WO2013180581A1 - Recombinant microorganisms and uses therefor - Google Patents
Recombinant microorganisms and uses therefor Download PDFInfo
- Publication number
- WO2013180581A1 WO2013180581A1 PCT/NZ2013/000092 NZ2013000092W WO2013180581A1 WO 2013180581 A1 WO2013180581 A1 WO 2013180581A1 NZ 2013000092 W NZ2013000092 W NZ 2013000092W WO 2013180581 A1 WO2013180581 A1 WO 2013180581A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- bacteria
- clostridium
- microorganism
- nucleic acid
- carboxydotrophic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/42—Hydroxy-carboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/52—Propionic acid; Butyric acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
- C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
- C12Y102/01075—Malonyl CoA reductase (malonate semialdehyde-forming)(1.2.1.75)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y604/00—Ligases forming carbon-carbon bonds (6.4)
- C12Y604/01—Ligases forming carbon-carbon bonds (6.4.1)
- C12Y604/01002—Acetyl-CoA carboxylase (6.4.1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/145—Clostridium
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Definitions
- the present invention relates to recombinant microorganisms and methods for the production of 3-Hydroxypropionate [3-HP] by microbial fermentation of a substrate comprising CO and/or C0 .
- 3-Hydroxypropionate [3-HP] is a platform chemical, acting as precursor for production of polymer materials and as chemical feedstock.
- Poly(3- hydroxypropionicacid) [P(3-HP)] is a biodegradable polymer with promising characteristics such as unusual high heat stability.
- 3-HP can be used to derive a number of valuable industrial chemicals including: acrylic acid which is used in the manufacture of paint, paper, adhesives, textiles, speciality coatings, ink, and superabsorbent polymer polyacrylates; 1,3-propanediol which is of use as a solvent, adhesive, cosmetic, or to make polytrimethylene terephthalate used in carpet and textiles; 3-hydroxypropinaldehyde which is used in the preparation of foods, as a feed additive, and as a preservative in the nutritional industry.
- acrylic acid which is used in the manufacture of paint, paper, adhesives, textiles, speciality coatings, ink, and superabsorbent polymer polyacrylates
- 1,3-propanediol which is of use as a solvent, adhesive, cosmetic, or to make polytrimethylene terephthalate used in carpet and textiles
- 3-hydroxypropinaldehyde which is used in the preparation of foods, as a feed additive, and as a preservative in the nutritional industry.
- 3-HP is listed as third most important renewable chemical by the US department of energy and a global market opening for 3-HP has been estimated to be 3.63 million tons per year (Paster et al, 2003, US DOE report: 48-49).
- the invention generally provides, inter alia, methods for the production of 3-HP by microbial fermentation of a substrate comprising CO and/or C0 2 , and recombinant microorganisms of use in such methods. It combines two different C0 2 fixation pathways to produce a single metabolic product.
- the invention provides an anaerobic acetogenic recombinant microorganism capable of producing 3-HP and optionally one or more other products by fermentation of a substrate comprising CO and/or C0 2 .
- the microorganism is adapted to express one or more enzymes (or one or more subunits thereof) in the 3-HP biosynthesis pathway which enzymes are not naturally present in a parental microorganism from which the recombinant microorganism is derived.
- the microorganism is adapted to over-express one or more enzymes (or one or more subunits thereof) in the 3-HP biosynthesis pathway, which enzymes are naturally present in a parental microorganism from which the recombinant microorganism is derived.
- the microorganism is adapted to express one or more enzymes (or one or more subunits thereof) in the 3-HP-biosynthesis pathway which are not naturally present in a parental microorganism and over-express one or more enzymes (or one or more subunits thereof) in the 3-HP biosynthesis pathway which are naturally present in a parental microorganism.
- the one or more enzymes are chosen from the group consisting of: Malonyl-CoenzymeA reductase (EC 1.2.1.75); Acetyl-CoA Carboxylase(ACC) (EC 6.4.1.2); and a functionally equivalent variant of any one thereof.
- the parental microorganism is capable of fermenting a substrate comprising CO and/or C0 2 to produce Acetyl-CoA but not of converting Acetyl-CoA to 3-HP and the recombinant microorganism is adapted to express one or more enzymes (or one or more subunits thereof) involved in the conversion of Acetyl-CoA to 3-HP.
- the microorganism comprises one or more exogenous nucleic acids adapted to increase expression of one or more nucleic acids native to the parental microorganism and which one or more nucleic acids encode one or more of the enzymes (or one or more subunits thereof) referred to herein before.
- the one or more exogenous nucleic acid adapted to increase expression is a regulatory element.
- the regulatory element is a promoter.
- the promoter is a constitutive promoter.
- the promoter is selected from the group comprising Wood-Ljungdahl gene cluster or Phosphotransacetylase/Acetate kinase operon promoters.
- the microorganism comprises one or more exogenous nucleic acids encoding and adapted to express one or more of the enzymes (or one or more subunits thereof) referred to herein before.
- the microorganisms comprise one or more exogenous nucleic acid encoding and adapted to express at least two of the enzymes (or one or more subunits thereof).
- the one or more exogenous nucleic acid is a nucleic acid construct or vector, in one particular embodiment a plasmid, encoding one or more of the enzymes referred to hereinbefore in any combination.
- the exogenous nucleic acid is an expression plasmid.
- the parental microorganism is selected from the group of anaerobic acetogens.
- the parental microorganism is selected from the group of carboxydotrophic acetogenic bacteria, in one embodiment from the group comprising Clostridium autoethanogenum, Clostridium ljungdahlii, Clostridium ragsdalei, Clostridium carboxidivorans, Clostridium drakei, Clostridium scatologenes, Clostridium aceticum, Clostridium formicoaceticum, Clostridium magnum, Butyribacterium methylotrophicum, Acetobacterium woodii, Alkalibaculum bacchii, Blautia producta, Eubacterium limosum, Moorella thermoacetica, Moorella thermautotrophica, Sporomusa ovata, Sporomusa silvacetica, Sporomusa sphaeroides, Oxobacter pfennigii, and Thermoanaerobacter kiuvi.
- Clostridium autoethanogenum Clostri
- the parental microorganism is Clostridium autoethanogenum or Clostridium ljungdahlii.
- the microorganism is Clostridium autoethanogenum DSM23693.
- the microorganism is Clostridium ljungdahlii DSM13528 (or ATCC55383).
- the parental microorganism lacks one or more genes encoding Malonyl-CoenzymeA reductase and/or Acetyl-CoA carboxylase, or one or more subunits thereof.
- the invention provides a nucleic acid encoding one or more enzymes (or one or more subunits thereof) which when expressed in a microorganism allows the microorganism to produce 3-HP by fermentation of substrate comprising CO and/or C0 2 .
- the nucleic acid encodes two or more enzymes (or one or more subunits thereof) which when expressed in a microorganism allows the microorganism to produce 3-HP by fermentation of substrate comprising CO.
- the enzymes are chosen from Malonyl-CoenzymeA reductase and Acetyl CoA carboxylase, and a functionally equivalent variant of any one or more thereof.
- the nucleic acid comprises nucleic acid sequences encoding Malonyl-CoenzymeA reductase, Acetyl CoA carboxylase, or a functionally equivalent variant of any one or more thereof, in any order.
- the nucleic acid encoding Malonyl-CoenzymeA reductase has the sequence of SEQ ID NO: 1 or GI:163848165, Caur 2614, or is a functionally equivalent variant thereof.
- the nucleic acid encoding Acetyl CoA carboxylase comprises the sequences SEQ ID NO: 18, 20, 22, and 24 (or CLJU_c42100-40, GI: 9447826-31, and GI:163847210 -11, Caur_1647 -48, GI: 163849262, Caur_3739, GI:163848951,
- Acetyl CoA carboxylase may be comprised of a number of subunits. These may be encoded on one or more nucleic acids, if desired.
- the nucleic acids of the invention further comprise a promoter.
- the promoter allows for constitutive expression of the genes under its control.
- a Wood-Ljungdahl cluster promoter is used.
- a Phosphotransacetylase/Acetate kinase operon promoter is used.
- the promoter is from C. autoethanogenum.
- the invention provides a nucleic acid construct or vector comprising one or more nucleic acid of the second aspect.
- the nucleic acid construct or vector is an expression construct or vector.
- the expression construct or vector is a plasmid.
- the invention provides host organisms comprising any one or more of the nucleic acids of the seventh aspect or vectors or constructs of the third aspect.
- the invention provides a composition comprising an expression construct or vector as referred to in the third aspect of the invention and a methylation construct or vector.
- the composition is able to produce a recombinant microorganism according to the first aspect of the invention.
- the expression construct/vector and/or the methylation construct/vector is a plasmid.
- the invention provides a method for the production of 3 -HP, and optionally one or more other products, by microbial fermentation comprising fermenting a substrate comprising CO and/or C0 2 using a recombinant microorganism of the first aspect of the invention.
- the method comprises the steps of:
- the method comprises the steps of:
- the microorganism is maintained in an aqueous culture medium.
- the fermentation of the substrate takes place in a bioreactor.
- the substrate comprising CO and/or C0 2 is a gaseous substrate comprising CO and/or C0 2 .
- the substrate comprises an industrial waste gas.
- the gas is steel mill waste gas or syngas.
- the substrate is a substrate comprising CO.
- the substrate comprises C0 2 , but no CO, the substrate preferably also comprises H 2 .
- the substrate comprises CO and C0 2 . In one embodiment, the substrate comprises C0 2 and H 2 . In another embodiment, the substrate comprises CO, C0 2 , and H 2 .
- the substrate will typically contain a major proportion of CO, such as at least about 20% to about 100% CO by volume, from 20% to 70% CO by volume, from 30% to 60% CO by volume, and from 40% to 55% CO by volume.
- the substrate comprises about 25%, or about 30%, or about 35%, or about 40%, or about 45%, or about 50% CO, or about 55% CO, or about 60% CO by volume.
- the methods further comprise the step of recovering 3-HP and optionally one or more other products from the fermentation broth.
- the invention provides 3-HP when produced by the method of the sixth aspect.
- the invention provides a method for the production of a microorganism of the first aspect of the invention comprising transforming a parental microorganism with one or more exogenous nucleic acid such that the microorganism is capable of producing 3-HP, and optionally one or more other products, by fermentation of a substrate comprising CO and/or C0 2 , wherein the parental microorganism is not capable of producing 3-HP by fermentation of a substrate comprising CO and/or C0 2 .
- a parental microorganism is transformed with one or more exogenous nucleic acid adapted to express one or more enzymes in the 3-HP biosynthesis pathway which are not naturally present in the parental microorganism.
- a parental microorganism is transformed with one or more nucleic acid adapted to over-express one or more enzymes in the 3-HP biosynthesis pathway which are naturally present in the parental microorganism.
- a parental microorganism is transformed with one or more exogenous nucleic acid adapted to express one or more enzymes in the 3-HP biosynthesis pathway which are not naturally present in the parental microorganism and over- express one or more enzymes in the 3-HP biosynthesis pathway which are naturally present in the parental microorganism.
- the one or more enzymes are as herein before described.
- the parental microorganism is as herein before described.
- a process is provided for converting CO or C02 into 3- hydroxypropionate (3-HP).
- a gaseous CO-containing and/or C02-containing substrate is passed to a bioreactor containing a culture of carboxydotrophic, acetogenic bacteria in a culture medium such that the bacteria convert the CO and/or C02 to 3-HP.
- the carboxydotrophic acetogenic bacteria are genetically engineered to express a malonyl-Coenzyme A reductase. They also express an acetyl-CoA carboxylase, whether native or exogenous.
- the 3-HP is recovered from the bioreactor.
- an isolated, genetically engineered, carboxydotrophic, acetogenic bacterium comprising a nucleic acid encoding a malonyl-Coenzyme A reductase.
- the nucleic acid is exogenous to the host bacteria.
- the bacteria express the malonyl-Coenzyme A reductase and the bacteria acquire the ability to fix three molecules of CO or C02 into one molecule of 3-hydroxypropionate (3-HP).
- the malonyl-Coenzyme A reductase is typically at least 85 % identical to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: l.
- the bacteria may further comprise an exogenous nucleic acid encoding acetyl- Coenzyme A carboxylase.
- the acetyl-CoA carboxylase is typically at least 85 % identical to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 18-21.
- the nucleic acid may be operably linked to a promoter.
- the nucleic acid may have been codon optimized.
- the nucleic acid or the encoded carboxylase may be from a nonsulfur, photosynthetic bacterium.
- the bacteria may be selected from the group consisting of Clostridium autoethanogenum, Clostridium ljungdahlii, Clostridium ragsdalei, Clostridium carboxt ivorans, Clostridium drakei, Clostridium scatologenes, Clostridium aceticum, Clostridium formicoaceticum, Clostridium magnum, Butyribacterium methylotrophicum, Acetobacterium woodii, Alkalibaculum bacchii, Blautia producta, Eubacterium limosum, Moorella thermoacetica, Moorella thermautotrophica, Sporomusa ovata, Sporomusa silvacetica, Sporomusa sphaeroides, Oxobacter pfennigii, and Thermoanaerobacter kiuvi.
- the donor bacterium of the exogenous nucleic acid may be a nonsulfur, photosynthetic bacterium such as, Chloroflexus auranticus, Metallosphaera, and Sulfolobus spp.
- the genetically engineered bacteria may be cultured by growing in a medium comprising a gaseous carbon source.
- the carbon source may comprise CO and/or C02, which may be used as either or both of an energy source or a carbon source.
- the bacteria may optionally be grown under strictly anaerobic conditions.
- the carbon source may comprise an industrial waste product or off-gas.
- the invention may also be said broadly to consist in the parts, elements and features referred to or indicated in the specification of the application, individually or collectively, in any or all combinations of two or more of said parts, elements or features, and where specific integers are mentioned herein which have known equivalents in the art to which the invention relates, such known equivalents are deemed to be incorporated herein as if individually set forth.
- Figure 1 Combination of two C0 2 fixing pathways for sustainable production of 1 molecule 3-HP from 3 molecules of CO or C0 2 .
- the inventors have surprisingly been able to engineer a carboxydotrophic acetogenic microorganism to produce 3-Hydroxypropionate (3-HP) by fermentation of a substrate comprising CO and/or C0 2 .
- This offers an alternative means for the production of 3-HP which may have benefits over the current methods for the production of 3-HP.
- it offers a means of using carbon monoxide from industrial processes which would otherwise be released into the atmosphere and pollute the environment.
- the invention describes fixation of three molecules of C02 into one molecule of 3-HP by combining two separate C02 fixation pathways (Fig. 1), the Wood-Ljungdahl pathways of acetogens that allows fixation of two molecules of C02, and the initial carbon fixation steps of the 3-HP cycle allows fixation of another molecule of C02.
- C02 could also be replaced with carbon monoxide (CO), as the key enzyme of the Wood-Ljungdahl pathway, a CO dehydrogenase (CODH) is able to convert CO into C02 and energy in a biological water gas shift reaction (CO + H20 ⁇ -> C02 + H2). Any mixture of CO and C02 can be used.
- CO carbon monoxide
- a “fermentation broth” is a culture medium comprising at least a nutrient media and bacterial cells.
- a "shuttle microorganism” is a microorganism in which a methyltransferase enzyme is expressed and is distinct from the destination microorganism.
- a "destination microorganism” is a microorganism in which the genes included on an expression construct/vector are expressed and is distinct from the shuttle microorganism. This is also called a host microorganism.
- main fermentation product is intended to mean the one fermentation product which is produced in the highest concentration and/or yield. There may be one or more fermentation products. The most prevalent may or may not be the most commercially valuable.
- the terms “increasing the efficiency,” “increased efficiency,” and the like, when used in relation to a fermentation process, include, but are not limited to, increasing one or more of the rate of growth of microorganisms catalysing the fermentation, the growth and/or product production rate at elevated product concentrations, the volume of desired product produced per volume of substrate consumed, the rate of production or level of production of the desired product, and the relative proportion of the desired product produced compared with other by-products of the fermentation.
- substrate comprising carbon monoxide and like terms should be understood to include any substrate in which carbon monoxide is available to one or more strains of bacteria for growth and/or fermentation, for example.
- gaseous substrate comprising carbon monoxide includes any gas which contains a level of carbon monoxide.
- the substrate contains at least about 20% to about 100% CO by volume, from 20% to 70% CO by volume, from 30% to 60% CO by volume, and from 40% to 55% CO by volume.
- the substrate comprises about 25%, or about 30%, or about 35%, or about 40%, or about 45%, or about 50% CO, or about 55% CO, or about 60% CO by volume.
- the substrate may comprise an approx 2:1, or 1 :1, or 1 :2 ratio of H 2 : CO.
- the substrate comprises about 30% or less H 2 by volume, 20% or less H 2 by volume, about 15% or less H 2 by volume or about 10% or less H 2 by volume.
- the substrate stream comprises low concentrations of H 2 , for example, less than 5%, or less than 4%, or less than 3%, or less than 2%, or less than 1%, or is substantially hydrogen free.
- the substrate may also contain some C0 2 for example, such as about 1% to about 80% C0 2 by volume, or 1% to about 30% C0 2 by volume. In one embodiment the substrate comprises less than or equal to about 20% C0 2 by volume. In particular embodiments the substrate comprises less than or equal to about 15% C0 2 by volume, less than or equal to about 10% C0 2 by volume, less than or equal to about 5% C0 2 by volume or substantially no C0 2 .
- substrate comprising carbon dioxide and like terms should be understood to include any substrate in which carbon dioxide is available to one or more strains of bacteria for growth and/or fermentation, for example.
- Substrates comprising carbon dioxide may further comprise hydrogen and/or carbon monoxide.
- gaseous substrate comprising carbon dioxide includes any gas which contains a level of carbon dioxide.
- the substrate contains at least about 10% to about 60% C0 2 by volume, from 20% to 50% C0 2 by volume, from 30% to 60% C0 2 by volume, and from 40% to 55% C0 2 by volume.
- the substrate comprises about 20%, or about 25%, or about 30%, or about 35%, or about 40%, or about 45%, or about 50% CO, or about 55% CO, or about 60% C0 2 by volume.
- a substrate comprising C0 2 will also contain a level of CO or H 2 .
- the substrate comprises a C0 2 :H 2 ratio of at least about 1 :1, or at least about 1 :2, or at least about 1 :3, or at least about 1 :4, or at least about 1 :5.
- the gaseous substrate may be provided in alternative forms.
- the gaseous substrate containing CO and/or C0 2 may be provided dissolved in a liquid.
- a liquid is saturated with a carbon monoxide containing gas and then that liquid is added to the bioreactor. This may be achieved using standard methodology.
- a microbubble dispersion generator Hensirisak et. al. Scale-up of microbubble dispersion generator for aerobic fermentation; Applied Biochemistry and Biotechnology Volume 101, Number 3 / October, 2002
- the gaseous substrate containing CO may be adsorbed onto a solid support.
- Such alternative methods are encompassed by use of the term "substrate containing CO and/or C0 2 " and the like.
- the CO-containing gaseous substrate (or a gaseous substrate comprising C0 2j or CO and C0 2; or C0 2 and H 2 and CO) is an industrial off or waste gas.
- "Industrial waste or off gases” should be taken broadly to include any gases comprising CO and/or C0 2 produced by an industrial process and include gases produced as a result of ferrous metal products manufacturing, non- ferrous products manufacturing, petroleum refining processes, gasification of coal, gasification of biomass, electric power production, carbon black production, and coke manufacturing. Further examples may be provided elsewhere herein.
- the phrases “fermenting”, “fermentation process” or “fermentation reaction” and the like, as used herein, are intended to encompass both the growth phase and product biosynthesis phase of the process.
- the bioreactor may comprise a first growth reactor and a second fermentation reactor.
- the addition of metals or compositions to a fermentation reaction should be understood to include addition to either or both of these reactors.
- bioreactor includes a fermentation device consisting of one or more vessels and/or towers or piping arrangement, which includes the Continuous Stirred Tank Reactor (CSTR), Immobilized Cell Reactor (ICR), Trickle Bed Reactor (TBR), Bubble Column, Gas Lift Fermenter, Static Mixer, or other vessel or other device suitable for gas-liquid contact.
- CSTR Continuous Stirred Tank Reactor
- ICR Immobilized Cell Reactor
- TBR Trickle Bed Reactor
- Bubble Column Gas Lift Fermenter
- Static Mixer Static Mixer
- the bioreactor may comprise a first growth reactor and a second fermentation reactor.
- Exogenous nucleic acids are nucleic acids which originate outside of the microorganism to which they are introduced.
- Exogenous nucleic acids may be derived from any appropriate source, including, but not limited to, the microorganism to which they are to be introduced, strains or species of microorganisms which differ from the organism to which they are to be introduced, or they may be artificially or recombinantly created.
- an organism When an organism is genetically engineered or recombinant, it contains sequences that are adjacent to different sequences than in the naturally occurring microorganism.
- the exogenous nucleic acids represent nucleic acid sequences naturally present within the microorganism to which they are to be introduced, and they are introduced to increase expression of or over-express a particular gene (for example, by increasing the copy number of the sequence (for example a gene), or introducing a strong or constitutive promoter to increase expression).
- the exogenous nucleic acids represent nucleic acid sequences not naturally present within the microorganism to which they are to be introduced and allow for the expression of a product not naturally present within the microorganism or increased expression of a gene native to the microorganism (for example in the case of introduction of a regulatory element such as a promoter).
- the exogenous nucleic acid may be adapted to integrate into the genome of the microorganism to which it is to be introduced or to remain in an extra-chromosomal state.
- the exogenous sequence may come from a heterologous source, for example, another species, genus, family, or kingdom.
- the bacterium so produced is non-naturally occurring, having a genetic complement which is different from the naturally occurring, either by sequence differences or by copy number differences, for example.
- nucleic acids whose sequence varies from the sequences specifically exemplified herein provided they perform substantially the same function.
- nucleic acid sequences that encode a protein or peptide this means that the encoded protein or peptide has substantially the same function.
- nucleic acid sequences that represent promoter sequences the variant sequence will have the ability to promote expression of one or more genes.
- nucleic acids may be referred to herein as "functionally equivalent variants.”
- functionally equivalent variants of a nucleic acid include allelic variants, fragments of a gene, genes which include mutations (deletion, insertion, nucleotide substitutions and the like) and/or polymorphisms and the like.
- homologous genes from other microorganisms may also be considered as examples of functionally equivalent variants of the sequences specifically exemplified herein.
- nucleic acid herein will preferably have at least approximately 70%, preferably approximately 80%, more preferably approximately 85%, preferably approximately 90%, preferably approximately 95% or greater nucleic acid sequence identity with the nucleic acid identified.
- a functionally equivalent variant of a protein or a peptide includes those proteins or peptides that share at least 40%, preferably 50%, preferably 60%, preferably 70%, preferably 75%, preferably 80%, preferably 85%, preferably 90%, preferably 95% or greater amino acid identity with the protein or peptide identified and has substantially the same function as the peptide or protein of interest.
- variants include within their scope fragments of a protein or peptide wherein the fragment comprises a truncated form of the polypeptide wherein deletions may be from 1 to 5, to 10, to 15, to 20, to 25 amino acids, and may extend from residue 1 through 25 at either terminus of the polypeptide, and wherein deletions may be of any length within the region; or may be at an internal location.
- Functionally equivalent variants of the specific polypeptides herein should also be taken to include polypeptides expressed by homologous genes in other species of bacteria, for example as exemplified in the previous paragraph.
- substantially the same function is intended to mean that the nucleic acid or polypeptide is able to perform the function of the nucleic acid or polypeptide of which it is a variant.
- a variant of an enzyme of the invention will be able to catalyse the same reaction as that enzyme.
- the variant has the same level of activity as the polypeptide or nucleic acid of which it is a variant.
- a "parental microorganism” is a microorganism used to generate a recombinant microorganism of the invention.
- the parental microorganism may be one that occurs in nature (i.e., a wild type microorganism) or one that has been previously modified but which does not express or over-express one or more of the enzymes the subject of the present invention. Accordingly, the recombinant microorganisms of the invention have been modified to express or over-express one or more enzymes that were not expressed or over-expressed in the parental microorganism.
- the terms should be taken to include plasmids, viruses (including bacteriophage), cosmids and artificial chromosomes.
- Constructs or vectors may include one or more regulatory elements, an origin of replication, a multicloning site and/or a selectable marker.
- the constructs or vectors are adapted to allow expression of one or more genes encoded by the construct or vector.
- Nucleic acid constructs or vectors include naked nucleic acids as well as nucleic acids formulated with one or more agents to facilitate delivery to a cell (for example, liposome-conjugated nucleic acid, an organism in which the nucleic acid is contained).
- the "3-HP biosynthesis pathway” is the enzymatic pathway allowing for the conversion of Acetyl-CoA to Malonyl-CoA to Malonate semialdehyde to 3-HP. Unless the context clearly requires otherwise, reference to an enzyme in the 3-HP biosynthesis pathway should be taken to include reference to any one or more subunits of the enzyme. By way of example only, Acetyl CoA carboxylase may comprise four subunits.
- the invention provides a recombinant microorganism capable of producing 3-HP, and optionally one or more other products, by fermentation of a substrate comprising CO and/or C0 2 .
- the microorganism is adapted to express one or more enzymes (or one or more subunits thereof) in the 3-HP biosynthesis pathway which are not naturally present in a parental microorganism from which it is derived.
- the microorganism is adapted to over-express one or more enzymes (or one or more subunits thereof) in the 3-HP biosynthesis pathway which are naturally present in the parental microorganism.
- the parental microorganism is capable of fermenting a substrate comprising CO to produce Acetyl-CoA but not of converting Acetyl-CoA to 3-HP and the recombinant microorganism is adapted to express one or more enzymes (or one or more subunits thereof) involved in the conversion of Acetyl-CoA to 3-HP.
- the parental microorganism is capable of converting Acetyl CoA to Malonyl CoA, but not of converting Malonyl CoA to 3-HP.
- the parental microorganism is capable of converting Malonyl CoA to 3-HP but not of converting Acetyl CoA to Malonyl CoA.
- the one or more enzymes in the 3-HP biosynthesis pathway are chosen from the group consisting: Malonyl-coenzyme A reductase; Acetyl CoA carboxylase; and a functionally equivalent variant of any one or more thereof.
- the microorganism may be adapted to express or over-express the one or more enzymes (or one or more subunits thereof) by any number of recombinant methods including, for example, increasing expression of native genes within the microorganism (for example, by introducing a stronger or constitutive promoter to drive expression of a gene), increasing the copy number of a gene encoding a particular enzyme by introducing exogenous nucleic acids encoding and adapted to express the enzyme, introducing an exogenous nucleic acid encoding and adapted to express an enzyme not naturally present within the parental microorganism.
- the parental microorganism may be transformed to provide a combination of increased or over-expression of one or more genes native to the parental microorganism and introduction of one or more genes not native to the parental microorganism.
- one or more genes encoding one or more enzyme in the 3 -HP biosynthesis pathway may be native to the parental microorganism but it may not include one or more other genes encoding one or more other enzyme in the pathway.
- the microorganism could for example be engineered to over-express native Acetyl CoA carboxylase and to introduce a Malonyl CoA reductase gene encoding an enzyme for the conversion of Malonyl-CoA to 3-HP (e.g., Malonyl CoA reductase).
- the microorganism could be engineered to over-express native Malonyl CoA reductase and to introduce a gene encoding Acetyl CoA carboxylase. Skilled persons will appreciate various other combinations of use in the invention.
- exemplary sequence information for Malonyl CoA reductase is provided in the form of SEQ ID NO: 1 herein, and also on public databases with the accession numbers YP 001636209.1/ Caur_2614, GI:163848165.
- exemplary sequence information for Acetyl CoA carboxylase is provided in the form of SEQ ID NO: 18-21 herein, and also on public databases with the accession numbers NC_014328.1 -33. l/CLJU_c42100-40, GI:
- Naturally occurring or synthetic enzymes may be used. Typically the enzymes will have at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, identity with the sequence encoded by a nucleic acid according to SEQ ID NO:l or 18-21.
- the enzymes (and any corresponding genes encoding them) of use in the microorganisms of the invention may be derived from any appropriate source, including different genera and species of bacteria, or other organisms.
- the Malonyl-coenzymeA reductase is that derived from Chloroflexus auranticus, Clostridium ljungdahlii, Metallosphaera or Sulfolobus spp.
- the Malonyl-coenzyme A reductase has the amino acid sequence exemplified above, or it is a functionally equivalent variant thereof.
- the Acetyl CoA carboxylase is that derived from Clostridium ljungdahlii, Chloroflexus auranticus, Metallosphaera or Sulfolobus spp. In one embodiment, the Acetyl CoA carboxylase has the amino acid sequence exemplified herein before, or it is a functionally equivalent variant thereof.
- Malonyl-CoA reductase belongs to the group of short-chain reductases (SDRs) and can be obtained from bacteria as green non-sulfur phototrophic bacteria (Chloroflexi) Chloroflexus aurantiacus (YP 001636209.1; AAS20429.1), Chloroflexus aggregans (YP 002462600.1), Oscillochloris trichoides (WP 006561105.1), Roseiflexus castenholzii (YP_001433009.1) or Roseiflexus sp. (YP 001277512.1), and in alpha-proteobacteria as Erythrobacter sp.
- SDRs short-chain reductases
- thermoacidophilic archaea as Crenarchaeotes Sulfolobus tokodaii (NP 378167.1), Acidianus hospitalis (YP 004459517.1), Metallosphaera cuprina (YP_004410014.1) Metallosphaera sedula (YP OOl 190808.1), Sulfolobus solfataricus (NP_343563.1), Metallosphaera yellow stonensis (WP 009071519.1), Sulfolobus islandicus (YP_002844727.1; YP 002833533.1 ; YP_002830795.1), Sulfolobus acidocaldarius (YP_256941.1; YP
- Acetyl CoA carboxylase (EC 1.2.1.75) belongs to the group of biotin dependent carboxylases and can be obtained from bacteria as green non-sulfur phototrophic bacteria (Chloroflexi) as Chloroflexus aurantiacus (YP 001635254.1-55.1 ; YP_001637306.1 ; YP_001636995.1; YP 001634995.1), or carboxydotrophic acetogens as C. Ijungdahlii (NC_014328.1-33.1).
- the microorganism comprises one or more exogenous nucleic acids adapted to increase expression of one or more nucleic acids native to the parental microorganism and which one or more nucleic acids encode one or more of the enzymes (or one or more subunits thereof) referred to herein before.
- the one or more exogenous nucleic acid adapted to increase expression is a regulatory element.
- the regulatory element is a promoter.
- the promoter is a constitutive promoter that is preferably highly active under appropriate fermentation conditions. Inducible promoters could also be used.
- the promoter is selected from the group comprising Wood-Ljungdahl gene cluster or Phosphotransacetylase/Acetate kinase operon promoters. It will be appreciated by those of skill in the art that other promoters which can direct expression, preferably a high level of expression under appropriate fermentation conditions, would be effective as alternatives to the exemplified embodiments. When a promoter is in a position such that it drives expression of a downstream coding sequence it is referred to as operably linked.
- the microorganism comprises one or more exogenous nucleic acids encoding and adapted to express one or more of the enzymes (or one or more subunits thereof) referred to herein before.
- the microorganisms comprise one or more exogenous nucleic acid encoding and adapted to express at least two of the enzymes (or one or more subunits thereof).
- the microorganism comprises one or more exogenous nucleic acids encoding Malonyl-CoenzymeA reductase or a functionally equivalent variant thereof.
- the microorganism comprises one or more exogenous nucleic acids encoding Acetyl CoA carboxylase or a functionally equivalent variant thereof.
- Acetyl CoA carboxylase may be comprised of 4 subunits, with each subunit encoded by a different gene. These genes may be combined in a single nucleic acid or two or more nucleic acids which together encode the whole enzyme.
- a particular parental microorganism may contain genes for only one, two, or three of these subunits.
- the invention encompasses engineering the microorganism using one or more exogenous nucleic to express one, two or three of the subunits only. Similarly, it encompasses engineering the microorganism to over-express one or more of the subunits if the genes are native to the microorganism. Combinations of over-expression of native subunit genes and introduction of any missing subunit genes is also envisaged.
- the Malonyl-CoenzymeA reductase is encoded by a nucleic acid comprising SEQ ID NO: 1, or a functionally equivalent variant thereof.
- the Acetyl CoA carboxylase is encoded by one or more nucleic acid comprising SEQ ID NO: 18, 19, 20 and 21, or a functionally equivalent variant of any one or more thereof.
- the enzymes may be encoded by a nucleic acid sequence as described in a publicly available database, for example, as listed herein before.
- the microorganism may comprise one or more exogenous nucleic acids. Where it is desirable to transform the parental microorganism with two or more genetic elements (such as genes or regulatory elements (for example a promoter)) they may be contained on one or more exogenous nucleic acids.
- two or more genetic elements such as genes or regulatory elements (for example a promoter)
- the one or more exogenous nucleic acid is a nucleic acid construct or vector, in one particular embodiment a plasmid, encoding one or more of the enzymes referred to hereinbefore in any combination.
- the exogenous nucleic acids may remain extra-chromosomal upon transformation of the parental microorganism or may integrate into the genome of the parental microorganism. Accordingly, they may include additional nucleotide sequences adapted to assist integration (for example, a region which allows for homologous recombination and targeted integration into the host genome) or expression and replication of an extrachromosomal construct (for example, origin of replication, promoter and other regulatory elements or sequences).
- the exogenous nucleic acids encoding one or enzymes (or one or more subunits thereof) as mentioned herein before will further comprise a promoter adapted to promote expression of the one or more enzymes encoded by the exogenous nucleic acids.
- the promoter is a constitutive promoter that is preferably highly active under appropriate fermentation conditions. Inducible promoters could also be used. In preferred embodiments, the promoter is selected from the group comprising Wood-Ljungdahl gene cluster and Phosphotransacetylase/Acetate kinase promoters. It will be appreciated by those of skill in the art that other promoters which can direct expression, preferably a high level of expression under appropriate fermentation conditions, would be effective as alternatives to the exemplified embodiments.
- the exogenous nucleic acid is an expression plasmid.
- the parental microorganism is selected from the group of anaerobic acetogens.
- the parental microorganism is selected from the group of carboxydotrophic acetogenic bacteria.
- the microorganism is selected from the group comprising Clostridium autoethanogenum, Clostridium ljungdahlii, Clostridium ragsdalei, Clostridium carboxidivorans, Clostridium drokei, Clostridium scatologenes, Clostridium aceticum, Clostridium formicoaceticum, Clostridium magnum, Butyribacterium methylotrophicum, Acetobacterium woodii, Alkalibaculum bacchii, Blautia producta, Eubacterium limosum, Moorella thermoacetica, Moorella thermautotrophica, Sporomusa ovata, Sporomusa silvacetica, Sporomusa sphaeroides, Oxobacter pfennigii, and Thermoanaerobacter
- the parental microorganism is selected from the cluster of ethanologenic, acetogenic Clostridia comprising the species C. autoethanogenum,
- Clostridium autoethanogenum, sp. nov., an anaerobic bacterium that produces ethanol from carbon monoxide. Arch Microbiol 1994, 4: 345-351], C. autoethanogenum LBS1560 (DSM19630) [Simpson SD, Forster RL, Tran PT, Rowe MJ, Warner IL: Novel bacteria and methods thereof. International patent 2009, WO/2009/064200], C. autoethanogenum LBS1561 (DSM23693), C. ljungdahlii PETC T (DSM13528 ATCC 55383) [Tanner RS, Miller LM, Yang D: Clostridium ljungdahlii sp.
- Clostridium ljungdahlii sp. nov. an Acetogenic Species in Clostridial rRNA
- E-J Clostridium autoethanogenum, sp. nov., an anaerobic bacterium that produces ethanol from carbon monoxide. Arch Microbiol 1994, 4: 345-351 ; Huhnke RL, Lewis
- Tanner RS Isolation and Characterization of novel Clostridial Species.
- International patent 2008, WO 2008/028055 all share the same major phylogenetic traits, such as same pH range (pH 4-7.5, with an optimal initial pH of 5.5-6), strong autotrophic growth on CO containing gases with similar growth rates, and a similar metabolic profile with ethanol and acetic acid as main fermentation end product, and small amounts of 2,3-butanediol and lactic acid formed under certain conditions.
- Tal RS Miller LM, Yang D: Clostridium ljungdahlii sp. nov., an Acetogenic Species in Clostridial rRNA Homology Group I.
- the species differentiate in substrate utilization of various sugars ⁇ e.g., rhamnose, arabinose), acids ⁇ e.g., gluconate, citrate), amino acids ⁇ e.g., arginine, histidine), or other substrates ⁇ e.g., betaine, butanol). Moreover some of the species were found to be auxotrophic for certain vitamins (e.g., thiamine, biotin) while others were not.
- vitamins e.g., thiamine, biotin
- the parental strain uses CO as its sole carbon and energy source.
- the parental microorganism is Clostridium autoethanogenum or Clostridium ljungdahlii.
- the microorganism is Clostridium autoethanogenum DSM23693.
- the microorganism is Clostridium ljungdahlii DSM13528 (or ATCC55383).
- the parental microorganism lacks one or more genes encoding Malonyl-coenzymeA reductase or Acetyl CoA carboxylase (or one or more subunit thereof).
- the invention also provides nucleic acids and nucleic acid constructs of use in generating a recombinant microorganism of the invention.
- the nucleic acids comprise one or more sequences encoding one or more of the enzymes (or one or more subunits thereof) in the 3-HP biosynthesis pathway which when expressed in a microorganism allows the microorganism to produce 3-HP by fermentation of substrate comprising CO and/or C0 2 .
- the invention provides a nucleic acid encoding two or more enzymes (or one or more subunits thereof) which when expressed in a microorganism allows the microorganism to produce 3-HP by fermentation of substrate comprising CO and/or C0 2 .
- the enzymes are chosen from Malonyl CoA reductase, Acetyl CoA carboxylase and a functionally equivalent variant of any one or more thereof.
- a nucleic acid of the invention comprises one or more nucleic acid sequences encoding Malonyl-CoenzymeA reductase, Acetyl CoA carboxylase or a functionally equivalent variant of any one or more thereof, in any order.
- a nucleic acid of the invention comprises one or more nucleic acid sequences encoding one or more subunit of Acetyl CoA carboxylase or a functionally equivalent variant of any one or more thereof, in any order.
- Malonyl-CoenzymeA reductase has a sequence as herein before described or is a functionally equivalent variant thereof.
- the nucleic acid sequence encoding Acetyl CoA carboxylase has a sequence as herein before described or is a functionally equivalent variant thereof.
- the nucleic acids of the invention will further comprise a promoter.
- the promoter allows for constitutive expression of the genes under its control.
- inducible promoters may also be employed.
- the promoter can direct a high level of expression under appropriate fermentation conditions.
- a Wood-Ljungdahl cluster promoter is used.
- a Phosphotransacetylase/Acetate kinase promoter is used.
- a pyruvate: ferredoxin oxidoreductase promoter, an Rnf complex operon promoter or an ATP synthase operon promoter in another embodiment, is from C. autoethanogenum.
- nucleic acids of the invention may remain extra-chromosomal upon transformation of a parental microorganism or may be adapted for integration into the genome of the microorganism. Accordingly, nucleic acids of the invention may include additional nucleotide sequences adapted to assist integration (for example, a region which allows for homologous recombination and targeted integration into the host genome) or stable expression and replication of an extrachromosomal construct (for example, origin of replication, promoter and other regulatory sequences).
- the nucleic acid is nucleic acid construct or vector.
- the nucleic acid construct or vector is an expression construct or vector, however other constructs and vectors, such as those used for cloning are encompassed by the invention.
- the expression construct or vector is a plasmid.
- an expression construct/vector of the present invention may contain any number of regulatory elements in addition to the promoter as well as additional genes suitable for expression of further proteins if desired.
- the expression construct/vector includes one promoter.
- the expression construct/vector includes two or more promoters.
- the expression construct/vector includes one promoter for each gene to be expressed.
- the expression construct/vector includes one or more ribosomal binding sites, preferably a ribosomal binding site for each gene to be expressed.
- nucleic acid sequences and construct/vector sequences described herein may contain standard linker nucleotides such as those required for ribosome binding sites and/or restriction sites. Such linker sequences should not be interpreted as being required and do not provide a limitation on the sequences defined.
- Nucleic acids and nucleic acid constructs may be constructed using any number of techniques known in the art. For example, chemical synthesis or recombinant techniques may be used. Such techniques are described, for example, in Sambrook et al (Molecular Cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). Further exemplary techniques are described in the Examples section herein after. Essentially, the individual genes and regulatory elements will be operably linked to one another such that the genes can be expressed to form the desired proteins. Suitable vectors for use in the invention will be appreciated by those of ordinary skill in the art. However, by way of example, the following vectors may be suitable: pMTL80000 vectors, pIMPl, pJIR750, and the plasmids exemplified in the Examples section herein after.
- nucleic acids of the invention may be in any appropriate form, including RNA, DNA, or cDNA.
- the invention also provides host organisms, particularly microorganisms, and including viruses, bacteria, and yeast, comprising any one or more of the nucleic acids described herein.
- the one or more exogenous nucleic acids may be delivered to a parental microorganism as naked nucleic acids or may be formulated with one or more agents to facilitate the transformation process (for example, liposome-conjugated nucleic acid, an organism in which the nucleic acid is contained).
- the one or more nucleic acids may be DNA, RNA, or combinations thereof, as is appropriate. Restriction inhibitors may be used in certain embodiments; see, for example Murray, N.E. et al. (2000) Microbial. Molec. Biol. Rev.
- the microorganisms of the invention may be prepared from a parental microorganism and one or more exogenous nucleic acids using any number of techniques known in the art for producing recombinant microorganisms.
- transformation including transduction or transfection
- transformation may be achieved by electroporation, ultrasonication, polyethylene glycol-mediated transformation, chemical or natural competence, or conjugation.
- Suitable transformation techniques are described for example in, Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A laboratory Manual, Cold Spring Harbour Laboratory Press, Cold Spring Harbour, 1989.
- a recombinant microorganism of the invention is produced by a method comprises the following steps: introduction into a shuttle microorganism of (i) of an expression construct/vector as described herein and (ii) a methylation construct/vector comprising a methyltransferase gene; expression of the methyltransferase gene; isolation of one or more constructs/vectors from the shuttle microorganism; and, introduction of the one or more construct/vector into a destination microorganism.
- the methyltransferase gene of step B is expressed constitutively.
- step B expression of the methyltransferase gene of step B is induced.
- the shuttle microorganism is a microorganism, preferably a restriction negative microorganism that facilitates the methylation of the nucleic acid sequences that make up the expression construct/vector.
- the shuttle microorganism is a restriction negative E. coli, Bacillus subtilis, or Lactococcus lactis.
- the methylation construct/vector comprises a nucleic acid sequence encoding a methyltransferase.
- the methyltransferase gene present on the methylation construct/vector is induced.
- Induction may be by any suitable promoter system although in one particular embodiment of the invention, the methylation construct/vector comprises an inducible lac promoter and is induced by addition of lactose or an analogue thereof, more preferably isopropyl-P-D-thio-galactoside (IPTG).
- suitable promoters include the ara, tet, or T7 system.
- the methylation construct/vector promoter is a constitutive promoter.
- the methylation construct/vector has an origin of replication specific to the identity of the shuttle microorganism so that any genes present on the methylation construct/vector are expressed in the shuttle microorganism.
- the expression construct/vector has an origin of replication specific to the identity of the destination microorganism so that any genes present on the expression construct/vector are expressed in the destination microorganism.
- Expression of the methyltransferase enzyme results in methylation of the genes present on the expression construct/vector.
- the expression construct/vector may then be isolated from the shuttle microorganism according to any one of a number of known methods. By way of example only, the methodology described in the Examples section described hereinafter may be used to isolate the expression construct/vector.
- both construct/vector are concurrently isolated.
- the expression construct/vector may be introduced into the destination microorganism using any number of known methods. However, by way of example, the methodology described in the Examples section hereinafter may be used. Since the expression construct/vector is methylated, the nucleic acid sequences present on the expression construct/vector are able to be incorporated into the destination microorganism and successfully expressed.
- a methyltransferase gene may be introduced into a shuttle microorganism and over-expressed.
- the resulting methyltransferase enzyme may be collected using known methods and used in vitro to methylate an expression plasmid.
- the expression construct/vector may then be introduced into the destination microorganism for expression.
- the methyltransferase gene is introduced into the genome of the shuttle microorganism followed by introduction of the expression construct/vector into the shuttle microorganism, isolation of one or more constructs/vectors from the shuttle microorganism and then introduction of the expression construct/vector into the destination microorganism.
- the expression construct/vector and/or the methylation construct/vector are plasmids.
- methyltransferases of use in producing the microorganisms of the invention.
- Bacillus subtilis phage ⁇ 1 methyltransferase and the methyltransferase described in the Examples herein after may be used.
- the methyltransferase has the amino acid sequence of SEQ ID NO: 6, or is a functionally equivalent variant thereof.
- Nucleic acids encoding suitable methyltransferases will be readily appreciated having regard to the sequence of the desired methyltransferase and the genetic code.
- the nucleic acid encoding a methyltransferase is as described in the Examples herein after (for example the nucleic acid of SEQ ID NO: 26, or it is a functionally equivalent variant thereof).
- Any number of constructs/vectors adapted to allow expression of a methyltransferase gene may be used to generate the methylation construct/vector.
- the plasmid described in the Examples section hereinafter may be used (for example, SEQ ID NO: 7).
- the invention provides a method for the production of 3-HP and optionally one or more other products by microbial fermentation comprising fermenting a substrate comprising CO and/or C0 2 using a recombinant microorganism of the invention.
- 3-HP is the main fermentation product.
- the methods of the invention may be used to reduce the total atmospheric carbon emissions from an industrial process.
- the fermentation comprises the steps of anaerobically fermenting a substrate in a bioreactor to produce at least 3-HP using a recombinant microorganism of the invention.
- the method comprises the steps of:
- the method comprises the steps of:
- the substrate comprises CO. In one embodiment, the substrate comprises C0 2 and CO. In another embodiment, the substrate comprises C0 and H 2 . In another embodiment, the substrate comprises C0 2 and CO and H 2 .
- the gaseous substrate fermented by the microorganism is a gaseous substrate containing CO.
- the gaseous substrate may be a CO-containing waste gas obtained as a by-product of an industrial process, or from some other source such as from automobile exhaust fumes.
- the industrial process is selected from the group consisting of ferrous metal products manufacturing, such as a steel mill, non-ferrous products manufacturing, petroleum refining processes, gasification of coal, electric power production, carbon black production, ammonia production, methanol production and coke manufacturing.
- the CO-containing gas may be captured from the industrial process before it is emitted into the atmosphere, using any convenient method.
- the CO may be a component of syngas (gas comprising carbon monoxide and hydrogen).
- the CO produced from industrial processes is normally flared off to produce C0 2 and therefore the invention has particular utility in reducing C0 2 greenhouse gas emissions and producing butanol for use as a biofuel.
- the gaseous CO -containing substrate may also be desirable to treat it to remove any undesired impurities, such as dust particles before introducing it to the fermentation.
- the gaseous substrate may be filtered or scrubbed using known methods.
- the gaseous substrate fermented by the microorganism is a gaseous substrate comprising C02 and H2.
- the C02/H2 containing substrate may be a waste gas obtained as a by-product of an industrial process.
- the industrial process is selected from the group consisting of hydrogen production.
- the gaseous substrate comprising C02 and H2 may be a blended gas stream, wherein at least a portionof the gas stream is derived from one or more industrial process is blended with at least a portion of C02 or H2 to optimisie the C02:H2 ratio of the gaseous substrate. This may be particularlybeneficial for industrial gas streams rich in either C02 or H2.
- Examples of industrial process which produce by-product gas streams which can be used as a source for a C02 and H2 substrate, or a C02 and H2 blended substrate include coke manufacturing, refinery processes, ammnia production processes, methanol production processes, acetic acid production, natural gas refineries and power plants.
- a suitable liquid nutrient medium in addition to the CO- and/or C0 2 -containing substrate gas will need to be fed to the bioreactor.
- the substrate and media may be fed to the bioreactor in a continuous, batch or batch fed fashion.
- a nutrient medium will contain vitamins and minerals sufficient to permit growth of the micro-organism used.
- Anaerobic media suitable for fermentation to produce one or more products using CO and/or C0 2 are known in the art. For example, suitable media are described Biebel (2001). In one embodiment of the invention the media is as described in the Examples section herein after.
- the fermentation should desirably be carried out under appropriate conditions for the fermentation supporting the conversion of the gas to products comprising 3-HP to occur.
- Reaction conditions that should be considered include pressure, temperature, gas flow rate, liquid flow rate, media pH, media redox potential, agitation rate (if using a continuous stirred tank reactor), inoculum level, maximum gas substrate concentrations to ensure that CO and/or C0 2 in the liquid phase does not become limiting, and maximum product concentrations to avoid product inhibition.
- reactor volume can be reduced in linear proportion to increases in reactor operating pressure, i.e. bioreactors operated at 10 atmospheres of pressure need only be one tenth the volume of those operated at 1 atmosphere of pressure.
- WO 02/08438 describes gas-to- ethanol fermentations performed under pressures of 30 psig and 75 psig, giving ethanol productivities of 150 g/l/day and 369 g/l/day respectively.
- example fermentations performed using similar media and input gas compositions at atmospheric pressure were found to produce between 10 and 20 times less ethanol per litre per day.
- the rate of introduction of the CO and/or C0 2 -containing gaseous substrate is such as to ensure that the concentration of CO and/or C0 2 in the liquid phase does not become limiting. This is because a consequence of CO- and/or C0 2 -limited conditions may be that one or more product is consumed by the culture.
- composition of gas streams used to feed a fermentation reaction can have a significant impact on the efficiency and/or costs of that reaction. For example, 0 2 may reduce the efficiency of an anaerobic fermentation process. Processing of unwanted or unnecessary gases in stages of a fermentation process before or after fermentation can increase the burden on such stages (to products comprising where the gas stream is compressed before entering a bioreactor, unnecessary energy may be used to compress gases that are not needed in the fermentation). Accordingly, it may be desirable to treat substrate streams, particularly substrate streams derived from industrial sources, to remove unwanted components and increase the concentration of desirable components.
- a culture of a bacterium of the invention is maintained in an aqueous culture medium.
- the aqueous culture medium is a minimal anaerobic microbial growth medium. Suitable media are known in the art and described for example in U.S. Patent Nos. 5,173,429 and 5,593,886 and WO
- 3-HP or a mixed stream containing 3-HP and/or one or more other products, may be recovered from the fermentation broth by methods known in the art, such as fractional distillation or evaporation, pervaporation, gas stripping and extractive fermentation, including for example, liquid-liquid extraction.
- 3-HP and one or more products are recovered from the fermentation broth by continuously removing a portion of the broth from the bioreactor, separating microbial cells from the broth (conveniently by filtration), and recovering one or more products from the broth.
- Alcohols may conveniently be recovered for example by distillation.
- Acetone may be recovered for example by distillation.
- Any acids produced may be recovered for example by adsorption on activated charcoal.
- the separated microbial cells are preferably returned to the fermentation bioreactor.
- the cell free permeate remaining after any alcohol(s) and acid(s) have been removed is also preferably returned to the fermentation bioreactor. Additional nutrients (such as B vitamins) may be added to the cell free permeate to replenish the nutrient medium before it is returned to the bioreactor.
- the pH of the broth was adjusted as described above to enhance adsorption of acetic acid to the activated charcoal, the pH should be re-adjusted to a similar pH to that of the broth in the fermentation bioreactor, before being returned to the bioreactor.
- 3-HP may be recovered following fermentation using any appropriate methodology including but not limited to pervaporation, reverse osmosis, and liquid liquid extraction techniques.
- 3-HP cycle found in Green nonsulfur bacteria and Archea were combined to present a sustainable route towards the platform chemical 3-Hydroxypropionate (3-HP).
- This route allows fixation of 3 molecules of CO or C0 2 into one molecule of 3-HP.
- a carboxydotrophic acetogenic organism, Clostridium autoethanogenum was chosen and metabolically engineered with genes performing the initial C0 2 fixation step from the nonsulfur photosynthetic bacterium Chloroflexus auranticus (Fig. 1).
- Carboxydotrophic acetogens such as Clostridium autoethanogenum or Clostridium ljungdahlii are able to grow autotropically by fixing two molecules of CO or C0 2 and fusing them to form acetyl-CoA.
- Nonsulfur photosynthetic bacterium such as Chloroflexus auranticus are able to fix C02 in a cyclic process. They use acetyl-CoA as starting point and fuse it in an ATP dependent step catalyzed by an acetyl-CoA carboxylase (EC.
- malonyl-CoA which can then be reduced to 3-HP, the central intermediate of this cycle by action of a Malonyl-Coenzyme A reductase (EC 1.2.1.75) (Huegler et al, 2002, J. Bacteriol. 184: 2404-10).
- a Malonyl- Coenzyme A reductase gene, enzyme (GI: 163848165, Caur_2614; YP 001636209.1), was introduced into the carboxydotrophic organism to form a new metabolic route that fixes three molecules of CO or C0 2 into 3-HP.
- An acetyl-CoA carboxylase was identified to be already present in the host organisms as part of fatty acid biosynthesis (C.
- C. autoethanogenum DSM23693 is a derivative of C. autoethanogenum DSM10061 sourced from DSMZ (The German Collection of Microorganisms and Cell Cultures, InhoffenstraBe 7 B, 38124 Braunschweig, Germany).
- E. coli XLl-Blue MRF' Kan was purchased from Stratagene (Santa Clara, CA 95051- 7201, USA). [0169] E. coli was cultivated under aerobic conditions, while all other strains were grown strictly anaerobically in a volume of 50 ml liquid media in serum bottles with fructose (heterotrophic growth) or 30 psi CO-containing steel mill gas (collected from New Zealand Steel site in Glenbrook, NZ; composition: 44% CO, 32% N 2 , 22% C0 2 , 2% H 2 ) in the headspace (autotrophic growth).
- PETC-MES medium C. autoethanogenum pH5.6
- the Maionyl-Coenzyme A reductase from Chloroflexus aurantiacus was codon- optimised (SEQ ID NO: 1) and synthesized by ATG:Biosynthetics GmbH (Merzhausen, Germany), flanked by Ndel and Ecol restriction sites for further sub- cloning.
- the Phosphotransacetylase/Acetate kinase operon promoter (P p t a -ack) of C. autoethanogenum was used for expression of Maionyl-Coenzyme A reductase. All DNA sequences used are given in Table 4.
- the promoter region of the phosphotransacetylase-acetate kinase operon (? pt a-ack) (SEQ ID NO: 17) was amplified using primers Ppta-ack-Notl-F (SEQ ID NO: 8: GAGCGGCCGCAATATGATATTTATGTCC) and Ppta-ack-Ndel-R (SEQ ID NO: 9: TTCCATATGTTTCATGTTCATTTCCTCC) and cloned into the E. coli- Clostridium shuttle vector pMTL 85141 (FJ797651.1 ; Nigel Minton, University of Nottingham, UK) [Heap JT, Pennington OJ, Cartman ST, Minton NP.
- the created plasmid pMTL 85245 (SEQ ID NO: 3) and a 1625 bp fragment of the repL gene from pMTL83151 (FJ797647.1; Nigel Minton, University of Nottingham, UK) [Heap JT, Pennington OJ, Cartman ST, Minton NP. A modular system for Clostridium shuttle plasmids. J Microbiol Methods. 2009, 78: 79-85] were both cut with Fsel and Ascl. A ligation was performed resulting in plasmid pMTL83245.
- the recombinant strain containing the plasmid pMTL 83245-SDR was grown up in LB medium containing the appropriate antibiotics under aerobic conditions overnight.
- the cells were inoculated into fresh LB medium with an initial OD600 of 0.1.
- the cells were harvested at logarithmic phase (OD600 -0.6), and centrifuged at 13,000xg and 4 °C for 10 mins.
- the cell pellet was washed twice with l OOmM Tris-HCl (pH 7.8) and resuspended in the same wash buffer containing protease inhibitor and mixed with 1.44 g of 100 ⁇ glass beads.
- Tubes were chilled on ice for 5 min prior to disruption in a Mini Bead Beater (Biospec Products) through 5 cycles of 1 min beating at 5,000 rpm followed by 1 min on ice between cycles. After lysis, the sample was centrifuged (13,000 x g, 4 °C for 10 mins) and the supernatant aliquoted and stored at -80 °C until analysis. Protein content of the extracts was determined using a commercial kit (Pierce® Microplate BCA Protein Assay Kit-Reducing Agent Compatible, Thermo Scientific).
- the enzyme lysate was pre-incubated at 45 °C in 100 mM Tris-HCl buffer (pH 7.8), containing 3 mM 1,4-dithioerythritol, 2 mM MgCl 2 , and 0.3 mM NADPH for 10 mins.
- the reaction was initiated by the addition of 0.3 mM malonyl-CoA.
- the amount of NADPH consumed was determined using a molar extinction coefficient ( ⁇ 365 ) of 3400M -1 cm -1 .
- One unit of SDR activity was defined as the amount of enzyme required to oxidize 2 ⁇ of NADPH to NADP + per min.
- the assay was also performed at 37 °C.
- the methyltransferase (SEQ ID NO: 6) was synthesised and fused with an inducible lac promoter in vector pGS20 (ATGrbiosynthetics GmbH, Merzhausen, Germany) (SEQ ID NO: 7).
- the culture was twice washed with ice- cold electroporation buffer (270 mM sucrose, 1 mM MgCl 2 , 7 mM sodium phosphate, pH 7.4) and finally suspended in a volume of 600 ⁇ fresh electroporation buffer.
- This mixture was transferred into a pre-cooled electroporation cuvette with a 0.4 cm electrode gap containing -10 ⁇ g of the methylated plasmid mix. Since an additional Type I restriction system was identified in the genome of C. ljungdahlii compared to C. autoethanogenum, 1 ⁇ of a Type I restriction inhibitor (EPICENTRE Biotechnologies, Madison, WI 53713, USA) was added to the plasmid mix.
- the cells were mixed with plasmid and restriction inhibitor and immediately pulsed using a Gene pulser Xcell electroporation system (Bio-Rad Labratories, Hercules, CA 94547, USA) with the following settings: 2.5 kV, 600 ⁇ , and 25 ⁇ . Time constants were between 3.7-5.1 ms.
- the culture was transferred in 5 ml PETC-MES media (Table 1), which increased recovery of the cells.
- the culture was monitored at a wavelength of 600 nm using a Spectronic Helios Epsilon Spectrophotometer
- the culture was scaled up to 10 ml and later 50 ml PETC-MES media containing each 5 ⁇ g/ml clarithromycin and 30 psi steel mill gas in the headspace as sole carbon source.
- HPLC analysis of 3-hydroxypropionate (3-HP) and other metabolites was performed using an Agilent 1100 Series HPLC system equipped with a RID (Refractive Index Detector) operated at 35 °C and an Aminex HPX-87H column (300 x 7.8 mm, particle size 5 ⁇ ) kept at 35 °C. Slightly acidified water was used (0.005 M H 2 S0 4 ) as mobile phase with a flow rate of 0.6 ml/min.
- RID Refractive Index Detector
- acetyl-CoA carboxylase acetyl-CoA carboxylase
- biotin vitamin B7, vitamin H
- Biotin is required as co-factor for this carboxylation reaction.
- Acetyl-CoA carboxylase is a complex consisting of four different subunits, AccA, AccB, AccC, and AccD, where biotin is covalently bound to subunit AccB. Carboxylation of biotin is catalyzed by subunit AccC with the expense of ATP.
- the pool of biotin co-factor can be increased by over- expression of genes involved in the biosynthesis pathway of this co-factor.
- Biotin biosynthesis includes enzymes 6-carboxyhexanoate ⁇ CoA ligase [EC:6.2.1.14], 8- amino-7-oxononanoate synthase [EC:2.3.1.47], adenosylmethionine-8-amino-7- oxononanoate aminotransferase [EC:2.6.1.62], biotin synthetase [EC :2.8.1.6], biotin- [acetyl-CoA-carboxylase] ligase [EC:6.3.4.15], biotinidase [EC:3.5.1.12], biotin— protein ligase [EC:6.3.4.15; EC:6.3.4.11 ; EC:6.3.4.10; EC:6.3.4.9], ethiobiotin synthetase [EC:6.3.3.3], type III pantothenate kinase [EC:2.7.1.33].
- Malonyl-CoA is also a precursor for fatty acid biosynthesis. To increase 3-HP production, the rate of fatty acid biosynthesis can be limited in favour for 3-HP production.
- a malonyl-CoA:acyl carrier protein transacylase (FabD) [EC:2.3.1.39] initiates the elongation of fatty acid chains. The gene encoding this enzyme can be downregulated or activity of this enzyme decreased to prevent malonyl-CoA from being used for the native fatty acid biosynthesis.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP13797085.1A EP2855690B1 (en) | 2012-05-30 | 2013-05-30 | Recombinant microorganisms and their uses |
| CN201380040793.3A CN104508136A (zh) | 2012-05-30 | 2013-05-30 | 重组微生物及其用途 |
| JP2015514947A JP6445970B2 (ja) | 2012-05-30 | 2013-05-30 | 組換え微生物およびその使用 |
| CA2874832A CA2874832C (en) | 2012-05-30 | 2013-05-30 | Recombinant microorganisms and uses therefor |
| KR1020147036589A KR102098849B1 (ko) | 2012-05-30 | 2013-05-30 | 재조합 미생물 및 이의 용도 |
| IN10168DEN2014 IN2014DN10168A (https=) | 2012-05-30 | 2013-05-30 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261653348P | 2012-05-30 | 2012-05-30 | |
| US61/653,348 | 2012-05-30 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013180581A1 true WO2013180581A1 (en) | 2013-12-05 |
Family
ID=49670706
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/NZ2013/000092 Ceased WO2013180581A1 (en) | 2012-05-30 | 2013-05-30 | Recombinant microorganisms and uses therefor |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US9994878B2 (https=) |
| EP (1) | EP2855690B1 (https=) |
| JP (1) | JP6445970B2 (https=) |
| KR (1) | KR102098849B1 (https=) |
| CN (2) | CN113832199A (https=) |
| CA (1) | CA2874832C (https=) |
| IN (1) | IN2014DN10168A (https=) |
| WO (1) | WO2013180581A1 (https=) |
Cited By (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015116734A1 (en) | 2014-01-28 | 2015-08-06 | Lanzatech New Zealand Limited | Method of producing a recombinant microorganism |
| WO2016065217A1 (en) | 2014-10-22 | 2016-04-28 | Lanzatech New Zealand Limited | Multi-stage bioreactor processes |
| WO2016065085A1 (en) | 2014-10-22 | 2016-04-28 | Lanzatech New Zealand Limited | Gas testing unit and method |
| WO2016138050A1 (en) | 2015-02-23 | 2016-09-01 | Lanzatech New Zealand Limited | Recombinant acetogenic bacterium for the conversion of methane to products |
| WO2017066498A1 (en) | 2015-10-13 | 2017-04-20 | Lanzatech New Zealand Limited | Genetically engineered bacterium comprising energy-generating fermentation pathway |
| WO2017096324A1 (en) | 2015-12-03 | 2017-06-08 | Lanzatech New Zealand Limited | Arginine supplementation to improve efficiency in gas fermenting acetogens |
| WO2017117309A1 (en) | 2015-12-28 | 2017-07-06 | Lanzatech New Zealand Limited | Microorganism with modified hydrogenase activity |
| WO2017136478A1 (en) | 2016-02-01 | 2017-08-10 | Lanzatech New Zealand Limited | Integrated fermentation and electrolysis process |
| WO2017147555A1 (en) | 2016-02-26 | 2017-08-31 | Lanzatech New Zealand Limited | Crispr/cas systems for c-1 fixing bacteria |
| WO2017200884A1 (en) | 2016-05-14 | 2017-11-23 | Lanzatech, Inc. | Microorganism with modified aldehyde:ferredoxin oxidoreductase activity and related methods |
| CN109112156A (zh) * | 2018-09-19 | 2019-01-01 | 江苏师范大学 | 一种生产3-羟基丙酸的重组假单胞菌、其构建方法及其应用 |
| WO2019051069A1 (en) | 2017-09-08 | 2019-03-14 | Lanzatech, Inc. | METHODS AND SYSTEMS FOR PRODUCING METABOLITES USING SUBSTRATES CONTAINING C1 COMPOUNDS RICH IN HYDROGEN |
| WO2019157507A1 (en) | 2018-02-12 | 2019-08-15 | Lanzatech, Inc. | A process for improving carbon conversion efficiency |
| WO2019204029A1 (en) | 2018-04-20 | 2019-10-24 | Lanzatech, Inc. | Intermittent electrolysis streams |
| US10704065B2 (en) | 2016-01-28 | 2020-07-07 | Verdant Bioproducts Limited | Method for producing 3-hydroxypropanamide employing Acetobacter lovaniensis |
| WO2020188033A1 (en) | 2019-03-20 | 2020-09-24 | Global Bioenergies | Improved means and methods for producing isobutene from acetyl-coa |
| WO2021006995A1 (en) | 2019-07-11 | 2021-01-14 | Lanzatech, Inc. | Methods for optimizing gas utilization |
| US11091415B2 (en) | 2019-02-08 | 2021-08-17 | Lanzatech, Inc. | Process for recovering close boiling products |
| US11097967B2 (en) | 2018-11-19 | 2021-08-24 | Lanzatech, Inc. | Integration of fermentation and gasification |
| WO2021188300A1 (en) | 2020-03-16 | 2021-09-23 | Lanzatech, Inc. | Tail gas of gas fermentation to dry gasification feedstock |
| WO2022170191A1 (en) * | 2021-02-08 | 2022-08-11 | Lanzatech, Inc. | Recombinant microorganisms and uses therefor |
| US11760989B2 (en) | 2020-06-06 | 2023-09-19 | Lanzatech, Inc. | Microorganism with knock-in at acetolactate decarboxylase gene locus |
| US12129503B2 (en) | 2022-08-10 | 2024-10-29 | Lanzatech, Inc. | Carbon sequestration in soils with production of chemical products |
| US12269005B2 (en) | 2021-04-09 | 2025-04-08 | Lanzatech, Inc. | Process and apparatus for providing a feedstock |
| US12286660B2 (en) | 2012-06-01 | 2025-04-29 | Lanzatech, Inc. | Microbial fermentation for the production of terpenes |
Families Citing this family (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789516B (zh) * | 2015-04-22 | 2017-12-22 | 天津大学 | 一种产三羟基丙酸的集胞藻6803基因工程菌及构建方法及应用 |
| DE102016212497B4 (de) * | 2015-07-13 | 2024-04-25 | Sk Innovation Co., Ltd. | Mutanter Mikroorganismus, der ein Gen umfasst, das Methylmalonyl-CoA-Reductase codiert, und seine Verwendung |
| JPWO2018070141A1 (ja) * | 2016-10-13 | 2019-08-08 | 積水化学工業株式会社 | 偏性嫌気性酢酸生成微生物、並びに、組換え微生物 |
| US11555209B2 (en) | 2017-12-19 | 2023-01-17 | Lanzatech, Inc. | Microorganisms and methods for the biological production of ethylene glycol |
| JP2023518045A (ja) | 2020-03-18 | 2023-04-27 | ランザテク,インコーポレイテッド | ガス基質からの2-フェニルエタノールの発酵産生 |
| KR20220159450A (ko) * | 2020-04-29 | 2022-12-02 | 란자테크, 인크. | 가스성 기질로부터의 β-케토아디페이트의 발효 제조 |
| US12241105B2 (en) | 2021-07-20 | 2025-03-04 | Lanzatech, Inc. | Recombinant microorganisms and uses therefor |
| TW202307202A (zh) | 2021-08-06 | 2023-02-16 | 美商朗澤科技有限公司 | 用於改良乙二醇之生物產生的微生物及方法 |
| US12091648B2 (en) | 2021-11-03 | 2024-09-17 | Lanzatech, Inc. | System and method for generating bubbles in a vessel |
| US12280331B2 (en) | 2022-04-29 | 2025-04-22 | Lanzatech, Inc. | Low residence time gas separator |
| US12077800B2 (en) | 2022-06-16 | 2024-09-03 | Lanzatech, Inc. | Liquid distributor system and process of liquid distribution |
| AU2023286621A1 (en) | 2022-06-21 | 2025-01-09 | Lanzatech, Inc. | Microorganisms and methods for the continuous co-production of tandem repeat proteins and chemical products from c1-substrates |
| CN119403929A (zh) | 2022-06-21 | 2025-02-07 | 朗泽科技有限公司 | 用于由c1底物连续共产生高价值专用蛋白和化学产物的微生物和方法 |
| WO2024253882A1 (en) | 2023-06-05 | 2024-12-12 | Lanzatech, Inc. | Integrated gas fermentation |
| US12359224B2 (en) | 2023-06-05 | 2025-07-15 | Lanzatech, Inc. | Integrated gas fermentation and carbon black processes |
| CN121065057B (zh) * | 2025-11-05 | 2026-03-24 | 珠海麦得发生物科技股份有限公司 | 一种生产3-羟基丙酸的重组菌及其构建方法和应用 |
Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5173429A (en) | 1990-11-09 | 1992-12-22 | The Board Of Trustees Of The University Of Arkansas | Clostridiumm ljungdahlii, an anaerobic ethanol and acetate producing microorganism |
| US5593886A (en) | 1992-10-30 | 1997-01-14 | Gaddy; James L. | Clostridium stain which produces acetic acid from waste gases |
| WO2002008438A2 (en) | 2000-07-25 | 2002-01-31 | Bioengineering Resources, Inc. | Methods for increasing the production of ethanol from microbial fermentation |
| US6368819B1 (en) | 1998-09-08 | 2002-04-09 | Bioengineering Resources, Inc. | Microbial process for the preparation of acetic acid as well as solvent for its extraction from the fermentation broth |
| WO2008028055A2 (en) | 2006-08-31 | 2008-03-06 | The Board Of Regents For Oklahoma State University | Isolation and characterization of novel clostridial species |
| WO2009064200A2 (en) | 2007-11-13 | 2009-05-22 | Lanzatech New Zealand Limited | Novel bacteria and methods of use thereof |
| WO2009089457A1 (en) * | 2008-01-11 | 2009-07-16 | Novozymes A/S | Methods for producing 3-hydroxypropionic acid and compounds thereof |
| WO2009111513A1 (en) * | 2008-03-03 | 2009-09-11 | Joule Biotechnologies, Inc. | Engineered co2 fixing microorganisms producing carbon-based products of interest |
| US20110125118A1 (en) * | 2009-11-20 | 2011-05-26 | Opx Biotechnologies, Inc. | Production of an Organic Acid and/or Related Chemicals |
| US20110229947A1 (en) | 2010-03-19 | 2011-09-22 | Coskata, Inc. | Novel Ethanologenic Clostridium species, Clostridium coskatii |
| US20120041232A1 (en) * | 2007-12-04 | 2012-02-16 | Opx Biotechnologies, Inc. | Compositions and methods for 3-hydroxypropionate bio-production from biomass |
Family Cites Families (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BR0115877A (pt) * | 2000-11-20 | 2003-10-07 | Cargill Inc | ácido 3-hidroxipropiÈnico e outros compostos orgánicos |
| CN101445813B (zh) * | 2007-12-21 | 2013-03-27 | 清华大学 | 一种生产3-羟基丙酸的方法 |
| CA2712779C (en) * | 2008-01-22 | 2021-03-16 | Genomatica, Inc. | Methods and organisms for utilizing synthesis gas or other gaseous carbon sources and methanol |
| CN101519635A (zh) * | 2009-04-03 | 2009-09-02 | 南京工业大学 | 产3-羟基丙酸的转化微生物及其构建方法和应用 |
| US8715971B2 (en) * | 2009-09-09 | 2014-05-06 | Genomatica, Inc. | Microorganisms and methods for the co-production of isopropanol and 1,4-butanediol |
| KR20120120493A (ko) * | 2009-12-10 | 2012-11-01 | 게노마티카 인코포레이티드 | 합성 가스 또는 기타 가스상 탄소원 및 메탄올을 1,3-부탄디올로 변환하는 방법 및 변환용 유기체 |
| WO2011088364A2 (en) * | 2010-01-15 | 2011-07-21 | Massachuseits Institute Of Technology | Bioprocess and microbe engineering for total carbon utilization in biofuelproduction |
| JP2012085635A (ja) | 2010-03-23 | 2012-05-10 | Nippon Shokubai Co Ltd | 3−ヒドロキシプロピオン酸の製造方法 |
| BR112013003003A2 (pt) * | 2010-08-06 | 2016-06-14 | Mascoma Corp | produção de produtos malonil-coa derivados através de rotas anaeróbicas |
| US9090918B2 (en) * | 2010-11-22 | 2015-07-28 | Novozymes A/A | Compositions and methods for 3-hydroxypropionic acid production |
| BR112013021524A2 (pt) | 2011-02-25 | 2017-06-13 | Lanzatech New Zealand Ltd | micro-organismos recombinantes e usos dos mesmos |
| WO2013043758A2 (en) * | 2011-09-19 | 2013-03-28 | Opx Biotechnologies, Inc. | Compositions and methods regarding direct nadh utilization to produce 3-hydroxypropionic acid, derived chemicals and further derived products |
| US8349587B2 (en) * | 2011-10-31 | 2013-01-08 | Ginkgo Bioworks, Inc. | Methods and systems for chemoautotrophic production of organic compounds |
| US20130288317A1 (en) * | 2012-04-30 | 2013-10-31 | Metabolix, Inc. Chemical | Increased yields of phas from hydrogen feeding and diverse carbon fixation pathways |
-
2013
- 2013-05-30 IN IN10168DEN2014 patent/IN2014DN10168A/en unknown
- 2013-05-30 CN CN202111160847.2A patent/CN113832199A/zh active Pending
- 2013-05-30 KR KR1020147036589A patent/KR102098849B1/ko not_active Expired - Fee Related
- 2013-05-30 WO PCT/NZ2013/000092 patent/WO2013180581A1/en not_active Ceased
- 2013-05-30 JP JP2015514947A patent/JP6445970B2/ja active Active
- 2013-05-30 CN CN201380040793.3A patent/CN104508136A/zh active Pending
- 2013-05-30 CA CA2874832A patent/CA2874832C/en active Active
- 2013-05-30 EP EP13797085.1A patent/EP2855690B1/en active Active
- 2013-05-30 US US13/905,143 patent/US9994878B2/en active Active
Patent Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5173429A (en) | 1990-11-09 | 1992-12-22 | The Board Of Trustees Of The University Of Arkansas | Clostridiumm ljungdahlii, an anaerobic ethanol and acetate producing microorganism |
| US5593886A (en) | 1992-10-30 | 1997-01-14 | Gaddy; James L. | Clostridium stain which produces acetic acid from waste gases |
| US6368819B1 (en) | 1998-09-08 | 2002-04-09 | Bioengineering Resources, Inc. | Microbial process for the preparation of acetic acid as well as solvent for its extraction from the fermentation broth |
| WO2002008438A2 (en) | 2000-07-25 | 2002-01-31 | Bioengineering Resources, Inc. | Methods for increasing the production of ethanol from microbial fermentation |
| WO2008028055A2 (en) | 2006-08-31 | 2008-03-06 | The Board Of Regents For Oklahoma State University | Isolation and characterization of novel clostridial species |
| WO2009064200A2 (en) | 2007-11-13 | 2009-05-22 | Lanzatech New Zealand Limited | Novel bacteria and methods of use thereof |
| US20120041232A1 (en) * | 2007-12-04 | 2012-02-16 | Opx Biotechnologies, Inc. | Compositions and methods for 3-hydroxypropionate bio-production from biomass |
| WO2009089457A1 (en) * | 2008-01-11 | 2009-07-16 | Novozymes A/S | Methods for producing 3-hydroxypropionic acid and compounds thereof |
| WO2009111513A1 (en) * | 2008-03-03 | 2009-09-11 | Joule Biotechnologies, Inc. | Engineered co2 fixing microorganisms producing carbon-based products of interest |
| US20110125118A1 (en) * | 2009-11-20 | 2011-05-26 | Opx Biotechnologies, Inc. | Production of an Organic Acid and/or Related Chemicals |
| US20110229947A1 (en) | 2010-03-19 | 2011-09-22 | Coskata, Inc. | Novel Ethanologenic Clostridium species, Clostridium coskatii |
Non-Patent Citations (18)
| Title |
|---|
| ABRINI J; NAVEAU H; NYNS E-J: "Clostridium autoethanogenum, sp. nov., an anaerobic bacterium that produces ethanol from carbon monoxide", ARCH MICROBIOL, vol. 4, 1994, pages 345 - 351, XP008024869 |
| ALBER, BIRGIT ET AL., MALONYL-COENZYME A REDUCTASE IN THE MODIFIED 3-HYDROXYPROPIONATE CYCLE FOR AUTOTROPHIC CARBON FIXATION IN ARCHAEAL METALLOSPHAERA AND SULFOLOBUS SPP., vol. 188, no. 24, December 2006 (2006-12-01), pages 8551 - 8559, XP008154562 * |
| HEAP JT; PENNINGTON OJ; CARTMAN ST; MINTON NP: "A modular system for Clostridium shuttle plasmids", J MICROBIOL METHODS, vol. 78, 2009, pages 79 - 85, XP026148475, DOI: doi:10.1016/j.mimet.2009.05.004 |
| HENSIRISAK: "Scale-up of microbubble dispersion generator for aerobic fermentation", APPLIED BIOCHEMISTRY AND BIOTECHNOLOGY, vol. 101, no. 3, October 2002 (2002-10-01) |
| HUEGLER ET AL., J. BACTERIOL., vol. 184, 2002, pages 2404 - 10 |
| HUGLER ET AL., J. BACTERIOL., vol. 184, 2002, pages 2404 - 2410 |
| HUGLER, M.; MENENDEZ, C.; SCHAGGER, H.; FUCHS, G.: "Malonyl- coenzyme A reductase from Chloroflexus aurantiacus, a key enzyme of the 3-hydroxypropionate cycle for autotrophic C02 fixation", J. BACTERIOL., vol. 184, no. 9, 2002, pages 2404 - 2410, XP055241831, DOI: doi:10.1128/JB.184.9.2404-2410.2002 |
| KROEGER ET AL., ANAL. BIOCHEM., vol. 411, 2011, pages 100 - 5 |
| MURRAY, N.E. ET AL., MICROBIAL. MOLEC. BIOL. REV., vol. 64, 2000, pages 412 |
| NORRIS JR AND RIBBONS DW: "Methods in Microbiology", vol. 3B, 1969, ACADEMIC PRESS, pages: 117 - 132 |
| PASTER ET AL., US DOE REPORT, 2003, pages 48 - 49 |
| SAMBROOK ET AL.: "Molecular Cloning: A laboratory manual", 1989, COLD SPRING HARBOR LABORATORY PRESS |
| SAMBROOK, J.; RUSSELL, D.: "Molecular cloning: A Laboratory Manual, 3rd ed.", 2001, COLD SPRING HARBOUR LAB PRESS |
| TANNER RS; MILLER LM; YANG D: "Clostridium Ijungdahlii sp. nov., an Acetogenic Species in Clostridial rRNA Homology Group I", INT J SYST BACTERIOL, vol. 43, 1993, pages 232 - 236 |
| TANNER RS; MILLER LM; YANG D: "Clostridium ljungdahlii sp. nov., an Acetogenic Species in Clostridial rRNA Homology Group I", INT J SYST BACTERIOL, vol. 43, 1993, pages 232 - 236 |
| THAUER, SCIENCE, vol. 318, 2007, pages 1732 - 33 |
| TYURIN ET AL., J. BIOTECH RES., vol. 4, 2012, pages 1 - 12 |
| WOLFE RS: "Microbial formation of methane", ADV MICROB PHYSIOL, vol. 6, 1971, pages 107 - 146 |
Cited By (40)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12286660B2 (en) | 2012-06-01 | 2025-04-29 | Lanzatech, Inc. | Microbial fermentation for the production of terpenes |
| WO2015116734A1 (en) | 2014-01-28 | 2015-08-06 | Lanzatech New Zealand Limited | Method of producing a recombinant microorganism |
| US9315830B2 (en) | 2014-01-28 | 2016-04-19 | Lanzatech New Zealand Limited | Method of producing a recombinant microorganism |
| WO2016065217A1 (en) | 2014-10-22 | 2016-04-28 | Lanzatech New Zealand Limited | Multi-stage bioreactor processes |
| WO2016065085A1 (en) | 2014-10-22 | 2016-04-28 | Lanzatech New Zealand Limited | Gas testing unit and method |
| EP4180806A1 (en) | 2014-10-22 | 2023-05-17 | LanzaTech NZ, Inc. | Bioreactor and gas testing unit and method |
| EP4198118A1 (en) | 2014-10-22 | 2023-06-21 | LanzaTech NZ, Inc. | Multi-stage bioreactor processes |
| US10113194B2 (en) | 2014-10-22 | 2018-10-30 | Lanzatech New Zealand Limited | Gas testing unit and method |
| US9834792B2 (en) | 2014-10-22 | 2017-12-05 | Lanzatech New Zealand Limited | Multi-stage bioreactor processes |
| WO2016138050A1 (en) | 2015-02-23 | 2016-09-01 | Lanzatech New Zealand Limited | Recombinant acetogenic bacterium for the conversion of methane to products |
| WO2017066498A1 (en) | 2015-10-13 | 2017-04-20 | Lanzatech New Zealand Limited | Genetically engineered bacterium comprising energy-generating fermentation pathway |
| US9738875B2 (en) | 2015-10-13 | 2017-08-22 | Lanzatech New Zealand Limited | Genetically engineered bacterium comprising energy-generating fermentation pathway |
| US9957531B1 (en) | 2015-10-13 | 2018-05-01 | Lanzatech New Zealand Limited | Genetically engineered bacterium for the production of 3-hydroxybutyrate |
| EP3901267A1 (en) | 2015-10-13 | 2021-10-27 | Lanzatech New Zealand Limited | Genetically engineered bacterium comprising energy-generating fermentation pathway |
| WO2017096324A1 (en) | 2015-12-03 | 2017-06-08 | Lanzatech New Zealand Limited | Arginine supplementation to improve efficiency in gas fermenting acetogens |
| EP3981869A1 (en) | 2015-12-03 | 2022-04-13 | LanzaTech NZ, Inc. | Arginine as sole nitrogen source for c1-fixing microorganism |
| WO2017117309A1 (en) | 2015-12-28 | 2017-07-06 | Lanzatech New Zealand Limited | Microorganism with modified hydrogenase activity |
| US10704065B2 (en) | 2016-01-28 | 2020-07-07 | Verdant Bioproducts Limited | Method for producing 3-hydroxypropanamide employing Acetobacter lovaniensis |
| WO2017136478A1 (en) | 2016-02-01 | 2017-08-10 | Lanzatech New Zealand Limited | Integrated fermentation and electrolysis process |
| EP4234708A2 (en) | 2016-02-01 | 2023-08-30 | LanzaTech NZ, Inc. | Integrated fermentation and electrolysis process |
| EP4234707A2 (en) | 2016-02-01 | 2023-08-30 | LanzaTech NZ, Inc. | Integrated fermentation and electrolysis process |
| WO2017147555A1 (en) | 2016-02-26 | 2017-08-31 | Lanzatech New Zealand Limited | Crispr/cas systems for c-1 fixing bacteria |
| WO2017200884A1 (en) | 2016-05-14 | 2017-11-23 | Lanzatech, Inc. | Microorganism with modified aldehyde:ferredoxin oxidoreductase activity and related methods |
| WO2019051069A1 (en) | 2017-09-08 | 2019-03-14 | Lanzatech, Inc. | METHODS AND SYSTEMS FOR PRODUCING METABOLITES USING SUBSTRATES CONTAINING C1 COMPOUNDS RICH IN HYDROGEN |
| WO2019157507A1 (en) | 2018-02-12 | 2019-08-15 | Lanzatech, Inc. | A process for improving carbon conversion efficiency |
| WO2019204029A1 (en) | 2018-04-20 | 2019-10-24 | Lanzatech, Inc. | Intermittent electrolysis streams |
| CN109112156A (zh) * | 2018-09-19 | 2019-01-01 | 江苏师范大学 | 一种生产3-羟基丙酸的重组假单胞菌、其构建方法及其应用 |
| US11097967B2 (en) | 2018-11-19 | 2021-08-24 | Lanzatech, Inc. | Integration of fermentation and gasification |
| US11091415B2 (en) | 2019-02-08 | 2021-08-17 | Lanzatech, Inc. | Process for recovering close boiling products |
| WO2020188033A1 (en) | 2019-03-20 | 2020-09-24 | Global Bioenergies | Improved means and methods for producing isobutene from acetyl-coa |
| WO2021006995A1 (en) | 2019-07-11 | 2021-01-14 | Lanzatech, Inc. | Methods for optimizing gas utilization |
| US11772038B2 (en) | 2019-07-11 | 2023-10-03 | Lanzatech, Inc. | Methods for optimizing gas utilization |
| EP4450146A2 (en) | 2019-07-11 | 2024-10-23 | LanzaTech , Inc. | Methods for optimizing gas utilization |
| WO2021188300A1 (en) | 2020-03-16 | 2021-09-23 | Lanzatech, Inc. | Tail gas of gas fermentation to dry gasification feedstock |
| US11760989B2 (en) | 2020-06-06 | 2023-09-19 | Lanzatech, Inc. | Microorganism with knock-in at acetolactate decarboxylase gene locus |
| WO2022170191A1 (en) * | 2021-02-08 | 2022-08-11 | Lanzatech, Inc. | Recombinant microorganisms and uses therefor |
| US11788092B2 (en) | 2021-02-08 | 2023-10-17 | Lanzatech, Inc. | Recombinant microorganisms and uses therefor |
| TWI837582B (zh) * | 2021-02-08 | 2024-04-01 | 美商朗澤科技有限公司 | 重組微生物及其用途 |
| US12269005B2 (en) | 2021-04-09 | 2025-04-08 | Lanzatech, Inc. | Process and apparatus for providing a feedstock |
| US12129503B2 (en) | 2022-08-10 | 2024-10-29 | Lanzatech, Inc. | Carbon sequestration in soils with production of chemical products |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2874832C (en) | 2016-02-02 |
| CN113832199A (zh) | 2021-12-24 |
| JP2015517823A (ja) | 2015-06-25 |
| US9994878B2 (en) | 2018-06-12 |
| KR102098849B1 (ko) | 2020-04-09 |
| JP6445970B2 (ja) | 2018-12-26 |
| CN104508136A (zh) | 2015-04-08 |
| US20130323806A1 (en) | 2013-12-05 |
| EP2855690A4 (en) | 2016-02-17 |
| IN2014DN10168A (https=) | 2015-08-21 |
| CA2874832A1 (en) | 2013-12-05 |
| KR20150021081A (ko) | 2015-02-27 |
| EP2855690A1 (en) | 2015-04-08 |
| EP2855690B1 (en) | 2018-07-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2874832C (en) | Recombinant microorganisms and uses therefor | |
| CA2995872C (en) | Recombinant clostridium bacterium and uses thereof in acetone production | |
| AU2011318676B2 (en) | Production of butanol from carbon monoxide by a recombinant microorganism | |
| US9834795B2 (en) | Recombinant microorganisms and uses therefor | |
| US9365868B2 (en) | Fermentation process for producing isopropanol using a recombinant microorganism | |
| CA2914003C (en) | Recombinant microorganisms exhibiting increased flux through a fermentation pathway | |
| JP6407141B2 (ja) | 代謝物活性が改変された酵素 | |
| NZ614459B2 (en) | Recombinant microorganisms and uses therefor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13797085 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2874832 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2015514947 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013797085 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 20147036589 Country of ref document: KR Kind code of ref document: A |