, transcriptional enhancers, translalionaf control sequences such as translationai enhancers and internal ribosome binding sites (IRES), nucleic acid sequences that modulate raRNA stability, as well as targeting sequences that target a product encoded by a transcribed polynucleotide to an intracellular compartment within a cell or to the extracellular environment.
  • transcriptional control sequences such as promoters, polyadenylatkm signals, transcriptional enhancers, translalionaf control sequences such as translationai enhancers and internal ribosome binding sites (IRES), nucleic acid sequences that modulate raRNA stability, as well as targeting sequences that target a product encoded by a transcribed polynucleotide to an intracellular compartment within a cell or to the extracellular environment.
  • nucleic acid sequence that displays substantial sequence identity to a reference nucleic acid sequence (e.g., at least about 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 97, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or even up to 100% sequence identity to all or a portion of the reference nucleic acid sequence.) or an amino acid sequence that displays substantial sequence similarity or identity to a reference amino acid sequence (e.g., at least 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59
  • an agent e.g., an attenuated orthopox vector as described herein
  • composition comprising same to an individual in need of such treatment or prophylaxis, either in a single dose or as part, of a series, that is effective for the prevention of incurring a symptom, holding in check such symptoms, and/or treating existing symptoms, of that condition or for modulating the immune response to the target antigen or organism.
  • the effective amount will vary depending upon the health and physical condition of the individual to be treated, the laxonomic group of individual to be treated, the formulation of the composition, the assessment of the medical situation, and other relevant factors. It is expected that the amount will fail in a relatively broad range that can be determined through routine trials,
  • the terms "encode,” “encoding” and the like refer to the capacity of a nucleic acid to provide for another nucleic acid or a polypeptide.
  • a nucleic acid sequence is said to "encode” a polypeptide if it can be transcribed and/or translated to produce the polypeptide or if it can be processed into a form that can be transcribed and/or translated to produce the polypeptide.
  • Such a nucleic acid sequence may include a coding sequence or both a coding sequence and a non-coding sequence.
  • the terms "encode,” “encoding” and the like include an.
  • RNA product resulting from transcription of a DMA molecule a protein resulting from translation of an RNA molecule, a protein resulting from transcription of a DMA molecule to form an RNA product and the subsequent translation of the RNA product, or a protein resulting from transcription of a DMA molecule to provide an RNA product
  • processing of the RNA product to provide a processed RNA product e.g., inRNA
  • a processed RNA product e.g., inRNA
  • endogenous refers to a gene or nucleic acid sequence or segment that is normally found in a host organism.
  • expressible refers to the ability of a ceil to transcribe a nucleotide sequence to RNA and optionally translate the mRNA to synthesize a peptide or polypeptide that provides a biological or biochemical function.
  • the term "gene'' includes a nucleic acid molecule capable of being used to produce mRNA optionally with the addition of elements to assist in this process. Genes may or may not be capable of being used to produce a functional protein. Genes can include both coding and non-coding regions (e.g.. imrorts, regulatory elements, promoters, enhancers, termination sequences and 5' and 3' untranslated regions).
  • heterologous nucleic acid sequence refers to any nucleic acid ⁇ e.g., a nucleotide sequence comprising an IRES) which is introduced into the genome of an.
  • organism by experimental manipulations and may include gene sequences found in that organism so long as the .introduced gene contains some modification (e.g., a point mutation, deletion, substitution or addition of at least one nucleotide, the presence of a endonuclease cleavage site, the presence of a 1oxP site, etc.) relative to the viral genomic sequence before the modification,
  • some modification e.g., a point mutation, deletion, substitution or addition of at least one nucleotide, the presence of a endonuclease cleavage site, the presence of a 1oxP site, etc.
  • heterologous polypeptide As well as “heterologous polypeptide,” “foreign polypeptide'' and
  • exogenous polypeptide are used interchangeably to refer to any peptide or polypeptide which is encoded by .an “heterologous nucleic acid sequence,” “heterologous nucleotide sequence,” “heterologous polynucleotide,” “foreign polynucleotide” and “exogenous polynucleotide,” as defined above.
  • mammalian cell means a cell into which a vector including the attenuated orlhopox vector of the invention may be introduced for the purpose of propagating the poxvirus vector.
  • the cell is a continuous cell line. It is less imperative that the modified eel! is a cell line able to divide continuously,
  • a mammalian or higher eukaryotk cell may be modified in accordance with the present invention and subsequently transformed or immortalised to become a continuously dividing cell line.
  • the cell prior to modification is conveniently a well characterised and continuously dividing biotechnology compatible continuous cell line known in the art. Such cells are conveniently available from depositing organisations such as the American Type Culture Collection (ATCC) or European Collection of Cell Cultures (ECACC).
  • ATCC American Type Culture Collection
  • ECACC European Collection of Cell Cultures
  • Suitable mammalian cell lines include, but are not limited to, RK18, BHK,
  • VERO HBOC-143B, HaCat, BepG2, HeLa, BT1080.
  • HEK-293, RD, COS-7, CHO, Jurkat, HUT, SUPT, C8166, MOLT4/clone8, ⁇ -2, MT-4, H9, FMl, CEM, myeloma cells (e.g., SB20 cells) and CEMX.174 are available, for example, from the ATCC.
  • any art recognised genome engineering method for producing modified cell lines expressing heterologous genes may be employed.
  • many method are recognised for introducing gene into cells, including, without limitation, retrovirus transduction (e.g., MoMLV, etc), lentivirus transduction, plasmid trailsfection and integration, other viral system for transducing cell lines such as Adenovirus, AAV (Adenovirus Associated Virus), EBV and genome editing techniques for site specific insertion by homologous recombination with linear DNA, engineered meganueelases, transcription- activator like effector nucleases (TAL-nuclease), Zinc- finger-nueleases (ZFNs) and CRISPRs.
  • retrovirus transduction e.g., MoMLV, etc
  • lentivirus transduction e.g., lentivirus transduction
  • plasmid trailsfection and integration other viral system
  • the mammalian, .cell is a CHO ceil.
  • Prior art CHO cell lines which do not encode viral host name genes, do not support manufacture of vaccinia or vaccinia derivatives substantially unable to propagate in man.
  • Chinese hamster ovary (CHO) ceils derived from the ovary of the hamster, Cricetiilus griseus, are the most commonly used mammalian cell for bio-industrial and G.MP production of recombinant protein therapeutics, including antibodies.
  • the popularity of CHO ceils for this purpose stems, in. part, from their rapid growth and high protein production. As a result, CHO cell lines have been well characterized.
  • Suitable CHO cell lines include without limitation A2, A2H, XrS6, CHO-Kl, CRO/dhfr, RR-CHO-Kl, U T- I P22, CHO-IC6, Led, Lee2 Lec8, Pro-5 an CDKXB l lines.
  • the CHO-Kl cell line deposited with the ATCC under Accession Number ATCC CLL-61 or ATCC CRL-9618 is frequently employed.
  • the CHO-Kl cell line was derived as a. subclone from the parental CHO cell line initiated from a biopsy of an ovary of an adult Chinese hamster by Puck T. (1957).
  • the present specification describes modified ceils other than modified CHO cells.
  • the mammalian cell is a human cell, a primate cell, a hamster cell or a rabbit cell.
  • Cells may be unicellular, or can be grown in tissue culture as liquid cultures, monolayers or the like. Host cells may also be derived directly or indirectly from tissues or may exist within an organism including animals.
  • inducing includes eliciting or stimulating an immune response and/or enhancing a previously existing immune response
  • IRES internal ribosonial entry site
  • a viral, cellular, or synthetic (e.g.., a recombinant) nucleotide sequence which allows for initiation of translation of an mRNA at a site internal to a coding region within the same mRNA or at a site 3' of the 5' end of the mRNA, to provide for translation of an operably linked coding region located downstream of (i.e., 3' of) the internal rlbosomal entry site. This makes translation independent of the 5' cap structure, and independent of the 5' end of the mRNA.
  • An IRES sequence provides necessary cw-aeting sequences required for initiation of translation of an operably linked coding region .
  • isolated is meant to describe a cell, a compound of interest (e.g., a recombinant poxvirus, a nucleic acid molecule suc as a genome, a. polypeptide, etc.) that is in an environment different from, thai in which the compound naturally occurs, "Isolated” is meant to include compounds that are within samples that are substantially enriched for the compound of interest and/or in which the compound of interest is partially or substantially purified.
  • a compound of interest e.g., a recombinant poxvirus, a nucleic acid molecule suc as a genome, a. polypeptide, etc.
  • isolated is meant to include compounds that are within samples that are substantially enriched for the compound of interest and/or in which the compound of interest is partially or substantially purified.
  • operably connected refers to a juxtaposition wherein the components so described are in a relationship permitting them t function in their intended manner.
  • a transcriptional control sequence "operably linked" to a coding sequence refers to positioning and or orientation of the transcriptional control sequence relati ve to the coding sequence to permit expression of the coding sequence under conditions compatible with the transcriptional control sequence.
  • an IRES operably connected to an orthopox virus coding sequence refers to positioning and/or orientation of the IRES relative to the orthopox virus codin sequence to permit c -independent translation of the orthopox virus coding sequence
  • initiation codon e.g. , ATG
  • termination codon e.g., TGA, TAA, TAG
  • parent vims will be understood to be a reference to a virus that is modified t incorporate heterologous nucleic acid sequence to form a recombinant, virus of the present invention.
  • polynucleotide designate mRNA, RNA, cRNA, cDNA or D A.
  • the term typically refers to polymeric form of nucleotides of at least .10 bases in length, either ribonucleotides or deoxy nucleotides or a. modified form of either type of nucleotide.
  • the term includes single and double stranded forms of RNA or DNA.
  • Polypeptide “peptide,” “protein” and “proteinaeeous molecule” are used interchangeably herein to refer to molecules comprising or consisting of a polymer of amino acid residues and to variants and synthetic analogues of the same. Thus, these terms apply to amino acid polymers in which one or more amino acid residues are synthetic non- naturally occurring amino acids, such as a chemical analogue of a corresponding naturally occurring, amino acid, as well as to naturally-occurring amino acid polymers.
  • nucleic acid molecules As used herein the term "recombinant” as applied to "nucleic acid molecules," “polynucleotides” and the like is understood to mean artificial nucleic acid structures (i.e., non-replicating cDNA or RNA; or repHcons, self-replicating cDNA or RNA) which can he transcribed and/or translated in host cells or cell-free systems described herein.
  • Recombinant nucleic acid molecules or polynucleotides may be inserted into a vector.
  • Non- viral vectors such as plasmid expression vectors or viral vectors may be used.
  • nucleic acid construct The kind of vectors and the technique of insertion of the nucleic acid construct according to this invention is known to the artisan, A nucleic acid molecule or polynucleotide according to the invention does not occur in nature in the arrangement described by the present invention. In other words, an heterologous nucleotide sequence is not naturally combined with elements of a parent virus genome (e.g. , promoter. QRF. polyaden.ylati.on signal, ribozyme).
  • a parent virus genome e.g. , promoter. QRF. polyaden.ylati.on signal, ribozyme.
  • the term "recombinant virus” will be understood to be a reference to a “parent virus” comprising at least one heterologous nucleic acid sequence
  • sequence identity refers to the extent that sequences are identical on a nucleotide-by ⁇ n.ueleoti.de basis or an amino acid-by-amino acid basis over a window of comparison.
  • a “percentage of sequence identity” is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base ( ⁇ e.g., A. T, C. G, I) or the identical amino acid residue (e.g. , Ala, Pro, Ser. Thr, Gly, Val, Leu, lie, Phe, Tyr. Trp, Lys, Arg, His, Asp, Glu, Asn, Gin.
  • sequence identity will be understood to mean the "match percentage” calculated by the DNAS1S computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA) using standard defaults as used in the reference manual accompanying the software.
  • signal sequence refers to a short (about 3 to about 60 amino acids long) peptide that directs co- or post-translational transport of a protein from the cytosol to certain organelles such as the nucleus, mitochondrial matrix, and endoplasmic reticulum, for example.
  • the signal peptides are typically cleaved from the precursor form by signal peptidase after the proteins are transported to the ER, and the resulting proteins move along the secretory pathway to their intracellular (e.g., the Golgi apparatus, cell membrane or cell wall) or extracellular locations.
  • ER targeting signal peptides include amino-terminal hydrophobic sequences which are usually enzymaticaliy removed following the insertion of part or all of the protein through the ER membrane into the lumen of the ER.
  • a signal precursor form of a sequence can be present as part of a precursor form, of a protein, but will generally be absent from the mature form of the protein.
  • Similarity refers to the percentage number of amino acids that are identical or constitute conservative substitutions as defined in Table A below. Similarity may he determined using sequence comparison programs such as GAP (De.veraux. et al, 1984, Nucleic Acids Research 12: 387-395). hi this way, sequences of a similar or substantially different length to those cited herein might be compared by insertion of gaps into the alignment, such gaps being determined, for example, by the comparison algorithm used by GAP.
  • Optimal alignment of sequences for aligning a comparison window may be conducted b computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in. the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA) or by inspection and the best alignment (i.e. , resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected.
  • GAP Garnier et al
  • FASTA Altschul et al.
  • subject refers to any subject, particularly a vertebrate subject, and even more particularly a mammalian subject, for whom therapy or prophylaxis is desired.
  • Suitable vertebrate animals that fall within the scope of the inventio include, but are not restricted to. any member of the subphylum Chordata including primates (e.g., humans, monkeys and apes, and includes species of monkeys such.
  • Macaca e.g., eynomologus monkeys such as Macac fmcic iaris, and/or rhesus monkeys (Macaca mukttt )) and baboon (Papio rsm s), as well as marmosets (species from the genus CaMiihrix), squirrel monkeys (species from the genus Saimiri) and tamarins (species from the genus Saguimts), as well as species of apes such as chimpanzees (Pan troglodytes)), rodents (eg., .mice, rats, guinea pigs), lagoraorphs (e.g., rabbits, hares), bovines (e.g.., cattle), ovines (e.g., sheep), caprines (e.g...
  • a preferred subject is a human in need of treatment or prophylaxis of a condition. However, it will be understood that the aforementioned terms do not imply that symptoms are present.
  • tran.sge.ne is used herein to describe genetic materia! that has been or is about to be artificially introduced into a genome of a host organism and that, is transmitted to the progeny of that host. In some embodiments, it confers a desired property to a mammalian cell or an orthopox vector into which it is introduced, or otherwise leads to a desired therapeutic or diagnostic outcome.
  • treatment refers to obtaining a desired pharmacologic and/or physiologic effect.
  • the effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the- disease.
  • Treatment covers any treatment of a disease in a mammal, particularly in a human, and includes; (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (e) relieving the disease, i.e., causing regression of the disease.
  • wild-type “natural,” “native” and the like with respect to an organism, polypeptide, or nucleic acid sequence, that the organism polypeptide, or nucleic acid sequence is naturally occurring or available in at least one naturally occurring organism which is not changed, mutated, or otherwise manipulated by man.
  • Variants include nucleic acid molecules sufficiently similar to a referenced molecule or their complementary forms over all or part thereof such that selective hybridisation may be achieved under conditions of medium or high stringency, or which have about 60% to 90% or 90 to 98% sequence identity to the nucleotide sequences defining a referenced poxvirus host range factor over a comparison window comprising at least about 15 nucleotides.
  • the hybridisation region is about 12 to about 18 nucleobases or greater in length.
  • the percent identity between a particular nucleotide sequence and the reference sequence is at least about 80%, or 85%. or more preferably about 90% similar or greater, such as about 95%, 96%, 97%, ⁇ 98%, 99% or greater.
  • Percent identities between 80% and 100% are encompassed. The length of the nucleotide sequence is dependent upon its proposed function. Homologs are encompassed. The terra “homolog” “homologous genes” or “homologs” refers broadly to functionally and structurally related molecules including those from other species. Homologs and orthologs are examples of variants.
  • Nucleic acid sequence identity can be determined in the following manner.
  • the subject nucleic acid sequence is used to search a nucleic acid sequence database, such as the GenBank database (accessible at web site http://wwvv.ncbi.nln.nih.gov/blast/), using the program BLASTM version 2.1 (based on Altschul et al ( 1997) Nucleic Acids Research 25:3389-3402).
  • the program is used in the ungapped mode. Default filtering is used to remove sequence homologies due to regions of low complexity. The default parameters of BLASTM are used.
  • Amino acid sequence identity can be determined in the following manner.
  • the subject polypeptide sequence is used to search a polypeptide sequence database, such as the GenBank database (accessible at web site hltp;//www .ftcbi.nln.nih.gov/blast/), using the BLASTP program.
  • GenBank database accessible at web site hltp;//www .ftcbi.nln.nih.gov/blast/
  • the program is used in the ungapped mode.
  • Default filtering is used to remove sequence homologies due to regions of low complexity.
  • the default parameters of BLASTP are utilized. Filtering for sequences of low complexity may use the SEG program.
  • hybridize under stringent conditions refers to the ability of a nucleic acid molecule to hybridize to a target nucleic acid molecule (such as a target nucleic acid molecule immobilized on a DNA or RNA blot, such as a Southern blot or Northern blot) under defined, conditions of temperature and salt concentration.
  • typical stringent hybridization conditions are- no more than 25°C to 30°C (for example, 10°C) below the melting temperature (Tin) of the native duplex (see generally, Sambrook et al, (supra); Ausubel et a/., (1999)).
  • exemplary stringent hybridization conditions are 5°C to 10°C below Tra,
  • deletion in the present context removal of ail or part of the coding region of the target gene.
  • the term also encompasses any form of mutation or transformation which ablates gene expression of the target gene or ablates or substantially down regulates the level or activity of the encoded protein,
  • Reference to "gene” includes DNfA corresponding to the exons or the open reading frame of a gene.
  • Reference herein to a “gene” is also taken to include; a classical genomic gene consisting of transcriptional and/or transiational regulatory sequences and/or a coding region and/or non-translated sequences (i.e. introns, 5' ⁇ and 3' ⁇ untranslated sequences); or mRNA or cDNA corresponding to the coding regions (i.e. exons) and 5'- and 3'- untranslated sequences of the gene.
  • regulatory element or “regulatory sequence” is meant nucleic acid sequences (e.g., DNA) necessary for expression of an operably linked. coding sequence in a particular host cell.
  • the regulatory sequences that are suitable for prokaryotic cells for example, include a promoter, and optionally a cis-acting sequence such as an operator sequence and a ri.bos.ome binding site.
  • Control sequences that are suitable for eukaryotic cells include promoters, polyadenylation signals, transcriptional enhancers, transiational enhancers, leader or trailing sequences that modulate mRNA stability, as well as targeting sequences that target a product encoded by a transcribed polynucleotide to an intracellular compartment within a cell or to the extracellular environment.
  • Chimeric constructs suitable for effecting the present modified mammalian cells comprise a nucleic acid sequence encoding an orfhopox host range factor, which is operably linked to a regulatory sequence.
  • the regulatory sequence suitably comprises transcriptional and/or transiational control sequences, which will be compatible for expression in the cell.
  • the transcriptional and transiational regulatory control sequences include, but are not limited to, a promoter sequence, a 5' non-coding region, a c&-reguiatory region such as a functional binding site for transcriptional, regulatory protein or transiational regulatory protein, an upstream open reading frame, ribosomal-binding sequences, transcriptional start site, transiational start, site, and/or nucleotide sequence which encodes a leader sequence, termination codon, transiational stop site and a 3' non- translated region.
  • Constitutive or inducible promoters as known in the art are contemplated.
  • the promoters may be either naturally occurring promoters,, or hybrid promoters that combine .elements of more than one promoter,
  • Promoter sequences contemplated may be native to mammalian, cell or may be derived from an alternative source, where the region is functional in the chosen organism.
  • the choice of promoter will differ depending o the intended host cell
  • promoters which could be used for expression in mammalian cells include the metallothionein promoter, which can be induced in response to heavy metals such as cadmium, the ⁇ -aclin promote as well as viral promoters such as the SV40 large T antigen promoter, human cytomegalovirus (CMV) immediate early (IE) promoter, Rous sarcoma virus LTR promoter, the mouse mammary tumor virus LTR promoter, the adenovirus major late promoter (Ad MLP), the herpes simplex vims promoter, and a HPV promoter, particularly the HPV upstream regulatory region (URR), among others. All these promoters are well described and readily available in the art.
  • Enhancer elements may also be used herein to increase expressio levels of the mammalian constructs.
  • Examples include the SV40 early gene enhancer, as described for example in Dijkema et at. (1985) EMBO J. 4:761, the enhancer/promoter derived from the lon terminal repeat. (LTR) of the Rous Sarcoma Virus, as described for example in Gorman et al tension (1982) Proc, Natl, Acad, Sci, USA 79:6777 and elements derived from human CMV, as described for example in Boshart et at (1 85) Celt 41 :521. such as elements included in the CMV intron A sequence.
  • LTR Rous Sarcoma Virus
  • the chimeric construct may also comprise a 3 * non- translated sequence
  • a 3 * non-translated sequence refers to thai portion of a gene comprising a DNA segment that contains a polyadenylation signal and any other regulator)' signals capable of effecting mRNA processing or gene expression.
  • the polyadenylation signal is characterized by effecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor.
  • Polyadenylation signals are commonly recognized by the presence of homology to the canonical form 5" AATAAA-3' although variations are not uncommon.
  • the 3' non- translated regulatory DNA sequence preferably includes fro about 50 to 1 ,000 nts and may contain transcriptional and translational termination sequences in addition to a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression.
  • the chimeric construct further contains a selectable marker gene to permit selection of cells containing the construct. Selection genes are well known in the art and will be compatible for expression in the cell of interest.
  • expression of the orthopox structural or assembly gene is under the control of a. promoter
  • the promoter is a cellular constitutive promoter, such as human EF1 alpha (human elongation factor 1 alpha gene promoter), DHPR (dihydrofolate reductase gene promoter) or PGK (phosphoglycerate kinase gene promoter) that direct expression of a sufficient level of CP77 to sustain viral propagation in the absence of significant toxic effect on the host cell.
  • Promoters may also be inducible, such as the cellular inducible promoter, ⁇ (from a metaltotbionein gene) viral promoters are also employed in mammalian cells, such as CMV, RSV, SV-40, and
  • the present invention provides a modified mammalian cell in which the genome of the cell is modified to comprise a sequence encoding CP77 under the control of a promoter such that the modified cell line sustains propagation of a poxvirus that is less able or unable to propagate in the unmodified cell
  • a second aspect th present invention provides a process for propagating an orthopoxvirus that does not propagate in CEO cells, the process comprising propagating the poxvirus in vitro in a mammalian cell line wherein the cell line is modified to encode and express CP77 under the control of a promoter.
  • the genome of the cell further comprises a sequence encodin D13L under the control of a promoter and/or further comprises a sequence encoding 1L under the control of a promoter.
  • the cell is a continuous cell line, preferably a CHO cell.
  • the cell may be a human cell, a primate cell, a hamster ceil or a rabbit cell.
  • the CP77 gene, D13L gene and/or the 1L gene is under the control of a mammalian promoter.
  • the expression of the CP77 gene supports propagation of the vims to generate virus yields equivalent, to that observed in a permissive cell line and preferabl supports a virus replication amplification ratio of more than 500.
  • the CP77, D13L and/or KIL is/are encoded b contiguous sequence of nucleotides eodon optimised for expression in mammalian eells.
  • the specification relates broadly to modified (recombinant or transformed) cells and to a process for in vitro manufacture of virus vectors in cultured higher eukaryotic host cells, wherein the cell is genetically modified in such a way as to enhance or facilitate multiplication of the virus vector within or via a population o the cells in vitro.
  • the specification provides for the propagation of vaccinia-based poxviruses in modified Chinese hamster ovary (CHO) cells.
  • CHO Chinese hamster ovary
  • Cricetulus grise s are the most commonly used mammalian cell for bio -industrial and GMP production of recombinant protein therapeutics, including antibodies.
  • the popularity of CHO cells for this purpose stems, in. part, from their rapid growth and high protein production. As a result, CHO cell lines have been well characterized.
  • Suitable CHO cell lines include without limitation A2, A2H, XrS6, CHO-Kl, CHO/dhfr, RR-CHO-Kl, UT-I, P22, CHO-1C6, Lecl, Lec2, LecS, Fro-5 an CDKXB1 lines.
  • the CHO-Kl ceil line deposited with the ATCC under Accession Number ATCC CLL-61 or ATCC CRL- 618 is frequently employed.
  • the CHO-Kl cell line was derived as a subclone from the parental CHO cell line initiated from a biopsy of an ovary of an adult Chinese hamster by Puck T. (1957).
  • the present specification describes modified cells other than modified CHO cells.
  • cell lines such as CHO cells may be adapted to suspension culture using standard techniques.
  • Reference to a recombinant or modified cell includes its progeny.
  • Cells ma be sold in any form, including frozen or in liquid suspension form.
  • Cells ma be sold infected with: a poxvirus vector.
  • Reference herein to CP77 means the cowpox host range gene referred to in Sphener et at. (1988), and Hsiao el aL (2006) and to functional orthologs and modified forms thereof able as determined herei to support pox viral growth when expressed as a heterologous gene in the genome of a mammalian host cell.
  • Reference to "modified forms” includes a variation (such as a deletion, substitution or addition) from the wild- type or reference sequence, A reference nucleotide sequence is provided in SEQ ID NO: .1. Modified forms share at least 80% sequence identity over the coding region or one or more portions thereof comprising at least .200 contiguous basepairs.
  • Modified forms include codon optimised forms as described herein that are optimised for expression in a mammalian or other higher eukaryotic cells including CHO cells.
  • Reference to CP77 includes orthologs i.e., genes with the same function present in other species or identified by different names.
  • the cowpox host range factor, CF77 is also referred to as VHR1, CHOhr,. and CPXV025.
  • the CHOhr/CP77 gene in the Western Reserve (WR) strain of vaccinia is substantially fragmented and fails to produce a functional factor.
  • CP77 is absent in MVA and the Copenhagen strain,
  • Reference herein to "CP77', "D13L” and “K1L” includes functional orthologs and functional variants.
  • “Functional” refers to the herein described quality of expression, (i.e., transcription, and translation) directed from the mammalian genome of a cultured cell, to support poxvirus propagation within the expressing cell cytoplasm.
  • the term “propagate” includes intracellular propagation and intercellular propagation and encompasses the production of mature viral particles.
  • a population of the modified cells sustains propagation of a poxvirus that is less able or substantially unable to propagate in an unmodified control cell.
  • the inability to propagate means that cell to ceil or subject to subject transmission does not typically occur.
  • Reference to "unmodified control cell” includes the modified cell as it existed prior to modification to encode at. least one viral host range factor selected from the group consisting of CP77, K1L and SPT-1 and to express same from its genome under control of a promoter, as well as other suitable control cells known in the art.
  • poxviruses such as MVA and vaccinia are unable to propagate in CHO cells.
  • CHO cells that are recombinantly modified to express CP77 from their genome under the control of a promoter are able to support propagation of not only vaccinia but also derivatives of vaccinia such as MVA. After propagation in the subject modified CHO-CP77 cells, MVA and vaccinia are still unable to propagate in unmodified CHO cells or other suitable control.
  • poxvirus includes a recombinant poxvirus vector encoding a heterologous molecule of interest (such as an antigen of interest) as a medicament, prophylactic, diagnostic or therapeutic agent. Such recombinant poxvirus vectors are typically for use as vaccines against non-poxviral induced diseases or conditions. Also, the term poxvirus includes isolated poxviruses and derivatives thereof proposed for use as a therapeutic or prophylactic vaccine against a poxvirus infection, such as variola or small pox infection.
  • vaccinia-based includes vaccinia and derivatives and modified forms of vaccinia virus.
  • Vaccinia based derivatives include, but are in no way limited to, (VIVA and NY VAC, Reference to MVA and NY VAC includes strains or derivates of these poxviruses known in the art. Modified forms may have modifications in one to ten or more genes.
  • modification is intended to mean a variation (such as a. deletion, substitution or addition) from the wild-type or reference sequence.
  • Reference to "attenuated” includes poxvirus that do not propagate or which propagate to a substantially lesser degree in a relevant subject compared to a non-attenuated form of the same virus. The term also includes viruses that are non-pathogenic in a subject.
  • the cell is a continuous cell line. It. is less imperative that, the modified cell is a cell line able to divide continuously.
  • a mammalian or higher eukaryotie cell may be modified in accordance with the present invention and subsequently transformed or immortalised to become a continuously dividing cell line.
  • the cell prior to modification is conveniently a well characterised and continuously dividing biotechnology compatible continuous cell line known in the art. Such cells are conveniently available from depositing organisations such as the American Type Culture Collection (ATCC) or European Collection, of Cell Cultures (ECACC).
  • ATCC American Type Culture Collection
  • ECACC European Collection, of Cell Cultures
  • Suitable mammalian cell lines include, but are not limited to, RK.1.8, BHK, VERQ, HBOC-143B, HaCat, HepG2, HeLa, HT1080, HEK-293, RD > COS-7, CHO, Jurkat, HUT. SUPT, C8166, MOLT4/clone8, MT-2, MT-4 H9 PM1, CEM, myeloma cells (e.g., SB20 cells) and CEMX174 are available, for example, from the ATCC.
  • the cell is a CHO cell.
  • Prior art CHO cell lines which do not encode viral host name genes, do not support manufacture of vaccinia or vaccinia derivatives substantially unable to replicate in man.
  • the cell is a human cell, a primate ceil, a hamster cell or a rabbit cell.
  • Chimeric constructs suitable for effecting the present modified mammalian cells comprise a nucleic acid sequence encoding a poxvtral host range factor, which is operably linked to a regulatory sequence.
  • the .regulatory sequence suitably comprises transcriptional and/or translational. control sequences, which will be compatible for expression in the cell.
  • the transcriptional and translational regulatory control sequences include, but are not limited to, a promoter sequence, a 5' non-coding region, a civ-regulatory region such as a.
  • promoters may be either naturally occurring promoters, or hybrid promoters that combine elements of more than one promoter.
  • Promoter sequences contemplated may be native to mammalian cells or may be derived from an alternative source, where the region is functional in the chosen organism.
  • the choice of promoter will differ depending on the intended host cell.
  • promoters which could be used for expression in mammalian cells include the metallothionein promoter, which can be induced in response to heavy metals such as cadmium, the ⁇ -actin promoter as well as viral promoters such as the SV40 large T antigen promoter, human cytomegalovirus (CM V) immediate early (IE) promoter, Rous sarcoma virus LTR promoter, the mouse mammary tumor virus LTR promoter, the adenovirus major late promoter (Ad MLP), the herpes simplex virus promoter, and a HPV promoter, particularly the HPV upstream regulatory region (URR), among others. All these promoters are well described and readily available in the art.
  • Enhancer elements may also be used herein to increase expression levels of the mammalian constructs. Examples include the SV40 early gene enhancer, as described for example in Dijfcema et til, (1985) EM-BO J, 4:761, the enhancer/promoter derived from the long terminal repeat (LTR) of the Rous Sarcoma Virus, as described for example in Gorman et at, (1982) Prac. Nail Acad Set USA 79:6777 and elements derived from human CMV, as described for example in Boshari et al (1985) Cell 41:521, such as elements included in the CMV intron A sequence.
  • the chimeric construct may also comprise a 3' non-translated sequence.
  • a 3 , non-translated sequence refers to that portion of a gene comprising a DNA segment that contains a poiyadenylation signal and any other regulatory signals: capable of effecting mRNA processing or gene expression.
  • the poiyadenylation signal is characterized by effecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor. Poiyadenylation signals are commonly recognized by the presence of homology to the canonical form 5° AATAAA-3' although variations are not uncommon.
  • the 3 * non- translated regulatory DNA sequence preferably includes from about. 50 to 1 ,000 nts and may contain transcriptional and translational termination sequences in addition to a poiyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression.
  • the chimeric construct further contains a selectable marker gene to permit selection of cells containing the construct.
  • Selection genes are well known in the art and wi ll be compatible for expression in the cell of interest.
  • expression of the viral host range gene is under the control of a promoter.
  • the promoter is a cellular constitutive promoter, such as human EF1 alpha (human elongation factor 1 alpha gene promoter), DHFR (dihydofolate reductase gene promoter) or PGK (phosphoglycerate kinase gene promoter) that direct expression of a sufficient level of CP77 to sustain viral propagation in the absence of significant toxic effects on the host cell.
  • Promoters may also be inducible, such as the cellular' inducible promoter, MTH (from a metallothionein gene) viral promoters are also employed in mammalian ceils, such as CMV, RSV, SV4, and MolB.
  • MTH from a metallothionein gene
  • the expression of the viral host range gene supports propagation of the virus to generate virus yields equivalent to that .observed in permissive cell lines.
  • the expression of the viral host range gene for example, supports a virus replication amplification ratio of more than 500.
  • the expression of the viral host range gene supports viral propagation in the absence of significant host cell toxicity.
  • Significant host cell toxicity refers to a level of viral host range factor expression that reduces viral yield due to premature host cell death or failure to divide. The skilled artisan is familiar with methods for qualitatively or quantitatively assessing host cell parameters such as host cell survival and multiplication, and viral parameters, such as viral host range gene expression, viral replication and viral yield.
  • the poxvirus is a chordopox vims, other than a orthopox virus that encodes a functional CP77 or CP77 orthoiog.
  • Cowpox virus encodes CP77 and is therefore not encompassed in this aspect
  • Orthopox viruses include, buf opox virus, cowpox virus, camelpox virus, ectronielia virus, monkeypox virus, rabbitpox vims, racconpox virus, teterapo virus, vaccinia virus, volepox virus, skunkpox virus, and Uasin Gishu disease virus of horses.
  • parapox viruses include the parapox viruses, avipox viruses, capripoxviruses, leporipoxviruses, swinepox viruses, molluscipoxviruses and. yalapoxviruses.
  • the poxvirus is MVA or a derivative of M A that is substantially unable to replicate in man/ a subject.
  • the poxvirus is vaccinia or an derivative of vaccinia that is substantially non-replicaliye in vivo in man.
  • the poxvirus is suitable for use as a poxviral vaccine.
  • the poxvirus is a recombinant poxviral vector which encodes and expresses a heterologous molecule of interest such as an antigen of medical interest, wherein the recombinant poxviral vector is for use as a diagnostic, therapeutic or prophylactic agent in a subject.
  • K1L means the gene described by Shisler and Jin (2004) and orthologs or modified form thereof.
  • SPI-1 means the host range gene described by Brooke et at. (1995) or orthologs and modified forms thereof.
  • the instant enhanced viral propagative process does not. require additio of genes to the poxviral genome. This does not, of course, exclude modifications of viral vectors for other purposes, such as, without limitation, to encode heterologous molecules ' as antigens of interest for vaccine purposes or to engender an immune response in a subject.
  • the pox viral .host range gene expressed by the infected cell line is CP77.
  • a permissive cell line such as 143 B.
  • confluent plaques are observed within two days from infection.
  • the level of viral propagation in the modified cell provides an amplification ratio of at least 10 to 5000.
  • Amplification ratios are, in some embodiments, between 500 and 3000, or between 1000 and 4000.
  • the promoter driving expression of the heterologous pox viral host, range gene provides a. level of pox viral host range heterologous gene expression in the cell.
  • the level of CP77 expression can be similar to or exceed that produced by cowpox virus in. permissive cells,
  • the promoter driving expression of the heterologous pox viral host range gene provides a level of heterologous gene expression in the- cell sufficient to allow viral propagation at least to the level of viral propagation in a permissive cell.
  • poxviral pjxxluction in a CHO cell line is equal to or exceeds the level of poxviral production in a positive control ceil
  • the level of MVA viral production in CHO cells is substantially equal to or exceeds the level of MVA viral production in CEF cells.
  • CP77, K1.L and/or SPI-1 is/are encoded by a contiguous sequence of nucleotides that is codon optimised for expression in mammalian cells.
  • the codon optimised nucleic acid sequence encoding CP77 may have less than 80% or less titan 75% nucleotide sequence identity to the sequence encoding the cowpox CP77 protein of the Brighton Red strain (UniprotKB/Swiss-Prot:P12932.1 ).
  • the codon optimised sequence has the sequence set forth in SEQ ID NO: 1 or is a functional variant comprising a nucleic acid sequence that has at least 70% sequence identity to the sequence set forth in SEQ ID NO; 1.
  • the CP77 virus host range factor has an amino acid sequence set forth in SEQ ID NO: 2 or has at least 70% amino acid sequence identity to the amino acid sequence set forth in SEQ ID .NO: 2.
  • kits comprising or consisting essentially of a population, such as a clonal population, of modified mammalian ceils expressing CP77 from their genome as described herein, in some embodiments, the modified cell does not contain a vaccinia virus,
  • the present description further describes a process for or method of manufacturing a poxvirus that does not propagate in CHO cells, the process comprising propagating the poxvirus in vitro in a mammalian cell line wherein the cell line is modified to encode and express CP77 under the control of a promoter.
  • the process may further comprise isolating viral particles.
  • the cell line is conveniently a mammalian cell line known to those of skill in the art to be suitable for the manufacture of a medicament or therapeutic, diagnostic or proph y 1 acti c agent .
  • the specification describes a modified CH cell, wherein the CHO cell is modified to encode CP77 and express same from its genome under control of a promoter.
  • the modified CHO cell line ustains propagation of a virus that is less able or unable to propagate in an unmodified control CHO cell which is one that does not express CP77.
  • the virus is an orthopox vims other than an orthopox virus that encodes CP77.
  • cowpox virus is a pox virus that encodes CP77.
  • the virus is vaccinia or a derivative of vaccinia that is substantially non-replkative in vivo in man/a subject.
  • the virus is MVA.
  • the specification provides a method o propagating a poxvirus- which is substantially non-repMcative in man, the method comprising: (i) culturing a CHO cell which has been transformed to express CP77; and (ii) infecting the cultured CHO ceil from (i) with the poxvirus which is substantially non-replicative in man.
  • the specification pro vides a method of propagating a poxvirus which is substantially non-replicative in man, the method comprising: (i) culturing a CHO cell which has been transformed to express CP77 and D13L and/or K1L, and (ii) infecting the cultured CHO cell from (i) with the poxvirus which is substantially non-replicative in man,
  • the specification provides a method of propagating MVA. the method comprising; (i) .culiurmg a CHO cell which has been transformed to express CP77 and D13L and/or KIL and (ii) infecting the cultured CHO cell from (i) with MVA.
  • the specification provides a method of propagating, a vaccinia derivative which is substantially non-replicative in man, the method comprising: (i) culturing a CHO cell which has been transformed to express CP77 and D . 13L and/or K1L and (ii) infecting the cultured CHO cell from (i) with the vaccinia derivative.
  • the specification provides a method of propagating MVA encoding a heterologous protein, the method comprising: (i) culturing . a CHO cell which has been transformed to express CP77 and D13L and/or KIL and (ii) infecting the cultured CHO cell from (i) with the MVA.
  • the specification provides a method of propagating, a vaccinia derivative encoding a heterologous protein, which is substantially non-replicative in man, the method comprising: (i) culturing a CHO cell which has been transformed to express CP77 and DDL and/or KIL and (ii) infecting the cultured CHO cell from (i) with the vaccinia derivative.
  • the present specification provides an artificially created vector, polynucleotide or plasmid comprising the nucleic acid sequence of a vims host range gene operably connected to regulatory elements such as a promoter for expression in a mammalian cell line.
  • the virus gene is cowpox. ankyrin repeat domain-containing protein CP77 gene (UniProtKBSwiss-Prot PI 2932.1 (G25LBR. CP77 protein] .
  • the virus host range gene, such as. CP77 is codon optimised for expression in a mammalian cell line. Suitable vectors and plasmids are known in the art.
  • the polynucleotide encodes CP77.
  • the polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 1 (codon optimised for expression in mammalian cells such as CHO).
  • the isolated polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 1. or a variant thereof that encodes the amino acid sequence set out in SEQ ID NO: 2,
  • the present specification described a transposition delivery vector for stable insertion of a virus host range gene into a mammalian cell.
  • the present description also provides a method of transforming a mammalian or higher eukaryotie culture cell which is substantially non-permissive to a virus, into a cell which is permissive to the virus, the method comprising transforming the ' cell to express CP77.
  • the method includes transfecting the cell with a vector capable of directing expression of an encoded CP77 under the control of a mammalian promoter
  • the vector is a transposition delivery vector encoding CP77 under the control of a mammalian promoter.
  • the promoter is a cellular constitutive promoter, such as human EFl alpha (human elongation factor 1 alpha gene promoter), DHFR (dihydofolale reductase gene promoter) or PGK (phosphoglycerate kinase gene promoter) that direct expression of a sufficient level of CP77 to sustain viral propagation in the absence of significant toxic effects on the host cell.
  • Promoters may also be inducible, such as the cellular inducible promoter, ⁇ TH (from a metallothionein gene) viral promoters are also employed in mammalian cells, such as CMV, RSV. SV4, and MoU3.
  • die cell is a CHO cell.
  • the virus is a poxvirus
  • the poxvirus is a vaccinia derivative which is nonpathogenic or non-replicating in man.
  • isolated is meant material that is substantially or essentially free from components that normally accompany it in its native state.
  • an "isolated polynucleotide” or an “isolated polypeptide” and the like, as used herein, refer to in vitro isolation and/or purification of a polynucleotide or polypeptide molecule from its natural cellular environment, and from association with other components of the cell.
  • an isolated composition, complex, polynucleotide, peptide, or polypeptide can refer to a native sequence that is isolated by purification or to a sequence that is produced by recombinant or synthetic means.
  • Variants include nucleic acid molecules sufficiently similar to a referenced molecule or their complementary forms over ail or part thereof such that selective hybridisation may be achieved under conditions of medium or high stringency, or which have about 60% to 90% or 90 to 98% sequence identity to the nucleotide sequences defining a referenced poxvirus host, range factor over a comparison window comprising at least about 15 nucleotides.
  • the hybridisation region is about 12 to about 18 nucleobases or greater in length.
  • the percent identity between a particular nucleotide sequence and the reference sequence is at least about 80%, or 85%, or more preferably about 90% similar or greater, such as about 95%, 96%, 97%, 98%, 99% or greater.
  • homologs Percent identities between 80% and 100% are encompassed. The length of the nucleotide sequence is dependent upon its proposed function, Homologs are encompassed.
  • homolog “homologous genes” or “homologs” refers broadly to functionally and structurally related molecules including those from other species, Homologs and orthologs are examples of variants.
  • Nucleic acid sequence identity can be determined in the following manner.
  • the subject nucleic acid sequence is used to search a nucleic acid sequence database, such as the GenBarik database (accessible at web site http://www.ncbi.nln.nih.gov/blast/), using the program BLASTM version 2.1 (based on Altsehul et at (1997) Nucleic Acids Research 25:3389-3402).
  • the program is used in the ungapped mode. Default filtering is; used to remove sequence homologies due to regions of low complexity. The. default parameters of BLASTM are used.
  • Amino acid sequence identity can be determined in the following manner.
  • the subject polypeptide sequence is used to search a polypeptide sequence database, such as the GenBank database (accessible at web site http://www.nebi.nln.nih.gov/btast/), using the BLASTP program.
  • GenBank database accessible at web site http://www.nebi.nln.nih.gov/btast/
  • the program is used in the ungapped mode.
  • Default filtering is used to remove sequence homologies due to regions of low complexity.
  • the default parameters of BLASTP are utilized. Filtering for sequences of low complexity may use the SBG program.
  • hybridize under stringent conditions refers to the ability of a nucleic acid molecule to ybridize to a targe nucleic acid molecule (such as a target: nucleic acid molecule immobili ed on a DNA or RNA blot, such as a Southern blot or Northern blot) under defined conditions of temperature and salt concentration.
  • typical stringent hybridization conditions are no more than 25"C to 30°C (for example, 10°Q belo the melting temperature (Tm) of the native duplex (see generally, Sambrook et aL, (supra); Ausubel ei !., (1999)).
  • exemplary stringent hybridization conditions are 5°C to RFC below Tm
  • vector is meant a polynucleotide molecule, suitably a DNA molecule derived, for example, from a plasmid, bacteriophage, yeast, virus, mammal, avian, reptile or fish into which a polynucleotide can be inserted o cloned.
  • a vector preferably contains one or more unique restriction sites and can be capable of autonomous replication in a defined host cell including a target cell or tissue or a progenitor ceil or tissue, thereof, or be inlegrabie with, the genome of the defined host such that the cloned sequence is reproducible.
  • the vector can be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a linear or closed circular plasmid, an extrachromosomal element, a minichromosome, or an. artificial chromosome.
  • the vector can contain, any means for assuring self-replication.
  • the vector ca be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.
  • a vector system can comprise a single vector or plasmid, two or more vectors or plasmids, which together contain the total DN to be introduced into the genome of the host cell, or a fransposon,
  • the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
  • the vector can also include a selection marker such as an antibiotic resistance gene that can be used for selection of suitable traosformants. Examples of such resistance genes are known to those of skill in the art.
  • Reference to "gene” includes cDNA corresponding to the exons of a gene.
  • Reference herein to a "gene” is also taken to include: a classical genomic gene consisting of transcriptional and/or translational regulatory sequences and/or a coding region and/or non-translated sequences (i.e. introns, 5'- and 3'- untranslated sequences); or mRNA or cDNA corresponding to the coding regions (i.e. exons) and 5' ⁇ and 3'- untranslated sequences of the gene.
  • a classical genomic gene consisting of transcriptional and/or translational regulatory sequences and/or a coding region and/or non-translated sequences (i.e. introns, 5'- and 3'- untranslated sequences); or mRNA or cDNA corresponding to the coding regions (i.e. exons) and 5' ⁇ and 3'- untranslated sequences of the gene.
  • regulatory element or “regulatory sequence” is meant nucleic acid sequences (e.g., DMA) necessary for expression of an. operably linked. coding sequence in a particular host cell.
  • the regulatory sequences that are suitable for prokaryolic cells for example, include a promoter, and optionally a cis-acting sequence such as an operator sequence and a ribosome binding site.
  • Control sequences that are suitable for eukaryotic cells include promoters, polyadenylation signals, transcriptional enhancers, translational enhancers, leader or trailing sequences that modulate mRNA stability, as well as targeting sequences that target a product encoded by a transcribed polynucleotide to an intracellular compartment within a cell or to the extracellular environment.
  • complementary sequences and parts of these sequences are encompassed.
  • the term "complement” and “complementary” when used in connection with a nucleic acid molecule refers to the complementary nucleic acid sequence as determined by Watson- Crick base pairing.
  • the complement of the nucleic, acid sequence 5'CCATG3' is 5 €ATGG3 * .
  • hybridizing specifically to refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA.
  • vertebrate subject refers to any subject, particularly a vertebrate subject, and even more particularly a mammalian subject, for whom therapy or prophylaxis is desired.
  • Suitable vertebrate animals that fall within the scope of the invention include, but are not restricted to, primates, avians, livestock animals (e.g., sheep, cows, horses, donkeys, pigs), laboratory test. animals ⁇ e,g. r rabbits, mice, rats, guinea pigs, hamsters), companion animals (e.g., cats, dogs) and captive wild animals (e.g., foxes, deer, dingoes).
  • a preferred subject is a primate such as a human in need of treatment or prophylaxis. However, it will be understood that the aforementioned terms do not imply that symptoms are present.
  • VAC V-C P fails to grow in CHO eetts
  • CHO and Vero cells were cultured to confluency in one 6- Well plate (6-WP) per cell line. Each well was infected with 4 10(4) ptu of VACV-COP YSS02 for 45 minute at room temperature and then incubated at 37°C/5%C02 thereafter. From each cell line, the contents of 2 wells where harvested and pooled at 24h. 48h, 72h post infection. Viral, extracts were made by freeze thawing three times and storing at. -80 e C until ready for titrations. Each extract was tiired using Vero cells as described in the Protocol described in Example 4.
  • a homogenation probe may be used to break up these large insoluble clumps.
  • Each well to be harvested contains 2mL of MM.
  • 2 wells were pooled to give a total, volume of 4mL per time point.
  • TE buffer may be added to give a total volume of 6mL per time point,
  • VACV-PH22 is a recombinant vaccinia vims Copenhagen strain expressing the native 025 L ORF from the Brighton strain of cowpox virus that codes for the CHO host range protein, CP77. This ORF in vaccinia is also under the control of the BR025L native promoter. The native BR025L gene (native promoter and ORF) was cloned to create pPH22 which also codes for a red fluorescent protein, DsRed-Express2. pPH2 is an integration vector that will insert the BR025L gene and the DsRed gene into the B.19R ORF of VACV-COP, which codes for the soluble and cell surface IF alpha/beta receptor protein.
  • Insertion of the BRQ25L and DsRed into VACV-COP was achieved by- homologous recombination as a result of infecting CHO with a low multiplicity of VACV- COP arid transection with. pPH22, Only virus containing the BRG25L gene will be amplified further in CHO cells which can be visually verified by the presence of red fluorescent infected cells or plaques.
  • Virus extracted 3 days after homologous recombination was amplified three times in CHO and then titred in Vero ceils before using in this multistep growth stud in CHO cells.
  • Vero YVHO-VERO-MCB passage No 141 , 08/08/2(305
  • CHO and Vero cells were cultured to confl.uen.cy in 2 T25 flasks per cell line. 1 flask of each cell line was infected with lx l0 s pfu of VACV-COP VSS02 and one each with lxl0 s pfu of VACV-PH22 for 45 minutes at room temperature and then incubated at 37°C/5%C02 thereafter. From each ceil line, the contents of eac flask where harvested 96h post infection. Viral extracts were made by freeze thawing three times and storing at - 80°C until ready for titrations. Each extract was tilted using Vero cells as described in the protocol detailed in Example 4 in 24 well plate formats;
  • CP77 when expressed by a recombinant vaccinia virus, VACV-PH22, amplification of the inoculum was achieved by about 700 fold. Expression of the CP77 did not limit vaccinia host range to only CHO cells, as infection of vero cells with VACV-PH22 als amplified the inoculum. However, the level of amplification may not be as good as ⁇ vaccinia without CP77. Since the standard error of the titration results are so large the difference in yield may not be significant.
  • CP77 binds to and removes the HMG20A from the newly synthesized vaccinia genome located in the viral factories, thus enabling the vaccinia life cycle to continue in CHO cells. It is postulated herein that CP77 enables the newly synthesized genome to be available for packaging which otherwise would not be available in CHO cells due to HMG20a binding to and "locking up" the genome.
  • CP77 Since the function of CP77 is not required for viral amplification in permissive cell lines, such as Vero, it is proposed herein that there is an alternative equivalent protein, even a cellular protein, that has this function which maybe be inactive or absent in at least CHO cells but active or present in permissive cell lines.
  • the alternative protein could render CP77 not required and thus over the evolution of vaccinia it was subsequently deleted or rearranged, as its loss of function was not essential for the broad host range.
  • a CHO cell line was constructed to express the CP77 protein.
  • a VACV-COP recombinant virus expressing a green fluorescent protein (EGFP) forms plaques which develop into a confluent infection within a few days of infection.
  • EGFP green fluorescent protein
  • Vaccinki-COP is a recombinant vaccinia virus of the Copenhagen strain (VACV-COP) that has inserted, into the A39R ORF an expression cassette consisting of a strong vaccinia virus early/late promoter operatively linked to the protein coding sequence of Enhanced Green Fluorescent Protein (EGFP) and terminated by the poxvirus early .transcriptional stop sequence.
  • EGFP Enhanced Green Fluorescent Protein
  • EGFP Enhanced Green Fluorescent Protein
  • the CP77 protein coding sequence was synthetically made by GeneArt GmbH (Germany) by recreating (back translation or reverse translation) the DNA sequence from the amino acid of the CP77 encoded by the 025L ORF of the cow poxvirus Brighton Red strain UniProtKB/Swiss-Prot: P12932. L and codon optimised for expression in mammalian cell (CHO) cells. See SEQ ID NO; 1 for the codon optimised nucleotide sequence for the expression of the protein coding sequence of CP77.
  • the codon optimized CP77 protein coding sequence from pPH51 (a cloning plasmid harbouring the codon optimized CP77 protein coding sequence) was PCR amplified using PCR primers where the 5' primer was designed to add a kozak sequence around the start codon and the 3" primer was designed to add the flag-Tag sequence prior to the stop codon.
  • the amplified PCR product was subcloned into the transposon piggybac vector pJ5Q7 ⁇ 2 (Hyg+) purchased from. DNA2.0 Ine (USA) via the Bsa I doffing site.
  • Membrane 2 was probed with 1 : 100 dilution of anti -CP77 antisera overnight at 4°C, washed 3 times with TBST, and then probed with secondary antibody, 1:5000 dilution of HRP conjugated anti- rabbit antibody (GE Healthcare) for 2 hours. Both membranes were then washed 3 times in TBST and treated with ECL western blotting detection reagents (GE Healthcare) and exposed to X-ray film as instructed by the user manual.
  • Plaque assay in CHO and p-LL7-CHO CHO and p ⁇ LL7-CHO cells were seeded into multiple 6 well plates and were cultured until the cell monolayers were 100% confluent.
  • a recombinant Vaccinia virus (Copenhagen strain) harbouring an EGFP expression cassette (green .fluorescent protein) under the control of an earlyflate vaccinia virus promoter (SCV401C) was used to infect the cells. Due to the unknown titre of SCV401C, 10 ⁇ of the stock virus was firstly diluted in lml of MM medium (Dil 1: 1 :.100 dilution), and then infected each well with 500 ⁇ of the viral diluent. Day 1 post infection, high .raoi infection was noticed where most cells were fluorescing green. It. was decided to perform a further 1 :20 dilution of Dil 1, by adding 100 ⁇ l Dil 1 into 2ml of MM medium (Dil 2). Then this was used to infect each well with 500 ⁇ l of Dil 2.
  • VACV-COP expressing green fluorescent protein (SCV401C) does not propagate in CHO cells as expected.
  • the single cells fluorescing green are the result of vims entering the cell, expressing its gene including EGFP but. unable to produce new infectious viral particles and therefore unable to spread the infection to the neighbouring cells.
  • the vaccinia virus is able to produce new infectious viruses that, spreading to the neighbouring cells for form a foci of infection by day 1 post, infection. These foci of infection became a confluent infection by the next two days post infection where by day 3 the entire cell monolayer was infected with SCV401C.
  • CHO cells expressing the host range protein, CP77 are permissive to vaccinia virus infections unlike the parental (native) CHO cells.
  • HMG20A belongs to a family of proteins containing the HMG box domain.
  • HMG proteins are chromosome remodeling proteins that recognise distorted DNA structures, such as GTUci.fo.rms. They can also induce DNA bending by binding to the -minor groove in DNA, HMG box- containing proteins are therefore considered important in chromosome remodeling during DNA replication, recombination, or repair.
  • certain HMG box-containing proteins can affect gene transcription by interacting with transcription factors at the promoter site.
  • Hsiao et al. 2006 had shown that CP77 binds HMG20A in CHQ-K 1 cells.
  • This host cell protein, HMG20A seems to bind the viral DNA in the viral factories of vaccinia infected CHO ceils and it was postulated that this host cell protein "locks up" the DNA in viral factories and prevents then next stage of the vaccinia life cycle and thus preventing the production of progeny infectious virus.
  • Expression of CP77 by the cowpox virus seems to remove host HMG20A off the viral DNA and allow the viral life cycle to recommence with the eventual production of progeny infectious virus particles.
  • Multistep growth kinetic study was conducted in p-LLQ7-CHO: The permissive nature of a CHO cell line expressing the host range gene CP77 to vaccinia virus infection was assessed and the level of viral production to the production levels attained in a naturally permissive human cell line - 143B was compared.
  • the aim was to compare the propagation characteristic of VACV-CGP in P-LL07-CHD, CHO and 143B cell lines.
  • the functionality of the expressed CP77 by P-LL07-CHQ was tested by examining the amplification, characteristic of VACV-COP within this cell line compared to its amplification characteristic in CHO (non- permissive) and 1.43B (permissive) cells.
  • CHO setup One 6-Well Plate (6WP) was seeded with CHO cells and was cultured until confluent in growth: medium (RPMI+10% FBS).
  • P-LL07-CHO setup 6-Well Plate (6WP) was seeded with p-LL07-CHO cells and was cultured until confluent in growth medium (RPMI+10% FBS+500 ug/m1 HygromyeinB).
  • Infections Culture medium was removed from each well of each plate where 500 u L of diluted virus was added and left to incubate at room temperature for 1 hr for cell to adsorb the virus. Virus inoculum was then removed and each infected well was washed once with 1mL sterile PBS and then incubated in 2mL of MM per well at 37°C/5%C02, [0194] Harvesting: Two sets of wells from each plate where harvested at the following times post infection: 24h, 48h, and 72h.On the day of harvesting, cells were scraped into the culture medium where two set of wells from each cell line was combined and the cells pelleted by centrif ligation at IGOOg for 5 min.
  • Each ceil pellet was resuspended in lmL of lOmM TrisHCl pH8. The resuspended cell pellet was then subjected to three cycles of freeze-thawing and stored at -80°C until ready for titration.
  • Infections Growth medium was removed from each well and infected with lmL of each dilution (4 wells per dilution, one plate for each virus starting from lO "2 dilution) for lb. at room temperature. After the incubation, each plate was move to the incubator and incubated at 37°C/5%C02 for 3 days for plaques to develop.
  • Standard error (SE) at 95% confidence was calculated from the 4 titration values that constituted the mean using the following fomiula: 1.95 x (SD/Vn) where: SD is the standard deviation from a small sample, n is the number of titration replicates (4 in this case).
  • Multistep growth kinetic studies were carried out in 6 well plates - two wells per cell line per time point. Each well was infected with 4x:10 4 pfu of VACV-COP and for harvesting the 2 well for each ceil line and lime point was harvested and combined from which a viral extract was prepared. This viral extract, total volume of ImL represent 2 combined infection resulting from an inoculum size of 8x10 4 pfu (4x10 4 pfu X 2) was then titred. Titration was carried out using two indicator cell lines 143B and Vero.
  • VACV-COP did not amplify in the non-permissive CHO ceils, i.e., it produced less virus than the amount used in the input inoculum.
  • virus amplification in the CHO cell line expressing the host-range gene CP77 was about 2000 times more than the input, inoculum (based on titration results using 143B cells as the indicator cell One).
  • Amplification from the permissive cell was about 3000 times more than the input inoculum. Because the standard errors overlap the difference in amplification between the P-LL07-CBO and 143B cells are not statistically significant.
  • vaccinia virus is not permissive in CHO cells as the level of viral production was very much less that the amount of virus used as inoculum.
  • CHO express the covvpox virus host range gene encoding CP77 protein, it now becomes permissive to vaccinia virus and support the production of virus to the same levels seen in a permissive cell line. It is also noteworthy that it only required expression of one host range gene, CP77, to convert this cell line into a "usable" permissive cell substrate for the production of vaccinia.
  • CHO is a biotechnology friendly cell line in that it grows as fast as bacteria, it can be cultured in defined synthetic culture medium without the requirement for biological additives such as Foetal Bovine Serum and can be cultured as a cell suspension in bioreactor, CHO also has a history of producing biological medicinal products, has been well characterised and is known and liked by the biomedical control agencies such as FDA and EMEA.
  • a transgenic CHO cell line expressing the CP77 protein under the control of a constitutive cellular promoter is permissive to vaccinia virus replication and propagation to the same levels seen in a naturally permissive ceil line that yields high levels of progeny virus.
  • GM Growth Medium
  • MM Maintenance Medium
  • Cell setup 143B, CHO and P ⁇ LL07 ⁇ GHO cells were seeded into multiple 6 ⁇ well plates and were cultured in growth medium (GM) at 37°C/5% COaunti! the cell monolayers were 100% confluent. One plate per ceil line was cultured.
  • GM growth medium
  • a recombinant MVA harbouring a GFP expression cassette (green fluorescent protein) was used to infect cells cultured in the 6- welt plates. Due to the unknown titie of MVA-GFP, the virus was serially diluted in maintenance medium (MM) as follows: o Dil 1; 20 ul of the stock virus was diluted in 2ml of MM medium (1: 100 dilution) and mixed by vigorous vortexing. o Dil 2: 500 ul of Dil 1 was added to 4,5 ml of MM (1: 10 3 dilution) and mixed b vigorous vortexing. o Dil 3:500 ul of Dil 2 was added to 4.5 ml of MM (1: 10* dilution) and mixed by vigorous vortexing.
  • MM maintenance medium
  • the viral infection was viewed under the fluorescent microscope (Olympu 1X51 ) with GFP filter (Cat#U-MGFPHQ, Olympus). The image was captured using eellSens Digital imaging Software (Olympus).
  • MVA expressing green fluorescent protein does not propagate in CHO and 143B cells as expected.
  • the single cell fluorescing green are the result of vims entering the cell, expressing it's gene including GFP but unable to produce new infectious viral particles and therefore unable to spread the infection to the neighbouring cells.
  • MVA is able to produce new infectious viruses that spreads to the neighbouring cells to form foci of infection by day I post infection with further development by day 3.
  • the cell pellet was resuspended in 500 ul of 100 ffiM Tris-HCl pH8 buffer.
  • the resuspended- cell pellet was freeze and thawed at least three times to release virus from the infected cells.
  • MVA thai was harvested from the CHO cell line expressing CP77 still maintained its restricted host range by not being able to propagate in the non-permissiv cells line CHO (hamster) and 143B ceil (human). The lack for green fluorescent foci over the three day period post infection of CHO and I43B cells demonstrates that, no infectious progeny virus was produced in these cell lines. However, this MVA still maintained its
  • CHO cells expressing the host range protein CP77 are permissive to MVA infections unlike the parental (native) CHO cells.
  • Plasmid INSERT/CASSETTE Configuration is as follows. Insert/Cassette Map, pLL7 clone #3 was sent for sequencing.
  • Expression plasmids encoding Flag-tagged-G 1 L or Flag-tagged -17L were constructed and used to make transgenic 143B cell lines expressing these proteins. Even though these cells had been amplified in the presence of Geneticin to positively select transduced cells and PCR analysis had confirmed the presence of these protein coding sequences within the genomes of -these cell lines, western blot analysis failed to detect the presence of expressed Flag-tagged -proteins when probing with an anti-DDDDK antibody.
  • the flag- tagged protein coding sequences are under the control of constitutive human promoter EFlaplha, these expression cassette together with the MPT 11 expression cassette (neomycin, resistance gene) are flanked by Left and Right Transposon borders to form an artificial transposon element.
  • the Transposon enzyme expression cassette that mediates irreversible integration of the transposon element into the host genome.
  • Cells carrying these transposon elements can be positively selected for by including G418 (Geneticin) into, the cell growth medium.
  • the plasmid vector pLL08 (Flag-tagged-GIL) and pLLlO (Fiag-tagged-I7L) were firansfected into 143B cells to create two transduced transgenic cell lines: G1 L-143B (containing the G IL expression cassette), and J7L-143B (containing the I7L expression cassette).
  • Cells with successful transposon integration were amplified to workable amounts by the inclusion of Geneticin in the growth medium.
  • To verify successful integration- total cellular DNA. was extracted from these transgenic cells using the DNeasy DNA extraction kit from Qi.ag.en.
  • Flag-tagged-G1L protein could be detected in the protein extract from the G1L-143B sample.
  • Bacterially expressed Flag- tagged-- I7L protein can be detected by the anti-Flag-tag antibody but the antibody could not detect Flag-tagged-I7L expression by the I7L-.143B cell line.
  • DI3L as an example of an essential structural maturation or assembly protein is expressed by mammalian cell and rescues vaccinia with deletion of the D13L gene an
  • D13L deleted vaccinia expresses protein in infected cells
  • Stable integratio of this tagged D13L-CHO codon optimised expression cassette consisting of a mammalia promoter and a mammalian poly-adenylation signal sequence into the nuclear DNA was achieved by Transposoii integration technology of the type reported b Ursehitz et al. 2010 and Matasei et al, 201 1. Transduction of CHO was achieved by usin the piggy Bae vector system purchased from DNA2.0 Inc (USA).
  • D13L protein coding sequence The DI3L protein coding sequence was synthetically made by GeneArt of LifeTechnoIogies by recreating the DNA sequence from the D13-amino acid encoded by the D13L ORF of the Vaccinia viru Copenhagen strain and codon optimised for expression in CHO cells. The protein coding sequence of the VACV-COP Dl 3L ORF is shown in the Sequence listing. [0229] Construction of D13L cell transducing vector - The codon optimized D13- protein coding sequence (D 13LchoTagged) from. pLL17 was PGR amplified and s.ubeloned into the transposon piggyBae vector pJ503-2 (pHULK piggyBae.
  • Mammalian Expression Vector with CometGFP and Neo+ purchased from DNA.2.0 Inc (Cat # pJ503- 2) via the Bsa I cloning sites to produce pLL19. Cloning between the Bsal by In -Fusion cloning (Clontech: ligase free cloning) removes the comet GPF coding sequence and replaces it with the tagged DB-ptofein coding sequence by in. vitro homologous recombination.
  • the D 1.3 lx:haTaggedptcAe;i& coding sequence is now under control of the human Elongation Factor 1 alpha promoter (EFla) and will be co-expressed with the Neomycin resistance gene once both have been stably integrated into the genome of transfected cells. Stable integration into the host genome is mediated by Transposon integration of the DNA. sequence bound by the Left and Right Transposon boarder of the piggyBae vector.
  • sequence in uppercase, hold and underline text represent sequence homologous to the Bsa I site up-stream of the comet GFP in pJ 503-2 (Neo+) necessary for In-fusion cloning.
  • sequence in lowercase red and underlined text is a modified Kozak sequence.
  • sequence in normal uppercase text is homologous to the 5' end of the Ol3hchoT gged sequence in pLL17.
  • sequence in uppercase, bold and underline text represent sequence homologous to the Bsa I site down-stream of the comet GFP in pJ503-2, (Neo+) necessary for In-fusion cloning.
  • sequence in normal uppercase text is homologous to the 3' end of the D VSLchoTagged sequence in pLLl.7,
  • the expected 71 bp PCR product was cloned into Bsal cut .1503-2 (Neo+) by IhFuslon cloning (Clontech) following the manufacturer's instructions to create pLL19.
  • the medium was changed with growth medium containing lOOOug/fnL Genelicin for selecting transduced cells.
  • the selection medium was changed every 2 to 3days.
  • the transduced .cells grew to over 90 to 100% confluency, they were recovered using TrypLE Select (Gibco-Invitrogen Corp, Cat #12563-029) and seeded into a T25 flask for further cell expansion.
  • CBQ-transduced cell preparation D 13LehoTagg-ed transduced CHO polyclonal expanded cell line (p ⁇ LL19 ⁇ CHO) was cultured t .100% confluency in a T25 flask as was normal CHO cells. Cells from each flask were harvested with TrypLE Select (Gibco-Invitrogen Corp, Cat #12563-029), pelleted by low speed centrif ligation (300g for 5 minutes) washed with PBS and resuspended in 200uL of PBS,
  • Membrane 1 was probed with 1:5000 dilution .of anti-DDDDK. tag antibody [M2] conjugated in HRP (Abeam, Cat # ab49763) overnight at 4°C.
  • Membrane 2 was probed with 1:2000 dilution of Rabbit D13-antisera overnight at 4°C, washed 3 times with TBST, and then probed with secondary antibody, 1 :5000 dilution of HRP conjugated anti-rabbit antibody (Abeam, Cat # ab97069) for 2 hours. Both membranes were then washed 3 times in TBST and treated with ECL western blotting detection reagents (GE Healthcare) and exposed to X ⁇ ray film as instructed by the user manual.
  • ECL western blotting detection reagents GE Healthcare
  • the conserved late promoter sequence together with the majority of the protein coding sequence of the COP-D13L ORF was earmarked for deletion by homologous recombination and in its place, a selection/reporter cassette was inserted so that successful deletion by homologous recombination can be selected for in a CHO cell line expressing D13-protein and where infection can be visualised by red fluorescence.
  • the selection/reporter cassette consist of the CHO host range gene expressing CP77 and the DsRed-Express2 sequence under the control of a vaccinia promoter.
  • Inf-PCR-Oa3L-Fl-Fw S'CGGTACGCGGGGATGACGAAAAATAATAGTAACCA -3 * .
  • the bold and underline text (15bp) represents sequence homologous to the left end of the linearized pUC19 piasmid supplied by the ClonTech In-Fusion kit.
  • Inf-PCR-B13L-F2-F 5'-ATATTTAAATGCG €GCAATAATGGAACAAGAACCCT-3 s .
  • the bold and underline text (15bp) represents sequence homologous to the 3' end of the Selection/Reporter cassette .
  • inf-PCR-D13L-F2-Rv 3'- CGAC ⁇ TAGAGGA CGCGCTGAGGTCC iCAACTACG -3 ⁇
  • the bold and underline text (15bp) represents sequence homologous to the right end of the linearized pUC19 piasmid supplied by the ClonTech In- Fusion kit- Expected PCR product size: 62 lp
  • selection/reporter cassette consist of the CP77 CHO host-range gene from covvpox vims 025L ORE (Brighton Red strain) and the red fluorescent protein coding sequence of DsRed-Express'2.
  • This expression cassette was synthetically made by Life Technologies GeneArt so that CP77 protein coding sequence is under the control of its native promoter (lOObp of sequence upstream of the CP77 ATG start eodon) and terminated with the poxvirus early transcriptional stop sequence (T 5 NT),
  • the DsRed protein coding sequence is under the control of a vaccinia virus early/late promoter and also terminated in the poxvirus earl transcriptional stop sequence,
  • COP- D13L ORF is under th control of a vaccinia virus late promoter where the conserved late promoter element is critical for promoter activity (Moss, 2007) - deletion of this will result in the COP-D1.3L ORF becoming silenced.
  • Deletion of the protein coding sequence and conserved promoter element is effected by homologous recombination between VACV- COP and pLL09 where the result of homologous recombination is the insertion of the CP77/DsRed expression cassette into the deleted region.
  • Insertion of this expression cassette enables the recombinant virus, now designated as SCV104, to propagate in CHO cells but only cells that express a functional D13-protein such as p ⁇ LL!9-CHO> After homologous recombination contaminating "carryover" parental virus (VACV-COP) was eliminated by successive rounds of plaque purification. The presence of contaminating parental virus was monitored for by PCR analysis of the insertion site.
  • SCV104 homologous recombination contaminating "carryover" parental virus
  • Flasks 1 (homologous recombination), 2 (infection only control), 3 (uninfected control) were incubated overnight at 37°C 5%C0 2 where the following day each flask had a media change with fresh MM -- 5mL per flask and further incubated at 37°C/5%C02 until gross CPE can be seen in Flask 1 only. There should be no signs of infection in Flask 2 as VACV-COP is non-infectious to CHQ cells and the monolayer should look healthy in
  • Plaque, purification process The rationale is to serially dilute the homologous recombination extract and use each dilution to infect one row of p ⁇ LLl9 ⁇ CHO cells cultured in a 48 well plate. The aim is to dilute the virus down to 1 pfu infection per well and then looking for wells that contain only 1 fluorescent plaque after approx. 3 hr of infection before -harvesting.
  • P-LL19-CHO cells were seeded into each well of a 48- well plate and culture t 100% in growth medium (RPMI- 1640/10% FBS/2mM Glutamax pen-sttep) containing lOOOug/mL Geneticin at 37°C/5% C(
  • the homologous recombination extract (SCV 104) wa thawed and briefly sonicated to break up lumps and aggregates, Ten-fold serial dilution down to UP of the viral extract was performed using MM (RPMI/2% FBS/Glulamax/PenStrep) in ImL volumes. For each dilution, one row of the 48-well plate was seeded with 500uL of diluted virus after removing the growth medium from each well and washed once with PBS, The 48-well plate was left at room temperature for 45 minute for viral adsorption to occur.
  • the virus inoculum was carefully removed from each well where residual inoculum was removed by a washing step consisting of SOOuL of PBS pe well. After washing, 500uL of MM (RPMI/2% FBS/GIutamax/PenStrep) was added to each well and then incubated at 37°C C0 2 until fluorescent red foci of infections can be clearly seen under a fluorescent microscope.
  • MM RPMI/2% FBS/GIutamax/PenStrep
  • plaque purification process was repeat another five times.
  • a selected clone was then further amplified by infecting 1 well of a 6-well plate containing p ⁇ LL19-CHQ cells at 100% eonfluency by removing the growth medium from the well and adding 10uL of viral extract diluted to 500uL in PBS. After 45 min at room temperature 2mL of MM was added to the well and incubated further at 37°C/5%C0 2 for 3 days until majority of the cells fluoresce red tinder a fluorescent microscope. The cells within the infected well were scraped into the culture medium and then pelleted at 500g for 5 minutes. The pelleted cells were resuspended in SOOuL of lOmM TrisHCl pH8 and briefly sonicated to make a viral extract,
  • ORF of SCV104 - PCR analysis was carried to determine if after homologous recombination and plaque purification that the D13L ORF had in fact been substituted with the CP77/DsRed expression cassette.
  • a PCR primer pair was designed to bind outside the region of the two flanking homologous recombination arms- so that they would bind to "native" DNA sequence rather than "introduced” DNA. Designing the primer pair in such a manner means that this primer pair could use VACV-COP and SCV104 as DNA templates for PCR amplification and the size of the PCR products will be indicative for insertion of expression cassette into the D13L ORF or the detection of the virus with no insertion, ie. VACV-COP.
  • This PCR assay not only indicates the presence of insertion but also can identify if residual contaminating parental virus (VACV-COP) is still present after multiple rounds of plaque purification.
  • VACV-COP residual contaminating parental virus
  • the presence of unwanted trace contamination of VACV-COP is highly undesirable as this contaminant can provide in trans D13 help to SCV104 and thereby reduce the attenuation, of SC.V1.04.
  • Viral DNA was extracted from 200uLof the above SCY104 amplified virus using the DNeasy Tissue kit following tire manufacturer's instruction. Briefly this was done by adding 20ul of Proteinase K .to 2(X)uL of viral extract and mixing well. To this, 200ul of buffer AL was added and thoroughly mbced-in before incubating at 56"C (heating block) for 10 minutes. After incubation, 200ul of 100% ethanol was added and mixed-in well and then the total volume was added to a spin column.
  • the liquid was passed through the spin column by cenirif ligation as instructed by the manufacturer's user handbook followed by spin column washes with AW 1 and AW2 buffers. DNA bound to the spin column was eluted off with two lime lOOuL of AE buffer. The eluted DNA was combined into a single tub and was read for PGR analysis or stored at 4 l, C until ready for PC ' R analysis.
  • PGR amplification - DNA extracted from SCV104 was used a template for PCR amplification to determine if insertion had taken place within the D13L ORF.
  • the PCR primers describe below binds to sequences flanking outside the D13L ORF so that amplification from SCV104 DNA should amplify a PCR product of 4360bp as appose to a PCR product of 2881 bp amplified from the parental virus, VACV- COP.
  • PCR analysis showed that the 6 th plaque purified clones of SCV104 only amplify a product corresponding to greater than 4OO0bp less than SOOObp indicating SCV.104 contains CP7?/DsRed cassette in the D13L ORF.
  • the lack of a PCR product of around 3000bp means that there are no detectable levels of parental vims contamination in the SCV1.04 amplified stocks.
  • ID_m2L_LL04JFw 5'-TACAAAATCAAATAATGGTCGAAAC-3' ID
  • ID_m2L_LL04JFw 5'-TACAAAATCAAATAATGGTCGAAAC-3' ID
  • ID_m2L_LL04JFw 5'-TACAAAATCAAATAATGGTCGAAAC-3' ID
  • ID_m2L_LL04JFw 5'-TACAAAATCAAATAATGGTCGAAAC-3' ID
  • ID_m2L_LL04JFw 5'-TACAAAATCAAATAATGGTCGAAAC-3'
  • 143B cell which are permissive to vaccinia virus
  • C.HO cells which are not permissive to vaccinia virus but can be if vaccinia virus express CP77 protein and p-LL19- CHO which is a recombinant cell line expressing D 13 L protein.
  • the virus describe in thi invention which has had a CP77/DsRed expression cassette inserted into the D13L ORF so
  • Dl 3 -protein should only form, infectious foci of infection in the p-LL19-CHO cell line.
  • the presence of foci of infections within the 143B cell monolayer indicates the presence of contaminating vaccinia, virus within the viral population mix as the contaminant will be providing D13L help in trans.
  • the presence of foci of infections within the CHO monolayer means that insertion of CP77/DsRed cassette had not inactivated the D13L ORF.
  • Celt setup - 143B, CHO and p-LLl 9-CHO cells were seeded into multiple 6 well plates and were cultured in. growth medium (RPMI-1640/10% FBS/2mM Glutamax/pen- strep, and only for p-LLl 9-CHO lOOOug/mL Geneticin) at 37°C/5% C0 2 until the cell monolayers were 100% confluent.
  • growth medium RPMI-1640/10% FBS/2mM Glutamax/pen- strep, and only for p-LLl 9-CHO lOOOug/mL Geneticin
  • Infection - Amplified 3 rd plaque purified viral extract was used to infect the cells. Due to the unknown litre of this virus, 10-fold serially diluted of the stock virus was done to 10 "4 as follows; firstly, 60 ul of stock virus was diluted in 6ml of MM medium (Dil 1; 1 :T00 dilution), and then further dilutions prepared by adding 800 ul Dilution 1 to 7.2ml of MM medium (Dilution 2; 10 "3 dilution), and then repeated to make a 10 "4 dilution. For infection, 500uL of each dilution was added to each well of a 6-well plate - one plate per cell line used.
  • Viral adsorption was carried out at room temperature for 45 tnin where after the viral inoculum was removed from each well and each well washed with PBS before MM was added at 2mL per well. The plates were incubated at 3°C/5% C0 2 and observed daily under a fluorescent microscope. 1.0 "2 dilution produced the best viral infection rate for observation.
  • a rescue cell line expressing D13 protein consisting of a vaccinia permissive cell Hue which supports lytic plaque formation was made.
  • vaccinia virus expressing CP77 or cell line expression of CP77 does not support lytic plaque formations that can be stained with crystal violet and counted by eye.
  • HeLa cells were transduced to express D l 3 protein by stable integration of an expression cassette consisting of a constitutive mammalian promoter, D13-protein coding sequence containing the Kozak sequence around the start codon and terminating in a polyadenylation signal sequence.
  • This cassette was then cloned into a piasmid vector that enable stable gene transfer into the host cell genomic DNA and selection for successful integration by antibiotic selection.
  • Transduced cells were then amplified by using antibiotic selection to select for cells containing the D13 expression cassette and then a plaque assay carried out with SCV104 (D13L ORE deletion) by infecting monolayers of cells at an moi of 0.001 pfu per cells and selecting for cell-line clone that produced the largest plaque size over a 3 day period.
  • SCV104 has had its D13L ORF replaces with two expression cassette: one for the expression of CP77 protein and the other for expression of a red fluorescent protein.
  • the medium was changed to fresh growth medium containing lOOOug/mL Geneticin for selectin transduced cells.
  • the remaining cells were recovered by detaching them from the flask surface with TrypLE Select (Gibco-Invitrogen Corp, Cat #12563-029) and single cell sorted into 96-well plates containing growth medium and lOOOug/mL Genetiein. These plates were incubated at 37°C/5%C02 until colonies of cells could be seen in eac well.
  • the selection medium was changed every 2 to 3 days.
  • Each colony of cells were recovered and serially expanded by culturing in to the following: 48- well plate to 24-well plate to 6- well, plate to T75 flask and maintained in T75 flask by 1:5 split ratio until ready for making a frozen cell stock.
  • SCV104 is a vaccinia virus that has had its D13L ORF replaced with cow poxvirus 025L promoter plus ORF which codes for the CP77 protein, and a red fluorescent, protein expression cassette Ds ed Express2).
  • the CP77 expression is not important or needed for plaque formation in HeLa cells but this virus will not propagated in the absence of cell line expression of D13 protein.
  • D 13 -protein SCVI04 should be able to amplify and spread to other neighbouring cells and in doing so form red fluorescent lytic plaques in the cell monolayer. This virus was. used in a plaque formation study in clonal LL1.
  • Cell line setup a number of cell line clones of LL19-HeLa were seeded into wells of 6 well plates and cultured in growth medium containin 10QQug/mL Genetkm t 100% confloency at 37°C/5% C0 2 :
  • Virus infection SCV104 was used to infect the cells at 0,001 pfu per cell by diluting the virus in MM (RPMI-1640/2% FBS/2m Glutamax/pen-strep) to lO 3 pfu/ml. ltril of diluted virus was added to each well for infection. Each well of a 6- well plate contains approximately lxlQ 6 ceils when confluent, therefore 1ml of lO 3 pfu/ml results in an moi 0.001. An moi of 0.001 will ensure plaque formations from single infected cells.
  • Results A day 1 post infection all infections resulted in sporadic small foci of • red fluorescence. ' By day 3, all clonal cell lines produced sizable red fluorescent lytic plaque where clone 11 (Cl l) produced the significantly largest plaque sizes of all clones tested.
  • a CHO cell line expressing the D 13 and CP77 proteins would have to be constructed. Tills was done by constructing a D13 mammalian expression cassette and CP77 mammalian expression cassette consisting of a mammalian promoter to drive expression, a CHO preferred codon optimised DNA sequencing coding for the D13 or CP77 proteins followed by a polyadenylation signal sequence. These cassettes where then cloned into plasmid vectors that enable stable gene transfer into the host cell genomic DNA and selection for successful integration by antibiotic selection.
  • Transduced cells were then amplified by using antibiotic selection to select for cells thai contain both D13 and CP77 expression cassettes.
  • a vaccinia virus expressing Enhance Green Fluorescent protein (SCV505) was used to infect the transgenic cell line where fluorescent plaque development was monitor over a 4 day period.
  • Ever expanding green fluorescent plaque size over the 4 day period confirmed CP77 expression by the cell line.
  • D13 protein and a D13L deleted vaccinia virus expressing CP77 (SCV104) and DsRed fluorescent protein was used to infect the transgenic cell line where plaque development was monitor over a 4 day period.
  • Ever expanding red fluorescent plaque size over the 4 day period confirmed 013 protein expression by the cell line.
  • Canstmction of CP77 protein coding sequence the CP77 protein coding sequence was synthetically made by GeneArt GmbH (Germany) by recreating (back translation or reverse translation) the DNA sequence from the amino acid sequence of the CP77 encoded by the .025 L ORF of cow poxvirus Brighton Red strain UmProtKB/Swiss- Prot: P 12932.1 and codon optimized for expression in Chinese Hamster Ovary (CHO) cells.
  • CP77 eel! transducing vector the codon optimized CP77 protein coding sequence from pPH51 (a cloning plasmid harbouring the codon optimized CP77 protein sequence) was PCR amplified using PCR primer pair where the 5 , primer was designed to add a Kozak sequence around the start codon and the 3' primer was designed to add the Flag -tag sequence prior to the stop codon.
  • the amplified PCR product was subcloned into the transposon pig ybac vector pJ567-2 (Hyg + ) purchased from DNA2.0 Inc (USA) via the Bsal cloning site.
  • Stable integration int the host genome is mediated by Transposon integration of the DNA. sequence bound by the Left and Right Transposon boarder of the piggyBac vector.
  • CAGGAAGACGCTTTTtcaCTTGTCATCGTCATCC TGTAATCCTGCTGCTCGAAG ATCTTGTACT (SEQ ID NO: 5).
  • the Flag Tag sequence is underlined followed by the stop codon (in lowercase).
  • the CH -codon optimized D13 protein coding sequence was PCR amplified from pLL1 (as described previously) to exchange the C-termianl Flag-tag sequence to the HA -tag sequence before cloning into pJ5O3-02 (pHULK. piggyBac Mammalian Expression Vector with CometGFP and Neo+) purchased from D A2.0 inc (Cat # pJ503-2) via the Bsa I cloning sites.
  • B13L-HA ceil transducing vector the codon optimized Di3-protein coding sequence without the C-terminal Flag-tag sequence was PCR amplified from pLL.19 and subcloned into the transposon piggyBac vector pJ503-2 (pHULK piggyBac Mammalian Expression Vector with CometGFP and Neo+) purchased from DNA2.0 Inc (Cat # p.I503-2) via the Bsa I cloning sites to produce pLL29.
  • 64 sequence is now under control of the constitutive human Elongatio Factor 1 alpha promoter (EFla) and will be co-expressed with the Neomycin resistance gene once both have been stably integrated into the genome of transfected cells.
  • Stable integration into the host genome is mediated by Transposon integration of the DNA sequence bound b the Left and Right Transposon boarder of the piggyBac vector.
  • a plasmid map of pLL29 is shown below.
  • CHO cells were seeded into a T25 flask, and cultured to approximately 50% confluency in RP I- 1640/10% FBS/2mM Giutamax/pen-strep growth medium. Using the
  • Hygromyctn B for selecting transduced cells.
  • the selection medium was changed every 2 to 3 days until most of the ceils died and detached leaving colonics of ceils that were derived from single cells. Whe the transduced cells grew to over 90 to 100% confluency,
  • SCV505 is a vaccinia virus that expresses the Enhanced Green Fluorescent Protein (EGFP) and only propagate in CHO cells in the presence of CP77 protein. This virus was used in a plaque inactivity study in p ⁇ LL07-LL29-CMO to verify CP77 expression by this cell line.
  • SCV104 is a vaccinia virus that has had its DDL ORF replace with cow poxvirus 025L promoter plus ORF which codes for the CP77 protein, and a red fluorescent protein expression cassette (DsRed Express2). This virus will not propagated in the absence of cell line expression of D13 protein. This virus was used in a plaque infectivity study in p-LL07-LL29-CHO to verify D.13 expression by this, cell line,
  • Vero This cell line is normally permissive to vaccinia virus infection. Plaque formation indicating ceil to cell spread of amplified virus over time as detected by GREEN fluorescence for SCV505 infection as this virus is normally infectious in this cell line. However, no plaque formation as detected by the lack of of only single cell RED fluorescence for SCV104 infection should be seen indicating there is no cell to cell spread of amplified virus over time due to the lack of D 1.3 protein expression by cell line or virus.
  • CI l-LL.t9-HeLa this is a vaccinia vims permissive cell line expressing D13 protein via pLL19 transduction. Plaque formation from SCV505 infection is expected indicating cell to cell spread of amplified virus over time as detected by GREEN fluorescence regardless of cell line expressio of D13. Plaque formation from SCV104 infectio is expected since this virus can now amplify in this cell line due to cell line expression of D13 protein. [0284] CHO: this cell line is non-permissive- to vaccinia virus infection.
  • P-LL07-LL29-CHO this is a CHO cell line expressing both D13 and CP77 proteins. Plaque formation from SCV505 infection is expected indicating celt to cell spread of amplified virus over time as detected by GREEN fluorescence indicate the cell line expression of CP77 protein. Plaque formation from SCV104 is expected indicating cell to cell spread of amplified virus over time as detected by RED fluorescence indicates the cell line expression of D13 protein.
  • Virus infection SCV104 and SCV505 were used to infect the cells at 0.001 pfu per cell by diluting the virus in MM (RPMI- 1640/2% FBS/2mM Glutamax/pen-strep) to 10' pfu/ral.
  • One virus per plate 1ml of diluted virus was added to each well fo infection.
  • Each well of a 6-weli plate contains approximately lxlO 6 cells when confluent therefore 1ml of 1 : pfu/ml results moi 0.001. At moi of 0.001 will ensure plaque formations- front single infected cells.
  • Microscopy viewing viral infection and plaque formation over a four day period wa viewed under the fluorescent microscope (Olympus 1X51 ) with Ds ed filter
  • the D13 and CP77 proteins expressed by p-LL07-LL2 -CHO are tagged and can be detected using an antibody that specifically recognises the amino acid ta sequence on the C-teiminal end of D13 and CP77 protein.
  • weslem-blot analysis can be carried out using these anti-tag antibodies to confirm expression of D1 and CP77 proteins in the p- LL07-LL29-CHO cell line.
  • the C-terminal end of the D13 protein contains the HA- tag amino sequence of "YPYDVPDYA" where the C-terminal end of the CP77 protein contains the Flag-lag amino sequence of "DY D ' DDDK".
  • CHO without selection antibiotics p- LL07-LL29-CHO with 500ug/mL Geneticin and 250 ug ml Hygromyein B, p ⁇ LL07-CH(3 with. 250 ug/ml Hygromyein B, and CI I-LL19-HeLa with lOGOug/raL Geneticin.
  • the confluent cell monolayer was detached and digested into single ceils suspension with TrypLE Select at 37 CI C for 10 mins.
  • the cells from each flask was recovered and pelleted by centrifugation at 300g for 5 minutes and washed twice with PBS.
  • the cell pellets were resuspended in 500uL of PBS, 4* SDS-PAGB loading buffer was added to the protein extract to give a final concentration of I* and heated at 98°C for 2 to 3 minutes.
  • the denatured protein samples were electrophoresed through a Biorad Mini- PROTEAN® TGX Stain-Free Precast Gel (gradient gel) for 30 to 45 minutes at 200V. After electrophoresis, separated proteins were transferred to nitrocellulose membrane by eleetroblotting for 1 hou at 100 .
  • nitrocellulose membrane was incubated in 5% Skim milk powder in PBS for 1 hour at room temperature to block non-specific antibody binding sites.
  • the membrane was incubated in 1:1.000 dilution of Anti-HA HRP conjugated (Abeam Cat# AB 1.265) in blocking buffer o vernight at 4°C.
  • Anti-HA HRP conjugated Abeam Cat# AB 1.265
  • Flag-tagged proteins a separate eleetroblotted nitrocellulose membrane was incubated 1:1000 dilution of Anti-Flag HRP conjugated (Abeam Cat# AB49763) in blocking buffer overnight at 4"C.
  • Membranes were then washed three times in PBS. 5 minutes per wash and then incubated in ECL substrate (Thermo Scientific Pierce ECL Western- bo t substrate, Cat No 32.106) for a couple of minutes before taking the imagine using a BioRad XRS gel doc system.
  • Detection of D13 protein via HA-tag detection the anti-HA-tag antibody was able to detect a protein of the expected size from a whole cell protein extract prepared from P-LL07-LL29-CHO but no protein from a whole ceil protein extract prepared from. CHO cells. This cleared indicated that p-LL07-LL29-CHO was expressing the D13 protein.
  • the anti -Flag-tag antibod was able to detect a protein of the expected size from a whole cell protein extract prepared from p- LL07-LL29-CHO and p-LL07-CHO (CHO cell line only expressing CP77) but no protein from a whole cell protein extract prepared from. CH ' O cells. This cleared indicated that p- LL07-LL29-CHO and p-LL07 ⁇ CHO were expressing the CP77 protein.
  • the amount of vims used for infection was 4xl0 4 pfu mL.
  • yields arc expressed as 10 4 values. Values present average yield per time point, i.e., yield from 3nlL harvest (6mL divided by 2 wells).
  • the table below shows the yield of vims produced above the input level from each cell line at each harvest time point, i.e., OUTPUT/INPUT ratio.
  • Virus extract volume per flask was ImL.
  • Plating volume for titration was ImL. Therefore, virus yield equals the titration in pfu fnL multiplied by ImL (plating volume),
  • Table 4 provides the total amount of virus in each 1mL viral extract.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/AU2014/050330 2013-11-01 2014-11-03 Viral vector manufacture Ceased WO2015061858A1 (en)

Priority Applications (24)

Application Number Priority Date Filing Date Title
LTEP14858802.3T LT3063278T (lt) 2013-11-01 2014-11-03 Virusinio vektoriaus gamyba
CA2931518A CA2931518C (en) 2013-11-01 2014-11-03 Viral vector manufacture
DK14858802.3T DK3063278T3 (en) 2013-11-01 2014-11-03 PREPARATION OF VIRAL VECTORS
NO14858802A NO3063278T3 (https=) 2013-11-01 2014-11-03
JP2016550897A JP6682443B2 (ja) 2013-11-01 2014-11-03 ウイルスベクターの作製
NZ72024114A NZ720241A (en) 2013-11-01 2014-11-03 Viral vector manufacture
RU2016121425A RU2658487C2 (ru) 2013-11-01 2014-11-03 Получение вирусного вектора
EP18154084.0A EP3375882B1 (en) 2013-11-01 2014-11-03 Viral vector manufacture
RS20180588A RS57290B1 (sr) 2013-11-01 2014-11-03 Proizvodnja virusnih vektora
EP14858802.3A EP3063278B1 (en) 2013-11-01 2014-11-03 Viral vector manufacture
PL14858802T PL3063278T3 (pl) 2013-11-01 2014-11-03 Wytwarzanie wektora wirusowego
SG11201603919XA SG11201603919XA (en) 2013-11-01 2014-11-03 Viral vector manufacture
HK16111526.2A HK1223395B (en) 2013-11-01 2014-11-03 Viral vector manufacture
KR1020167014693A KR102047030B1 (ko) 2013-11-01 2014-11-03 바이러스 벡터 제조
CN201480071836.9A CN106255758B (zh) 2013-11-01 2014-11-03 病毒载体制造
HRP20180789TT HRP20180789T1 (hr) 2013-11-01 2014-11-03 Proizvodnja virusnog vektora
AU2014344738A AU2014344738B2 (en) 2013-11-01 2014-11-03 Viral vector manufacture
ES14858802.3T ES2670034T3 (es) 2013-11-01 2014-11-03 Preparación de vector vírico
SI201430731T SI3063278T1 (sl) 2013-11-01 2014-11-03 Izdelava virusnega vektorja
SM20180267T SMT201800267T1 (it) 2013-11-01 2014-11-03 Produzione di vettore virale
US15/033,541 US10544397B2 (en) 2013-11-01 2014-11-03 Viral vector manufacture
IL245363A IL245363B (en) 2013-11-01 2016-05-01 Cell lines and processes for viral vector manufacture
CY20181100533T CY1121414T1 (el) 2013-11-01 2018-05-22 Παρασκευη ιικου φορεα
US16/711,184 US20200190482A1 (en) 2013-11-01 2019-12-11 Viral vector manufacture

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
AU2013904242 2013-11-01
AU2013904242A AU2013904242A0 (en) 2013-11-01 Viral vector manufacture
AU2014900370 2014-02-07
AU2014900370A AU2014900370A0 (en) 2014-02-07 Orthopox vectors and propagation

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/033,541 A-371-Of-International US10544397B2 (en) 2013-11-01 2014-11-03 Viral vector manufacture
US16/711,184 Continuation US20200190482A1 (en) 2013-11-01 2019-12-11 Viral vector manufacture

Publications (1)

Publication Number Publication Date
WO2015061858A1 true WO2015061858A1 (en) 2015-05-07

Family

ID=53003022

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2014/050330 Ceased WO2015061858A1 (en) 2013-11-01 2014-11-03 Viral vector manufacture

Country Status (25)

Country Link
US (2) US10544397B2 (https=)
EP (2) EP3375882B1 (https=)
JP (2) JP6682443B2 (https=)
KR (1) KR102047030B1 (https=)
CN (1) CN106255758B (https=)
AU (1) AU2014344738B2 (https=)
CA (1) CA2931518C (https=)
CY (1) CY1121414T1 (https=)
DK (2) DK3063278T3 (https=)
ES (1) ES2670034T3 (https=)
HR (1) HRP20180789T1 (https=)
HU (1) HUE037718T2 (https=)
IL (1) IL245363B (https=)
LT (1) LT3063278T (https=)
NO (1) NO3063278T3 (https=)
NZ (1) NZ720241A (https=)
PL (1) PL3063278T3 (https=)
PT (1) PT3063278T (https=)
RS (1) RS57290B1 (https=)
RU (1) RU2658487C2 (https=)
SG (1) SG11201603919XA (https=)
SI (1) SI3063278T1 (https=)
SM (1) SMT201800267T1 (https=)
TR (1) TR201807128T4 (https=)
WO (1) WO2015061858A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2019528271A (ja) * 2016-08-19 2019-10-10 セメンティス リミテッド ウイルスワクチン
WO2024003346A1 (en) * 2022-06-30 2024-01-04 Bavarian Nordic A/S Mammalian cell line for the production of modified vaccinia virus ankara (mva)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2018081568A (ja) * 2016-11-17 2018-05-24 グローリー株式会社 紙幣収納装置および紙幣処理機
IL295154A (en) * 2020-01-28 2022-09-01 Lonza Walkersville Inc Methods for determining viral titer
WO2024064608A2 (en) * 2022-09-20 2024-03-28 Intergalactic Therapeutics, Inc. Best1 vectors and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5830688A (en) * 1986-09-23 1998-11-03 Transgene, S.A. DNA sequences, vectors, recombinant viruses and method which employs recombinant vaccinia viruses capable of muliplying in CHO cells

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE298370T1 (de) 1994-04-29 2005-07-15 Baxter Healthcare Sa Rekombinante poxviren mit fremdenpolynukleotiden in wichtigen regionen
WO2004015118A1 (en) * 2002-08-07 2004-02-19 Bavarian Nordic A/S Vaccinia virus host range genes to increase the titer of avipoxviruses
FR2884255B1 (fr) * 2005-04-11 2010-11-05 Vivalis Utilisation de lignees de cellules souches aviaires ebx pour la production de vaccin contre la grippe
CA2658301A1 (en) * 2006-08-04 2008-02-07 Dublin City University A method of producing recombinant biological products

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5830688A (en) * 1986-09-23 1998-11-03 Transgene, S.A. DNA sequences, vectors, recombinant viruses and method which employs recombinant vaccinia viruses capable of muliplying in CHO cells

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
RAMSEY-EWING, A.L. ET AL.: "Complementation of a vaccinia virus host-range K1L gene deletion by the nonhomologous CP77 gene .", VIROLOGY, vol. 222, 1996, pages 75 - 86, XP055339106 *
SCHUENADEL, L. ET AL.: "Generation and characterization of a Cowpox virus mutant lacking host range factor CP77.", VIRUS RESEARCH., vol. 168, no. 1-2, 2012, pages 23 - 32, XP055339104 *
See also references of EP3063278A4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2019528271A (ja) * 2016-08-19 2019-10-10 セメンティス リミテッド ウイルスワクチン
WO2024003346A1 (en) * 2022-06-30 2024-01-04 Bavarian Nordic A/S Mammalian cell line for the production of modified vaccinia virus ankara (mva)

Also Published As

Publication number Publication date
CN106255758A (zh) 2016-12-21
ES2670034T3 (es) 2018-05-29
AU2014344738B2 (en) 2019-03-21
CY1121414T1 (el) 2020-05-29
DK3063278T3 (en) 2018-06-06
EP3063278B1 (en) 2018-02-28
PT3063278T (pt) 2018-05-25
KR102047030B1 (ko) 2019-11-20
RU2016121425A (ru) 2017-12-04
JP6682443B2 (ja) 2020-04-15
US10544397B2 (en) 2020-01-28
IL245363B (en) 2020-01-30
DK3375882T3 (da) 2019-12-16
HUE037718T2 (hu) 2018-09-28
JP2020039340A (ja) 2020-03-19
IL245363A0 (en) 2016-06-30
EP3375882A1 (en) 2018-09-19
SG11201603919XA (en) 2016-07-28
PL3063278T3 (pl) 2018-08-31
AU2014344738A1 (en) 2016-06-09
US20170029784A1 (en) 2017-02-02
SMT201800267T1 (it) 2018-07-17
NO3063278T3 (https=) 2018-07-28
EP3375882B1 (en) 2019-10-16
NZ720241A (en) 2019-10-25
KR20160079868A (ko) 2016-07-06
HRP20180789T1 (hr) 2018-09-07
RU2658487C2 (ru) 2018-06-21
CA2931518C (en) 2021-03-09
EP3063278A4 (en) 2017-04-12
LT3063278T (lt) 2018-07-10
HK1223395A1 (en) 2017-07-28
SI3063278T1 (sl) 2019-04-30
JP2016534755A (ja) 2016-11-10
US20200190482A1 (en) 2020-06-18
RS57290B1 (sr) 2018-08-31
EP3063278A1 (en) 2016-09-07
CA2931518A1 (en) 2015-05-07
TR201807128T4 (tr) 2018-06-21
CN106255758B (zh) 2020-06-23

Similar Documents

Publication Publication Date Title
US20200190482A1 (en) Viral vector manufacture
US20230381297A1 (en) Attenuated poxvirus vector based vaccine for protection against covid-19
US20210113684A1 (en) Vector-based attenuated poxvirus vaccines
CN105039268A (zh) 表达鸭坦布苏病毒e蛋白的重组鸭瘟病毒及其构建方法和应用
JP2021533791A (ja) ウイルスを生成する方法及び組成物
HK1260426B (en) Viral vector manufacture
HK1260426A1 (en) Viral vector manufacture
WO2023066920A1 (en) Recombinant african swine fever virus and uses thereof
HK1223395B (en) Viral vector manufacture
JP7274138B2 (ja) Scr欠失ワクシニアウイルス
CA3088646A1 (en) Recombinant viral vector systems expressing exogenous feline paramyxovirus genes and vaccines made therefrom

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14858802

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 15033541

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 245363

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2016550897

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2014858802

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2014858802

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2931518

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 20167014693

Country of ref document: KR

Kind code of ref document: A

Ref document number: 2016121425

Country of ref document: RU

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2014344738

Country of ref document: AU

Date of ref document: 20141103

Kind code of ref document: A