WO2014003502A1 - 3-하이드록시프로피온산을 생산하는 재조합 미생물 및 이를 이용한 3-하이드록시프로피온산의 생산방법 - Google Patents

3-하이드록시프로피온산을 생산하는 재조합 미생물 및 이를 이용한 3-하이드록시프로피온산의 생산방법 Download PDF

Info

Publication number
WO2014003502A1
WO2014003502A1 PCT/KR2013/005803 KR2013005803W WO2014003502A1 WO 2014003502 A1 WO2014003502 A1 WO 2014003502A1 KR 2013005803 W KR2013005803 W KR 2013005803W WO 2014003502 A1 WO2014003502 A1 WO 2014003502A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
sequence encoding
nucleotide sequence
glycerol
amino acid
Prior art date
Application number
PCT/KR2013/005803
Other languages
English (en)
French (fr)
Inventor
이찬무
김영수
최인석
Original Assignee
삼성전자 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 삼성전자 주식회사 filed Critical 삼성전자 주식회사
Priority to US14/411,845 priority Critical patent/US9587255B2/en
Publication of WO2014003502A1 publication Critical patent/WO2014003502A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42—Hydroxy-carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/52—Propionic acid; Butyric acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01003—Aldehyde dehydrogenase (NAD+) (1.2.1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/01—Hydro-lyases (4.2.1)
    • C12Y402/0103—Glycerol dehydratase (4.2.1.30)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts

Definitions

  • the present invention relates to a method for producing 3-hydroxypropionic acid and a recombinant microorganism used therein. Specifically, a base sequence encoding a glycerol dehydratase derived from Iobobacter polytropus is used. And a recombinant microorganism comprising a base sequence encoding dehydrogenase converting 3′hydroxypropionaldehyde into 3-hydroxypropionic acid and culturing the same.
  • Biodiesel one of biofuels, is produced from vegetable oils or animal fats by ester exchange reactions of triglycerides. Due to mass production of biodiesel
  • Glycerol can be used as a raw material for oils, fibers, antistatic agents of leather, emulsifiers for detergents, as well as as a carbon source of microorganisms, and can be used to make various chemicals based on microorganisms.
  • 3-Hydroxypropionic acid (3-HP) is one of the promising platform chemicals that can be used as a raw material for various chemicals along with lactic acid and succinic acid. It is produced from microorganisms based on glycerol. Can be.
  • 3-HP has two functional groups that play an important role in the synthesis of optically active materials, which makes 3-HP an important precursor in the chemical industry.
  • Core compounds synthesized using 3-HP as precursors include acrylic acid (, 72.06), malonic acid (MW 104.06), and 1,3-propanediol (l, 3-propanediol, ⁇ 76.06). (See FIG. 1).
  • 3-HP can be produced from glycerol through biologically catalyzed dehydration and oxidation processes.
  • the first enzyme, Glycerol dehydratase dehydrates glycerol to convert 3-hydroxypropionaldehyde (3-HPA), and the second enzyme 3-hydroxypropy Aldehyde dehydrogenase (3-HPA dehydrogenase) oxidizes 3-HPA to produce 3-HP.
  • Glycer dehydratase is divided into two depending on the mode of action.
  • glycerol de hydratase derived from Clostridium butyricum is a vitamin B 12 independent enzyme, which has been reported to be active without the help of vitamin B 12 but has an extreme oxygen sensitivity (PNAS, 100: pp 5010-5015 (2003)).
  • PNAS, 100: pp 5010-5015 (2003) The production of 3-HP using this vitamin B 12 independent glycerol dehydratase does not require vitamin B 12 , which lowers the production cost. In production, difficulties in fermentation.
  • vitamin B 12 dependent enzyme US 6,852,5157
  • This enzyme is a vitamin B 12 dependent enzyme, and vitamin B 12 should be added when used for 3-HP production.
  • vitamin B 12 since it shows high activity in general aerobic microorganisms including Escherichia coli, it is higher than vitamin independent enzymes in producing high concentrations of 3 ⁇ HP. Relatively advantageous.
  • 3-HPA an intermediate product of 3-HP production
  • PD0 1,3-propanediol
  • glycerol can be converted to 1,3-propanediol by 1,3-PDO oxidoreductase after conversion to 3—HPA, 3—1,3-PDO to increase HP production It is necessary to curb production.
  • An object of the present invention is to provide an effective production method of 3-hydroxypropionic acid having high 3-hydroxypropionic acid production ability and low production of by-products, and a recombinant microorganism involved in 3 ′ high hydroxypropionic acid biosynthesis used therein.
  • One embodiment of the present invention is to convert glycerol derived from Iloobacter polytropus into a base sequence encoding glycerol dehydratase and 3 ′ high hydroxypropionaldehyde to 3-hydroxypropionic acid.
  • a method for producing 3-hydroxypropionic acid comprising the step of culturing a recombinant microorganism comprising a base sequence encoding a hydrogenase.
  • Still another embodiment of the present invention provides a transcriptional promoter, a nucleotide sequence encoding glycerol dehydratase, a nucleotide sequence encoding a glycerol dehydratase reactivation factor, and a transcription terminator It provides an expression cassette comprising Hadotok.
  • FIG. 1 is a schematic diagram showing the pathway for producing 3-hydroxypropionic acid from glycerol and the key compounds synthesized with the foregoing as a whole.
  • FIG. 2 is a schematic cleavage map for the recombinant vector of Example 1 (ET-iBAB-H).
  • 3 is a schematic cleavage map of the recombinant vector of Comparative Example 1 (ET—BAB-H).
  • 4 schematically shows a method for measuring the concentration of 3-hydroxypropionaldehyde (3-HPA) using acrolein and tryptophan.
  • Figure 5 shows the change in concentration (0D) of the cell culture with time in the production of 3-HP using the recombinant Escherichia coli prepared in Example 1 and Comparative Example 1, at 35 ° C culture conditions according to Experimental Example 1 .
  • Example 6 is prepared in Example 1 and Comparative Example 1, at 35 ° C culture conditions in accordance with Experimental Example 1 In a production experiment of 3-HP using one recombinant E. coli, the pH of the cell culture was shown with time.
  • Figure 7 shows the production of 3-HP over time in the production experiment, 3-HP using the recombinant E. coli prepared in Example 1 and Comparative Example 1, at 35 ° C culture conditions according to Experimental Example 1.
  • FIG. 8 shows the yield of 1,3-PDO according to the ⁇ time in the 3-HP production experiment using the recombinant E. coli prepared in Example 1 and Comparative Example 1, at 35 ° C culture conditions according to Experimental Example 1.
  • Figure 10 shows the change in concentration (0D) of the cell culture with time in the production of 3-HP using the recombinant E. coli prepared in Example 1 and Comparative Example 1, at 30 ° C culture conditions according to Experimental Example 2 Shows.
  • Figure 11 shows the pH change of the cell culture with time in the production of 3-HP using the recombinant E. coli prepared in Example 1 and Comparative Example 1, at 30 ° C culture conditions according to Experimental Example 2.
  • FIG. 12 shows the yield of 3-HP over time in the production experiment of 3-HP using the recombinant E. coli prepared in Example 1 and Comparative Example 1, at 30 ° C culture conditions according to Experimental Example 2.
  • FIG. 13 shows the yield of 1,3-PDO over time in the production experiment of 3-HP using the recombinant E. coli prepared in Example 1 and Comparative Example 1, at 30 ° C culture conditions according to Experimental Example 2.
  • Figure 14 shows the production of 3-HPA over time in the production of 3-HP using the recombinant E. coli prepared in Example 1 and Comparative Example 1, at 30 ° C culture conditions in accordance with Experimental Example 2.
  • a 'polypeptide' is to be interpreted to include an amino acid sequence that exhibits substantial identity to that amino acid sequence.
  • the above practical identity is minimal when aligning the amino acid sequence of the present invention with any other sequence as possible, and analyzing the aligned sequence using algorithms commonly used in the art.
  • amino acid sequence it represents 80% homology, preferably at least 90% homology.
  • the polypeptide may comprise at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, 98% of the specified amino acid sequences. At least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%,
  • Amino acids having at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identity A polypeptide having a sequence and related to 3-hydroxypropionic acid biosynthesis. In general, the higher the percent identity, the more desirable.
  • Polypeptides having said identity also include polypeptides involved in 3-hydroxypropionic acid synthesis, including amino acid sequences in which amino acid residues have been lost, substituted, inserted, and / or added in the polypeptides of the particular amino acid sequences described. .
  • polypeptides involved in 3-hydroxypropionic acid synthesis including amino acid sequences in which amino acid residues have been lost, substituted, inserted, and / or added in the polypeptides of the particular amino acid sequences described. .
  • 'polynucleotide' has the meaning of comprehensively including DNA (gDNA and cDNA) and RNA molecules, and the nucleotides that are the basic structural units in nucleic acid molecules are modified as well as natural nucleotides, sugar or base sites Analogues are also included.
  • polypeptides of the present invention are not limited to nucleic acid molecules encoding certain amino acid sequences (polypeptides) described above, and may include polypeptides having an amino acid sequence or a corresponding function showing substantial identity to the amino acid sequence. It is interpreted to include a nucleic acid molecule that encodes. This substantial identity is at least 80% homology when the amino acid sequence of the present invention is aligned with the maximal treatment of any other sequence, and the aligned sequence is analyzed using algorithms commonly used in the art. , Preferably an amino acid sequence exhibiting at least 90% homology.
  • polypeptides having corresponding functions include, for example, polypeptides of amino acid sequence in which one or more amino acids are lost, substituted, inserted, and / or added. All.
  • polypeptides comprise polypeptides which consist of an amino acid sequence in which one or more amino acid residues have been lost, substituted, inserted, and / or added, and which are involved in 3-hydroxypropionic acid synthesis.
  • the present invention relates to Iloobacter polytropus.
  • a base sequence encoding conventional glycerol and a hydroxyol dehydratase and a dehydrocarbon to convert 3-hydroxypropionaldehyde to 3-hydroxypropionic acid.
  • a method for producing 3-hydroxypropionic acid comprising culturing a recombinant microorganism comprising a nucleotide sequence encoding genase (3-HPA dehydrogenase), and a microorganism used therefor.
  • Dehydratage 1 of glycerol derived from Ilyobacter polytropus of the present invention means a polypeptide having an enzymatic activity of converting glycerol to 3-hydroxypropionaldehyde (3-HPA). .
  • Glyceric dehydratase according to the present invention microorganisms use glycerol as a substrate Glycerol dehydratase derived from the known vitamin Bi2 dependent Klebsiella pneumoniae derived from the known glycerol dehydratase.
  • the balance with dehydrogenase that converts 3HPA into 3-HP can be minimized to reduce the production of 1,3-PDO by minimizing the 1,3-PDO production pathway.
  • the glycerol dehydratase derived from the Ilyobacter polytropus is composed of three structural subunits of SEQ ID NO: 2, SEQ ID NO: 4 and SEQ ID NO: 6, and DhaBl, DhaB2, and As DhaB3 glycer constitutes the ⁇ , ⁇ and ⁇ subunits of the dehydratase enzyme.
  • amino acid sequence of SEQ ID NO: 2 is based on DhaBl derived from Iloobacter polytropus
  • amino acid sequence of SEQ ID NO: 4 is DhaB2 derived from Iloobacter polytropus
  • the amino acid sequence set forth in SEQ ID NO: 6 competes with DhaB3 from Ilyobacter polytropus.
  • nucleotide sequence of SEQ ID NO: 1 is based on dhaBl derived from Iloobacter polytropus
  • nucleotide sequence of SEQ ID NO: 3 is dhaB2 derived from Ilyobacter polytropus
  • SEQ ID NO: 5 The base sequence described in the above is based on dhaB3 derived from Ilyobacter polytropus.
  • the nucleotide sequence encoding glyceride dehydratase applicable to the present invention is a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6 It may be a nucleotide sequence encoding the tide.
  • the base sequence encoding glycerol dehydratase may be a nucleotide sequence including all ⁇ , ⁇ and Y subunits of glycerol dehydratase enzyme as DhaBl, DhaB2 and DhaB3.
  • the base sequence encoding the glycerol dehydratase may include the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5.
  • the nucleotide sequence encoding glyceride dehydratase is DhaBl, DhaB2 and DhaB3 as the base sequence containing all of the ⁇ , ⁇ and ⁇ subunits of the glyceride dehydrase enzyme, ie, SEQ ID NO: 1, SEQ ID NO: Both 3 and SEQ ID NO: 5 may be included.
  • 3-hydroxy propionaldehyde dehydrogenase for converting 3-hydroxypropionaldehyde to 3-hydroxypropionic acid' of the present invention is called 3-hydroxy propionaldehyde dehydrogenase (3-HP dehydrogenase), which is a dehydrogenation reaction. It is an enzyme if 3-HPA can be converted to 3-HP via NAD + / NADH or NADP + / NADPH as coenzyme.
  • the base sequence encoding the dehydrogenase preferably may be a base sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 12, which is reciprocal to AldH derived from E. coli K-12, preferably SEQ ID NO: GI on 11 It may be a nucleotide sequence.
  • the glycerol according to the invention is irreversibly inactivated by glycerol or by interaction with 1,3-propanedi while the dehydratase is catalyzed. Therefore, the recombinant microorganism producing 3-HP of the present invention may further include a nucleotide sequence encoding glycerol dehydratase reactivator for glycerol for activating dehydratase.
  • the glyceride dehydratase reactivation factor may be any one commonly known and described in WO 98/21341 (US 6,013,494), R. Daniel et Eur. J. Biochem. , 268 (2001), pp. 2369-2378, Toraya and Mori, J.
  • the sequences encoding the dehydratase reactivation factor are Citrobacter f reundi i-derived gene dhaFG (ABI36568.1), Klebsiella pneumonia-derived gdrAB (EF077655.1), Klebsiella oxytoca ddrAB (AAC15871), and Ilobacter polytropus Derived from GdrA (SEQ ID NO: 7) and GdrB (SEQ ID NO: 9) and the like.
  • the base sequence encoding the glycerol dehydratase reactivation factor may include a base sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 8 and SEQ ID NO: 10, more preferably It may include the nucleotide sequence described in SEQ ID NO: 7 and the nucleotide sequence described in SEQ ID NO: 9.
  • nucleotide sequence encoding the transcriptional promoter, glycerol dehydratase, glycerol A base sequence encoding a reactivation factor of dehydratase, and an expression cassette operably including a transcription terminator, wherein the base sequence is as described above.
  • the "expression cassette" of the present invention refers to a nucleic acid fragment comprising a nucleotide sequence encoding a gene and a regulatory sequence existing before and after the nucleotide sequence and mainly exists in the vector.
  • the expression cassette generally includes a promoter sequence, a sequence encoding a gene, and an electronic terminator.
  • the "transcriptional promoter” of the present invention refers to a DNA sequence that regulates the expression of a coding sequence and includes an enhancer.
  • the promoter may be a natural gene or may be derived from a promoter different from the natural one.
  • that the promoter is "operably linked” means that the promoter is linked to the coding sequence so that the coding sequence can be expressed.
  • the "transcription termination sequence” of the present invention means a DNA sequence present downstream of a sequence encoding a gene.
  • Promoters applicable to the present invention CYCl, HIS3, GALl, GAL10, ADHl, PGK, PH05, GAPDH, ADCl, TRPl, URA3, LEU2, ENO, and lac, ara, tet, trp, / P _, IPp>, T7, tac, trc, amy, apr, npr, etc. can be used.
  • a further embodiment of the present invention provides a microorganism comprising said expression cassette and involved in the biosynthesis of 3-hydroxypropionic acid.
  • the recombinant microorganism according to the present invention may be derived from a microorganism having the same base sequence encoding glyceride dehydratase reactivation factor and the same base sequence encoding glyceride dehydratase, both of which are ilobacter polytrope Perth (Ilyobacter polytropus) is most preferred in terms of the synthesis efficiency of 3-hydroxypropionic acid.
  • SEQ ID NO: 2 (DhaBl), SEQ ID NO: 4 (DhaBl) and SEQ ID NO: 6 (DhaBl), SEQ ID NO: 8 (GdrA), SEQ ID NO: 10 (GdrB) and a standing column No. 12 It can be expressed as including a nucleotide encoding the polypeptide described in (Akffl), more preferably SEQ ID NO: l (dhaBl), SEQ ID NO:
  • the recombinant microorganism that can be used to obtain the recombinant microorganism of the present invention is not limited as long as it can express the gene, and may be selected from the group consisting of bacteria, yeast and fungi.
  • Ashkerikia a group consisting of bacteria, yeast and fungi.
  • Expression cassette that can be used in the dehydration of glycerol in the present invention and The method for producing a recombinant microorganism containing can be used a known method.
  • the produced expression cassette is introduced into a suitable host cell using a known method. Specifically, methods such as transformation using heat shock or electroporat ion, and transfection using recombinant phage may be used.
  • the introduced expression cassette can be kept extrachromosomal or integrated into the chromosome by random recombination using homologous recombination or vector using known techniques.
  • Cultivation of recombinant microorganisms used in the production method of 3-hydroxypropionic acid or 3-hydroxypropionic acid biosynthesis of the present invention is selected from the group consisting of monosaccharides, polysaccharides, polysaccharides or glycerol as a carbon source. It may be carried out in the presence of more than one carbon source. Among them, glycerol is included as a carbon source, and glucose is included to further promote cell growth, and production efficiency of 3-HP is preferable from the viewpoint of economics. In the case of microorganisms that do not naturally convert glucose into glycerol, foreign genes required for the conversion may be introduced by known methods to produce 3-HP from glucose. Vitamin B 12 may be added to the medium used in the culture.
  • the above culture conditions can be appropriately adjusted according to the host cell used, for example, in the case of E. coli aerobic conditions, pH 6 ⁇ 7.6, the temperature is 30 ° C or more, preferably 33 ⁇ 37 ° C At temperatures, it can be carried out for 1 to 4 days. In the case of culturing in the above range, 3-hydroxypropionic acid is efficiently Can produce. Since the culture temperature according to the present invention uses enzymes and microorganisms that are stable at a high temperature, it is not preferable that the incubation required for maintaining the incubation temperature can be reduced, and thus, additional facilities such as incidence and cost can be reduced. Using microorganisms
  • the culture temperature increases due to the culture heat of the microorganisms, and if enzymes or microorganisms with high stability are used under the increased culture temperature conditions, 3-HP is continuously maintained under stabilized conditions.
  • the present invention can be carried out in batch, pad-batch, or continuous mode, and any known fermentation method is also suitable.
  • the cells may be immobilized on the substrate and fermented.
  • Glycere dehydratase derived from Ilyobacter polytropus is a glycerol derived from Klebsiella pneumoniae as previously reported. Since it shows an excellent effect on propionic acid production capacity and reduces the production of 1,3-propanediol, glycerol derived from the existing Klebsiella pneumoniae is substituted for dehydratase to produce 3-hydroxypropionic acid. It was confirmed that it can be effectively used.
  • the present invention will be described in more detail with reference to Examples. However, these examples are only for illustrating the present invention, and the scope of the present invention should not be construed as being limited by these examples.
  • Example 1 Preparation of a Recombinant Microorganism Containing Ilobacter Polytropes-Derived Glycer Decoding the Dehydratase Gene
  • Step 1 Construction of a recombinant vector containing a glycerin de hydratase expression gene derived from Ilyobacter polytropus
  • Genomic DNA was extracted from Iloobacter polytropus DSM 2926, PCR amplification of the dhaB123—gdrA and gdrB genes from the genomic DNA using the following primers respectively, and NcoI-EcoRI and the pET—Duet (Novagen) vector; ET-iBAB vector was prepared by inserting each into EcoRI-SacI position.
  • dhaBl / dhaB2 and dhaB3 were cleaved with BspHI and BamHI, and gdrA and gdrB were cleaved with BamHI and Sac I.
  • PCR conditions were as follows: using Phusion high fidelity DNA polymerase (Thermo scientific), Cycle I (98 ° C, 30 sec), Cycle ⁇ (30 cycles / 98 ° C, 10 sec / 55 ° C, 1 min , 72 ° C, 2 min), Cycle ⁇ (72 ° C, 5 min). Both amplified DNA fragments were inserted into the NcoI-EcoRI and EcoRI_SacI positions of the pET-Duet (Novagen) vector, respectively, to prepare ET-iBAB.
  • Step 2 Construction of a Recombinant Vector Comprising a Gene Encoding an Aldehyde Dehydrogenase
  • Genomic DNA was extracted from Escherichia coli K-12 and the aldH gene was amplified using the following primers and digested with Ndel and Bgin.
  • Cycle I (97 ° C, 5 min)
  • Cycle ⁇ (31 cycles / 97 ° C, 1 min / 55 ° C, 1 min, 72 ° C, 3 min)
  • CyclelH (72 ° C, 10 min).
  • the ET-H vector of ⁇ Step 2> was treated with restriction enzymes Sall-HF and Avrll to obtain DNA fragments containing aldH in the ET-H vector, which were subjected to the same enzyme treatment.
  • Example 2 is a schematic cleavage map for the recombinant vector of Example 1 (ET-iBAB-H).
  • the dhaBl, dhaB2 and dhaB3 genes are called Ilyobacter polytropus Glycerol dehydratase coding gene derived from glycerol, 2) gdrA, gdrB is a glycerol dehydratase reactivator coding gene for glycerol derived from Ilyobacter polytropus 3) aldH is an aldehyde dehydrogenase coding gene derived from E. coli K-12.
  • the recombinant vector ET-iBAB-H prepared in ⁇ Step 3> was transformed into E. coli to prepare a recombinant strain.
  • Genomic DNA was extracted from E. coli K-12 to obtain the aldH gene, and the aldH gene was amplified using the following primer and cleaved with Ndel and Bgin.
  • Cycle I (97 ° C, 5 min)
  • Cycle ⁇ (31 cycles / 97 ° C, 1 min / 55 ° C, 1 min, 72 ° C, 3 min)
  • Cycle m (72 ° C, 10 min).
  • the amplified DNA was introduced into a pET-BAB vector digested with the same enzyme to prepare an ET-BAB-H vector.
  • the recombinant vector ET-BAB-H prepared in the above step was transformed into Escherichia coli to prepare a recombinant strain (see FIG. 3).
  • FIG. 3 is a schematic cleavage map of the recombinant vector (ET-BAB-H) of Comparative Example 1.
  • FIG. 3 is a schematic cleavage map of the recombinant vector (ET-BAB-H) of Comparative Example 1.
  • dhaBl, dhaB2 and dhaB3 genes are derived from klebsiel la pneumoniae glycerol dehydratase gene; 2) gdrA and gdrB are klebsiella pneumoniae Glycerol dehydratase reactivator gene, 3) aldH is derived from E. coli K-12 Aldehyde dehydrogenase coding gene.
  • HPLC high performance liquid chromatography
  • Aminex HPX-87H (300 ⁇ * 7.8 ⁇ ) column was used for 3-HP analysis, and the mobile phase was 0.4 m £ / flow rate using a solution containing 9% acetonitrile in a 0.5 mM sulfuric acid solution. It was held by min. The temperature of the column was 35 ° C. and the detector used RI and UV / VIS (210 nm) dual mode. 3-HP was detected at 17.5 min out of a total of 35 min analysis time, and production of 3—HP was also confirmed by liquid chromatography / mass spectrometry (LC / MS).
  • LC / MS liquid chromatography / mass spectrometry
  • the 0D value was similar in the two strains up to 10 hours, after 10 hours the strain of Example 1 showed a slightly higher value than the comparative example 1 and strain, the pH of the culture medium was also similar It showed an aspect.
  • the strain of Comparative Example 1 was 48.9 mM and 48 hours in 24 hours. While the liver of 61.1mM, the strain of Example 1 according to the present invention showed a high 3-HP production of 83.3mM at 24 hours, 121mM at 48 hours (Fig. 7).
  • the total activity of glycerol dehydratase can be confirmed indirectly by obtaining the amount of 3-HPA by combining the production of 3-HP and the production of 1,3-PDO (FIG. 9).
  • FOG. 9 The total activity of glycerol dehydratase can be confirmed indirectly by obtaining the amount of 3-HPA by combining the production of 3-HP and the production of 1,3-PDO (FIG. 9).
  • HPLC high performance liquid chromatography
  • Aminex HPX-87H (300 ⁇ * 7.8 ⁇ ) column was used for 3-HP analysis, and the mobile phase was 0.4 m ⁇ iiin with a solution containing 9% acetonitrile in 0,5 mM sulfuric acid solution. To be held. The temperature of the column was 35 ° C. and the detector used RI and UV / VIS (210 nm) dual mode. 3-HP was detected at 17.5 min out of a total of 35 min analysis time and the production of 3-HP was also confirmed by liquid chromatography / mass spectrometry (LC / MS).
  • LC / MS liquid chromatography / mass spectrometry
  • Example 1 In contrast, the strain of Example 1 according to the present invention showed 58.27 mM for 24 hours at 30 ° C. and 83.34 mM at 48 hours for 48 hours (FIG. 12). In the case of 1,3-PDO production, in the strain of Comparative Example 1 at 31.65mM at 24 ° C, 48 hours at 30 ° C.
  • Example 1 61.47 mM, whereas the strain of Example 1 according to the present invention at 30 ° C for 24 hours.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 일로박터 폴리트로퍼스(Ilyobacter polytropus) 유래의 글리세롤 데하이드라타제(glycerol dehydratase)를 코딩하는 염기서열 및 3-하이드록시프로피온알데히드를 3-하이드록시프로피온산으로 전환시키는 데하이드로게나제(dehydrogenase)를 코딩하는 염기서열을 포함하는 재조합 미생물을 배양하는 단계를 포함하는 3-하이드록시프로피온산의 생산방법 및 그에 사용되는 재조합 미생물에 관한 것으로서, 종래 크렙시엘라 뉴모니아(klebsiella pneumoniae) 유래의 비타민 B12 의존성 글리세롤 데하이드라타제를 발현하는 유전자를 포함하는 재조합 미생물보다 3-하이드록시프로피온의 생산이 현저하게 증가하고, 또한 3-하이드록시프로피온산 생산시 부산물로 발생하는 1,3-프로판디올(1,3-propanediol; 1,3-PDO)의 생산량을 현저히 감소하는 효과를 발휘한다.

Description

【명세서】
【발명의 명칭】
3-하이드록시프로피온산을 생산하는 재조합 미생물 및 이를 이용한 3-하이드 록시프로피온산의 생산방법
【기술분야】
본 발명은 3-하이드록시프로피온산의 생산방법 및 그에 사용되는 재조합 미 생물에 관한 것으로， 구체적으로는 일로박터 폴리트로퍼스 (Ilyobacter polytropus) 유래의 글리세롤 데하이드라타제 (glycerol dehydratase)를 코딩하는 염기서열 및 3ᅳ하이드록시프로피온알데히드를 3-하이드록시프로피온산으로 전환시키는 데하이드 로게나제를 코딩하는 염기서열을 포함하는 재조합 미생물 및 이를 배양하는 단계를 포함하는 3-하이드록시프로피온산의 생산방법이다.
【발명의 배경이 되는 기술】
최근 석유 기반 산업의 확장에 따른 지구 온난화 문제와 석유 가격의 심한 변동 및 상승 등으로 인한 석유 기반 산업의 문제점들이 논의되기 시작하였고， 이 에 바이오를 기반으로 한 화학， 에너지 산업이 주목을 받게 되었다. 바이오 연료의 하나인 바이오 디젤은 식물성 기름이나 동물성 지방으로부터 트리글리세리드의 에 스테르 교환반웅에 의하여 생산되고 있다. 바이오 디젤의 대량생산으로 인하여 부
1
대체용지 (규칙 제 26조) 산물인 글리세를의 생산이 급증하게 되었고, 대량으로 생산되는 글리세를은 계속하 여 가격이 낮아지는 추세에 있다. 앞으로 바이오 디젤의 시장 수요가 증가하여 시 장이 커질수록 부산물인 글리세를의 생산량은 급격하게 증가할 것이며 글리세를의 가격도 현재보다 더욱 낮아질 것으로 예측된다.
글리세를은 유지， 섬유， 피혁의 대전 방지제， 세제용 유화제의 원료로 사용 될 수 있으며， 뿐만 아니라 미생물의 탄소원으로 사용가능하여 이를 활용하여 미생 물 기반으로 다양한 케미칼을 만들 수 있다. 그 중 3-하이드록시프로피온산 (3- hydroxypr op ionic acid; 3-HP)은 젖산， 숙신산과 더불어 다양한 케미칼의 원료로 사용될 수 있는 유망 플랫폼 화학원료 중 하나로， 글리세를을 기반으로 미생물로부 터 생산될 수 있다. 3-HP는 광학적으로 활성이 있는 물질의 합성을 위해 중요한 역 할을 하는 2개의 작용기를 가지고 있는데, 이는 화학산업에서 3-HP가 중요한 전구 체로 각광을 받게 하는 요소이다. 3-HP를 전구체로 하여 합성되는 핵심 화합물로 는 아크릴산 (acrylic acid, 匿 72.06), 말론산 (malonic acid, MW 104.06), 1,3- 프로판디올 (l,3-propanediol, 丽 76.06) 등이 있다 (도 1 참조).
도 1에 나타낸 바와 같이， 생물학적으로 두 종의 효소가 촉매하는 탈수 및 산화 공정을 통하여 글리세를로부터 3-HP를 생산할 수 있다. 첫 번째 효소인 글리 세를 데하이드라타제 (Glycerol dehydratase)로 글리세를을 탈수반웅시켜 3-하이드 록시프로피온알데히드 (3— Hydroxypropionaldehyde; 3-HPA)로 전환하고， 두 번째 효 소인 3-하이드록시프로피은알데히드 데하이드로게나아제 (3-HPA dehydrogenase)가 3-HPA를 산화시켜 3-HP를 생성하게 된다. 글리세를 데하이드라타제는 작용 방식에 따라 2가지로 나뒤어진다.
먼저 클로스트리디움 부티리쿰 (Clostridium butyricum) 유래의 글리세롤 데 하이드라타제는 비타민 B12 비의존성 효소로서， 비타민 B12도움 없이 활성올 나타내 는 것으로 보고되었으나 극도의 산소 민감도를 가지고 있다 (PNAS, 100： pp 5010- 5015 (2003)). 이와 같은 비타민 B12 비의존성 글리세롤 데하이드라타제를 이용한 3-HP 생산은 비타민 B12를 필요로 하지 않기 때문에 생산단가를 낮출 수 있지만 산 소 민감도가 극도로 높기 때문에 재조합 미생물을 만들어 3-HP를 생산시, 발효에 어려움을 겪는다.
다음으로 크랩시엘라 뉴모니아 (Klebsiella pneumoniae) 유래의 글리세를 데 하이드라타제는 비타민 B12 의존성 효소로 알려져 있다 (US 6,852,517). 이 효소는 비타민 B12 의존성 효소로서 , 3-HP 생산에 이용시 비타민 B12를 첨가하여야 하지만， 대장균을 비롯한 일반적인 호기성 미생물에서 높은 활성을 나타내므로 고농도로 3ᅳ HP생산하는데 있어 비타민 비의존성 효소에 비해 상대적으로 유리하다.
한편 3-HP 생산의 중간 산물인 3— HPA는 또한 1，3-프로판디올 (1,3- propanediol, PD0)을 생산하는 중간체로 사용될 수 있다. 즉， 글리세롤이 3—HPA로 전환된 후 1,3-PDO 옥시도리덕테이즈 (oxidoreductase)에 의하여 1,3-프로판디올로 전환될 수 있으며, 3— HP 생산을 증가시키기 위하여 1,3-PDO 생산을 억제하는 것이 필요하다.
【발명의 내용】 【해결하고자 하는 과제】
본 발명의 목적은 3-하이드록시프로피은산 생산능이 우수하면서 부산물의 생 산이 적은 3-하이드록시프로피온산의 효과적인 생산방법 및 그에 사용되는 3ᅳ하이 드록시프로피온산 생합성에 관여하는 재조합 미생물을 제공하는 것이다.
【과제의 해결 수단】
본 발명의 일구현는, 일로박터 폴리트로퍼스 (Ilyobacter polytropus) 유래의 글리세를 데하이드라타제 (glycerol dehydratase)를 코딩하는 염기 서열 및 3ᅳ하이 드록시프로피온알데히드를 3-하이드록시프로피온산으로 전환시키는 데하이드로게나 제 (dehydrogenase)를 코딩하는 염기 서열을 포함하는 재조합 미생물을 배양하는 단 계를 포함하는 3-하이드록시프로피온산의 생산방법올 제공한다.
본 발명의 또 다른 구현예는， 전사 프로모터， 글리세를 데하이드라타제 (glycerol dehydratase)를 코딩하는 염기 서열， 글리세를 데히드라타제의 재활성화 인자를 코딩하는 염기서열， 및 전사 종결인자를 작동 가능하도톡 포함하는 발현 카 세트를 제공한다.
또한， 본 발명의 추가 구현예는， 상기 발현 카세트를 포함하고 3-하이드록시 프로피온산의 생합성에 관여하는 재조합 미생물을 제공한다.
【발명의 효과】
본 발명에 따른 3-하이드록시프로피온산의 생산방법 및 그에 사용되는 재조 합 미생물은 및 이를 이용한 3-하이드록시프로피온산 생산방법은 기존에 보고된 크 렙시엘라 뉴모니아 (klebsiella pneumoniae) 유래의 비타민 B12 의존성 글리세롤 데 하이드라타제를 발현하는 유전자를 포함하는 재조합 미생물보다 3-하이드록시프로 피온산의 생산이 현저하게 증가하고， 또한 3-하이드록시프로피온산 생산시 부산물 로 발생하는 1，3-프로판디을 (1ᅳ 3-propanediol; 1,3-PDO)의 생산량을 현저히 감소하 는 효과를 발휘한다 .
따라서 본 발명의 재조합 미생물을 이용하여 3-하이드록시프로피온산을 경제 적으로 대량 수득할 수 있는 효과가 있다.
【도면의 간단한 설명】
도 1은 글리세를로부터 3-하이드록시프로피온산을 생성하는 경로와 이를 전 구체로 하여 합성되는 핵심 화합물들을 보여주는 개략적인 모식도이다.
도 2는 실시예 1의 재조합 백터 (ET-iBAB-H)에 대한 개략적인 개열지도이다. 도 3은 비교예 1의 재조합 백터 (ET— BAB-H)에 대한 개략적인 개열지도이다. 도 4는 아크를레인과 트립토판을 이용한 3-하이드록시프로피온 알데히드 (3- Hydroxypropionaldehyde; 3-HPA)의 농도 측정방법올 개략적으로 보여준다.
도 5은 실험예 1에 따라 35°C 배양조건에서， 실시예 1 및 비교예 1에서 제 조한 재조합 대장균올 이용한 3-HP를 생산실험에서， 시간에 따른 세포 배양액의 농도 (0D) 변화를 보여준다.
도 6은 실험예 1에 따라 35°C 배양조건에서， 실시예 1 및 비교예 1에서 제조 한 재조합 대장균을 이용한 3-HP를 생산실험에서， 시간에 따른 세포 배양액의 pH 변화를 보여준다.
도 7은 실험예 1에 따라 35°C 배양조건에서， 실시예 1 및 비교예 1에서 제조 한 재조합 대장균을 이용한 3-HP를 생산실험에서， 시간에 따른 3-HP의 생산량을 보 여준다.
도 8은 실험예 1에 따라 35°C 배양조건에서, 실시예 1 및 비교예 1에서 제조 한 재조합 대장균을 이용한 3-HP를 생산실험에서 ᅳ 시간에 따른 1,3-PDO의 생산량을 보여준다.
도 9은 실험예 1에 따라 35°C 배양조건에서， 실시예 1 및 비교예 1에서 제조 한 재조합 대장균을 이용한 3-HP를 생산실험에서， 시간에 따른 3-HPA의 생산량을 보여준다.
도 10은 실험예 2에 따라 30°C 배양조건에서 , 실시예 1 및 비교예 1에서 제 조한 재조합 대장균을 이용한 3-HP를 생산실험에서， 시간에 따른 세포 배양액의 농 도 (0D) 변화를 보여준다. - 도 11은 실험예 2에 따라 30°C 배양조건에서， 실시예 1 및 비교예 1에서 제 조한 재조합 대장균을 이용한 3-HP를 생산실험에서 , 시간에 따른 세포 배양액의 pH 변화를 보여준다.
도 12은 실험예 2에 따라 30°C 배양조건에서, 실시예 1 및 비교예 1에서 제 조한 재조합 대장균을 이용한 3-HP를 생산실험에서, 시간에 따른 3-HP의 생산량을 보여준다. 도 13은 실험예 2에 따라 30°C 배양조건에서, 실시예 1 및 비교예 1에서 제 조한 재조합 대장균을 이용한 3-HP를 생산실험에서， 시간에 따른 1,3-PDO의 생산량 을 보여준다.
도 14은 실험예 2에 따라 30°C 배양조건에서， 실시예 1 및 비교예 1에서 제 조한 재조합 대장균을 이용한 3-HP를 생산실험에서， 시간에 따른 3-HPA의 생산량을 보여준다.
【발명을 실시하기 위한 구체적인 내용】
본 발명의 구체적인 내용을 기술하기에 앞서 본 명세서에 사용된 용어에 대 하여 의미를 서술한다.
본 명세서에서 사용되는 '폴리펩타이드'는 해당 아미노산 서열에 대하여 실 질적인 동일성을 나타내는 아미노산 서열을 포함하는 것으로 해석된다. 상기의 실 질적인 동일성은 본 발명의 아미노산 서열과 임의의 다른 서열을 최대한 대웅되도 록 얼라인하고， 당업계에서 통상적으로 사용되는 알로리즘을 이용하여 얼라인된 서 열을 분석한 경우에， 최소 80%의 상동성， 바람직하게는 최소 90%의 상동성올 나타 내는 아미노산 서열을 의미한다.
예를 들어, 상기 폴리펩타이드는 기재된 특정의 아미노산 서열과 약 90% 이 상, 91% 이상， 92% 이상， 93% 이상, 94% 이상， 95% 이상， 96% 이상， 97% 이상， 98% 이상, 99% 이상, 99.1% 이상, 99.2% 이상， 99.3% 이상, 99.4% 이상, 99.5% 이상,
99.6% 이상， 99.7% 이상， 99.8% 이상， 또는 99.9% 이상의 동일성을 갖는 아미노산 서열을 가지며 3-하이드록시프로피온산 생합성 관련하는 플리펩타이드를 포함한다. 일반적으로, 동일성 퍼센트가 높을수록 더욱 바람직하다.
또한 상기 동일성을 가지는 폴리펩타이드는 기재된 특정 아미노산 서열의 폴 리펩타이드에서 아미노산 잔기가 소실, 치환， 삽입， 및 /또는 첨가된 아미노산 서열 을 포함하면서 3-하이드록시프로피온산 합성과 관련되는 폴리펩타이드를 포함한다. 일반적으로， 소실, 치환， 삽입， 및 /또는 첨가의 수는 적을수록 더욱 바람직하다. 본 명세서에 사용되는 '폴리뉴클레오타이드'는 DNA(gDNA 및 cDNA) 그리고 RNA 분자를 포괄적으로 포함하는 의미를 가지며， 핵산 분자에서 기본 구성 단위인 뉴클레오타이드는 자연의 뉴클레오타이드 뿐만 아니라， 당 또는 염기 부위가 변형 된 유사체 (analogues)도 포함한다.
본 발명의 폴리뉴클레오타이드는 상기 기재된 특정의 아미노산 서열 (폴리펩 타이드)을 암호화하는 핵산 분자에 제한되지 않고， 아미노산 서열에 대하여 실질적 인 동일성을 나타내는 아미노산 서열 또는 그에 상응하는 기능을 갖는 폴리펩타이 드를 암호화하는 핵산 분자를 포함하는 것으로 해석된다. 상기의 실질적인 동일성 은 본 발명의 아미노산 서열과 임의의 다른 서열을 최대한 대웅되도록 얼라인하고， 당업계에서 통상적으로 사용되는 알고리즘을 이용하여 얼라인된 서열을 분석한 경 우에， 최소 80%의 상동성 , 바람직하게는 최소 90%의 상동성을 나타내는 아미노산 서열을 의미한다.
상기 상응하는 기능을 가진 폴리펩타이드는 예를 들어, 하나 이상의 아미노 산이 소실， 치환， 삽입， 및 /또는 첨가되는 아미노산 서열의 폴리펩타이드를 포함한 다. 그러한 폴리펩타이드는 1 개 이상의 아미노산 잔기가 소실， 치환， 삽입， 및 /또 는 첨가된 아미노산 서열로 이루어지며 3-하이드록시프로피온산 합성 관련되는 폴 리펩타이드를 포함한다.
아미노산 서열 또는 뉴클레타이드 서열 사이의 동일성은 Karl in 및 Altschul 에 의한 알고리즘 BLAST를 사용해 측정될 수 있으며， BLAST 알고리즘을 바탕으로 한 BLASTN 및 BLASTX 라고 하는 프로그램에 의할 수 있다. 뉴클레타이드 서열이 BLASTN 을 사용하여 서열화되는 경우， 변수는 예를 들어， 스코어 = 100 이고, 워드 길이 = 12 이다. 아미노산 서열이 BLASTX 를 사용하여 서열화되는 경우, 변수는 예 를 들어， 스코어 = 50 이고 워드 길이 = 3 이다. BLAST 및 Gapped BLAST 프로그램 이 사용되는 경우， 각각의 프로그램에 대해 디폴트 변수가 적용된다.
본 발명은， 일로박터 폴리트로퍼스 (Ilyobacter polytropus).유래의 글리세를 데하이드라타제 (glycerol dehydratase)를 코딩하는 염기서열 및 3-하이드톡시프로 피온알데히드를 3-하이드록시프로피온산으로 전환시키는 데하이드로게나제 (3-HPA dehydrogenase)를 코딩하는 염기서열을 포함하는 재조합 미생물을 배양하는 단계를 포함하는 3—하이드록시프로피온산의 생산방법 및 그에 사용되는 미생물을 제공한다. 이하 도면을 참조하여 본 발명을 구체적으로 설명한다.
본 발명의 '일로박터 폴리트로퍼스 (Ilyobacter polytropus) 유래의 글리세를 데하이드라타게1는 글리세를을 3-히드록시프로피온알데히드로 (3-HPA) 전환시키는 효소 활성을 가지는 폴리펩리드를 의미한다.
본 발명에 따른 글리세를 데하이드라타제는 미생물이 글리세를을 기질로 사 용할 수 있게 하며， 공지의 비타민 Bi2 의존성 크렙시엘라 뉴모니아 (Klebsiella pneumoniae) 유래의 글리세롤 데하이드라타제보다 글리세를을 3—HPA로 전환하는 활 성이 우수한 특징이 있다. 또한， 3HPA를 3-HP로 전환시키는 데하이드로게나제와의 밸런스가 적합하여 1,3-PDO 생성 경로를 최소화하여 1,3-PDO의 생산량을 감소시킬 수 있다.
상기 일로박터 폴리트로퍼스 (Ilyobacter polytropus) 유래의 글리세롤 데하 이드라타제 (glycerol dehydratase)는 는 서열번호 2， 서열번호 4 및 서열번호 6 의， 3개의 구조적 서브유닛으로 구성되며， 각각 DhaBl, DhaB2 및 DhaB3으로서 글리세를 데하이드라타제 효소의 α , β 및 γ 서브 유닛을 구성한다.
보다 구체적으로， 서열번호 2에 기재된 아미노산 서열은 일로박터 폴리트로 퍼스 (Ilyobacter polytropus) 유래의 DhaBl에 대웅하고， 서열번호 4에 기재된 아미 노산 서열은 일로박터 폴리트로퍼스 (Ilyobacter polytropus)유래의 DhaB2, 서열번 호 6에 기재된 아미노산 서열은 일로박터 폴리트로퍼스 (Ilyobacter polytropus) 유 래의 DhaB3에 대웅한다.
한편， 서열번호 1에 기재된 염기서열은 일로박터 폴리트로퍼스 (Ilyobacter polytropus) 유래의 dhaBl에 대웅하고, 서열번호 3에 기재된 염기서열은 일로박터 폴리트로퍼스 (Ilyobacter polytropus)유래의 dhaB2, 서열번호 5에 기재된 염기서열 은 일로박터 폴리트로퍼스 (Ilyobacter polytropus) 유래의 dhaB3에 대웅한다.
따라서, 본 발명에 적용가능한 글리세를 데하이드라타제를 코딩하는 염기 서 열은 서열번호 2， 서열번호 4， 및 서열번호 6의 아미노산 서열을 포함하는 폴리펩 타이드를 암호화하는 염기서열일 수 있다. 바람직하게는 글리세를 데하이드라타제 를 코딩하는 염기 서열은 DhaBl, DhaB2 및 DhaB3으로서 글리세를 데하이드라타제 효소의 α , β 및 Y 서브 유닛을 모두 포함하는 염기서열일 수 있다.
상기 글리세를 데하이드라타제를 코딩하는 염기서열은 서열번호 1， 서열번호 3， 및 서열번호 5의 염기서열 서열을 포함할 수 있다. 바람직하게는 글리세를 데하 이드라타제를 코딩하는 염기 서열은 DhaBl, DhaB2 및 DhaB3으로서 글리세를 데하이 드라타제 효소의 α , β 및 γ 서브 유닛을 모두 포함하는 염기서열， 즉 서열번호 1， 서열번호 3 및 서열번호 5을 모두 포함할수 있다.
본 발명의 '3-하이드록시프로피온알데히드를 3-하이드록시프로피온산으로 전 환시키는 데하이드로게나제'는 3-하이드록시프로피온알데히드 데하이드로게나제 (3- HP dehydrogenase)라고 명명되고， 이는 탈수소 반응올 통해 3-HPA를 3-HP로 전환할 수 있으면 효소이며, 조효소로서 NAD+/NADH 또는 NADP+/NADPH를 사용한다.
본 발명에서 3-하이드록시프로피온알데히드를 3-하이드록시프로피온산으로 전환시키는 데하이드로게나제를 코딩하는 염기서열로는， 호모 사피엔스 (Homo sapiens) 유래의 aldH2 유전자 (匪 _000690.3， 匪ᅳ 001204889.1)， 사카로마이세스 세 레비지에 (S. cerevisiae) 유래의 ald4 유전자 (NM_001183794.1)， 대장균 (E. coli) 유래의 aldA, aldB, aldH 유전자 (서열번호 11) 등으로부터 선택될 수 있지만， 이에 한정되는 것은 아니다. 상기 데하이드로게나제를 코딩하는 염기서열은， 바람직하게 는 대장균 K-12 유래의 AldH에 상웅하는 서열번호 12의 아미노산 서열을 포함하는 폴리펩타이드를 암호화하는 염기서열일 수 있으며， 바람직하게는 서열번호 11에 기 재된 염기서열일 수 있다.
본 발명에 따른 글리세를 데하이드라타제가 촉매 작용을 하는 동안 글리세를 에 의해 또는 1， 3-프로판디을과의 상호작용에 의해 비가역적으로 불활성화된다. 따 라서ᅳ 본 발명의 3-HP를 생산하는 재조합 미생물은 데하이드라타제를 활성화시키기 위한 글리세를 데하이드라타제 재활성화 인자 (Glycerol dehydratase reactivator) 를 암호화하는 염기서열을 추가로 포함할 수 있다. 상기 글리세를 데하이드라타제 재활성화 인자는 일반적으로 알려진 어느 것이라도 사용할 수 있고， W0 98/21341호 (US 6,013,494), 문헌 [R.Daniel et Eur. J. Biochem. , 268 (2001)， pp. 2369- 2378] , 문헌 [Toraya and Mori, J. Biol. Chem. 274:3372 (1999)] 및 문헌 [Tobimatsu et al. , J. Bacteriol. 181:4110 (1999)]에 공지되어 있다. 상기 데하 이드라타제 재활성화 인자를 코딩하는 염기서열은 Citrobacter f reundi i 유래 유전 자 dhaFG (ABI36568.1) , Klebsiella pneumonia 유래 gdrAB (EF077655.1) , Klebsiella oxytoca ddrAB (AAC15871), 일로박터 폴리트로퍼스유래의 GdrA (서열번 호 7) 및 GdrB (서열번호 9)등으로부터 선택될 수 있다.
바람직하게는， 글리세롤 데하이드라타제 재활성화 인자를 코딩하는 염기서열 은 서열번호 8 및 서열번호 10 의 아미노산 서열을 포함하는 플리펩타이드를 암호 화하는 염기서열을 포함하는 것일 수 있으며， 더욱 바람직하게는 서열번호 7에 기 재된 염기서열 및 서열번호 9에 기재된 염기서열을 포함할 수 있다.
본 발명의 다른 구현예는， 전사 프로모터， 글리세롤 데하이드라타제 (glycerol dehydratase)를 코딩하는 염기 서열， 글리세를 데히드라타제의 재활성화 인자를 코딩하는 염기서열， 및 전사 종결인자를 작동 가능하도록 포함하는 발현 카세트로서， 상기 염기서열을 상술한 바와 같다.
본 발명의 "발현 카세트" 란 유전자를 암호화하는 염기서열과 상기 염기서열의 전후에 존재하는 조절 서열을 포함하는 핵산 단편을 말하여 주로 백터 내에 존재한다. 상기 발현카세트는 일반적으로 프로모터 서열, 유전자를 암호화하는 서열, 전자 종결서열 (terminator)을 포함한다.
본 발명의 "전사 프로모터" 란 암호화하는 서열의 발현을 조절하는 DNA 서열로서， 인핸서를 포함한다. 상기 프로모터 천연 유전자를 사용하거나， 천연의 것과 다른 프로모터에서 유래한 것일 수 있다. 본 발명에서 프로모터가 "작동가능 하도록 연결된" 것이란 암호화 서열이 발현될 수 있도록 프로모터가 암호화 서열에 연결된 것을 의미한다. 본 발명의 "전사 종결 서열" 은 유전자를 암호화하는 서열의 다운스트림에 존재하는 DNA서열을 의미한다.
본 발명에 적용 가능한 프로모터는， CYCl, HIS3, GALl, GAL10, ADHl, PGK, PH05, GAPDH, ADCl, TRPl, URA3, LEU2, ENO, and lac, ara, tet, trp, /P _, IPp>, T7, tac, trc, amy, apr, npr 등을 사용할 수 있다.
본 발명의 추가 구현예는， 상기 발현 카세트를 포함하고 3- 하이드록시프로피온산의 생합성에 관여하는 미생물을 제공한다.
본 발명에 따른 재조합 미생물은 글리세를 데하이드라타제 재활성화 인자를 암호화하는 염기서열과 글리세를 데하이드라타제를 암호화는 염기서열이 동일한 미 생물 종으로부터 유래할 수 있으며， 양자 모두 일로박터 폴리트로퍼스 (Ilyobacter polytropus)로부터 유래한 것이 3-하이드록시프로피온산의 합성 효율 면에서 가장 바람직하다ᅳ
' 따라서， 본 발명에 따른 바람직한 재조합 미생물은 서열번호 2(DhaBl), 서열 번호 4(DhaBl) 및 서열번호 6(DhaBl), 서열번호 8(GdrA), 서열번호 10(GdrB) 및 서 열번호 12(Akffl)에 기재된 폴리펩타이드를 암호화하는 뉴클레오타이드를 포함하는 것으로 표현될 수 있으며, 더욱 바람직하게는 서열번호 l(dhaBl), 서열번호
3(dhaBl), 서열번호 5(dhaBl), 서열번호 7(gdrA), 서열번호 9(gdrB) 및 서열번호 ll(aldh)에 기재된 뉴클레오타이드를 포함하는 것으로 표현될 수 있다.
본 발명의 재조합 미생물을 얻기 위하여 사용할 수 있는 재조합 미생물은 해당 유전자를 발현할 수 있는 것이라면 제한되지 않으며， 박테리아， 효모 및 곰팡이로 이루어진 군 중에서 선택될 수 있다. 바람직하게는， 에쉬케리키아
(Escherichia), 시트로박터 (Ci trobacter )， 엔테로박터 (Enterobacter )， 클로스트리듐 (Clostridium), 클렙시엘라 (Klebsiella), 락토바실러스
(Lactobacillus), 아스퍼질러스 (Aspergillus), 사카로마이세스 (Saccharomyces) , 시조사카로마이세스 (Schizosaccharomyces), 지고사카로마이세스
(Zygosaccharomyces) , 피치아 (Pichia), 클루이베로마이세스 (Kluyveromyces) , 칸디다 (Candida), 한세눌라 (Hansenula), 살모넬라 (Salmonel la)， 바실러스
(Bacillus), 스트렙토마이세스 (Streptomyces) 및 슈도모나스 (Pseudomonas)로 구성된 속의 군으로부터 선택된다. 더욱 바람직하게는， 대장균이다.
본 발명에서 글리세를의 탈수반응에 사용될 수 있는 발현 카세트 및 이를 포 함하는 재조합 미생물을 제조하는 방법은 공지의 방법을 이용할 수 있다. 상기 제 작한 발현 카세트는 공지의 방법을 사용하여 적절한 숙주세포로 도입된다. 구체적 으로 열층격 (heat shock) 또는 전기천공법 (electroporat ion) 등을 통한 형질전환 (transformation), 재조합 파지를 이용한 형질주입 (transfect ion) 등 의 방법을 사용할 수 있다. 상기 도입된 발현 카세트는 염색체외에 유지되게 하거나， 공지의 기술을 사용하여 상동재조합 또는 백터를 이용한 랜덤 재조합으로 염색체 내로 통 합되도록 할 수 있다.
본 발명의 3-하이드록시프로피온산의 생산방법 또는 3-히이드록시프로피온산 생합성에 사용되는 재조합 미생물의 배양은 탄소원 (carbon source)으로 단당류， 을 리고당류， 다당류， 또는 글리세를로부터 구성된 군으로부터 선택된 1종 이상의 탄 소원의 존재하에서 수행될 수 있다. 그 중에도 탄소원으로 글리세롤을 포함하고， 추가로 세포 생장을 촉진하기 위하여 글루코스를 포함하는 것이， 3-HP의 생산효을 이나 경제면에서 바람직하다. 자연적으로 글루코스를 글리세롤로 전환하지 못하는 미생물의 경우에는 공지의 방법으로 상기 전환에 필요한 외래 유전자를 도입시켜 글루코스로부터 3-HP가 생산되도록 할 수 있다. 상기 배양에 있어 사용되는 배지에 는 비타민 B12가 첨가될 수 있다.
상기의 배양조건은 사용된 숙주세포에 따라 적절히 조절할 수 있는데， 예를 들어 대장균의 경우 호기성 (aerobic) 조건， pH 6 ~ 7.6이고， 온도는 30 °C 이상， 바람직하게는 33 ~ 37°C의 온도에서， 1 ~ 4 일간 수행될 수 있다. 상기 범위 내에 서 배양하는 경우가 세포 성장이 활발하면서 효율적으로 3-하이드록시프로피온산을 생산할 수 있다. 본 발명에 따른 배양온도는， 높은 온도에서 안정한 효소 및 미생 물을 사용하므로 배양온도 유지에 필요한 넁각을 하지 않아도 되므로 넁각 등의 추 가 설비 및 이에 따른 비용을 절감할 수 있어 더욱 바람직하다. 미생물올 이용하여
3-HP를 생산하는 과정에서 미생물 배양에 따른 배양열로 인해 배양온도가 증가하고， 증가된 배양온도 조건에서도 높은 안정성올 갖는 효소 또는 미생물을 사용하면， 안 정화된 조건하에서 3-HP를 지속적으로 높은 효율로 생산할 수 있는 장점이 있다. 본 발명은 배치식, 패드-배치식, 또는 연속식으로 수행될 수 있고, 임의의 공지된 방식의 발효법도 적절하다. 또한， 세포는 기질 상에 고정화되어 발효될 수 도 있다.
본 발명에 따른 일로박터 훑리트로퍼스 (Ilyobacter polytropus)유래의 글리 세를 데하이드라타제는 기존에 보고된 크랩시엘라 뉴모니아 (Klebsiella pneumoniae) 유래의 글리세를 데하이드라타제 보다 3-하이드록시프로피온산 생산능 에 있어서 우수한 효과를 나타내고 1,3-프로판디을의 생산을 감소시키므로， 기존의 크렙시엘라 뉴모니아 유래의 글리세를 데하이드라타제를 대체하여 3-하이드록시프 로피온산 생산에 효과적으로 활용될 수 있음을 확인하였다. 이하에서는 실시예를 통하여 본 발명올 더욱 상세히 설명하고자 한다. 다만， 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서， 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되어서는 안된다. [실시예 1] 일로박터 폴리트로퍼스 유래 글리세를 데하이드라타제를 코딩하 는 유전자를 포함하는 재조합 미생물의 제작
<단계 1> 일로박터 폴리트로퍼스 (Ilyobacter polytropus) 유래 글리세를 데 하이드라타제 발현 유전자를 포함하는 재조합 백터의 제작
일로박터 폴리트로퍼스 (Ilyobacter polytropus DSM 2926)로부터 게놈 DNA를 추출하고， 게놈 DNA로부터 dhaB123— gdrA 및 gdrB 유전자를 각각 하기의 프라이머를 사용하여 PCR 증폭하고 pET— Duet (Novagen)백터의 NcoI-EcoRI 및 EcoRI-SacI 위치 에 각각 삽입하여 ET-iBAB백터를 제작하였다
1) dhaBl, dhaB2 및 dhaB3 유전자 증폭에 사용한 프라이머
정방향 (서열번호 13: TCATGAMTCAAAAAGATTTGAAGTA GAAGCBspHI ) )
역방향 (서열번호 14: GGATCCCT TCTTTTCTAAGTTGACCTCTTTGTTC (BamHI))
2) gdrA 및 gdrB유전자 증폭에 사용한 프라이머
정방향 (서열번호 15: GGATCCAAAGGTTCGGGGATAGmTGAAG( BamHI ) )
역방향 (서열번호 16: GAGCTCmTCTAAGTGGCAGACCCTTTACAAGCSac I ) )
PCR 종료 후 BspHI과 BamHI으로 dhaBl/ dhaB2 및 dhaB3를 절단하고， BamHI 과 Sac I으로 gdrA 및 gdrB를 절단하였다.
PCR조건은 하기와 같다: Phusion high fidelity DNA폴리머라아제 (Thermo scientific) 사용， Cycle I (98°C, 30 sec), Cycle Π (30 cycles/ 98 °C , 10 sec/55 °C , 1 min, 72 °C , 2 min), Cycle ΙΠ (72°C， 5 min). 증폭된 양 DNA 단편을 pET-Duet (Novagen)백터의 NcoI-EcoRI 및 EcoRI_SacI 위치에 각각 삽입하여 ET-iBAB를 제작하였다.
<단계 2> 알데히드 데하이드로게나제를 코딩하는 유전자를 포함하는 재조합 백터의 제작
대장균 K-12로부터 게놈 DNA를 추출하고 하기의 프라이머를 사용하여 aldH 유전자를 증폭하고， Ndel 및 Bgin로 절단하였다.
정방향 프라이머 (서열번호 17: TTTCATATGAATTTTCATCATCTGGCTTAC (Ndel)) 역방향 프라이머 (서열번호 18： nTAGATCTTTCGGTCATTTCAGGCCTCCA (Bgl Π ) ) PCR 조건은 하기와 같았다: LA taq 폴리머라아제 (Takara, Japan) 사용ᅳ
Cycle I (97°C， 5 min), Cycle Π (31 cycles/ 97°C , 1 min/55°C, 1 min, 72 °C , 3 min), CyclelH (72°C , 10 min). 증폭된 DNA를 동일 효소로 절단한 pETDuet 백터
(Novagen)에 도입하여 ET-H 백터를 제작하였다.
<단계 3〉 3-HP 생산용 유전자를 포함한 재조합 백터의 제조
상기 <단계 2〉의 ET-H 백터에 제한효소 Sall-HF와 Avrll를 처리하여 ET-H 백 터에서 aldH 를 함유한 DNA 단편을 얻고， 이것을 동일효소 처리가 된 <단계 1>의
ET-iBAB백터에 도입하여 ET-iBAB-H백터를 제작하였다 (도 2 참조).
도 2는 실시예 1의 재조합 백터 (ET-iBAB-H)에 대한 개략적인 개열지도이다.
1) dhaBl, dhaB2 및 dhaB3유전자는 일로박터 폴리트로퍼스 (Ilyobacter polytropus) 유래의 글리세를 데하이드라타제 (glycerol dehydratase) 코딩 유전자이고, 2) gdrA, gdrB는 일로박터 폴리트로퍼스 (Ilyobacter polytropus) 유래의 글리세를 데하이드 라타제 재활성인자 (glycerol dehydratase reactivator) 코딩 유전자이고， 3) aldH 는 대장균 K-12 유래의 알데히드 데하이드로게나제 코딩 유전자이다.
<단계 4> 재조합 백터로 형질전환된 대장균의 제조
상기 <단계 3〉에서 제작한 재조합 백터 ET-iBAB-H를 대장균에 형질전환시켜 재조합 균주를 제작하였다.
[비교예 1]: 클렙시엘라 뉴모니에 유래 글리세를 데하이드라타제를 코딩하는 유전자를 포함하는 재조합 미생물의 제작 클렙시엘라 뉴모니에 (Klebsiella pneumonia DSM 2026)의 게놈 DNA를 추출하 고 하기의 프라이머를 사용하여 dhaB123-gdrA 및 gdrB 유전자를 PCR 증폭하고 pET- Duet (Novagen)백터의 Ncol— EcoRI 및 EcoRI-Sall 위치에 각각 삽입하여 ET-BAB백터 를 제작하였다.
1) dhaB123-gdrA유전자 증폭을 위해 사용된 프라이머
정방향 프라이머 (서열번호 19: ATATCATGAAAAGATCAAAACGATTT (BspHD) 역방향 프라이머 (서열번호 20: AAAGAATTCCGCGAGCGCCCG1TTAATTC (EcoRI))
2) gdrB유전자 증폭을 위해 사용된 프라이머 정방향 프라이머 (서열번호 21: TTTGAATTCTAACGAGGGGACCGTCATGTC (EcoRD) 역방향 프라이머 (서열번호 22: ATAGTCGACTCAGTTTCTCTCAOTAACGG (Sail)) 이때， PCR은 Cycle I (95T：， 5분), Cycle Π (30 cycles/ 95°C , 30초 I
55 °C , 30초 I 72 °C , 5분 (dhaB123— gdrA) 혹은 30초 (gdrB)), Cycle m (72 °C， 5분) 의 과정으로 수행되었다.
aldH 유전자를 얻기 위해 대장균 K-12로부터 게놈 DNA를 추출하고 하기의 프 라이머를 사용하여 aldH유전자를 증폭하고， Ndel 및 Bgin로 절단하였다.
정방향 프라이머 (서열번호 17: TTTCATATGAATTTTCATCATCTGGCTTAC (Ndel)) 역방향 프라이머 (서열번호 18： ITTAGATCTTTCGGTCATTTCAGGCCTCCA ( Bg 1 Π ) ) PCR 조건은 하기와 같았다: LA taq 폴리머라아제 (Takara, Japan) 사용,
Cycle I (97°C， 5 min), Cycle Π (31 cycles/ 97 °C, 1 min/55°C , 1 min, 72 °C, 3 min), Cycle m(72°C , 10 min).
증폭된 DNA를 동일 효소로 절단한 pET-BAB 백터에 도입하여 ET-BAB-H백터를 제작하였다. 상기 단계에서 제작한 재조합 백터 ET-BAB-H를 대장균에 형질전환시켜 재조합 균주를 제작하였다 (도 3 참조).
도 3은 비교예 1의 재조합 백터 (ET-BAB-H)에 대한 개략적인 개열지도이다.
1) dhaBl, dhaB2 및 dhaB3유전자는 크렙시엘라 뉴모니아 (klebsiel la pneumoniae) 유래의 글리세를 데하이드라타제 (glycerol dehydratase) 유전자， 2) gdrA, gdrB는 크렙시엘라 뉴모니아 (klebsiella pneumoniae) 유래의 글리세를 데하이드라타제 재 활성인자 (glycerol dehydratase reactivator) 유전자， 3) aldH는 대장균 K-12 유래 의 알데히드 데하이드로게나제 코딩 유전자이다.
[실험예 1] : 3-하이드록시프로피온산 (3-HP)의 합성
실시예 1 및 비교예 1에서 제조한 재조합 대장균의 배양을 위해， 각각 250 플라스크에 50 LB 배지를 넣고 37 °C 회전배양기에서 12시간 전 배양을 하였다. 이후 250 플라스크에 50 mi M9 배지를 넣고 35 °C 배양기에서 배양하여' 0D(optical density )=0.8에서 0.03mM 이소프로필티오갈락토시드 (Isopropyl β-D- thiogalactopyranoside, IPTG)로 발현을 유도하였다. 24, 48시간째에 배양액 중 일 부를 추출하여 흡광도 (0D) 및 pH를 측정하고 HPLC (high performance liquid chromatography)를 이용하여 3-HP 생산을 확인하였다.
3-HP 분석시 Aminex HPX-87H (300瞧 *7.8瞧) 컬럼을 사용하였고， 이동상은 0,5mM 황산용액에 9% 아세토나이트릴 (acetonitrile)이 함유된 용액을 사용하여 유 속 0.4 m£/min으로 홀려주었다. 컬럼의 온도는 35°C 였으며， 검출기는 RI 및 UV/VIS (210 nm) 듀얼모드를 이용하였다. 3-HP는 총 35분의 분석 시간 중 17.5 분 에 검출되었으며 3— HP의 생산은 LC/MS(Liquid chromatography/mass spectrometry) 에 의해서도 확인하였다.
도 5 및 도 6에서 보는 바와 같이 , 0D값은 10시간까지는 두 균주에서 비슷하 였으나， 10 시간 이후 실시예 1의 균주가 비교예 1와 균주보다 조금 높은 값을 보 였으며， 배양액의 pH도 유사한 양상을 보였다.
한편， 3-HP 생산량의 경우， 비교예 1의 균주의 경우 24시간에 48.9mM, 48시 간에 61.1mM 인 반면， 본 발명에 따른 실시예 1의 균주의 경우 24시간에 83.3mM, 48시간에 121mM의 높은 3-HP 생산량을 나타내었다 (도 7).
부산물인 1,3-PDO 생산량의 경우， 비교예 1의 균주의 경우 24시간에 35.0mM, 48시간에 50.0mM인 반면， 본 발명에 따른 실시예 1의 균주의 경우 24시간에 11.6mM, 48시간에 18.0mM로 부산물 생성이 현저히 감소함을 확인하였다 (도 8 참조).
글리세를 데하이드라타제의 총 활성은 3-HP의 생성과 1,3-PDO 생성을 합하여 3-HPA의 양을 구함으로써 간접적으로 확인할 수 있다 (도 9). 이를 측정하면 , 비교 예 1의 경우 24시간에 83.8mM, 48시간에 lll.OmM인 반면， 본 발명에 따른 실시예 1 의 균주의 경우 24시간에 94.9mM, 48시간에 139.0mM의 3— HPA를 생산하였다.
따라서， 본 발명에 따라 일리오박터 폴리트로퍼스 (Ilyobacter polytropus) 유래의 글리세를 데하이드라타제를 사용한 경우 공지의 크렙시엘라 뉴모니아 (klebsiella pneumoniae)유래의 글리세롤 데하이드라타제를 사용한 경우와 비교할 때， 3-HPA 생산량은 25% 향상되며 이에 따라 3-HP 생산량이 96¾> 향상됨을 확인하였 다. 더욱이 부산물인 1,3-PDO의 생산량은 64% 감소하여 본 발명에 따르면 3-HP 생 산을 증가시키고 1,3-PDO의 생산량은 감소시킴으로써 3-HP의 생산올 최대화할 수 있음을 알 수 있다.
[실험예 2] : 3-하이드록시프로피온산 (3-HP)의 합성
실시예 1 및 비교예 1에서 제조한 재조합 대장균의 배양을 위해， 각각 250 플라스크에 50 LB 배지를 넣고 37°C 회전배양기에서 12시간 전 배양을 하였다. 이후 250 mi 플라스크에 50 M9 배지를 넣고 30°C 배양기에서 배양하여 ' ODCoptical density)=0.8에서 0.03mM 이소프로필티오갈락토시드 (Isopropyl β-D- thiogalactopyranoside, IPTG)로 발현을 유도하였다. 24， 48시간째에 배양액 중 일 부를 추출하여 흡광도 (0D) 및 pH를 측정하고 HPLC (high performance liquid chromatography)를 이용하여 3-HP 생산을 확인하였다.
3-HP 분석시 Aminex HPX-87H (300瞧 *7.8腿) 컬럼을 사용하였고, 이동상은 0,5mM 황산용액에 9% 아세토나이트릴 (acetonitrile)이 함유된 용액을 사용하여 유 속 0.4 m^iiin으로 홀려주었다. 컬럼의 온도는 35°C 였으며， 검출기는 RI 및 UV/VIS (210 nm) 듀얼모드를 이용하였다. 3-HP는 총 35분의 분석 시간 중 17.5 분 에 검출되었으며 3-HP의 생산은 LC/MS(Liquid chromatography/mass spectrometry) 에 의해서도 확인하였다.
도 10 및 도 11에서 보는 바와 같이， 0D값은 두 균주에서 비슷하였으나， 실 시예 1의 균주가 비교예 1의 균주보다 조금 낮은 값을 보였으며， 배양액의 pH변화 는 유사한 양상을 보였다.
3-HP 생산량의 경우， 비교예 1의 균주의 경우 30°C에서 24시간에 84.72mM,
48시간에 109.36mM 인 반면， 본 발명에 따른 실시예 1의 균주의 경우 30°C에서 24시 간에 58.27mM, 48시간에 83.34mM의 3-HP 생산량을 나타내었다 (도 12). 1,3-PDO 생 산량의 경우, 비교예 1의 균주의 경우 30°C에서 24시간에 31.65mM, 48시간에
61.47mM인 반면， 본 발명에 따른 실시예 1의 균주의 경우 30°C에서 24시간에
16.34mM, 48시간에 48.89mM의 1,3-PD0 생산량을 나타내었다 (도 13). 3-HP와 1,3-PDO를 합하여 확인할 수 있는 3-HPA의 생산량의 경우， 비교예 1 의 균주의 경우 30°C에서 24시간에 116.37mM, 48시간에 170.83mM 인 반면， 본 발명 에 따른 실시예 1의 균주의 경우 30°C에서 24시간에 74.61m^ 48시간에 132.23mM의 3-HPA 생산량을 나타내었다 (도 14).
상기 실험결과에서 나타낸 바와 같이， 배양온도 30°C에서는 {(.pneumoniae 유 래 glycerol dehydratase의 활성이 우세하지만， 온도가 올라감에 따라 급속히 활성 올 잃는다. 그에 반하여 일로박터 폴리트로퍼스 유래 glycerol dehydratase는 온도 가 올라감에도 불구하고 활성을 유지한다. 일로박터 폴리트로퍼스 유래 글리세를 데하이드라타제는 [(.pneumoniae 유래 글리세롤 데하이드라타제보다 열 안정성이 우 세한 것올 알 수 있다.
따라서， 본 발명에 따라 일리오박터 폴리트로퍼스 (Ilyobacter polytropus) 유래의 글리세를 데하이드라타제를 사용한 경우 공지의 크렙시엘라 뉴모니아 (klebsiella pneumoniae)유래의 글리세를 데하이드라타제를 사용한 경우와 비교할 때， 3— HPA 생산량이 향상되며 이에 따라 3-HP 생산량이 향상됨을 확인하였다. 더욱 이 부산물인 1,3-PDO의 생산량은 감소하여 본 발명에 따르면 3-HP 생산을 증가시키 고 1,3-PDO의 생산량은 감소시킴으로써 3-HP의 생산을 최대화할 수 있음을 알 수 있다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바， 당업계의 통 상의 지식올 가진 자에게 있어서， 이러한 구체적 기술은 단지 바람직한 실시 양태 일 뿐이며， 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항 들과 그것들의 등가물에 의하여 정의된다고 할 것이다.

Claims

【특허청구범위】
【청구항 1】
일로박터 폴리트로퍼스 (Ilyobacter polytropus) 유래의 글리세를 데하이드라 타제 (glycerol dehydratase)를 코딩하는 염기 서열 및 3-하이드록시프로피온알데히 드를 3-하이드록시프로피온산으로 전환시키는 데하이드로게나제 (dehydrogenase)를 코딩하는 염기 서열을 포함하는 재조합 미생물을 배양하는 단계를 포함하는 3-하이 드록시프로피온산의 생산방법.
【청구항 2]
제 1 항에 있어서, 상기 글리세를 데하이드라타제를 코딩하는 염기 서열은 서열번호 2, 서열번호 4, 및 서열번호 6의 아미노산 서열을 포함하는 폴리펩타이드 를 암호화하는 염기서열인 생산방법.
【청구항 3]
제 2 항에 있어서， 상기 글리세를 데하이드라타제를 코딩하는 염기서열은 서 열번호 1， 서열번호 3, 및 서열번호 5의 염기서열을 포함하는 것인 생산방법.
【청구항 4]
제 1 항에 있어"서， 상기 데하이드로게나제를 코딩하는 염기서열은， 호모 사 피엔스 (Homo sapiens) 유래의 aklH2 유전자， 사카로마이세스 세레비지에 (S. cerevisiae) 유래의 ald4 유전자， 대장균 (E. coli) 유래의 aldA, aldB, 및 aldH 유 전자로 이루어지는 군에서 선택된 것인 생산방법.
【청구항 5】 제 1 항에 있어서， 상기 데하이드로게나제를 코딩하는 염기서열은， 서열번호 12의 아미노산 서열을 포함하는 폴리펩타이드를 암호화하는 염기서열인 생산방법.
【청구항 6】
제 4 항에 있어서, 상기 데하이드로게나제를 코딩하는 염기서열은， NM_000690.3, 匪 _001204889.1， 匪ᅳ 001183794.1， 및 서열번호 11의 염기서열로 이투 어지는 군에서 선택되는 것인 생산방법.
【청구항 7】
제 1 항에 있어서 , 상기 재조합 미생물은 ABI36568.1, EF077655.1, MC 15871 또는 서열번호 8 및 서열번호 10 의 아미노산 서열을 포함하는 폴리펩타이드를 암 호화하는 염기서열을 포함하는 글리세를 데하이드라타제 재활성화 인자를 코딩하는 염기서열을 더 포함하는 생산방법 .
【청구항 8】
제 6 항에 있어서， 상기 글리세를 데하이드라타제 재활성화 인자를 코딩하는 염기서열은 서열번호 7 및 서열번호 9를 포함하는 생산방법.
【청구항 9】
제 1 항에 있어서， 상기 재조합 미새물은 30°C 이상 배양은도에서 배양되 는 것인 생산방법.
【청구항 10】
전사 프로모터, 글리세를 데하이드라타제 (glycerol dehydratase)를 코딩하는 염기 서열, 글리세를 데히드라타제의 재활성화 인자를 코딩하는 염기서열, 및 전사 종결인자를 작동 가능하도록 포함하는 발현 카세트로서，
상기 글리세롤 데하이드라타제를 코딩하는 염기 서열은 서열번호 2， 서열번호 4, 및 서열번호 6의 아미노산 서열을 포함하는 폴리펩타이드를 암호화하는 염기서열이고,
상기 데하이드로게나제를 코딩하는 염기서열은ᅳ 서열번호 12의 아미노산 서열을 포함하는 폴리펩타이드를 암호화하는 염기서열이고，
상기 글리세를 데하이드라타제 재활성화 인자를 코딩하는 염기서열은 서열번호 8 및 서열번호 10 의 아미노산 서열을 포함하는 폴리펩타이드를 암호화하는 염기서열인 발현 카세트.
【청구항 11】
제 10 항에 있어서, 상기 글리세를 데하이드라타제를 코딩하는 염기서열은 서열번호 1， 서열번호 3， 및 서열번호 5의 염기서열을 포함하는 것인 발현 카세트.
【청구항 12]
제 10 항에 있어서， 상기 데하이드로게나제를 코딩하는 염기서열은 匪_000690.3， 匪 _001204889.1, 匪_001183794.1， 및 서열번호 11의 염기서열로 이루 어지는 군에서 선택되는 것인 발현 카세트.
【청구항 13】
제 10 항에 있어서, 상기 글리세를 데하이드라타제 재활성화 인자를 코딩하 는 염기서열은, 서열번호 8 및 서열번호 10 의 아미노산 서열을 포함하는 폴리펩타 이드를 암호화하는 염기서열인 발현 카세트. 【청구항 14]
제 10 항에 있어서， 상기 글리세롤 데하이드라타제 재활성화 인자를 코딩하 는 염기서열은 서열번호 7 및 서열번호 9를 포함하는 염기서열인 발현 카세트. 【청구항 15】
제 10항 내지 14항중 어느 한항에 따른 발현 카세트를 포함하고 3-하이드록시 프로피온산의 생합성에 관여하는 재조합 미생물.
PCT/KR2013/005803 2012-06-29 2013-07-01 3-하이드록시프로피온산을 생산하는 재조합 미생물 및 이를 이용한 3-하이드록시프로피온산의 생산방법 WO2014003502A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/411,845 US9587255B2 (en) 2012-06-29 2013-07-01 3-hydroxypropionic acid-producing recombinant microorganism and method of producing 3-hydroxypropionic acid using the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2012-0071367 2012-06-29
KR1020120071367A KR20140003258A (ko) 2012-06-29 2012-06-29 3-하이드록시프로피온산을 생산하는 재조합 미생물 및 이를 이용한 3-하이드록시프로피온산의 생산방법

Publications (1)

Publication Number Publication Date
WO2014003502A1 true WO2014003502A1 (ko) 2014-01-03

Family

ID=49783548

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/005803 WO2014003502A1 (ko) 2012-06-29 2013-07-01 3-하이드록시프로피온산을 생산하는 재조합 미생물 및 이를 이용한 3-하이드록시프로피온산의 생산방법

Country Status (3)

Country Link
US (1) US9587255B2 (ko)
KR (1) KR20140003258A (ko)
WO (1) WO2014003502A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104805112A (zh) * 2015-04-20 2015-07-29 北京化工大学 一种3-羟基丙酸高产菌重组质粒的构建方法

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102569806B1 (ko) 2018-11-05 2023-08-22 주식회사 엘지화학 아데노실트랜스퍼라제를 코딩하는 유전자로 형질전환된 미생물 및 이의 이용
KR102631362B1 (ko) 2018-11-08 2024-01-29 주식회사 엘지화학 dhaB 유전자의 발현 증대를 위한 5'-UTR 및 이의 이용
KR20210038244A (ko) 2019-09-30 2021-04-07 주식회사 엘지화학 비타민 b12-비의존성 글리세롤 디하이드라타제를 이용한 3-히드록시프로피온산 생산 방법

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040071157A (ko) * 1995-05-12 2004-08-11 이.아이,듀우판드네모아앤드캄파니 단일 미생물에 의한 발효가능한 탄소원의1,3-프로판디올로의 생물전환
KR20100134545A (ko) * 2010-12-10 2010-12-23 부산대학교 산학협력단 글리세롤디하이드라타제 및 3-하이드록시프로피온알데히드 디하이드로게나제를 코딩하는 유전자로 형질전환된 재조합 미생물 및 상기 재조합 미생물을 이용한 3-하이드록시프로피온산의 제조방법
WO2011052819A1 (ko) * 2009-10-29 2011-05-05 한국생명공학연구원 글리세롤로부터 3-하이드록시프로피온산을 생산하는 새로운 방법
KR101048485B1 (ko) * 2009-08-17 2011-07-12 부산대학교 산학협력단 재조합 대장균을 배양하여 글리세롤로부터 3-히드록시프로피온산 및 1,3-프로판디올을 동시 생산하는 방법

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6428767B1 (en) 1995-05-12 2002-08-06 E. I. Du Pont De Nemours And Company Method for identifying the source of carbon in 1,3-propanediol

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040071157A (ko) * 1995-05-12 2004-08-11 이.아이,듀우판드네모아앤드캄파니 단일 미생물에 의한 발효가능한 탄소원의1,3-프로판디올로의 생물전환
KR101048485B1 (ko) * 2009-08-17 2011-07-12 부산대학교 산학협력단 재조합 대장균을 배양하여 글리세롤로부터 3-히드록시프로피온산 및 1,3-프로판디올을 동시 생산하는 방법
WO2011052819A1 (ko) * 2009-10-29 2011-05-05 한국생명공학연구원 글리세롤로부터 3-하이드록시프로피온산을 생산하는 새로운 방법
KR20100134545A (ko) * 2010-12-10 2010-12-23 부산대학교 산학협력단 글리세롤디하이드라타제 및 3-하이드록시프로피온알데히드 디하이드로게나제를 코딩하는 유전자로 형질전환된 재조합 미생물 및 상기 재조합 미생물을 이용한 3-하이드록시프로피온산의 제조방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI 18 June 2012 (2012-06-18), accession no. P 003967422.1 *
DATABASE NCBI, GENBANK 21 November 2011 (2011-11-21), accession no. P002281.1 *
RAJ, SUBRAMANIAN MOHAN ET AL.: "Production of 3-hydroxypropionic acid from glycerol by a novel recombinant Escherichia coli BL21 strain", PROCESS BIOCHEMISTRY, vol. 43, 2008, pages 1440 - 1446 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104805112A (zh) * 2015-04-20 2015-07-29 北京化工大学 一种3-羟基丙酸高产菌重组质粒的构建方法

Also Published As

Publication number Publication date
US20150240269A1 (en) 2015-08-27
KR20140003258A (ko) 2014-01-09
US9587255B2 (en) 2017-03-07

Similar Documents

Publication Publication Date Title
US20200325499A1 (en) Methods And Microorganisms For The Production Of 1,3-Butanediol
JP4592418B2 (ja) 高収率での１，３−プロパンジオールの生物生産のための方法
JP2022031648A (ja) １，４－ブタンジオールの生成のための微生物体及び関連する方法
JP2021192622A (ja) １，４−ブタンジオールの生成のための微生物体
JP2022023169A (ja) １，４－ブタンジオールおよびその前駆体の生合成のための組成物および方法
JP4716634B2 (ja) 高力価を有する１，３−プロパンジオールの生物的生産法
KR102093172B1 (ko) 2,4-다이하이드록시부티레이트의 제조 방법
EP2505656A1 (en) Method of producing 3-hydroxypropionic acid using malonic semialdehyde reducing pathway
EP3317396B1 (en) Process and microorganism for synthesis of adipic acid from carboxylic acids
EP3201326B1 (en) Mutant glutamate dehydrogenase for the conversion of homoserine into 4-hydroxy-2-ketobutyrate
AU2012214255A1 (en) Cells and methods for producing isobutyric acid
KR101760340B1 (ko) 3-히드록시프로피온산을 생산하는 재조합 미생물 및 이를 이용한 3-히드록시프로피온산의 생산방법
Tan et al. Biosynthesis of optically pure chiral alcohols by a substrate coupled and biphasic system with a short-chain dehydrogenase from Streptomyces griseus
WO2014003502A1 (ko) 3-하이드록시프로피온산을 생산하는 재조합 미생물 및 이를 이용한 3-하이드록시프로피온산의 생산방법
Matsakas et al. New trends in microbial production of 3-hydroxypropionic acid
KR101437042B1 (ko) 포도당 및 글리세롤을 이용한 3-히드록시프로피온산의 생산방법
EP2872639B1 (en) A microorganism modified for the production of 1,3-propanediol
Li et al. Metabolic engineering of Escherichia coli for the production of glyoxylate from xylose
EP3347478B1 (en) New lactaldehyde reductases for the production of 1,2-propanediol
KR101494386B1 (ko) 3-하이드록시프로피온알데히드 및/또는 3-하이드록시프로피온산을 생산하는 재조합 미생물 및 이를 이용한 3-하이드록시프로피온알데히드 및/또는 3-하이드록시프로피온산의 생산방법
US20160040196A1 (en) Enzymatic conversion of both enantiomers of 1,2-propanediol to propionaldehyde
JP2013070675A (ja) アルキルジオールを産生する組換え菌の培養方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13809343

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14411845

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 13809343

Country of ref document: EP

Kind code of ref document: A1