WO2015038939A2 - Modulators of complement factor b - Google Patents

Modulators of complement factor b Download PDF

Info

Publication number
WO2015038939A2
WO2015038939A2 PCT/US2014/055458 US2014055458W WO2015038939A2 WO 2015038939 A2 WO2015038939 A2 WO 2015038939A2 US 2014055458 W US2014055458 W US 2014055458W WO 2015038939 A2 WO2015038939 A2 WO 2015038939A2
Authority
WO
WIPO (PCT)
Prior art keywords
compound
certain embodiments
seq
modified oligonucleotide
modified
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/055458
Other languages
English (en)
French (fr)
Other versions
WO2015038939A3 (en
Inventor
Tamar R. GROSSMAN
Michael L. Mccaleb
Andrew T. Watt
Susan M. Freier
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Isis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to ES14844168T priority Critical patent/ES2745758T3/es
Priority to PL14844168T priority patent/PL3043827T3/pl
Priority to BR112016004671-4A priority patent/BR112016004671B1/pt
Priority to KR1020167009610A priority patent/KR102381790B1/ko
Priority to EP14844168.6A priority patent/EP3043827B1/en
Priority to CN201480056788.6A priority patent/CN105744959B/zh
Priority to HRP20191600 priority patent/HRP20191600T1/hr
Priority to RSP20191160 priority patent/RS59252B1/sr
Priority to US15/021,651 priority patent/US20160222389A1/en
Priority to CA2921842A priority patent/CA2921842A1/en
Priority to MA38959A priority patent/MA38959A1/fr
Priority to JP2016542824A priority patent/JP6666250B2/ja
Priority to RU2016113763A priority patent/RU2662967C2/ru
Priority to LTEP14844168.6T priority patent/LT3043827T/lt
Priority to AU2014318580A priority patent/AU2014318580B2/en
Priority to SG11201601445XA priority patent/SG11201601445XA/en
Priority to MX2016003263A priority patent/MX371518B/es
Priority to DK14844168.6T priority patent/DK3043827T3/da
Priority to EP19182415.0A priority patent/EP3603677A1/en
Application filed by Isis Pharmaceuticals Inc filed Critical Isis Pharmaceuticals Inc
Priority to CR20190329A priority patent/CR20190329A/es
Priority to EA201690582A priority patent/EA035433B1/ru
Priority to SI201431272T priority patent/SI3043827T1/sl
Priority to UAA201603969A priority patent/UA119046C2/uk
Publication of WO2015038939A2 publication Critical patent/WO2015038939A2/en
Publication of WO2015038939A3 publication Critical patent/WO2015038939A3/en
Priority to IL244095A priority patent/IL244095A0/en
Priority to ZA2016/01236A priority patent/ZA201601236B/en
Priority to PH12016500443A priority patent/PH12016500443A1/en
Priority to DO2016000063A priority patent/DOP2016000063A/es
Anticipated expiration legal-status Critical
Priority to CR20160170A priority patent/CR20160170A/es
Priority to US15/912,386 priority patent/US20190048351A1/en
Priority to US16/439,317 priority patent/US20200149047A1/en
Priority to AU2020201763A priority patent/AU2020201763A1/en
Priority to US17/465,035 priority patent/US11926830B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)
    • C12Y304/21047Alternative-complement-pathway C3/C5 convertase (3.4.21.47), i.e. properdin factor B
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine

Definitions

  • the present embodiments provide methods, compounds, and compositions for treating, preventing, or ameliorating a disease associated with dysregulation of the complement alternative pathway by administering a Complement Factor B (CFB) specific inhibitor to a subject.
  • CFB Complement Factor B
  • the complement system is part of the host innate immune system involved in lysing foreign cells, enhancing phagocytosis of antigens, clumping antigen-bearing agents, and attracting macrophages and neutrophils.
  • the complement system is divided into three initiation pathways— the classical, lectin, and alternative pathways— that converge at component C3 to generate an enzyme complex known as C3 convertase, which cleaves C3 into C3a and C3b.
  • C3b associates with C3 convertase mediated by CFB and results in generation of C5 convertase, which cleaves C5 into C5a and C5b, which initiates the membrane attack pathway resulting in the formation of the membrane attack complex (MAC) comprising components C5b, C6, C7, C8, and C9.
  • the membrane-attack complex (MAC) forms transmembrane channels and disrupts the phospholipid bilayer of target cells, leading to cell lysis.
  • the alternative pathway is continuously activated at a low "tickover" level as a result of activation of the alternative pathway by spontaneous hydrolysis of C3 and the production of C3b, which generates C5 convertase.
  • CFB Complement Factor B
  • a method of reducing or inhibiting accumulation of C3 deposits in the eye of a subject having, or at risk of having, a disease associated with dysregulation of the complement alternative pathway comprises administering a CFB specific inhibitor to the subject.
  • a method of reducing or inhibiting accumulation of C3 deposits in the kidney of a subject having, or at risk of having, a disease associated with dysregulation of the complement alternative pathway comprises administering a CFB specific inhibitor to the subject.
  • 2'-0-methoxyethyl refers to an O-methoxy-ethyl modification at the 2' position of a furanose ring.
  • a 2'-0-methoxyethyl modified sugar is a modified sugar.
  • 2'-MOE nucleoside (also 2'-0-methoxyethyl nucleoside) means a nucleoside comprising a 2'- MOE modified sugar moiety.
  • 2 '-substituted nucleoside means a nucleoside comprising a substituent at the 2 '-position of the furanosyl ring other than H or OH.
  • 2' substituted nucleosides include nucleosides with bicyclic sugar modifications.
  • 3' target site refers to the nucleotide of a target nucleic acid which is complementary to the 3 '-most nucleotide of a particular antisense compound.
  • 5' target site refers to the nucleotide of a target nucleic acid which is complementary to the 5 '-most nucleotide of a particular antisense compound.
  • 5-methylcytosine means a cytosine modified with a methyl group attached to the 5 position.
  • a 5- methylcytosine is a modified nucleobase.
  • “About” means within ⁇ 10% of a value. For example, if it is stated, “the compounds affected at least about 70% inhibition of CFB", it is implied that CFB levels are inhibited within a range of 60%> and 80%.
  • administering refers to routes of introducing an antisense compound provided herein to a subject to perform its intended function.
  • routes of administration includes, but is not limited to parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.
  • “Amelioration” refers to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition.
  • amelioration includes a delay or slowing in the progression of one or more indicators of a condition or disease.
  • the severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
  • Animal refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
  • Antisense activity means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.
  • Antisense compound means an oligomeric compound that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.
  • Antisense inhibition means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.
  • Antisense mechanisms are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
  • Antisense oligonucleotide means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.
  • Base complementarity refers to the capacity for the precise base pairing of nucleobases of an antisense oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization), and is mediated by Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen binding between corresponding nucleobases.
  • Bocyclic sugar moiety means a modified sugar moiety comprising a 4 to 7 membered ring
  • the 4 to 7 membered ring is a sugar ring.
  • the 4 to 7 membered ring is a furanosyl.
  • the bridge connects the 2 '-carbon and the 4 '-carbon of the furanosyl.
  • BNA nucleosides means nucleic acid monomers having a bridge connecting two carbon atoms between the 4' and 2'position of the nucleoside sugar unit, thereby forming a bicyclic sugar.
  • bicyclic sugar examples include, but are not limited to A) a-L- Methyleneoxy (4'-CH 2 -0-2') LNA , (B) ⁇ -D-Methyleneoxy (4'-CH 2 -0-2') LNA , (C) Ethyleneoxy (4'- (CH 2 ) 2 -0-2') LNA , (D) Aminooxy (4'-CH 2 -0-N(R)-2') LNA and (E) Oxyamino (4'-CH 2 -N(R)-0-2') LNA, as depicted below.
  • Examples of 4'- 2' bridging groups encompassed within the definition of LNA include, but are not limited to one of formulae: -[C(R (R 2 )] n -, -[C(R (R 2 )] n -O-, -C(R 1 R 2 )-N(R 1 )-0- or -C(R 1 R 2 )-0-N(R 1 )-.
  • bridging groups encompassed with the definition of LNA are 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'- (CH 2 ) 3 -2', 4'-CH 2 -0-2', 4'-(CH 2 ) 2 -0-2', 4'-CH 2 -0-N(R 1 )-2' and 4'-CH 2 -N(R -O-2'- bridges, wherein each Ri and R 2 is, independently, H, a protecting group or C r Ci 2 alkyl.
  • LNAs in which the 2'- hydroxyl group of the ribosyl sugar ring is connected to the 4' carbon atom of the sugar ring, thereby forming a methyleneoxy (4'-CH 2 -0-2') bridge to form the bicyclic sugar moiety.
  • the bridge can also be a methylene (-CH 2 -) group connecting the 2' oxygen atom and the 4' carbon atom, for which the term methyleneoxy (4'- CH 2 -0-2') LNA is used.
  • ethyleneoxy (4'-CH 2 CH 2 -0-2') LNA is used, a -L- methyleneoxy (4'-CH 2 - 0-2'), an isomer of methyleneoxy (4'-CH 2 -0-2') LNA is also encompassed within the definition of LNA, as used herein.
  • Cap structure or "terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.
  • cEt or “constrained ethyl” means a bicyclic sugar moiety comprising a bridge connecting the 4'- carbon and the 2'-carbon, wherein the bridge has the formula: 4'-CH(CH 3 )-0-2'.
  • Consstrained ethyl nucleoside (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH 3 )-0-2' bridge.
  • Complement Factor B means any nucleic acid or protein of CFB.
  • CFB nucleic acid means any nucleic acid encoding CFB.
  • a CFB nucleic acid includes a DNA sequence encoding CFB, an RNA sequence transcribed from DNA encoding CFB (including genomic DNA comprising introns and exons), including a non-protein encoding (i.e. non-coding) RNA sequence, and an mRNA sequence encoding CFB.
  • CFB mRNA means an mRNA encoding a CFB protein.
  • CFB specific inhibitor refers to any agent capable of specifically inhibiting CFB RNA and/or CFB protein expression or activity at the molecular level.
  • CFB specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of CFB RNA and/or CFB protein.
  • “Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'- O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2'-0- methoxyethyl modifications.
  • “Chimeric antisense compounds” means antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits.
  • “Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
  • Contiguous nucleobases means nucleobases immediately adjacent to each other.
  • Deoxyribonucleotide means a nucleotide having a hydrogen at the 2' position of the sugar portion of the nucleotide. Deoxyribonucleotides may be modified with any of a variety of substituents.
  • Designing or “Designed to” refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.
  • Effective amount means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent.
  • the effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
  • “Expression” includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and translation.
  • “Fully complementary” or “100% complementary” means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid.
  • a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.
  • Gapmer means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as the "gap” and the external regions may be referred to as the "wings.”
  • Hybridization means the annealing of complementary nucleic acid molecules.
  • complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target.
  • complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.
  • Identifying an animal having, or at risk for having, a disease, disorder and/or condition means identifying an animal having been diagnosed with the disease, disorder and/or condition or identifying an animal predisposed to develop the disease, disorder and/or condition. Such identification may be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments.
  • “Individual” means a human or non-human animal selected for treatment or therapy.
  • “Inhibiting the expression or activity” refers to a reduction, blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity.
  • Internucleoside linkage refers to the chemical bond between nucleosides.
  • Lengthened antisense oligonucleotides are those that have one or more additional nucleosides relative to an antisense oligonucleotide disclosed herein.
  • Linked deoxynucleoside means a nucleic acid base (A, G, C, T, U) substituted by deoxyribose linked by a phosphate ester to form a nucleotide.
  • Linked nucleosides means adjacent nucleosides linked together by an internucleoside linkage.
  • mismatch or “non-complementary nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
  • Modified internucleoside linkage refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).
  • Modified nucleobase means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil.
  • An "unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified nucleoside means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.
  • Modified nucleotide means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase.
  • Modified oligonucleotide means an oligonucleotide comprising at least one modified internucleoside linkage, a modified sugar, and/or a modified nucleobase.
  • Modified sugar means substitution and/or any change from a natural sugar moiety.
  • Modulating refers to changing or adjusting a feature in a cell, tissue, organ or organism.
  • modulating CFB mRNA can mean to increase or decrease the level of CFB mRNA and/or CFB protein in a cell, tissue, organ or organism.
  • a “modulator” effects the change in the cell, tissue, organ or organism.
  • a CFB antisense compound can be a modulator that decreases the amount of CFB mRNA and/or CFB protein in a cell, tissue, organ or organism.
  • “Monomer” refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occuring or modified.
  • Microtif means the pattern of unmodified and modified nucleosides in an antisense compound.
  • Natural sugar moiety means a sugar moiety found in DNA (2'-H) or RNA (2'-OH).
  • Naturally occurring internucleoside linkage means a 3' to 5' phosphodiester linkage.
  • Non-complementary nucleobase refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.
  • Nucleic acid refers to molecules composed of monomeric nucleotides.
  • a nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.
  • Nucleobase means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
  • nucleobase complementarity refers to a nucleobase that is capable of base pairing with another nucleobase.
  • adenine (A) is complementary to thymine (T).
  • adenine (A) is complementary to uracil (U).
  • complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid.
  • nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid
  • the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.
  • Nucleobase sequence means the order of contiguous nucleobases independent of any sugar, linkage, and/or nucleobase modification.
  • Nucleoside means a nucleobase linked to a sugar.
  • Nucleoside mimetic includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics, e.g., non furanose sugar units.
  • Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only.
  • the tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system.
  • Mimetic refers to groups that are substituted for a sugar, a nucleobase, and/ or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.
  • Nucleotide means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
  • Olemeric compound means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
  • Oligonucleoside means an oligonucleotide in which the internucleoside linkages do not contain a phosphorus atom.
  • Oligonucleotide means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
  • Parenteral administration means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular
  • intraarterial administration intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.
  • “Pharmaceutical composition” means a mixture of substances suitable for administering to an individual.
  • a pharmaceutical composition may comprise one or more active pharmaceutical agents and a sterile aqueous solution.
  • “Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
  • Phosphorothioate linkage means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom.
  • a phosphorothioate linkage is a modified internucleoside linkage.
  • a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound "Prevent” refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing the risk of developing a disease, disorder, or condition.
  • “Prophylactically effective amount” refers to an amount of a pharmaceutical agent that provides a prophylactic or preventative benefit to an animal.
  • Regular is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
  • “Ribonucleotide” means a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.
  • “Segments” are defined as smaller or sub-portions of regions within a target nucleic acid.
  • Side effects means physiological disease and/or conditions attributable to a treatment other than the desired effects.
  • side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system
  • abnormalities myopathies, and malaise.
  • increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality.
  • increased bilirubin may indicate liver toxicity or liver function abnormality.
  • Sites are defined as unique nucleobase positions within a target nucleic acid. “Slows progression” means decrease in the development of the said disease.
  • Specifically hybridizable refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments.
  • Stringent hybridization conditions or “stringent conditions” refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences.
  • Subject means a human or non-human animal selected for treatment or therapy.
  • Target refers to a protein, the modulation of which is desired.
  • Target gene refers to a gene encoding a target.
  • Targeting means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
  • Target nucleic acid means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
  • target nucleic acid means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
  • target nucleic acid means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
  • target nucleic acid target all mean a nucleic acid capable of being targeted by antisense compounds.
  • Target region means a portion of a target nucleic acid to which one or more antisense compounds is targeted.
  • Target segment means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted.
  • 5' target site refers to the 5 '-most nucleotide of a target segment.
  • 3' target site refers to the 3 '-most nucleotide of a target segment.
  • “Therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual. “Treat” refers to administering a pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal. In certain embodiments, one or more pharmaceutical compositions can be administered to the animal.
  • Unmodified nucleobases mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Unmodified nucleotide means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages.
  • an unmodified nucleotide is an RNA nucleotide (i.e. ⁇ -D-ribonucleosides) or a DNA nucleotide (i.e. ⁇ -D-deoxyribonucleoside).
  • Certain embodiments provide methods, compounds and compositions for inhibiting Complement
  • CFB Factor B
  • the CFB nucleic acid has the sequence set forth in GENBANK Accession No. NM 001710.5 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NT 007592.15 truncated from nucleotides 31852000 to 31861000 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No NW 001116486.1 truncated from nucleotides 536000 to 545000 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. XM 001113553.2 (incorporated herein as SEQ ID NO: 4), or GENBANK Accession No. NM 008198.2 (incorporated herein as SEQ ID NO: 5).
  • Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808. Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808.
  • Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808.
  • Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808.
  • Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to
  • nucleosides having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808.
  • Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 6-808.
  • Certain embodiments provide a compound comprising a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 6-808.
  • Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within nucleobases 30-49, 48-63, 150-169, 151-170, 152-171, 154-169, 154-173, 156-171, 156-175, 157-176, 158-173, 158-177, 480-499, 600-619, 638-657, 644-663, 738-757, 1089-1108, 1135-1154, 1141-1160, 1147-1166, 1150-1169, 1153-1172, 1159-1 178, 1162-1181, 1165-1184, 1171-1186, 1171-1190, 1173-1188, 1173-1192, 1175-1190, 1175-1194, 1177-1 196, 1183-1202, 1208-1227, 1235-1254, 1298-1317, 1304-1323, 1310-1329, 1316-1335, 1319-1338, 1322-1341, 1328-1347, 1349-1368, 1355-1374
  • Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of nucleobases 30-49, 48-63, 150-169, 151-170, 152- 171, 154-169, 154-173, 156-171, 156-175, 157-176, 158-173, 158-177, 480-499, 600-619, 638-657, 644-663, 738-757, 1089-1108, 1135-1154, 1141-1160, 1147-1166, 1150-1169, 1153-1172, 1159-1178, 1162-1181, 1165-1184, 1171-1186, 1171-1190, 1173-1188, 1173-1192, 1175-1190, 1175-1 194, 1177-1196, 1183-1202, 1208-1227, 1235-1254, 1298-1317, 1304-1323, 1310-1329,
  • nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 1.
  • Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within nucleobases 1608-1627, 1685-1704, 1686-1705, 1751-1770, 1769-1784, 1871-1890, 1872-1891, 1873-1892, 1875-1890, 1875-1894, 1877-1892, 1877-1896, 1878-1897, 1879-1894, 1879-1898, 2288-2307, 2808-2827, 2846-2865, 2852-2871, 2946-2965, 3773-3792, 3819-3838, 3825-3844, 3831-3850, 3834-3853, 3837-3856, 3843-3862, 4151 -4166, 4151-4170, 4153-4172, 4159-4178, 4184-4203, 4211-4230, 4609-4628, 4612-4631, 4615-4634, 4621 -4640, 4642-4661, 4648-4667, 46
  • Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of nucleobases 1608-1627, 1685-1704, 1686-1705, 1751-1770, 1769-1784, 1871-1890, 1872-1891, 1873-1892, 1875-1890, 1875-1894, 1877-1892, 1877-1896, 1878-1897, 1879-1894, 1879-1898, 2288-2307, 2808-2827, 2846-2865, 2852-2871, 2946-2965, 3773-3792, 3819-3838, 3825-3844, 3831-3850, 3834-3853, 3837-3856, 3843-3862, 4151-4166, 4151-4170, 4153-4172, 4159-4178, 4184-4203, 4211-4230, 4609-4628, 4612
  • antisense compounds or oligonucleotides target a region of a CFB nucleic acid.
  • such compounds or oligonucleotides targeted to a region of a CFB nucleic acid have a contiguous nucleobase portion that is complementary to an equal length nucleobase portion of the region.
  • the portion can be at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion of a region recited herein.
  • such compounds or oligonucleotide target the following nucleotide regions of SEQ ID NO: 1 : 30-49, 48-63, 150- 169, 151-170, 152-171, 154-169, 154-173, 156-171, 156-175, 157-176, 158-173, 158-177, 480-499, 600-619, 638-657, 644-663, 738-757, 1089-1108, 1135-1154, 1141-1160, 1147-1166, 1150-1169, 1153-1172, 1159- 1178, 1162-1181, 1165-1184, 1171-1186, 1171-1190, 1173-1188, 1173-1192, 1175-1190, 1175-1194, 1177- 1196, 1183-1202, 1208-1227, 1235-1254, 1298-1317, 1304-1323, 1310-1329, 1316-1335, 1319-1338, 1322- 1341, 1328-1347, 1349-1368, 1355-1374, 1393-14
  • 2630 2612-2631, 2613-2628, 2613-2629, 2613-2630, 2613-2631, 2614-2629, 2614-2630, 2614-2631, 2615- 2630, 2615-2631 , and 2616-2631.
  • antisense compounds or oligonucleotides target a region of a CFB nucleic acid.
  • such compounds or oligonucleotides targeted to a region of a CFB nucleic acid have a contiguous nucleobase portion that is complementary to an equal length nucleobase portion of the region.
  • the portion can be at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion of a region recited herein.
  • such compounds or oligonucleotide target the following nucleotide regions of SEQ ID NO: 2: 1608-1627, 1685- 1704, 1686-1705, 1751-1770, 1769-1784, 1871-1890, 1872-1891, 1873-1892, 1875-1890, 1875-1894, 1877- 1892, 1877-1896, 1878-1897, 1879-1894, 1879-1898, 2288-2307, 2808-2827, 2846-2865, 2852-2871, 2946- 2965, 3773-3792, 3819-3838, 3825-3844, 3831-3850, 3834-3853, 3837-3856, 3843-3862, 4151-4166, 4151- 4170, 4153-4172, 4159-4178, 4184-4203, 4211-4230, 4609-4628, 4612-4631, 4615-4634, 4621-4640, 4642- 4661, 4648-4667, 4686-4705, 4689-
  • antisense compounds or oligonucleotides target the 3 'UTR of a CFB nucleic acid. In certain embodiments, antisense compounds or oligonucleotides target within nucleotides 2574-2626 of a CFB nucleic acid having the nucleobase sequence of SEQ ID NO: 1. In certain embodiments, antisense compounds or oligonucleotides have at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 2574-2626 of a CFB nucleic acid having the nucleobase sequence of SEQ ID NO: 1.
  • antisense compounds or oligonucleotides target a region of a CFB nucleic acid having the nucleobase sequence of SEQ ID NO: 1 within nucleobases 2457-2631, 2457-2472, 2457- 2474, 2457-2476, 2457-2566, 2457-2570, 2457-2571, 2457-2572, 2457-2573, 2457-2574, 2457-2575, 2457- 2576, 2457-2577, 2457-2578, 2457-2579, 2457-2580, 2457-2581, 2457-2582, 2457-2583, 2457-2584, 2457- 2585, 2457-2586, 2457-2587, 2457-2588, 2457-2589, 2457-2590, 2457-2591, 2457-2592, 2457-2593, 2457- 2594, 2457-2595, 2457-2596, 2457-2597, 2457-2598, 2457-2599, 2457-2600, 2457-2601, 2457-2602, 2457- 2603, 2457-
  • 2629 2560- -2630, 2560- -2631, 2561 -2578, 2561 -2579, 2561 -2580, 2561- -2581, 2561- -2582, 2561- -2583, 2561-
  • 2565- -2604 2565- -2605, 2565- -2606, 2565- -2607, 2565- -2608, 2565- -2609, 2565- -2610, 2565- -2611, 2565-
  • 2603 2568-2604, 2568-2605, 2568-2606, 2568-2607, 2568-2608, 2568-2609, 2568-2610, 2568-2611, 2568- 2612, 2568-2613, 2568-2614, 2568-2615, 2568-2616, 2568-2617, 2568-2618, 2568-2619, 2568-2620, 2568-
  • 2630 2568-2631, 2569-2586, 2569-2587, 2569-2588, 2569-2589, 2569-2590, 2569-2591, 2569-2592, 2569- 2593, 2569-2594, 2569-2595, 2569-2596, 2569-2597, 2569-2598, 2569-2599, 2569-2600, 2569-2601, 2569- 2602, 2569-2603, 2569-2604, 2569-2605, 2569-2606, 2569-2607, 2569-2608, 2569-2609, 2569-2610, 2569- 2611, 2569-2612, 2569-2613, 2569-2614, 2569-2615, 2569-2616, 2569-2617, 2569-2618, 2569-2619, 2569- 2620, 2569-2621, 2569-2622, 2569-2623, 2569-2624, 2569-2625, 2569-2626, 2569-2627, 2569-2628, 2569- 2629, 2569-2
  • 2602 2571-2603, 2571-2604, 2571-2605, 2571-2606, 2571-2607, 2571-2608, 2571-2609, 2571-2610, 2571- 2611, 2571-2612, 2571-2613, 2571-2614, 2571-2615, 2571-2616, 2571-2617, 2571-2618, 2571-2619, 2571-
  • 2604 2572-2605, 2572-2606, 2572-2607, 2572-2608, 2572-2609, 2572-2610, 2572-2611, 2572-2612, 2572- 2613, 2572-2614, 2572-2615, 2572-2616, 2572-2617, 2572-2618, 2572-2619, 2572-2620, 2572-2621, 2572-
  • 2604 2576-2605, 2576-2606, 2576-2607, 2576-2608, 2576-2609, 2576-2610, 2576-2611, 2576-2612, 2576- 2613, 2576-2614, 2576-2615, 2576-2616, 2576-2617, 2576-2618, 2576-2619, 2576-2620, 2576-2621, 2576-
  • 2622 2576-2623, 2576-2624, 2576-2625, 2576-2626, 2576-2627, 2576-2628, 2576-2629, 2576-2630, 2576- 2631, 2577-2594, 2577-2595, 2577-2596, 2577-2597, 2577-2598, 2577-2599, 2577-2600, 2577-2601, 2577-
  • 2626 2581-2627, 2581-2628, 2581-2629, 2581-2630, 2581-2631, 2582-2600, 2582-2601, 2582-2602, 2582- 2603, 2582-2604, 2582-2605, 2582-2606, 2582-2607, 2582-2608, 2582-2609, 2582-2610, 2582-2611, 2582- 2612, 2582- -2613, 2582- -2614, 2582- -2615, 2582- -2616, 2582- -2617, 2582- -2618, 2582- -2619, 2582- -2620, 2582-
  • 2630 2601-2631, 2602-2618, 2602-2619, 2602-2620, 2602-2621, 2602-2622, 2602-2623, 2602-2624, 2602- 2625, 2602-2626, 2602-2627, 2602-2628, 2602-2629, 2602-2630, 2602-2631, 2603-2620, 2603-2621, 2603- 2622, 2603-2623, 2603-2624, 2603-2625, 2603-2626, 2603-2627, 2603-2628, 2603-2629, 2603-2630, 2603-
  • antisense compounds or oligonucleotides target at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobases within the aforementioned nucleobase regions.
  • nucleotide regions of SEQ ID NO: 1 when targeted by antisense compounds or oligonucleotides, display at least 50% inhibition: 30-49, 48-63, 150-169, 151-170, 152-171, 154-169, 154-173, 156-171, 156-175, 157-176, 158-173, 158-177, 480-499, 600-619, 638-657, 644- 663, 738-757, 1089-1108, 1135-1154, 1141-1160, 1147-1166, 1150-1169, 1153-1172, 1159-1178, 1162- 1181, 1165-1184, 1171-1186, 1171-1190, 1173-1188, 1173-1192, 1175-1190, 1175-1194, 1177-1196, 1183- 1202, 1208-1227, 1235-1254, 1298-1317, 1304-1323, 1310-1329, 1316-1335, 1319-1338, 1322-1341, 1328- 1347, 1349-1368
  • nucleotide regions of SEQ ID NO: 2 when targeted by antisense compounds or oligonucleotides, display at least 50% inhibition: 1608-1627, 1685-1704, 1686-1705, 1751-1770, 1769-1784, 1871-1890, 1872-1891, 1873-1892, 1875-1890, 1875-1894, 1877-1892, 1877-1896, 1878-1897, 1879-1894, 1879-1898, 2288-2307, 2808-2827, 2846-2865, 2852-2871, 2946-2965, 3773-3792, 3819-3838, 3825-3844, 3831-3850, 3834-3853, 3837-3856, 3843-3862, 4151-4166, 4151-4170, 4153-4172, 4159-4178, 4184-4203, 4211-4230, 4609-4628, 4612-4631, 4615-4634, 4621-4640, 4642-4661, 4648-4667,
  • nucleotide regions of SEQ ID NO: 1 when targeted by antisense compounds or oligonucleotides, display at least 60% inhibition: 48-63, 150-169, 152-171, 154-169, 154-173, 156-171, 156-175, 158-173, 158-177, 600-619, 1135-1154, 1141-1160, 1147-1166, 1153-1172, 1171-1186, 1173-1188, 1175-1190, 1749-1768, 1763-1782, 1763-1782, 1912-1931, 2189-2208, 2191-2210, 2193-2212, 2195-2210, 2195-2214, 2197-2212, 2197-2216, 2223-2238, 2225-2240, 2227-2242, 2238-2257, 2448-2467, 2453-2472, 2455-2474, 2457-2472, 2457-2476, 2459-2474, 2459-2478, 2461-2476, 2461-2480, 2550-2569, 2551-2566, 2552-2571,
  • nucleotide regions of SEQ ID NO: 2 when targeted by antisense compounds or oligonucleotides, display at least 60% inhibition: 1685-1704, 1686-1705, 1769-1784, 1871-1890, 1873-1892, 1875-1890, 1875-1894, 1877-1892, 1877-1896, 1879-1894, 1879-1898, 2808-2827, 3819-3838, 3825-3844, 3831-3850, 3837-3856, 4151-4166, 5890-5909, 5904-5923, 5904-5923, 6406-6425, 6977-6996, 6979-6998, 6981-7000, 6983-6998, 6983-7002, 6985-7000, 6985-7004, 7122-7141, 7683-7702, 7688- -7707, 7690- -7709, 7692- -7707, 7692- -7711, 7694- -7709
  • nucleotide regions of SEQ ID NO: 1 when targeted by antisense compounds or oligonucleotides, display at least 70% inhibition: 48-63, 150-169, 152-171, 154-169, 154-173, 156-171, 156-175, 158-173, 158-177, 1135-1154, 1141-1160, 1147-1 166, 1171-1186, 1173-1188, 1175-1190, 1749-1768, 1763-1782, 1912-1931, 2193-2212, 2195-2210, 2195-2214, 2197-2212, 2197-2216, 2223-2238, 2225-2240, 2227-2242, 2453-2472, 2455-2474, 2457-2472, 2457-2476, 2459-2474, 2461-2476, 2461-2480, 2550-2569, 2551-2566, 2552-2571, 2553-2570, 2553-2571, 2553-2572, 2554-2571, 2554-2572, 2554-2573, 2554-2573, 2555-25
  • nucleotide regions of SEQ ID NO: 2 when targeted by antisense compounds or oligonucleotides, display at least 70% inhibition: 1685-1704, 1686-1705, 1769-1784, 1871-1890, 1873-1892, 1875-1890, 1875-1894, 1877-1892, 1877-1896, 1879-1894, 1879-1898, 3819-3838, 3825-3844, 3831-3850, 4151-4166, 5890-5909, 5904-5923, 5904-5923, 6406-6425, 6983-6998, 6983-7002, 6985-7000, 6985-7004, 7688-7707, 7690-7709, 7692-7707, 7692-7711, 7694-7709, 7696-7711, 7696-7715, 7786-7801, 7787-7806, 7788-7805, 7788-7806, 7788-7807, 7789-78
  • nucleotide regions of SEQ ID NO: 1 when targeted by antisense compounds or oligonucleotides, display at least 80% inhibition: 152-171, 154-169, 156-171, 158- 173, 1135-1154, 1171-1186, 1173-1188, 1175-1190, 1763-1782, 1912-1931, 2197-2212, 2223-2238, 2225- 2240, 2227-2242, 2457-2472, 2459-2474, 2461-2476, 2551-2566, 2553-2570, 2553-2571, 2553-2572, 2554- 2573, 2555-2572, 2555-2574, 2556-2573, 2556-2574, 2556-2575, 2557-2574, 2557-2576, 2558-2575, 2558-
  • nucleotide regions of SEQ ID NO: 2 when targeted by antisense compounds or oligonucleotides, display at least 80% inhibition: 1685-1704, 1686-1705, 1873-1892, 1875-1890, 1877-1892, 1879-1894, 3819-3838, 4151-4166, 5904-5923, 6406-6425, 6985-7000, 7692-7707, 7694-7709, 7696-7711, 7786-7801, 7788-7805, 7788-7806, 7788-7807, 7789-7808, 7790-7807, 7790-7809, 7791-7808, 7791-7809, 7791-7810, 7792-7809, 7792-7811, 7793-7810, 7793-7811, 7794-7812, 7794-7813, 7795-7812, 7795-7813, 7795-7814,
  • nucleotide regions of SEQ ID NO: 1 when targeted by antisense compounds or oligonucleotides, display at least 90% inhibition: 154-169, 156-171, 158-173, 1135- 1154, 1171-1186, 1173-1188, 1763-1782, 1912-1931, 2223-2238, 2227-2242, 2459-2474, 2461-2476, 2554- 2573, 2555-2574, 2560-2577, 2561-2578, 2561-2579, 2562-2581, 2563-2580, 2563-2582, 2564-2581, 2566- 2583, 2567-2584, 2568-2585, 2568-2587, 2569-2586, 2570-2587, 2576-2593, 2577-2594, 2577-2596, 2578- 2597, 2580-2599, 2581-2600, 2582-2601, 2583-2602, 2584-2603, 2586-2605, 2587-2605, 2587-2606, 2588- 2607, 2589-2608, 2590-26
  • nucleotide regions of SEQ ID NO: 2 when targeted by antisense compounds or oligonucleotides, display at least 90%> inhibition: 1685-1704, 1686-1705, 1875-1890, 1877-1892, 1879-1894, 3819-3838, 5904-5923, 6406-6425, 7694-7709, 7696-7711, 7789-7808, 7790-7809, 7795-7812, 7795-7813, 7796-7813, 7796-7814, 7797-7814, 7797-7816, 7798-7815, 7798-7817, 7799-7816, 7801-7818, 7802-7819, 7803-7820, 7803-7822, 7804-7821, 7805-7822, 7811-7828, 7812-7829, 7812-7831, 7813-7832, 7815-7834,
  • the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 50% inhibition of a CFB mRNA, ISIS NOs: 516350, 532614, 532632, 532635, 532638, 532639, 532686, 532687, 532688, 532689, 532690, 532691, 532692, 532692, 532693, 532694, 532695, 532696, 532697, 532698, 532699, 532700, 532701, 532702, 532703, 532704, 532705, 532706, 532707, 532770, 532775, 532778, 532780, 532791, 532800, 532809, 532810, 532811, 532917,
  • the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 50% inhibition of a CFB m NA, SEQ ID NOs: 12, 30, 33, 36, 37, 84, 85, 86, 87, 88, 89, 90, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 198, 203, 206, 208, 219, 228, 237, 238, 239, 317, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 43
  • the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 60% inhibition of a CFB mRNA, ISIS NOs: 516350, 532614, 532635, 532686, 532687, 532688, 532689, 532770, 532800, 532809, 532810, 532811, 532917, 532952, 588512,
  • the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 60% inhibition of a CFB m NA, SEQ ID NOs: 12, 33, 84, 85, 86, 87, 198, 228, 237, 238, 239, 317, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458,
  • the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 70% inhibition of a CFB mRNA, ISIS NOs: 516350, 532614, 532686, 532687, 532688, 532770, 532800, 532809, 532810, 532811, 532917, 532952, 588512, 588513, 588514, 588515, 588516, 588517, 588518, 588524, 588529, 588530, 588531, 588532, 588533, 588534, 588535, 588536, 588537, 588538, 588539, 588540, 588541, 588542, 588543, 588544, 588545, 588546, 588547, 588548, 588549, 588550, 588551,
  • the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 70% inhibition of a CFB mRNA, SEQ ID NOs: 12, 84, 85, 86, 198, 228, 237, 238, 239, 317, 395, 396, 397, 398, 399, 402, 403, 404, 405, 407, 408, 410, 411, 412, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 46
  • the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least an 80% inhibition of a CFB mRNA, ISIS NOs: 532686, 532809, 532810, 532811, 532917, 532952, 588512, 588517, 588518, 588533, 588534, 588535, 588536, 588537, 588538, 588539, 588540, 588542, 588543, 588544, 588545, 588546, 588547, 588548, 588549, 588550, 588551, 588552, 588553, 588554, 588555, 588556, 588557, 588558, 588559, 588560, 588561, 588562, 588563, 588564, 588565, 588571,
  • the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 80% inhibition of a CFB mRNA, SEQ ID NOs: 84, 237, 238, 239, 317, 395, 397, 411, 412, 413, 414, 415, 417, 418, 419, 420, 421, 422, 423, 425, 426, 427, 429, 430, 431, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 472, 473, 514, 515, 542, 543, 544, 545, 546, 547, 550, 551, 552, 553, 554, 555
  • the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 90% inhibition of a CFB mRNA, ISIS NOs: 532686, 532811, 532917, 588536, 588537, 588538, 588539, 588544, 588545, 588546, 588548, 588551, 588552, 588553, 588554, 588555, 588556, 588557, 588558, 588559, 588560, 588561, 588562, 588564, 588638, 588640, 588696, 588698, 588849, 588850, 588851, 588860, 588866, 588867, 588872, 588873, 588874, 588876, 588877, 588878, 588879, 588881, 588883, 599149, 5
  • the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 90% inhibition of a CFB mRNA, SEQ ID NOs: 84, 238, 239, 317, 412, 413, 420, 421, 426, 434, 436, 437, 438, 439, 440, 442, 443, 444, 445, 446, 448, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 464, 465, 472, 473, 514, 515, 542, 543, 544, 545, 546, 551, 553, 555, 556, 599, 600, 601, 602, 610, 616, 617, 618, 662, 666, 670, 676, 677, 678, 688, 689, 713, 723, 729, 730, 740, 741, 742, 743, 744, 7
  • a compound comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within nucleotides 2193-2212, 2195-2210, 2457-2476, 2571 -2590, 2584- 2603, 2588-2607, 2592-2611, 2594-2613, 2597-2616, 2600-2619, or 2596-2611 of SEQ ID NO: 1.
  • a compound comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598.
  • a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598.
  • any of the foregoing compounds or oligonucleotides comprises at least one modified internucleoside linkage, at least one modified sugar, and/or at least one modified nucleobase.
  • any of the foregoing compounds or oligonucleotides comprises at least one modified sugar.
  • at least one modified sugar comprises a 2'-0-methoxyethyl group.
  • at least one modified sugar is a bicyclic sugar, such as a 4'-CH(CH 3 )-0-2' group, a 4'-CH 2 -0-2' group, or a 4'-(CH 2 ) 2 -0-2'group.
  • the modified oligonucleotide comprises at least one modified internucleoside linkage, such as a phosphorothioate internucleoside linkage.
  • any of the foregoing compounds or oligonucleotides comprises at least one modified nucleobase, such as 5-methylcytosine.
  • any of the foregoing compounds or oligonucleotides comprises:
  • a 3' wing segment consisting of linked nucleosides
  • the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
  • the oligonucleotide consists of 10 to 30 linked nucleosides having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, or 598.
  • the modified oligonucleotide has a nucleobase sequence comprising the sequence recited in SEQ ID NO: 198, 228, 237, 440, 444, 448, 450, 453, or 455, wherein the modified oligonucleotide comprises
  • a 3' wing segment consisting of five linked nucleosides
  • each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.
  • a compound comprises or consists of a single-stranded modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence consisting of the sequence recited in SEQ ID NO: 198, 228, 237, 440, 444, 448, 450, 453, or 455, wherein the oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleosides; a 5' wing segment consisting of five linked nucleosides; and a 3' wing segment consisting of five linked nucleosides;
  • each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
  • a compound comprises or consists of a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence recited in SEQ ID NO: 549, wherein the modified oligonucleotide comprises
  • each nucleoside of each wing segment comprises a cEt sugar; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
  • a compound comprises or consists of a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 598, wherein the modified oligonucleotide comprises
  • a 3' wing segment consisting of three linked nucleosides
  • the gap segment is positioned between the 5' wing segment and the 3' wing segment; wherein the 5' wing segment comprises a 2'-0-methoxyethyl sugar, 2'-0-methoxyethyl sugar, and cEt sugar in the 5' to 3' direction; wherein the 3' wing segment comprises a cEt sugar, cEt sugar, and 2'-0- methoxyethyl sugar in the 5' to 3' direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
  • the compound or oligonucleotide can be at least 85%, at least
  • the compound or oligonucleotide can be single-stranded.
  • the compounds or compositions as described herein are efficacious by virtue of having at least one of an in vitro IC 50 of less than 250 nM, less than 200 nM, less than 150 nM, less than 100 nM, less than 90 nM, less than 80 nM, less than 70 nM, less than 65 nM, less than 60 nM, less than 55 nM, less than 50 nM, less than 45 nM, less than 40 nM, less than 35 nM, less than 30 nM, less than 25 nM, or less than 20 nM.
  • an in vitro IC 50 of less than 250 nM, less than 200 nM, less than 150 nM, less than 100 nM, less than 90 nM, less than 80 nM, less than 70 nM, less than 65 nM, less than 60 nM, less than 55 nM, less than 50 nM, less than 45 nM, less than 40 nM, less than 35
  • the compounds or compositions as described herein are highly tolerable as demonstrated by having at least one of an increase an ALT or AST value of no more than 4 fold, 3 fold, or 2 fold over saline treated animals or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%), 12%), 10%), 5%), or 2%.
  • the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase of ALT or AST over saline treated animals.
  • the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase in liver, spleen, or kidney weight over saline treated animals.
  • compositions comprising the compound of any of the aforementioned embodiments or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.
  • the composition has a viscosity less than about 40 centipoise (cP), less than about 30 centipose (cP), less than about 20 centipose (cP), less than about 15 centipose (cP), or less than about 10 centipose (cP).
  • the composition having any of the aforementioned viscosities comprises a compound provided herein at a concentration of about 100 mg/mL, about 125 mg/mL, about 150 mg/mL, about 175 mg/mL, about 200 mg/mL, about 225 mg/mL, about 250 mg/mL, about 275 mg/mL, or about 300 mg/mL.
  • the composition having any of the aforementioned viscosities and/or compound concentrations has a temperature of room temperature or about 20°C, about 21°C, about 22°C, about 23 °C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, or about 30°C.
  • a method of treating, preventing, or ameliorating a disease associated with dysregulation of the complement alternative pathway in a subject comprises administering to the subject a specific inhibitor of Complement Factor B (CFB), thereby treating, preventing, or ameliorating the disease.
  • CFB Complement Factor B
  • the complement alternative pathway is activated greater than normal.
  • the CFB specific inhibitor is an antisense compound targeted to CFB, such as an antisense oligonucleotide targeted to CFB.
  • the CFB specific inhibitor is a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808.
  • the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6-808.
  • the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598.
  • the CFB specific inhibitor is a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430.
  • the CFB specific inhibitor is a compound comprising or consisting of ISIS 588540, which has the following chemical structure:
  • the disease is macular degeneration, such as age related macular degeneration (AMD), which can be wet AMD or dry AMD. In certain embodiments, dry AMD can be Geographic Atrophy.
  • AMD age related macular degeneration
  • dry AMD can be Geographic Atrophy.
  • the disease is a kidney disease such as lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.
  • a method of treating, preventing, or ameliorating macular degeneration, such as age-related macular degeneration (AMD) in a subject comprises administering to the subject a CFB specific inhibitor, thereby treating, preventing, or ameliorating AMD, such as wet AMD and dry AMD.
  • AMD age-related macular degeneration
  • dry AMD can be Geographic Atrophy. Geographic Atrophy is considered an advanced form of dry AMD involving degeneration of the retina.
  • the subject has a complement alternative pathway that is activated greater than normal.
  • administering the antisense compound reduces or inhibits accumulation of ocular C3 levels, such as C3 protein levels.
  • administering the antisense compound reduces the level of ocular C3 deposits or inhibits accumulation of ocular C3 deposits.
  • the CFB specific inhibitor is an antisense compound targeted to CFB, such as an antisense oligonucleotide targeted to CFB.
  • the CFB specific inhibitor is a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808.
  • the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6- 808.
  • the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598.
  • the CFB specific inhibitor is a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430.
  • the compound is administered to the subject parenterally.
  • a method of treating, preventing, or ameliorating a kidney disease associated with dysregulation of the complement alternative pathway in a subject comprises administering to the subject a specific inhibitor of Complement Factor B (CFB), thereby treating, preventing, or ameliorating the kidney disease.
  • CFB Complement Factor B
  • the complement alternative pathway is activated greater than normal.
  • the CFB specific inhibitor is an antisense compound targeted to CFB, such as an antisense oligonucleotide targeted to CFB.
  • the CFB specific inhibitor is a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808.
  • the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6-808.
  • the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598.
  • the CFB specific inhibitor is a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430.
  • the compound is administered to the subject parenterally.
  • the kidney disease is lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.
  • the kidney disease is associated with C3 deposits, such as C3 deposits in the glomerulus.
  • the kidney disease is associated with lower than normal circulating C3 levels, such as serum or plasma C3 levels.
  • administering the compound reduces or inhibits accumulation of C3 levels in the kidney, such as C3 protein levels.
  • administering the compound reduces the level of kidney C3 deposits or inhibits accumulation of kidney C3 deposits, such as C3 levels in the glomerulus.
  • the subject is identified as having or at risk of having a disease associated with dysregulation of the complement alternative pathway, for example by detecting complement levels or membrane-attack complex levels in the subject's blood and/or performing a genetic test for gene mutations of complement factors associated with the disease.
  • a method of inhibiting expression of Complement Factor B (CFB) in a subject having, or at risk of having, a disease associated with dysregulation of the complement alternative pathway comprises administering a Complement Factor B (CFB) specific inhibitor to the subject, thereby inhibiting expression of CFB in the subject.
  • administering the inhibitor inhibits expression of CFB in the eye.
  • the subject has, or is at risk of having, age related macular degeneration (AMD), such as wet AMD and dry AMD.
  • AMD age related macular degeneration
  • dry AMD can be Geographic Atrophy.
  • administering the inhibitor inhibits expression of CFB in the kidney, such as in the glomerulus.
  • the subject has, or is at risk of having, lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.
  • the CFB specific inhibitor is a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808.
  • the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6-808.
  • the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598.
  • the CFB specific inhibitor is a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430.
  • the compound is administered to the subject parenterally.
  • a method of reducing or inhibiting accumulation of C3 deposits in the eye of a subject having, or at risk of having, a disease associated with dysregulation of the complement alternative pathway comprises administering a Complement Factor B (CFB) specific inhibitor to the subject, thereby reducing or inhibiting accumulation of C3 deposits in the eye of the subject.
  • CFB Complement Factor B
  • the subject has, or is at risk of having, age related macular degeneration (AMD), such as wet AMD and dry
  • the inhibitor is an antisense compound targeted to CFB.
  • the CFB specific inhibitor is a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808.
  • the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6-808.
  • the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598.
  • the CFB specific inhibitor is a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430.
  • the compound is administered to the subject parenterally.
  • a method of reducing or inhibiting accumulation of C3 deposits in the kidney of a subject having, or at risk of having, a disease associated with dysregulation of the complement alternative pathway comprises administering a Complement Factor B (CFB) specific inhibitor to the subject, thereby reducing or inhibiting accumulation of C3 deposits in the kidney of the subject.
  • CFB Complement Factor B
  • the subject has, or is at risk of having, lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.
  • the inhibitor is an antisense compound targeted to CFB.
  • the CFB specific inhibitor is a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808.
  • the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6-808.
  • the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598.
  • the CFB specific inhibitor is a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430.
  • the compound is administered to the subject parenterally.
  • Certain embodiments are drawn to a compound or composition described herein for use in therapy.
  • Certain embodiments are drawn to a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808 for use in therapy. Certain embodiments are drawn to a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6-808 for use in therapy.
  • Certain embodiments are drawn to a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598, for use in therapy.
  • Certain embodiments are drawn to a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430 for use in therapy.
  • Certain embodiments are drawn to a compound or composition described herein for use in treating a disease associated with dysregulation of the complement alternative pathway. Certain embodiments are drawn to a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808 for use in treating a disease associated with dysregulation of the complement alternative pathway.
  • Certain embodiments are drawn to a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6-808 for use in treating a disease associated with dysregulation of the complement alternative pathway. Certain embodiments are drawn to a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598, for use in treating a disease associated with dysregulation of the complement alternative pathway.
  • Certain embodiments are drawn to a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430 for use in treating a disease associated with dysregulation of the complement alternative pathway.
  • the complement alternative pathway is activated greater than normal.
  • the disease is macular degeneration, such as age related macular degeneration (AMD), which can be wet AMD or dry AMD.
  • AMD age related macular degeneration
  • dry AMD can be Geographic Atrophy.
  • the disease is a kidney disease such as lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.
  • kidney disease such as lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.
  • Certain embodiments are drawn to a compound comprising or consisting of ISIS 588540, which has the following chemical structure:
  • the complement alternative pathway is activated greater than normal.
  • the disease is macular degeneration, such as age related macular degeneration (AMD), which can be wet AMD or dry AMD. In certain embodiments, dry AMD can be Geographic Atrophy.
  • AMD age related macular degeneration
  • the disease is a kidney disease such as lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.
  • Certain embodiments are drawn to use of a compound or composition described herein for the manufacture of a medicament for treating a disease associated with dysregulation of the complement alternative pathway. Certain embodiments are drawn to use of a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808 for the manufacture of a medicament for treating disease associated with dysregulation of the complement alternative pathway.
  • Certain embodiments are drawn to use of a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6-808 for the manufacture of a medicament for treating a disease associated with dysregulation of the complement alternative pathway.
  • Certain embodiments are drawn to use of a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598, for the manufacture of a medicament for treating a disease associated with dysregulation of the complement alternative pathway.
  • Certain embodiments are drawn to use of a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430 for the manufacture of a medicament for treating a disease associated with dysregulation of the complement alternative pathway.
  • the complement alternative pathway is activated greater than normal.
  • the disease is macular degeneration, such as age related macular degeneration (AMD), which can be wet AMD or dry AMD.
  • AMD age related macular degeneration
  • dry AMD can be Geographic Atrophy.
  • the disease is a kidney disease such as lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.
  • kidney disease such as lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.
  • Certain embodiments are drawn to use of a compound comprising or consisting of ISIS 588540, which has the following chemical structure:
  • the complement alternative pathway is activated greater than normal.
  • the disease is macular degeneration, such as age related macular degeneration (AMD), which can be wet AMD or dry AMD. In certain embodiments, dry AMD can be Geographic Atrophy.
  • AMD age related macular degeneration
  • the disease is a kidney disease such as lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.
  • the CFB specific inhibitor can be an antisense compound targeted to CFB.
  • the antisense compound comprises an antisense oligonucleotide, for example an antisense oligonucleotide consisting of 8 to 80 linked nucleosides, 12 to 30 linked nucleosides, or 20 linked nucleosides.
  • the antisense oligonucleotide is at least 80%, 85%, 90%>, 95% or 100%) complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1 -5.
  • the antisense oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar and/or at least one modified nucleobase.
  • the modified internucleoside linkage is a phosphorothioate internucleoside linkage
  • the modified sugar is a bicyclic sugar or a 2'-0-methoxyethyl
  • the modified nucleobase is a 5-methylcytosine.
  • the modified oligonucleotide comprises a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and a 3' wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
  • the antisense oligonucleotide is administered parenterally.
  • the antisense oligonucleotide can be administered through injection or infusion.
  • Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.
  • Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs.
  • An oligomeric compound may be "antisense" to a target nucleic acid, meaning that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
  • an antisense compound is 10 to 30 subunits in length. In certain embodiments, an antisense compound is 12 to 30 subunits in length. In certain embodiments, an antisense compound is 12 to 22 subunits in length. In certain embodiments, an antisense compound is 14 to 30 subunits in length. In certain embodiments, an antisense compound is 14 to 20 subunits in length. In certain embodiments, an antisense compoun is 15 to 30 subunits in length. In certain embodiments, an antisense compound is 15 to 20 subunits in length. In certain embodiments, an antisense compound is 16 to 30 subunits in length. In certain embodiments, an antisense compound is 16 to 20 subunits in length.
  • an antisense compound is 17 to 30 subunits in length. In certain embodiments, an antisense compound is 17 to 20 subunits in length. In certain embodiments, an antisense compound is 18 to 30 subunits in length. In certain embodiments, an antisense compound is 18 to 21 subunits in length. In certain embodiments, an antisense compound is 18 to 20 subunits in length. In certain embodiments, an antisense compound is 20 to 30 subunits in length.
  • antisense compounds are from 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to 22 linked subunits, respectively.
  • an antisense compound is 14 subunits in length.
  • an antisense compound is 16 subunits in length.
  • an antisense compound is 17 subunits in length.
  • an antisense compound is 18 subunits in length.
  • an antisense compound is 19 subunits in length. In certain embodiments, an antisense compound is 20 subunits in length. In other embodiments, the antisense compound is 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits.
  • the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values.
  • the antisense compound is an antisense oligonucleotide, and the linked subunits are nucleotides.
  • antisense oligonucleotides may be shortened or truncated.
  • a single subunit may be deleted from the 5' end (5' truncation), or alternatively from the 3' end (3' truncation).
  • a shortened or truncated antisense compound targeted to an CFB nucleic acid may have two subunits deleted from the 5' end, or alternatively may have two subunits deleted from the 3' end, of the antisense compound.
  • the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end.
  • the additional subunit may be located at the 5' or 3' end of the antisense compound.
  • the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the antisense compound.
  • the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5' end and one subunit added to the 3' end.
  • an antisense compound such as an antisense oligonucleotide
  • an antisense oligonucleotide it is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity.
  • an antisense compound such as an antisense oligonucleotide
  • a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
  • Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches. Gautschi et al. (J. Natl. Cancer Inst.
  • antisense compounds have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
  • Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity.
  • a second region of a chimeric antisense compound may confer another desired property e.g., serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
  • Antisense activity may result from any mechanism involving the hybridization of the antisense compound (e.g., oligonucleotide) with a target nucleic acid, wherein the hybridization ultimately results in a biological effect.
  • the amount and/or activity of the target nucleic acid is modulated.
  • the amount and/or activity of the target nucleic acid is reduced.
  • hybridization of the antisense compound to the target nucleic acid ultimately results in target nucleic acid degradation.
  • hybridization of the antisense compound to the target nucleic acid does not result in target nucleic acid degradation.
  • the presence of the antisense compound hybridized with the target nucleic acid results in a modulation of antisense activity.
  • antisense compounds having a particular chemical motif or pattern of chemical modifications are particularly suited to exploit one or more mechanisms.
  • antisense compounds function through more than one mechanism and/or through mechanisms that have not been elucidated. Accordingly, the antisense compounds described herein are not limited by particular mechanism.
  • Antisense mechanisms include, without limitation, RNase H mediated antisense; RNAi mechanisms, which utilize the RISC pathway and include, without limitation, siRNA, ssRNA and microRNA mechanisms; and occupancy based mechanisms. Certain antisense compounds may act through more than one such mechanism and/or through additional mechanisms.
  • antisense activity results at least in part from degradation of target RNA by
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are "DNA-like" elicit RNase H activity in mammalian cells. Accordingly, antisense compounds comprising at least a portion of DNA or DNA-like nucleosides may activate RNase H, resulting in cleavage of the target nucleic acid.
  • antisense compounds that utilize RNase H comprise one or more modified nucleosides. In certain embodiments, such antisense compounds comprise at least one block of 1-8 modified nucleosides. In certain such embodiments, the modified nucleosides do not support RNase H activity.
  • such antisense compounds are gapmers, as described herein.
  • the gap of the gapmer comprises DNA nucleosides.
  • the gap of the gapmer comprises DNA-like nucleosides.
  • the gap of the gapmer comprises DNA nucleosides and DNA-like nucleosides.
  • Certain antisense compounds having a gapmer motif are considered chimeric antisense compounds.
  • a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region.
  • the gap segment In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides.
  • the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region.
  • sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include ⁇ -D-ribonucleosides, ⁇ -D-deoxyribonucleosides, 2'- modified nucleosides (such 2'-modified nucleosides may include 2'-MOE and 2'-0-CH 3 , among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a constrained ethyl).
  • nucleosides in the wings may include several modified sugar moieties, including, for example 2'-MOE and bicyclic sugar moieties such as constrained ethyl or LNA.
  • wings may include several modified and unmodified sugar moieties.
  • wings may include various combinations of 2'-MOE nucleosides, bicyclic sugar moieties such as constrained ethyl nucleosides or LNA nucleosides, and 2'-deoxynucleosides.
  • Each distinct region may comprise uniform sugar moieties, variant, or alternating sugar moieties.
  • the wing-gap-wing motif is frequently described as "X-Y-Z", where "X” represents the length of the 5'- wing, "Y” represents the length of the gap, and “Z” represents the length of the 3 '-wing.
  • "X” and “Z” may comprise uniform, variant, or alternating sugar moieties.
  • "X" and "Y” may include one or more 2'-deoxynucleosides.”
  • Y may comprise 2'-deoxynucleosides.
  • a gapmer described as "X-Y-Z” has a configuration such that the gap is positioned immediately adjacent to each of the 5 '-wing and the 3' wing. Thus, no intervening nucleotides exist between the 5 '-wing and gap, or the gap and the 3 '-wing. Any of the antisense compounds described herein can have a gapmer motif.
  • "X” and “Z” are the same; in other embodiments they are different.
  • "Y” is between 8 and 15 nucleosides.
  • X, Y, or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleosides.
  • the antisense compound targeted to a CFB nucleic acid has a gapmer motif in which the gap consists of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 linked nucleosides.
  • the antisense oligonucleotide has a sugar motif described by Formula A as follows: (J) m -(B) n -(J) p -(B) r -(A) t -(D) g -(A) v -(B) w -(J) x -(B) y -(J) z
  • each A is independently a 2'-substituted nucleoside
  • each B is independently a bicyclic nucleoside
  • each J is independently either a 2' -substituted nucleoside or a 2'-deoxynucleoside;
  • each D is a 2'-deoxynucleoside
  • At least one of m, n, and r is other than 0;
  • At least one of w and y is other than 0;
  • antisense compounds are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and single- stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). In certain embodiments, antisense compounds comprise modifications that make them particularly suited for such mechanisms.
  • RNAi interfering RNA compounds
  • siRNA double-stranded RNA compounds
  • ssRNAi compounds single- stranded RNAi compounds
  • antisense compounds including those particularly suited for use as single- stranded RNAi compounds (ssRNA) comprise a modified 5 '-terminal end.
  • the 5 '-terminal end comprises a modified phosphate moiety.
  • such modified phosphate is stabilized (e.g., resistant to degradation/cleavage compared to unmodified 5 '-phosphate).
  • such 5 '-terminal nucleosides stabilize the 5 '-phosphorous moiety.
  • Certain modified 5'- terminal nucleosides may be found in the art, for example in WO/201 1/139702.
  • Ti is an optionally protected phosphorus moiety
  • T 2 is an internucleoside linking group linking the compound of Formula lie to the olig
  • A has o
  • Qi and (3 ⁇ 4 are each, independently, H, halogen, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkoxy, substituted Ci-Ce alkoxy, C 2 -C6 alkenyl, substituted C 2 -C6 alkenyl, C 2 -C6 alkynyl, substituted C 2 -C6 alkynyl or N(R 3 )(R4);
  • Q 3 is O, S, N(R 5 ) or C(R 6 )(R 7 );
  • each R 3 , R4 R 5 , R 6 and R 7 is, independently, H, Ci-Ce alkyl, substituted Ci-Ce alkyl or Ci-Ce alkoxy;
  • Ri 4 is H, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, Ci-C 6 alkoxy, substituted Ci-C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • Ri5, Ri 6 , Ri7 and R i8 are each, independently, H, halogen, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, Ci-C 6 alkoxy, substituted Ci-C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • Bx ! is a heterocyclic base moiety
  • Bx 2 is a heterocyclic base moiety and Bx ! is H, halogen, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, Ci-C 6 alkoxy, substituted Ci-C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 - Ce alkynyl or substituted C 2 -C6 alkynyl; J4, J 5 , ⁇ and J 7 are each, independently, H, halogen, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkoxy, substituted Ci-C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • each R 19 , R 20 and R 2i is, independently, H, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, Ci-C 6 alkoxy, substituted Ci-Ce alkoxy, C 2 -C6 alkenyl, substituted C 2 -C6 alkenyl, C 2 -C6 alkynyl or substituted C 2 -C6 alkynyl;
  • each R 8 and R9 is, independently, H, halogen, Ci-Ce alkyl or substituted Ci-Ce alkyl;
  • Xi is O, S or N(Ei);
  • Z is H, halogen, Ci-Ce alkyl, substituted Ci-Ce alkyl, C 2 -C6 alkenyl, substituted C 2 -C6 alkenyl, C 2 -C6 alkynyl, substituted C 2 -C6 alkynyl or N(E 2 )(E 3 );
  • Ei, E 2 and E 3 are each, independently, H, Ci-Ce alkyl or substituted Ci-Ce alkyl;
  • n is from 1 to about 6;
  • n 0 or 1 ;
  • j is 0 or 1 ;
  • X 2 is O, S or NJ 3 ;
  • each Ji, J 2 and J 3 is, independently, H or Ci-C 6 alkyl
  • said oligomeric compound comprises from 8 to 40 monomelic subunits and is hybridizable to at least a portion of a target nucleic acid.
  • J4, J 5 , J and J 7 are each H. In certain embodiments, J4 forms a bridge with one of J 5 or J 7 .
  • Qi and Q 2 are each, independently, H, halogen, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkoxy or substituted Ci-C 6 alkoxy.
  • Qi and Q 2 are each H.
  • Qi and Q 2 are each, independently, H or halogen.
  • Qi and Q 2 is H and the other of Qi and Q 2 is F, CH 3 or OCH 3 .
  • Ti has the formula:
  • R a and R c are each, independently, protected hydroxyl, protected thiol, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkoxy, substituted Ci-Ce alkoxy, protected amino or substituted amino; and
  • R b is O or S. In certain embodiments, R b is O and R a and R c are each, independently, OCH 3 ,
  • G is F, OCH 3 or 0(CH 2 ) 2 -OCH 3 .
  • G is 0(CH 2 ) 2 -OCH 3 .
  • antisense compounds including those particularly suitable for ssRNA comprise one or more type of modified sugar moieties and/or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a defined pattern or sugar modification motif.
  • Such motifs may include any of the sugar modifications discussed herein and/or other known sugar modifications.
  • the oligonucleotides comprise or consist of a region having uniform sugar modifications.
  • each nucleoside of the region comprises the same RNA-like sugar modification.
  • each nucleoside of the region is a 2'-F nucleoside.
  • each nucleoside of the region is a 2'-OMe nucleoside.
  • each nucleoside of the region is a 2'-MOE nucleoside.
  • each nucleoside of the region is a cEt nucleoside.
  • each nucleoside of the region is an LNA nucleoside.
  • the uniform region constitutes all or essentially all of the oligonucleotide.
  • the region constitutes the entire oligonucleotide except for 1-4 terminal nucleosides.
  • oligonucleotides comprise one or more regions of alternating sugar modifications, wherein the nucleosides alternate between nucleotides having a sugar modification of a first type and nucleotides having a sugar modification of a second type.
  • nucleosides of both types are RNA-like nucleosides.
  • the alternating nucleosides are selected from: 2'-OMe, 2'-F, 2'-MOE, LNA, and cEt.
  • the alternating modificatios are 2'-F and 2'- OMe. Such regions may be contiguous or may be interupted by differently modified nucleosides or conjugated nucleosides.
  • the alternating region of alternating modifications each consist of a single nucleoside (i.e., the patern is (AB) x A y wheren A is a nucleoside having a sugar modification of a first type and B is a nucleoside having a sugar modification of a second type; x is 1-20 and y is 0 or 1).
  • one or more alternating regions in an alternating motif includes more than a single nucleoside of a type.
  • oligonucleotides may include one or more regions of any of the following nucleoside motifs:
  • A is a nucleoside of a first type and B is a nucleoside of a second type.
  • a and B are each selected from 2'-F, 2'-OMe, BNA, and MOE.
  • oligonucleotides having such an alternating motif also comprise a modified
  • 5' terminal nucleoside such as those of formula lie or He.
  • oligonucleotides comprise a region having a 2-2-3 motif. Such regions comprises the following motif:
  • A is a first type of modifed nucleosde
  • B and C are nucleosides that are differently modified than A, however, B and C may have the same or different modifications as one another;
  • x and y are from 1 to 15.
  • A is a 2'-OMe modified nucleoside.
  • B and C are both 2'-F modified nucleosides.
  • A is a 2'-OMe modified nucleoside and B and C are both 2'-F modified nucleosides.
  • oligonucleosides have the following sugar motif:
  • Q is a nucleoside comprising a stabilized phosphate moiety.
  • Q is a nucleoside having Formula lie or He;
  • A is a first type of modifed nucleoside
  • B is a second type of modified nucleoside
  • D is a modified nucleoside comprising a modification different from the nucleoside adjacent to it. Thus, if y is 0, then D must be differently modified than B and if y is 1 , then D must be differently modified than A. In certain embodiments, D differs from both A and B.
  • X is 5-15;
  • Y is O or 1 ;
  • Z is 0-4.
  • oligonucleosides have the following sugar motif:
  • Q is a nucleoside comprising a stabilized phosphate moiety.
  • Q is a nucleoside having Formula lie or He;
  • A is a first type of modifed nucleoside
  • D is a modified nucleoside comprising a modification different from A.
  • X is 11-30;
  • Z is 0-4.
  • A, B, C, and D in the above motifs are selected from: 2'-OMe, 2'-F, 2'- MOE, LNA, and cEt.
  • D represents terminal nucleosides. In certain embodiments, such terminal nucleosides are not designed to hybridize to the target nucleic acid (though one or more might hybridize by chance).
  • the nucleobase of each D nucleoside is adenine, regardless of the identity of the nucleobase at the corresponding position of the target nucleic acid. In certain embodiments the nucleobase of each D nucleoside is thymine.
  • antisense compounds comprising those particularly suited for use as ssRNA comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif.
  • oligonucleotides comprise a region having an alternating internucleoside linkage motif.
  • oligonucleotides comprise a region of uniformly modified internucleoside linkages.
  • the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages.
  • the oligonucleotide is uniformly linked by phosphorothioate internucleoside linkages.
  • each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate.
  • each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.
  • the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages.
  • the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3 ' end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3' end of the oligonucleotide.
  • Oligonucleotides having any of the various sugar motifs described herein may have any linkage motif.
  • the oligonucleotides including but not limited to those described above, may have a linkage motif selected from non-limiting the table below:
  • antisense compounds are double-stranded RNAi compounds (siRNA).
  • siRNA double-stranded RNAi compounds
  • one or both strands may comprise any modification motif described above for ssRNA.
  • ssRNA compounds may be unmodified RNA.
  • siRNA compounds may comprise unmodified RNA nucleosides, but modified internucleoside linkages.
  • compositions comprising a first and a second oligomeric compound that are fully or at least partially hybridized to form a duplex region and further comprising a region that is complementary to and hybridizes to a nucleic acid target. It is suitable that such a composition comprise a first oligomeric compound that is an antisense strand having full or partial complementarity to a nucleic acid target and a second oligomeric compound that is a sense strand having one or more regions of complementarity to and forming at least one duplex region with the first oligomeric compound.
  • compositions of several embodiments modulate gene expression by hybridizing to a nucleic acid target resulting in loss of its normal function.
  • the degradation of the targeted CFB is facilitated by an activated RISC complex that is formed with compositions of the invention.
  • compositions of the present invention are directed to double-stranded compositions wherein one of the strands is useful in, for example, influencing the preferential loading of the opposite strand into the RISC (or cleavage) complex.
  • the compositions are useful for targeting selected nucleic acid molecules and modulating the expression of one or more genes.
  • the compositions of the present invention hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA.
  • compositions of the present invention can be modified to fulfil a particular role in for example the siRNA pathway.
  • Using a different motif in each strand or the same motif with different chemical modifications in each strand permits targeting the antisense strand for the RISC complex while inhibiting the incorporation of the sense strand.
  • each strand can be independently modified such that it is enhanced for its particular role.
  • the antisense strand can be modified at the 5'-end to enhance its role in one region of the RISC while the 3'-end can be modified differentially to enhance its role in a different region of the RISC.
  • the double-stranded oligonucleotide molecules can be a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the double-stranded oligonucleotide molecules can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e.
  • each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double-stranded structure, for example wherein the double-stranded region is about 15 to about 30, e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs; the antisense strand comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof (e.g., about 15 to about 25 or more nucleotides of the double-stranded oligonucleotide molecule are complementary to the target nucleic acid or a portion thereof).
  • the double-stranded oligonucleotide is assembled from a single oligonucleotide, where the self- complementary sense and antisense regions of the siRNA are linked by means of a nucleic acid based or non- nucleic acid-based linker(s).
  • the double-stranded oligonucleotide can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the double-stranded oligonucleotide can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNAi.
  • the double-stranded oligonucleotide comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non-nucleotide linkers molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, van der waals interactions, hydrophobic interactions, and/or stacking interactions.
  • the double-stranded oligonucleotide comprises nucleotide sequence that is complementary to nucleotide sequence of a target gene.
  • the double-stranded oligonucleotide interacts with nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene.
  • double-stranded oligonucleotides need not be limited to those molecules containing only RNA, but further encompasses chemically modified nucleotides and non-nucleotides.
  • the short interfering nucleic acid molecules lack 2'-hydroxy (2'-OH) containing nucleotides.
  • short interfering nucleic acids optionally do not include any ribonucleotides (e.g., nucleotides having a 2'-OH group).
  • double-stranded oligonucleotides that do not require the presence of ribonucleotides within the molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2'-OH groups.
  • double-stranded oligonucleotides can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions.
  • siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others.
  • siRNA short interfering RNA
  • dsRNA double-stranded RNA
  • miRNA micro-RNA
  • shRNA short hairpin RNA
  • siRNA short interfering oligonucleotide
  • short interfering nucleic acid short interfering modified oligonucleotide
  • ptgsRNA post-transcriptional gene silencing RNA
  • RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.
  • sequence specific RNA interference such as post transcriptional gene silencing, translational inhibition, or epigenetics.
  • double-stranded oligonucleotides can be used to epigenetically silence genes at both the post-transcriptional level and the pre -transcriptional level.
  • epigenetic regulation of gene expression by siRNA molecules of the invention can result from siRNA mediated modification of chromatin structure or methylation pattern to alter gene expression (see, for example, Verdel et al., 2004, Science, 303, 672-676; Pal-Bhadra et al., 2004, Science, 303, 669-672; Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237).
  • compositions of several embodiments provided herein can target CFB by a dsRNA-mediated gene silencing or RNAi mechanism, including, e.g., "hairpin” or stem-loop double-stranded RNA effector molecules in which a single RNA strand with self-complementary sequences is capable of assuming a double-stranded conformation, or duplex dsRNA effector molecules comprising two separate strands of RNA.
  • a dsRNA-mediated gene silencing or RNAi mechanism including, e.g., "hairpin" or stem-loop double-stranded RNA effector molecules in which a single RNA strand with self-complementary sequences is capable of assuming a double-stranded conformation, or duplex dsRNA effector molecules comprising two separate strands of RNA.
  • the dsRNA consists entirely of ribonucleotides or consists of a mixture of ribonucleotides and deoxynucleotides, such as the RNA/DNA hybrids disclosed, for example, by WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.
  • the dsRNA or dsRNA effector molecule may be a single molecule with a region of self-complementarity such that nucleotides in one segment of the molecule base pair with nucleotides in another segment of the molecule.
  • a dsRNA that consists of a single molecule consists entirely of ribonucleotides or includes a region of ribonucleotides that is complementary to a region of deoxyribonucleotides.
  • the dsRNA may include two different strands that have a region of complementarity to each other.
  • both strands consist entirely of ribonucleotides, one strand consists entirely of ribonucleotides and one strand consists entirely of deoxyribonucleotides, or one or both strands contain a mixture of ribonucleotides and deoxyribonucleotides.
  • the regions of complementarity are at least 70, 80, 90, 95, 98, or 100% complementary to each other and to a target nucleic acid sequence.
  • the region of the dsRNA that is present in a double-stranded conformation includes at least 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 50, 75,100, 200, 500, 1000, 2000 or 5000 nucleotides or includes all of the nucleotides in a cDNA or other target nucleic acid sequence being represented in the dsRNA.
  • the dsRNA does not contain any single stranded regions, such as single stranded ends, or the dsRNA is a hairpin.
  • the dsRNA has one or more single stranded regions or overhangs.
  • RNA/DNA hybrids include a DNA strand or region that is an antisense strand or region (e.g, has at least 70, 80, 90, 95, 98, or 100% complementarity to a target nucleic acid) and an RNA strand or region that is a sense strand or region (e.g, has at least 70, 80, 90, 95, 98, or 100% identity to a target nucleic acid), and vice versa.
  • an antisense strand or region e.g, has at least 70, 80, 90, 95, 98, or 100% complementarity to a target nucleic acid
  • RNA strand or region that is a sense strand or region e.g, has at least 70, 80, 90, 95, 98, or 100% identity to a target nucleic acid
  • the RNA/DNA hybrid is made in vitro using enzymatic or chemical synthetic methods such as those described herein or those described in WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.
  • a DNA strand synthesized in vitro is complexed with an RNA strand made in vivo or in vitro before, after, or concurrent with the transformation of the DNA strand into the cell.
  • the dsRNA is a single circular nucleic acid containing a sense and an antisense region, or the dsRNA includes a circular nucleic acid and either a second circular nucleic acid or a linear nucleic acid (see, for example, WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.)
  • Exemplary circular nucleic acids include lariat structures in which the free 5' phosphoryl group of a nucleotide becomes linked to the 2' hydroxyl group of another nucleotide in a loop back fashion.
  • the dsRNA includes one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as fluorine group) or contains an alkoxy group (such as a methoxy group) which increases the half-life of the dsRNA in vitro or in vivo compared to the corresponding dsRNA in which the corresponding 2' position contains a hydrogen or an hydroxyl group.
  • the dsRNA includes one or more linkages between adjacent nucleotides other than a naturally- occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages.
  • the dsRNAs may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661.
  • the dsRNA contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.
  • the dsRNA can be any of the at least partially dsRNA molecules disclosed in WO 00/63364, as well as any of the dsRNA molecules described in U.S. Provisional Application 60/399,998; and U.S. Provisional Application 60/419,532, and PCT/US2003/033466, the teaching of which is hereby incorporated by reference. Any of the dsRNAs may be expressed in vitro or in vivo using the methods described herein or standard methods, such as those described in WO 00/63364.
  • antisense compounds are not expected to result in cleavage or the target nucleic acid via RNase H or to result in cleavage or sequestration through the RISC pathway.
  • antisense activity may result from occupancy, wherein the presence of the hybridized antisense compound disrupts the activity of the target nucleic acid.
  • the antisense compound may be uniformly modified or may comprise a mix of modifications and/or modified and unmodified nucleosides.
  • Nucleotide sequences that encode Complement Factor B include, without limitation, the following: GENBANK Accession No. NM 001710.5 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NT 007592.15 truncated from nucleotides 31852000 to 31861000 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No NW 001116486.1 truncated from nucleotides 536000 to 545000 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. XM 001113553.2 (incorporated herein as SEQ ID NO: 4), or GENBANK Accession No. NM 008198.2 (incorporated herein as SEQ ID NO: 5).
  • hybridization occurs between an antisense compound disclosed herein and a CFB nucleic acid.
  • the most common mechanism of hybridization involves hydrogen bonding (e.g., Watson- Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
  • Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
  • the antisense compounds provided herein are specifically hybridizable with a CFB nucleic acid.
  • An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a CFB nucleic acid).
  • Non-complementary nucleobases between an antisense compound and a CFB nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid.
  • an antisense compound may hybridize over one or more segments of a CFB nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
  • the antisense compounds provided herein, or a specified portion thereof are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a CFB nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
  • an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • an antisense compound which is 18 nucleobases in length having four noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
  • Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
  • the antisense compounds provided herein, or specified portions thereof are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof.
  • an antisense compound may be fully complementary to a CFB nucleic acid, or a target region, or a target segment or target sequence thereof.
  • "fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid.
  • a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound.
  • Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid.
  • a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long.
  • the 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound.
  • the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
  • non-complementary nucleobase may be at the 5' end or 3' end of the antisense compound.
  • the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound.
  • two or more non-complementary nucleobases may be contiguous (i.e. linked) or non-contiguous.
  • a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
  • antisense compounds that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a CFB nucleic acid, or specified portion thereof.
  • antisense compounds that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a CFB nucleic acid, or specified portion thereof.
  • the antisense compounds provided also include those which are complementary to a portion of a target nucleic acid.
  • portion refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid.
  • a “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound.
  • the antisense compounds are complementary to at least an 8 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 9 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
  • the antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof.
  • an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability.
  • a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine.
  • Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated.
  • the non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
  • the antisense compounds, or portions thereof are, or are at least 70%, 75%,
  • a portion of the antisense compound is compared to an equal length portion of the target nucleic acid.
  • an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
  • a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid.
  • an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
  • a nucleoside is a base-sugar combination.
  • the nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar.
  • Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
  • Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
  • Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
  • RNA and DNA The naturally occuring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage.
  • Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
  • Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom.
  • Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.
  • antisense compounds targeted to a CFB nucleic acid comprise one or more modified internucleoside linkages.
  • the modified internucleoside linkages are phosphorothioate linkages.
  • each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.
  • Antisense compounds can optionally contain one or more nucleosides wherein the sugar group has been modified.
  • Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds.
  • nucleosides comprise chemically modified ribofuranose ring moieties.
  • Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(Ri)(R 2 ) (R, Ri and R 2 are each independently H, C r Ci 2 alkyl or a protecting group) and combinations thereof.
  • substitutent groups including 5' and 2' substituent groups
  • BNA bicyclic nucleic acids
  • R, Ri and R 2 are each independently H, C r Ci 2 alkyl or a protecting group
  • Examples of chemically modified sugars include 2'-F-5'-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on 8/21/08 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5'-substitution of a BNA (see PCT International Application WO 2007/134181 Published on 11/22/07 wherein LNA is substituted with for example a 5'-methyl or a 5'-vinyl group).
  • nucleosides having modified sugar moieties include without limitation nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH 3 , 2'-OCH 2 CH 3 , 2'-OCH 2 CH 2 F and - 0(CH 2 ) 2 OCH 3 substituent groups.
  • bicyclic nucleosides refer to modified nucleosides comprising a bicyclic sugar moiety.
  • examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms.
  • antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4' to 2' bridge.
  • 4' to 2' bridged bicyclic nucleosides include but are not limited to one of the formulae: 4'-(CH 2 )-0-2' (LNA); 4'-(CH 2 )-S-2'; 4'-(CH 2 ) 2 -0-2' (ENA); 4'-CH(CH 3 )-0-2' (also referred to as constrained ethyl or cEt) and 4'-CH(CH 2 OCH 3 )- 0-2' (and analogs thereof see U.S.
  • Patent 7,427,672 issued on September 23, 2008
  • 4'-CH 2 -C(H)(CH 3 )-2' see Chattopadhyaya et al, J. Org. Chem., 2009, 74, 118-134
  • Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and ⁇ -D-ribofuranose (see PCT international application PCT/DK98/00393, published on March 25, 1999 as WO 99/14226).
  • x 0, 1, or 2;
  • n 1, 2, 3, or 4;
  • the bridge of a bicyclic sugar moiety is -[C(R a )(R b )] n -, -[C(R a )(R b )] n -0- , -C(R a R b )-N(R)-0- or -C(R a R b )-0-N(R)-.
  • the bridge is 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'- (CH 2 ) 3 -2', 4'-CH 2 -0-2', 4'-(CH 2 ) 2 -0-2', 4'-CH 2 -0-N(R)-2' and 4'-CH 2 -N(R)-0-2'- wherein each R is, independently, H, a protecting group or C 1 -C 12 alkyl.
  • bicyclic nucleosides are further defined by isomeric configuration.
  • a nucleoside comprising a 4 '-2' methylene-oxy bridge may be in the a-L configuration or in the ⁇ - D configuration.
  • a-L-methyleneoxy (4'-CH 2 -0-2') BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al, Nucleic Acids Research, 2003, 21, 6365- 6372).
  • bicyclic nucleosides include, but are not limited to, (A) a-L-methyleneoxy (4'-CH 2 -0-2') BNA , (B) ⁇ -D-methyleneoxy (4'-CH 2 -0-2') BNA , (C) ethyleneoxy (4'-(CH 2 ) 2 -0-2') BNA , (D) aminooxy (4'-CH 2 -0-N(R)-2') BNA, (E) oxyamino (4'-CH 2 -N(R)-0-2') BNA, and (F) methyl(methyleneoxy) (4'-CH(CH 3 )-0-2') BNA, (G) methylene-thio (4'-CH 2 -S-2') BNA, (H) methylene- amino (4'-CH 2 -N(R)-2') BNA, (I) methyl carbocyclic (4'-CH 2 -CH(CH 3 )-2') BNA, (J)
  • Bx is the base moiety and R is independently H, a protecting group, C 1 -C 12 alkyl or C 1 -C 12 alkoxy.
  • bicyclic nucleosides having Formula I:
  • Bx is a heterocyclic base moiety
  • R c is C 1 -C 12 alkyl or an amino protecting group
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.
  • bicyclic nucleosides are provided having Formula II:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • Z a is Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted Ci-C 6 alkyl, substituted C 2 -C 6 alkenyl, substituted C 2 -C 6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio.
  • bicyclic nucleosides are provided having Formula III: wherein:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • Ci-C 6 alkyl substituted Ci-C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • each q a , q b , q c and q is, independently, H, halogen, Ci-Ce alkyl, substituted Ci-Ce alkyl, C 2 -C6 alkenyl, substituted C 2 -C6 alkenyl, C 2 -C6 alkynyl or substituted C 2 -C6 alkynyl, Ci-Ce alkoxyl, substituted Cp Ce alkoxyl, acyl, substituted acyl, Ci-Ce aminoalkyl or substituted Ci-Ce aminoalkyl;
  • bicyclic nucleosides are provided having Formula V: wherein:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • q g and q h are each, independently, H, halogen, C1-C12 alkyl or substituted C1-C12 alkyl.
  • BNA methyleneoxy (4'-CH 2 -0-2') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • 4'-2' bicyclic nucleoside or “4' to 2' bicyclic nucleoside” refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2' carbon atom and the 4' carbon atom of the sugar ring.
  • nucleosides refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties.
  • sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.
  • 2 '-modified sugar means a furanosyl sugar modified at the 2' position.
  • modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl.
  • Other - substituent groups can also be selected from: C1-C12 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, F, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties.
  • modifed nucleosides comprise a 2'-MOE side chain (Baker et al, J. Biol. Chem., 1997, 272, 11944-12000).
  • 2'-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'- O- methyl, O-propyl, and 0-aminopropyl.
  • Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim.
  • a "modified tetrahydropyran nucleoside” or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran "sugar” substituted in for the pentofuranosyl residue in normal nucleosides (a sugar surrogate).
  • Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854) or fluoro HNA (F-HNA) having a tetrahydropyran ring system as illustrated below:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T a and T b is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T a and T b is H, a hydroxyl protecting group, a linked conjugate group or a 5' or 3'-terminal group;
  • qi, 3 ⁇ 42, 3 ⁇ 43, 3 ⁇ 44, 3 ⁇ 45, 3 ⁇ 46 and q 7 are each independently, H, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl; and each of Ri and R 2 is selected from hydrogen, hydroxyl, halogen, subsitituted or unsubstituted alkoxy, NJiJ 2 , SJi, N 3 ,
  • the modified THP nucleosides of Formula VII are provided wherein q b q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each H. In certain embodiments, at least one of qi, q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is other than H. In certain embodiments, at least one of qi, q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of Ri and R 2 is fluoro. In certain embodiments, Ri is fluoro and R 2 is H; R t is methoxy and R 2 is H, and Ri is methoxyethoxy and R 2 is H.
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al, Biochemistry, 2002, 41, 4503-4510; and U.S. Patents 5,698,685; 5,166,315; 5,185,444; and 5,034,506).
  • morpholino means a sugar llowing formula:
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are referred to herein as "modifed morpholinos.”
  • Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5 '-substitution of a bicyclic nucleic acid see PCT International Application WO 2007/134181, published on 11/22/07 wherein a 4'-CH 2 -0-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group.
  • PCT International Application WO 2007/134181 published on 11/22/07 wherein a 4'-CH 2 -0-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group.
  • carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described ⁇ see, e.g., Srivastava et al, J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
  • antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides.
  • Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on April 10, 2010, Robeyns et al, J. Am. Chem. Soc, 2008, 130(6), 1979-1984; Horvath et al, Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al, J.
  • Bx is a heterocyclic base moiety
  • T 3 and T 4 are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an antisense compound or one of T 3 and T 4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an antisense compound and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5'-or 3'-terminal group; and
  • qi, 3 ⁇ 42, 3 ⁇ 43, 3 ⁇ 44, 3 ⁇ 45, 3 ⁇ 46, 3 ⁇ 47, 3 ⁇ 48 and q 9 are each, independently, H, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, C 2 - C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted C 2 -C 6 alkynyl or other sugar substituent group.
  • 2'-modified or “2 '-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH.
  • 2 '-modified nucleosides include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2' carbon and another carbon of the sugar ring; and nucleosides with non-bridging 2'substituents, such as allyl, amino, azido, thio, O-allyl, O-C Ci 0 alkyl, -OCF 3 , 0-(CH 2 ) 2 -0-CH 3 , 2'-0(CH 2 ) 2 SCH 3 , 0-(CH 2 ) 2 -0- N(R m )(R n ), or where each R m and R n is, independently, H or substituted or unsubstituted Ci-Ci
  • 2'-F refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position of the sugar ring.
  • 2'-OMe or “2'-OCH 3 " or “2'-0-methyl” each refers to a nucleoside comprising a sugar comprising an -OCH 3 group at the 2' position of the sugar ring.
  • MOE or "2'-MOE” or “2'-OCH 2 CH 2 OCH 3 " or “2'-0-methoxyethyl” each refers to a nucleoside comprising a sugar comprising a -OCH 2 CH 2 OCH 3 group at the 2' position of the sugar ring.
  • oligonucleotide refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA). Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see for example review article: Leumann, Bioorg. Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to enhance activity.
  • nucleobase moieties In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
  • antisense compounds comprise one or more nucleosides having modified sugar moieties.
  • the modified sugar moiety is 2' -MOE.
  • the 2'-MOE modified nucleosides are arranged in a gapmer motif.
  • the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH 3 )-0-2') bridging group.
  • the (4'- CH(CH 3 )-0-2') modified nucleosides are arranged throughout the wings of a gapmer motif.
  • Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5- methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6- 1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).
  • Additional modified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C ⁇ C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5- substituted urac
  • Heterocyclic base moieties can also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5- substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
  • antisense compounds targeted to a CFB nucleic acid comprise one or more modified nucleobases.
  • shortened or gap-widened antisense oligonucleotides targeted to a CFB nucleic acid comprise one or more modified nucleobases.
  • the modified nucleobase is 5-methylcytosine.
  • each cytosine is a 5-methylcytosine.
  • Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides.
  • Typical conjugate groups include cholesterol moieties and lipid moieties.
  • Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'- cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3' and 5 '-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on January 16, 2003.
  • antisense compounds are modified by attachment of one or more conjugate groups.
  • conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge and clearance.
  • Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional conjugate linking moiety or conjugate linking group to a parent compound such as an oligonucleotide.
  • Conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes.
  • Certain conjugate groups have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci.
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
  • Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
  • Cells may be treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.
  • One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, CA).
  • Antisense oligonucleotides may be mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN concentration that may range from 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad, CA).
  • Antisense oligonucleotide is mixed with LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that may range from 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation. Yet another technique used to introduce antisense oligonucleotides into cultured cells includes free uptake of the oligonucleotides by the cells.
  • Cells are treated with antisense oligonucleotides by routine methods.
  • Cells may be harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
  • the concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols.
  • Certain embodiments provided herein relate to methods of treating, preventing, or ameliorating a disease associated with dysregulation of the complement alternative pathway in a subject by administration of a CFB specific inhibitor, such as an antisense compound targeted to CFB.
  • a CFB specific inhibitor such as an antisense compound targeted to CFB.
  • renal diseases associated with dysregulation of the complement alternative pathway treatable, preventable, and/or ameliorable with the methods provided herein include C3 glomerulopathy, atypical hemolytic uremic syndrome (aHUS), dense deposit disease (DDD; also known as MPGN Type II or C3Neph), and CFHR5 nephropathy.
  • C3 glomerulopathy atypical hemolytic uremic syndrome (aHUS)
  • DDD dense deposit disease
  • CFHR5 nephropathy CFHR5 nephropathy
  • Additional renal diseases associated with dysregulation of the complement alternative pathway treatable, preventable, and/or ameliorable with the methods provided herein include IgA nephropathy; mesangiocapillary (membranoproliferative) glomerulonephritis (MPGN); autoimmune disorders including lupus nephritis and systemic lupus erythematosus (SLE); infection-induced glomerulonephritis (also known as Postinfectious glomerulonephritis); and renal ischemia-reperfusion injury, for example post-transplant renal ischemia-reperfusion injury.
  • IgA nephropathy mesangiocapillary (membranoproliferative) glomerulonephritis (MPGN); autoimmune disorders including lupus nephritis and systemic lupus erythematosus (SLE); infection-induced glomerulonephritis (also known as Postinfectious glomerulonephriti
  • non-renal disorders associated with dysregulation of the complement alternative pathway treatable and/or preventable with the methods provided herein include ocular diseases such as macular degeneration, for example age-related macular degeneration (AMD), including wet AMD and dry AMD, such as Geographic Atrophy; neuromyelitis optica; corneal disease, such as corneal inflammation; autoimmune uveitis; and diabetic retinopathy. It has been reported that complement system is involved in ocular diseases. Jha P, et al., Mol Immunol (2007) 44(16): 3901-3908.
  • AMD age-related macular degeneration
  • non-renal disorders associated with dysregulation of the complement alternative pathway treatable and/or preventable with the methods provided herein include ANCA-assocaited vasculitis, antiphospholipid syndrome (also known as antiphospholipid antibody syndrome (APS)), asthma, rheumatoid arthritis, Myasthenia Gravis, and multiple sclerosis.
  • Certain embodiments provided herein relate to methods of treating, preventing, or ameliorating a renal disease associated with dysregulation of the complement alternative pathway in a subject by administration of a CFB specific inhibitor, such as an antisense compound targeted to CFB.
  • the renal disease is lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.
  • Certain embodiments provided herein relate to methods of treating, preventing, or ameliorating macular degeneration, such as age-related macular degeneration (AMD), in a subject by administration of a CFB specific inhibitor, such as an antisense compound targeted to CFB.
  • a CFB specific inhibitor such as an antisense compound targeted to CFB.
  • the AMD is wet AMD or dry AMD.
  • dry AMD can be Geographic Atrophy.
  • Complement components are common constituents of ocular drusen, the extracellular material that accumulates in the macula of AMD patients.
  • CFH and CFB variants account for nearly 75% of AMD cases in northern Europe and North America. It has also been found that a specific CFB polymorphism confers protection against AMD. Patel, N.
  • CFB homozygous null mice have lower complement pathway activity, exhibit smaller ocular lesions, and choroidal neovascularization (CNV) after laser photocoagulation.
  • CNV choroidal neovascularization
  • Rohrer, B. et al. Invest Ophthalmol Vis Sci. (2009) 50(7):3056-64.
  • CFB siRNA treatment protects mice from laser induced CNV. Bora, NS et al., J Immunol. (2006) 177(3): 1872-8.
  • Studies have also shown that the kidney and eye share developmental pathways and structural features including basement membrane collagen IV protomer composition and vascularity. Savige et al., J Am Soc Nephrol. (2011) 22(8): 1403-15.
  • DDD Dense deposit disease
  • mice harboring genetic deletion of a component of the complement alternative pathway have coexisting renal and ocular disease phenotypes. It has been reported that CFH homozygous null mice develop DDD and present retinal abnormalities and visual dysfunction. Pickering et al., Nat Genet. (2002) 31(4):424-8. Mouse models of renal diseases associated with dysregulation of the complement alternative pathway are also accepted as models of AMD. Pennesi ME et al., Mol Apects Med (2012) 33:487-509. CFH null mice, for example, are an accepted model for renal diseases, such as DDD, and AMD. Furthermore, it has been reported that AMD is associated with the systemic source of complement factors, which accumulate locally in the eye to drive alternative pathway complement activation. Loyet et al., Invest Ophthalmol Vis Sci. (2012) 53(10):6628-37.
  • antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.
  • Antisense oligonucleotides were designed targeting human Complement Factor B (CFB) nucleic acid and were tested for their effects on CFB m NA in vitro. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 4,500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and CFB mRNA levels were measured by quantitative real-time PCR.
  • CFB Complement Factor B
  • Human primer probe set RTS3459 (forward sequence AGTCTCTGTGGCATGGTTTGG, designated herein as SEQ ID NO: 810; reverse sequence GGGCGAATGACTGAGATCTTG, designated herein as SEQ ID NO: 811 ; probe sequence TACCGATTACCACAAGCAACCATGGCA, designated herein as SEQ ID NO: 812) was used to measure mRNA levels. CFB mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of CFB, relative to untreated control cells.
  • the newly designed chimeric antisense oligonucleotides in the Tables below were designed as 5-10-5 MOE gapmers.
  • the 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each.
  • Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2' -MOE modification.
  • Start site indicates the 5'-most nucleoside to which the gapmer is targeted in the human gene sequence.
  • “Stop site” indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence.
  • Each gapmer listed in the Tables below is targeted to either the human CFB mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM 001710.5) or the human CFB genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 007592.15 truncated from nucleotides 31852000 to 31861000), or both, 'n/a' indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Saccharide Compounds (AREA)
  • Epidemiology (AREA)
  • Amplifiers (AREA)
  • Optical Communication System (AREA)
PCT/US2014/055458 2013-09-13 2014-09-12 Modulators of complement factor b Ceased WO2015038939A2 (en)

Priority Applications (32)

Application Number Priority Date Filing Date Title
EP19182415.0A EP3603677A1 (en) 2013-09-13 2014-09-12 Modulators of complement factor b
BR112016004671-4A BR112016004671B1 (pt) 2013-09-13 2014-09-12 compostos moduladores do fator b do complemento, composição compreendendo os referidos compostos e usos dos compostos ou da composição
KR1020167009610A KR102381790B1 (ko) 2013-09-13 2014-09-12 보체 인자 b의 조절자
EP14844168.6A EP3043827B1 (en) 2013-09-13 2014-09-12 Modulators of complement factor b
CR20190329A CR20190329A (es) 2014-09-12 2014-09-12 MODULADORES DEL FACTOR DEL COMPLEMENTO B (Divisional 2016-0170)
HRP20191600 HRP20191600T1 (hr) 2013-09-13 2014-09-12 Modulatori faktora b komplementa
RSP20191160 RS59252B1 (sr) 2013-09-13 2014-09-12 Modulatori faktora b komplementa
US15/021,651 US20160222389A1 (en) 2013-09-13 2014-09-12 Modulators of complement factor b
CA2921842A CA2921842A1 (en) 2013-09-13 2014-09-12 Modulators of complement factor b
MA38959A MA38959A1 (fr) 2013-09-13 2014-09-12 Modulateurs du facteur b du complément
JP2016542824A JP6666250B2 (ja) 2013-09-13 2014-09-12 補体b因子の調節薬
RU2016113763A RU2662967C2 (ru) 2013-09-13 2014-09-12 Модуляторы фактора в комплемента
LTEP14844168.6T LT3043827T (lt) 2013-09-13 2014-09-12 Komplemento faktoriaus b moduliatoriai
AU2014318580A AU2014318580B2 (en) 2013-09-13 2014-09-12 Modulators of Complement Factor B
SG11201601445XA SG11201601445XA (en) 2013-09-13 2014-09-12 Modulators of complement factor b
MX2016003263A MX371518B (es) 2013-09-13 2014-09-12 Moduladores del factor del complemento b.
DK14844168.6T DK3043827T3 (da) 2013-09-13 2014-09-12 Modulatorer af komplement faktor b
ES14844168T ES2745758T3 (es) 2013-09-13 2014-09-12 Moduladores del factor B del complemento
PL14844168T PL3043827T3 (pl) 2013-09-13 2014-09-12 Modulatory czynnika b dopełniacza
CN201480056788.6A CN105744959B (zh) 2013-09-13 2014-09-12 补体因子b的调节剂
EA201690582A EA035433B1 (ru) 2013-09-13 2014-09-12 Модуляторы фактора в комплемента
SI201431272T SI3043827T1 (sl) 2013-09-13 2014-09-12 Modulatorji komplementnega faktorja B
UAA201603969A UA119046C2 (uk) 2013-09-13 2014-12-09 Модулятор фактора в комплемента
IL244095A IL244095A0 (en) 2013-09-13 2016-02-09 Modulators of complement factor b
ZA2016/01236A ZA201601236B (en) 2013-09-13 2016-02-22 Modulators of complement factor b
PH12016500443A PH12016500443A1 (en) 2013-09-13 2016-03-08 Modulators of complement factor b
DO2016000063A DOP2016000063A (es) 2013-09-13 2016-03-11 Moduladores del factor del complemento b
CR20160170A CR20160170A (es) 2013-09-13 2016-04-12 Moduladores del factor del complemento b
US15/912,386 US20190048351A1 (en) 2013-09-13 2018-03-05 Modulators of complement factor b
US16/439,317 US20200149047A1 (en) 2013-09-13 2019-06-12 Modulators of complement factor b
AU2020201763A AU2020201763A1 (en) 2013-09-13 2020-03-11 Modulators of Complement Factor B
US17/465,035 US11926830B2 (en) 2013-09-13 2021-09-02 Modulators of Complement Factor B

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361877624P 2013-09-13 2013-09-13
US61/877,624 2013-09-13

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/021,651 A-371-Of-International US20160222389A1 (en) 2013-09-13 2014-09-12 Modulators of complement factor b
US15/912,386 Continuation US20190048351A1 (en) 2013-09-13 2018-03-05 Modulators of complement factor b

Publications (2)

Publication Number Publication Date
WO2015038939A2 true WO2015038939A2 (en) 2015-03-19
WO2015038939A3 WO2015038939A3 (en) 2015-07-02

Family

ID=52666522

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/055458 Ceased WO2015038939A2 (en) 2013-09-13 2014-09-12 Modulators of complement factor b

Country Status (32)

Country Link
US (5) US20160222389A1 (https=)
EP (2) EP3043827B1 (https=)
JP (3) JP6666250B2 (https=)
KR (1) KR102381790B1 (https=)
CN (2) CN105744959B (https=)
AU (2) AU2014318580B2 (https=)
BR (1) BR112016004671B1 (https=)
CA (1) CA2921842A1 (https=)
CL (2) CL2016000606A1 (https=)
CR (1) CR20160170A (https=)
DK (1) DK3043827T3 (https=)
DO (1) DOP2016000063A (https=)
EA (1) EA035433B1 (https=)
ES (1) ES2745758T3 (https=)
HR (1) HRP20191600T1 (https=)
HU (1) HUE045109T2 (https=)
IL (1) IL244095A0 (https=)
LT (1) LT3043827T (https=)
MA (1) MA38959A1 (https=)
MX (2) MX371518B (https=)
MY (1) MY181251A (https=)
PE (2) PE20160500A1 (https=)
PH (1) PH12016500443A1 (https=)
PL (1) PL3043827T3 (https=)
PT (1) PT3043827T (https=)
RS (1) RS59252B1 (https=)
RU (1) RU2662967C2 (https=)
SG (2) SG11201601445XA (https=)
SI (1) SI3043827T1 (https=)
UA (1) UA119046C2 (https=)
WO (1) WO2015038939A2 (https=)
ZA (1) ZA201601236B (https=)

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2673361B1 (en) 2011-02-08 2016-04-13 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
KR20160147892A (ko) * 2014-05-01 2016-12-23 아이오니스 파마수티컬즈, 인코포레이티드 보체 인자 b 발현을 조절하기 위한 조성물 및 방법
JP2017500031A (ja) * 2013-12-12 2017-01-05 アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. 補体成分iRNA組成物及びその使用方法
EP2410054B1 (en) 2006-10-18 2017-01-25 Ionis Pharmaceuticals, Inc. Antisense compounds
WO2017135397A1 (ja) * 2016-02-05 2017-08-10 協和発酵キリン株式会社 補体b因子の発現を抑制するアンチセンスオリゴヌクレオチド
WO2018005552A1 (en) 2016-06-27 2018-01-04 Achillion Pharmaceuticals, Inc. Quinazoline and indole compounds to treat medical disorders
WO2019027015A1 (ja) * 2017-08-02 2019-02-07 協和発酵キリン株式会社 核酸複合体
WO2020109343A1 (en) 2018-11-29 2020-06-04 F. Hoffmann-La Roche Ag Combination therapy for treatment of macular degeneration
WO2021222549A1 (en) * 2020-04-30 2021-11-04 Alnylam Pharmaceuticals, Inc. Complement factor b (cfb) irna compositions and methods of use thereof
WO2022028527A1 (zh) 2020-08-07 2022-02-10 上海美悦生物科技发展有限公司 补体因子b抑制剂及其药物组合物、制备方法和用途
WO2022028507A1 (zh) 2020-08-07 2022-02-10 上海美悦生物科技发展有限公司 一种杂环类化合物、其制备方法及用途
WO2023018523A2 (en) 2021-07-17 2023-02-16 Sirnaomics, Inc. Products and compositions
WO2023031359A1 (en) 2021-09-02 2023-03-09 Silence Therapeutics Gmbh Nucleic acids for inhibiting expression of complement factor b (cfb) in a cell
WO2023076451A1 (en) * 2021-10-29 2023-05-04 Alnylam Pharmaceuticals, Inc. Complement factor b (cfb) irna compositions and methods of use thereof
WO2023143293A1 (zh) 2022-01-26 2023-08-03 上海美悦生物科技发展有限公司 补体因子b抑制剂的盐型、晶型及其制备方法和应用
US11866701B2 (en) 2017-11-01 2024-01-09 Alnylam Pharmaceuticals, Inc. Complement component C3 iRNA compositions and methods of use thereof
WO2024051849A1 (en) 2022-09-10 2024-03-14 Jiangsu Hansoh Pharmaceutical Group Co., Ltd. 2-substituted piperidine derivatives, preparation methods and medicinal uses thereof
WO2024222852A1 (zh) 2023-04-27 2024-10-31 上海翰森生物医药科技有限公司 一种哌啶基吲哚化合物的盐及其制备方法
WO2025002299A1 (en) * 2023-06-28 2025-01-02 Shanghai Argo Biopharmaceutical Co., Ltd. Compositions and methods for inhibiting expression of complement factor b (cfb)
US12258565B2 (en) 2019-10-22 2025-03-25 Alnylam Pharmaceuticals, Inc. Complement component C3 iRNA compositions and methods of use thereof
US12595477B2 (en) 2021-11-24 2026-04-07 Adarx Pharmaceuticals, Inc. Complement Factor B-modulating compositions and methods of use thereof

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PT2161038E (pt) 2006-01-26 2014-03-10 Isis Pharmaceuticals Inc Composições e suas utilizações dirigidas à huntingtina
EP3626823A1 (en) 2009-09-11 2020-03-25 Ionis Pharmaceuticals, Inc. Modulation of huntingtin expression
DK2991656T3 (da) 2013-05-01 2020-03-23 Ionis Pharmaceuticals Inc Sammensætninger og fremgangsmåder til modulering af apolipoprotein c-iii-ekspression
DK3043827T3 (da) * 2013-09-13 2019-08-26 Ionis Pharmaceuticals Inc Modulatorer af komplement faktor b
EP4035659A1 (en) 2016-11-29 2022-08-03 PureTech LYT, Inc. Exosomes for delivery of therapeutic agents
TW201827596A (zh) * 2016-12-23 2018-08-01 日商協和醱酵麒麟有限公司 抑制補體b因子之表現之核酸
WO2023129496A2 (en) * 2021-12-27 2023-07-06 Apellis Pharmaceuticals, Inc. Rnas for complement inhibition
AU2023372971A1 (en) * 2022-11-02 2025-05-15 Ionis Pharmaceuticals, Inc. Methods for modulating complement factor b expression
TW202513799A (zh) * 2023-06-02 2025-04-01 大陸商維亞臻生物技術(蘇州)有限公司 用於免疫類疾病的雙鏈核苷酸化合物及其用途
CN118620964A (zh) * 2023-06-28 2024-09-10 百奥赛图(北京)医药科技股份有限公司 一种cfb基因修饰的非人动物
WO2025122669A1 (en) * 2023-12-05 2025-06-12 Regeneron Pharmaceuticals, Inc. Non-human animals having a humanized complement factor b gene

Citations (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4981957A (en) 1984-07-19 1991-01-01 Centre National De La Recherche Scientifique Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US5319080A (en) 1991-10-17 1994-06-07 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5446137A (en) 1993-12-09 1995-08-29 Syntex (U.S.A.) Inc. Oligonucleotides containing 4'-substituted nucleotides
US5466786A (en) 1989-10-24 1995-11-14 Gilead Sciences 2'modified nucleoside and nucleotide compounds
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5567811A (en) 1990-05-03 1996-10-22 Amersham International Plc Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
US5576427A (en) 1993-03-30 1996-11-19 Sterling Winthrop, Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5610300A (en) 1992-07-01 1997-03-11 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5639873A (en) 1992-02-05 1997-06-17 Centre National De La Recherche Scientifique (Cnrs) Oligothionucleotides
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
WO2000063364A2 (en) 1999-04-21 2000-10-26 American Home Products Corporation Methods and compositions for inhibiting the function of polynucleotide sequences
WO2001049687A2 (en) 1999-12-30 2001-07-12 K. U. Leuven Research & Development Cyclohexene nucleic acids
US6600032B1 (en) 1998-08-07 2003-07-29 Isis Pharmaceuticals, Inc. 2′-O-aminoethyloxyethyl-modified oligonucleotides
US6673661B1 (en) 2002-12-20 2004-01-06 Taiwan Semiconductor Manufacturing Co., Ltd. Self-aligned method for forming dual gate thin film transistor (TFT) device
WO2004103288A2 (en) 2003-05-13 2004-12-02 New York Society For The Ruptured And Crippled Maintaining The Hospital For Special Surgery Method of preventing recurrent miscarriages
WO2005121371A2 (en) 2004-06-03 2005-12-22 Isis Pharmaceuticals, Inc. Double strand compositions comprising differentially modified strands for use in gene modulation
WO2006047842A2 (en) 2004-11-08 2006-05-11 K.U. Leuven Research And Development Modified nucleosides for rna interference

Family Cites Families (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5506337A (en) 1985-03-15 1996-04-09 Antivirals Inc. Morpholino-subunit combinatorial library and method
EP0673559A1 (en) 1992-12-14 1995-09-27 Honeywell Inc. Motor system with individually controlled redundant windings
JP3756313B2 (ja) 1997-03-07 2006-03-15 武 今西 新規ビシクロヌクレオシド及びオリゴヌクレオチド類縁体
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
AU9063398A (en) 1997-09-12 1999-04-05 Exiqon A/S Oligonucleotide analogues
WO2000021559A2 (en) * 1998-10-09 2000-04-20 Musc Foundation For Research Development Blocking factor b to treat complement-mediated immune disease
EP1178999B1 (en) 1999-05-04 2007-03-14 Santaris Pharma A/S L-ribo-lna analogues
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
JP2005504020A (ja) 2001-07-03 2005-02-10 アイシス・ファーマシューティカルス・インコーポレーテッド ヌクレアーゼ耐性キメラオリゴヌクレオチド
US6964950B2 (en) * 2001-07-25 2005-11-15 Isis Pharmaceuticals, Inc. Antisense modulation of C-reactive protein expression
JP4634799B2 (ja) * 2002-09-13 2011-02-16 ライフ テクノロジーズ コーポレーション 耐熱性逆転写酵素およびその使用法
CA2504694C (en) 2002-11-05 2013-10-01 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US8604183B2 (en) 2002-11-05 2013-12-10 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2′-modified nucleosides for use in gene modulation
EP2305812A3 (en) 2002-11-14 2012-06-06 Dharmacon, Inc. Fuctional and hyperfunctional sirna
EP1661905B9 (en) 2003-08-28 2012-12-19 IMANISHI, Takeshi Novel artificial nucleic acids of n-o bond crosslinkage type
WO2005027962A1 (en) 2003-09-18 2005-03-31 Isis Pharmaceuticals, Inc. 4’-thionucleosides and oligomeric compounds
US7959919B2 (en) * 2003-11-19 2011-06-14 Novelmed Therapeutics, Inc. Method of inhibiting factor B-mediated complement activation
ES2432112T3 (es) * 2004-02-10 2013-11-29 The Regents Of The University Of Colorado, A Body Corporate Inhibición del factor B, de la vía alternativa del complemento y métodos relacionados
EP1752536A4 (en) * 2004-05-11 2008-04-16 Alphagen Co Ltd POLYNUCLEOTIDE CAUSING RNA INTERFERENCE AND METHOD OF REGULATING GENE EXPRESSION WITH THE USE OF THE SAME
EP2397563A3 (en) 2004-09-17 2012-07-18 Isis Pharmaceuticals, Inc. Enhanced antisense oligonucleotides
GB0521716D0 (en) * 2005-10-25 2005-11-30 Genomica Sau Modulation of 11beta-hydroxysteriod dehydrogenase 1 expression for the treatment of ocular diseases
JP5342881B2 (ja) 2006-01-27 2013-11-13 アイシス ファーマシューティカルズ, インコーポレーテッド 6−修飾された二環式核酸類似体
AU2007249349B2 (en) 2006-05-11 2012-03-08 Isis Pharmaceuticals, Inc. 5'-Modified bicyclic nucleic acid analogs
WO2008036841A2 (en) * 2006-09-22 2008-03-27 Dharmacon, Inc. Tripartite oligonucleotide complexes and methods for gene silencing by rna interference
CN101589143A (zh) * 2006-11-27 2009-11-25 Isis药物公司 用于治疗高胆固醇血症的方法
US20100190837A1 (en) 2007-02-15 2010-07-29 Isis Pharmaceuticals, Inc. 5'-Substituted-2-F' Modified Nucleosides and Oligomeric Compounds Prepared Therefrom
CA2678774A1 (en) * 2007-03-01 2008-09-04 Advanced Vision Therapies, Inc. Treatment of diseases characterized by inflammation
EP2170917B1 (en) 2007-05-30 2012-06-27 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
EP2173760B2 (en) 2007-06-08 2015-11-04 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
CA2692579C (en) 2007-07-05 2016-05-03 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
PL2320925T3 (pl) * 2008-07-10 2016-06-30 Regenesance B V Antagoniści dopełniacza i ich zastosowania
US8604192B2 (en) 2008-09-24 2013-12-10 Isis Pharmaceuticals, Inc. Cyclohexenyl nucleic acids analogs
KR101869570B1 (ko) 2010-04-28 2018-06-20 아이오니스 파마수티컬즈, 인코포레이티드 변형된 뉴클레오사이드 및 그로부터 제조된 올리고머 화합물
WO2012012467A2 (en) * 2010-07-19 2012-01-26 Isis Pharmaceuticals, Inc. Modulation of nuclear-retained rna
WO2012142458A1 (en) * 2011-04-13 2012-10-18 Isis Pharmaceuticals, Inc. Antisense modulation of ptp1b expression
DK3043827T3 (da) 2013-09-13 2019-08-26 Ionis Pharmaceuticals Inc Modulatorer af komplement faktor b
SG11201608502TA (en) * 2014-05-01 2016-11-29 Ionis Pharmaceuticals Inc Compositions and methods for modulating complement factor b expression

Patent Citations (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US4981957A (en) 1984-07-19 1991-01-01 Centre National De La Recherche Scientifique Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5466786B1 (en) 1989-10-24 1998-04-07 Gilead Sciences 2' Modified nucleoside and nucleotide compounds
US5466786A (en) 1989-10-24 1995-11-14 Gilead Sciences 2'modified nucleoside and nucleotide compounds
US5792847A (en) 1989-10-24 1998-08-11 Gilead Sciences, Inc. 2' Modified Oligonucleotides
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5567811A (en) 1990-05-03 1996-10-22 Amersham International Plc Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5319080A (en) 1991-10-17 1994-06-07 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5393878A (en) 1991-10-17 1995-02-28 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5639873A (en) 1992-02-05 1997-06-17 Centre National De La Recherche Scientifique (Cnrs) Oligothionucleotides
US5610300A (en) 1992-07-01 1997-03-11 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5700920A (en) 1992-07-01 1997-12-23 Novartis Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5576427A (en) 1993-03-30 1996-11-19 Sterling Winthrop, Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5446137A (en) 1993-12-09 1995-08-29 Syntex (U.S.A.) Inc. Oligonucleotides containing 4'-substituted nucleotides
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US6600032B1 (en) 1998-08-07 2003-07-29 Isis Pharmaceuticals, Inc. 2′-O-aminoethyloxyethyl-modified oligonucleotides
WO2000063364A2 (en) 1999-04-21 2000-10-26 American Home Products Corporation Methods and compositions for inhibiting the function of polynucleotide sequences
WO2001049687A2 (en) 1999-12-30 2001-07-12 K. U. Leuven Research & Development Cyclohexene nucleic acids
US6673661B1 (en) 2002-12-20 2004-01-06 Taiwan Semiconductor Manufacturing Co., Ltd. Self-aligned method for forming dual gate thin film transistor (TFT) device
WO2004103288A2 (en) 2003-05-13 2004-12-02 New York Society For The Ruptured And Crippled Maintaining The Hospital For Special Surgery Method of preventing recurrent miscarriages
WO2005121371A2 (en) 2004-06-03 2005-12-22 Isis Pharmaceuticals, Inc. Double strand compositions comprising differentially modified strands for use in gene modulation
WO2006047842A2 (en) 2004-11-08 2006-05-11 K.U. Leuven Research And Development Modified nucleosides for rna interference

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
"Antisense Research and Applications", 1993, CRC PRESS, pages: 276 - 278
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
AM. CHEM., vol. 122, 2000, pages 8595 - 8602
CHOI, J. ET AL., OPHTHALMIC EPIDEMIOL., vol. 18, no. 6, 2011, pages 259 - 263
CRUZ; SMITH, GENEREVIEWS, 20 July 2007 (2007-07-20)
LEUMANN, BIOORG. MED. CHEM., vol. 10, 2002, pages 841 - 854
LOYET ET AL., INVEST OPHTHALMOL VIS SCI., vol. 53, no. 10, 2012, pages 6628 - 6637
NITSCH, D. ET AL., OPHTHALMIC EPIDEMIOL., vol. 16, no. 3, 2009, pages 181 - 186
PENNESI ME ET AL., MOL APECTS MED, vol. 33, 2012, pages 487 - 509
PICKERING ET AL., NAT GENET, vol. 31, no. 4, 2002, pages 424 - 428
SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 - 489
ZHANG; MADDEN, GENOME RES., vol. 7, 1997, pages 649 - 656

Cited By (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2410054B2 (en) 2006-10-18 2019-12-11 Ionis Pharmaceuticals, Inc. Antisense compounds
EP2410054B1 (en) 2006-10-18 2017-01-25 Ionis Pharmaceuticals, Inc. Antisense compounds
EP2673361B1 (en) 2011-02-08 2016-04-13 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
KR20210158880A (ko) * 2013-12-12 2021-12-31 알닐람 파마슈티칼스 인코포레이티드 보체 성분 iRNA 조성물 및 이의 이용 방법
JP2017500031A (ja) * 2013-12-12 2017-01-05 アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. 補体成分iRNA組成物及びその使用方法
EP3080270B1 (en) * 2013-12-12 2021-10-27 Alnylam Pharmaceuticals, Inc. Complement component irna compositions and methods of use thereof
US11186842B2 (en) 2013-12-12 2021-11-30 Alnylam Pharmaceuticals, Inc. Complement component iRNA compositions and methods of use thereof
EP3608406A1 (en) * 2014-05-01 2020-02-12 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating complement factor b expression
KR20160147892A (ko) * 2014-05-01 2016-12-23 아이오니스 파마수티컬즈, 인코포레이티드 보체 인자 b 발현을 조절하기 위한 조성물 및 방법
US10280423B2 (en) 2014-05-01 2019-05-07 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating complement factor B expression
US11732265B2 (en) 2014-05-01 2023-08-22 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating complement factor B expression
EP3137596A4 (en) * 2014-05-01 2017-09-20 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating complement factor b expression
EP4219718A3 (en) * 2014-05-01 2024-01-10 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating complement factor b expression
WO2017135397A1 (ja) * 2016-02-05 2017-08-10 協和発酵キリン株式会社 補体b因子の発現を抑制するアンチセンスオリゴヌクレオチド
WO2018005552A1 (en) 2016-06-27 2018-01-04 Achillion Pharmaceuticals, Inc. Quinazoline and indole compounds to treat medical disorders
US10961252B2 (en) 2016-06-27 2021-03-30 Achillion Pharmaceuticals, Inc. Quinazoline and indole compounds to treat medical disorders
EP3939591A1 (en) 2016-06-27 2022-01-19 Achillion Pharmaceuticals, Inc. Quinazoline and indole compounds to treat medical disorders
US11248000B2 (en) 2016-06-27 2022-02-15 Achillion Pharmaceuticals, Inc. Quinazoline and indole compounds to treat medical disorders
WO2019027015A1 (ja) * 2017-08-02 2019-02-07 協和発酵キリン株式会社 核酸複合体
US11866701B2 (en) 2017-11-01 2024-01-09 Alnylam Pharmaceuticals, Inc. Complement component C3 iRNA compositions and methods of use thereof
WO2020109343A1 (en) 2018-11-29 2020-06-04 F. Hoffmann-La Roche Ag Combination therapy for treatment of macular degeneration
US12365896B2 (en) 2019-10-22 2025-07-22 Alnylam Pharmaceuticals, Inc. Complement component C3 iRNA compositions and methods of use thereof
US12258565B2 (en) 2019-10-22 2025-03-25 Alnylam Pharmaceuticals, Inc. Complement component C3 iRNA compositions and methods of use thereof
WO2021222549A1 (en) * 2020-04-30 2021-11-04 Alnylam Pharmaceuticals, Inc. Complement factor b (cfb) irna compositions and methods of use thereof
WO2022028527A1 (zh) 2020-08-07 2022-02-10 上海美悦生物科技发展有限公司 补体因子b抑制剂及其药物组合物、制备方法和用途
EP4282486A2 (en) 2020-08-07 2023-11-29 Shanghai Meiyue Biotech Development Co., Ltd. Complement factor b inhibitor, and pharmaceutical composition thereof, preparation method therefor and use thereof
WO2022028507A1 (zh) 2020-08-07 2022-02-10 上海美悦生物科技发展有限公司 一种杂环类化合物、其制备方法及用途
WO2023018523A2 (en) 2021-07-17 2023-02-16 Sirnaomics, Inc. Products and compositions
WO2023018523A3 (en) * 2021-07-17 2023-08-24 Sirnaomics, Inc. Products and compositions
US12600967B2 (en) 2021-07-17 2026-04-14 Sirnaomics, Inc. SiRNA compound that inhibits complement factor B (CFB)
WO2023031359A1 (en) 2021-09-02 2023-03-09 Silence Therapeutics Gmbh Nucleic acids for inhibiting expression of complement factor b (cfb) in a cell
WO2023076451A1 (en) * 2021-10-29 2023-05-04 Alnylam Pharmaceuticals, Inc. Complement factor b (cfb) irna compositions and methods of use thereof
US11965166B2 (en) 2021-10-29 2024-04-23 Alnylam Pharmaceuticals, Inc. Complement factor B (CFB) iRNA compositions and methods of use thereof
US12595477B2 (en) 2021-11-24 2026-04-07 Adarx Pharmaceuticals, Inc. Complement Factor B-modulating compositions and methods of use thereof
WO2023143293A1 (zh) 2022-01-26 2023-08-03 上海美悦生物科技发展有限公司 补体因子b抑制剂的盐型、晶型及其制备方法和应用
WO2024051849A1 (en) 2022-09-10 2024-03-14 Jiangsu Hansoh Pharmaceutical Group Co., Ltd. 2-substituted piperidine derivatives, preparation methods and medicinal uses thereof
WO2024222852A1 (zh) 2023-04-27 2024-10-31 上海翰森生物医药科技有限公司 一种哌啶基吲哚化合物的盐及其制备方法
WO2025002299A1 (en) * 2023-06-28 2025-01-02 Shanghai Argo Biopharmaceutical Co., Ltd. Compositions and methods for inhibiting expression of complement factor b (cfb)

Also Published As

Publication number Publication date
MX2020001258A (es) 2020-03-20
PL3043827T3 (pl) 2020-03-31
ES2745758T3 (es) 2020-03-03
SG10201806787VA (en) 2018-09-27
JP7297112B2 (ja) 2023-06-23
CL2016000606A1 (es) 2017-02-17
PE20190354A1 (es) 2019-03-07
JP2022058784A (ja) 2022-04-12
PE20160500A1 (es) 2016-05-21
EA035433B1 (ru) 2020-06-15
HK1225638A1 (en) 2017-09-15
DOP2016000063A (es) 2016-06-01
ZA201601236B (en) 2017-05-31
US20200149047A1 (en) 2020-05-14
EP3043827A2 (en) 2016-07-20
JP6666250B2 (ja) 2020-03-13
JP2020036600A (ja) 2020-03-12
SG11201601445XA (en) 2016-03-30
EP3043827A4 (en) 2017-05-24
CL2018002334A1 (es) 2018-12-14
IL244095A0 (en) 2016-04-21
CN105744959A (zh) 2016-07-06
US20160222389A1 (en) 2016-08-04
CA2921842A1 (en) 2015-03-19
AU2020201763A1 (en) 2020-04-02
HRP20191600T1 (hr) 2019-11-29
PH12016500443A1 (en) 2016-05-16
RU2662967C2 (ru) 2018-07-31
CR20160170A (es) 2016-07-15
EP3043827B1 (en) 2019-07-03
EA201690582A1 (ru) 2016-07-29
AU2014318580A1 (en) 2016-03-03
US20240247268A1 (en) 2024-07-25
HUE045109T2 (hu) 2019-12-30
CN112359042A (zh) 2021-02-12
RU2016113763A (ru) 2017-10-16
MX2016003263A (es) 2016-12-08
US11926830B2 (en) 2024-03-12
JP7158363B2 (ja) 2022-10-21
US20190048351A1 (en) 2019-02-14
AU2014318580B2 (en) 2019-12-12
DK3043827T3 (da) 2019-08-26
MY181251A (en) 2020-12-21
EP3603677A1 (en) 2020-02-05
RS59252B1 (sr) 2019-10-31
UA119046C2 (uk) 2019-04-25
CN105744959B (zh) 2020-12-01
KR102381790B1 (ko) 2022-03-31
JP2016533765A (ja) 2016-11-04
MX371518B (es) 2020-01-31
LT3043827T (lt) 2019-08-12
SI3043827T1 (sl) 2019-08-30
US20220243209A1 (en) 2022-08-04
BR112016004671B1 (pt) 2020-12-29
MA38959A1 (fr) 2017-08-31
WO2015038939A3 (en) 2015-07-02
PT3043827T (pt) 2019-09-26
KR20160054595A (ko) 2016-05-16

Similar Documents

Publication Publication Date Title
US11926830B2 (en) Modulators of Complement Factor B
AU2014312196B2 (en) Modulation of prekallikrein (PKK) expression
AU2014284398B2 (en) Modulators of growth hormone receptor
EP3277817A1 (en) Compounds and methods for modulating tmprss6 expression
WO2014004572A2 (en) Modulation of ube3a-ats expression
WO2013142514A1 (en) Methods and compositions for modulating alpha-1-antitrypsin expression
EP3261643A1 (en) Allele specific modulators of p23h rhodopsin
WO2014059364A1 (en) Methods of treating kennedy's disease
WO2013130868A1 (en) Methods for modulating fibrinogen expression
HK40022442A (en) Modulators of complement factor b
HK1225638B (en) Modulators of complement factor b
WO2015054579A1 (en) Treatment of acute kidney injury with phd1 modulators

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 244095

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2921842

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: DZP2016000091

Country of ref document: DZ

ENP Entry into the national phase

Ref document number: 2014318580

Country of ref document: AU

Date of ref document: 20140912

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2016542824

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2016/003263

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 000376-2016

Country of ref document: PE

WWE Wipo information: entry into national phase

Ref document number: NC2018/0012440

Country of ref document: CO

Ref document number: 16086923

Country of ref document: CO

WWE Wipo information: entry into national phase

Ref document number: 201690582

Country of ref document: EA

Ref document number: 38959

Country of ref document: MA

ENP Entry into the national phase

Ref document number: 20167009610

Country of ref document: KR

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2014844168

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: A201603969

Country of ref document: UA

Ref document number: 2014844168

Country of ref document: EP

Ref document number: CR2016-000170

Country of ref document: CR

ENP Entry into the national phase

Ref document number: 2016113763

Country of ref document: RU

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: IDP00201602458

Country of ref document: ID

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112016004671

Country of ref document: BR

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14844168

Country of ref document: EP

Kind code of ref document: A2

WWP Wipo information: published in national office

Ref document number: NC2018/0012440

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 112016004671

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20160302

WWG Wipo information: grant in national office

Ref document number: NC2018/0012440

Country of ref document: CO