WO2014066663A1 - Platelet targeted treatment - Google Patents
Platelet targeted treatment Download PDFInfo
- Publication number
- WO2014066663A1 WO2014066663A1 PCT/US2013/066651 US2013066651W WO2014066663A1 WO 2014066663 A1 WO2014066663 A1 WO 2014066663A1 US 2013066651 W US2013066651 W US 2013066651W WO 2014066663 A1 WO2014066663 A1 WO 2014066663A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gene
- composition
- expression
- platelets
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/745—Blood coagulation or fibrinolysis factors
- C07K14/755—Factors VIII, e.g. factor VIII C (AHF), factor VIII Ag (VWF)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70546—Integrin superfamily
- C07K14/7055—Integrin beta1-subunit-containing molecules, e.g. CD29, CD49
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K2035/124—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells the cells being hematopoietic, bone marrow derived or blood cells
Definitions
- the present disclosure relates to compositions and methods for targeting expression of exogenous genes to platelets.
- the present disclosure relates to treatment of hemophilia and other diseases and conditions by targeting expression of exogenous agents (e.g., clotting factors) to platelets.
- exogenous agents e.g., clotting factors
- Hemophilia is a common bleeding disorder (occurring in approximately 1 : 10,000 males) in which causes severe internal bleeding that often leads to death because the patient's blood doesn't clot normally. Hemophilia usually is inherited with patients displaying severe uncontrollable bleeding events beginning at birth and re -occurring throughout the
- Hematopoietic stem cells differentiate in the bone marrow to form megakaryocytes that mature and break-up into several thousand small fragments known as platelets, which in normal conditions circulate quietly (not interacting with the other blood cells or the vessel wall) in the blood stream for approximately 10 days with the main job to become activated, change shape and stick to damaged blood vessel to repair the injury.
- platelets When blood vessels are injured, clotting factors help platelets stick together to plug cuts and close breaks on the vessels to stop bleeding.
- Hemophilia can be mild, moderate, or severe, depending on how much normal functional clotting factor is present in the blood. About 7 out of 10 people who have hemophilia A have the severe form of the disorder.
- Hemophilia usually occurs in males because Factors VIII and IX are located on the X chromosome (although with rare exceptions females who inherit a defective X chromosome each from an affected father and mother who is a carrier for the disease). About 1 in 10,000 individuals are born with hemophilia each year all over the world.
- the main treatment for hemophilia is protein replacement therapy.
- Concentrates of clotting factor VIII (for hemophilia A) or clotting factor IX (for hemophilia B) can be isolated from pools of donor blood or recombinant protein that has been prepared from tissue culture cell lines transformed with the normal genes encoding FVIII or FIX that are slowly dripped or injected into a vein at the onset of a serious bleeding event. These infusions help replace the clotting factor that's missing or low.
- Complications of replacement therapy include developing antibodies response to the normal therapeutic protein that is foreign to the patient's immune system (known as inhibitor formation), which ultimately leads to inactivation or destruction of the clotting factor and uncontrolled bleeding in about 30% of patients, developing viral infections from human clotting factors (from blood contaminated with HIV or Hepatitis from infected blood donors especially in third world countries), very expensive costs of the replacement protein which has a very short half-life (days) which requires frequent re-administration to subside a severe vascular injury and damage to joints, muscles, or other parts of the body resulting from delays in treatment.
- the present disclosure relates to compositions and methods for targeting expression of exogenous genes to platelets.
- the present disclosure relates to treatment of hemophilia and other diseases and conditions by targeting expression of exogenous agents (e.g., clotting factors) to platelets.
- exogenous agents e.g., clotting factors
- the present disclosure relates to compositions and clinically relevant methods for hematopoietic stem cell gene therapy where targeting expression of exogenous genes within bone marrow megakaryocytes leads to expression and/or storage of recombinant therapeutic proteins within human platelets.
- the present invention provides a composition comprising an expression vector comprising a) an expression cassette comprising a fragment of the integrin allb gene (ITGA2B) promoter; and an exogenous gene of interest operably linked to the expression cassette.
- an expression vector comprising a) an expression cassette comprising a fragment of the integrin allb gene (ITGA2B) promoter; and an exogenous gene of interest operably linked to the expression cassette.
- the expression cassette comprises, consists essentially of, or consists of a nucleic acid sequence selected from, for example, SEQ ID NOs: 21, 22, or 23, or sequences larger or smaller than SEQ ID NOs:21, 22, 23, or 25 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 75, 100, 150, 200, 300, 400, 500, 600 or more nucleotides larger or smaller than SEQ ID NOs: 21, 22, 23, and 25) or fragments thereof.
- SEQ ID NOs: 21, 22, or 23, or sequences larger or smaller than SEQ ID NOs:21, 22, 23, or 25 e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 75, 100, 150, 200, 300, 400, 500, 600 or more nucleotides larger or smaller than SEQ ID NOs: 21, 22, 23, and 25
- the expression vector further comprises targeting factor (e.g., a fragment of the human Von Willebrand Factor propeptide (VWFpp) operably linked to a D2 domain) (e.g., as described by SEQ ID NO:24 or sequences 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 75, 100, 150, 200, 300, 400, 500, 600 or more nucleotides larger or smaller than SEQ ID NO: 24 or fragment of SEQ ID NO:24).
- VWFpp Von Willebrand Factor propeptide
- the present invention is not limited to a particular exogenous gene. Examples include, but are not limited to, a human FVIII or FIX gene.
- the vector is a self-inactivating vector, for example, a retroviral vector (e.g., a lenti viral vector).
- hematopoietic stem cell comprising the expression vectors described herein (e.g., an ex vivo stem cell).
- the present invention provides the use of such stem cells to treat diseases and conditions (e.g., hemophilia) in an animal (e.g., a human).
- diseases and conditions e.g., hemophilia
- the present invention also provides a method, comprising: contacting a hematopoietic stem cell with a vector as described herein to generate a modified stem cell under conditions such that a gene (e.g., Factor VIII gene) is expressed in the modified stem cell.
- the method further comprises the step of transferring said modified stem cell into an animal (e.g., human).
- the animal has been diagnosed with hemophilia and the transferring treats or prevents excessive bleeding in the animal.
- the contacting occurs ex vivo.
- the stem cells are mobilized from the animal (e.g., by administration of cytokines, mobilization into peripheral blood, contacting apheresis collection, immune magnetic bead isolation).
- cytokines mobilization into peripheral blood
- contacting apheresis collection immune magnetic bead isolation
- the animal expresses said Factor VIII in platelets.
- the method is repeated (e.g., at regular intervals or when needed).
- FIGURES Figure 1 shows platelet-targeted lentiviral vector design.
- ITGA2B gene promoter fragments direct megakaryocyte-specific expression in luciferase.
- B -889ITGA2B- BDDFVIII-WPTS lentiviral vector diagram.
- C -673ITGA2B-VWFSPD2-BDDFVIII-WPTS lentiviral vector diagram.
- Figure 2 shows synthesis and trafficking of BDDFVIII into canine platelet a-granules
- FIG. 3 shows quantitative analysis of platelet FVIII.
- Figure 4 shows activated platelets induced to secrete FVIILC.
- Figure 5 shows PCR analysis for detection and localization of lentiviral vector within canine genome.
- A long-term detection of BDDFVIII-lentiviral vector within leukocyte genomic DNA.
- B linear amplification-mediated (LAM)-PCR to localize lentiviral vector within
- Figure 6 shows correction of the canine Hemophilia A phenotype with platelet
- Figures 7 shows structural regions of the ITGA2B gene promoter and VWFspD2. Arrows show serious bleeding events before and after platelet targeted treatment. Dogs 142 and M64 show complete correction of hemostasis
- Figure 8 shows an exemplary lentiviral gene therapy vector of embodiments of the present disclosure.
- Figure 9 shows the sequence (SEQ ID NO:25) of the vector of figure 8.
- Figure 10 shows a diagram and nucleotide sequence for integrin allb promoter fragments used in recombinant lentivirus gene transfer constructs.
- A Nucleotide sequence for -Sal I Bgl II -1218 to +30 of human allb-gene promoter Nco I used for Megakaryocyte- Specific Luciferase reporter studies (SEQ ID NO:21).
- B Nucleotide sequence for -Sal I Bgl II -889 to +30 of human allb-gene promoter Nco I used for Megakaryocyte-Specific
- gene transfer system refers to any means of delivering a composition comprising a nucleic acid sequence to a cell or tissue.
- gene transfer systems include, but are not limited to, vectors (e.g., retroviral, adenoviral, adeno- associated viral, human artificial chromosomes, and other nucleic acid-based delivery systems), microinjection of naked nucleic acid, polymer-based delivery systems (e.g., liposome -based and metallic particle-based systems), biolistic injection, and the like.
- viral gene transfer system refers to gene transfer systems comprising viral elements (e.g., intact viruses, modified viruses and viral components such as nucleic acids or proteins) to facilitate delivery of the sample to a desired cell or tissue.
- adenovirus gene transfer system refers to gene transfer systems comprising intact or altered viruses belonging to the family Adenoviridae.
- nucleic acid molecule refers to any nucleic acid containing molecule, including but not limited to, DNA or RNA.
- the term encompasses sequences that include any of the known base analogs of DNA and RNA including, but not limited to,
- gene refers to a nucleic acid (e.g., DNA) sequence that comprises coding sequences necessary for the production of a polypeptide, precursor, or RNA (e.g., rRNA, tRNA).
- the polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or functional properties (e.g. , enzymatic activity, ligand binding, signal transduction, immunogenicity, etc.) of the full-length or fragment are retained.
- the term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb or more on either end such that the gene corresponds to the length of the full- length mRNA. Sequences located 5' of the coding region and present on the mRNA are referred to as 5' non-translated sequences. Sequences located 3' or downstream of the coding region and present on the mRNA are referred to as 3' non-translated sequences.
- genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed “introns” or “intervening regions” or “intervening sequences.”
- Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or “spliced out” from the nuclear or primary transcript;
- introns therefore are absent in the messenger RNA (mRNA) transcript.
- mRNA messenger RNA
- the mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.
- heterologous gene refers to a gene that is not in its natural environment.
- a heterologous gene includes a gene from one species introduced into another species.
- a heterologous gene also includes a gene native to an organism that has been altered in some way (e.g., mutated, added in multiple copies, linked to non-native regulatory sequences, etc).
- Heterologous genes are distinguished from endogenous genes in that the heterologous gene sequences are typically joined to DNA sequences that are not found naturally associated with the gene sequences in the chromosome or are associated with portions of the chromosome not found in nature (e.g., genes expressed in loci where the gene is not normally expressed).
- Promoter/enhancer denotes a segment of DNA which contains sequences capable of providing both promoter and enhancer functions (i.e., the functions provided by a promoter element and an enhancer element, see above for a discussion of these functions).
- the enhancer/promoter may be "endogenous” or “exogenous” or “heterologous.”
- An "endogenous” enhancer/promoter is one that is naturally linked with a given gene in the genome.
- tissue specific or cell specific refers to a regulatory element that is capable of directing selective expression of a nucleotide sequence of interest to a specific type of tissue (e.g., mammary gland) in the relative absence of expression of the same nucleotide sequence(s) of interest in a different type of tissue (e.g., liver).
- Tissue specificity of a regulatory element may be evaluated by, for example, operably linking a reporter gene to a promoter sequence (which is not tissue-specific) and to the regulatory element to generate a reporter construct, introducing the reporter construct into the genome of an animal such that the reporter construct is integrated into every tissue of the resulting transgenic animal, and detecting the expression of the reporter gene (e.g., detecting mR A, protein, or the activity of a protein encoded by the reporter gene) in different tissues of the transgenic animal.
- the detection of a greater level of expression of the reporter gene in one or more tissues relative to the level of expression of the reporter gene in other tissues shows that the regulatory element is "specific" for the tissues in which greater levels of expression are detected.
- tissue-specific e.g., liver-specific
- tissue-specific does not require that one tissue have extremely high levels of expression and another tissue have no expression. It is sufficient that expression is greater in one tissue than another.
- tissue-specific expression is meant to indicate expression in a single tissue type (e.g., liver) with no detectable expression in other tissues.
- portion or “fragment” when in reference to a nucleotide sequence (as in “a portion or fragment of a given nucleotide sequence”) refers to fragments of that sequence.
- the fragments may range in size from four nucleotides to the entire nucleotide sequence minus one nucleotide (10 nucleotides, 20, 30, 40, 50, 100, 200, etc.).
- fragments comprise a nucleotide sequence (e.g., promoter) that are 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 100, 150, or 200 nucleotides less than the sequence or subsets thereof (e.g., 31 , 32, 33, 34, 35, 35, 36, 37, 38, 39 nucleotides shorter and the like).
- a nucleotide sequence e.g., promoter
- sequences thereof e.g., 31 , 32, 33, 34, 35, 35, 36, 37, 38, 39 nucleotides shorter and the like.
- oligonucleotide refers to a short length of single-stranded polynucleotide chain. Oligonucleotides are typically less than 200 residues long (e.g., between 15 and 100), however, as used herein, the term is also intended to encompass longer polynucleotide chains. Oligonucleotides are often referred to by their length. For example a 24 residue oligonucleotide is referred to as a "24-mer”. Oligonucleotides can form secondary and tertiary structures by self-hybridizing or by hybridizing to other polynucleotides.
- Such structures can include, but are not limited to, duplexes, hairpins, cruciforms, bends, and triplexes.
- the terms "complementary” or “complementarity” are used in reference to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules.
- the sequence "5'-A-G-T-3', M is complementary to the sequence "3'-T-C-A-5 ⁇ "
- Complementarity may be "partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be “complete” or “total” complementarity between the nucleic acids.
- the degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids.
- a partially complementary sequence is a nucleic acid molecule that at least partially inhibits a completely complementary nucleic acid molecule from hybridizing to a target nucleic acid is "substantially homologous.” The inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or Northern blot, solution
- a substantially homologous sequence or probe will compete for and inhibit the binding (i.e., the hybridization) of a completely homologous nucleic acid molecule to a target under conditions of low stringency.
- conditions of low stringency are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction.
- the absence of non-specific binding may be tested by the use of a second target that is substantially non-complementary (e.g. , less than about 30% identity); in the absence of non-specific binding the probe will not hybridize to the second non-complementary target.
- substantially homologous refers to any probe that can hybridize to either or both strands of the double-stranded nucleic acid sequence under conditions of low stringency as described above.
- a gene may produce multiple RNA species that are generated by differential splicing of the primary RNA transcript.
- cDNAs that are splice variants of the same gene will contain regions of sequence identity or complete homology (representing the presence of the same exon or portion of the same exon on both cDNAs) and regions of complete non-identity (for example, representing the presence of exon "A” on cDNA 1 wherein cDNA 2 contains exon "B" instead). Because the two cDNAs contain regions of sequence identity they will both hybridize to a probe derived from the entire gene or portions of the gene containing sequences found on both cDNAs; the two splice variants are therefore substantially homologous to such a probe and to each other.
- substantially homologous refers to any probe that can hybridize (i.e., it is the complement of) the single-stranded nucleic acid sequence under conditions of low stringency as described above.
- hybridization is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is impacted by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, the T m of the formed hybrid, and the G:C ratio within the nucleic acids. A single molecule that contains pairing of complementary nucleic acids within its structure is said to be “self- hybridized.”
- isolated when used in relation to a nucleic acid, as in “an isolated oligonucleotide” or “isolated polynucleotide” refers to a nucleic acid sequence that is identified and separated from at least one component or contaminant with which it is ordinarily associated in its natural source. Isolated nucleic acid is such present in a form or setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acids as nucleic acids such as DNA and RNA found in the state they exist in nature. For example, a given DNA sequence (e.g.
- RNA sequences such as a specific mRNA sequence encoding a specific protein, are found in the cell as a mixture with numerous other mRNAs that encode a multitude of proteins.
- isolated nucleic acid encoding a given protein includes, by way of example, such nucleic acid in cells ordinarily expressing the given protein where the nucleic acid is in a chromosomal location different from that of natural cells, or is otherwise flanked by a different nucleic acid sequence than that found in nature.
- the isolated nucleic acid, oligonucleotide, or polynucleotide may be present in single- stranded or double-stranded form.
- oligonucleotide or polynucleotide When an isolated nucleic acid, oligonucleotide or polynucleotide is to be utilized to express a protein, the oligonucleotide or polynucleotide will contain at a minimum the sense or coding strand (i.e., the oligonucleotide or
- polynucleotide may be single-stranded), but may contain both the sense and anti-sense strands (i.e., the oligonucleotide or polynucleotide may be double-stranded).
- purified or “to purify” refers to the removal of components (e.g., contaminants) from a sample.
- components e.g., contaminants
- antibodies are purified by removal of contaminating non-immunoglobulin proteins; they are also purified by the removal of immunoglobulin that does not bind to the target molecule.
- recombinant polypeptides are expressed in bacterial host cells and the polypeptides are purified by the removal of host cell proteins; the percent of recombinant polypeptides is thereby increased in the sample.
- sample is used in its broadest sense. In one sense, it is meant to include a specimen or culture obtained from any source, as well as biological and environmental samples. Biological samples may be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases. Biological samples include blood products, such as plasma, serum and the like. Environmental samples include environmental material such as surface matter, soil, water, and industrial samples. Such examples are not however to be construed as limiting the sample types applicable to the present invention.
- the term "subject” refers to organisms to be treated by the methods of the present invention. Such organisms preferably include, but are not limited to, mammals (e.g., murines, simians, equines, bovines, porcines, canines, felines, and the like), and most preferably includes humans.
- the term “subject” generally refers to an individual who will receive or who has received treatment (e.g., administration of a compound of the present invention and optionally one or more other agents) for a condition characterized by bacterial infection.
- the present disclosure relates to compositions and methods for targeting expression of exogenous genes to platelets.
- the present disclosure relates to treatment of hemophilia and other diseases and conditions by targeting expression of exogenous agents (e.g., clotting factors) to platelets.
- exogenous agents e.g., clotting factors
- Embodiments of the present invention provide compositions and method for directing expression of a heterologous gene to a specific cell type using a cell-specific promoter.
- expression of heterologous or exogenous genes is targeted to a stem cell (e.g., cancer stem cell or hematopoietic stem cell) that in turn expresses the gene of interest in progenitor cells (e.g., platelets).
- stem cell e.g., cancer stem cell or hematopoietic stem cell
- progenitor cells e.g., platelets.
- the compositions and methods find use in the treatment of a variety of disease (e.g., platelet mediated diseases such as hemophilia).
- Certain embodiments of the present invention are illustrated based on treatment of hemophilia with exogenous or heterologous clotting factors, although the present invention is not limited to the treatment of hemophilia or platelet disorders.
- the present disclosure relates to treatment of hemophilia and rare and common inherited bleeding disorders as well as other diseases states that involve platelets (e.g. thrombosis of veins and arteries, immune response, and cancer) and conditions by employing hematopoietic stem cell gene therapy using a fragment of a platelet specific gene promoter to drive expression of proteins only in the platelet lineage and in some circumstances fusion of a signal peptide to the therapeutic molecule to traffic recombinant proteins specifically to platelet a-granules to induce regulated release of the exogenous agents from activated platelets at the site of injury.
- platelets e.g. thrombosis of veins and arteries, immune response, and cancer
- this approach allows platelets to be utilized as a vehicle to deliver therapeutic agents to enable wound repair targeting expression of exogenous agents (e.g., normal replacement proteins to restore hemostasis by correcting inherited platelet defects, clotting factors for hemophilia, anti-thrombotic agents for deep vein thrombosis and artery occlusion and anti -neoplastic agents to shrink solid tumors and prevent angiogenesis in cancer) to platelets.
- exogenous agents e.g., normal replacement proteins to restore hemostasis by correcting inherited platelet defects, clotting factors for hemophilia, anti-thrombotic agents for deep vein thrombosis and artery occlusion and anti -neoplastic agents to shrink solid tumors and prevent angiogenesis in cancer
- Embodiments of the present invention provide autologous transplant of hematopoietic stem cells transduced with genes encoding normal integrin gene promoter driving synthesis of coagulation FVIII within platelets for correction of hemophilia A within humans. De novo synthesis of a biologically normal molecule within
- megakaryocytes has previous allowed trafficking of the entire protein to allow platelets to participate in wound repair. This is supported by the recent success of using hematopoietic stem cell gene transfer of integrin allb gene promoter driving expression of integrin allb to generate denovo synthesis of integrin ⁇ 3 ⁇ 4 ⁇ 3 receptor complex on platelets for improved platelet function and reduced bleeding times and blood loss for dogs deficient in integrin allb affected with canine Glanzmann Thrombasthenia (GT) (Fang, J. et al. Proc Natl Acad Sci U S A 108, 9583-9588 (2011)).
- GT Glanzmann Thrombasthenia
- G-PBC G-CSF mobilized peripheral blood stem cells
- the present invention provides compositions and methods for genetic therapies for targeting stem cells (e.g., hematopoietic stem cells).
- stem cells e.g., hematopoietic stem cells.
- the compositions and methods described herein find use in the treatment of a variety of disease and conditions (e.g., platelet mediated disorders).
- compositions and methods comprise in vivo or ex vivo genetic therapies.
- hematopoietic stem cells are mobilized and targeted ex vivo with vectors that target expression of exogenous genes (e.g., clotting factors, platelet proteins pertinent to platelet function, anti-thrombotic agents for thrombotic disorders and anti-angiogenic and anti-neoplastic agents for oncogenic disorders) specifically to platelets following reintroduction of the modified hematopoietic stem cells.
- exogenous genes e.g., clotting factors, platelet proteins pertinent to platelet function, anti-thrombotic agents for thrombotic disorders and anti-angiogenic and anti-neoplastic agents for oncogenic disorders
- expression cassettes comprise an exogenous gene of interest operable linked to a cell (e.g., platelet) specific promoter.
- expression cassettes further comprise genes expression targeting or signal molecules, as well as expression enhancers.
- Figures 7, 8, and 10 show exemplary expression cassettes and vectors useful in embodiments of the present invention. Exemplary vector components are described below.
- vectors comprise promoters that direct gene expression to particular cell type.
- promoters are platelet specific promoters. The present invention is not limited to particular platelet specific promoter.
- truncated integrin allb gene (ITGA2B) promoters are used. Exemplary promoters include, but are not limited to, -1218, -889 and -673 ITGA2B promoters that encode"ETS" and "GAT A" elements for high level of gene transcription within
- the nucleotide sequence of the ITGA2B gene promoter was first characterized in 1988 by a group in France headed by Dr. Gerard Marguerie (Prandini MH, Denarier E, Frachet P, Uzan G, Marguerie G. Isolation of the human platelet glycoprotein lib gene and characterization of the 5' flanking region. Biochem Biophys Res Commun 1988, 156(1): 595- 601).
- Figure 7 shows structural regions of the ITGA2B promoter.
- a fragment e.g., 1218, -889 and -673
- the - 673 contains all of the essential regulatory elements to drive platelet-specific transgene expression.
- the Murine ITGA2B promoter was cloned and found to have very high nucleotide sequence homology with the human ITGA2B promoter, especially at the regions where transcription factors consensus binding sequences were identified (Denarier E, Martin F, Martineau S, Marguerie G. PCR cloning and sequence of the murine GPIIb gene promoter. Biochem Biophys Res
- the present invention is not limited to the ITGA2B promoters described in SEQ ID NOs: 21-23). Embodiments of the present invention contemplate fragments, portions, and combinations of the fragments described herein. In some embodiments, fragments are shorter than the full length ITGA2B promoter (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 75, 100, 150, 200 or more nucleotides shorter) and maintain desired activity (e.g., the ability to drive cell-specific expression to elicit a desired effect, e.g., reduction in sing or symptoms of a disease or condition).
- desired activity e.g., the ability to drive cell-specific expression to elicit a desired effect, e.g., reduction in sing or symptoms of a disease or condition.
- promoters comprise the ITGA2B fragments described in SEQ ID NO: 1
- ID NOs: 21, 22, and 23 or sequences that are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 75, 100, 150, 200, 300, 400, 500, 600 or more nucleotides larger or smaller than SEQ ID NOs: 21, 22, and 23.
- fragments that are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 75, 100, 150, 200 or more nucleotides smaller than SEQ ID NO:21 are utilized.
- fragments that are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 75, 100, 150, 200, 300, 400, 500, 600 or more nucleotides larger than SEQ ID NO:23 are utilized.
- discontinuous fragments of SEQ ID NOs: 21, 22, or 23 that retain promoter activity are utilized.
- 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 75, 100, 150, 200, 300, 400, 500, 600 nucleotides of SEQ ID NOs 21, 22, or 23 are utilized.
- promoter fragments comprise one or more elements useful for promoter activity. Examples include, but are not limited to, GATA elements (e.g., GATA54 or GATA454), sPl elements, Ets35 elements, and the like (See e.g., Block et al, Blood 1994 84: 3385-3393; Prandini et al, Blood 1996 88: 2062-2070; Block et al, Blood 1996 88: 2071-2080; and Doubeikovski et al, J. Biol. Chem. 272: 24300-24307, 1997; each of which is herein incorporated by reference in its entirety).
- GATA elements e.g., GATA54 or GATA454
- sPl elements e.g., Ets35 elements, and the like
- the 5 ' ends of promoters are modified to add restriction endonuclease sites to aid in cloning and constructing expression vectors.
- 1, 2, 3, or 4 nucleotides at the 5' end are modified from the wild type sequence or the fragments disclosed herein to add restriction endonuclease sites.
- the fragments comprise, consist essentially of, or consist of promoter sequence found in SEQ ID NOs: 21, 22, or 23.
- exogenous genes are generally clotting factors (e.g., Factor VIII and/or Factor IX).
- Human Factor VIII has the accession number NM 000132.3 and Human Factor IX has the accession number NM 000133.3.
- exogenous genes may be utilized in the treatment of other platelet related conditions.
- exogenous genes useful in the treatment of diseases other than platelet related disorders are utilized (e.g., in the treatment of cancer by using platelets to target release of anti-neplastic agents "i.e. IL-24" to shrink solid tumors and anti-thrombotic agents to be released at the site of blood clots such as cases of deep vein thrombosis).
- expression cassettes further comprise a targeting factor that targets expression into a particular sub-structure of a platelet.
- expression cassettes further comprise the minimal amino acid sequence of a signal sequence peptide that has been found to be able traffic not only VWF but also recombinant proteins fused to the peptide that has the proven ability to store proteins in cellular granule
- expression constructs comprise a nucleic acid encoding a Von Willebrand Factor propeptide signal peptide and D2 domain (SPD2) to promote trafficking of molecules directly into the a-granule compartment as shown in Rosenberg JB et al, Intracellular Trafficking of FVIII to von Willebrand Factor storage Granules, J. Clin. Invest. 101, 613-624 (1998); Haberichter SL, Jacobi P, Montgomery RR. Critical
- FIG. 7 An example of an expression cassette comprising a 673 bp fragment of the ITGA2B gene promoter and a VWF/SPD2 gene is shown in Figure 7 (SEQ ID NO:24). Variants of these sequences that retain its desired activity are specifically contemplated for use in compositions and methods of embodiments of the present invention.
- constructs comprise an expression enhancer (e.g., Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE)) between the promoter/signaling cassette and the exogenous gene of interest.
- WPRE Woodchuck Hepatitis Virus
- This element has been utilized by several gene transfer strategies because its structure inhibits degradation of the transcript within the cell and thus allows for more therapeutic protein to be synthesized compared to a gene transfer vector in the absence of WPRE.
- vectors are self-inactivating.
- vectors are retroviral vectors (e.g., lentiviral vectors). Table 2 provides a summary of exemplary suitable vectors. able 2
- Retroviruses family Retro viridae are divided into three groups: the spumaviruses (e.g., human foamy virus); the lentiviruses (e.g., human immunodeficiency virus and sheep visna virus) and the oncoviruses (e.g., MLV, Rous sarcoma virus).
- the spumaviruses e.g., human foamy virus
- the lentiviruses e.g., human immunodeficiency virus and sheep visna virus
- the oncoviruses e.g., MLV, Rous sarcoma virus.
- Retroviruses are enveloped (e.g., surrounded by a host cell-derived lipid bilayer membrane) single-stranded RNA viruses that infect animal cells.
- a retrovirus infects a cell, its RNA genome is converted into a double-stranded linear DNA form (e.g., it is reverse transcribed).
- the DNA form of the virus is then integrated into the host cell genome as a provirus.
- the provirus serves as a template for the production of additional viral genomes and viral mRNAs. Mature viral particles containing two copies of genomic RNA bud from the surface of the infected cell.
- the viral particle comprises the genomic RNA, reverse transcriptase and other pol gene products inside the viral capsid (which contains the viral gag gene products), which is surrounded by a lipid bilayer membrane derived from the host cell containing the viral envelope glycoproteins (also referred to as membrane-associated proteins).
- retroviral vector which contains the sequences necessary for the efficient expression of the gene of interest (including promoter and/or enhancer elements which may be provided by the viral long terminal repeats [LTRs] or by an internal promoter/enhancer and relevant splicing signals), sequences required for the efficient packaging of the viral RNA into infectious virions (e.g., the packaging signal [Psi], the tRNA primer binding site [-PBS], the 3' regulatory sequences required for reverse transcription [+PBS] and the viral LTRs).
- promoter and/or enhancer elements which may be provided by the viral long terminal repeats [LTRs] or by an internal promoter/enhancer and relevant splicing signals
- sequences required for the efficient packaging of the viral RNA into infectious virions e.g., the packaging signal [Psi], the tRNA primer binding site [-PBS], the 3' regulatory sequences required for reverse transcription [+PBS] and the viral LTRs.
- the LTRs contain sequences required for the association of viral genomic RNA, reverse transcriptase and integrase functions, and sequences involved in directing the expression of the genomic RNA to be packaged in viral particles.
- many recombinant retroviral vectors lack functional copies of the genes that are essential for viral replication (these essential genes are either deleted or disabled); the resulting virus is said to be replication defective.
- the vector DNA is introduced into a packaging cell line.
- Packaging cell lines provide viral proteins required in trans for the packaging of the viral genomic RNA into viral particles having the desired host range (e.g., the viral-encoded gag, pol and env proteins). The host range is controlled, in part, by the type of envelope gene product expressed on the surface of the viral particle.
- Packaging cell lines may express ecotrophic, amphotropic or xenotropic envelope gene products.
- the packaging cell line may lack sequences encoding a viral envelope (env) protein. In this case the packaging cell line will package the viral genome into particles that lack a membrane-associated protein (e.g., an env protein).
- the packaging cell line containing the retroviral sequences is transfected with sequences encoding a membrane-associated protein (e.g., the G protein of vesicular stomatitis virus [VSV]).
- VSV vesicular stomatitis virus
- the transfected packaging cell will then produce viral particles that contain the membrane-associated protein expressed by the transfected packaging cell line; these viral particles, which contain viral genomic RNA derived from one virus encapsidated by the envelope proteins of another virus are said to be pseudotyped virus particles.
- Viral vectors including recombinant retroviral vectors, provide a more efficient means of transferring genes into cells as compared to other techniques such as calcium phosphate -DNA co-precipitation or DEAE-dextran-mediated transfection, electroporation or microinjection of nucleic acids. It is believed that the efficiency of viral transfer is due in part to the fact that the transfer of nucleic acid is a receptor-mediated process (i.e., the virus binds to a specific receptor protein on the surface of the cell to be infected).
- nucleic acids transferred by other means such as calcium phosphate-DNA co-precipitation are subject to rearrangement and degradation.
- MoMLV amphotropic Moloney murine leukemia virus
- the MoMLV system has several advantages: 1) this specific retrovirus can infect many different cell types, 2) established packaging cell lines are available for the production of recombinant MoMLV viral particles and 3) the transferred genes are permanently integrated into the target cell chromosome.
- the established MoMLV vector systems comprise a DNA vector containing a small portion of the retroviral sequence (the viral long terminal repeat or "LTR" and the packaging or "psi" signal) and a packaging cell line. The gene to be transferred is inserted into the DNA vector.
- the viral sequences present on the DNA vector provide the signals necessary for the insertion or packaging of the vector RNA into the viral particle and for the expression of the inserted gene.
- the packaging cell line provides the viral proteins required for particle assembly (Markowitz et al., J. Virol., 62: 1120 [1988]).
- retrovectors are derived from lentiviruses including, but not limited to, human immunodeficiency virus (HIV) or feline immunodeficiency virus (FIV). Lentivirus vectors have the advantage of being able to infect non replicating cells.
- HIV human immunodeficiency virus
- FMV feline immunodeficiency virus
- retroviral vectors which contain the G protein of VSV as the membrane associated protein.
- the VSV G protein interacts with a phospholipid component of the plasma membrane (Mastromarino et al., J. Gen. Virol., 68:2359 [1977]). Because entry of VSV into a cell is not dependent upon the presence of specific protein receptors, VSV has an extremely broad host range.
- VSV G protein Pseudotyped retroviral vectors bearing the VSV G protein have an altered host range characteristic of VSV (i.e., they can infect almost all species of vertebrate, invertebrate and insect cells). Importantly, VSV G-pseudotyped retroviral vectors can be concentrated 2000-fold or more by
- the VSV G protein has also been used to pseudotype retroviral vectors based upon the human immunodeficiency virus (HIV) (Naldini et al, Science 272:263 [1996]).
- HIV human immunodeficiency virus
- the VSV G protein may be used to generate a variety of pseudotyped retroviral vectors and is not limited to vectors based on MoMLV.
- the present invention is not limited to the use of the VSV G protein when a viral G protein is employed as the heterologous membrane-associated protein within a viral particle. Sequences encoding other G proteins derived from other members of the Rhabdoviridae family may be used; sequences encoding numerous rhabdoviral G proteins are available from the GenBank database.
- retroviruses can transfer or integrate a double-stranded linear form of the virus (the provirus) into the genome of the recipient cell only if the recipient cell is cycling (i.e., dividing) at the time of infection.
- Retroviruses that have been shown to infect dividing cells exclusively, or more efficiently, include MLV, spleen necrosis virus, Rous sarcoma virus human immunodeficiency virus, and other lentiviral vectors.
- the present invention is not limited to retroviral vectors. Large numbers of suitable vectors are known to those of skill in the art, and are commercially available. Such vectors include, but are not limited to, the following vectors: 1) Bacterial— pQE70, pQE60, pQE 9 (Qiagen), pBS, pDIO, phagescript, psiX174, pbluescript SK, pBSKS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223 3, pKK233 3, pDR540, pRIT5
- mammalian expression vectors comprise, along with an expression cassette as described herein, an origin of replication, any necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non transcribed sequences.
- DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the non-transcribed genetic elements.
- the present invention provides systems and methods for genetic manipulation of stem cells (e.g., hematopoietic stem cells or cancer stem cells).
- stem cells e.g., hematopoietic stem cells or cancer stem cells.
- the compositions and methods described herein find use in the treatment of a variety of disorder related to platelet function (e.g., hemophilia and the disorders described in Table 3 below).
- hematopoietic stem cell gene therapy aimed at targeting therapeutic agents to the platelet surface, cytoplasm or granules finds use as a strategy to correct other disorders of hemostasis, thrombosis, immune response and cancer.
- therapeutic methods are ex vivo methods, in which autologous hematopoietic stem cells are harvested from an animal (e.g., human) in need of treatment, modified using one of the vector described herein, and re -introduced into the original donor.
- autologous methods reduce the risk of autoimmune or rejection responses that can occur with infusion of donor clotting factors and allow one to limit gene transduction to
- hematopoietic stem cells through ex vivo transduction.
- the method includes the steps of administering cytokines to mobilize peripheral blood stem cells into the peripheral blood; performing apheresis and magnetic bead selection for CD34+ cells; preconditioning using e.g., bulsulfan and/or other agents like fludarabine; and using a viral (e.g., lentiviral) gene transfer vector to modify stem cells before they are re -introduced into the patient.
- cytokines to mobilize peripheral blood stem cells into the peripheral blood
- preconditioning e.g., bulsulfan and/or other agents like fludarabine
- a viral e.g., lentiviral
- hematopoietic stem cells are mobilized using administration of cytokines or other mobilization agents (See e.g., Fu et al, Blood Rev. 2000 Dec;14(4):205-18 and United States Patent 7417026, each of which is herein incorporated by reference in its entirety for a discussion of mobilization protocols), although other suitable protocols may be utilized.
- cytokines See e.g., Fu et al, Blood Rev. 2000 Dec;14(4):205-18 and United States Patent 7417026, each of which is herein incorporated by reference in its entirety for a discussion of mobilization protocols
- mobilization cytokines include, but are not limited to, Interleukin-3 (IL-3), granulocyte colony stimulating factor (G-CSF), also known as Amgen's FDA approved drug Neupogen, stem cell factor (SCF), granulocyte macrophage colony-stimulating factor (GM-CSF), and sequential or co-administration of one or more of IL-3, GM-CSF, SCF, and GM-CSF.
- IL-3 Interleukin-3
- G-CSF granulocyte colony stimulating factor
- SCF stem cell factor
- GM-CSF granulocyte macrophage colony-stimulating factor
- Suitable dosage ranges for mobilization agents vary, but in general, the compounds are administered in the range of about 0.1 ⁇ g/kg-5 mg/kg of body weight; preferably the range is about 1 ⁇ g/kg-300 ⁇ g/kg of body weight; more preferably about 10 ⁇ g/kg-100 ⁇ g/kg of body weight.
- the dosage range is from about 0.7 ⁇ g-350 mg; preferably about 700 ⁇ g-21 mg; most preferably about 700 ⁇ g-7 mg.
- Dosages can be higher when the compounds are administered orally or transdermally as compared to, for example, i.v. administration.
- the compounds can be administered as a single bolus dose, a dose over time, as in i.v. or transdermal administration, or in multiple dosages.
- the amount of active compound to be administered can vary according to the discretion of the skilled artisan.
- the amount of active compound to be administered to the recipient is within the ranges described above for stem cell mobilization. However, the administration of such amounts will vary according to the standards set forth by clinicians in the field of stem cell enhancement therapy.
- CD34+ Peripheral Blood stem cells are isolated from the low molecular weight mononuclear cells by immunomagnetic beads using Miltenyi's automacs system (for large animal, dogs, 25-45 kg) and Miltenyi's Clinimacs system (for humans) recently approved for clinical use by the FDA.
- the CD34+PBC are the genetically modified using the vectors described herein and re-introduced into a subject in need by autologous stem cell transplant.
- a single treatment is utilized to provide long-term protection against episodes of bleeding.
- treatment is performed on a regular basis (e.g., weekly, monthly, yearly, once every 2, 3, 4, 5 or more years, and the like) in order to prevent episodes of bleeding.
- treatment is only administered when episodes of abnormal bleeding occur (e.g., following accidents, prior to or following surgery, etc,).
- maintenance therapy is administered in combination with extra therapy when episodes of abnormal bleeding occur.
- HEL Megakaryocyte transformed cell line Human transformed cell lines were obtained from American Type Culture Collection (Rockville, MD) and propogated under conditions described for promegakaryocytic (HEL Megakaryocyte transformed cell line) (Bray, P. F. et al. J Clin Invest 80, 1812-1817. (1987); Greenberg, S. M., et al., T-cell lymphoma (KT1), (Okamoto, T., et al. J Biol Chem 261, 4615-4619 (1986)) B-cell lymphoma (Rail), (Choi, J. H. et al. International
- Genomic DNA was isolated from the human pro- megakaryocyte cell line, Dami,49 and human ITGA2B gene promoter fragments were amplified by PCR using either sense primer "-1218"(5'-
- pCMVLuc A Bglll and Hindlll restriction digest of cytomegalovirus tissue nonspecific gene promoter (878bp) from pRc/CMV (Invitrogen) is ligated into the pGL3-Basic Luciferase vector (Promega, Madison, WI). This construct served as the positive control for high level gene expression within all cell-types; thus, assigned an arbitrary level of 100% luciferase activity for each cell line (Fig. 1).
- pGL3-BasicLuc Negative control construct for 0% luciferase activity (Fig. 1) because lacks a gene promoter to drive luciferase gene transcription (Promega).
- pCMVnlac Cell lines were co-transfected with one of the pITGA2BLuc+ constructs and
- Cell lines (2xl0 7 ) were co-transfected with either (20) ⁇ g) of the ITGA2B gene promoter construct (-1218, -889, -673) (Fig. 1A) or the positive (CMV) or negative (Basic) controls encoding firefly luciferase and pCMVnlac (20 ⁇ g) encoding P-galactosidase.49 Briefly, forty-eight hours after co-transfection cells were washed, harvested, and lysates were prepared and frozen to -80°C using the luciferase assay system (Promega). Luciferase activity was measured
- ⁇ -galactosidase activity was performed to normalize transient transgene expression for each cell line with a sensitive ELISA enzymatic assay that measured colormetric change with the substrate for ⁇ - galactosidase, chlorophenol red ⁇ -D-galactophranoside (CPRG) (Eustice DC, et al,
- luciferase/CPRG Vmax value for each construct to reveal the transfection efficiency for each cell line.
- the RLU for pCMVLuc was assigned arbitrarily a value of 100% and all other results were calculated for each vector based upon that
- ITGA 25-(M)WPTS genetic transfer vectors are derived from a HIV type-1 lentiviral vector (D.Trono, University of Geneva, Switzerland).51 p-889ITGA2B-BDDFVIII-WPTS lentiviral vector (Fig. IB) encodes a -889 to +30 nucleotide fragment of the human ITGA2B promoter and human BDDFVIII molecule.16 p-673ITGA2B-VWFSPD2-BDDFVIII- WPTS lentiviral vector (Fig.
- VWFpp Von Willebrand Factor propeptide
- SP a fragment of the human Von Willebrand Factor propeptide linked to the D2 domain(l,199bp)
- cDNA encoding human BDDFVIII to allow megakaryocyte- specific transcription of a hybrid molecule that uses the SPD2 peptide to traffic human BDDFVIII to platelet a-granules.
- VWFpp Von Willebrand Factor propeptide
- SP VWFpp encoding 540 amino acid VWF signal peptide linked to the D2 domain(l,199bp)
- cDNA encoding human BDDFVIII to allow megakaryocyte- specific transcription of a hybrid molecule that uses the SPD2 peptide to traffic human BDDFVIII to platelet a-granules.
- cDNA encoding SP was amplified by PCR with forward Primer (P) 1 (5 ' GTTAATCGATATCTCCTTGCC ACCTAGA3 ') (SEQ ID NO
- P5 (5'ATCGATATCTCCTTGCCACCT A3') (SEQ ID NO:9) and P4.
- p-889ITGA2- BDDFVIII-WPTS served as a template for PCR of cDNA encoding a fragment of BDDFVIII using forward
- P8(5 'ACGCGTCTTCTCTACATACTAGTA3 ') (SEQ ID NO: l 1) to synthesize cDNA that ligated directly to VWFD2.
- All PCR products were cloned into pCR-Blunt II-TOPO (Life Technologies, Grand Island, NY) using unique restriction sites -673ITGA2B-SPD2(ClaI and BsmBI) ligated to 5'hBDDFVIII (BsmBl and Mlul) with 3 'BDDFVIII (Mlul and Spel). All fragments were cloned into pWPTS lentiviral vector and the correct identity confirmed by nucleotide sequence analysis.
- Recombinant virions were generated from three-plasmid transient co-transfection followed by supernatant collection, 500-fold concentration by centrifugation, and storage at -80oC until utilized (Fang J, et al., Proc Natl Acad Sci U S A 2011, 108(23): 9583-9588). Virion titer was determined by RT-PCR (Lizee G, et al, Hum Gene Ther 2003, 14(6):
- Replication-competent virions were confirmed absent from stocks with marker rescue assays (Wilcox et al, Blood 2000, 95(12): 3645-3652).
- Cytokine mobilized CD34+G-PBC gene transfer and autologous transplant studies using FVIII-Deficient dogs affected with hemophilia A (University of North Carolina, Chapel Hill, NC) (Lozier JN, et al, Proc Natl Acad Sci USA 2002, 99(20): 12991-12996) were conducted and approved by Institutional Animal Care and Use Committees of the University of North Carolina and The Medical College of Wisconsin which are both accredited facilities of the American Association for Accreditation of Laboratory Animal Care.
- CD34+ G-PBC were selected with a biotin-conjugated-lH6 Ab (lmg/ml) (Richard Nash, Fred Hutchinson Research Institute, Seattle, WA) and anti-biotin immuno -magnetic beads (1 :5 dilution) on an Automacs magnetic cell separator (Miltenyi Biotec Inc., Auburn, CA).
- CD34+ G-PBC were transduced with - 889ITG A2B -BDDF VIII- WPT S or -673ITGA2B-VWFSPD2-BDDFVIII- WPTS lentiviral vector.
- 4x106 cells/well were seeded in a 6-well plate (Falcon- Becton Dickinson, Franklin Lakes, NJ) coated with 20 ⁇ g/cm2 RetroNectin (Takara Shuzo, Otsu, Shiga, Japan) and incubated with l .OxlO 4 ITGA2B-FYUI lentivirions/cell in X-Vivo 10 containing 10%FCS, rhIL-3, rcaIL-6,
- Busulfex® Transient immune suppression administered for ⁇ 90 days after transplant with 10 mg/kg/d cyclosporine (Gengraf®, Abbott Laboratories, North Chicago, IL) and 8 mg/kg/d MMF (Table 1) (Fang et al, Proc Natl Acad Sci USA 2011, 108(23): 9583-9588). Blood Collection.
- Blood was collected at preselected times into a vacutube containing 7.5% EDTA anticoagulant (Fang et al., supra). Blood cells were counted on a Vet ABC hematology analyzer (scil animal care company, Gurnee, IL). Platelets were isolated with Fico/LiteTM (Atlanta Biologicals, Norcross, GA), washed with PBS and used directly for
- a murine monoclonal l°Ab to canine CD34 "1H6" was from the Fred Hutchinson Cancer Research Center (Seattle, WA).27 A sheep anti-rabbit fibrinogen polyclonal l°Ab (5 ⁇ g/ml) that recognizes canine fibrinogen was purchased from (Enzyme Research).
- Monoclonal l°Abs (5-10 ⁇ g/ml), MBC 103.3 and 301.3 (R.R.Montgomery, BloodCenter of WI, Milwaukee, WI), recognize epitopes on human BDDFVIII.53 2°Abs used were Alexa Fluor® 488 F(ab')2 conjugated to a fragment of donkey anti-sheep IgG (H+L) (1 : 1 ,000 dilution) and Alexa Fluor® 568 F(ab')2 fragment of goat anti-mouse IgG (H+L) (1 :500 dilution) were from Life Technologies (Grand Island, NY).
- Canine platelets were fixed with 3.7% (vol/vol) buffered formalin, permeabilized in
- Triton X-100 in 20 mmol/L Hepes, 300 mmol/L sucrose, 50 mmol/L NaCl, and 3mmol/L MgC12, pH7.0, and blocked with 2.5% normal goat serum in HBSS.
- Platelets were incubated with a sheep polyclonal l°Ab to canine fibrinogen and monoclonal l°Ab (MBC 103.3 & 301.3) to human FVIII (5ug/ml) overnight at 4°C53
- the Alexa Fluor® 488- conjugated F(ab')2 fragment of donkey anti-sheep IgG (H+L) was used as a 2°Ab (1 : 1 ,000 dilution) to detect fibrinogen and Alexa Fluor® 568-conjugated F(ab')2 fragment of goat anti-mouse IgG (H+L) conjugated 2°Ab (1 :500 dilution) was used to detect the presence of FVIII for 30 min at 25°C. Platelets were mounted with Vectashield (Vector Labs,
- Canine platelets were isolated from blood and treated with CytofixTM and
- PERM/WASHTM reagents for intracellular detection of BDDFVIII.
- Platelets were incubated with a monoclonal l°Ab (MBC 103.3 & 301.3) to human FVIII (5ug/ml) 30 minutes at 4°C and then incubated with Alexa Fluor® 568-conjugated F(ab')2 fragment of goat anti-mouse IgG (H+L) conjugated 2°Ab (1 :500 dilution) for 30 minutes at 4°C. Platelets isolated from FVIII-Deficient dogs were used as negative controls. Nonspecific isotype control Ab served as negative controls. Cells were collected and analyzed on an Accuri® C6 Flow Cytometer (Accuri Cytometers, Inc., Ann Arbor MI) using the Accuri analysis software.
- Platelets were fixed in 1.25% glutaraldehyde (Fluka AG, Buchs, Switzerland), infused with 2.3M sucrose (Fluka), and frozen with a Reichert KF 80 freezing system (Leica, Vienna, Austria). Sections of ⁇ 80 nm were prepared with the Ultracut E ultramicrotome equipped with a FC 4E cryokit attachment and placed on collodion-coated nickel grids. Grids were incubated for 10 min on PBS with 1% BSA and then placed on (10 ⁇ g/ml) drops of the l°Ab to FVIII(301.3) for lh at 25°C.
- Sections were incubated for lh with a goat anti-mouse 2°Ab adsorbed onto lOnm gold particles (1/100 dilution of AuroProbe EM G10). Controls included the use of an irrelevant IgG of the same species and at the same concentration.
- Grids were stained by uranyl acetate and osmium and then embedded in
- Platelets were isolated from circulating peripheral blood, washed, and activated with physiological agonists of platelet activation. To induce activation, platelets were resuspended in Tyrode's buffer (2.5 x 106/ml) containing 1 mM CaC12, 1 mM MgC12, 25 ⁇ each of adenosine diphosphate (ADP) (Sigma), epinephrine (Bio/Data Corporation, Horsham, PA) and canine thrombin receptor activating peptides: PARI (SFFLKN-NH2), PAR3 (TRFGAP- NH2) and PAR4 (SFPGQP-NH2) for 30 minutes at 37°C as previously described (Fang et al, supra).
- Tyrode's buffer 2.5 x 106/ml
- PARI SFFLKN-NH2
- PAR3 TRFGAP- NH2
- PAR4 SFPGQP-NH2
- p-889ITGA2-BDDFVIII-WPTS served as a positive control.
- PCR analysis was performed with Taq polymerase (Invitrogen, Carlsbad, CA) on a PTC200 instrument (MJ Research, Watertown, MA) with forward primer Pl(5'- ACGCTATGTGGATACGCTG-3 ') and reverse primer P2(5'-
- AACACCACGGAATTGTCAG-3 ') (SEQ ID NO: 12) to synthesize a 318 nucleotide primary product encoding the WPRE ( Figure 1B,C).
- a secondary PCR reaction was performed with nested forward primer P3(5'-TGGATACGCTGCTTTAATGC-3') (SEQ ID NO: 13) and reverse primer P4(5 ' -AATTGTCAGTGCCCAAC AG-3 ') (SEQ ID NO: 14) encoding a 302 bp product of WPRE (Fig.5A).
- Percent lentiviral gene marking was measured by RT-qPCR using BIO-RAD CFX96
- lentiviral LTR primers and probe used were: Fwd:5'- AGCTTGCCTTGAGTGCTTC A-3 ' (SEQ ID NO: 15); Rev:5'- TGACT AAAAGGGTCTGAGGGA-3 ' (SEQ ID NO: 16); probe:6FAM- TGCCCGTCTGTTGTGTGACTCTG-MGBNFQ (SEQ ID NO: 17).
- the canine ITGB3 gene was used as an endogenous control for gene copy number with Fwd:5'- ATGCATCCCACTTGCTGGTAT-3'(SEQ ID NO: 18); Rev:5'- TGCCCATCGTTAGGTTGG-3 ' (SEQ ID NO: 19); probe:6FAM-
- TGCCTGCCAGCCTTCCATCCAG-MGBNFG (SEQ ID NO:20). Copy number was based on TaqMan principle. Ten- fold serial dilution of the plasmid constructs of known concentration containing relevant sequences (Lentiviral vector LTR and canine ITGB3) were used to create standard curves for quantification of samples.
- LAM Linear Amplification-Mediated
- LAM-PCR was performed to localize the lentiviral vector insertion sites within genomic DNA isolated from peripheral blood leukocytes. Briefly, the junction between integrated proviral LTR and the host genome was selected by 2 rounds of linear PCR [95°C for 5min; (95°C for lm, 60°C for 45s, 72°C for 90s) x 50; 72°C for 10m] with a vector- specific 5'-biotinylated primer
- Sequence products from LAM-PCR that were verified to contain proviral LTR sequence were masked for known genomic repeats and proviral features.
- the resulting sequence was aligned to the dog genome (CanFam 2.0, May 2005 assembly) using the Blat (BLAST-like alignment tool) server at UCSC.
- Sequences mapping to a unique location in the genome at 95% similarity were selected and integration sites were determined as the base in the genomic alignment flanking the proviral LTR sequence. For each site, the closest RefSeq gene was determined and compared to a list of human cancer orthologs. Detection of Biologically Active Human FVIII (FVIILC).
- Lysates of 1x10 platelets/ml were tested for FVIILC using a Chromogenix Coatest® SP4 FVIII kit (DiaPharma, Franklin, OH).12 Duplicate samples of supernatant were placed in uncoated wells of a 96-well microtiter plate (25 ⁇ /well) and assay components
- chromogenic Factor Xa substrate S-675 was added, and the plate was transferred to a Wallac Victor2 microplate reader preset at 37oC.
- the Factor Xa-dependent conversion of S-2675 is directly related of the amount of FVIILC in each well.
- a standard curve was constructed by plotting known amounts of recombinant human FVIII (Kogenate; Bayer Healthcare
- WBCT is a modification of the Lee-White clotting time using two siliconized glass tubes (Becton-Dickinson, Rutherford, NJ) at 28°C (Nichols TC, et al, J Thromb Haemost 2012, 10(3): 474-476).
- One ml of whole blood was drawn and 0.5 ml blood was distributed into each tube.
- a timer was started. After one minute, one tube was tilted every 30 sec, the other left undisturbed. When a clot formed in the tilted tube, the second tube was then tilted every 30 sec until a clot formed. The time for formation of a fully gelled clot in the second tube was recorded as the WBCT.
- Blood was collected from a hemostatically normal (WBCT 7.5-12.5 min) and the three experimental dogs (F20,I42,M64) before and after G-PBC transplant if animals had not been treated with plasma for at least one month.
- Canine blood plasma (F20, 142 and M64) was screened for inhibitors with an activated partial thromboplastin time (aPTT) mixing assay that detects inhibitory antibodies to either coagulation factor VIII or IX as previously described (Langdell RD, et al, J Lab Clin Med 1953, 41(4): 637-647; Sahud MA. Semin Thromb Hemost 2000, 26(2): 195-203; Matrai J, et al, Hepatology 2011, 53(5): 1696-1707). Briefly, test plasmas are incubated in a 1 : 1 mix with normal plasma for 2 h at 37°C and then the incubated mixture is analyzed using standard aPTT reagents.
- aPTT activated partial thromboplastin time
- BIU Bethesda Inhibitor
- a luciferase reporter assay revealed that fragments of the full-length human ITGA2B gene promoter permitted comparable platelet-specific gene transcription (Fig.lA).
- Three different ITGA2B promoter fragments (1218, -889 and -673) directed similar levels of luciferase activity within a pro-megakaryocytic cell line.
- ITGA2B promoter driven luciferase activity remained undetectable in the other blood cell lineages and an epithelial cell line.
- Each ITGA2B promoter encodes Ets and GATA factors permitting a high level of megakaryocyte gene transcription and a repressor region that inhibits expression within other lineages (Prandini MH, et al, Blood 1996, 88(6): 2062-2070).20
- two lentiviral gene transfer vectors were tested for optimal hematopoietic stem cell transduction efficiency and the ability to improve hemostatic function with platelet-derived BDDFVIII in hemophilia A dogs to develop a strategy for human gene therapy.
- VWF is a normal a-granule constituent in human platelets (albeit absent in canine platelets) (Nichols TC, et al., Blood 1993, 81(10): 2644-2651) that serves as a carrier protein of FVIII in human and canine plasma (Kaufman RJ, et al. Molecular & Cellular Biology 1989, 9(3): 1233-1242).
- canine hematopoietic stem cells were mobilized from the bone marrow into the peripheral blood with canine cytokines (cG-CSF & cSCF) and G-PBC apheresis was performed without adverse incident identical to previous studies using GT dogs (Fang et al, supra).
- Mononuclear lymphocytes were isolated with Ficoll-Paque Plus from the apheresis product and then canine CD34 antigen positive
- CD34+ cells were purified by immunomagnetic selection (McSweeney PA, et al, Blood 1998, 91(6): 1977-1986).
- Table 1 summarizes the conditions for autologous transplant of three hemophilia A dogs transfused with approximately 3xl0 6 FVIII -transduced CD34+G- PBC/kg of body weight where each target cell was transduced with approximately 1x104 total viral particles/CD34+G-PBC without the use of ex vivo or in vivo selection for transduced cells (Columns 4,5).
- a non-myeloablative pre-transplant conditioning regimen was employed to create a niche in the bone marrow for the newly transplanted cells to engraft (Table 1, Column 2).
- the intensity of the conditioning regimen is determined by the level at which the dose becomes toxic to the organs.
- a sublethal dose of busulfan a drug preferentially toxic to hematopoietic stem cells
- busulfan at 10 mg/kg for hematopoietic stem cell gene transfer to correct canine leukocyte adhesion deficiency (Bauer TR, Jr., et al., Nat Med 2008, 14(1): 93-97), followed by transient immunosuppression with mycophenolate mofetil (MMF) and cyclosporine (CSP) after major histocompatibility complex identical marrow transplantation (Enssle J, et al, Hum Gene Ther 2010, 21(4): 397-403).
- MMF mycophenolate mofetil
- CSP cyclosporine
- EACA is an effective synthetic inhibitor of the plasmin-plasminogen system and controls subarachnoid hemorrhage, genitourinary bleeding from many causes and dental surgery in hemophiliacs (Griffin JD, et al, Semin Thromb Hemost 1978, 5(1): 27-40). For comparison, the number of serious bleeding episodes that required treatment with cFVIII supplement has been recorded 1 year before and 2.5 years after G-PBC transplant for each dog (Table 1, Columns 10, 11) (Niemeyer GP, et al, Experimental Hematology 2003, 31(12): 1357-1362).
- BDDFVIII was being synthesized and stored in platelets following G-PBC transplant.
- Fig.2A are images of the results of microscopic analysis of platelets isolated from one dog (142) that received an autologous transplant of lentiviral vector transduced G-PBC, which represents the outcome of analysis of all three dogs (F20, 142, M64).
- Fg fibrinogen
- BDDFVIII staining co-localized frequently within Fg as evident by the appearance of a yellow staining when the left (Fg) and middle panel (BDDFVIII) were overlaid indicating that both proteins could be stored together within platelet a-granules (Right Panel) (Wilcox et al., J Thromb Haemost 2003, 1(12): 2477-2489).
- Immuno-electron microscopy was performed to determine if exogenous BDDFVIII was being transported specifically to platelet ⁇ -granules. Immunogold analysis was performed on ultrathin sections of platelets with a l°Ab to FVIII and a 2°Ab adsorbed on 10 nm gold particles (Fig.2B). The ⁇ -granules appeared normal in size and shape within platelets of FVIII-Deficient dogs as well as FVIII transplant recipients. BDDFVIII is absent in platelet ⁇ -granules from a FVIII-Deficient negative control (Left Panel).
- BDDFVIII was detected within ⁇ -granules and cytoplasm of platelets isolated from all three dogs (F20, 142, M64). This result is consistent with observations reported for ectopic expression of BDDFVIII within platelets of VWF(-/-) transgenic mice affected with von Willibrand disease (Yarovoi H, et al, Blood 2005, 105(12): 4674-4676). -673/rG ⁇ 25-VWFSPD2-BDDFVIII transduced platelets from M64 stored the greatest level of BDDFVIII within the a-granule (Right Panel). In addition, BDDFVIII was detected rarely within membrane systems in the platelet cytoplasm indicating that the VWFSPD2 indeed had an increased efficiency to traffic BDDFVIII directly into the a-granule compartment.
- a Chromogenix Coatest® SP4 FVIII assay was perform to determine if activated platelets could secrete a biologically active form of BDDFVIII (FVIILC) as previously shown for activated human megakaryocytes in tissue culture (Wilcox et al., Thromb Haemost 2003, 1(12): 2477-2489.12
- FVIILC biologically active form of BDDFVIII
- FIG.4 platelet lysates from a FVIII-Deficient dog show that the level of BDDFVIILC background activity is virtually unchanged for untreated (Black, - Agonist) and activated platelets (White, + Agonist).
- FVIILC activity was detected readily in the lysate of quiescent, untreated platelets from F20, 142 and M64.
- BDDFVIILC levels were decreased in lysates of platelets stimulated by a mixture of physiological agonists of platelet activation: ADP, epinephrine, and canine PAR 1,3,4 in all three experimental dogs.
- dogs that received BDDFVIII-transduced G-PBC show an appreciable decrease in FVIILC activity only after platelet activation indicating that platelets from experimental animals can be induced to secrete FVIII within the vasculature.
- the lentiviral vector WPRE element was detected by PCR of genomic DNA isolated from leukocytes collected from F20, 142, and M64 for at least 2.5 years after transplant (Fig. 5A).
- Real time quantitative PCR (RT-qPCR) analysis of genomic DNA isolated from peripheral blood leukocytes revealed that the transduction efficiency for each lentiviral vector was 1% (F20), 4% (142) and 2% (M64) (Table 1, Column 8).
- RT-qPCR Real time quantitative PCR
- Linear Amplification-Mediated (LAM)-PCR was also performed to determine the integration pattern of lentiviral vector within the genome of the experimental dogs.
- Fig.SB shows that lentiviral vector was not present within the genome of a FVIII-Deficient control while multiple bands appear to be present in the genomic DNA of transplanted dogs (F20, 142 and M64).
- a distinct insertion site was detected specifically in chromosome 4 for F20 and chromosome 35 for M64.
- the results demonstrate that insertion of the lentiviral vector could be detected within 142 genomic DNA, although a site of insertion could not be localized to a precise region of the current canine genome map (Sutter NB, Ostrander EA. Dog star rising: the canine genetic system.
- human hematopoietic cells could serve as a primary tissue source for the synthesis of a functional form of human BDDFVIII (FVIILC) within tissue-cultured human megakaryocytes (Shi Q, et al, Molecular Genetics and Metabolism 2003, 79(1): 25-33.), in peripheral blood platelets isolated from mice xeno-transplanted with BDDFVIII -transduced human G-PBC,12 and in a murine model for hemophilia A that received a transplant of BDDFVIII-transduced bone marrow (Shi Q, et al. Journal of
- Fig.6 shows that FVIILC activity (-5-15 mU/ml/108 platelets) can be detected by chromogenic analysis for at least 2.5 years after autologous G-PBC transplant in each dog with the highest levels appearing approximately one year after transplant and typically leveling off to - 5-10 mU/ml/10 platelets (F20, 142, M6). Samples from FVIII-Deficient dogs served as negative controls for each time point (black line).
- FVIII:C/ml defines 100% FVIII activity in the reference plasma from a normal (20 kg) dog; therefore, a normal (20kg) animal has -800 total units of FVIII in its plasma volume at any given time.
- the results in Fig.6 show that multiple severe bleeding episodes occurred in each animal one year prior to G-PBC that required a transfusion with cFVIII supplements. Note, to prevent bleeding due to the gene therapy protocol, each dog received daily supplements of cFVIII beginning on day one of the G-PBC transplant protocol. EACA was also administered to the transplanted dogs until blood was absent from their stool, which remarkably coincided with platelet FVIILC levels reaching ⁇ 5mU/ml/10 8 platelets.
- F20 (Top Panel) displayed the lowest overall platelet FVIILC levels of ⁇ 5mU/ml/10 platelets and also experienced severe intermittent bleeding episodes throughout the experimental follow-up of 2.5 years after transplant that required administration of additional supplements in the form of transfusions of normal canine plasma or cFVIII. This result indicates that 5mU/ml/108 platelet FVIILC appears to be a threshold level of transgene expression that must be overcome in canine hemophilia A to achieve adequate correction of the bleeding phenotype.
- Transplant dog 142 Transplant dog 142
- the time required for whole blood to clot in a test tube was measured for each dog using traditional version of the Lee-White whole blood clotting time (WBCT) assay (Nichols TC, et al., J Thromb Haemost 2012, 10(3): 474-476). Hemostatically normal dogs have a mean WBCT of 10.5 minutes ⁇ SD 1.4 minutes.
- canine blood plasma from (F20, 142 and M64) was screened for inhibitors with an activated partial thromboplastin time (aPTT) mixing assay which detects inhibitory antibodies to either coagulation factor VIII or IX.
- aPTT activated partial thromboplastin time
- Plasma from hemophilia A dogs with known Bethesda Inhibitor (BIU) titers that cross-react with and inhibit human FVIII was used as a positive control and plasma from dogs without inhibitors was assayed concurrently as a negative control for comparative analysis. The results indicate that F20, 142, and M64 did not develop inhibitors (Table 1: Column 12).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Hematology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Developmental Biology & Embryology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Virology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Diabetes (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (16)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/437,457 US9982034B2 (en) | 2012-10-24 | 2013-10-24 | Platelet targeted treatment |
| PL13848463T PL2912186T3 (pl) | 2012-10-24 | 2013-10-24 | Leczenie ukierunkowane na płytki krwi |
| EP21150184.6A EP3859004A1 (en) | 2012-10-24 | 2013-10-24 | Platelet targeted treatment |
| EP13848463.9A EP2912186B1 (en) | 2012-10-24 | 2013-10-24 | Platelet targeted treatment |
| KR1020157012821A KR101819803B1 (ko) | 2012-10-24 | 2013-10-24 | 혈소판 표적화 치료 |
| CA2888982A CA2888982C (en) | 2012-10-24 | 2013-10-24 | Platelet targeted treatment |
| BR112015009229-2A BR112015009229B1 (pt) | 2012-10-24 | 2013-10-24 | Composição tendo como alvo a expressão de genes para plaquetas, uso de uma célula tronco compreendendo a referida composição para tratar hemofilia e método in vitro ou ex vivo para gerar uma célula tronco modificada |
| ES13848463T ES2854754T3 (es) | 2012-10-24 | 2013-10-24 | Tratamiento dirigido a plaquetas |
| HK15112856.1A HK1211986B (en) | 2012-10-24 | 2013-10-24 | Platelet targeted treatment |
| JP2015539804A JP2016501515A (ja) | 2012-10-24 | 2013-10-24 | 血小板標的化治療 |
| DK13848463.9T DK2912186T3 (da) | 2012-10-24 | 2013-10-24 | Behandling rettet mod blodplader |
| IL238417A IL238417B (en) | 2012-10-24 | 2015-04-21 | Platelet-directed therapy |
| ZA2015/02945A ZA201502945B (en) | 2012-10-24 | 2015-04-29 | Platelet targeted treatment |
| US15/689,875 US10294291B2 (en) | 2012-10-24 | 2017-08-29 | Platelet targeted treatment |
| US16/361,591 US20190270791A1 (en) | 2012-10-24 | 2019-03-22 | Platelet targeted treatment |
| US18/366,237 US20240270822A1 (en) | 2012-10-24 | 2023-08-07 | Platelet targeted treatment |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261717951P | 2012-10-24 | 2012-10-24 | |
| US61/717,951 | 2012-10-24 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/437,457 A-371-Of-International US9982034B2 (en) | 2012-10-24 | 2013-10-24 | Platelet targeted treatment |
| US15/689,875 Division US10294291B2 (en) | 2012-10-24 | 2017-08-29 | Platelet targeted treatment |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014066663A1 true WO2014066663A1 (en) | 2014-05-01 |
Family
ID=50545271
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/066651 Ceased WO2014066663A1 (en) | 2012-10-24 | 2013-10-24 | Platelet targeted treatment |
Country Status (12)
| Country | Link |
|---|---|
| US (4) | US9982034B2 (https=) |
| EP (2) | EP2912186B1 (https=) |
| JP (2) | JP2016501515A (https=) |
| KR (1) | KR101819803B1 (https=) |
| BR (1) | BR112015009229B1 (https=) |
| CA (1) | CA2888982C (https=) |
| DK (1) | DK2912186T3 (https=) |
| ES (1) | ES2854754T3 (https=) |
| IL (1) | IL238417B (https=) |
| PL (1) | PL2912186T3 (https=) |
| WO (1) | WO2014066663A1 (https=) |
| ZA (1) | ZA201502945B (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2022512622A (ja) * | 2018-10-05 | 2022-02-07 | ユニヴァーシティー オブ ユタ リサーチ ファウンデーション | 改変受容体を含む血小板の作製方法及びその使用法 |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11319528B2 (en) | 2015-07-13 | 2022-05-03 | University Of Utah Research Foundation | Methods of making red blood cells and platelets in vitro and uses thereof |
| JP2021509812A (ja) | 2018-01-05 | 2021-04-08 | プレートレット バイオジェネシス, インコーポレイテッド | 巨核球を産生するための組成物および方法 |
| EP3813853A4 (en) | 2018-06-29 | 2022-04-06 | Platelet Biogenesis, Inc. | DELIVERY COMPOSITIONS AND METHODS OF USE |
| CA3121200A1 (en) | 2018-11-30 | 2020-06-04 | Cellphire, Inc. | Platelets as delivery agents |
| WO2020112963A1 (en) | 2018-11-30 | 2020-06-04 | Cellphire, Inc. | Platelets as delivery agents |
| EP3937631A4 (en) * | 2019-03-13 | 2023-01-04 | Cellphire Inc. | DOG PLALETLET PREPARATIONS |
| IL322149A (en) | 2019-05-03 | 2025-09-01 | Cellphire Inc | Materials and methods for manufacturing blood products |
| CN114450066A (zh) | 2019-08-16 | 2022-05-06 | 塞尔菲乐有限公司 | 作为抗血小板剂逆转剂的血栓小体 |
| CA3170196A1 (en) | 2020-02-04 | 2021-08-12 | Cellphire, Inc. | Anti-fibrinolytic loaded platelets |
| DE102020111571A1 (de) | 2020-03-11 | 2021-09-16 | Immatics US, Inc. | Wpre-mutantenkonstrukte, zusammensetzungen und zugehörige verfahren |
| TW202245814A (zh) | 2021-02-17 | 2022-12-01 | 美商賽菲爾公司 | 用於治療抗血小板誘導的凝血病之凍乾血小板衍生物組成物 |
Citations (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US2452892A (en) | 1947-05-07 | 1948-11-02 | Robert A Appleton | Igniter for rockets |
| US4596556A (en) | 1985-03-25 | 1986-06-24 | Bioject, Inc. | Hypodermic injection apparatus |
| EP0468520A2 (en) | 1990-07-27 | 1992-01-29 | MITSUI TOATSU CHEMICALS, Inc. | Immunostimulatory remedies containing palindromic DNA sequences |
| WO1992019265A1 (en) | 1991-05-02 | 1992-11-12 | Amgen Inc. | Recombinant dna-derived cholera toxin subunit analogs |
| WO1993013202A1 (en) | 1991-12-31 | 1993-07-08 | Biocine Sclavo Spa | Immunogenic detoxified mutants of cholera toxin and of the toxin lt, their preparation and their use for the preparation of vaccines |
| WO1994000153A1 (en) | 1992-06-25 | 1994-01-06 | Smithkline Beecham Biologicals (S.A.) | Vaccine composition containing adjuvants |
| WO1995017210A1 (en) | 1993-12-23 | 1995-06-29 | Smithkline Beecham Biologicals (S.A.) | Vaccines |
| WO1996002555A1 (en) | 1994-07-15 | 1996-02-01 | The University Of Iowa Research Foundation | Immunomodulatory oligonucleotides |
| WO1996033739A1 (en) | 1995-04-25 | 1996-10-31 | Smithkline Beecham Biologicals S.A. | Vaccines containing a saponin and a sterol |
| WO1997048440A1 (en) | 1996-06-18 | 1997-12-24 | Alza Corporation | Device for enhancing transdermal agent delivery or sampling |
| WO1998020734A1 (en) | 1996-11-14 | 1998-05-22 | The Government Of The United States Of America, As Represented By The Secretary Of The Army | Adjuvant for transcutaneous immunization |
| WO1998028037A1 (en) | 1996-12-20 | 1998-07-02 | Alza Corporation | Device and method for enhancing transdermal agent flux |
| WO1998056414A1 (en) | 1997-06-11 | 1998-12-17 | Smithkline Beecham Biologicals S.A. | Oil in water vaccine compositions |
| WO1999011241A1 (en) | 1997-09-05 | 1999-03-11 | Smithkline Beecham Biologicals S.A. | Oil in water emulsions containing saponins |
| WO1999012565A1 (en) | 1997-09-05 | 1999-03-18 | Smithkline Beecham Biologicals S.A. | Vaccines |
| WO1999027961A1 (en) | 1997-12-02 | 1999-06-10 | Powderject Vaccines, Inc. | Transdermal delivery of particulate vaccine compositions |
| US5993412A (en) | 1997-05-19 | 1999-11-30 | Bioject, Inc. | Injection apparatus |
| US20040192599A1 (en) * | 2001-06-15 | 2004-09-30 | Schuh Andre C | Gene therapy for hemophilia a |
| US20050238660A1 (en) | 2001-10-06 | 2005-10-27 | Babiuk Lorne A | Cpg formulations and related methods |
| US20060134663A1 (en) * | 2004-11-03 | 2006-06-22 | Paul Harkin | Transcriptome microarray technology and methods of using the same |
| US7629153B2 (en) * | 2001-08-02 | 2009-12-08 | Research Development Foundation | Methods and compositions relating to improved lentiviral vector production systems |
| WO2010075303A1 (en) * | 2008-12-23 | 2010-07-01 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Splicing factors with a puf protein rna-binding domain and a splicing effector domain and uses of same |
| US20100183556A1 (en) * | 2008-02-29 | 2010-07-22 | Sang Yon Choi | Recombinant expression vector system for variants of coagulation factor VIII and von Willebrand factor |
| WO2011060242A2 (en) * | 2009-11-13 | 2011-05-19 | Talecris Biotherapeutics, Inc. | Von willebrand factor (vwf)-containing preparations, and methods, kits, and uses related thereto |
| US8147820B2 (en) | 2009-09-14 | 2012-04-03 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Attenuated vaccine against fish pathogen Francisella sp |
| US20120225028A1 (en) * | 2011-03-02 | 2012-09-06 | Moshe Cohen | Compositions and methods for mobilization of stem cells |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1048736A1 (en) * | 1999-04-27 | 2000-11-02 | Aventis Behring Gesellschaft mit beschränkter Haftung | DNA-construct for the tissue specific expression of a blood coagulation factor |
| WO2005017160A2 (en) | 2003-08-13 | 2005-02-24 | Children's Hospital Medical Center | Mobilization of hematopoietic cells |
-
2013
- 2013-10-24 US US14/437,457 patent/US9982034B2/en active Active
- 2013-10-24 ES ES13848463T patent/ES2854754T3/es active Active
- 2013-10-24 KR KR1020157012821A patent/KR101819803B1/ko active Active
- 2013-10-24 PL PL13848463T patent/PL2912186T3/pl unknown
- 2013-10-24 JP JP2015539804A patent/JP2016501515A/ja active Pending
- 2013-10-24 DK DK13848463.9T patent/DK2912186T3/da active
- 2013-10-24 WO PCT/US2013/066651 patent/WO2014066663A1/en not_active Ceased
- 2013-10-24 CA CA2888982A patent/CA2888982C/en active Active
- 2013-10-24 EP EP13848463.9A patent/EP2912186B1/en active Active
- 2013-10-24 EP EP21150184.6A patent/EP3859004A1/en active Pending
- 2013-10-24 BR BR112015009229-2A patent/BR112015009229B1/pt active IP Right Grant
-
2015
- 2015-04-21 IL IL238417A patent/IL238417B/en active IP Right Grant
- 2015-04-29 ZA ZA2015/02945A patent/ZA201502945B/en unknown
-
2017
- 2017-08-29 US US15/689,875 patent/US10294291B2/en active Active
-
2018
- 2018-07-19 JP JP2018135886A patent/JP6975105B2/ja active Active
-
2019
- 2019-03-22 US US16/361,591 patent/US20190270791A1/en not_active Abandoned
-
2023
- 2023-08-07 US US18/366,237 patent/US20240270822A1/en active Pending
Patent Citations (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US2452892A (en) | 1947-05-07 | 1948-11-02 | Robert A Appleton | Igniter for rockets |
| US4596556A (en) | 1985-03-25 | 1986-06-24 | Bioject, Inc. | Hypodermic injection apparatus |
| EP0468520A2 (en) | 1990-07-27 | 1992-01-29 | MITSUI TOATSU CHEMICALS, Inc. | Immunostimulatory remedies containing palindromic DNA sequences |
| WO1992019265A1 (en) | 1991-05-02 | 1992-11-12 | Amgen Inc. | Recombinant dna-derived cholera toxin subunit analogs |
| WO1993013202A1 (en) | 1991-12-31 | 1993-07-08 | Biocine Sclavo Spa | Immunogenic detoxified mutants of cholera toxin and of the toxin lt, their preparation and their use for the preparation of vaccines |
| WO1994000153A1 (en) | 1992-06-25 | 1994-01-06 | Smithkline Beecham Biologicals (S.A.) | Vaccine composition containing adjuvants |
| WO1995017210A1 (en) | 1993-12-23 | 1995-06-29 | Smithkline Beecham Biologicals (S.A.) | Vaccines |
| WO1996002555A1 (en) | 1994-07-15 | 1996-02-01 | The University Of Iowa Research Foundation | Immunomodulatory oligonucleotides |
| WO1996033739A1 (en) | 1995-04-25 | 1996-10-31 | Smithkline Beecham Biologicals S.A. | Vaccines containing a saponin and a sterol |
| WO1997048440A1 (en) | 1996-06-18 | 1997-12-24 | Alza Corporation | Device for enhancing transdermal agent delivery or sampling |
| WO1998020734A1 (en) | 1996-11-14 | 1998-05-22 | The Government Of The United States Of America, As Represented By The Secretary Of The Army | Adjuvant for transcutaneous immunization |
| WO1998028037A1 (en) | 1996-12-20 | 1998-07-02 | Alza Corporation | Device and method for enhancing transdermal agent flux |
| US5993412A (en) | 1997-05-19 | 1999-11-30 | Bioject, Inc. | Injection apparatus |
| WO1998056414A1 (en) | 1997-06-11 | 1998-12-17 | Smithkline Beecham Biologicals S.A. | Oil in water vaccine compositions |
| WO1999012565A1 (en) | 1997-09-05 | 1999-03-18 | Smithkline Beecham Biologicals S.A. | Vaccines |
| WO1999011241A1 (en) | 1997-09-05 | 1999-03-11 | Smithkline Beecham Biologicals S.A. | Oil in water emulsions containing saponins |
| WO1999027961A1 (en) | 1997-12-02 | 1999-06-10 | Powderject Vaccines, Inc. | Transdermal delivery of particulate vaccine compositions |
| US20040192599A1 (en) * | 2001-06-15 | 2004-09-30 | Schuh Andre C | Gene therapy for hemophilia a |
| US7629153B2 (en) * | 2001-08-02 | 2009-12-08 | Research Development Foundation | Methods and compositions relating to improved lentiviral vector production systems |
| US20050238660A1 (en) | 2001-10-06 | 2005-10-27 | Babiuk Lorne A | Cpg formulations and related methods |
| US20060134663A1 (en) * | 2004-11-03 | 2006-06-22 | Paul Harkin | Transcriptome microarray technology and methods of using the same |
| US20100183556A1 (en) * | 2008-02-29 | 2010-07-22 | Sang Yon Choi | Recombinant expression vector system for variants of coagulation factor VIII and von Willebrand factor |
| WO2010075303A1 (en) * | 2008-12-23 | 2010-07-01 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Splicing factors with a puf protein rna-binding domain and a splicing effector domain and uses of same |
| US8147820B2 (en) | 2009-09-14 | 2012-04-03 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Attenuated vaccine against fish pathogen Francisella sp |
| WO2011060242A2 (en) * | 2009-11-13 | 2011-05-19 | Talecris Biotherapeutics, Inc. | Von willebrand factor (vwf)-containing preparations, and methods, kits, and uses related thereto |
| US20120225028A1 (en) * | 2011-03-02 | 2012-09-06 | Moshe Cohen | Compositions and methods for mobilization of stem cells |
Non-Patent Citations (76)
| Title |
|---|
| "Vaccine Design--the Subunit and Adjuvant Approach", 1995, PLENUM PRESS |
| ALANIZ, R. C.; B. L. DEATHERAGE; J. C. LARA; B. T. COOKSON: "Membrane vesicles are immunogenic facsimiles of Salmonella typhimurium that potently activate dendritic cells, prime B and T cell responses, and stimulate protective immunity in vivo", J.IMMUNOL., vol. 179, 2007, pages 7692 - 7701, XP002721554, DOI: doi:10.4049/jimmunol.179.11.7692 |
| ALUGUPALLI, K. R.: "A distinct role for B lb lymphocytes in T cell-independent immunity", CURR.TOP.MICROBIOL.IMMUNOL., vol. 319, 2008, pages 105 - 130 |
| ANTHONY, L. D.; R. D. BURKE; F. E. NANO: "Growth of Francisella spp. in rodent macrophages", INFECT.IMMUN., vol. 59, 1991, pages 3291 - 3296 |
| AVILA-CALDERON, E. D.; A. LOPEZ-MERINO; N. JAIN; H. PERALTA; E. O. LOPEZ-VILLEGAS; N. SRIRANGANATHAN; S. M. BOYLE; S. WITONSKY; A.: "Characterization of outer membrane vesicles from Brucella melitensis and protection induced in mice", CLIN.DEV.IMMUNOL., vol. 2012, 2012, pages 352493 |
| BIRKBECK, T. H.; M. BORDEVIK; M. K. FROYSTAD; A. BAKLIEN: "Identification of Francisella sp. from Atlantic salmon, Salmo salar L.", CHILE. J.FISH.DIS., vol. 30, 2007, pages 505 - 507 |
| BRUDAL ET AL., INFECT IMMUN, vol. 82, no. 6, June 2014 (2014-06-01), pages 2180 - 94 |
| BRUDESETH, B. E.; R. WIULSROD; B. N. FREDRIKSEN; K. LINDMO; K. E. LOKLING; M. BORDEVIK; N. STEINE; A. KLEVAN; K. GRAVNINGEN: "Status and future perspectives of vaccines for industrialised fin-fish farming", FISH.SHELLFISH.IMMUNOL., 2013 |
| CASADEVALL, A.; L. A. PIROFSKI: "A reappraisal of humoral immunity based on mechanisms of antibody-mediated protection against intracellular pathogens", ADV.IMMUNOL., vol. 91, 2006, pages 1 - 44 |
| COLE, L. E.; Y. YANG; K. L. ELKINS; E. T. FERNANDEZ; N. QURESHI; M. J. SHLOMCHIK; L. A. HERZENBERG; L. A. HERZENBERG; S. N. VOGEL: "Antigen-specific B-la antibodies induced by Francisella tularensis LPS provide long-term protection against F. tularensis LVS challenge", PROC.NATL.ACAD.SCI.U.S.A, vol. 106, 2009, pages 4343 - 4348 |
| COLLINS, B. S.: "Gram-negative outer membrane vesicles in vaccine development", DISCOV.MED., vol. 12, 2011, pages 7 - 15, XP009154450 |
| COLQUHOUN DJ; DUODU S: "Francisella infections in farmed and wild aquatic organisms", VET RES, vol. 42, no. 1, 8 March 2011 (2011-03-08), pages 47, XP021098302, DOI: doi:10.1186/1297-9716-42-47 |
| COLQUHOUN, D. J.; S. DUODU: "Francisella infections in farmed and wild aquatic organisms", VET.RES., vol. 42, 2011, pages 47, XP021098302, DOI: doi:10.1186/1297-9716-42-47 |
| CONLAN, J. W.; H. SHEN; I. GOLOVLIOV; C. ZINGMARK; P. C. OYSTON; W. CHEN; R. V. HOUSE; A. SJ OSTEDT: "Differential ability of novel attenuated targeted deletion mutants of Francisella tularensis subspecies tularensis strain SCHU S4 to protect mice against aerosol challenge with virulent bacteria: effects of host background and route of immunization", VACCINE, vol. 28, 2010, pages 1824 - 1831, XP026884519, DOI: doi:10.1016/j.vaccine.2009.12.001 |
| CONLAN, J. W.; P. C. OYSTON: "Vaccines against Francisella tularensis", ANN.N.Y.ACAD.SCI., vol. 1105, 2007, pages 325 - 50, XP002592424, DOI: doi:10.1196/ANNALS.1409.012 |
| COWLEY, S. C.; K. L. ELKINS: "Immunity to francisella", FRONT MICROBIOL, vol. 2, 2011, pages 26 |
| DATABASE GENBANK 10 November 1994 (1994-11-10), "HUMAN PLATELET GLYCOPROTEIN IIB (GPIIB) GENE, EXON 1", XP055254523, accession no. NCBI Database accession no. 33319.1 * |
| DAVIS ET AL., J.IMMUNOL, vol. 160, no. 2, 1998, pages 870 - 876 |
| DUODU, S.; P. LARSSON; A. SJODIN; E. SOTO; M. FORSMAN; D. J. COLQUHOUN: "Real-time PCR assays targeting unique DNA sequences of fish-pathogenic Francisella noatunensis subspecies noatunensis and orientalis", DIS.AQUAT.ORGAN, vol. 101, 2012, pages 225 - 234 |
| FORESTAL, C. A.; M. MALIK; S. V. CATLETT; A. G. SAVITT; J. L. BENACH; T. J. SELLATI; M. B. FURIE: "Francisella tularensis has a significant extracellular phase in infected mice", J.INFECT.DIS., vol. 196, 2007, pages 134 - 137 |
| FRYER JL; LANNAN CN; GIOVANNONI SJ; WOOD ND: "Piscirickettsia salmonis gen. nov., sp. nov., the causative agent of an epizootic disease in salmonid fishes", INT J SYST BACTERIOL, vol. 42, no. 1, January 1992 (1992-01-01), pages 120 - 6, XP001029383 |
| GALKA, F.; S. N. WAI; H. KUSCH; S. ENGELMANN; M. HECKER; B. SCHMECK; S. HIPPENSTIEL; B. E. UHLIN; M. STEINERT: "Proteomic characterization of the whole secretome of Legionella pneumophila and functional analysis of outer membrane vesicles", INFECT.IMMUN., vol. 76, 2008, pages 1825 - 1836 |
| GOEL, M. K.; P. KHANNA; J. KISHORE: "Understanding survival analysis: Kaplan-Meier estimate", INT.J.AYURVEDA.RES., vol. 1, 2010, pages 274 - 278 |
| GOLOVLIOV, I.; V. BARANOV; Z. KROCOVA; H. KOVAROVA; A. SJOSTEDT: "An attenuated strain of the facultative intracellular bacterium Francisella tularensis can escape the phagosome of monocytic cells", INFECT.IMMUN., vol. 71, 2003, pages 5940 - 5950 |
| GOMEZ FA; TOBAR JA; HENRIQUEZ V; SOLA M; ALTAMIRANO C; MARSHALL SH: "Evidence of the presence of a functional Dot/Icm type IV-B secretion system in the fish bacterial pathogen Piscirickettsia salmonis", PLOS ONE, vol. 8, no. l, 2013, pages e54934 |
| GOODMAN; GILMAN'S ET AL.: "The Pharmacological Basis of Therapeutics", 1996, MCGRAW HILL |
| GRANOFF, D. M.: "Review of meningococcal group B vaccines", CLIN.INFECT.DIS., vol. 50, no. 2, 2010, pages S54 - S65, XP009137322, DOI: doi:10.1086/648966 |
| GUNN, J. S.; R. K. ERNST: "The structure and function of Francisella lipopolysaccharide", ANN.N.Y.ACAD.SCI., vol. 1105, 2007, pages 202 - 218 |
| HAURAT, M. F.; J. ADUSE-OPOKU; M. RANGARAJAN; L. DOROBANTU; M. R. GRAY; M. A. CURTIS; M. F. FELDMAN: "Selective sorting of cargo proteins into bacterial membrane vesicles", J.BIOL.CHEM., vol. 286, 2011, pages 1269 - 1276 |
| HENRIQUEZ M; GONZALEZ E; MARSHALL SH; HENRIQUEZ V; GOMEZ FA; MARTINEZ I; ALTAMIRANO C: "A Novel Liquid Medium for the Efficient Growth of the Salmonid Pathogen Piscirickettsia salmonis and Optimization of Culture Conditions", PLOS ONE, vol. 8, 2013, pages e7l830 |
| JEFFERY, K. R.; D. STONE; S. W. FEIST; D. W. VERNER-JEFFREYS: "An outbreak of disease caused by Francisella sp. in Nile tilapia Oreochromis niloticus at a recirculation fish farm in the UK", DIS.AQUAT.ORGAN, vol. 91, 2010, pages 161 - 165 |
| JONES, R. M.; M. NICAS; A. HUBBARD; M. D. SYLVESTER; A. REINGOLD: "The Infectious Dose of Francisella tularensis (Tularemia", APPLIED BIOSAFETY, vol. 10, 2005, pages 227 - 239 |
| KAMAISHI, T.; S. MIWA; E. GOTO; T. MATSUYAMA; N. OSEKO: "Mass mortality of giant abalone Haliotis gigantea caused by a Francisella sp. bacterium", DIS.AQUAT.ORGAN, vol. 89, 2010, pages 145 - 154 |
| KAMAISHI, T.; Y. FUKUDA; M. NISHIYAMA; M. KAWAKAMI; T. MATSUYAMA; T. YOSHINAGA; N. OSEKO: "Identification and Pathogenicity of Intracellular Francisella Bacterium in Three-line Grunt Parapristipoma trilineatum", FISH PATHOLOGY, vol. 40, 2005, pages 67 - 71 |
| KAY W; PETERSEN BO; DUUS JO; PERRY MB; VINOGRADOV E: "Characterization of the lipopolysaccharide and beta-glucan of the fish pathogen Francisella victoria", FEBS J., vol. 273, no. 13, July 2006 (2006-07-01), pages 3002 - 13 |
| KUEHN, M. J.; N. C. KESTY: "Bacterial outer membrane vesicles and the host-pathogen interaction", GENES DEV., vol. 19, 2005, pages 2645 - 2655, XP008155452, DOI: doi:10.1101/gad.1299905 |
| LAU KW; REN J; FUNG MC; WOO PC; YUEN KY; CHAN KK; QIAN PY; WONG PK; WU M: "Fangia hongkongensis gen. nov., sp. nov., a novel gammaproteobacterium of the order Thiotrichales isolated from coastal seawater of Hong Kong", INT J SYST EVOL MICROBIOL, vol. 57, November 2007 (2007-11-01), pages 2665 - 9 |
| LUND, V.; S. BORDAL; M. B. SCHRODER: "Specificity and durability of antibody responses in Atlantic cod (Gadus morhua L.) immunised with Vibrio anguillarum 02b", FISH.SHELLFISH.IMMUNOL., vol. 23, 2007, pages 906 - 910, XP022190759, DOI: doi:10.1016/j.fsi.2007.04.006 |
| LUND, V.; S. BORDAL; O. KJELLSEN; H. MIKKELSEN; M. B. SCHRODER: "Comparison of antibody responses in Atlantic cod (Gadus morhua L.) to Aeromonas salmonicida and Vibrio anguillarum", DEV.COMP IMMUNOL., vol. 30, 2006, pages 1145 - 1155, XP025088328, DOI: doi:10.1016/j.dci.2006.02.004 |
| MANTEGAZZA, A. R.; J. G. MAGALHAES; S. AMIGORENA; M. S. MARKS: "Presentation of phagocytosed antigens by MHC class I and II", TRAFFIC, vol. 14, 2013, pages 135 - 152 |
| MAUEL MJ; MILLER DL: "Piscirickettsiosis and piscirickettsiosis-like infections in fish: a review", VET MICROBIOL, vol. 87, 2002, pages 279 - 289, XP055078596, DOI: doi:10.1016/S0378-1135(02)00085-8 |
| MAUEL, M. J.; D. L. MILLER; E. STYER; D. B. POUDER; R. P. YANONG; A. E. GOODWIN; T. E. SCHWEDLER: "Occurrence of Piscirickettsiosis-like syndrome in tilapia in the continental United States", J.VET.DIAGN.INVEST, vol. 17, 2005, pages 601 - 605 |
| MAUEL, M. J.; E. SOTO; J. A. MORALIS; J. HAWKE: "A piscirickettsiosis-like syndrome in cultured Nile tilapia in Latin America with Francisella spp. as the pathogenic agent", J.AQUAT.ANIM HEALTH, vol. 19, 2007, pages 27 - 34 |
| MAUEL; MILLER, VET MICROBIOL, vol. 87, 2002, pages 279 - 289 |
| MCCAIG, W. D.; A. KOLLER; D. G. THANASSI: "Production of outer membrane vesicles and outer membrane tubes by Francisella novicida", J.BACTERIOL., vol. 195, 2013, pages 1120 - 1132, XP055318339, DOI: doi:10.1128/JB.02007-12 |
| MCCARTHY U; STEIROPOULOS NA; THOMPSON KD; ADAMS A; ELLIS AE; FERGUSON HW: "Confirmation of Piscirickettsia salmonis as a pathogen in European sea bass Dicentrarchus labrax and phylogenetic comparison with salmonid strains", DIS AQUAT ORGAN., vol. 64, no. 2, 18 April 2005 (2005-04-18), pages 107 - 19 |
| MCCLUSKIE; DAVIS, J.IMMUNOL., vol. 161, no. 9, 1998, pages 4463 - 6 |
| NIEVES, W.; S. ASAKRAH; O. QAZI; K. A. BROWN; J. KURTZ; D. P. AUCOIN; J. B. MCLACHLAN; C. J. ROY; L. A. MORICI: "A naturally derived outer-membrane vesicle vaccine protects against lethal pulmonary Burkholderia pseudomallei infection", VACCINE, vol. 29, 2011, pages 8381 - 8389 |
| NODA H; MUNDERLOH UG; KURTTI TJ: "Endosymbionts of ticks and their relationship to Wolbachia spp. and tick-borne pathogens of humans and animals", APPL ENVIRON MICROBIOL, vol. 63, no. 10, October 1997 (1997-10-01), pages 3926 - 32 |
| NYLUND, A.; K. F. OTTEM; K. WATANABE; E. KARLSBAKK; B. KROSS0Y: "Francisella sp. (Family Francisellaceae) causing mortality in Norwegian cod (Gadus morhua) farming", ARCH.MICROBIOL., vol. 185, 2006, pages 383 - 392, XP019419681, DOI: doi:10.1007/s00203-006-0109-5 |
| OLSEN, A. B.; J. MIKALSEN; M. RODE; A. ALFJORDEN; E. HOEL; K. STRAUM-LIE; R. HALDORSEN; D. J. COLQUHOUN: "A novel systemic granulomatous inflammatory disease in farmed Atlantic cod, Gadus morhua L., associated with a bacterium belonging to the genus Francisella", J.FISH.DIS., vol. 29, 2006, pages 307 - 311, XP002421766, DOI: doi:10.1111/j.1365-2761.2006.00714.x |
| PAMMIT, M. A.; E. K. RAULIE; C. M. LAURIANO; K. E. KLOSE; B. P. ARULANANDAM: "Intranasal vaccination with a defined attenuated Francisella novicida strain induces gamma interferon-dependent antibody-mediated protection against tularemia", INFECT.IMMUN., vol. 74, 2006, pages 2063 - 2071, XP055045431, DOI: doi:10.1128/IAI.74.4.2063-2071.2006 |
| PARK, S. B.; H. B. JANG; S. W. NHO; I. S. CHA; J. HIKIMA; M. OHTANI; T. AOKI; T. S. JUNG: "Outer membrane vesicles as a candidate vaccine against edwardsiellosis", PLOS.ONE., vol. 6, 2011, pages e17629, XP055183327, DOI: doi:10.1371/journal.pone.0017629 |
| PEREZ-CRUZ, C.; O. CARRION; L. DELGADO; G. MARTINEZ; C. LOPEZ-IGLESIAS; E. MERCADE: "New type of outer membrane vesicle produced by the Gram-negative bacterium Shewanella vesiculosa M7T: implications for DNA content", APPL.ENVIRON.MICROBIOL., vol. 79, 2013, pages 1874 - 1881 |
| PIERSON, T.; D. MATRAKAS; Y. U. TAYLOR; G. MANYAM; V. N. MOROZOV; W. ZHOU; M. L. VAN HOEK: "Proteomic characterization and functional analysis of outer membrane vesicles of Francisella novicida suggests possible role in virulence and use as a vaccine", J.PROTEOME.RES., vol. 10, 2011, pages 954 - 967, XP055431925, DOI: doi:10.1021/pr1009756 |
| PILSTROM, L.; G. W. WARR; S. STROMBERG: "Why is the antibody response of Atlantic cod so poor? The search for a genetic explanation", FISHERIES SCIENCE, vol. 71, 2005, pages 961 - 971 |
| QU P; DENG X; ZHANG J; CHEN J; ZHANG J; ZHANG Q; XIAO Y; CHEN S: "Identification and characterization of the Francisella sp. strain 08HL01032 isolated in air condition systems", WEI SHENG WU XUE BAO ACTA MICROBIOLOGICA SINICA, vol. 49, 2009, pages 1003 - 1110 |
| RENSHAW, S. A.; N. S. TREDE: "A model 450 million years in the making: zebrafish and vertebrate immunity", DIS.MODEL.MECH., vol. 5, 2012, pages 38 - 47 |
| ROMEU, B.; M. LASTRE; L. GARCIA; B. CEDRE; A. MANDARIOTE; M. FARINAS; R. OLIVA; E. ROZENQVIST; O. PEREZ: "Combined meningococcal serogroup A and W outer-membrane vesicles activate cell-mediated immunity and long-term memory responses against non-covalent capsular polysaccharide", A. IMMUNOL.RES., 2013 |
| ROY, K.; D. J. HAMILTON; G. P. MUNSON; J. M. FLECKENSTEIN: "Outer membrane vesicles induce immune responses to virulence proteins and protect against colonization by enterotoxigenic Escherichia coli", CLIN.VACCINE IMMUNOL., vol. 18, 2011, pages 1803 - 1808, XP055035065, DOI: doi:10.1128/CVI.05217-11 |
| SAMUELSEN, O. B.; A. H. NERLAND; T. JORGENSEN; M. B. SCHRODER; T. SVASAND; O. BERGH: "Viral and bacterial diseases of Atlantic cod Gadus morhua, their prophylaxis and treatment: a review", DIS.AQUAT.ORGAN, vol. 71, 2006, pages 239 - 254 |
| SCHILD, S.; E. J. NELSON; A. CAMILLI: "Immunization with Vibrio cholerae outer membrane vesicles induces protective immunity in mice", INFECT.IMMUN., vol. 76, 2008, pages 4554 - 4563, XP002651388, DOI: doi:10.1128/IAI.00532-08 |
| SCHRODER, M. B.; T. ELLINGSEN; H. MIKKELSEN; E. A. NORDERHUS; V. LUND: "Comparison of antibody responses in Atlantic cod (Gadus morhua L.) to Vibrio anguillarum, Aeromonas salmonicida and Francisella sp", FISH.SHELLFISH.IMMUNOL., vol. 27, 2009, pages 112 - 119, XP026336743, DOI: doi:10.1016/j.fsi.2008.11.016 |
| SEBASTIAN, S.; S. T. DILLON; J. G. LYNCH; L. T. BLALOCK; E. BALON; K. T. LEE; L. E. COMSTOCK; J. W. CONLAN; E. J. RUBIN; A. O. TZI: "A defined O-antigen polysaccharide mutant of Francisella tularensis live vaccine strain has attenuated virulence while retaining its protective capacity", INFECT.IMMUN., vol. 75, 2007, pages 2591 - 2602, XP055170791, DOI: doi:10.1128/IAI.01789-06 |
| See also references of EP2912186A4 |
| SOMMERSET, I.; B. KROSSOY; E. BIERING; P. FROST: "Vaccines for fish in aquaculture", EXPERT.REV.VACCINES., vol. 4, 2005, pages 89 - 101, XP009059664, DOI: doi:10.1586/14760584.4.1.89 |
| SOTO, E.; D. FERNANDEZ; J. P. HAWKE: "Attenuation of the fish pathogen Francisella sp. by mutation of the iglC* gene", J.AQUAT.ANIM HEALTH, vol. 21, 2009, pages 140 - 149 |
| SOTO, E.; J. WILES; P. ELZER; K. MACALUSO; J. P. HAWKE: "Attenuated Francisella asiatica iglC mutant induces protective immunity to francisellosis in tilapia", VACCINE, vol. 10, 2011, pages 593 - 598, XP027575665 |
| STAR, B.; A. J. NEDERBRAGT; S. JENTOFT; U. GRIMHOLT; M. MALMSTROM; T. F. GREGERS; T. B. ROUNGE; J. PAULSEN; M. H. SOLBAKKEN; A. SH: "The genome sequence of Atlantic cod reveals a unique immune system", NATURE, vol. 477, 2011, pages 207 - 210 |
| TITBALL, R. W.: "Vaccines against intracellular bacterial pathogens", DRUG DISCOV.TODAY, vol. 13, 2008, pages 596 - 600, XP022797176, DOI: doi:10.1016/j.drudis.2008.04.010 |
| TWINE, S.; M. BYSTROM; W. CHEN; M. FORSMAN; I. GOLOVLIOV; A. JOHANSSON; J. KELLY; H. LINDGREN; K. SVENSSON; C. ZINGMARK: "A mutant of Francisella tularensis strain SCHU S4 lacking the ability to express a 58-kilodalton protein is attenuated for virulence and is an effective live vaccine", INFECT.IMMUN., vol. 73, 2005, pages 8345 - 8352, XP003003095, DOI: doi:10.1128/IAI.73.12.8345-8352.2005 |
| VAN DE WATERBEEMD, B.; G. P. MOMMEN; J. L. PENNINGS; M. H. EPPINK; R. H. WIJFFELS; L. A. VAN DER POL; A. P. DE JONG: "Quantitative Proteomics Reveals Distinct Differences in the Protein Content of Outer Membrane Vesicle Vaccines", J.PROTEOME.RES., 2013 |
| WILHELM ET AL., VACCINE, vol. 24, 2006, pages 5083 - 5091 |
| WILHELM V; MIQUEL A; BURZIO LO; ROSEMBLATT M; ENGEL E; VALENZUELA S; PARADA G; VALENZUELA PD: "A vaccine against the salmonid pathogen Piscirickettsia salmonis based on recombinant proteins", VACCINE, vol. 24, 2006, pages 5083 - 91, XP028010704, DOI: doi:10.1016/j.vaccine.2006.03.027 |
| YANEZ AJ; VALENZUELA K; SILVA H; RETAMALES J; ROMERO A; ENRIQUEZ R; FIGUEROA J; CLAUDE A; GONZALEZ J; AVENDANO-HERRERA R: "Broth mediaum for the successful culture of the fish pathogen Piscirickettsia salmonis", DIS AQUAT ORG, vol. 97, 2012, pages 197 - 205, XP055371486, DOI: doi:10.3354/dao02403 |
| YU, J. J.; E. K. RAULIE; A. K. MURTHY; M. N. GUENTZEL; K. E. KLOSE; B. P. ARULANANDAM: "The presence of infectious extracellular Francisella tularensis subsp. novicida in murine plasma after pulmonary challenge", EUR.J.CLIN.MICROBIOL.INFECT.DIS., vol. 27, 2008, pages 323 - 325, XP019566679 |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2022512622A (ja) * | 2018-10-05 | 2022-02-07 | ユニヴァーシティー オブ ユタ リサーチ ファウンデーション | 改変受容体を含む血小板の作製方法及びその使用法 |
| EP3861102A4 (en) * | 2018-10-05 | 2022-07-13 | University of Utah Research Foundation | METHODS OF PRODUCTION OF BLOOD PLATELET WITH MODIFIED RECEPTORS AND USES THEREOF |
Also Published As
| Publication number | Publication date |
|---|---|
| ZA201502945B (en) | 2016-11-30 |
| IL238417A0 (en) | 2015-06-30 |
| JP6975105B2 (ja) | 2021-12-01 |
| JP2016501515A (ja) | 2016-01-21 |
| CA2888982C (en) | 2020-07-21 |
| BR112015009229A2 (pt) | 2017-11-14 |
| PL2912186T3 (pl) | 2021-06-14 |
| US20240270822A1 (en) | 2024-08-15 |
| JP2018161152A (ja) | 2018-10-18 |
| HK1211986A1 (en) | 2016-06-03 |
| KR101819803B1 (ko) | 2018-01-17 |
| US20190270791A1 (en) | 2019-09-05 |
| IL238417B (en) | 2019-07-31 |
| US20150344541A1 (en) | 2015-12-03 |
| EP2912186B1 (en) | 2021-01-06 |
| US20180009874A1 (en) | 2018-01-11 |
| CA2888982A1 (en) | 2014-05-01 |
| DK2912186T3 (da) | 2021-02-22 |
| US10294291B2 (en) | 2019-05-21 |
| ES2854754T3 (es) | 2021-09-22 |
| EP2912186A1 (en) | 2015-09-02 |
| EP3859004A1 (en) | 2021-08-04 |
| BR112015009229B1 (pt) | 2021-07-20 |
| EP2912186A4 (en) | 2016-06-08 |
| KR20150069017A (ko) | 2015-06-22 |
| US9982034B2 (en) | 2018-05-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240270822A1 (en) | Platelet targeted treatment | |
| AU2018202200B2 (en) | Improved gene therapy methods | |
| US9249210B2 (en) | Recombinant expression vector system for variants of coagulation factor VIII and von Willebrand factor | |
| Gangadharan et al. | High-level expression of porcine factor VIII from genetically modified bone marrow–derived stem cells | |
| US20090148425A1 (en) | Therapeutic method for blood coagulation disorder | |
| JP2018519827A (ja) | 逆配向のヒトユビキチンcプロモーターを含むレトロウイルスベクター | |
| Khamaikawin et al. | CRISPR/Cas9 genome editing of CCR5 combined with C46 HIV-1 fusion inhibitor for cellular resistant to R5 and X4 tropic HIV-1 | |
| JP2022529271A (ja) | Cybbレンチウイルスベクター、レンチウイルスベクター形質導入幹細胞、ならびにそれらの調製方法及び適用 | |
| HK40057844A (en) | Platelet targeted treatment | |
| HK1211986B (en) | Platelet targeted treatment | |
| Coquin et al. | Syncytins enable novel possibilities to transduce human or mouse primary B cells and to achieve well-tolerated in vivo gene transfer | |
| KR100969271B1 (ko) | 제8 혈액응고 인자와 폰 빌리 블란트 인자 변이체의 재조합 발현 벡터 시스템 | |
| KR100969268B1 (ko) | 제8 혈액응고 인자와 폰 빌리 블란트 인자 변이체의 재조합 발현 벡터 시스템 | |
| Johnston | Optimization of a Lentiviral Vector for use in an HSC Gene Therapy Protocol for Hemophilia A | |
| Avedillo Díez | A novel vector for the gene therapy of the Wiskott-Aldrich syndrome | |
| Ward | Lentiviral vectors for treatment of haemophilia | |
| Abdul-Razak | Correction of the classical scid mouse mutation by gene repair | |
| HK1127549A (en) | Therapeutic method for blood coagulation disorder |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13848463 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2888982 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 238417 Country of ref document: IL Ref document number: 14437457 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2015539804 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112015009229 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 20157012821 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013848463 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 112015009229 Country of ref document: BR Kind code of ref document: A2 Effective date: 20150424 |