WO2014191205A1 - Hefestamm und verfahren zur produktion von lycopin - Google Patents

Hefestamm und verfahren zur produktion von lycopin Download PDF

Info

Publication number
WO2014191205A1
WO2014191205A1 PCT/EP2014/059846 EP2014059846W WO2014191205A1 WO 2014191205 A1 WO2014191205 A1 WO 2014191205A1 EP 2014059846 W EP2014059846 W EP 2014059846W WO 2014191205 A1 WO2014191205 A1 WO 2014191205A1
Authority
WO
WIPO (PCT)
Prior art keywords
genes
yeast strain
lycopene
strain
strain according
Prior art date
Application number
PCT/EP2014/059846
Other languages
English (en)
French (fr)
Inventor
Thomas Schlösser
Gerold Barth
Michael Gatter
Markus KETELHOT
Falk MATTHÄUS
Original Assignee
Wacker Chemie Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wacker Chemie Ag filed Critical Wacker Chemie Ag
Publication of WO2014191205A1 publication Critical patent/WO2014191205A1/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)

Definitions

  • the invention relates to a yeast starar of the species Yarrowla lipolytica and a process for the production of lycopene with this strain.
  • the interest in biotechnologically produced carotenoids as a food additive or as an active ingredient in the pharmaceutical or cosmetic industry is steadily increasing.
  • Carotenoids have complex chemical structures that are difficult to synthesize synthetically. The isolation of plant material is complicated and time consuming.
  • Lycopene represents a key carotenoid in carotenoid biosynthesis. Starting from lycopene different carotenoids can be formed. It is found in natural form in plants, algae and other photosynthetic organisms. Lycopene has a high quenching rate for singlet oxygen. This is said to have lycopene preventive properties against cancer. Furthermore, lycopene has anti-fungal properties against the human pathogenic yeast Candida al ⁇ bicans. For this reason, the microbiological production of lycopene is particularly challenging.
  • Saccharomyces cerevisiae Verwaal, R., J. Wang, et al.
  • Pichia pastoris (Bhataya, A., C. Schmidt-Dannert, et al.
  • Yarrowia lipolytica (Y. lipolytica) can be made to produce lycopene (Ye, R.W., P.L. Sharpe, et al. (2012), Methods Mol Biol 898: 153-
  • Y. lipolytica does not naturally produce carotenoids. However, it forms geranylgeranyl pyrophosphate, an important intermediate in lycopene biosynthesis.
  • US201110021843A1 discloses that a Y. lipolytica strain with the genes for ATP citrate lyase, AMP deaminase and cytosolic malate dehydrogenase was able to accumulate larger amounts of fats.
  • HMG1 encoding a HMG-CoA reductase
  • GGS1 encoded by a geranyl-geranyl synthase
  • crtB encodes a phytoene synthase
  • crtl encodes a Phytoendesaturase
  • WO 2010/004141 discloses that by a deletion of the gene GUT2 in combination with the deletions of the genes POX1, POX2, POX3, POX4, POX5 and POX6 are formed enlarged fat bodies, which can be used for the production of lipids. Based on this, WO 2012 / 001144A1 discloses that an additional overexpression of the gene GPD1 in Y. lipolytica leads to further enlarged fat bodies.
  • the object of the present invention is to provide a yeast strain of the species Y. lipolytica which is suitable for the microbial production of lycopene, in amounts greater than hitherto known.
  • the object is achieved by a yeast strain of the species Y. lipolytica which is characterized in that it contains a phytoene synthase and a phytoene desaturase, has a reduction in the activity of the proteins Poxlp, Pox2p, Pox3p, Pox4p, Pox5p ⁇ and Gut2p, and an increased activity the proteins Ggslp and Hmglp has.
  • the phytoene synthase is preferably a phytoene synthase from bacteria, more preferably Pantoea ananatis (P.ananatis). Most preferably, the phytoene synthase is the protein crtBp (NCBI Reference Sequence: YP_003522457.1).
  • the phytoene desaturase is preferably a bacterial phytoene desaturase, more preferably P.
  • the phytoene desaturase is the protein crtlp (UniProtKB / Swiss-Prot:
  • an increased activity of the proteins Ggslp and Hmglp is preferably meant that the activity per cell is increased, which can be achieved by increasing the amount of protein or by increasing the protein's own activity.
  • the increase in the amount of protein is characterized in that more protein is formed than in an unchanged strain under the same conditions.
  • the increase in proteinic activity is characterized by the fact that the same amount of protein in an altered strain has a higher activity than the unaltered strain.
  • reducing the activity of a protein is preferably meant that the activity of the protein per cell is reduced. Particularly preferred is understood to mean the lack of activity of the protein.
  • An increased activity of the proteins can be produced in various ways:
  • promoter of the relevant gene by exchanging the natural promoter of the relevant gene with a stronger than the natural promoter, preferably a promoter having at least 50% of the activity of the promoter of the TiJF1 gene (translation elongation factor 1 alpha genolevures: YALI0C09141g), most preferably the activity of the TEF1 promoter.
  • Promoters can be selected which are either active during the entire cultivation or are active only in a desired growth phase (gene regulation effect).
  • the additional introduction of the relevant gene under the control of a strong promoter is particularly preferred, in particular preferably under the control of the TEF1 promoter from Yarrowia lipolytica.
  • the proteins Poxlp, Pox2p, Pox3p, Pox4p, Pox5p ⁇ and Gut2p are preferably replaced by the genes POX1, POX2, P0X3, POX4, POX5 and POX6 (Genolevures.- YALI0E32835g, YALI0F10857g,
  • the protein Ggslp is preferably encoded by the gene GGS1 (Genolevures: YALI0D17050p).
  • the protein Hmglp is preferably encoded by the gene HMG1 (Genolevures: YALI0D17050p).
  • the inhibition or reduction of the expression can be effected, for example, by inhibiting or reducing the transcription of the coding gene or the translation of the mRNA formed.
  • the deletion of the coding genes can be carried out, for example, by an expansion of the genes by means of deletion cassettes.
  • the expression of a dysfunctional or activity-reduced gene product can be accomplished, for example, by insertion, substitution or point mutation in the coding gene.
  • deletion of a coding gene is preferred.
  • the strain according to the invention thus preferably carries the genes crtB, crtl, GGS1 and HMG1 whose gene products have increased activity in their gene products and has a deletion of the genes P0X1, POX2, POX3 r POX4, POX5, P0X6 and GUT2.
  • the deletion of the genes POX1, POX2, POX3, POX4, POX5 and P0X6 inhibits the beta-oxidation, thus preventing the degradation of the intracellular fat reserves and thus in turn leads to enlarged fat bodies.
  • YALI0E27654g encoded proteins in modified Y. lipolytica- which are already described in the prior art.
  • a yeast-type isolate Y. lipolytica can be used, preferably strain H222.
  • the strain H222 was deposited on April 29, 2013 with the DSMZ (German Collection for Microorganisms and Cell Cultures GmbH, Inhoffen No 7B, D-38124 Braunschweig) under the number DSM 27185 in accordance with the Budapest Treaty.
  • DSMZ German Collection for Microorganisms and Cell Cultures GmbH, Inhoffen No 7B, D-38124 Braunschweig
  • DSM 27185 in accordance with the Budapest Treaty.
  • a selection marker is necessary. This selection marker may be e.g. in the form of uracil auxotrophy in a manner known per se be introduced into the strain.
  • genes are preferably introduced by conventional methods known in the art.
  • crtB and crtl genes whose codon usage is linked to the program GeneOptimizer 15 (http://dede.initrogen.com/site/en/en/home/Products-and- Services / Applications / Cloning / genes - synthesis / GeneArt genes
  • the crtB gene has the sequence SEQ ID NO: 34.
  • the crtl gene has the sequence SEQ ID NO: 35.
  • the organism functioning promoters to associate with the open reading frame of the genes.
  • constitutive promoters and cultivating conditions-dependent promoters of the yeast Y. lipolytica can be used.
  • constitutive promoters are used.
  • the promoter of the translation elongation factor 1 alpha (pTEF1) is particularly preferably used.
  • the open reading frame of the genes with a terminator.
  • the terminator of the isocitrate lyase (ICLlt) gene is used.
  • the invention further relates to a process for the preparation of lycopene, which is characterized in that a microorganism according to the invention is fermented in a manner known per se in a fermenter.
  • the deletion of the GUT2 gene leads not only to the enlargement of the fat bodies by the reduced outflow of G3P in the glycolysis, but also to a reduced utilization of glycerol.
  • glycerol as the sole carbon source, the formation of glucose via gluconeogenesis is essential.
  • the gene product of the GUT2 gene is an important enzyme because it catalyzes the conversion of G3P to DHAP, which then enters into gluconeogenesis.
  • the deletion of the GUT2 gene when cultivated in glycerol-containing medium, leads to limited growth and increased specific lycopene formation. Accordingly, the deletion of the GUT2 gene is critically responsible for the formation and accumulation of lycopene in two respects.
  • limitation Another form of limitation is nitrogen limitation. This limitation leads to a growth stop in the yeast Y. lipolytica after exhaustion of the nitrogen source and to the formation of citric acid and iso-citric acid.
  • the cultivation in the fermenter is carried out under controlled process parameters, wherein particularly preferably the pH in the medium is kept constant.
  • the fermentation is carried out under Limitations vin.
  • the nitrogen content in the medium during the production phase 1 preferably should be less than 2 gl "1, preferably less than 1 gl" 1, highly preferably meadow less than 0.5 gl ", be most preferably zero.
  • the production phase is characterized in that it is a phase strengthen
  • the pH in the medium should be less than the physiologically preferred of 5.5, preferably the pH should be between 1 and 5.5, more preferably between 2 and 4, most preferably at 3.5.
  • said limiting conditions are combined with one another.
  • Fig. 1 shows schematically lycopene biosynthesis in non-carotenoid-forming organisms.
  • Fig. 2 shows schematically the increase of fat synthesis and accumulation.
  • Protein names on the pathways correspond to those of Saccharomyces cerevisiae, crossed-out proteins indicate the activity of the proteins to be reduced.
  • FIG. 3 shows integrative vectors for lycopene biosynthesis.
  • FIG. 4 shows integrative vectors for increased formation of the isoprenoid precursors
  • FIG. 5 shows, as described in Example 3, the specific lycopene content of the wild-type strain H222, the derivatives transformed with the codon usage-optimized genes crtB and crti from P.ananatis (BI) and the additional overexpression of the genes GGS1 (G ) and HMG1 (H) after 96 h in YPD medium.
  • the genes P0X1, P0X2, P0X3, POX4, POX5, P0X6 and GUT2 are deleted.
  • FIG. 6 shows, as described in Example 4, specific lycopene concentrations after 168 h cultivation of H222 BI GH (strain without deletions of the genes POX1, POX2, POX3, POX4, POX5, POX6 and GUT2) in complex (YP) and Minimal medium (M) with 3% glucose (G) or 3% dextrose (D), 3% glycerol (Y) or 3% oleic acid (O).
  • Fig. 7 shows, as described in Example 4, the microscopic
  • FIG. 8 shows, as described in Example 5, the specific lycopene content and the dry biomass of the strains H222 ⁇ BI GH (according to the invention) and H222 BI GH (comparative example).
  • FIG. 9 shows, as described in Example 6, cultivations of the strain H222 ⁇ BI GH at different pH values.
  • Fig. 10 shows the codon usage table of Y. lipolytica.
  • a restriction cleavage site (Table 1: RS) was obtained between promoter and terminator of the respective gene, which was obtained by PCR from genomic DNA of strain H222 with the primers listed in Table 1 were introduced by PCR.
  • the PCR product was ligated into pJET1.2 (Fermentas, Germany) and linearized with BamEI.
  • the URA3 fragment (2868 bp) was isolated by restriction with BamEI and BglII from the vector pU-CLys2-DK2 (SEQ ID NO: 1) and ligated into the BamUI linearized vector with the corresponding promoter-terminator fragment.
  • the deletion cassettes were ultimately recovered by naturally occurring or attached primers and into Y. lipolytica H222-S4, which can be prepared from Y. lipolytica H222 (Mauersberger, S., HJ Wang, et al. (2001), J Bacteriol 183 (17): 5102-5109), after Barth and Gaillardin (1996) transformed. Before re-transformation, the marker was recovered by FOA selection. The strain carrying both deletions of the genes POX1, POX2, POX3, POX4, POX5, P0X6 and GUT2 was named H222 ⁇ .
  • the starting plasmid was pUCBM21 (Boehringer Ingelheim) (SEQ ID NO: 2). From this vector, the SpnI site was removed by restriction with EcoRV and EcoICRI and religation. The URA3 fragment (2868 bp) was isolated by restriction with BamUI and BglII from the vector pUCLys2-DK2 (SEQ ID NO: 1) and ligated into the BamHI linearized pUCBM21 without Sphl interface.
  • the pTEF1 promoter and the tICLI terminator were isolated from the vector p64-TEF-T (SEQ ID NO: 3) by restriction with BamEI and KpnI (1262 bp) and ligated into the BamHI / KpnI cut pUCBM21.
  • Expression cassettes were constructed which, in addition to the selection marker URA3, carry the promoter of the translation elongation factor 1 alpha (pTEF1) fused to the open reading frames of the genes GGS1, HMG1, crtB and crtl.
  • the terminator of the isocitrate lyase gene (tICL1) acts as a terminator for the translation.
  • the selection marker URA3 is provided with two homologous fragments of the tetracycline resistance gene from Escherichia coli in order to be able to recover the selection marker for further work by homologous recombination (Ausloopen).
  • a sequence is introduced into the expression cassette which is homologous to a non-coding region in the genome of the expression organism in which a central NotI restriction cleavage site is present.
  • the expression cassette can be linearized for homologous integration into the expression organism.
  • the vector is called plntB according to the integration site.
  • the homologous region for integration into the host genome was obtained by PCR with primers that carry a KpnI site in the overhang (intb_KpnI_fw atataggtaccCCCACAGTTCTCACTCAG with SEQ ID NO: 4; intb_KpnI_rv atataggtaccC ⁇ TA ⁇ GACGCCTCGTTGC with SEQ ID NO: 5). These were then ligated into the KpnI linearized vector. All of the following genes were introduced into the resulting vector in the same manner. Spei and SphI served as interfaces for integration into the expression vector.
  • the P.ananatis genes crtB and crti adapted to the codon usage of Y. lipolytica yeast, were synthetically generated with the promoter pTEF1 and provided with the restriction sites for vector integration ( Figure 3).
  • Yarrowia's own genes GGS1 and HMG1 were obtained by PCR and likewise, like crtB and crti, were fused by PCR to the promoter pTEF1 and introduced into the vector (FIG. 4).
  • the Notl-linearized vectors were transformed into the Y. lipolytica strains H222 and H222 ⁇ using the lithium acetate method of Barth and Gaillardin (1996, Berlin, Heidelberg, New York, Springer-Verlag). Homologous recombination was detected by PCR. The uracil selection marker was recovered by selection for 5 * fluororotic acid (FOA), allowing further transformation with another vector.
  • FOA fluororotic acid
  • the genes for carotenoid biosynthesis were successively introduced into the strain H222 ⁇ by the integration of pIntB crti and pIntB crtB and subsequent FOA selection.
  • GGS1 was integrated into the genome under control of the pTEF1 promoter in the uracil-auxotrophic strain thus obtained.
  • HMG1 was also integrated into the recipient strain and the strain already transformed with GGS1 in the same way.
  • telomeres All tranformands and the recipient strain were cultured in YPD (1% yeast extract, 2% peptone, 2% glucose). Lycopene was extracted with hexane: ethyl acetate: butylhydroxytoluene (50: 50: 1) during glass bead digestion and photometrically determined at 472 nm.
  • YPD 1% yeast extract, 2% peptone, 2% glucose
  • Lycopene was extracted with hexane: ethyl acetate: butylhydroxytoluene (50: 50: 1) during glass bead digestion and photometrically determined at 472 nm.
  • Fig. 5 it can be seen that the increased formation of Ggslp and Hmglp leads to increased formation of lycopene.
  • the additive or synergistic effect of both enzymes can also be seen in the further increase in the specific lycopene yield.
  • Example 4 Cultivation under Limitation conditions to increase the specific lycopene content
  • the strain H222 ⁇ BI GH was compared in the shake flask in complete medium YP (1% yeast extract, 2% peptone) with 3% dextrose (YPD), dextrose and oleic acid (YPDO), glycerol (YPY) or glycerol and oleic acid (YPYO ); or in miniral medium (1 gl -1 KH 2 P0, 0.16 gl -1 K 2 HP0 4 ⁇ 3 H 2 0, 3 gl -1 (NH 4 ) 2 S0 4 , 0.7 gl -1 MgS0 4 ⁇ 7 H 2 O, 0.5 g / 1 NaCl, 0.4 ⁇ l "1 Ca (NO 3 ) 2 ⁇ 4 H 2 O, 0.5 mg 1 " H 3 BO 3 , 0.04 mg 1 "1 CuSO 4 x 5 H 2 O, 0.1 mg L "1 KI, 0, mg l " 1 MnS0 4 x 4 H 2 0, 0.2 mg l '
  • Fig. 7 it can be seen that the fat bodies are enlarged in medium with oleic acid.
  • the magnification is more pronounced in minimal medium than in complex medium and is not associated with an increased accumulation of lycopene (Figure 6).
  • Example 5 Sticksto flimitierende cultivation of the lycopene-forming strains
  • the strains H222 ⁇ crtB crtl GGS1 HMG1 (H222 ⁇ BI GH) and H222 crtB crtl GGS1 HMG1 (H222 BI GH) were compared in the fermenter (Multifors, Infors, Stuttgart, Germany) in minimal to (5% glucose, 1 ⁇ l "1 KH 2 P0 4 , 0.16 g 1 _1 K 2 HP0 4 x 3 H 2 O, 3 g 1 (NH 4 ) 2 S0 4 , 0.7 ⁇ L " 1 MgSO 4 x 7 H 2 O, 0.5 g / 1 NaCl, 0.4 ⁇ L "1
  • Example 6 Increased lycopene accumulation by cultivation at reduced pH
  • H222 ⁇ BI GH was compared at pH 5.5 and 3.5 in the fermenter (Multifors, Infors, Stuttgart, Germany) in minimal medium (5% glucose, 1 ⁇ l -1 KH 2 P0 4 , 0.16 gl -1 K 2 HP0 4 x 3H 2 0, 0.7 gl "1

Abstract

Hefestamra der Art Yarrowia lipolytica der dadurch gekennzeichnet ist, dass er eine Phytoensynthase und eine Phytoendesaturase enthält, eine Verringerung der Aktivität der Proteine Poxlp, Pox2p, Pox3p, Pox4p, Pox5p Pox6p und Gut2p aufweist, und eine erhöhte Aktivität der Proteine Ggslp und Hmglp aufweist.

Description

Hefestamm und Verfahren zur Produktion von Lycopin
Die Erfindung betrifft einen Hefestarara der Art Yarrowla lipoly- tica und ein Verfahren zur Produktion von Lycopin mit diesem Stamm . Das Interesse an biotechnologisch hergestellten Carotinoiden als Lebensmittelzusatzstoff oder als Wirkstoff in der pharmazeutischen oder kosmetischen Industrie steigt stetig. Carotinoide besitzen komplexe chemische Strukturen, die sich auf synthetischem Weg nur schwer herstellen lassen. Die Isolation aus pflanzlichem Material ist kompliziert und zeitaufwendig.
Lycopin repräsentiert ein zentrales Carotinoid in der Carotino- id-Biosynthese . Ausgehend von Lycopin können verschiedenartige Carotinoide gebildet werden. Es wird in natürlicher Form in Pflanzen, Algen und anderen photosynthetisch aktiven Organismen gefunden. Lycopin besitzt eine hohe Quenchingrate für Singu- lett-Sauerstoff . Dadurch werden Lycopin vorbeugende Eigenschaften gegen Krebs nachgesagt. Des Weiteren besitzt Lycopin anti- fungale Eigenschaften gegen die humanpathogene Hefe Candida al¬ bicans. Aus diesem Grund ist die mikrobiologische Produktion von Lycopin besonders herausfordernd.
Die Carotinoid-Biosynthese zweigt sich vom Isoprenoid- Stoffwechsel ab durch die Kondensation von zwei GGPP-Molekülen zu Phytoen. Dies wird durch das Enzym Phytoensynthase (crtBp) durchgeführt. Phytoen wird danach durch die sukzessive Einfüh- rung von Doppelbindungen über Phytofluen, Zeta-Carotin, Neurosporen zu Lycopin umgewandelt. Hierfür ist das Enzym Phytoende- saturase (crtlp) verantwortlich (Fig. 1) .
In verschiedenen nicht- lycopinbildenden Hefen wurden bereits die Lycopin-Biosynthese-Gene eingebracht: · Saccharomyces cerevisiae (Verwaal, R., J. Wang, et al .
(2007), Appl Environ Microbiol 73(13): 4342-4350; Lange, N. and A. Steinbüchel (2011) , Appl Microbiol Biotechnol 91(6) : 1611-1622; Ukibe , K. , . Hashida, et al . (2009), Appl Environ Microbiol 75(22) : 7205-7211; Yamano, S., T. Ishii, et al. (1994), Biosci Biotechnol Blochem 58(6) : 1112-1114)
• Candida utilis (Misawa, N. and H. Shimada (1998) , J
Biotechnol 59(3) : 169-181; Miura, Y. , K. Kondo, et al . (1998), Appl Environ Microbiol 64(4) : 1226-1229; Shimada,
H., K. Kondo, et al . (1998), Appl Environ Microbiol 64(7) : 2676-2680)
• Pichia pastoris (Bhataya, A. , C. Schmidt-Dannert , et al .
(2009), Process Biochemistry 44(10) : 1095-1102;) und · Mucor circlnelloides (Papp, T. , A. Velayos, et al . (2006),
Appl Microbiol Biotechnol 69(5) : 526-531;).
Des Weiteren wurde bereits beschrieben, wie Yarrowia lipolytica (Y. lipolytica) zur Lycopinbildung gebracht werden kann (Ye, R. W., P. L. Sharpe, et al . (2012), Methods Mol Biol 898: 153-
159) . In den Veröffentlichungen wurden maximal 7,8 mg Lycopin pro Gramm Biotrockenmasse beschrieben.
Y. lipolytica bildet natürlicherweise keine Carotinoide. Sie bildet aber Geranyl-Geranyl-Pyrophosphat , ein wichtiges Inter- mediat der Lycopinbiosynthese .
US201110021843A1 offenbart, dass ein Y. lipolytica Stamm mit den Genen für ATP-Citrat Lyase, AMP Deaminase und cytosolischer Malat-Dehydrogenase in die Lage versetzt wurde größere Mengen an Fetten zu akkumulieren. Durch Überexpression der Gene HMG1 (kodiert eine HMG-CoA Reduktase) und GGS1 (kodiert eine Ge- ranyl-Geranyl Synthase) aus Y. lipolytica , sowie einer Überexpression der Gene crtB (kodiert eine Phytoensynthase) und crtl (codiert eine Phytoendesaturase) aus Erwinia uredovora konnte Lycopin produziert werden. US7851199B2 offenbart die Verwendung von Y. lipolytica zur Produktion von Carotinoiden.
WO 2010/004141 offenbart, dass durch eine Deletion des Genes GUT2 in Kombination mit den Deletionen der Gene POX1 , POX2 , POX3, POX4, POX5 und POX6 vergrößerte Fettkörperchen gebildet werden, die für die Produktion von Lipiden genutzt werden können. Darauf aufbauend offenbart WO 2012/001144A1 , dass eine zusätzliche Überexpression des Gens GPDl in Y. lipolytica zu wei- ter vergrößerten Fettkörperchen führt .
Aufgabe der vorliegenden Erfindung ist die Bereitstellung eines Hefestamms der Art Y. lipolytica der zur mikrobiellen Produktion von Lycopin, in größeren Mengen als bisher bekannt, geeignet ist . Die Aufgabe wird gelöst durch einen Hefestamm der Art Y. lipolytica der dadurch gekennzeichnet ist, dass er eine Phytoensynthase und eine Phytoendesaturase enthält, eine Verringerung der Aktivität der Proteine Poxlp, Pox2p, Pox3p, Pox4p, Pox5p Ροχβρ und Gut2p aufweist, und eine erhöhte Aktivität der Proteine Ggslp und Hmglp aufweist.
Bei der Phytoensynthase handelt es sich bevorzugt um eine Phytoensynthase aus Bakterien, besonders bevorzugt aus Pantoea ananatis (P. ananatis) . Ganz besonders bevorzugt handelt es sich bei der Phytoensynthase um das Protein crtBp (NCBI Refe- rence Sequence : YP_003522457.1) .
Bei der Phytoendesaturase handelt es sich bevorzugt um eine Phytoendesaturase aus Bakterien, besonders bevorzugt aus P.
ananatis . Ganz besonders bevorzugt handelt es sich bei der Phytoendesaturase um das Protein crtlp (UniProtKB/Swiss-Prot :
P21685.1) .
Unter einer erhöhten Aktivität der Proteine Ggslp und Hmglp ist vorzugsweise zu verstehen, dass die Aktivität pro Zelle erhöht ist, was durch die Steigerung der Proteinmenge oder durch die Steigerung der proteineigenen Aktivität erzielt werden kann. Die Steigerung der Proteinmenge ist dadurch gekennzeichnet, dass mehr Protein gebildet wird, als bei einem unveränderten Stamm unter gleichen Bedingungen. Die Steigerung der proteineigenen Aktivität ist dadurch gekennzeichnet, dass die gleiche Menge an Protein in einem veränderten Stamm eine höhere Aktivi- tät aufweist als der unveränderte Stamm. Unter einer Verringerung der Aktivität eines Proteins ist vorzugsweise zu verstehen, dass die Aktivität des Proteins pro Zelle verringert wird. Besonders bevorzugt ist darunter das Fehlen der Aktivität des Proteins zu verstehen. Eine erhöhte Aktivität der Proteine kann auf verschiedene Weise erzeugt werden:
(i) durch Einbringen des relevanten Gens in mehrfacher, vorzugsweise 8 bis 12facher, Kopie in das Genom des Organismus (Gen-Dosis-Effekt)
(ii) durch Austausch des natürlichen Promoters des relevanten Gens durch einen stärkeren als den natürlichen Promotor, vorzugsweise einen Promoter, der mindestens 50% der Aktivität des Promoters des TiJFl-Gens (Translationselonga- tionsfaktor 1 alpha Genolevures: YALI0C09141g) besitzt, höchstvorzugsweise die Aktivität des TEF1- Promoters besitzt. Dabei können Promotoren gewählt werden, die entweder während der gesamten Kultivierung aktiv sind oder nur in einer gewünschten Wachstumsphase aktiv sind (Gen- Regulations-Effekt)
Bei der Aktivitätserhöhung wird das zusätzliche Einbringen des relevanten Gens unter Kontrolle eines starken Promotors besonders bevorzugt, insbesondere bevorzugt unter Kontrolle des TEF1- Promoters aus Yarrowia lipolytica.
Die Verringerung der Aktivität von Proteinen kann durch ver- schiedene Verfahren erlangt werden:
(i) durch die Inhibierung oder Verminderung der Expression der Gene
(ii) durch partielle oder komplette Deletion der codierenden Gene
(iü) durch Expression von nicht-funktionalen Genen
(iv) durch Inhibierung oder Verminderung der Aktivität der exprimierten Gene .
Die Proteine Poxlp, Pox2p, Pox3p, Pox4p, Pox5p Ροχδρ und Gut2p werden vorzugsweise durch die Gene POXl , POX2 , P0X3 , POX4 , POX5 und POX6 (Genolevures.- YALI0E32835g, YALI0F10857g,
YALI0D2475Og, YALI0E27654g, YALI0C23859g, YALI0E06567g) und GUT2 (Genolevures: YALI0B13970g) kodiert. Das Protein Ggslp wird vorzugsweise kodiert durch das Gen GGS1 (Genolevures : YALI0D17050p) .
Das Protein Hmglp wird vorzugsweise kodiert durch das Gen HMGl (Genolevures: YALI0D17050p) . Die Inhibierung oder Verminderung der Expression kann beispielsweise durch Inhibierung oder Verminderung der Transkription des codierenden Gens oder der Translation der gebildeten mRNA erfolgen. Die Deletion der codierenden Gene kann beispielsweise durch einen Ausbau der Gene mittels Deletionskas- setten durchgeführt werden. Die Expression eines dysfunktiona- len oder aktivitätsreduzierten Genproduktes kann beispielsweise durch Insertion, Substitution oder Punktmutation in dem codierenden Gen bewerkstelligt werden.
Bei der Aktivitätsverringerung wird die Deletion eines codie- renden Gens bevorzugt .
Vorzugsweise trägt der erfindungsgemäße Stamm somit die Gene crtB, crtl, GGS1 und HMGl dessen Genprodukte in ihrer Aktivität erhöht vorliegen und weist eine Deletion der Gene P0X1 , POX2 , POX3r POX4, POX5, P0X6 und GUT2 auf. Die Deletion der Gene POX1 , POX2, POX3, POX4 , POX5 und P0X6 unterbindet die Beta-Oxidation, verhindert somit den Abbau der intrazellulären Fettreserven und führt somit wiederum zu vergrößerten Fettkörperchen .
Die Deletion des Gens GUT2, dessen Genprodukt für die Umwand- lung von G3P zu DHAP verantwortlich ist, lässt sich die TAG-
Synthese Rate erhöhen was zu vergrößerten Fettkörperchen führt .
Das Einbringen der Gene crtB und crtl aus P. ananatis , bewirkt die Bildung von Lycopin.
Die Aktivitätssteigerung Geneprodukte von GGS1 und HMGl führt zu einer vermehrten Bildung der Carotinoidvorstufen .
Überraschenderweise wurde gefunden, dass große Fettkörperchen per se keine verstärkte Akkumulation von hydrophoben Substraten in den Hefezellen bewirkt. Unter geeigneten Bedingungen, wie Wachstum in Anwesenheit von Fettsäuren, bildet Y. lipolytica sehr große Fettkörperchen aus. Diese führen jedoch in Lycopin- bildenden Yarrowia lipolytica- Stämmen nicht zu einer verstärkten Akkumulation von Lycopin. Erst die erfindungsgemäßen gen- technischen Veränderungen, nämlich eine Verringerung der Aktivität der durch die Gene POX1 , POX2-, POX3, POX4 , POX5 und POX6 (Genolevures: YALI0E32835g, YALI0F10857g, YALI0D24750g,
YALI0E27654g, YALI0C23859g, YALI0E06567g) und GUT2 (Genolevures: YALI0B13970g) kodierten Proteine in an sich bereits im Stand der Technik beschriebenen modifizierten Y. lipolytica-
Stämmen, welche die Lycopin-bildenen Proteine crtBp (NCBI Refe- rence Sequence: YP_003522457.1) und crtlp (UniProtKB/Swiss- Prot: P21685.1) enthalten und welche eine Erhöhung der Aktivität der Proteine Ggslp und Hmglp, vorzugsweise durch die Ver- knüpfung mit dem starken Promoter des TEF1 -Gens, aufweisen und Desweiteren in geeigneten Limitationsbedingungen kultiviert werden, führen zu einer verstärkten Akkumulation von Lycopin in den Fettkörperchen der Hefe.
Als Ausgangsstamm für die Konstruktion eines erfindungsgemäßen Stammes kann ein ildtypisolat der Hefe Y. lipolytica verwendet werden, vorzugsweise der Stamm H222. Der Stamm H222 wurde am 29.04.2013 bei der DSMZ (Deutsche Sammlung für Mikroorganismen und Zellkulturen GmbH, Inhoffenstraße 7B, D-38124 Braunschweig) unter der Nummer DSM 27185 gemäß Budapester Vertrag hinterlegt. Zur Verwendung eines Stammes für die weitere gentechnische Bearbeitung, ist ein Selektionsmarker notwendig. Dieser Selekti- onsmarker kann z.B. in Form der Uracilauxotrophie in an sich bekannter Weise in den Stamm eingebracht werden. Alternativ kann auf bereits bekannte uracilauxotrophe Stämme zurückgegrif- fen, vorzugsweise auf den Stamm H222-S4 (Mauersberger, S., H. J. Wang, et al. (2001), J Bacteriol 183(17): 5102-5109) .
Eingebracht werden die Gene vorzugsweise mittels üblicher Verfahren, die im Stand der Technik bekannt sind.
Um eine effiziente Translation der eingebrachten Gene zu ge- währleisten, ist es bevorzugt, die Sequenz der Gene crtB und crtl an die Codon-Verwendung von Y. lipolytica anzupassen. Besonders bevorzugt werden crtB und crtl Gene eingesetzt, deren Codon-Verwendung mit dem Program GeneOptimizer15 (http://de- de . invitrogen . com/site/de/de/home/Products-and- Services/Applications/Cloning/gene- synthesis/GeneArt-Gene-
Synthesis/GeneOptimizer .html) angepasst wurde. Insbesondere bevorzugt hat das crtB Gen die Sequenz SEQ ID NO: 34. Insbesondere bevorzugt hat das crtl Gen die Sequenz SEQ ID NO: 35.
Weiterhin ist es bevorzugt für den Organismus funktionierende Promotoren mit dem offenen Leserahmen der Gene zu verknüpfen. Hierbei können sowohl konstitutive Promotoren als auch von den Kultivierungsbedingungen abhängige Promotoren der Hefe Y. lipolytica genutzt werden.
Vorzugsweise werden konstitutive Promotoren genutzt. Besonders bevorzugt wird der Promoter des Translationselongationsfaktors 1 alpha (pTEFl) verwendet.
Ebenso ist es bevorzugt, den offenen Leserahmen der Gene mit einem Terminator zu versehen. Vorzugsweise wird der Terminator des Gens der Isocitratlyase (ICLlt) verwendet. Die Erfindung betrifft ferner ein Verfahren zur Herstellung von Lycopin, das dadurch gekennzeichnet ist, dass ein erfindungsgemäßer Mikroorganismus in an sich bekannter Art und Weise in einem Fermenter fermentiert wird.
Bei der Kulivierung eines erfindungsgemäßen Stammes führt ein verbessertes Wachstum in Medium mit Ölsäure zu einer Verringerung der spezifischen Lycopin-Bildung . Daher ist es bevorzugt neben den erfindungsgemäßen gentechnischen Veränderungen von Y. lipolytica zur Erhöhung der Kapazität der Fettkörperchen durch Erhöhung des Fettgehalts, das Wachstum zu limitieren. Die vergrößerten Fettkörperchen bilden zwar eine erhöhte Kapazität für die Akkumulation von Lycopin, jedoch ist dies nur relevant, wenn auch zytotoxische Mengen an Lycopin gebildet werden. Aufgrund der konstitutiven Expression der an der Carotino- id-Biosynthese beteiligten Gene, führt eine Wachstumslimitation zu einer erhöhten spezifischen Lycopin-Bildung . Diese Limitation kann auf verschiedene Weise realisiert werden.
Die Deletion des GUT2-Gens führt nicht nur zur Vergrößerung der Fettkörperchen durch den verminderten Abfluss des G3P in die Glycolyse, sondern auch zu einer verringerten Verwertung von Glycerol . Für das Wachstum auf Glycerol als einzige Kohlenstoffquelle ist die Bildung von Glucose über die Gluconeogenese essentiell. Das Genprodukt des GUT2-Gens stellt hierbei ein wichtiges Enzym dar, weil es die Umsetzung von G3P zu DHAP ka- talysiert, welches dann in die Gluconeogenese einfließt. Die Deletion des GUT2-Gens führt bei Kultivierung in Glycerol - haltigem Medium zu limitiertem Wachstum und zu einer erhöhten spezifischen Lycopin-Bildung. Dementsprechend ist die Deletion des GUT2-Gens in zweierlei Hinsicht entscheidend für die Bil- dung und Akkumulation von Lycopin verantwortlich.
Eine weitere Form der Limitierung ist die Stickstofflimitierung. Diese Limitierung führt in der Hefe Y. lipolytica zu einem Wachstumsstopp nach Aufbrauchen der Stickstoffquelle und zur Bildung von Citronensäure und Iso-Citronensäure .
Vorzugsweise erfolgt die Kultivierung im Fermenter unter kontrollierten Prozessparametern, wobei besonders bevorzugt der pH-Wert im Medium konstant gehalten wird. Insbesondere bevorzugt erfolgt die Fermentation unter Limitationsbedingungen .
Es konnte gezeigt werden, dass die spezifische Lycopinkonzent- ration in den Zellen durch Wachstum unter Limitationsbedingungen erhöht ist. Die Wachstumslimitation kann durch vielerlei Mittel erzeugt werden. Vorzugsweise sollte der Stickstoffgehalt im Medium während der Produktionsphase kleiner als 2 g l"1, vorzugsweise kleiner als 1 g l"1, hoch vorzugswiese kleiner 0,5 g l"1, höchst vorzugsweise Null sein. Die Produktionsphase ist dadurch gekennzeichnet, dass sie sich einer Phase starken
Wachstums (Wachstumsphase) anschließt und nur noch im Vergleich zur Wachstumsrate geringes Wachstum, jedoch erhöhte Produktbildung aufweist. Im Falle der Stickstofflimitation sollte der pH-Wert im Medium kleiner sein als der physiologisch bevorzugte von 5,5, vorzugsweise sollte der pH-Wert zwischen 1 und 5,5 liegen, besonders bevorzugt zwischen 2 und 4, insbesondere bevorzugt bei 3,5. Vorzugsweise werden im erfindungsgemäßen Verfahren die genannten Limitationsbedingungen miteinander kombiniert .
Fig. 1 zeigt schematisch die Lycopin-Biosynthese in nicht- carotinoidbildenden Organismen.
Fig. 2 zeigt schematisch die Erhöhung der Fettsynthese und - akkumulation . Proteinbezeichnungen an den Reaktionswegen entsprechen denen aus Saccharomyces cerevisiae, durchgestrichene Proteine kennzeichnen die Aktivität der Proteine, die verringert werden soll.
Fig. 3 zeigt Integrative Vektoren für die Lycopin-Biosynthese Fig. 4 zeigt integrative Vektoren zur vermehrten Bildung der Isoprenoid-Vorstufen
Fig. 5 zeigt wie in Bsp. 3 beschrieben, den spezifischen Lyco- pingehalt des Wildtypstammes H222, der Abkömmlinge transformiert mit den Codon-Usage-optimierten Genen crtB und crti aus P. ananatis (BI) und der zusätzlichen Überexpression der Gene GGS1 (G) und HMG1 (H) nach 96 h in YPD-Medium . In allen Abkömmlingen sind die Gene P0X1 , P0X2, P0X3, POX4, POX5, P0X6 und GUT2 deletiert.
Fig. 6 zeigt wie in Bsp. 4 beschrieben, spezifische Lycopin- Konzentrationen nach 168 h Kultivierung von H222 BI GH (Stamm ohne Deletionen der Gene POX1 , POX2, POX3, POX4 , POX5, POX6 und GUT2) in Komplex- (YP) und Minimalmedium (M) mit je 3 % Glucose (G) bzw. 3% Dextrose (D) , 3 % Glycerol (Y) oder 3 % Ölsäure (O) . Fig. 7 zeigt wie in Bsp. 4 beschreiben, die mikroskopische
Überlagerung aus Hellfeld- und Fluoreszenzaufnahmen von Nilrot- gefärbten Zellen nach 168 h Kultivierung von H222 BI GH. Fig. 8 zeigt, wie in Bsp. 5 beschreiben, den spezifischen Lyco- pingehalt und die Biotrockenmasse der Stämme H222 Δ BI GH (erfindungsgemäß) und H222 BI GH (Vergleichsbeispiel) .
Fig. 9 zeigt, wie in Bsp. 6 beschreiben, Kultivierungen des Stammes H222 Δ BI GH bei verschiedenen pH-Werten.
Fig. 10 zeigt die Codon Usage Tabelle von Y. lipolytica .
Die folgenden Beispiele dienen der weiteren Erläuterung der Erfindung .
Beispiel 1 : Blockierung der Beta-Oxidation und der Glycerol- basierten Gluconeogenese
Für die Konstruktion der Deletionskassetten der POX-Gene und des GUT2-Gens wurde eine Restriktionsschnittstelle (Tabelle 1: RS) zwischen Promoter und Terminator des eweiligen Gens, welche per PCR aus genomischer DNA des Stammes H222 mit den in Ta- belle 1 aufgeführten Primern gewonnen wurden, durch PCR eingebracht. Das PCR-Produkt wurde in pJETl .2 (Fermentas, Germany) ligiert und mit BamEI linearisiert . Das URA3-Fragment (2868 bp) wurde durch Restriktion mit BamEI und Bglll aus dem Vektor pU- CLys2-DK2 (SEQ ID NO: 1) isoliert und in den mit BamUI lineari- sierten Vektor mit den entsprechenden Promoter-Terminator- Fragment ligiert. Die Deletionskassetten wurden letztendlich mittels natürlich vorkommenden oder an den Primern angehängten Schnittstellen gewonnen und in Y. lipolytica H222-S4, der aus Y. lipolytica H222 hergestellt werden kann (Mauersberger, S., H. J. Wang, et al . (2001), J Bacteriol 183(17) : 5102-5109), nach Barth und Gaillardin (1996) transformiert. Vor einer erneuten Transformation, wurde der Marker per FOA- Selektion zurückgewonnen. Der Stamm, der sowohl Deletionen der Gene POXl, POX2, POX3, POX4, POX5, P0X6 und GUT2 trägt wurde H222 Δ ge- nannt .
Tabelle 1 : Primer zur Herstellung der Deletionskassetten
Name DNA-Sequenz <5' >3' ) RS SEQ ID NO pPO 2_fw TCCAGAAGCGCTACAAAGAG EcoRI 6 pPOXl__rv ggatccTGAAGGTTGCAGTCGTAGTC BamEI 7
POXl t_fw ggatccTGCGATCTCGATGAGTGATG BamEI 8
POXl t_rv GCCCAGAAGATTGGAATGAC H ndiII 9 pPOX2_fw atataccgcggGATTCCGCCAAGTGAGACTG Cfr42I 10 pPOX2_rv ggatccCGTCGÄGGAAGTAGGTCÄTC : BamEI li
POX2t_fw ggatccGCGAGCTTGATGAGGÄATAG BamE 12
POX2tjcv atataccgcggCCTGACGCCAATTTGAAGAG Ofr42I 13 pPOX3_fw atataccgcggCTGGGCTGTTCGGTCGATAG Cfr42I 14 pPOX3_rv ggatccAGGACGCACAACGCCATCAC BamEI 15
POX3t__fw ggatccCGCTCCCATTGGAAACTA BamEI 16
POX3t_rv atataccgcggTCTCTTCGCTGTGGTCTAGG Cfr 2I 17 pPOX4__fw atataccgcggTCCACCGTTCTCCTTCATAC CftAZl 18 pPOX4_rv ggatccATGTCTCTAGGGTCGAAGTC BamEI 19
POX4 t Ew ggatccTGGCAAGCCTCACTAGTACG BamEI 20
POX4t' cv atätaccgeggTGGGGCGGAACTACTGTATC CfrVZZ 21 pPOX5_fw atataccgcggGGGATTCTCCGGGTTATTTG Cfr 2I 22 pPOX5_rv ggatccACGTCTCGGACCTTGAATTG BamEI 23
POX5t_fw ggatccCCTTCAACCTGTCCGACTTC BamEI 24
POX5t_rv atataccgcggGAAGCGGTCCTCGTTGTATG Cfr42I 25 pPOX6_fw GTGTAGCÄACTCGGÄTACAG Mlul 26 pPOX6_rv ggatcGGGTCCATÄAGCAGÄGTGTTC BamEI 27
POX6t_£w ggatccAGCCTCGACCTCCTTATTAC BamEI 28
POX6t_rv CTGTTCTTGACTGGCATAGC EcoRV 29 pGÜT2__fw CGCAGATCtACTGTCAAGCCGAGTC SglII 30 pGUT2_rv atatagga tccGGGTGGTGGGTAGGAA BamEI 31 tGUT2~fw atatagga tccGCGTATAGCCAATAAGATAATCAC BamEI 32 tGUT2-rv CCCTCCAACTCGAGGGTTGATGTAG SglII 33 Beispiel 2 : Herstellung der Vektoren
Als Ausgangsplasmid diente pUCBM21 (Boehringer Ingelheim) (SEQ ID NO: 2) . Aus diesem Vektor wurde durch Restriktion mit EcoRV und EcoICRI und Religation die Spnl-Schnittstelle entfernt. Das URA3- Fragment (2868 bp) wurde durch Restriktion mit BamUI und Bglll aus dem Vektor pUCLys2-DK2 (SEQ ID NO : 1) isoliert und in den mit BamHI linearisierten pUCBM21 ohne Sphl-Schnittstelle ligiert . Der pTEFl-Promoter und der tICLI-Terminator wurden aus dem Vektor p64-TEF-T (SEQ ID NO: 3) durch Restriktion mit BamEI und Kpnl (1262 bp) isoliert und in den mit BamHI/ Kpnl geschnittenen pUCBM21 ligiert.
Es wurden Expressionskassetten konstruiert, die neben dem Se- lektionsmarker URA3 den Promoter des Translationselongations - faktors 1 alpha (pTEFl) fusioniert mit den offenen Leserahmen (open reading frames) der Gene GGS1, HMGl , crtB und crtl tragen. Als Terminator für die Translation fungiert der Terminator des Isocitratlyasegens (tICLl) . Der Selektionsmarker URA3 ist mit zwei homologen Fragmenten des Tetracyclinresistenzgens aus Escherichia coli versehen, um durch homologe Rekombination (Ausloopen) den Selektionsmarker für weiterführende Arbeiten zurückgewinnen zu können.
Des Weiteren ist in der Expressionskassette eine Sequenz eingebracht, die homolog ist zu einem nichtcodierenden Bereich im Genom des Expressionsorganismus , in der eine zentrale Notl- Restriktionsschnittstelle vorliegt. Mit dieser Schnittstelle kann die Expressionskassette für die homologe Integration in den Expressionsorganismus linearisiert werden. Der Vektor wird entsprechend der Integrationsstelle plntB genannt.
Der homologe Bereich für die Integration in das Wirtsgenom wur- de per PCR mit Primern, die eine Kpnl -Schnittstelle im Überhang tragen (intb_KpnI_fw atataggtaccCCCACAGTTCTCACTCAG mit SEQ ID NO: 4; intb_KpnI_rv atataggtaccCÄTAÄGACGCCTCGTTGC mit SEQ ID NO: 5), gewonnen. Diese wurden dann in den mit Kpnl linearisierten Vektor ligiert. Alle folgenden Gene wurden auf die gleiche Weise in den erhaltenen Vektor eingebracht. Als Schnittstellen für die Integration in den Expressionsvektor dienten hierbei Spei und SphI .
Die an die Codon-Verwendung der Hefe Y. lipolytica angepassten Gene crtB und crti aus P. ananatis wurden auf synthetischem Wege mit dem Promotor pTEFl erzeugt und mit den Restriktions- schnittstellen für die Vektorintegration versehen (Fig. 3) .
Die Yarrowia-eigenen Gene GGSl und HMG1 wurden durch PCR gewonnen und ebenfalls wie crtB und crti per PCR mit dem Promoter pTEFl fusioniert und in den Vektor eingebracht (Fig. 4) .
Die Notl-linearisierten Vektoren wurden mittels Lithiumacetat- Methode nach Barth und Gaillardin (1996, Berlin, Heidelberg, New York, Springer-Verlag) in die Y. lipolytica-Stämme H222 und H222 Δ transformiert. Homologe Rekombination wurde durch PCR nachgewiesen. Der Uracil-Selektionsmarker wurde durch die Selektion auf 5 * -Fluororotsäure (FOA) zurückgewonnen, sodass eine erneute Transformation mit einem weiteren Vektor möglich wird.
Beispiel 3 : Vergleichende Kultivierung der Carotinoid- Vorstufen-produzierenden Stämme
Die Gene für die Carotinoid-Biosynthese wurden sukzessive in den Stamm H222 Δ durch die Integration von pIntB crti und pIntB crtB und nachfolgender FOA-Selektion eingebracht. In den so erhaltenen uracilauxotrophen Stamm wurde GGSl unter Kontrolle des pTEFl-Promoters in das Genom integriert. Auch HMGl wurde auf dieselbe Weise in den Rezipientenstamm und den bereits mit GGSl transformierten Stamm integriert.
Alle Tran formanden und der Rezipientenstamm wurden in YPD (1 % Hefeextrakt, 2 % Pepton, 2 % Glucose) kultiviert. Lycopin wurde mit Hexan :Ethylacetat : Butylhydroxytoluol (50:50:1) während eines Glasperlenaufschlusses extrahiert und bei 472 nm photometrisch bestimmt. In Fig. 5 ist zu sehen, dass die vermehrte Bildung von Ggslp und Hmglp zu vermehrter Bildung von Lycopin führt. Auch der additive bzw. synergistische Effekt beider Enzyme ist in der weiteren Erhöhung der spezifischen Lycopinausbeute zu sehen.
Beispiel 4 : Kultivierung unter Limitationsbedingungen zur Erhöhung des spezifischen Lycopin-Gehalts
Es konnte gezeigt werden, dass Stämme und Kultivierungsbedingungen, die zu vergrößerten Fettkörperchen führen, nicht auto- matisch zu einer erhöhten biomassespezifischen Lycopin-Bildung führen (Fig. 6 und Fig. 7) .
Der Stamme H222 Δ BI GH wurde vergleichend im Schüttelkolben in Vollmedium YP (1 % Hefeextrakt, 2 % Pepton) mit je 3 % Dextrose (YPD) , Dextrose und Ölsäure (YPDO) , Glycerol (YPY) oder Glyce- rol und Ölsäure (YPYO) ; oder in Miniraalmedium (1 g l"1 KH2P0 , 0,16 g l"1 K2HP04 x 3 H20, 3 g l"1 (NH4)2S04, 0,7 g l"1 MgS04 x 7 H20, 0,5 g/1 NaCl, 0,4 g l"1 Ca(N03)2 x 4 H20, 0,5 mg l"1 H3BO3, 0,04 mg l"1 CuS04 x 5 H20, 0,1 mg l"1 KI, 0 , mg l"1 MnS04 x 4 H20, 0,2 mg l'1 Na2Mo04 x 2 H20, 0,4 mg 1_1 ZnS04 x 7 H20, 6 mg l"1 FeCl3 x 6 H20, 0,3 mg l"1 Thiamin-Hydrochlorid) mit je 3 % Glu- cose (MG) , Glucose und Ölsäure (MGO) , Glycerol (MY) oder Glycerol und Ölsäure (MYO) kultiviert. Die Kultivierung wurde bei 28 °C und pH 5,5 durchgeführt.
In Fig. 7 ist zu sehen, dass die Fettkörperchen in Medium mit Ölsäure vergrößert sind. Die Vergrößerung ist in Minimalmedium stärker ausgeprägt als in Komplexmedium und geht jedoch nicht mit einer erhöhten Akkumulation von Lycopin einher (Fig. 6).
Beispiel 5: Sticksto flimitierende Kultivierung der Lycopin- bildenden Stämme
Die Stämme H222 Δ crtB crtl GGS1 HMG1 (H222 Δ BI GH) und H222 crtB crtl GGS1 HMG1 (H222 BI GH) wurden vergleichend im Fermenter (Multifors, Infors, Stuttgart, Deutschland) in Minimalmedi- um (5 % Glucose, 1 g l"1 KH2P04, 0,16 g 1_1 K2HP04 x 3 H20, 3 g 1 (NH4)2S04, 0,7 g l"1 MgS04 x 7 H20, 0,5 g/1 NaCl, 0,4 g l"1
Ca(N03)2 x 4 H20, 0,5 mg l"1 H3B03, 0,04 mg l"1 CuS04 x 5 H20, 0,1 mg l"1 KI, 0,4 mg l"1 MnS04 x 4 H20, 0 , 2 mg l"1 Na2Mo04 x 2 H20, 0,4 mg l"1 ZnS04 x 7 H20, 6 mg l"1 FeCl3 x 6 H20, 0 , 3 mg l"1 Thia- min-Hydrochlorid) kultiviert. Die Kultivierung wurde bei 28 °C, pH 5,5, 1 WM Druckluft und Rührerdrehzahl zwischen 400 und 1200 Upm durchgeführt.
Aus Fig. 8 ist die verstärkte spezifische Bildung des Lycopins im erfindungsgemäßen Stamm ersichtlich (3,8fach) . Die gebildeten Mengen an Citronensäure (CA) und Isocitronensäure (ICA) sind in beiden Stämmen vergleichbar (H222 BI GH: CA = 46,6 g l"1; ICA = 6,8 g l"1; H222 Δ BI GH: CA = 43,3 g l"1; ICA = -6,0 g l"1 nach 7 Tagen [d] ) .
Beispiel 6: Erhöhte Lycopin-Akkvimulation durch Kultivierung bei verringertem pH-Wert
H222 Δ BI GH wurde vergleichend bei pH 5,5 und 3,5 im Fermenter (Multifors, Infors, Stuttgart, Deutschland) in Minimalmedium (5 % Glucose, 1 g l"1 KH2P04, 0,16 g l-1 K2HP04 x 3H20, 0,7 g l"1
MgS04 x 7 H20, 0,4 g l"1 Ca(N03)2 x 4 H20, 0 , 5 mg l"1 H3B03, 0,04 mg l"1 CuS0 x 5 H20, 0,4 mg 1_1 MnS04 x 4 H20, 0,4 mg l"1 ZnS04 x 7 H20, 0,2 mg 1_1 Na2Mo04 x 2 H20, 0,1 mg l"1 KI, 6 mg l"1 FeCL3 x 6 H20, 0,3 mg l"1 Thiamin-Hydrochlorid) kultiviert. Die Kulti- vierung wurde bei 28 °C, 1 WM Druckluft und Rührerdrehzahl zwischen 400 und 1200 Upm durchgeführt (Fig. 9) .
Die Verringerung des pH-Wertes führt zu einem Verfahren mit dem sehr hohe Mengen an Lycopin (16 mg Lycopin pro Gramm Biotrockenmasse) produziert werden können.

Claims

51 Patentansprüche :
1. Hefestamm der Art Yarrowia lipolytica der dadurch gekennzeichnet ist, dass er eine Phytoensynthase und eine Phyto- endesaturase enthält, eine Verringerung der Aktivität der Proteine Poxlp, Pox2p, Pox3p, Pox4p, Pox5p Pox6p und Gut2p aufweist, und eine erhöhte Aktivität der Proteine Ggslp und Hmglp aufweist.
2. Hefestamm gemäß Anspruch 1 dadurch gekennzeichnet, dass es sich bei der Phytoensynthase um eine Phytoensynthase aus Bakterien handelt.
3. Hefestamm gemäß Anspruch 1 oder 2, dadurch gekennzeichnet, dass es sich bei der Phytoensynthase um die Phytoensynthase aus Pantoea ananatis handelt.
4. Hefestamm gemäß einem der Ansprüche 1 bis 3, dadurch gekennzeichnet, dass es sich bei der Phytoendesaturase um eine Phytoendesaturase aus Bakterien handelt.
5. Hefestamm gemäß einem der Ansprüche 1 bis 4, dadurch gekennzeichnet, dass es sich bei der Phytoendesaturase um die Phytoendesaturase aus Pantoea ananatis handelt.
6. Hefestamm gemäß einem der Ansprüche 1 bis 5 dadurch gekennzeichnet, dass er die Gene crtB und crti exprimiert, die Gene GGS1 und HMG1 überexprimiert und eine Deletion der Gene P0X1 , P0X2, P0X3, POX4, POX5, P0X6 und GUT2 aufweist .
7. Hefestamm gemäß Anspruch 6, dadurch gekennzeichnet, dass die Sequenz der Gene crtB und crti an die Codon-Verwendung von Yarrowia lipolytica angepasst ist.
8. Verfahren zur Herstellung von Lycopin dadurch gekennzeichnet ist, dass ein Hefestamm gemäß Anspruch 1 bis 7 in einem Fermenter unter limitierten Wachstumsbedingungen fermentiert wird. 52
9. Verfahren gemäß Anspruch 8, dadurch gekennzeichnet, dass der Stickstoffgehalt im Medium während der Fermentation kleiner als 2 g l_1ist.
10. Verfahren gemäß Anspruch 8 oder 9, dadurch gekennzeichnet, dass der pH-Wert zwischen 1 und 5,5 liegt.
PCT/EP2014/059846 2013-05-28 2014-05-14 Hefestamm und verfahren zur produktion von lycopin WO2014191205A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102013209950.9A DE102013209950A1 (de) 2013-05-28 2013-05-28 Hefestamm und Verfahren zur Produktion von Lycopin
DE102013209950.9 2013-05-28

Publications (1)

Publication Number Publication Date
WO2014191205A1 true WO2014191205A1 (de) 2014-12-04

Family

ID=50721795

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2014/059846 WO2014191205A1 (de) 2013-05-28 2014-05-14 Hefestamm und verfahren zur produktion von lycopin

Country Status (2)

Country Link
DE (1) DE102013209950A1 (de)
WO (1) WO2014191205A1 (de)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112779295A (zh) * 2020-12-31 2021-05-11 广东博沃特生物科技有限公司 一种产番茄红素酿酒酵母的高密度发酵培养基

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006091924A2 (en) * 2005-02-24 2006-08-31 Regents Of The University Of Minnesota Producing carotenoids
WO2006102342A2 (en) * 2005-03-18 2006-09-28 Microbia, Inc. Production of carotenoids in oleaginous yeast and fungi
WO2008073367A1 (en) * 2006-12-12 2008-06-19 E. I. Du Pont De Nemours And Company Carotenoid production in a recombinant oleaginous yeast
WO2009126890A2 (en) * 2008-04-10 2009-10-15 Microbia, Inc. Production of carotenoids in oleaginous yeast and fungi
WO2010004141A2 (fr) 2008-07-11 2010-01-14 Institut National De La Recherche Agronomique (Inra) Nouvelles souches de levure mutantes capables d'accumuler une grande quantité de lipides
WO2012001144A1 (fr) 2010-07-01 2012-01-05 Institut National De La Recherche Agronomique Optimisation de la synthese et de l'accumulation de lipides

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006091924A2 (en) * 2005-02-24 2006-08-31 Regents Of The University Of Minnesota Producing carotenoids
WO2006102342A2 (en) * 2005-03-18 2006-09-28 Microbia, Inc. Production of carotenoids in oleaginous yeast and fungi
US7851199B2 (en) 2005-03-18 2010-12-14 Microbia, Inc. Production of carotenoids in oleaginous yeast and fungi
US20110021843A1 (en) 2005-03-18 2011-01-27 Microbia, Inc. Production of carotenoids in oleaginous yeast and fungi
WO2008073367A1 (en) * 2006-12-12 2008-06-19 E. I. Du Pont De Nemours And Company Carotenoid production in a recombinant oleaginous yeast
WO2009126890A2 (en) * 2008-04-10 2009-10-15 Microbia, Inc. Production of carotenoids in oleaginous yeast and fungi
WO2010004141A2 (fr) 2008-07-11 2010-01-14 Institut National De La Recherche Agronomique (Inra) Nouvelles souches de levure mutantes capables d'accumuler une grande quantité de lipides
WO2012001144A1 (fr) 2010-07-01 2012-01-05 Institut National De La Recherche Agronomique Optimisation de la synthese et de l'accumulation de lipides

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
BHATAYA, A.; C. SCHMIDT-DANNERT ET AL., PROCESS BIOCHEMISTRY, vol. 44, no. 10, 2009, pages 1095 - 1102
LANGE, N.; A. STEINBUCHEL, APPL MICROBIOL BIOTECHNOL, vol. 91, no. 6, 2011, pages 1611 - 1622
MATTHAEUS FALK ET AL: "Production of Lycopene in the Non-Carotenoid-Producing Yeast Yarrowia lipolytica", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 80, no. 5, 27 December 2013 (2013-12-27), pages 1660 - 1669, XP008170176 *
MAUERSBERGER, S.; H. J. WANG ET AL., J BACTERIOL, vol. 183, no. 17, 2001, pages 5102 - 5109
MISAWA, N.; H. SHIMADA, J BIOTECHNOL, vol. 59, no. 3, 1998, pages 169 - 181
MIURA, Y.; K. KONDO ET AL., APPL ENVIRON MICROBIOL, vol. 64, no. 4, 1998, pages 1226 - 1229
NICAUD JEAN-MARC: "Yarrowia lipolytica", YEAST, vol. 29, no. 10, October 2012 (2012-10-01), pages 409 - 418, XP002726413 *
PAPP, T.; A. VELAYOS ET AL., APPL MICROBIOL BIOTECHNOL, vol. 69, no. 5, 2006, pages 526 - 531
SHIMADA; H., K. KONDO ET AL., APPL ENVIRON MICROBIOL, vol. 64, no. 7, 1998, pages 2676 - 2680
UKIBE, K.; K. HASHIDA ET AL., APPL ENVIRON MICROBIOL, vol. 75, no. 22, 2009, pages 7205 - 7211
VERWAAL, R.; J. WANG ET AL., APPL ENVIRON MICROBIOL, vol. 73, no. 13, 2007, pages 4342 - 4350
YAMANO, S.; T. ISHII ET AL., BIOSCI BIOTECHNOL BIOCHEM, vol. 58, no. 6, 1994, pages 1112 - 1114
YE, R. W.; P. L. SHARPE ET AL., METHODS MOL BIOL, vol. 898, 2012, pages 153 - 159

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112779295A (zh) * 2020-12-31 2021-05-11 广东博沃特生物科技有限公司 一种产番茄红素酿酒酵母的高密度发酵培养基
CN112779295B (zh) * 2020-12-31 2022-12-13 广东博沃特生物科技有限公司 一种产番茄红素酿酒酵母的高密度发酵培养基

Also Published As

Publication number Publication date
DE102013209950A1 (de) 2014-12-04

Similar Documents

Publication Publication Date Title
EP3080252B1 (de) Hefestämme und verfahren zur produktion von -hydroxyfettsäuren und dicarbonsäuren
DE112014000710T5 (de) Bakterienstamm mit hoher Ausbeute an 5-Aminolävulinsäure, Herstellungsverfahren und Verwendungen dafür
EP2692729B1 (de) Verfahren zur biotechnologischen Herstellung von Dihydrochalkonen
BRPI0214366B1 (pt) célula de candida e, métodos para produzir um ou mais de isocitrato, alfa-cetoglutarato, lactato, succinato, malato, fumarato, oxaloacetato, citrato e acrilato, e para produzir uma célula
CN108138193A (zh) 产乳酸微生物及使用其生产乳酸的方法
EP3000888A1 (de) Verfahren zur Umwandlung von Ferulasäure in Vanillin
EP3169768B1 (de) Gentechnisch veränderte hefe mit verbessertem glycerol-katabolismus
WO2023220060A1 (en) Enzymatic lysis for extraction of bioproducts from yeast
DE60115757T2 (de) Verfahren zur Herstellung von Astaxanthin
CN106574236A (zh) 遗传修饰的产生(r)‑乳酸的嗜热细菌
WO2013087714A1 (de) Pilzstämme mit genetischer modifikation betreffend einen carbonsäure-transporter
WO2014191205A1 (de) Hefestamm und verfahren zur produktion von lycopin
DE112019000467T5 (de) Rekombinanter Mikroorganismus, Verfahren zu dessen Herstellung und seine Anwendung bei der Herstellung von Coenzym Q10
EP1504103B1 (de) Promotoren mit veränderter transkriptionseffizienz aus der methylotrophen hefe hansenula polymorpha
WO2003097848A1 (de) Verfahren zur biotechnologischen herstellung von xylit
EP1196592B1 (de) Expressionssystem zur Produktion von Proteinen in Pilzen
JP2012254044A (ja) 酵母におけるアセチルＣｏＡを経由する代謝経路を利用した物質の製造法
EP0930367B1 (de) Pilz der Gattung Ashbya zur Herstellung von Riboflavin
WO1999051757A1 (de) Expressionssystem zur produktion von proteinen
WO2006136311A1 (de) Metabolic engineering der q10-produktion in hefen der gattung sporidiobolus
DE10333144B4 (de) Verfahren zur biotechnologischen Herstellung von Citronensäure mit einer genetisch veränderten Hefe Yarrowia lipolytica
WO2018211002A1 (de) Verfahren zur fermentativen de novo synthese von harzsäuren
EP4095230A1 (de) Gentechnisch veränderte hefe zur biotechnologischen herstellung von bernsteinsäure aus glycerin
DE102014109858A1 (de) Gentechnisch veränderte Hefe mit verbessertem Glycerol-Katabolismus
KR101763820B1 (ko) 글리세롤의 생성이 억제된 2,3-부탄다이올이 생산방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14723809

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14723809

Country of ref document: EP

Kind code of ref document: A1