WO2015060511A1 - 생체분자와 핵산의 결합정보를 생성하기 위한 마커, 이의 제조방법, 이를 이용한 생체분자 분석방법 및 장치 - Google Patents
생체분자와 핵산의 결합정보를 생성하기 위한 마커, 이의 제조방법, 이를 이용한 생체분자 분석방법 및 장치 Download PDFInfo
- Publication number
- WO2015060511A1 WO2015060511A1 PCT/KR2014/004107 KR2014004107W WO2015060511A1 WO 2015060511 A1 WO2015060511 A1 WO 2015060511A1 KR 2014004107 W KR2014004107 W KR 2014004107W WO 2015060511 A1 WO2015060511 A1 WO 2015060511A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- stranded nucleic
- biomolecule
- analysis
- biomolecules
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B40/00—ICT specially adapted for biostatistics; ICT specially adapted for bioinformatics-related machine learning or data mining, e.g. knowledge discovery or pattern finding
- G16B40/20—Supervised data analysis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B25/00—ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression
- G16B25/20—Polymerase chain reaction [PCR]; Primer or probe design; Probe optimisation
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B25/00—ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression
- G16B25/30—Microarray design
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B99/00—Subject matter not provided for in other groups of this subclass
Definitions
- the present invention relates to a reference material and nucleic acid chip for predicting the biological meaning of biomolecules in a biological sample composed of biomolecules, a method for preparing the same, and a method and apparatus for analyzing biomolecules using the same, and generating binding information of biomolecules and ligands.
- the present invention relates to a method for manufacturing an external marker and a biochip and a method for analyzing biomolecules using the same.
- biosamples containing biomolecules information that aggregates the quantitative state of these biomolecules, that is, a method of producing profiles of biomolecules, is not an ultimate goal in itself but a means to achieve the goal, It can be usefully used in cells, tissues, etc., and is widely applied to medicine, veterinary medicine, environmental engineering, food engineering, and agriculture.
- the Clinical Decision Support System which analyzes biological significance using profiles of biomolecules in biological samples, assists physicians in making decisions about diagnosis and treatment in patient care.
- the clinical decision support system is largely divided into a Case Based Machine Learning Inference System and an Expert System.
- the case-based machine learning inference system collects clinical information and biological information, ie biomolecule profile data, of patients who are diagnosed with disease, and then infers or discriminates disease based on clinical and biological information given using machine learning. It is a system to make it possible.
- An expert system is a system for diagnosing a disease using a predetermined rule by a medical expert.
- Nucleic acids are linear multimers in which nucleotides are covalently linked and nucleotides are small organic compounds that are phosphoric acid, sugars and purines (adenine or guanine) or pyrimidines (cytosine, thymidine, uracil). Nucleic acids exist in single- or double-stranded, single-stranded nucleic acids bind by hydrogen bonds and interactions between nucleotides under specific physical conditions to produce unique conformations, which are formed by single-stranded sequences. Is determined.
- nucleic acids such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are stores of information for expressing proteins with cell structure and enzyme activity, but in 1982 RNA produced enzyme-specific structures. Since the publication of its activity, there have been many reports on the structural properties of a nucleic acid and its specific function.
- DNA deoxyribonucleic acid
- RNA ribonucleic acid
- Nucleic acid is composed of four base repeats to maintain a high diversity to produce a large number of three-dimensional structure, which interacts with a specific material to form a complex stabilized.
- Nucleic acid can act as a single strand of a nucleic acid to a molecule containing a protein, high binding ability and specificity through a constant screening process and sequencing from a library of a combination of single stranded nucleic acids arranged in various nucleotide sequences Nucleic acids that bind to specific substances have been selected.
- the method of screening nucleic acids for binding to a specific substance is called SELEX (Systematic Evolution of Ligand by Exponential enrichment), and the selected nucleic acids are called aptamers (Tuerk C. and Gold L .; Science, 249). , pp 505-510, 1990).
- nucleic acids that can bind with various biomolecules with a very high affinity, including proteins that can bind nucleic acids in nature or proteins that do not bind nucleic acids, are selected.
- the existing nucleic acid selection method through SELEX prior to the selection of nucleic acid that specifically binds to a specific substance (e.g. protein), first to produce and purify the protein (specific substance) in large quantities, and then to produce
- a nucleic acid (aptamer) having a high binding capacity by reacting a single-stranded nucleic acid library with a single protein and repeating selection and amplification
- Biomolecule-single-nucleic acid can be selected in various ways, such as harvesting and washing complexes by fixing biomolecules and capillary electrophoresis.
- biomolecules including micromolecules that constitute tissues, cell masses, cells, and microorganisms, which are biological samples, are made by various methods using physical and chemical properties, and in general, molecular weights or pI values of biomolecules. Electrophoresis is used to confirm the biomolecule profile, which is a quantitative state of the biomolecule in a biological sample.
- Protein chip manufacturing method is a method of fixing by spotting (spotting) the antibody using a microarrayer (Microarrayer).
- Protein chip detection technology must be able to detect very weak signals that occur when protein chips are concentrated at a high density in a small area to provide as much information as possible on a single chip.
- the degree of integration is increasing. Accordingly, a new method for detecting quantitatively and quickly and accurately is required.
- the detection method is mainly used laser induced fluorescence (laser induced fluorescence) and the electrochemical detection method has been developed.
- laser induced fluorescence laser induced fluorescence
- electrochemical detection method has been developed.
- the aptamer chip is different from using an aptamer (nucleic acid) instead of an antibody in a protein chip, and the other elements are very similar.
- Biosamples are known to be composed of millions of proteins, but the number of known proteins is currently only tens of thousands, so technology for producing quantitative states, or profiles, of unknown biomolecules such as unknown proteins in biosamples. The need is very high.
- the present inventors conducted a biological semantic analysis using reverse-SELEX (see Korean Patent Registration No. 10-0670799), an aptamer-based nucleic acid chip (see Korean Patent Registration No. 10-0464225) and an aptamer-based nucleic acid chip to produce a profile for the protein.
- Technology see Korean Patent Registration No. 10-0923048, etc., but did not suggest appropriate reference materials and quality control methods when performing parallel high-speed analysis to produce protein profiles.
- the present invention has been proposed to solve this problem.
- biomolecules that can diagnose diseases collectively includes biomolecules that can diagnose diseases, biomolecules that can be used to diagnose diseases, biomolecules that can analyze therapeutic effects, disease development and progression. It may be used to identify biomolecules that play an important role, susceptibility-related biomolecules, and target molecules for drug development.
- An object of the present invention is to provide a reference material, a nucleic acid chip, a method for providing the binding information of biomolecules and analyte single-stranded nucleic acids in a biological sample composed of two or more biomolecules while controlling the internal quality thereof, and methods thereof Provided are methods and apparatus for analyzing biomolecules, which are intended to enable biomolecules to analyze various biological meanings, including related disease information, from binding information efficiently generated using them.
- Another object of the present invention by providing an external marker and a biochip that can generate the binding information of the biomolecules and ligands included in the biological sample, the disease information associated with the biomolecules from the binding information efficiently generated using them It is intended to be able to analyze various biological meanings, including.
- the present invention provides a single-stranded nucleic acid and analytical single-stranded nucleic acid that bind to a biomolecule in a biological sample composed of two or more biomolecules in a nucleic acid library consisting of random single-stranded nucleic acids consisting of random nucleotide sequences.
- the method provides a method for selecting a single molecule nucleic acid for biomolecule analysis, characterized in that the quality control reference material is selected and quality control single-stranded nucleic acid is analyzed by nucleic acid analysis.
- the present invention is a binding single-stranded nucleic acid and quality control for fixing the capture probe synthesized using the nucleotide sequence of the binding single-stranded nucleic acid and quality control single-stranded nucleic acid of the present invention to the support, to select the analysis single-stranded nucleic acid It provides a nucleic acid chip, characterized in that for generating binding information of single-stranded nucleic acid.
- the present invention uses the quality control reference material for the analysis of biomolecules in the biological sample using the analysis single-stranded nucleic acid of the present invention and the internal quality control by analyzing the quality control single-stranded nucleic acid by nucleic acid analysis method Provided is a biomolecule analysis method.
- the present invention is a mixture of an assay target probe prepared by reacting analytical single stranded nucleic acid with biomolecules in a biological sample and a comparative target probe prepared by reacting the assay single stranded nucleic acid with biomolecules in a control biosample. It provides a biomolecule analysis method characterized by analyzing the nucleic acid chip with a target probe prepared by.
- the present invention has a configuration that the capture probe prepared using the analysis single-stranded nucleic acids and base sequences of the quality control single-stranded nucleic acids is fixed to the support, for analyzing the biological meaning of the biomolecules in the biological sample It provides a nucleic acid chip, which is used to generate the binding information of the biomolecules and the analysis single-stranded nucleic acid.
- the present invention is composed of foreign molecules that are not included in the biological sample, to analyze the biological meaning of the biomolecules in the biological sample with the analysis single-stranded nucleic acid, included in the quality control and biological samples of the analysis process It provides a reference material characterized in that it is used for quantitative analysis of the biomolecules.
- the present invention provides a biomolecule analysis kit, characterized in that using the analysis single-stranded nucleic acid and the reference material for analyzing the biological meaning of the biomolecules in the biological sample.
- the present invention is carried out through the analysis of the biomolecules analysis method using the single-stranded nucleic acid and the reference material, the sample processing apparatus for preparing the biomolecules in the biological sample, the biomolecule-single-nucleic acid complex It provides a biomolecule analysis device, characterized in that the biomolecule analysis system comprising an amplification device consisting of a module for manufacturing and amplifying the module and the amplified product.
- biomolecule analysis method in the biological material consisting of the reference material and the nucleic acid chip according to the present invention and two or more biomolecules using the same, very simple and inexpensive using high throughput screening
- Efficient methods and devices can produce profiles for biomolecules contained in biological samples containing microorganisms, cells, and proteins, thus providing a broad understanding of the biological significance of biomolecules in a wide range of fields such as medicine, veterinary medicine, environmental engineering, food engineering, and agriculture. It is expected to be applied as an analysis tool.
- a very simple, inexpensive and efficient method using high throughput screening is included in a biological sample including microorganisms, cells, and proteins.
- a biological sample including microorganisms, cells, and proteins.
- the biological action of the unknown biomolecules can be grasped, the structure thereof can be determined, and the lifesaving can be determined.
- biomolecule analysis method using the external marker and the biochip according to the present invention by analyzing the profile of the biomolecules related to the medical, biomolecules capable of diagnosing the disease, biomolecules capable of analyzing the therapeutic results , Biomolecules that play an important role in disease development and progression, biomolecules related to disease susceptibility, and target molecules for drug development can be efficiently and efficiently identified.
- nucleic acid 1 is a nucleic acid prepared based on the nucleotide sequence of a single-stranded nucleic acid determined from the biomolecules and reference material in the biological sample consisting of the two or more biomolecules and quality control single-stranded nucleic acid. It is a diagram showing the process of analyzing the biological meaning of biomolecules in a biological sample with a nucleic acid chip used for the analysis of single-stranded nucleic acid as a chip and prepared with the analysis single-stranded nucleic acid and quality control single-stranded nucleic acid.
- FIG. 2 is a view showing a process for determining the assay single-stranded nucleic acid by preparing a nucleic acid chip using the biomolecule-bound single-stranded nucleic acid and the quality control single-stranded nucleic acid.
- FIG. 3 shows a binding profile of a biomolecule in the biological sample and the analysis single-stranded nucleic acid by preparing a nucleic acid chip for analyzing the biological meaning of the biomolecule in a biological sample using the assay single-stranded nucleic acid and the quality control single-stranded nucleic acid. Shows the process of creating a line,
- FIG. 4 is a diagram showing a process of quality control as reference material I in the process of analyzing the biological meaning of a biomolecule included in a biological sample using a nucleic acid chip prepared with analysis single-stranded nucleic acid and quality control single-stranded nucleic acid.
- FIG. 5 is a diagram illustrating a process of quality control with reference material II in analyzing a biological meaning of a biomolecule included in a biological sample by using a nucleic acid chip prepared with analysis single-stranded nucleic acid and quality control single-stranded nucleic acid.
- FIG. 6 is a view showing a spot corresponding to the quality control single-stranded nucleic acid corresponding to the reference material
- FIG. 7 is a view showing a process of diagnosing a disease by a program using a database of human serum protein profiles generated by the nucleic acid chip according to the present invention and an artificial neural network algorithm.
- FIG. 8 is a diagram showing the results of diagnosing cardiovascular disease by a program using a database of human serum protein profiles generated using a reference material and a nucleic acid chip according to the present invention and an artificial neural network algorithm.
- FIG. 9 is a diagram showing the results of diagnosing liver cancer by a program using a database of a human serum protein profile generated using a reference material and a nucleic acid chip according to the present invention and an artificial neural network algorithm.
- FIG. 10 is a program using a database of human serum protein profiles generated using a reference material and a nucleic acid chip and an artificial neural network algorithm according to the present invention, and shows a result of diagnosing metastasis of liver cancer.
- FIG. 11 is a view showing a procedure of determining the amino acid sequence of a protein specifically present in the serum of myocardial infarction patients in the database of the human serum protein profile generated using the reference material and the nucleic acid chip according to the present invention
- FIG. 12 is a view of determining the amino acid sequence of a protein specifically present in the serum of myocardial infarction patients in the database of the human serum protein profile generated using the reference material and the nucleic acid chip according to the present invention
- FIG. 13 is a view showing the result of binding to a small-cell lung cancer cell line single-stranded nucleic acid obtained by producing and analyzing the surface biomolecular profile of the small cell lung cancer cell line generated using the nucleic acid chip according to the present invention
- FIG. 14 is a view showing the specificity of the biomolecule binding single-stranded nucleic acid obtained by producing and analyzing the surface biomolecular profile of Escherichia coli KCTC12006 and Salmonella (Salmonella typhimurium ATCC13311) using the nucleic acid chip according to the present invention
- FIG. 15 is a view showing the result of measuring the degree of contamination in E. coli contaminated food using biomolecule binding single-stranded nucleic acid and nano gold particles that specifically bind to E. coli, selected using a nucleic acid chip according to the present invention ego,
- 16 is a schematic diagram showing a process of generating a biological meaning using an external marker and a biochip of the present invention
- Figure 17 is a schematic diagram showing the process of determining the biomolecule binding single-stranded nucleic acids related to the method for producing a biochip of the present invention.
- the present invention provides a method for producing an external marker and a biochip used for generating binding information of ligands and biomolecules, and a method for analyzing biomolecules using the same, wherein the external marker and the biochip according to the present invention are included in a biological sample. It can be used to analyze the biological meaning of biomolecules.
- the external marker may be used for quality control and quantitative analysis of biochips as foreign molecules which are substances not included in the biological sample to be analyzed.
- Capture probes are molecules that bind to biochips with ligand information that binds to biomolecules and external markers.
- the target probe is a molecule that binds to the capture probe and may be a mixture of the assay target probe and the comparative target probe, or may be composed of the assay target probe.
- the analytical target probe may be an analytical target probe derived from a ligand that binds to a biomolecule in the analytical biological sample
- the comparative target probe may be derived from a ligand or artificially derived or artificially derived biomolecule and binding to a biomolecule in the comparative biological sample. It may be a comparative target probe prepared from a ligand pool that binds to an external marker.
- the target probe is composed of an analysis target probe and a comparative target probe.
- the marker target probe is a molecule derived from a ligand that binds to a capture probe corresponding to a marker molecule and binds to an external marker and can be divided into analytical marker target probe and comparative marker target probe according to the purpose of use.
- the binding information is a profile consisting of spots corresponding to capture probes constituting the biochip, or the fluorescence degree of each spot.
- the method of manufacturing an external marker and a biochip according to the present invention determines the biomolecules not included in the biological sample to be analyzed and binds them to the biomolecules and the external markers to prepare the external markers from the determined foreign biomolecules.
- the manufacturing method of the external marker according to the present invention is as follows.
- a test such as a transcript or a protein is a typical example.
- the internal marker GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) or Actin mRNA is used for the quality control, but there is no internal marker for the purpose of clear quantitative analysis. And there is no useful internal marker when analyzing protein bodies. Accordingly, quality control and quantitative analysis are difficult when analyzing protein bodies. Therefore, the present invention intends to provide a quality control and quantitative analysis method that can be useful when analyzing a biological sample using an external marker.
- the external marker may be, for example, a plant-specific biomolecule as a biomolecule not included in the human-derived biological sample when the human-derived biological sample is analyzed with a substance (or molecule) not included in the biological sample to be analyzed.
- the plant-specific proteins have been reported with the conclusion of the human genome project and the Arabidopsis thaliana genome project.
- a plant-specific protein when analyzing a human-derived biological sample, can be used as an external marker.
- ligands that bind to biomolecules according to the present invention are as follows.
- Ligands that bind to biomolecules and external markers include antibodies, peptides, single stranded nucleic acids and aptamers.
- aptamer a single-stranded nucleic acid that binds biomolecules and tertiary structures
- a method for determining biomolecule-bound single-stranded nucleic acid is a bio-containing biomolecule. Determined by the REVERSE-SELEX method (see Republic of Korea Patent Registration No. 10-0923048) that reacts a sample with random single-stranded nucleic acids having a random nucleotide sequence to determine biomolecule-bound single-stranded nucleic acids that bind to the biomolecules.
- Ligand binding to the marker can be determined by the SELEX method.
- aptamer is referred to as analytical single stranded nucleic acid or biomolecule binding single stranded nucleic acid.
- the method of manufacturing a biochip for analyzing the biological meaning according to the present invention is at least one base selected from the base sequences of the determined biomolecule binding single-stranded nucleic acid and the outer marker-binding single-stranded nucleic acid and their complementary base sequences
- the capture probes synthesized using the sequence can be prepared by fixing to the substrate.
- Method for determining a biologically significant ligand using a biochip preparing a biochip; Reacting the biomolecule binding single-stranded nucleic acid with a biomolecule in a biological sample to form a biomolecule-single-stranded nucleic acid complex and separating the biomolecule-single-stranded nucleic acid complex; Preparing analytical target probes by separating, amplifying and labeling single-stranded nucleic acids from the separated biomolecule-single-stranded nucleic acid complexes; Reacting the mixed target probe of the labeled analysis target probe and the comparative target probe with the capture probes of the biochip to obtain binding information through the label; And analyzing the biological meaning of the biomolecules by comparing the obtained profile with binding information data already secured. It includes.
- FIG. 16 A schematic diagram of a process of generating a biological meaning using an external marker and a biochip of the present invention is shown in FIG. 16.
- the capture probes containing the sequence information of the single-stranded nucleic acid binding to the biomolecule and the external marker is fixed to the biochip
- the target probes are prepared by mixing the analyte target probes and the comparative target probes prepared from the complexes.
- the reaction profile is obtained by analyzing the binding profile of the capture probes of the biochip and analyzing the properties thereof. As a result, the binding profile of the single-stranded nucleic acid binding to the biomolecule is analyzed.
- the single-stranded nucleic acid separated from the biomolecule-single-stranded nucleic acid complexes is amplified when the biomolecule is analyzed.
- Analytical target probes produced through the process are also generated in the state containing the same information as the profile information of the single-stranded nucleic acid of the complex, so as to achieve the desired purpose even by analyzing the target probes as capture probes of the biochip according to the present invention can do.
- the step of obtaining the binding information to know the information of the biomolecules by adding the foreign molecules constituting the external markers to the biological sample in different amounts to prepare an analysis target probe, or constitute the external markers
- the analysis marker target probes having ligand information binding to an external marker may be mixed with the assay target probes in different amounts to prepare the target probe and generate binding information.
- the comparative target probe may be prepared and used in a pool consisting of ligands that bind to biomolecules and ligands that bind to external markers.
- biomolecule When the biomolecule is analyzed using the biochip according to the present invention, relevant binding information data is accumulated, and specific single-stranded nucleic acids that contribute to the analysis of the biological meaning of the biomolecule are naturally revealed, thereby biomolecules. It is possible to identify single-stranded nucleic acids that have meaning in analyzing.
- biosamples to which the biochip according to the present invention may be applied include bacteria, fungi, viruses, cell lines, tissues, and the like, and biomolecules whose biological meaning may be analyzed by the biochip according to the present invention include proteins, carbohydrates, At least one biomolecule selected from the group consisting of lipids, polysaccharides, glycoproteins, hormones, receptors, antigens, antibodies, enzymes and nucleic acids is included.
- a biological sample containing biomolecules is reacted with single-stranded nucleic acids having a random sequence (hereinafter, referred to as 'random single-stranded nucleic acids'). It is a step of determining target single-stranded nucleic acids that bind to molecules.
- selecting single-stranded nucleic acids that bind to the biomolecules included in the biosample comprises reacting the biomolecules of the biosample with random single-stranded nucleic acids to prepare biomolecule-single-stranded nucleic acid complexes and After washing, selecting biomolecule-single-nucleic acid complexes having a certain binding force or more based on the binding force of the biomolecules and the single-stranded nucleic acids, separating and amplifying the single-stranded nucleic acids from the selected complexes, and amplifying the single-stranded strands. Inserting the nucleic acids into the cloning vector to obtain a monoclonal and determining the nucleotide sequence thereof to determine the biomolecule binding single-stranded nucleic acids.
- the selection and amplification of the biomolecule-single-nucleic acid complexes may be repeatedly performed several times, but since the biological sample including the unknown biomolecule is composed of numerous biomolecules and their quantitative differences are very diverse, It may be more desirable to manufacture a linear method that performs one-time selection and amplification and enhances the washing process, rather than a cyclic method of repeatedly selecting and amplifying binding single-stranded nucleic acids.
- the random single-stranded nucleic acids having the random nucleotide sequences are prepared by double-stranded DNA using single-stranded DNA oligonucleotides having the following random nucleotide sequences, followed by RNA random singlet through in vitro transcription. It can be prepared with stranded nucleic acid.
- N40 means that the base, such as A, G, T, C, etc. are present at the same concentration at each position.
- the FW primer (5'-GGGGGAATTCTAATACGA CTCACTATAGGGAGAGCGGAAGCGTGCTGGG-3 ') used for PCR (Polymerase Chain Reaction) is capable of base binding to the 5' end of the underlined bases of the above base sequence and is a promoter for RNA polymerase of bacteriophage T7. Contains the nucleotide sequence.
- the RE primer of PCR (5'-GGGGGGATCCATCGACCTCTGGGTTATG-3 ') can base bond with the 3' end of the underlined bases of the above base sequence.
- the biomolecule binding single-stranded nucleic acids are RNA single-stranded nucleic acids including 2'-F-substituted pyrimidine and are prepared by synthesis and purification by in vitro transcription.
- the synthesized random single-stranded nucleic acids can be reacted with biomolecules for 30 minutes by treating the biological sample at a concentration of 10 15 nucleotides / L, for example.
- the target single-stranded nucleic acids can be inserted into the cloning vector product obtained by RT-PCR (Reverse Transcription-PCR) to secure E. coli clones and determine the base sequence.
- RT-PCR Reverse Transcription-PCR
- the reaction temperature is ideally performed at a temperature lower than the SELEX operating temperature, preferably the reaction is carried out at a temperature of 20 °C to 37 °C.
- the second step includes the single-stranded nucleic acid determined in the first step and base sequences of the outer-marker-bound single-stranded nucleic acid.
- capture probes are synthesized using at least one base sequence selected from among them and their complementary sequences, and the synthesized capture probes are fixed on a substrate to prepare a biochip of the present invention.
- Each capture probe that is secured to the biochip of the present invention consists of a characteristic base and the combinations of capture single stranded nucleic acids and target single stranded nucleic acids must maintain appropriate Tm values. Accordingly, the degree of hybridization of the conjugate should be able to maintain its signal value uncontaminated by the fluorescently labeled target probes.
- the nucleotide sequence of the capture probes can be determined based on the nucleotide sequences of the biomolecule-bound single-stranded nucleic acids and the outer marker-bound single-stranded nucleic acids selected from random single-stranded nucleic acids of the nucleic acid library in the first step.
- the capture probe uses 40 nucleotides or a portion thereof corresponding to a random portion of the nucleic acid library, and in some cases, an artificial sequence may be added.
- the capture probes are single stranded nucleic acids of oligonucleotides having a nucleotide sequence of 10 bp to 20 bp.
- the target probe When analyzing biological samples with biochips, the target probe uses a dual target probe or a single target probe.
- biological samples derived from disease sites are analyzed biological samples
- normal targets are comparative biological samples
- analytical target probes are prepared in the former
- comparative target probes are prepared in the latter, and then mixed with target probes. use.
- a single target probe derived from the analytical biological sample is used as the target probe.
- the comparative target probe of the present invention may be a single-stranded nucleic acid synthesized from a ligand pool that binds to a biomolecule and a ligand that binds to a biomolecule as a nucleic acid that is complementary to the capture probe.
- the comparative target probe may be single stranded nucleic acids of an oligonucleotide having a nucleotide sequence of 80bp to 140bp.
- the marker target probe is derived from a ligand that binds to foreign molecules constituting the outer marker, and can be classified into analytical marker target probe and comparative marker target probe according to the use.
- analytical marker target probes by mixing external markers with a biological sample, when the analytical target probes are prepared together, or when the external markers are used without mixing with the biological sample, the external markers may be combined with a capture probe of the external marker.
- Analytical marker target probes can be prepared and mixed with the analytical target probes.
- Comparative marker target probes can be prepared from ligands that bind to biomolecules and ligand pools that bind to external markers.
- the target probe of the present invention may preferably be used by mixing an analysis target probe including a marker target probe and a comparative target probe including a marker target probe.
- the substrate may be made of inorganic materials such as glass and silicon, or polymer materials such as acrylic or polyethylene terephtalate (PET), polycarbonate, polystyrene, and polypropylene.
- PET polyethylene terephtalate
- the substrate may be one coated with an amine group or an aldehyde group.
- UltraGAPS TM Coated Slide (Corning Co., Ltd.)
- GAPS Gamma Amino Propyl Silane
- a microarrayer system may be used, and each capture probe is dissolved in a buffer to adjust the concentration, and the humidity in the arrayer is maintained at 70 to 80% for spotting. Perform spotting. The spotted slides are left in a humidified chamber and then baked in a UV crosslinker.
- the biochip according to the present invention after fixing the capture probes to the glass slide by a method well known in the art, the slide is immediately centrifuged and dried, and then stored in a light-blocked state until use.
- Acquisition probes can regularly produce biochips by various methods known in the art (M. schena; DNA microarray; a practical approach, Oxford, 1999).
- the biochip according to the present invention if the biological meaning of the unknown biomolecule can be analyzed with the same degree of precision, it is preferable to reduce the number of capture probes attached to the biochip in view of the production cost and efficiency of analysis of the biochip.
- the present invention is provided by analyzing the contributions of the respective capture probes to the biological meaning analysis of the biomolecules, and selecting the capture probes based on the analyzed contributions, within a range capable of analyzing the biological meaning of the biomolecules.
- the method may further include reducing the number of capture probes attached to the biochip.
- the present invention manages the internal degree, the reference material for generating the binding information of the biomolecules and the analysis single-stranded nucleic acid in the biological sample consisting of two or more biomolecules, nucleic acid chips, methods for their preparation and living organisms using the same
- the reference material and nucleic acid chip according to the present invention is used to analyze the biological meaning of the biomolecules contained in the biological sample.
- the nucleic acid chip refers to a support on which a ligand made of nucleic acid is fixed for analyzing one or more substances simultaneously.
- the support may preferably be a solid glass or nylon substrate.
- the nucleic acid chip comes in a two-dimensional probe matrix fabricated on a solid glass or nylon substrate. It is highly desirable to carry out an analysis of as many features as possible on a single nucleic acid chip, since it requires a significant increase in the density of the probe and the amount of probe on a single substrate.
- microarrays with probe holding positions smaller than 500 m i.e., densities greater than 400 probes per square centimeter
- those which are not "low density" microarrays are referred to as high density microarrays and those which are not "low density" microarrays.
- nucleic acid chips are arranged in small spaces by arranging nucleic acids having hundreds to hundreds of thousands of highly diverse nucleotide sequences in a small space. It is used to find out information about the nucleic acid in the unknown through hybridization of the nucleic acid of the) and the unknown nucleic acid sample.
- Nucleic acid microarrays can replace existing Southern blots, Norther blots, and mutations, and can search for at least hundreds of nucleotide sequences at the same time.
- the reference material is an internal quality control material for comparison in qualitative quantitative analysis, various tests, and tests.
- a single-stranded nucleic acid is used for biomolecules in a biological sample composed of two or more biomolecules to be analyzed.
- This qualitative and quantitative analysis refers to a substance for internal quality control.
- the reference material may be an alien substance, which is an ideal material that is always present in a certain amount in the sample to be analyzed, but is not included in the sample.
- the reference material is included in the biological sample when the sample to be analyzed is a biological sample. It can be composed of foreign biomolecules that are not.
- Quality control refers to internal quality control that manages the accuracy of the measured value by analyzing a group of test results obtained by each measurement without using external standards such as a control sample.
- a stable secondary structure is predicted by a single-stranded nucleic acid sequence determined by reacting a biomolecule in a biological sample composed of two or more biomolecules with a nucleic acid library consisting of a random single-stranded nucleic acid.
- the stranded nucleic acid was referred to as the single-stranded nucleic acid, and the single-stranded nucleic acid selected from the profile secured for analyzing the biological meaning by the nucleic acid chip prepared based on the single-stranded nucleic acid was named as the single-stranded nucleic acid.
- quality control single-stranded nucleic acid determined for the purpose of quality control as a single-stranded nucleic acid binding to the reference material was referred to as quality control single-stranded nucleic acid.
- These single stranded nucleic acids are all aptamers.
- aptamer refers to a small (20-60 nucleotide) single-stranded nucleic acid (DNA or RNA) fragment having properties capable of binding with high affinity and specificity to various kinds of receptors from low molecular weight compounds to proteins. do.
- SELEX a method called SELEX.
- Selex stands for 'Systematic Evolution of Ligands by Exponential enrichment' and was first developed in 1990 (Tuerk, C. and Gold, L., 1990, Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase.
- RNA molecules that bind specific ligands.Nature 346 (6287), 818-822) A nucleic acid aptamer having a high binding strength is obtained.
- Aptamers are considered to be nucleic acid molecules with properties similar to antibodies in that they have high binding and selectivity at the level of nanomolar-picomol to receptors.
- Aptamers are screened in vitro by Selectex.
- the central principle of the Selex is that the concept of evolution, in which a large number of randomly existing individuals possess only certain traits, survives, and these surviving individuals become more and more dominant in the group, and finally dominate the group. similar.
- the individual in Selex is a single-stranded nucleic acid, and the selective pressure is the binding force for a particular receptor. Therefore, first, a nucleic acid library with a large number of random sequences must be created, and a fractionation process that can select an individual with high binding capacity to a specific receptor expected to exist in the library is required. An amplification step is needed to amplify to increase the ratio in the nucleic acid pool and to proceed to the next round of selections. Specific methods and reagents / materials for the selex of aptamers are known (Marshall, KA and Ellington, AD, 2000, In vitro selection of RNA aptamers. Methods Enzymol 318, 193-214; Fitzwater, T.
- the present inventors react with biomolecules in a biological sample composed of two or more biomolecules to react with a single-stranded nucleic acid that binds specifically to each biomolecule by reacting a nucleic acid library consisting of random single-stranded nucleic acids consisting of random sequences. A method of selection was proposed (Korean Patent Registration No. 10-0923048).
- the present invention provides a quality control for selecting binding single-stranded nucleic acid and analysis single-stranded nucleic acid that bind to a biomolecule in a biological sample comprising two or more biomolecules in a nucleic acid library composed of random single-stranded nucleic acids composed of random nucleotide sequences.
- a biomolecular analysis single stranded nucleic acid selection method is provided by using a reference material and analyzing quality control single stranded nucleic acid by nucleic acid analysis method.
- the present inventors analyze the aptamer in the biomolecule-aptamer complex generated by reacting the biomolecule in the biological sample with the aptamer by a nucleic acid analysis method to analyze the biomolecule as a receptor (Korea Patent Registration No. 10-0670799).
- Nucleic acid analysis method for analyzing the biomolecule and aptamer in the aptamer complex in the biological sample is PCR (polymeras chain reaction), LCR (ligase chain reaction), strand displacement amplification (SDA), transcription-mediated amplification (TMA) , bDNA (branched DNA), Invader method and RCA (rolling circle amplification).
- the amplification product generated by PCR of the single-stranded nucleic acid in the biomolecule-single-stranded nucleic acid complex as a template may be further analyzed.
- the present invention also provides a biomolecule analysis single-stranded nucleic acid selection method characterized in that the quality control reference material is a biomolecule not included in the biological sample.
- the binding single-stranded nucleic acid after determining the binding single-stranded nucleic acid and the quality control single-stranded nucleic acid by reacting the random single-stranded nucleic acid consisting of a random sequence and the biomolecule and the reference material in the biological sample, the binding single-stranded nucleic acid Biological meaning of biomolecules in a biological sample using the prepared nucleic acid chip based on the nucleotide sequence and used for the analysis of single stranded nucleic acid and the prepared nucleic acid chip as the nucleotide sequence of the analyzed single stranded nucleic acid and the quality control single stranded nucleic acid. You can see this in-line process by performing the steps of analyzing.
- the biological sample tested by the nucleic acid chip is a transcript or protein.
- GAPDH Glyceraldehyde 3-phosphate dehydrogenase
- ⁇ -actin mRNA which is expressed in a constant amount in almost all tissues, is used for internal quality control purposes, but the reference substance is used for clear quantitative analysis. There is no dependence on external quality control.
- the present invention is to provide a quality control target reference material for efficiently selecting a ligand binding to a biomolecule in a biological sample having two or more biomolecules by the reverse-SELEX.
- the present invention proposes a useful internal quality control and quantitative analysis method for analyzing the sample using a reference material.
- the reference material according to the present invention may use plant-specific biomolecules as biomolecules not included in human-derived biological samples when analyzing human-derived biological samples similar to the external markers described above.
- Plant-specific proteins have been reported with the conclusion of the Human Genome Project and Arabidopsis thaliana Genome Project, a type of plant.
- a plant-specific protein can be used as a reference material for analyzing human-derived biological samples.
- Substances that bind to biomolecules and reference materials included in the biological sample include antibodies, peptides, and single stranded nucleic acids, and may preferably be single stranded nucleic acids.
- the present invention comprises the steps of determining the biomolecule not included in the biological sample and producing a quality control single-stranded nucleic acid from the determined foreign biomolecules; Preparing the binding single-stranded nucleic acids from the biomolecules included in the biological sample; And selecting a single stranded nucleic acid that analyzes the biological meaning of the biomolecules, comprising: preparing a support to which a capture probe synthesized using the quality control single stranded nucleic acid and the nucleotide sequence of the bound single stranded nucleic acid is fixed.
- Biomolecule analysis single-stranded nucleic acid to generate a binding profile of biomolecules and binding single-stranded nucleic acids using the biological sample, the reference material, the binding single-stranded nucleic acid, the quality control single-stranded nucleic acid and the nucleic acid chip Provides a way to select.
- the method for determining the quality control single-stranded nucleic acid determined from the single-stranded nucleic acid binding to the reference material according to the present invention is to separate the reference material and the single-stranded nucleic acid by reacting the reference material with random single-stranded nucleic acids having a random sequence. It can be composed of standard SELEX methods (Tuerk C. and Gold L., 1990, Science, 249; 505-510) to select single-stranded nucleic acids that bind to the reference by repeatedly performing this selection and amplification. .
- the method for selecting a single-stranded nucleic acid that binds to a biomolecule present in a biological sample composed of two or more biomolecules comprises a random single-stranded nucleic acid having a random sequence and a biological sample containing the biomolecule Rervers-SELEX method (Korean Patent Registration No. 10-0923048) may be used to determine biomolecule binding single-stranded nucleic acids by binding to the biomolecules.
- the method for preparing the binding single-stranded nucleic acids provided by the present invention is the same as the method for selecting a single-stranded nucleic acid that binds to a biomolecule included in a biological sample. First, the single molecule having the random sequence on the biomolecule is provided.
- the present invention is a method for selecting the biomolecule-single-nucleic acid complexes to wash the generated biomolecule-single-nucleic acid complexes in the reaction solution, based on the magnitude of the binding force of the biomolecules and the single-stranded nucleic acids It provides a biomolecule analysis single-stranded nucleic acid selection method characterized in that for selecting the biomolecule-single-nucleic acid complexes more than a certain binding force.
- the present invention provides a method for selecting a biomolecule-single-nucleic acid complex, wherein the method for selecting a biomolecule-single-nucleic acid complex comprises selecting the biomolecule-single-nucleic acid complexes by capillary electrophoresis of the reaction solution. .
- the present invention is a method for selecting the biomolecule-single-nucleic acid complex, the biomolecule analysis single-stranded, characterized in that to select the biomolecule-single-nucleic acid complex by treating the reaction solution to the structure consisting of nitrocellulose and nylon Provided are nucleic acid selection methods.
- the present invention provides a method for selecting a biomolecule analysis single-stranded nucleic acid, characterized in that the selection and amplification of the biomolecule-single-nucleic acid complexes are repeatedly performed a plurality of times.
- the biomolecule-single-nucleic acid complex is selected for washing the generated biomolecule-single-nucleic acid complexes, and the biomolecules having a predetermined binding force or more based on the magnitude of the binding force between the biomolecules and the single-stranded nucleic acids.
- a method for selecting single-stranded nucleic acid complexes a method for selecting the biomolecule-single-stranded nucleic acid complexes by capillary electrophoresis of the reaction solution, or a biomolecule-single strand by treating the reaction solution to a structure of nitrocellulose and nylon And nucleic acid complexes.
- Single-stranded nucleic acids separated from the biomolecule-single-stranded nucleic acid can be inserted into the cloning vector product obtained by reverse transcription-PCR (RTPCR) to secure E. coli clones and determine the base sequence.
- RTPCR reverse transcription-PCR
- the present invention provides a biomolecule analysis single-stranded nucleic acid selection method characterized in that the support to which the capture probe is fixed comprises a glass slide, a sensing surface of the biosensor, beads, nanoparticles and the like.
- the present invention is characterized in that the capture probe is synthesized by consisting of at least one base sequence selected from the base sequences of the binding single-stranded nucleic acid and quality control single-stranded nucleic acid and their complementary base sequence Provides a single stranded nucleic acid selection method.
- the present invention is a method for generating a binding profile of biomolecules and binding single-stranded nucleic acids in the biomolecule consisting of two or more biomolecules is the reference material, the biological sample, the quality control single-stranded nucleic acid and the binding single Preparing an assay target probe with a label from the strand nucleic acid; Preparing a comparative target probe having a label by mixing and amplifying the binding single-stranded nucleic acid and the quality control single-stranded nucleic acid corresponding to the capture probe; Preparing the target probe by mixing the analysis target probe and the comparative target probe; And hybridizing the target probes with the capture probes of the support to generate a binding profile. It provides a biomolecule analysis single-stranded nucleic acid selection method comprising a.
- the present invention provides a method for producing an assay target probe comprising the steps of preparing an assay sample in which the reference material I composed of different amounts of the reference substances to the biological sample; Separating the biomolecule-single-stranded nucleic acid complex and the reference material-single-stranded nucleic acid complex generated by reacting the sample with the single-stranded nucleic acid consisting of the binding single-stranded nucleic acid and the quality control single-stranded nucleic acid; And separating, amplifying and labeling single-stranded nucleic acids in the separated complexes to prepare an assay target probe. It provides a biomolecule analysis single-stranded nucleic acid selection method characterized in that.
- the present invention provides a method for preparing the assay target probe, comprising: separating single-stranded nucleic acid from a biomolecule-single-stranded nucleic acid complex generated by reacting the biological sample with the bound single-stranded nucleic acid; And preparing the analytical target probe by amplification and labeling by mixing the separated single-stranded nucleic acid with reference material II composed of different amounts of quality control single-stranded nucleic acids, respectively. It provides a biomolecule analysis single-stranded nucleic acid selection method characterized in that.
- screening of the single-stranded nucleic acid for biological meaning analysis of the biomolecules is performed by selecting the capture probes within a range capable of analyzing the biological meaning of the biomolecule, based on the contribution of the capture probes. It provides a biomolecule analysis single-stranded nucleic acid selection method further comprising the step of reducing the number of the capture probes fixed to the support.
- the present invention has a configuration in which a capture probe synthesized using the nucleotide sequence of the binding single-stranded nucleic acid and the quality control single-stranded nucleic acid is fixed to a support, and the binding single-stranded nucleic acid for selecting the analysis single-stranded nucleic acid Quality control Provides a nucleic acid chip, characterized in that for generating binding information of single-stranded nucleic acid.
- the capture probe is a molecule that is fixed to the support in the single-stranded nucleic acids that bind to the biomolecule and the reference material or in a material having their information It is composed of at least one material selected.
- the binding information of the biomolecule and the single-stranded nucleic acid in the biological sample refers to a signal generated by the complementary coupling of the target probe and the capture probe prepared from the biomolecule-coupled single-stranded nucleic acid, and preferably the capture that constitutes the support.
- the profile is composed of spots corresponding to the probes, each of which is a signal generated from a label on the binding single-stranded nucleic acid of the target probe bound to the capture probe constituting the spot.
- the binding information is a combination of signals of the analysis target probe and the comparative analysis probe of the target probe, and ultimately indicates the distribution state of the biomolecule binding single-stranded nucleic acid in the biological sample, and thus the distribution state of the biomolecule binding to the single-stranded nucleic acid. Can deduce.
- the method for producing a nucleic acid chip for selecting an analysis single-stranded nucleic acid for analyzing the biological meaning of the biomolecules in a biological sample is the base sequence of the determined analysis single-stranded nucleic acid and quality control single-stranded nucleic acid and the Capture synthesized using at least one nucleotide sequence selected from among these complementary nucleotide sequences, or by using a capture probe consisting of a nucleotide sequence that is completely complementary to a nucleotide sequence of a biomolecule binding single-stranded nucleic acid. Probes may be in a configuration that is fixed to the support.
- the support to which the capture probe is fixed in the present disease may be selected from glass slides, sensing surfaces of biosensors, beads, nanoparticles, and the like.
- the support is glass slides.
- a method of analyzing a signal of an amplification product that binds to the capture probe may be selected.
- the nucleic acid chip according to the present invention after fixing the capture probes to the glass slide by a method well known in the related art, the slide is immediately centrifuged and dried, and then stored in a light-blocked state until use.
- Acquisition probes can regularly produce nucleic acid chips by various methods known in the art (M. schena; DNA microarray; a practical approach, Oxford, 1999).
- the target probe is generally analyzed in the transcript, and the biological sample derived from the disease site is an analytical biological sample, and the normal target is a comparative biological sample. Make a target probe, mix them, and use it as a target probe. However, in the absence of a suitable comparative biological sample, a single target probe derived from the analytical biological sample may be used as the target probe.
- the target probe may be single stranded nucleic acids of an oligonucleotide having a nucleotide sequence of 80bp to 140bp.
- the assay target probe may be prepared by two methods as follows. In the case of preparing the assay target probe by mixing the reference material I composed of different amounts of the reference materials into a biological sample and the biomolecule- This is a case where analytical target probe is prepared by mixing reference material II composed of different amounts of quality control single stranded nucleic acids to single stranded nucleic acid separated from single stranded nucleic acid.
- the comparative target probe may be a single-stranded nucleic acid synthesized from a single-stranded nucleic acid pool composed of biomolecule-binding single-stranded nucleic acids and quality control single-stranded nucleic acids as a nucleic acid that is complementary to the capture probe.
- the present invention is characterized by using the quality control reference material for the analysis of biomolecules in the biological sample using the analysis single-stranded nucleic acid and the internal quality control by analyzing the quality control single-stranded nucleic acid by a nucleic acid analysis method
- biomolecule analysis methods Provided are biomolecule analysis methods.
- the present invention provides a biomolecule analysis method characterized in that the analysis of the biomolecules in the biological sample using the analysis single-stranded nucleic acid as a nucleic acid analysis method.
- the present inventors analyze the aptamer by a nucleic acid analysis method in the biomolecule-aptamer complex generated by reacting the biomolecule in the biological sample with the aptamer, and the method for analyzing the biomolecule which is a receptor is Korean Patent Registration No. 10-0670799 Posted at -0000.
- Nucleic acid analysis method for analyzing the biomolecule and aptamer in the aptamer complex in the biological sample is PCR (polymeras chain reaction), LCR (ligase chain reaction), strand displacement amplification (SDA), transcription-mediated amplification (TMA) , bDNA (branched DNA), Invader method and RCA (rolling circle amplification).
- the amplification products generated by PCR of the nucleic acid in the biomolecule-single strand nucleic acid complex may be further analyzed.
- the present invention provides a biomolecule analysis method, wherein the quality control reference material is characterized by a biomolecule not included in the biological sample.
- the present invention comprises the steps of fixing the capture probe synthesized using the nucleotide sequence of the analysis single-stranded nucleic acid and the quality control single-stranded nucleic acid to a support; Preparing a target probe with a label from the reference material, the biological sample, the quality control single-stranded nucleic acid, and the analysis single-stranded nucleic acid; Hybridizing the target probe to the capture probe of the support to obtain binding information; And analyzing the biological meanings of the biomolecules by comparing the obtained binding information with already secured binding information data. It provides a biomolecule analysis method comprising a.
- the present invention provides a method for preparing the target probe comprises the steps of preparing an analysis target probe with a label from the reference material, the biological sample, the quality control single-stranded nucleic acid, and the analysis single-stranded nucleic acid; Preparing a comparative target probe having a label by mixing and amplifying the assay single-stranded nucleic acid and the quality control single-stranded nucleic acid corresponding to the capture probe; And preparing a target probe including the analysis target probe and the comparison target probe. It provides a biomolecule analysis method comprising a.
- a reference material for the purpose of quality control in the process of analyzing the biological meaning of the biomolecules included in the biological sample by preparing a nucleic acid chip using the analysis single-stranded nucleic acid and the quality control single-stranded nucleic acid And quality control single-stranded nucleic acid can be seen in a series of processes to analyze.
- the present invention provides a biomolecule analysis method, wherein the support to which the capture probes are fixed comprises a glass slide, a sensing surface of a biosensor, beads, nanoparticles, and the like.
- the present invention provides a biomolecule analysis method comprising the capture probe consisting of a nucleotide sequence that is completely complementary to the nucleotide sequence of the analysis single-stranded nucleic acid and the quality control single-stranded nucleic acid.
- the capture probe may be composed of a nucleotide sequence complementary to the analysis single-stranded nucleic acid and the analysis single-stranded nucleic acid is selected from the binding single-stranded nucleic acids constituting the biological sample in the biological sample It is an aptamer used for analyzing the biological meaning of biomolecules. Therefore, the capture probe can complementarily bind to the nucleotide sequence of the specific analysis single-stranded nucleic acid in the amplification product obtained by PCR of the analysis single-stranded nucleic acid in the complex as a template. Analysis of single-stranded nucleic acids results in quantitative determination of the receptor protein.
- a method of analyzing a signal of an amplification product that binds to the capture probe may be selected.
- the capture probe is a single-stranded nucleic acid that is bound to the biomolecule and the reference material as a molecule fixed to the support It consists of at least one substance selected from among those with information of.
- the present invention provides a primer with a label for analyzing and amplifying single-stranded nucleic acid separated from the biomolecule-single-stranded nucleic acid complex and the reference-single-stranded nucleic acid complex, and the analysis single-stranded nucleic acid contained in the complex and degree.
- a biomolecule analysis method comprising using a primer comprising a region containing a specific base sequence of a managed single-stranded nucleic acid and a nucleotide sequence region each indicating the same.
- primers with a label and a tag indicating a specific single-stranded nucleic acid can be used.
- Tag refers to unique nucleotide sequences used to identify polynucleotides in a reaction and / or to track the source of a polynucleotide.
- the tag sequence may be at the 5 or 3 ends of the primer.
- Capture probe sequences can vary widely in size and composition; The following references provide guidelines for selecting a series of capture probe sequences suitable for certain embodiments (US Pat. No. 5,635,400; Brenner et al, 2000, PNAS., 97: 1665-1670; Shoemaker et al, 1996, Nature Genetics, 14: 450-456; European Patent Publication 0799897A1; US Pat. No. 5,981,179). And similar things.
- the capture probe sequence may have a length in the range of 4 to 36 nucleotides, or 6 to 30 nucleotides, or 8 to 20 nucleotides.
- the present invention provides a biomolecule analysis method characterized by the capture probe consisting of a base sequence that is completely complementary to the base sequence of the tag indicating the analysis single-stranded nucleic acid and the quality control single-stranded nucleic acid.
- the capture probe may be prepared using a base sequence complementary to the tag, and the capture probe may be completely complementary to the tag sequence in the PCR product generated by PCR of the assay single-stranded nucleic acid in the complex.
- the PCR product may be analyzed and the single-stranded nucleic acid in the complex may be analyzed by analyzing signals of spots generated by the capture probe and the PCR product.
- the comparative target probe may be a single-stranded nucleic acid synthesized from a single-stranded nucleic acid pool composed of biomolecule-binding single-stranded nucleic acids and quality control single-stranded nucleic acids as a nucleic acid that is a base sequence complementary to the capture probe.
- the target probe is an analytical biological sample which is a test part, and the normal part is a comparative biological sample which is a control part, and the analytical target probe is prepared in the former and a comparative target probe is prepared in the latter. After mixing, use as target probe.
- a single target probe derived from the analytical biological sample may be used as the target probe.
- the assay target probe may be prepared by two methods as follows.
- the assay target probe is prepared by mixing the reference material I composed of different amounts of reference materials into a biological sample and the biomolecule- This is a case where analytical target probe is prepared by mixing standard strand II composed of different amounts of quality control single stranded nucleic acids separated from single stranded nucleic acid.
- the present invention provides a method for producing an assay target probe comprising the steps of preparing an assay sample in which the reference material I composed of different amounts of the reference material to the biological sample; Separating the biomolecule-single-stranded nucleic acid complex and the reference substance-single-stranded nucleic acid complex generated by reacting the prepared sample with the single-stranded nucleic acid consisting of the analysis single-stranded nucleic acid and the quality control single-stranded nucleic acid; And separating, amplifying and labeling the assay single-stranded nucleic acid in the complex to prepare an assay target probe. It provides a biomolecule analysis method characterized in that.
- the present invention provides a method for preparing an assay target probe, comprising: separating a biomolecule-single strand nucleic acid complex generated by reacting biomolecules in the biological sample with the assay single stranded nucleic acid; And mixing, amplifying, and labeling the reference material II composed of different amounts of quality control single-stranded nucleic acids to the analysis single-stranded nucleic acid separated from the separated biomolecule-single-stranded nucleic acid complex to prepare the labeled assay target probe. ; It provides a biomolecule analysis method characterized in that.
- the present invention is a comparative target probe prepared by reacting analytical single-stranded nucleic acid to a biomolecule in the biological sample which is a test sphere and a single-stranded nucleic acid to a biomolecule in the biological sample which is a control. It provides a biomolecule analysis method and analysis device characterized in that for analyzing the nucleic acid chip with a target probe prepared by mixing.
- Target probes derived from analytical single-stranded nucleic acid that bind to biomolecules in laboratory biosamples are derived from analytical target-probes and analytical single-stranded nucleic acid that binds to biomolecules in control biosamples or artificially
- the target probes prepared in the binding single-stranded nucleic acid pool were compared.
- the target probe is composed of an analysis target probe and a comparative target probe.
- the target probe is a molecule that binds to the capture probe and may be composed of only the analytical target probe and the comparative target probe or electrons alone.
- the labeling material is Biotin, Cy2, GFP, YO-PRO-1, YOYO-1, Calcein, FITC, FlourX, ALEXA 488, Rhodamine 110, ABI 5-FAM, Oregon Green 500, Oregon green 488 , RiboGreen, Rhodamine Green, Rhodamine 123, Magnesium Green, Calcium Green, TO-PRO-1, TOTO-1, ABI JOE, BODIPY 530/550, Dil, BODIPY TMR, BODIPY558 / 568, BODIPY564 / 570, Alexa 546, TRITC , Magnesium Orange, Phycoerythrin R & B, Rhodamine Phalloidin, Calcium Orange, Pyronin Y, Rhodamine B, ABI TAMRA, Rhodamine Red, Cy3.5, ABI ROX, Calcium Crimson, Alexa 594, Texas Red, Nile Red, YO-PRO- 3, YO
- the capture probes complementarily bind to the single-stranded nucleic acid of the amplified product with a label to produce a double-stranded nucleic acid. Therefore, when a signal based on a label is generated, the spot formed by the capture probe can analyze single-stranded nucleic acid with this signal and can quantitate a protein which is a receptor in the complex generated by the single-stranded nucleic acid. Therefore, the labeling material can be selected according to the purpose of analysis in various ranges, and preferably, Cy3 or Cy5 can be used.
- the present invention has a configuration in which the capture probes prepared using the assay single-stranded nucleic acids and base sequences of the quality control single-stranded nucleic acids are fixed to a support and analyze the biological meaning of the biomolecules included in the biological sample.
- a nucleic acid chip which is used to generate the binding information of the biomolecules and the analysis single-stranded nucleic acid.
- the method for producing a nucleic acid chip for analyzing the biological meaning of the biomolecules in a biological sample is the base sequences of the determined single-stranded nucleic acid and quality control single-stranded nucleic acid and their complementary base sequences
- the synthesized capture probes may be of a structure that is fixed to the support.
- Acquisition probes can regularly produce nucleic acid chips by various methods known in the art (M. schena; DNA microarray; a practical approach, Oxford, 1999).
- the nucleic acid chip for analyzing the biological meaning of the biomolecule in the biological sample according to the present invention is composed of the capture probes synthesized using the information of the analysis single-stranded nucleic acid and quality control single-stranded nucleic acid is fixed to the support.
- nucleic acid chip if the biological meaning of the unknown biomolecule can be analyzed with the same degree of precision, reducing the number of capture probes fixed to the nucleic acid chip in terms of manufacturing cost and analysis efficiency of the nucleic acid chip. desirable.
- the binding information refers to a signal generated by complementary binding of a target probe and a capture probe prepared from the analysis single-stranded nucleic acid that binds to the biomolecule, and preferably includes a profile corresponding to the capture probe constituting the support. It is a signal generated from the labeling material in the single-stranded nucleic acid of the target probe bound to the capture probe constituting the spot, respectively, preferably means the degree of fluorescence.
- the binding information is a combination of signals of the analysis target probe and the comparative analysis probe of the target probe, and ultimately indicates the distribution state of the single-stranded nucleic acid bound to the biomolecule in the biological sample, and thus the distribution state of the biomolecule bound to the single-stranded nucleic acid therefrom. Can be deduced.
- the present invention is provided by analyzing the contributions of the respective capture probes to the biological meaning analysis of the biomolecules, and selecting the capture probes based on the analyzed contributions, within a range capable of analyzing the biological meaning of the biomolecules.
- the method may further include reducing the number of capture probes attached to the nucleic acid chip.
- biomolecule When the biomolecule is analyzed using the nucleic acid chip according to the present invention, relevant binding information data is accumulated, and specific single-stranded nucleic acids that contribute to the analysis of the biomolecule biological meaning are naturally revealed, thereby biomolecules. It is possible to discover biomarkers that have meaning in analyzing.
- the present invention is composed of foreign molecules not included in the biological sample, to analyze the biological meaning of the biomolecules included in the biological sample with the analysis single-stranded nucleic acid, included in the quality control and biological sample of the analysis process It provides a reference material characterized in that it is used for quantitative analysis of the biomolecules.
- the present invention provides a biomolecule analysis kit, wherein the analysis single-stranded nucleic acid and the reference material are used for analyzing the biological meaning of the biomolecules in the biological sample.
- the present invention is carried out through the analysis of the biomolecules using the analysis single-stranded nucleic acid and the reference material, the sample processing device for preparing the biomolecules in the biological sample, the biomolecule-single-nucleic acid complex It provides a biomolecule analysis device, characterized in that the biomolecule analysis system comprising an amplification device consisting of a module for manufacturing and amplifying the module and the amplified product.
- a sample processing apparatus for separating biomolecules from a sample containing biomolecules and the biomolecule-analytical single-stranded nucleic acid and reference material-single-stranded nucleic acid complex
- the system of the present invention is a mixing chamber, a dissolution chamber and a reaction chamber It consists of a sample processing device and amplification device composed of these may be integrated operation.
- Analysis of a sample that is believed to contain a biomolecule of interest involves a series of sample preparation steps and is performed in a sample processing device consisting of a mixing chamber and a dissolution chamber. These steps may include filtration, cell lysis, biomolecules, preparation of biomolecule-single-nucleic acid complexes and mixing with reagents. Controlling contamination of sample preparation may be useful to gain confidence in the results of biomolecular analysis.
- a method for preparing a sample for nucleic acid amplification reactions and validating the sample preparation is provided.
- the sample is believed to contain a target entity selected from the group consisting of cells, spores, microorganisms, and viruses, which target entity comprises at least one target biomolecule.
- the method includes introducing a sample into an apparatus having a mixing chamber that mixes the sample and a sample preparation control.
- the sample preparation control is selected from the group consisting of cells, spores, microorganisms and viruses, and the sample preparation control comprises a quality control material.
- the apparatus also has a dissolution chamber and a reaction chamber. The sample is mixed with the sample preparation control in the mixing chamber.
- the method also comprises dissolving the target entity in the dissolution chamber to purify the biomolecules, generating the biomolecule-mononucleic acid complex, and presenting the biomolecule-mononucleic acid in the dissolution chamber. Exposing the complex to nucleic acid amplification conditions in the reaction chamber and detecting the presence of at least one quality control substance. Positive detection of the quality control material indicates that the sample preparation process was satisfactory, whereas if the control material could not be detected, the sample was improperly prepared.
- the present invention provides an amplification apparatus for preparing a sample for nucleic acid amplification reaction and verifying the effectiveness of the sample preparation.
- the sample is believed to contain a target entity selected from the group consisting of cells, spores, microorganisms, and viruses, which target entity comprises at least one target biomolecule.
- the apparatus includes a body having a first chamber for receiving a sample preparation control to be mixed with the sample.
- the sample preparation control is selected from the group consisting of cells, spores, microorganisms, and viruses, and the sample preparation control comprises a control material.
- the body also includes a dissolution chamber that dissolves the target entity and sample preparation control when present in the sample to release the biomolecules therefrom and separate the biomolecule-single-stranded nucleic acid complex. It also includes a dissolution chamber that reacts the released biomolecule with the assay single-stranded nucleic acid to produce a biomolecule-single-stranded nucleic acid complex. The body also includes a reaction chamber that holds the nucleic acid for amplification and detection.
- the apparatus further comprises at least one flow controller for guiding flow into the lysis chamber in the first chamber with the sample mixed with the sample preparation control and for releasing the biomolecule liberated in the lysis chamber into the reaction chamber.
- the dissolution chamber contains an enzyme, at least one filter, and a solid material that captures the target entity and sample preparation control when present in the sample when the sample flows through the dissolution chamber
- the device comprises a dissolution chamber.
- at least one waste chamber for receiving the used sample fluid flowing through the at least one flow controller, wherein the at least one flow controller can also direct the used sample fluid flowing through the dissolution chamber to the waste chamber.
- the apparatus further comprises an ultrasonic transducer coupled to the wall of the dissolution chamber for providing ultrasonic waves to the dissolution chamber.
- the device further comprises beads in a dissolution chamber for rupturing the sample preparation control and target entity.
- the invention provides a method of determining the effectiveness of a dissolution process.
- the method includes mixing a sample that is believed to contain a target entity selected from the group consisting of cells, spores, microorganisms and viruses with a sample preparation control.
- the target entity includes at least one quality control substance.
- the sample preparation control is selected from the group consisting of cells, spores, microorganisms and viruses, the sample preparation control comprising a quality control material.
- the mixture of sample preparation control and target entity when present in the sample is subjected to dissolution treatment.
- the method further includes detecting the presence of a quality control material to determine whether the biomolecule is free from the sample preparation control during the dissolution process. Positive detection of the quality control material indicates that the sample preparation process is satisfactory, whereas if the control material cannot be detected, the sample was improperly prepared.
- the method allows the sample mixed with the sample preparation control to flow through the chamber containing the solid material to capture the sample preparation control and the target entity when present in the sample before the dissolution treatment. It includes a step.
- the sample may be prefiltered before mixing the sample and the sample preparation control.
- the dissolution treatment comprises exposing the sample preparation control and target entity to ultrasonic energy.
- the dissolution treatment also includes stirring the sample preparation control and beads to rupture the target entity.
- the sample preparation control is spores.
- the mixing step comprises digesting the dry beads containing the sample preparation control.
- the dissolution treatment includes contacting with a chemical solubilizer.
- the marker nucleic acid sequence is detected by amplifying the marker nucleic acid sequence (eg, by PCB) and detecting the amplified marker nucleic acid sequence.
- the marker nucleic acid sequence is detected by determining whether a signal from a probe capable of binding to the marker nucleic acid sequence exceeds a threshold.
- nucleic acid amplification of DNA involves a repetition of a cycle consisting of thermally denaturing DNA, annealing two oligonucleotide primers in sequences flanking the DNA segment to be amplified, and extending the annealed primers by DNA polymerase.
- the primers are crossed to opposite strands of the target sequence, while the DNA synthesis by the polymerase is oriented to proceed across the region between the primers, effectively doubling the amount of DNA fragments.
- each successive cycle substantially doubles the amount of DNA synthesized in the previous cycle. This results in the exponential accumulation of specific target segments at the rate of 2n per cycle, where n is the number of cycles.
- Methods such as amplification reactions and ligase chain reactions (LCR) can be used to directly amplify nucleic acid sequences. Isothermal amplification reactions are also known and can be used according to the methods of the invention.
- the nucleic acid amplification reaction is preferably carried out using heat treatment equipment that heats and / or cools the reaction mixture in the reaction vessel to a temperature necessary for the amplification reaction.
- heat treatment equipment may also include one or more detection instruments that detect marker nucleic acid sequences of the sample preparation control and one or more target nucleic acid sequences for testing in the sample.
- Preferred heat treatment equipment US Pat. No. 6,369,893; US Pat. No. 6,391,541
- an optical detector for amplifying and detecting nucleic acid sequences in the reaction vessel can be used.
- there are many other known methods suitable for the present invention for controlling the temperature of the reaction mixture and for detecting nucleic acid sequences in the reaction mixture.
- detection of one or more quality control materials for testing in the quality control material and the samples of the sample preparation control is preferably performed using a probe.
- the reaction vessel preferably has one or more transparent or light transmissive walls through which signals from the optically detectable probe pass.
- capture probes may be used to detect and quantify nucleic acid sequences. There are many different assays employing nucleic acid capture probes. Some of these capture probes produce signals with a change in the fluorescence of the fluorescent source due to a change in interaction with other molecules or moieties.
- the fluorescent probe consists of oligonucleotides labeled by a fluorescent reporter dye module. Cleavage of the capture probe results in an increase in fluorescence intensity of the reporter dye.
- Contamination of the sample preparation should be controlled to ensure detection of the target biomolecule in the sample or lack thereof. This is why the sample preparation control should undergo the same treatment as the target entity in the sample (eg, target cells, spores, viruses or microorganisms containing biomolecules). If a control agent of the sample preparation control is detected, the sample preparation is considered satisfactory. If the presence of a quality control material cannot be detected, the sample preparation is considered inadequate, and the result of the test for the target nucleic acid sequence is considered to be "indeterminate". Preferably, the presence of a quality control material exceeds a predetermined threshold of fluorescence that must be met or exceeded so that a signal from a capture probe capable of binding to the target probe is considered to be valid for the assay, for example. Is detected by determining whether
- the fluid control device may be computer controlled according to the desired protocol. Using a single valve can produce high manufacturing yields due to only one failure factor.
- the integration of the fluid control and processing component can result in a compact device (eg in the form of a small cartridge) and facilitates the automation of molding and assembly.
- a compact device eg in the form of a small cartridge
- Such a system may advantageously include dilution and mixing capabilities, intermediate washing capabilities and certain pressurization capabilities.
- the fluid path in the system is normally closed to minimize contamination of the fluid in the system and to facilitate the receipt and control of such fluid.
- the reaction vessel is conveniently removable and replaceable, and in some embodiments is disposable.
- the configuration for biological meaning analysis using the binding information data of the biomolecule and the analysis single-stranded nucleic acid is the binding information of the biomolecule and the analysis single-stranded nucleic acid of the patient group and the biomolecule and the analysis single-stranded nucleic acid of the control group
- a module for receiving the combined information data and constructing a database A module for performing pre-processing in an analysis system using the input combined information data; A module for generating a model of a patient with the preprocessed results; A module for loading the generated model and applying the generated model to a visiting patient to perform a diagnosis as a blind test; And a module for evaluating the performance of the system through a cross test; It provides a biomolecule analysis method and apparatus comprising a.
- the biological semantic prediction system using the binding information data of the biomolecule and the analysis single-stranded nucleic acid is an exemplary diagnosis, but is not limited thereto.
- the binding information data of many biomolecules and analytical single-stranded nucleic acids generated by the present invention can produce a variety of information related to cells, tissues, or diseases with massive amounts of information having high-dimensional characteristics.
- the module that performs the preprocessing in the analysis system using the input data finds features that affect the patient's condition, and the multivariate analysis method for improving classification performance finds important dimensions for accurate treatment and diagnosis. Feature selection procedure that finds key features by reducing or modifying their characteristics.
- Feature extraction can be either unsupervised learning or supervised learning, depending on whether class information is used for learning in detail.
- Principal Component Analysis (PCA) or Independent Component Analysis (ICA), which are mainly used for unsupervised learning, can extract features by considering the characteristics of variables.
- Supervision is a method of selecting variables by using statistical significance between the class information and variables or correlations between variables. This method can calculate the main feature through the performance applied to the classifier by sequentially adding or removing features in the forward or backward direction in a given feature set.
- the module for generating a model of a patient by performing the learning with the preprocessed results is a procedure of classifying the selected characteristics by each class through a suitable classifier.
- an artificial neural network is used, and it is applied in various fields such as pattern recognition, function approximation, classification technique, etc. because of the characteristics of determining behavior according to input and output.
- the structure consists of several layers, nodes, and neural network connection weights.
- the neural network interlayer connection method used in the present invention is a feed-forward method. According to the input pattern, the output value was calculated using the neural network connection weight and activation function for each node. When the estimated value is different from the actual result value when a certain thing is processed through the generated combined information, the method is repeatedly found to reduce the error while comparing the calculated value with the actual result value.
- the method of generating the patient model includes linear models, support vector machines, neural networks, classification and regression trees, ensemble learning methods, Biomolecule analysis method and apparatus selected from the group consisting of discriminant analysis, neighbor neighbor method, Bayesian networks, and independent components analysis To provide.
- Case-based diagnosis is very important for the majority of diseases for which precise and comprehensive mechanisms are not known.
- the existing case-based machine learning reasoning system which is designed for specific machine learning techniques, is low in accuracy, and therefore, there is a continuous demand for the development of an improved system.
- the existing system is designed only as a disease discriminator using all the learned clinical test items, and does not provide a method of utilizing the importance or priority of the clinical test items for each disease.
- the present invention relates to a disease diagnosis and test item selection system using case-based machine learning inference to support a doctor's accurate diagnosis of a disease, and a machine with a neural network trained through a patient database of patients.
- the present invention relates to a system for identifying a disease by analyzing test information of a new patient through a disease discriminator which is a learning machine, and selecting and providing a minimum of important test items for the final determination of each disease by preliminary diagnosis.
- the disease diagnosis technique through machine learning inference is composed by applying machine learning techniques individually.
- the method of generating the patient model includes linear models, support vector machines, neural networks, classification and regression trees, ensemble learning methods, Discriminant analysis, neighbor neighbor method, Bayesian networks, independent components analysis, and the like.
- This system can be divided into two types. It consists of a stand-alone type diagnosis system for diagnosis only and an integrated system linked to existing hospital information systems such as OCS, PACS, LIS, etc. can do. For interworking with the integrated system, the system must be configured according to the HL7 and DICOM protocols.
- This system is an initial model, and linked with PMS (Patient Monitoring System) to increase the accuracy of diagnosis.
- PMS tient Monitoring System
- it can be developed as a system that is linked with various medical information systems such as OCS, EMR, and PACS as well as PMS to develop a more accurate diagnosis system that includes various disease factors.
- the present invention is the biological sample is selected from the group consisting of bacteria, fungi, viruses, cell lines, tissues and the biomolecule is from the group consisting of proteins, carbohydrates, lipids, polysaccharides, glycoproteins, hormones, receptors, antigens, antibodies and enzymes It provides a biomolecule analysis method using the analysis single-stranded nucleic acid and the reference material characterized in that at least one selected.
- N40 CATAACCCAGAGGTCGATGGATCCCCCC -3 '(where the underlined base sequence is a fixed site of the nucleic acid library and N40 means that the bases such as A, G, T, and C are present at the same concentration at each position).
- the FW primer used for PCR can base-bond with the 5 'end of the underlined bases of the base sequence and includes a promoter sequence for RNA polymerase of bacteriophage T7.
- the RE primer used for PCR may base-bond with the 3 'end of the underlined bases of the above base sequence.
- the FW and RE primers may also contain restriction enzyme cleavage sequences such as EcoRI and BamHI, respectively, for subsequent cloning.
- Random single-stranded nucleic acids to be reacted with a biological sample is an RNA library containing 2'-F-substituted pyrimidine, DNA nucleic acid library transcript and PCR primers were designed and prepared as described above prepared by PCR and in vitro transcription method.
- PCR was performed using a 1000 pmoles single-stranded nucleic acid transcript, primer pair (5P7) of 2,500 pmoles PCR with 50 mM KCl, 10 mM Tris-Cl (pH 8.3), 3 mM MgCl 2 , 0.5 mM dNTP (dATP, dCTP, dGTP, and dTTP), 0.1 U Taq DNA Polymerase (Perkin-Elmer, Foster City Calif.) and then purified by a QIAquick-spin PCR purification column (QIAGEN Inc., Chatsworth Calif.).
- Random single-stranded nucleic acids comprising 2′-F-substituted pyrimidines were prepared by synthesis and purification by in vitro transcription. 200 pmoles double stranded DNA transcript, 40 mM Tris-Cl, pH 8.0, 12 mM MgCl 2 , 5 mM DTT, 1 mM spermidine, 0.002% Triton X-100, 4% PEG 8000, 5 U T7 RNA Polymerase and 1 After reacting mM ATP, GTP and 3 mM 2'F-CTP, 2'F-UTP at 37 °C for 6 to 12 hours, purified by Bio-Spin 6 chromatography column (Bio-Rad Laboratories, Hercules Calif.) The amount of purified nucleic acid and its purity were then retrieved using a UV spectrometer.
- a biological sample composed of two or more biomolecules is an example of a human serum protein.
- a concentration of 10 15 nucleotide sequences / L of the random single-stranded nucleic acids synthesized in Example 1 was selected at a concentration of 200 pmol / L (50 mM TrisCl (pH 7.4), 5 mM KCl, 100 mM NaCl, 1 mM MgCl 2). , 0.1% NaN 3 ) was heated at 80 ° C. for 10 minutes and then left on ice for 10 minutes.
- the reaction solution was prepared by adding 5 times yeast tRNA (yeast tRNA, Life Technologies) and 0.2% BSA (bovine serum albumin, Merck) of the used single-stranded nucleic acid.
- the 10 ⁇ l serum biological sample containing the reference material was reacted by adding 90 ⁇ l of PBS solution and shaking with a nitrocellulose membrane disc for 30 minutes.
- the RNA single-stranded nucleic acids prepared above were treated with a serum biological sample attached disk and reacted for 30 minutes.
- biomolecule binding single-stranded nucleic acid binding to human serum biological samples is aimed at single-stranded nucleic acids consisting primarily of random sequences, and the reaction is repeated once with various washing buffers.
- human serum protein (biomolecule) -single-stranded nucleic acid complexes were obtained.
- RNA biomolecule binding single-stranded nucleic acid
- RT-PCR was performed on the isolated complex to amplify a DNA pool indicative of RNA (biomolecule binding single-stranded nucleic acid) that binds to serum proteins.
- biomolecule binding single-stranded nucleic acids may be prepared.
- Quality control single-stranded nucleic acid may be analyzed for the complex selected above.
- the base sequence of the capture probes to be used in the biochip according to the present invention for generating the profile of the biomolecule reflects the base sequence information of the single-stranded nucleic acid binding to the human serum protein (biomolecule)
- the secondary structure of the nucleic acid is After confirming the secondary structure and structure free energy using the modeling MFOLD program, the capture probe was designed by selecting single-stranded nucleic acid having the most stable secondary structure.
- the outer marker was selected from five plant-specific proteins to express the corresponding protein in the E. coli expression system, and the proteins were separated to secure single-stranded nucleic acid binding to the outer marker by the SELEX method.
- a capture probe corresponding to the external marker was designed with the base sequence of the id.
- reaction solution 10 15 nucleotide sequence / L concentration solution of the random single-stranded nucleic acids synthesized above was added to the reaction solution [100mM Tris-HCl (pH 8.2), 200mM NaCl, and 10mM MgCl 2 ] at a concentration of 200 pmol / L and 80 ° C. After heating for 10 minutes at, it was left for 10 minutes on ice.
- a reaction solution was prepared by adding 5 times yeast tRNA (yeast tRNA, Life Technologies) and 0.2% BSA (bovine serum albumin, Merck) of the used single-stranded nucleic acid.
- RT-PCR was performed on the isolated complex to amplify a DNA pool indicative of RNA (biomolecule binding single-stranded nucleic acid) that binds to serum proteins.
- RNA biological binding single-stranded nucleic acid
- reaction solution 100 mM Tris-HCl at pH 8.2, 200 mM NaCl, and 10 mM MgCl 2 ) at a concentration of 200 pmol / L at 80 ° C. After heating for 10 minutes, it was left for 10 minutes on ice.
- a reaction solution was prepared by adding 5 times yeast tRNA (yeast tRNA, Life Technologies) and 0.2% BSA (bovine serum albumin, Merck) of the used single-stranded nucleic acid.
- RNA single-stranded nucleic acids prepared above were reacted for 30 minutes to generate a biomolecule-single-nucleic acid complex.
- Biomolecule-binding single-stranded nucleic acid that binds to a human serum biological sample is performed by subjecting the reaction mixture solution to a structure made of nitrocellulose and nylon and applying pressure to the biomolecule-
- the single stranded nucleic acid complex is on the nitrocellulose filter and the unbound single stranded nucleic acid is on the nylon.
- the nitrocellulose filter was recovered and the human serum protein (biomolecule) -single-stranded nucleic acid complexes were secured by a single selection process by repeating the washing process with various washing buffers.
- RNA biomolecule binding single-stranded nucleic acid
- RT-PCR was performed on the isolated complex to amplify a DNA pool indicative of RNA (biomolecule binding single-stranded nucleic acid) that binds to serum proteins.
- RNA biological binding single-stranded nucleic acid
- nucleotide sequence of the capture probes to be used in the nucleic acid chip according to the present invention for generating the profile of the biomolecule reflects the nucleotide sequence information of the single-stranded nucleic acid binding to the human serum protein (biomolecule), the secondary structure of the nucleic acid therefor After confirming the secondary structure and the free energy of the structure using the MFOLD program modeling, we designed the capture probe by selecting the single-stranded nucleic acid having the most stable secondary structure.
- nucleotide sequence of the capture probes to be used in the nucleic acid chip according to the present invention for generating the profile of the biomolecule reflects the nucleotide sequence information of the single-stranded nucleic acid binding to the human serum protein (biomolecule), the secondary structure of the nucleic acid therefor After confirming the secondary structure and the free energy of the structure using the MFOLD program modeling, we designed the capture probe by selecting the single-stranded nucleic acid having the most stable secondary structure.
- the reference material consists of five plant-specific proteins, A, B, C, D and E, obtained from http://genomics.msu.edu/plant_specific/ (see Table 1).
- RNA the shape of things to come, pp. 497-510.In: RF Gestelend and JF Atkins (eds.).
- RNA World, Cold Spring Harbor Press, Cold Spring Harbor, NY Single stranded nucleic acid was obtained.
- This quality control single stranded nucleic acid and based on their nucleotide sequence, we designed a capture probe corresponding to quality control single stranded nucleic acid.
- a nucleotide sequence complementary to about 3,000 biomolecule-binding single stranded nucleic acids having the nucleotide sequence selected in Example 1 and a single stranded nucleic acid having nucleotide sequences complementary to the quality control single stranded nucleic acid were prepared by organic synthesis (Bionia).
- a nucleic acid chip having a capture probe fixed to a predetermined rule was prepared.
- the fabrication of nucleic acid chips was performed using a pin-type microarrayer system (GenPak, Inc.), and the spot spacing was such that the center-to-center was 370 ⁇ m.
- Each capture probe was dissolved in standard solution to adjust the concentration. At this time, the humidity in the arrayer was maintained at 70% to perform spotting.
- the spotted slides were left in a humidified chamber for 24 to 48 hours and then baked in a UV crosslinker. After fixing the capture probes to the glass slide in a widely known manner, the slide was immediately centrifuged and dried, and then stored in a light-blocked state.
- Plasmid pools were prepared by mixing the same amount of single-stranded nucleic acid-inserted plasmids selected in Example 1 or used for manufacturing a biochip (nucleic acid chip) or the plasmids inserted with the quality control single-stranded nucleic acid selected in Example 3.
- the single-stranded nucleic acid pool that binds to the human serum protein was designed and prepared by the plasmid pool and PCR primers, and prepared by PCR and in vitro transcription.
- a standard PCR method was performed in a PCR reaction solution, 100 pM 5'-primer, 100 pM 3'-primer, dNTP mixture (5 mM dATP, 5 mM CTP, 5 mM dGTP, 5 mM dTTP). 30 cycles were repeated for 30 seconds at 94 ° C, 30 seconds at 52 ° C, and 20 seconds at 72 ° C to synthesize double-stranded nucleic acids, which were purified by a QIAquick-spin PCR purification column (QIAGEN Inc., Chatsworth Calif.). .
- RNA molecules comprising 2′-F-substituted pyrimidines were prepared by in vitro transcription and purification.
- Reference I was added to the PBS solution, each containing a different amount of reference. It consists of five plant-specific proteins, A, B, C, D and E, which are the reference substances (see Table 1).
- Foreign biomolecule A is 0.01 pg / ml
- foreign biomolecule B is 1.0 pg / ml
- foreign biomolecule C is 100.0 pg / ml
- foreign biomolecule D is 10.0 ng / ml
- foreign biomolecule E is 1.0 ug / ml Standard I was constructed.
- Human serum used in the analysis is serum of healthy and stable angina patients with cardiovascular disease. 10 ⁇ l of serum samples were added to 90 ⁇ l of the PBS solution (the standard I), followed by nitrocellulose membrane ( Nitrocellulose membrane) disc was added to shake the reaction for 30 minutes to prepare a biological sample. 100-400 ng of the prepared single-stranded nucleic acid was reacted for 30 minutes to produce a biomolecule-single-stranded nucleic acid complex.
- the prepared single-stranded nucleic acids were treated with a serum biological sample attached standard I and reacted for 30 minutes. Three washes with a selection buffer or 50 mM EDTA and the protein-single-nucleated discs were separated and harvested.
- the protein (biomolecule) -single-nucleic acid attached disc or analytical target probe with an external marker and the protein (biomolecule) -single-nucleic acid-containing disc in RT-PCR solution was reverse-transcribed and labeled with Cy-5
- An amplification reaction was carried out with a primer (5'-Cy5-CGGAAGCGTGCTGGGCC-3 ') to prepare an assay target probe, which is a single stranded nucleic acid labeled with Cy-5.
- the target kit probe solution prepared in Example 4 was treated in a capture probe of the biochip (nucleic acid chip) of the present invention, hybridized at 60 ° C. for 4 to 12 hours, and washed with a 0.1 ⁇ SSC solution at 42 ° C.
- the hybridization solution then comprises 1 M sodium chloride, 0.3 M sodium citrate, 0.5% SDS or 100 / ml salmon pump DNA, 0.2% bovine serum albumin or single stranded nucleic acid.
- the target probe solution prepared in Example 3 was treated with hybridization at 42 ° C. for 12 hours, and the nucleic acid chip was washed with a washing solution.
- the composition of the washing solution is, for example, 1X SSC + 0.2% SDS, 1X SSC + 0.2% SDS, 0.5X SSC + 0.2% SDS, 0.01X SSC + 0.2% SDS in the order of 30 °C at each step 30 It was performed for a minute.
- Example 4 After the washing of Example 4 was finished, the glass slide was dried by centrifugation, and then a laser scanner having a laser (Cy5, 635 nm) of a suitable wavelength for excitation of the used fluorescent dye (laser scanner, GenePix4000, Search using Axon). Fluorescence images were saved in a multi-image-tagged image file (TIFF) format and analyzed by appropriate image analysis software (GenePix Pro 3.0, Axon).
- TIFF multi-image-tagged image file
- the signal intensity per spot is used by subtracting the base signal of the surrounding background, where the background signal consists of a local background of four spot signals around the particular spot. ). Include more than 90% of the spot's pixels in the data analysis when the signal intensity exceeds the background signal + 2 standard deviation (SD). It is common to classify as a bad spot and not include it in the analysis.
- the result is recorded as the signal intensity of the Cy5 channel and the average value is used when the spotting is more than doubled.
- the signal intensity (S) of the target single-stranded nucleic acid is obtained by obtaining the respective signal intensities for the pixels of the spot and then using the median value of pixel-by-pixel. ).
- Signal strength (S) is averaged to the variation in labeling efficiency using the internal standard (IS).
- the fluorescence of the spots varies with the nature of the double strands produced by the capture probe and the target probe.
- the fluorescence degree of the spot is determined by the amount of the analysis target probe and the comparative target probe constituting the spot.
- the reference material is composed of five kinds of plant-specific proteins, such as foreign molecules A, B, C, D and E.
- the foreign biomolecule A is 0.01 pg / ml
- the foreign biomolecule B is 1.0 pg / ml
- the foreign biomolecule C is 100.0 pg / ml
- the foreign biomolecule D is 10.0 ng / ml
- the foreign biomolecule E is 1.0 ug / ml. It was put into serum sample and analyzed. The fluorescence level of the spot corresponding to the reference material will be determined by the amount of the control comparative target probe and the control assay target probe.
- the fluorescence intensity of the spot corresponding to the reference material will be determined by the amount of quality control assay probe produced from the reference material in the analyte. That is, the degree of fluorescence of the spot corresponding to the reference material is related to the amount of reference material included in the analyte biological sample. Therefore, these correlations can be prepared as a standard curve to quantitatively analyze the desired spot using the degree of fluorescence of the desired spot.
- the comparative target probe is composed of a constant amount, so the fluorescence of the spot represents the amount of the assay target probe, and the amount of the assay target probe represents the amount of the human serum protein-single-stranded nucleic acid complex.
- the amount of the complex also represents the amount of biomolecule in the biological sample. Therefore, the amount of specific biomolecules in the biological sample including the biomolecules corresponding to the spots can be confirmed from the degree of fluorescence of the spots.
- the generated spots of the blue-yellow-red color spectrum show a variety of ratios of Cy-3-labeled competitive inhibitors bound to the capture probes and Cy-5-labeled target probes.
- the degree of color spectrum represents the amount of specific biomolecules (proteins) present in the specific serum samples that make up human serum so that the image showing the color spectrum of all spots on the nucleic acid chip corresponds to the biomolecule profile in the particular biosample. .
- a target probe which generates a double strand by combining with a capture probe at a specific spot is composed of a comparative target probe labeled with Cy-3 and an assay target probe labeled with Cy-5,
- the former is present in constant amounts, while the latter is present in proportion to the corresponding biomolecules in human serum. This results in certain spots becoming blue if the latter is present in relatively small amounts, yellow if similar, and red if present in excess.
- the degree of fluorescence differs depending on the number of target probes in the double strand, which is correlated with the number of biomolecules. Therefore, the image reflecting the color spectrum of all the spots constituting the nucleic acid chip of the present invention is a biomolecular profile of a biological sample containing unknown biomolecules.
- test results are as shown in FIG. 6, and as shown in FIG. 6, the spots, which are attached to the capture probes based on single-stranded nucleic acids that bind to the serum proteins, on the glass slides with the capture probes, vary in fluorescence, blue, yellow, and red. Generates a color spectrum of the color.
- Beads are polystyrene, polymethyl methacrylate, latex, silica, polyvinyltoluene, styrenevinyltoluene, styrene-butadien It can be used to select a kind from the group consisting of).
- the size of the microbeads there is no limitation on the size of the microbeads, and both the unmodified surface and the carboxyl group-modified bead may be used.
- the microbead surface is modified with a carboxyl group and the ELP is immobilized using the NHS / EDC reaction.
- single-stranded nucleic acids having a base sequence complementary to 3,000 biomolecule-binding single-stranded nucleic acids having a nucleotide sequence selected in Example 1 and a base sequence complementary to a quality control single-stranded nucleic acid were prepared by organic synthesis (Bionia).
- Bead arrays were prepared by fixing the capture probes to the beads using the prepared probes (xMAP carboxylated microspheres; Luminex Corp. Austin, TX).
- Example 4 Using the capture probe prepared in Example 4 was prepared by melting the capture probe at 100 uM each. After mixing the beads to be reacted well to each number, 40 ul of each was prepared and prepared. (Beads of different numbers were prepared according to each probe, and mixed well to react with the probe. Pipette 40ul off and prepare in a new tube). 20ul of 0.1 M MES (pH 4.5) was mixed and 2ul of the prepared probe was mixed with the beads. Thereafter, 1 ⁇ l of freshly prepared 10 ml / ml EDC (1-Ethyl-3- (3-dimethylaminopropyl) carbodiimide HCl, PIERCE) solution was added and reacted. Shake well for about 30 minutes in the dark to react.
- EDC 1-Ethyl-3- (3-dimethylaminopropyl) carbodiimide HCl
- Analytical target probes were prepared as in Example 5, except that analytical target probes were biotin-labeled single-stranded nucleic acids by amplification with a biotin-labeled primer (5'-Cy5-CGGAAGCGTGCTGGGCC-3 ').
- a biotin-labeled primer 5'-Cy5-CGGAAGCGTGCTGGGCC-3 '.
- the analytical target probe prepared above was dissolved in the hybridization solution, and then hybridized with each other. After 5 minutes of reaction at 95 ° C, the reaction was carried out at 40 ° C for 30 minutes. The reaction was terminated by a 96 well filter plate and washed three times using the wash buffer. After washing, Streptavidin phycoerythrin (Sigma Aldrich, S3402) was stirred in the dark for 15 minutes using 100 ul of a solution diluted 500-fold.
- Luminex 100 was numerically calculated using two lasers (lazer), one bead number and one amount of reacted picoerythrin. The amount of target probe bound to each capture probe while reading the corresponding beads is represented by the Mean fluorescent intensity (MFI) value of the beads.
- MFI Mean fluorescent intensity
- the nucleic acid chip based on the target single-stranded nucleic acid binding to human serum protein can be used to confirm the profile of serum protein in human serum and also in the serum of healthy human (A) and stable angina cardiovascular disease (B). It can be seen that the biomolecule profiles are different.
- FIG. 7 is a flowchart illustrating a procedure of a database configured for a disease group from a blood biological sample of a patient by using the nucleic acid chip of the present invention.
- 8 is a flow chart for diagnosing a disease by producing a biomolecular profile of a specific human serum by a program using a database and artificial neural network configured by the disease group.
- useful information can be obtained by analyzing a database constructed of profiles produced in many biological samples by bioinformatics techniques.
- the clinical data of serum biological samples used to establish the cardiovascular disease diagnosis database are shown in Table 2 below.
- Serum biopsy of Lee 2-1 (99) was performed using a serum profile database of cardiovascular patients such as healthy people, stable angina, unstable angina pectoris and myocardial infarction, as shown in FIG. 9 and 72.5% 10 fold cross Validation can be predicted as a healthy person.
- the clinical data of serum biological samples used to establish the liver cancer diagnosis database are shown in Table 3, with 19 healthy patients, 72 patients with metastatic liver cancer, 11 patients with metastatic liver cancer, 83 patients with liver cancer, and 102 cases with biologic samples. to be.
- liver cancer patients and healthy people After a patient model of liver cancer patients and healthy people was constructed from a database of serum protein profiles of liver cancer patients and healthy people, a patient model of metastatic patients and non-patients was constructed from the database of liver cancer patients.
- blind patients can be classified into liver cancer patients by using a neural network using a liver cancer patient and a healthy human patient model, and additionally positive liver cancer patients using a patient model of metastatic patients and non-patients.
- a program using an artificial neural network can check the metastatic status, which is the progression of liver cancer, and it can examine prognosis and drug responsiveness as well as disease progression such as metastatic status.
- results of testing serum biological samples of KIM humans using a serum profile database of healthy people and liver cancer are shown in FIG. 10 and can be predicted as liver cancer patients with 93.0% 10 fold cross validation.
- the serum biosamples of KIM were examined using a serum protein profile database of healthy human, non-transparent liver cancer and metastatic liver cancer to test for metastasis as shown in FIG. 8 and showed 76.0% 10 fold cross validation. Can be predicted as a liver cancer patient.
- FIG. 12 is a diagram illustrating the amino acid sequence of a protein separated from a protein binding to a selected single-stranded nucleic acid using a MALDI-TOF-TOF device.
- the biomolecule profile was searched and analyzed in a specific biological sample.
- a database consisting of disease groups was compared and analyzed to determine useful spots and to prepare corresponding single-stranded nucleic acids to identify and identify corresponding proteins.
- a biological sample composed of two or more biomolecules is an example of a cell line.
- the biochip of the present invention was produced by producing the profile of the surface biomolecules of the non-small cell lung cancer cell line as a biological sample by the method of Examples 2 to 4. After reacting the prepared random single-stranded nucleic acids with lung cancer cell lines, wash the cell line (biomolecule) -single-stranded nucleic acid complex using a washing buffer to dissociate the single-stranded nucleic acid according to the degree of binding and unbound single-stranded nucleic acid, and then to 5,000xg. After repeating the process of centrifugation, single-stranded nucleic acid complexes were separated by centrifugation to prepare single-stranded nucleic acids that bind to surface biomolecules of non-small cell lung cancer cell lines.
- the clones were selected from the prepared single-stranded nucleic acids to determine and analyze the base sequence to select about 1,000 single-stranded nucleic acids.
- a nucleic acid chip of the present invention was prepared by synthesizing a capture probe consisting of complementary base sequences of about 1,000 single-stranded nucleic acids selected by the method of Example 2 and attaching it on a solid support.
- nucleic acid chip prepared by the method of Example 4 to produce a surface molecule profile of small cell lung cancer cell line (SCLC).
- SCLC small cell lung cancer cell line
- the biomolecule-single-nucleic acid complex of the cell line (biosample) was washed and separated.
- Single-stranded nucleic acid bound to the complex was amplified and labeled by the method of Example 3.
- the capture probe and the labeled target probe were reacted by the method of Example 4.
- the measurement of the substance labeled on the target probe was performed by the method of Example 5, and the profile of the surface biomolecules of the non-small cell lung cancer cell line was confirmed.
- the single-stranded nucleic acid which is expected to bind strongly to the small cell lung cancer cell line (SCLC) was synthesized using the produced profile to synthesize FITC-attached single-stranded nucleic acid. MRC-5 and THP-1) and then fluorescence image is shown in Figure 13.
- the single-stranded nucleic acid selected from the small cell lung cancer cell line profile produced using the nucleic acid chip of the present invention binds to the small cell lung cancer cell line.
- the nucleic acid chip of the present invention was produced by the E. coli KCTC12006 as a biological sample and the method of Examples 2 to 4. After reacting the prepared single-stranded nucleic acids with E. coli, wash the E. coli (biomolecule) -single-nucleic acid complex using a washing buffer to dissociate the single-stranded nucleic acid according to the degree of binding and unbound single-stranded nucleic acid and centrifuged at 5,000xg After repeated treatment, the E. coli-single-nucleic acid complex was separated by centrifugal separation to prepare single-stranded nucleic acids that bind to the surface biomolecules of E. coli.
- the clones were selected from the prepared single-stranded nucleic acids to determine and analyze the base sequence to select about 1,000 single-stranded nucleic acids.
- Capture probes were synthesized by complementary base sequences of about 1,000 single-stranded nucleic acids selected and attached onto a solid support to prepare a nucleic acid chip according to the present invention.
- a biological sample composed of two or more biomolecules is an example of a bacterium.
- the surface molecule profile of Escherichia coli KCTC12006 was produced using the nucleic acid chip produced by the method of Example 6.
- E. coli and the single-stranded nucleic acid pool were reacted, and then the E. coli-target single-stranded nucleic acid complex was washed and separated.
- Single-stranded nucleic acid bound to the complex was amplified and labeled by the method of Example 3.
- the capture probe and the labeled target probe were reacted by the method of Example 4.
- the measurement of the substance labeled on the target single-stranded nucleic acid was performed by the method of Example 5, and confirmed the profile of the surface biomolecules of E. coli.
- a surface biomolecular profile of Salmonella typhimurium ATCC13311 was produced to build a database, and then a single-stranded nucleic acid that specifically binds to E. coli based on the hierarchical clustering method. Selected. The specificity of the single-stranded nucleic acid was measured by SPR equipment (BIAcore) as shown in FIG. 14, and it was confirmed that the selected single-stranded nucleic acid specifically binds to E. coli compared with Salmonella.
Abstract
Description
Claims (45)
- 정도관리를 목적으로 하는 물질을 선택하고 이를 기준물질로 결정하는 단계;둘 또는 그 이상의 생체분자들로 구성된 생체시료에 포함된 생체분자 및/또는 상기 기준물질과 결합할 수 있는 리간드를 결정하는 단계;결정된 리간드의 정보를 사용하여 포착프로브들을 합성하고 합성된 포착프로브들을 기판에 고착시키는 단계; 및생체분자들의 생물학적 의미를 분석하는 리간드를 선정하기 위한 기준물질 및 분석대상의 생체시료에 포함된 생체분자로부터 준비된 타깃프로브들을 사용하여 상기 생체시료에서 생체분자들과 리간드들의 결합정보를 수집하는 단계;를 포함하는, 기준물질을 이용한 바이오칩의 제조방법.
- 제1항에 있어서,상기 물질은 분석하고자 하는 생체시료에 포함되지 않는 것을 특징으로 하는 기준물질을 이용한 바이오칩의 제조방법.
- 제1항에 있어서,상기 생체시료에 포함된 생체분자 및 기준물질과 결합할 수 있는 리간드는 항체, 펩타이드, 단일가닥핵산 및 압타머(aptamer)로 이루어진 군 중에서 선택되는 것을 특징으로 하는 기준물질을 이용한 바이오칩의 제조방법.
- 제1항에 있어서,생체시료에 포함된 생체분자들과 결합할 수 있는 생체분자결합 리간드를 결정하는 단계는,생체분자들에 무작위 단일가닥핵산들을 반응시켜 생체분자-단일가닥핵산 복합체들을 제조하는 단계;상기 생체분자-단일가닥핵산 복합체들을 세척하고, 상기 생체분자들과 상기 단일가닥핵산들의 결합력 크기를 측정하여 일정 결합력 이상을 갖는 생체분자-단일가닥핵산 복합체들을 선택하는 단계;선택된 상기 복합체들로부터 단일가닥핵산들을 분리하고 증폭하는 단계; 및증폭된 단일가닥핵산들의 염기서열을 결정하여 상기 생체분자결합 단일가닥핵산들을 결정하는 단계;를 포함하는 것을 특징으로 하는 기준물질을 이용한 바이오칩의 제조방법.
- 제1항에 있어서,생체분자들의 생물학적 의미를 분석하는 리간드를 선정하는 단계는,생체시료와 생체분자결합 단일가닥핵산들을 반응시켜 생체분자-단일가닥핵산 복합체를 형성하고 상기 복합체를 분리하는 단계;분리된 생체분자-단일가닥핵산 복합체에서 상기 단일가닥핵산을 증폭 및 표지하여 분석타깃프로브를 제작하는 단계; 및표지된 분석타깃프로브를 타깃프로브로 하여 바이오칩에서 포착프로브들에 대한 결합프로파일을 획득하는 단계;를 포함하는 것을 특징으로 하는 기준물질을 이용한 바이오칩의 제조방법.
- 제1항에 있어서,상기 포착프로브들을 합성하는 단계는,생체분자결합 단일가닥핵산들, 상기 기준물질들과 결합하는 단일가닥핵산들의 염기서열 및 이들의 상보적인 염기서열들로 이루어진 군 중에서 선택되는 염기서열로 합성된 것을 특징으로 하는 기준물질을 이용한 바이오칩의 제조방법.
- 제1항에 있어서,상기 타깃프로브는,기준물질을 구성하는 외래분자들이 각기 다른 양으로 첨가된 생체시료로부터 분석타깃프로브들을 준비하거나 또는, 상기 기준물질을 구성하는 외래분자들에 상응하는 포착프로브들에 결합하는 분석마커타깃프로브들이 각각 다른 양으로 첨가된 분석타깃프로브를 준비하는 단계, 및 상기 포착프로브들에 결합하는 비교타깃프로브들을 상기 분석타깃프로브들에 첨가하여 상기 타깃프로브를 준비하는 것을 특징으로 하는 기준물질을 이용한 바이오칩의 제조방법.
- 생체시료에 함유된 생체분자들과 결합하는 리간드 및 기준물질을 구성하는 분자들에 결합하는 리간드의 정보를 사용하여 합성된 포착프로브들이 기판에 고착되어 있는 바이오칩을 준비하는 단계;생체시료를 대상으로 생체분자들과 결합하는 리간드들, 기준물질을 구성하는 외래분자에 결합하는 리간드들로부터 제조된 타깃프로브들 및 바이오칩을 이용하여 분석한 결합프로파일을 획득하는 단계; 및획득된 결합정보와 이미 확보되어 있는 결합정보 데이터를 비교하여 미지의 생체분자들의 생물학적 의미를 분석하는 단계;를 포함하는, 생체분자 분석단일가닥 핵산 선정 방법.
- 제8항에 있어서,상기 생체시료는 세균, 진균류, 바이러스, 세포주, 조직으로 이루어진 군 중에서 선택되고, 상기 생체분자는 단백질, 탄수화물, 지질, 다당체, 당단백, 호르몬, 수용체, 항원, 항체 및 효소로 이루어진 군으로부터 선택된 적어도 하나 이상인 것을 특징으로 하는, 생체분자 분석단일가닥핵산 선정 방법.
- 무작위 염기서열로 이루어진 단일가닥핵산을 포함하는 핵산라이브러리에서 둘 또는 그 이상의 생체분자들로 구성된 생체시료에 있는 생체분자와 결합하는 결합단일가닥핵산 및 분석단일가닥핵산을 선정하기 위한 정도관리 기준물질을 사용하고 정도관리 단일가닥핵산을 핵산분석방법으로 분석하여 내부정도관리하는 것을 특징으로 하는, 생체분자 분석단일가닥핵산 선정 방법.
- 제10항에 있어서,상기 정도관리 기준물질은 분석하고자하는 생체시료에 포함되지 않는 생체분자인 것을 특징으로 하는 생체분자 분석단일가닥핵산 선정 방법.
- 제11항에 있어서,상기 기준물질들로부터 정도관리 단일가닥핵산을 제조하는 단계;상기 생체시료에 있는 생체분자들로부터 결합단일가닥핵산들을 제조하는 단계; 및상기 정도관리 단일가닥핵산 및 상기 결합단일가닥핵산의 염기서열을 사용하여 합성된 포착프로브가 고착된 지지체를 제조하는 단계;를 포함하고,생체분자들의 생물학적 의미를 분석하는 상기 분석단일가닥핵산을 선정하기 위한, 생체시료, 기준물질, 결합단일가닥핵산, 정도관리 단일가닥핵산 및 핵산 칩은 상기 생체분자들과 상기 결합단일가닥핵산들의 결합프로파일을 생성하는 것에 사용되는 것을 특징으로 하는, 생체분자 분석단일가닥핵산 선정 방법.
- 제12항에 있어서,상기 결합단일가닥핵산들을 제조하는 방법은,생체시료에 있는 생체분자들 및 상기 기준물질로 구성된 시료에 상기 무작위 염기서열을 가진 단일가닥핵산들을 반응시켜 생체분자-단일가닥핵산 복합체들을 선택하는 단계;상기 복합체들로부터 단일가닥핵산들을 분리 및 증폭하여 단일가닥핵산 DNA를 제조하는 단계; 및상기 단일가닥핵산 DNA의 염기서열을 결정함으로써 상기 결합단일가닥핵산을 제조하는 단계;를 포함하는 것을 특징으로 하는, 생체분자 분석단일가닥핵산 선정 방법.
- 제13항에 있어서,상기 생체분자-단일가닥핵산 복합체들을 선택하는 방법은, 반응용액에 있는 생체분자-단일가닥핵산 복합체들을 세척하고, 상기 생체분자들과 상기 단일가닥핵산들의 결합력을 측정하여 일정 결합력 이상의 생체분자-단일가닥핵산 복합체들을 선택하는 것을 특징으로 하는, 생체분자 분석단일가닥핵산 선정 방법.
- 제14항에 있어서,상기 생체분자-단일가닥핵산 복합체를 선택하는 방법은 상기 반응용액을 모세관 전기영동하여 생체분자-단일가닥핵산 복합체들을 선택하거나, 상기 반응용액을 나이트로셀룰로스 및 나일론으로 이루어진 구조체에 처리하여 생체분자-단일가닥핵산 복합체들을 선택하는 것을 특징으로 하는, 생체분자 분석단일가닥핵산 선정 방법.
- 제12항에 있어서,상기 포착프로브가 고착된 지지체는 유리슬라이드, 바이오센서의 감지표면, 비드 및 나노입자로 이루어진 군 중에서 선택되는 것을 특징으로 하는, 생체분자 분석단일가닥핵산 선정 방법.
- 제12항에 있어서,상기 포착프로브는 결합단일가닥핵산의 염기서열, 정도관리 단일가닥핵산의 염기서열 및 이들의 상보적인 염기서열들 중에 선택되는 적어도 하나의 염기서열로 합성된 것을 특징으로 하는, 생체분자 분석단일가닥핵산 선정 방법.
- 제12항에 있어서,상기 생체시료에 있는 생체분자와 결합단일가닥핵산의 결합프로파일을 생성하는 방법은,상기 기준물질, 생체시료, 정도관리 단일가닥핵산 및 결합단일가닥핵산으로부터 표지물질이 있는 분석타깃프로브를 제조하는 단계;포착프로브에 상응하는 상기 결합단일가닥핵산 및 상기 정도관리 단일가닥핵산을 혼합 및 증폭하여 표지물질이 있는 비교타깃프로브를 제조하는 단계;상기 분석타깃프로브와 상기 비교타깃프로브들을 혼합하여 타깃프로브를 제조하는 단계; 및상기 타깃프로브들과 지지체 상의 포착프로브들을 혼성화 반응시켜 결합프로파일을 획득하는 단계;를 포함하는 것을 특징으로 하는, 생체분자 분석단일가닥핵산 선정 방법.
- 제18항에 있어서,상기 분석타깃프로브를 제조하는 단계는,기준물질들이 각각 다른 양으로 포함된 기준물질 I을 생체시료에 첨가한 분석시료를 준비하는 단계;상기 분석시료와 결합단일가닥핵산 및 상기 정도관리 단일가닥핵산으로 구성된 단일가닥핵산들을 반응시켜 생성된 생체분자-단일가닥핵산 복합체 및 기준물질-단일가닥핵산 복합체를 분리하는 단계; 및상기 복합체들에서 단일가닥핵산들을 분리, 증폭 및 표지하여 분석타깃프로브를 제조하는 단계;를 포함하는 것을 특징으로 하는, 생체분자 분석단일가닥핵산 선정 방법.
- 제18항에 있어서,상기 분석타깃프로브를 제조하는 방법은,생체시료와 결합단일가닥핵산들을 반응시켜 생성된 생체분자-단일가닥핵산 복합체로부터 단일가닥핵산을 분리하는 단계; 및분리된 단일가닥핵산에 정도관리 단일가닥핵산들이 각각 다른 양으로 구성된 기준물질 II를 혼합하여 증폭 및 표지로 상기 분석타깃프로브를 제조하는 단계;를 포함하는 것을 특징으로 하는, 생체분자 분석단일가닥핵산 선정 방법.
- 기준물질을 사용하여 둘 또는 그 이상의 생체분자들로 구성된 생체시료를 대상으로 둘 또는 그 이상의 생체분자들을 상기 분석단일가닥핵산으로 분석하는 과정을 포함하는, 기준물질을 이용한 바이오칩의 제조방법.
- 분석단일가닥핵산을 사용하여 생체시료에 있는 생체분자 분석을 위한 상기 정도관리 기준물질을 사용하고 상기 정도관리 단일가닥핵산을 핵산분석방법으로 분석하여 내부정도관리하는 단계를 포함하는, 생체분자 분석 방법.
- 제22항에 있어서,상기 분석단일가닥핵산을 사용하여 상기 생체시료에 있는 생체분자의 분석은 핵산분석방법으로 수행하는 것을 특징으로 하는, 생체분자 분석 방법.
- 제22항에 있어서,상기 정도관리 기준물질은 분석하고자하는 생체시료에 포함되지 않는 생체분자인 것을 특징으로 하는, 생체분자 분석 방법.
- 제22항에 있어서,분석단일가닥핵산 및 상기 정도관리 단일가닥핵산의 염기서열을 사용하여 합성된 포착프로브를 지지체에 고착하는 단계;기준물질, 생체시료, 정도관리 단일가닥핵산 및 분석단일가닥핵산으로부터 표지물질이 있는 타깃프로브를 제조하는 단계;상기 타깃프로브를 지지체 상의 포착프로브와 혼성화 반응시켜 결합정보를 획득하는 단계; 및상기 획득된 결합정보와 이미 확보되어 있는 결합정보 데이터를 비교하여 상기 생체분자들의 생물학적 의미를 분석하는 단계;를 포함하는 것을 특징으로 하는, 생체분자 분석방법.
- 제25항에 있어서,상기 타깃프로브를 제조하는 단계는,상기 기준물질, 생체시료, 정도관리 단일가닥핵산 및 분석단일가닥핵산으로부터 표지물질이 있는 분석타깃프로브를 제조하는 단계;상기 포착프로브에 상응하는 상기 분석단일가닥핵산 및 상기 정도관리 단일가닥핵산을 혼합, 증폭하여 표지물질이 있는 비교타깃프로브를 제조하는 단계; 및상기 분석타깃프로브 및 상기 비교타깃프로브로 구성된 타깃프로브를 제조하는 단계; 를 포함하는 것을 특징으로 하는, 생체분자 분석방법.
- 제25항에 있어서,상기 포착프로브들이 고착하는 지지체는 유리슬라이드, 바이오센서의 감지표면, 비드, 나노입자 등을 포함하는 것을 특징으로 하는, 생체분자 분석방법.
- 제25항에 있어서,상기 포착프로브는 분석단일가닥핵산 및 상기 정도관리 단일가닥핵산의 염기서열에 완전하게 상보적 결합을 하는 염기서열로 이루어진 것을 특징으로 하는, 생체분자 분석방법.
- 제25항에 있어서,상기 생체분자-단일가닥핵산 복합체와 상기 기준물질-단일가닥핵산 복합체에서 분리된 분석단일가닥핵산을 표지 및 증폭하기 위한, 표지물질이 있는 프라이머와 상기 복합체에 포함된 상기 분석단일가닥핵산 및 상기 정도관리 단일가닥핵산의 특정염기서열을 포함하는 영역과 이들을 각각 지시하는 염기서열 영역이 있는 태그로 구성된 프라이머를 사용하는 것을 특징으로 하는, 생체분자분석방법.
- 제25항에 있어서,상기 분석타깃프로브를 제조하는 방법은,상기 기준물질들이 각각 다른 양으로 구성된 기준물질 I을 생체시료에 첨가하여 분석시료를 준비하는 단계;준비한 분석시료와 상기 분석단일가닥핵산 및 상기 정도관리 단일가닥핵산으로 구성된 단일가닥핵산들을 반응시켜 형성된 생체분자-단일가닥핵산 복합체 및 기준물질-단일가닥핵산 복합체를 분리하는 단계; 및상기 분리된 복합체에 있는 상기 분석단일가닥핵산을 분리, 증폭 및 표지하여 분석타깃프로브를 준비하는 단계;를 특징으로 하는, 생체분자 분석방법.
- 제25항에 있어서,상기 분석타깃프로브를 준비하는 방법은,상기 생체시료와 상기 분석단일가닥핵산들을 반응시켜 생성된 생체분자-단일가닥핵산 복합체를 분리하는 단계; 및상기 분리된 생체분자-단일가닥핵산 복합체에서 분리된 분석단일가닥핵산에 정도관리 단일가닥핵산들이 각각 다른 양으로 함유된 기준물질 II를 혼합, 증폭 및 표지하여 상기 표지된 분석타깃프로브를 제조하는 단계;를 특징으로 하는, 생체분자 분석방법.
- 제31항에 있어서,상기 생체분자-단일가닥핵산 복합체를 분리하는 방법은 상기 반응용액을 모세관 전기영동하여 생체분자-단일가닥핵산 복합체들을 선택하거나, 상기 반응용액을 나이트로셀룰로스 및 나일론으로 이루어진 구조체에 처리하여 생체분자-단일가닥핵산 복합체들을 선택하는 것을 특징으로 하는, 생체분자 분석방법.
- 제25항에 있어서,상기 표지물질은 비오틴(Biotin), Cy2, GFP, YO-PRO-1, YOYO-1, Calcein, FITC, FlourX, ALEXA 488, Rhodamine 110, ABI 5-FAM, Oregon Green 500, Oregon green 488, RiboGreen, Rhodamine Green, Rhodamine 123, Magnesium Green, Calcium Green, TO-PRO-1, TOTO-1, ABI JOE, BODIPY 530/550, Dil, BODIPY TMR, BODIPY558/568, BODIPY564/570, Alexa 546, TRITC, Magnesium Orange, Phycoerythrin R & B, Rhodamine Phalloidin, Calcium Orange, Pyronin Y, Rhodamine B, ABI TAMRA, Rhodamine Red, Cy3.5, ABI ROX, Calcium Crimson, Alexa 594, Texas Red, Nile Red, YO-PRO-3, YOYO-3, R-phycocyanin, C-phycocyanin, TOPRO-3, TOTO-3, DiD DilC(5), Thiadicarbocyainie, Cy5.5, Cy5 및 Cy3으로 이루어진 군 중에서 선택되는 형광색소를 사용하는 것을 특징으로 하는, 생체분자의 분석방법.
- 제22항에 있어서,분석단일가닥핵산을 사용하여 생체시료에 있는 생체분자 분석을 위한 상기 정도관리 기준물질을 사용하고 상기 정도관리 단일가닥핵산을 핵산분석방법으로 분석하여 내부정도관리하는 단계를 포함하는 생체분자 분석 방법으로 생산되는 환자군의 상기 생체분자와 분석단일가닥핵산의 결합정보 및 대조군의 생체분자와 분석단일가닥핵산의 결합정보 데이터를 입력받고 데이터베이스를 구축하는 단계;입력된 결합정보 데이터를 이용하여 분석시스템에서 전처리를 수행하는 단계;전처리된 결과를 가지고 환자의 모델을 생성하는 단계;생성된 모델을 로딩하여 내원한 환자에 적용하여 블라인드 테스트(Blind test)인 진단을 수행하는 단계; 및교차검정을 통해 시스템의 성능을 평가하는 단계;를 더 포함하는 것을 특징으로 하는 생체분자 분석 방법.
- 제34항에 있어서,상기 환자의 모델을 생성하는 방법은, 선형 모델(linear models), 지지 벡터 기계(support vector machines), 신경망(neural networks), 분류 및 회귀 트리(classification and regression trees), 앙상블 학습법(ensemble learning methods), 판별식 분석(discriminant analysis), 근접 네이버 방법(nearest neighbor method), 베이즈 네트워크(Bayesian networks), 독립 성분 분석(independent components analysis)으로 구성되는 군으로부터 선택되는 것을 특징으로 하는, 생체분자 분석 방법.
- 생체시료에 있는 생체분자들을 준비하는 시료처리장치, 생체분자-단일가닥핵산 복합체를 제조하고 상기 복합체의 단일가닥핵산을 분석하는 모듈로 구성된 핵산분석장치를 포함하는, 생체분자 분석장치.
- 제36항에 있어서,상기 생체분자 분석장치는,환자군의 상기 생체분자와 분석단일가닥핵산의 결합정보 및 대조군의 생체분자와 분석단일가닥핵산의 결합정보 데이터를 입력받고 데이터베이스를 구축하는 모듈;입력된 결합정보 데이터를 이용하여 분석 시스템에서 전 처리를 수행하는 모듈;전 처리된 결과를 가지고 환자의 모델을 생성하는 모듈;생성된 모델을 로딩하여 내원한 환자에 적용하여 블라인드 테스트(Blind test)인 진단을 수행하는 모듈; 및교차검정을 통해 시스템의 성능을 평가하는 모듈;을 더 포함하는 것을 특징으로 하는 생체분자 분석장치.
- 제37항에 있어서,상기 환자의 모델을 생성하는 방법은, 선형 모델(linear models), 지지 벡터 기계(support vector machines), 신경망(neural networks), 분류 및 회귀 트리(classification and regression trees), 앙상블 학습법(ensemble learning methods), 판별식 분석(discriminant analysis), 근접 네이버 방법(nearest neighbor method), 베이즈 네트워크(Bayesian networks), 독립 성분 분석(independent components analysis)으로 구성되는 군으로부터 선택되는 것을 특징으로 하는, 생체분자 분석장치.
- 제36항에 있어서,상기 생체시료는 세균, 진균류, 바이러스, 세포주, 조직으로 구성된 군으로 부터 선택되고 상기 생체분자는 단백질, 탄수화물, 지질, 다당체, 당단백, 호르몬, 수용체, 항원, 항체 및 효소로 이루어진 군으로부터 선택된 적어도 하나 이상인 것을 특징으로 하는, 생체분자 분석장치.
- 제37항에 있어서,생성된 환자모델을 이용하여 일차적으로 환자의 질병을 확인하는 단계; 및연속적으로 환자의 질병 진행단계, 예후 및 약물반응성을 확인하는 단계를 더 포함하는 것을 특징으로 하는, 생체분자 분석장치.
- 제40항에 있어서,상기 환자모델은 간암 환자모델이고, 상기 질병은 간암이며, 상기 질병 진행단계 확인은 전이를 확인하는 것을 특징으로 하는, 생체분자 분석장치.
- 생체분자 분석단일가닥핵산들을 둘 또는 그 이상의 생체분자들로 구성된 생체시료를 대상으로 둘 또는 그 이상의 생체분자들과 반응시켜 생체분자-단일가닥핵산 복합체를 형성하는 단계;상기 반응용액을 모세관 전기영동하여 생체분자-단일가닥핵산 복합체들을 선택하거나, 상기 반응용액을 나이트로셀룰로스 및 나일론으로 이루어진 구조체에 처리하여 생체분자-단일가닥핵산 복합체들을 선택하는 단계; 및상기 선택된 생체분자-단일가닥핵산 복합체의 상기 분석단일가닥핵산을 핵산분석기술로 분석하는 단계를 포함하는, 생체분자 분석방법.
- 분석단일가닥핵산을 사용하여 생체시료에 있는 생체분자 분석을 위한 상기 정도관리 기준물질을 사용하고 상기 정도관리 단일가닥핵산을 핵산분석방법으로 분석하여 내부정도관리하는 단계를 포함하는 생체분자 분석 방법으로 생산되는 환자군의 상기 생체분자와 분석단일가닥핵산의 결합정보 및 대조군의 생체분자와 분석단일가닥핵산의 결합정보 데이터를 입력받고 데이터베이스를 구축하는 단계;입력된 결합정보 데이터를 이용하여 분석시스템에서 전처리를 수행하는 단계;전처리된 결과를 가지고 환자의 모델을 생성하는 단계;생성된 모델을 로딩하여 내원한 환자에 적용하여 블라인드 테스트(Blind test)인 진단을 수행하는 단계; 및교차검정을 통해 시스템의 성능을 평가하는 단계;를 더 포함하는 것을 특징으로 하는 생체분자 분석 방법.
- 제43항에 있어서,생성된 환자모델을 이용하여 일차적으로 환자의 질병을 확인하는 단계; 및연속적으로 환자의 질병 진행단계, 예후 및 약물반응성을 더 포함하는 것을 특징으로 하는, 생체분자 분석 방법.
- 제44항에 있어서,상기 환자모델은 간암 환자모델이고, 상기 질병은 간암이며, 상기 질병 진행단계 확인은 전이를 확인하는 것을 특징으로 하는, 생체분자 분석 방법.
Priority Applications (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP14855454.6A EP3062252A4 (en) | 2013-10-22 | 2014-05-08 | Marker for generating binding information on biomolecules and nucleic acids, preparation method therefor, and method and apparatus for analyzing biomolecule by using same |
CA2935138A CA2935138C (en) | 2013-10-22 | 2014-05-08 | Marker for generating binding information on biomolecules and nucleic acids, preparation method therefor, and method and apparatus for analyzing biomolecule by using same |
JP2016526217A JP6518238B2 (ja) | 2013-10-22 | 2014-05-08 | 生体分子と核酸の結合情報を生成するためのマーカー、その製造方法、並びにそれを用いた生体分子分析方法及び装置 |
CN201480070233.7A CN105960644B (zh) | 2013-10-22 | 2014-05-08 | 用于生成生物分子和核酸的结合信息的标记物及其制备方法,利用上述标记物的生物分子分析方法及装置 |
US15/031,009 US10072286B2 (en) | 2013-03-27 | 2014-05-08 | Marker for generating binding information on biomolecules and nucleic acids, preparation method therefor, and method and apparatus for analyzing biomolecule by using same |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR10-2013-0125675 | 2013-10-22 | ||
KR1020130125675A KR101829668B1 (ko) | 2013-03-27 | 2013-10-22 | 생체분자와 단일가닥핵산의 결합정보를 생성하기 위한 기준물질 및 핵산칩, 이들의 제조방법 및 이들을 이용한 생체분자 분석방법 및 장치 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2015060511A1 true WO2015060511A1 (ko) | 2015-04-30 |
Family
ID=52997728
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2014/004107 WO2015060511A1 (ko) | 2013-03-27 | 2014-05-08 | 생체분자와 핵산의 결합정보를 생성하기 위한 마커, 이의 제조방법, 이를 이용한 생체분자 분석방법 및 장치 |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP3062252A4 (ko) |
JP (1) | JP6518238B2 (ko) |
CN (1) | CN105960644B (ko) |
CA (1) | CA2935138C (ko) |
WO (1) | WO2015060511A1 (ko) |
Families Citing this family (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20180048420A (ko) * | 2016-11-02 | 2018-05-10 | 김성천 | 차세대서열결정법을 이용한 표적 단백질의 집단적 정량 방법과 그 용도 |
SG11201906442TA (en) * | 2017-02-01 | 2019-08-27 | Illumina Inc | System and method with fiducials responding to multiple excitation frequencies |
JP6463572B1 (ja) * | 2017-07-24 | 2019-02-06 | アクシオンリサーチ株式会社 | 対象システムの内部状態を推定する支援システム |
JP7115693B2 (ja) * | 2018-05-18 | 2022-08-09 | 株式会社島津製作所 | 診断支援システム、診断支援装置および診断支援方法 |
WO2021162028A1 (ja) * | 2020-02-14 | 2021-08-19 | 東レ株式会社 | バイオチップの製造方法 |
WO2023171740A1 (ja) * | 2022-03-10 | 2023-09-14 | コニカミノルタ株式会社 | 状態センシング用の複合発光シグナル発生材料、発光物質担持体、状態センシング用のインク、計測用チップ、および解析方法 |
WO2023171738A1 (ja) * | 2022-03-10 | 2023-09-14 | コニカミノルタ株式会社 | 解析システム、プレート、および解析方法 |
Citations (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
US5635400A (en) | 1994-10-13 | 1997-06-03 | Spectragen, Inc. | Minimally cross-hybridizing sets of oligonucleotide tags |
EP0799897A1 (en) | 1996-04-04 | 1997-10-08 | Affymetrix, Inc. (a California Corporation) | Methods and compositions for selecting tag nucleic acids and probe arrays |
US5981179A (en) | 1991-11-14 | 1999-11-09 | Digene Diagnostics, Inc. | Continuous amplification reaction |
US6369893B1 (en) | 1998-05-19 | 2002-04-09 | Cepheid | Multi-channel optical detection system |
US6391541B1 (en) | 1999-05-28 | 2002-05-21 | Kurt E. Petersen | Apparatus for analyzing a fluid sample |
KR100464225B1 (ko) | 2004-02-10 | 2005-01-03 | 제노프라 주식회사 | 단일가닥핵산 리간드를 이용한 특정물질 동정 및 분석방법 |
KR20060029771A (ko) * | 2004-10-04 | 2006-04-07 | 김성천 | 단일가닥핵산 프로브를 이용한 특정물질의 동정 및 분석방법 |
KR20060072480A (ko) | 2004-12-23 | 2006-06-28 | (주)디피아이 홀딩스 | 아크릴 에멀젼 수지 조성물의 제조방법, 이 방법에 의해제조된 아크릴 에멀젼 수지 및 이를 포함하는 수성 도료조성물 |
KR100670799B1 (ko) | 2004-05-06 | 2007-01-17 | 제노프라 주식회사 | 단일가닥핵산의 이중기능을 이용한 특정물질의 동정 및분석방법 |
KR20080108652A (ko) * | 2007-06-11 | 2008-12-16 | 김성천 | 미지의 생체분자와 단일가닥핵산의 결합 프로파일을생성하기 위한 핵산칩, 핵산칩의 제조방법, 및 핵산칩을이용한 미지의 생체분자 분석방법 |
JP2012125200A (ja) * | 2010-12-16 | 2012-07-05 | Olympus Corp | 標的核酸の解析方法 |
Family Cites Families (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003062444A2 (en) * | 2001-11-13 | 2003-07-31 | Emory University | Array systems and methods |
US20040197779A1 (en) * | 2003-04-03 | 2004-10-07 | Apffel James Alexander | Methods for analyzing mixtures of proteins |
WO2005090546A1 (en) * | 2004-03-19 | 2005-09-29 | Detroit R & D, Inc. | Chip production, hybridization and data interpretation for antibody and protein microarrays |
WO2005108609A1 (en) * | 2004-05-06 | 2005-11-17 | Genoprot Inc. | Method for identification and analysis of certain molecules using the dual function of single strand nucleic acid |
CN1296492C (zh) * | 2004-11-18 | 2007-01-24 | 博奥生物有限公司 | 一种基于生物芯片检测能结合特异序列的核酸结合蛋白的方法 |
JP2010524459A (ja) * | 2007-06-11 | 2010-07-22 | コリア テクノロジー インダストリー カンパニー リミテッド | 未知の生体分子と一本鎖核酸の結合プロファイルを生成するための核酸チップ、核酸チップの製造方法、及び核酸チップを利用した未知の生体分子分析方法 |
CN101236209B (zh) * | 2007-09-03 | 2013-03-20 | 博奥生物有限公司 | 基于生物芯片检测核酸结合蛋白-靶标蛋白之间是否存在相互作用的方法 |
US20090075828A1 (en) * | 2007-09-17 | 2009-03-19 | Gentel Biosurfaces, Inc. | Integrated protein chip assay |
JP2010057451A (ja) * | 2008-09-05 | 2010-03-18 | Nec Soft Ltd | マウス由来のIgG抗体に結合性を有する核酸分子、及び検出キット |
JP5419138B2 (ja) * | 2009-03-27 | 2014-02-19 | Necソフト株式会社 | 検出対象物の検出方法およびそれに用いる検出用キット |
US20120283109A1 (en) * | 2011-04-08 | 2012-11-08 | Timothy Z. Liu | Method of analyzing target nucleic acid of biological samples |
CN103074419A (zh) * | 2012-09-27 | 2013-05-01 | 中国科学院苏州纳米技术与纳米仿生研究所 | 基于生物芯片的检测核酸降解组mRNA的通用探针方法 |
-
2014
- 2014-05-08 CA CA2935138A patent/CA2935138C/en active Active
- 2014-05-08 EP EP14855454.6A patent/EP3062252A4/en not_active Ceased
- 2014-05-08 CN CN201480070233.7A patent/CN105960644B/zh active Active
- 2014-05-08 WO PCT/KR2014/004107 patent/WO2015060511A1/ko active Application Filing
- 2014-05-08 JP JP2016526217A patent/JP6518238B2/ja not_active Expired - Fee Related
Patent Citations (16)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
US4683202B1 (ko) | 1985-03-28 | 1990-11-27 | Cetus Corp | |
US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
US4683195B1 (ko) | 1986-01-30 | 1990-11-27 | Cetus Corp | |
US5981179A (en) | 1991-11-14 | 1999-11-09 | Digene Diagnostics, Inc. | Continuous amplification reaction |
US5635400A (en) | 1994-10-13 | 1997-06-03 | Spectragen, Inc. | Minimally cross-hybridizing sets of oligonucleotide tags |
EP0799897A1 (en) | 1996-04-04 | 1997-10-08 | Affymetrix, Inc. (a California Corporation) | Methods and compositions for selecting tag nucleic acids and probe arrays |
US6369893B1 (en) | 1998-05-19 | 2002-04-09 | Cepheid | Multi-channel optical detection system |
US6391541B1 (en) | 1999-05-28 | 2002-05-21 | Kurt E. Petersen | Apparatus for analyzing a fluid sample |
KR100464225B1 (ko) | 2004-02-10 | 2005-01-03 | 제노프라 주식회사 | 단일가닥핵산 리간드를 이용한 특정물질 동정 및 분석방법 |
KR100670799B1 (ko) | 2004-05-06 | 2007-01-17 | 제노프라 주식회사 | 단일가닥핵산의 이중기능을 이용한 특정물질의 동정 및분석방법 |
KR20060029771A (ko) * | 2004-10-04 | 2006-04-07 | 김성천 | 단일가닥핵산 프로브를 이용한 특정물질의 동정 및 분석방법 |
KR20060072480A (ko) | 2004-12-23 | 2006-06-28 | (주)디피아이 홀딩스 | 아크릴 에멀젼 수지 조성물의 제조방법, 이 방법에 의해제조된 아크릴 에멀젼 수지 및 이를 포함하는 수성 도료조성물 |
KR20080108652A (ko) * | 2007-06-11 | 2008-12-16 | 김성천 | 미지의 생체분자와 단일가닥핵산의 결합 프로파일을생성하기 위한 핵산칩, 핵산칩의 제조방법, 및 핵산칩을이용한 미지의 생체분자 분석방법 |
KR100923048B1 (ko) | 2007-06-11 | 2009-10-22 | 김성천 | 미지의 생체분자와 단일가닥핵산의 결합 프로파일을생성하기 위한 핵산칩, 핵산칩의 제조방법, 및 핵산칩을이용한 미지의 생체분자 분석방법 |
JP2012125200A (ja) * | 2010-12-16 | 2012-07-05 | Olympus Corp | 標的核酸の解析方法 |
Non-Patent Citations (19)
Title |
---|
"PCR Protocols: A Guide to Methods and Applications", 1990 |
ADAM ET AL., CANCER RESEARCH, vol. 62, 2002, pages 3609 - 3614 |
BRENNER ET AL., PNAS, vol. 97, 2000, pages 1665 - 1670 |
CLAIRE L. WILSON ET AL.: "SIMPLEAFFY: A BIOCONDUCTOR PACKAGE FOR AFFYMETRIX QUALITY", BIOINFORMATICS APPLICATIONS NOTE, vol. 21, no. 18, CO, 2005, pages 3683 - 3685, XP007912597, DOI: NTROL AND DATA ANALYSIS * |
ELLINGTON, A.D.; J.W. SZOSTAK.: "In vitro selection of RNA molecules that bind specific ligands", NATURE, vol. 346, 1990, pages 818 - 822, XP002547962, DOI: doi:10.1038/346818a0 |
ELLINGTON, A.D.; SZOSTAK, J.W.: "In vitro selection of RNA molecules that bind specific ligands", NATURE, vol. 346, no. 6287, 1990, pages 818 - 822, XP002547962, DOI: doi:10.1038/346818a0 |
FITZWATER, T.; POLISKY, B.: "A SELEX primer", METHODS ENZYMOL, vol. 267, 1996, pages 275 - 301, XP002112701, DOI: doi:10.1016/S0076-6879(96)67019-0 |
GOLD, L.; P.ALLEN; J. BINKLEY; D. BROWN; D. SCHNEIDER; S.R. EDDY; C. TUERK; L. GREEN; S. MACDOUGAL; D. TASSET.: "The RNA World", 1993, COLD SPRING HARBOR PRESS, article "RNA: the shape of things to come", pages: 497 - 510 |
HOMANN, M.; GORINGER, H.U., NUCLEIC ACIDS RES., vol. 27, no. 9, 1999, pages 2006 - 2014 |
LI ET AL., CLINICAL CHEMISTRY, vol. 48, 2002, pages 1296 - 1304 |
M. SCHENA, DNA MICROARRAY; A PRACTICAL APPROACH, 1999 |
MARSHALL, K.A.; ELLINGTON, A.D.: "In vitro selection of RNA aptamers", METHODS ENZYMOL, vol. 318, 2000, pages 193 - 214, XP001031309, DOI: doi:10.1016/S0076-6879(00)18053-X |
MCCAULEY ET AL., ANAL. BIOCHEM., vol. 319, no. 2, 2003, pages 244 - 250 |
PETRICOIN ET AL., THE LANCET, vol. 359, 2002, pages 572 - 577 |
See also references of EP3062252A4 |
SHOEMAKER E, NATURE GENETICS, vol. 14, 1996, pages 450 - 456 |
SMITH ET AL., MOL. CELL PROTOMICS, 2003, pages 11 - 18 |
TUERK C.; GOLD L., SCIENCE, vol. 249, 1990, pages 505 - 510 |
TUERK, C.; GOLD, L.: "Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase", SCIENCE, vol. 249, no. 4968, 1990, pages 505 - 510, XP002547963, DOI: doi:10.1126/science.2200121 |
Also Published As
Publication number | Publication date |
---|---|
EP3062252A4 (en) | 2017-06-07 |
JP2016534723A (ja) | 2016-11-10 |
EP3062252A1 (en) | 2016-08-31 |
JP6518238B2 (ja) | 2019-05-22 |
CN105960644B (zh) | 2018-07-10 |
CN105960644A (zh) | 2016-09-21 |
CA2935138A1 (en) | 2015-04-30 |
CA2935138C (en) | 2021-04-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2015060511A1 (ko) | 생체분자와 핵산의 결합정보를 생성하기 위한 마커, 이의 제조방법, 이를 이용한 생체분자 분석방법 및 장치 | |
EP1880025B1 (en) | Multiplex branched-chain dna assays | |
CN112852921B (zh) | 一种基于即时检测试纸条的核酸检测方法、检测探针及其试剂盒 | |
WO2016171474A1 (ko) | 표준물질로서 외부 생체분자를 이용한 생체분자의 분석 방법 및 그 키트 | |
US8680016B2 (en) | Testing method of nucleic acid binding protein based on biochip | |
WO2018084594A1 (ko) | 차세대서열결정법을 이용한 표적 단백질의 집단적 정량 방법과 그 용도 | |
WO2015060609A2 (ko) | 올리고뉴클레오타이드를 이용한 생체분자의 분석방법 및 장치 | |
US20100029492A1 (en) | Nucleic acid chip for obtaining binding profile of single strand nucleic acid and unknown biomolecule, manufacturing method thereof and analysis method of unknown biomolecule using nucleic acid chip | |
CN112601825A (zh) | 核酸测序方法 | |
US10072286B2 (en) | Marker for generating binding information on biomolecules and nucleic acids, preparation method therefor, and method and apparatus for analyzing biomolecule by using same | |
US11091803B2 (en) | Nucleic acid quantification method | |
KR100923048B1 (ko) | 미지의 생체분자와 단일가닥핵산의 결합 프로파일을생성하기 위한 핵산칩, 핵산칩의 제조방법, 및 핵산칩을이용한 미지의 생체분자 분석방법 | |
RU2007108303A (ru) | СПОСОБ ДЕТЕКТИРОВАНИЯ И КОЛИЧЕСТВЕННОЙ ОЦЕНКИ in vitro ДНК ВИЧ ПРИ ПОМОЩИ КОЛИЧЕСТВЕННОЙ ПЦР | |
CN112858693A (zh) | 一种生物分子检测方法 | |
JP2006524033A (ja) | 内部基準試料を用いる核酸のメチル化検出方法 | |
KR101783657B1 (ko) | 생체분자 분석 방법, 키트 및 장비 | |
KHELURKAR et al. | DNA Microarray: Basic Principle and It’s Applications | |
JP2004290123A (ja) | マイクロアレイを用いたアプタマーの取得方法 | |
Vitte et al. | Development of O. minuta specific clones using representational difference analysis (RDA) | |
JP2003009862A (ja) | cDNAの標識方法 | |
Screens et al. | 4 Gene Expression and |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14855454 Country of ref document: EP Kind code of ref document: A1 |
|
ENP | Entry into the national phase |
Ref document number: 2016526217 Country of ref document: JP Kind code of ref document: A |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
REEP | Request for entry into the european phase |
Ref document number: 2014855454 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2014855454 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2935138 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 15031009 Country of ref document: US |