WO2013180350A1 - 다능성 줄기세포의 제작, 유지, 증식을 증진하는 신규 저분자 화합물 및 이를 포함하는 조성물과 배양방법 - Google Patents

다능성 줄기세포의 제작, 유지, 증식을 증진하는 신규 저분자 화합물 및 이를 포함하는 조성물과 배양방법 Download PDF

Info

Publication number
WO2013180350A1
WO2013180350A1 PCT/KR2012/009420 KR2012009420W WO2013180350A1 WO 2013180350 A1 WO2013180350 A1 WO 2013180350A1 KR 2012009420 W KR2012009420 W KR 2012009420W WO 2013180350 A1 WO2013180350 A1 WO 2013180350A1
Authority
WO
WIPO (PCT)
Prior art keywords
stem cells
pluripotent stem
cells
rsc
compound
Prior art date
Application number
PCT/KR2012/009420
Other languages
English (en)
French (fr)
Inventor
조이숙
이경
이정운
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Priority to EP12877706.7A priority Critical patent/EP2774918B1/en
Priority to US14/358,672 priority patent/US9587225B2/en
Publication of WO2013180350A1 publication Critical patent/WO2013180350A1/ko
Priority to US15/411,642 priority patent/US10301598B2/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404—Indoles, e.g. pindolol
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/04—Indoles; Hydrogenated indoles
    • C07D209/10—Indoles; Hydrogenated indoles with substituted hydrocarbon radicals attached to carbon atoms of the hetero ring
    • C07D209/18—Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/04—Indoles; Hydrogenated indoles
    • C07D209/10—Indoles; Hydrogenated indoles with substituted hydrocarbon radicals attached to carbon atoms of the hetero ring
    • C07D209/18—Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C07D209/20—Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals substituted additionally by nitrogen atoms, e.g. tryptophane
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/04—Indoles; Hydrogenated indoles
    • C07D209/10—Indoles; Hydrogenated indoles with substituted hydrocarbon radicals attached to carbon atoms of the hetero ring
    • C07D209/18—Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C07D209/24—Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals with an alkyl or cycloalkyl radical attached to the ring nitrogen atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/12—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0603—Embryonic cells ; Embryoid bodies
    • C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/02—Atmosphere, e.g. low oxygen conditions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60—Transcription factors
    • C12N2501/602—Sox-2
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60—Transcription factors
    • C12N2501/603—Oct-3/4
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60—Transcription factors
    • C12N2501/604—Klf-4
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60—Transcription factors
    • C12N2501/606—Transcription factors c-Myc
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/999—Small molecules not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/02—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/09—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from epidermal cells, from skin cells, from oral mucosa cells

Definitions

  • the present invention provides a novel compound based on indole acrylic acid of Formula 1, a medium composition comprising the same, a composition for promoting differentiation comprising the same, a cell culture comprising the same, and a method for producing and maintaining a differentiated pluripotent stem cell using the same. It is about.
  • Stem cell is a cell that can be differentiated tissue-specifically to have a specific function and form, given the excellent self-proliferative capacity and given a certain environment and conditions while maintaining an undifferentiated state.
  • Human pluripotent stem cells including human embryonic stem cells and human induced pluripotent stem cells, grow indefinitely under appropriate in vitro culture conditions (reproducibility; in terms of understanding biological basic knowledge, including the development, differentiation and growth of individuals, due to their ability to self-renewal and to differentiate into all kinds of cells of the individual (pluripotency or pluripotency)
  • the scope of application of the research results for the development of cell therapies, the new drug development, and the therapeutic method for various diseases are expanding.
  • human pluripotent stem cells are maintained in an undifferentiated state by co-culturing with feeder cells such as mouse embryonic fibroblasts (MEFs) or by culturing them in conditioned media (CM). It can be maintained and cultured continuously.
  • feeder cells such as mouse embryonic fibroblasts (MEFs) or by culturing them in conditioned media (CM).
  • CM conditioned media
  • both direct culture with animal feeder cells or culture methods using feeder cell cultures carry the risk that one or more infectious agents, such as viruses, can spread from animal cells to human pluripotent stem cells.
  • Embryonic stem cells derived from the inner cell mass of frozen embryos are extracted from frozen embryos to be discarded, so there is no legal problem, but since they are extracted from embryos, they are subject to ethical and religious controversy from the standpoint of destruction of life. Because of the lack of immunocompatibility between individuals, transplant rejection cannot be avoided when developing as a cell therapy. As an alternative to overcome this problem, a recent method of producing induced pluripotent stem cells having the characteristics of pluripotent stem cells similar to embryonic stem cells from adult cells has been successful (Cell 126, 663-676,).
  • the present inventors have continuously searched for a low molecular weight compound capable of improving the maintenance and culture technology of undifferentiated human pluripotent stem cells and a low molecular weight compound capable of improving the reverse differentiation technology for producing human pluripotent stem cells from somatic cells.
  • the excavated novel low molecular compound RSC-133 was discovered, and in case of using the medium composition containing RSC-133, the efficiency of induction of differentiation for producing human pluripotent stem cells was greatly improved, and human pluripotent stem cells
  • the present invention was completed by verifying that the culture conditions for maintaining and propagating undifferentiated state were effectively improved.
  • Another object of the present invention is to provide a medium composition comprising the novel compound of formula 1, or a pharmaceutically acceptable salt thereof.
  • Another object of the present invention is to provide a composition for promoting reverse differentiation into pluripotent stem cells from differentiated cells comprising a novel compound of Formula 1, or a pharmaceutically acceptable salt thereof.
  • Another object of the invention is to differentiated cells; The reverse differentiation promoting composition; And a reverse differentiation inducer, wherein the differentiated cells are to provide an in vitro cell culture that is differentiated into pluripotent stem cells.
  • Another object of the present invention is to provide a medium composition capable of promoting maintenance and proliferation of pluripotent stem cells in an undifferentiated state.
  • Another object of the present invention relates to a method for culturing pluripotent stem cells in an undifferentiated state.
  • Another object of the present invention is to provide a medium composition capable of promoting maintenance and proliferation of pluripotent stem cells in an undifferentiated state.
  • Another object of the present invention is a pluripotent stem cell; And it is to provide an in vitro cell culture comprising the medium composition such that the pluripotent stem cells are maintained in an undifferentiated state through a plurality of serial passages.
  • the present invention provides a compound of formula (1), or a pharmaceutically acceptable salt thereof.
  • R 1 is a methoxy group (OCH 3 ), amino group (NH 2 ), methylamino group (NHCH 3 ), dimethylamino group (N (CH 3 ) 2 ), O-isopropyl group (O-isopropyl), propyl Amino group (NHCH (CH 3 ) 2 ), hydroxy group (OH), NHCH 2 -furan, NHCH 2 CH 2 -piperidine, or NH (CH 2 ) 3 -morpholine; R 2 is a hydroxy group (OH) or hydrogen (H).
  • the part represented by --- may be a single bond or a double bond.
  • R 1 of Chemical Formula 1 is a methoxy group (OCH 3 ); R 2 is hydrogen; The part may be a double bond.
  • R 1 of Formula 1 is an amino group (NH 2 ); R 2 is hydrogen; The part may be a double bond.
  • R 1 of Chemical Formula 1 is a methylamino group (NHCH 3 ); R 2 is hydrogen; The part may be a double bond.
  • R 1 of Formula 1 is a dimethylamino group (N (CH 3 ) 2 ); R 2 is hydrogen; The part may be a double bond.
  • R 1 of Formula 1 is an amino group (NH 2 ); R 2 is hydrogen; The part may be a single bond.
  • R 1 of Formula 1 is O-isopropyl; R 2 is a hydroxy group (OH); The part may be a double bond.
  • R 1 of Formula 1 is an amino group (NH 2 ); R 2 is a hydroxy group (OH); The part may be a double bond.
  • R 1 of Chemical Formula 1 is a methylamino group (NHCH 3 ); R 2 is a hydroxy group (OH); The part may be a double bond.
  • R 1 of Chemical Formula 1 is a propylamino group (NHCH (CH 3 ) 2 ); R 2 is a hydroxy group (OH); The part may be a double bond.
  • R 1 of Formula 1 is a dimethylamino group (NH (CH 3 ) 2 ); R 2 is a hydroxy group (OH); The part may be a double bond.
  • R 1 of Formula 1 is a hydroxy group (OH); R 2 is hydrogen; The part may be a double bond.
  • R 1 of Formula 1 is NHCH 2 -furan; R 2 is hydrogen; The part may be a double bond.
  • R 1 of Formula 1 is NHCH 2 CH 2 -piperidine; R 2 is hydrogen; The part may be a double bond.
  • R 1 of Chemical Formula 1 is NH (CH 2 ) 3 -morpholine; R 2 is hydrogen; The part may be a double bond.
  • R 1 of Formula 1 is O-isopropyl; R 2 is hydrogen; The part may be a double bond.
  • preferred compounds of the compound of formula 1 of the present invention are the same as 1) to 15).
  • salts are acid addition salts formed with pharmaceutically acceptable free acids.
  • Acid addition salts are prepared by conventional methods, for example by dissolving a compound in an excess of aqueous acid solution and precipitating the salt using a water miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. Equivalent molar amounts of the compound and acid or alcohol (eg, glycol monomethyl ether) in water can be heated and the mixture can then be evaporated to dryness or the precipitated salts can be suction filtered.
  • a water miscible organic solvent such as methanol, ethanol, acetone or acetonitrile.
  • Equivalent molar amounts of the compound and acid or alcohol (eg, glycol monomethyl ether) in water can be heated and the mixture can then be evaporated to dryness or the precipitated salts can be suction filtered.
  • organic acids and inorganic acids may be used as the free acid
  • hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc. may be used as the inorganic acid
  • methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, and maleic acid may be used as the organic acid.
  • maleic acid succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, citric acid, lactic acid, glycolic acid, gluconic acid (gluconic acid), galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, glucuronic acid, aspartic acid, ascorbic acid, carboxylic acid, vanic acid, hydroiodic acid, and the like can be used. It is not limited.
  • Bases can also be used to make pharmaceutically acceptable metal salts.
  • Alkali metal or alkaline earth metal salts are obtained, for example, by dissolving a compound in an excess of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and then evaporating and drying the filtrate.
  • the metal salt it is particularly suitable to prepare sodium, potassium or calcium salt, but is not limited thereto.
  • Corresponding silver salts may also be obtained by reacting alkali or alkaline earth metal salts with a suitable silver salt (eg, silver nitrate).
  • Pharmaceutically acceptable salts of the compounds of Formula 1 include salts of acidic or basic groups which may be present in compounds of Formula 1 unless otherwise indicated.
  • pharmaceutically acceptable salts may include sodium, calcium and potassium salts of the hydroxy group
  • other pharmaceutically acceptable salts of the amino group include hydrobromide, sulfate, hydrogen sulphate, phosphate, hydrogen phosphate, Dihydrogen phosphate, acetate, succinate, citrate, tartrate, lactate, mandelate, methanesulfonate (mesylate) and p-toluenesulfonate (tosylate) salts, and the like. It can be prepared through.
  • the compound of the present invention may be 3- [3- (1H-indol-3-yl) -acrylamido] -benzamide having the structure of Formula 2 below.
  • Formula 2 is 3- [3- (1H-indol-3-yl) -acrylamido] -benzamide (3- (3-1H-Indol-3-yl) -acrylamido) -benzamide) as an indole derivative.
  • the two compounds, each of which were treated with the trans-3-indoleacrylic acid-based composites were selected to select two compounds having excellent effects of enhancing the differentiation efficiency, and the new trans-3-s having similar chemical structures.
  • a total of 32 indole acrylic acid-based compounds were selected to analyze the effect of enhancing the differentiation-inducing efficiency of human fibroblasts, and the reprogramming stimulating compound (RSC) -133 was selected.
  • trans-3-indoleacrylic acid and 3-amino-benzamide 2 are dissolved in DMF, and then amarbenzotriazol-1-yl-N in the solution.
  • DIPEA N, N-diisopropylethylamine
  • the present invention provides a medium composition comprising a compound of Formula 1, or a pharmaceutically acceptable salt thereof.
  • the compound of Formula 1 may be 3- [3- (1H-indol-3-yl) -acrylamido] -benzamide (RSC-133), or a pharmaceutically acceptable salt thereof.
  • culture media in the present invention refers to a culture medium that can support cell growth and survival in in vitro culture conditions, and includes all conventional media used in the art suitable for the culture of cells. Therefore, the medium composition refers to a substance that is put into the medium for the purpose of culturing the cell or for a special purpose, and is used for culturing the cell by adding a compound of Formula 1, or a pharmaceutically acceptable salt thereof to the medium. Say it can.
  • the medium may be selected from the composition and culture conditions of the medium according to the type of cells.
  • the medium used for the culturing is preferably a cell culture minimum medium (CCMM), and generally includes a carbon source, a nitrogen source and a trace element component.
  • CCMM cell culture minimum medium
  • Such cell culture minimal media include, for example, Dulbecco's Modified Eagle's Medium (DMEM), Minimal Essential Medium (MEM), Basic Medium Eagle (BME), RPMI1640, F-10, F-12, ⁇ -Minimal Essential Medium ), GMEM (Glasgow's Minimal Essential Medium), Iscove's Modified Dulbecco's Medium, etc., but are not necessarily limited thereto.
  • DMEM Dulbecco's Modified Eagle's Medium
  • MEM Minimal Essential Medium
  • BME Basic Medium Eagle
  • RPMI1640 RPMI1640
  • F-10 F-12
  • ⁇ -Minimal Essential Medium ⁇ -Minimal Essential Medium
  • GMEM Gasgow's Minimal Essential Medium
  • Iscove's Modified Dulbecco's Medium etc., but are not necessarily limited thereto.
  • the present invention provides a composition for promoting reverse differentiation into pluripotent stem cells from differentiated cells comprising a compound of formula (1), or a pharmaceutically acceptable salt thereof.
  • the compound of Formula 1 may be 3- [3- (1H-indol-3-yl) -acrylamido] -benzamide (RSC-133), or a pharmaceutically acceptable salt thereof.
  • the term "differentiation” refers to a phenomenon in which cells divide and proliferate, and the structure or function of the cell is specialized while the entire individual is growing. In other words, it refers to a process in which cells, tissues, etc. of an organism are transformed into suitable forms and functions in order to play a role given to each.
  • pluripotent stem cells such as embryonic stem cells are also differentiated into ectoderm, mesoderm, and endoderm cells, and narrowly, hematopoietic stem cells into red blood cells, white blood cells, platelets, and the like.
  • differentiated cell refers to a cell that has undergone the differentiation process and has a certain form and function.
  • the differentiated cells of the present invention are not particularly limited but are preferably somatic cells or progenitor cells. Also preferably cells derived from humans.
  • the term "somatic cells” refers to all cells that have completed differentiation constituting the flora and fauna except germ cells, and has the characteristic that the chromosome maintains 2n.
  • neuroblasts neurovascular stem cells
  • myoblasts progenitor cells for myotubes.
  • pluripotent stem cell in the present invention refers to a pluripotent or totipotent self-renewal capable of differentiating into cells of all tissues of an individual.
  • Stem cells including but not limited to embryonic stem cells and induced pluripotent stem cells.
  • the pluripotent stem cells include all-derived pluripotent stem cells, such as humans, monkeys, pigs, horses, cows, sheep, dogs, cats, mice, rabbits, and the like. Preferably, they are human-derived pluripotent stem cells. .
  • embryonic stem cell refers to an inner cell mass extracted from an blastocyst embryo immediately before implantation of a fertilized egg into the mother's uterus and cultured in vitro, to differentiate into cells of all tissues of the individual. It refers to a cell having a pluripotent or pluripotent or self-renewal capable of being pluripotent, and in a broad sense, an embryoid derived from embryonic stem cells. bodies).
  • Embryonic stem cells of the present invention include embryonic stem cells of all derived from humans, monkeys, pigs, horses, cattle, sheep, dogs, cats, mice, rabbits, etc., preferably human embryonic stem cells.
  • induced pluripotent stem cells refers to cells induced to have pluripotent differentiation ability through artificial dedifferentiation from differentiated cells and is also called induced pluripotent stem cells (iPSC).
  • iPSC induced pluripotent stem cells
  • Artificial dedifferentiation process is performed by the use of virus-mediated or non-viral vectors with retroviruses and lentiviruses, introduction of non-virus-mediated dedifferentiation factors using protein and cell extracts, or by stem cell extracts, compounds, etc. Includes reverse differentiation process.
  • Induced pluripotent stem cells have almost the same characteristics as embryonic stem cells, specifically, have similar cell morphology, similar gene and protein expression patterns, pluripotency in vitro and in vivo, and teratoma.
  • the induced pluripotent stem cells of the present invention include induced pluripotent stem cells derived from all humans, such as humans, monkeys, pigs, horses, cows, sheep, dogs, cats, mice, rabbits, and the like. It is a cell.
  • the term "de-differentiation” refers to a process by which differentiated cells can be restored to a state having the potential to differentiate into a new type.
  • the dedifferentiation is used in the present invention with the same meaning as cell reprogramming.
  • This mechanism of cell differentiation means establishing a different set of epigenetic marks after the epigenetics in the nucleus (the DNA state associated with causing a genetic change in function without a change in nucleotide sequence) are deleted. While multicellular organisms differentiate and grow, different cells and tissues acquire different gene expression programs.
  • the term "promoting dedifferentiation” refers to the process of dedifferentiation occurring rapidly or increasing the efficiency of dedifferentiation during dedifferentiation. That is, to enhance the efficiency of dedifferentiation in terms of speed and ratio.
  • the composition for promoting reverse differentiation of differentiated cells into pluripotent stem cells of the present invention comprises RSC-133 at a concentration that does not harm the survival and function of the cells.
  • RSC-133 at a concentration of greater than 0.01 to less than 50 ⁇ M, more preferably RSC-133 at a concentration of greater than 0.1 to less than 20 ⁇ M.
  • a composition for promoting reverse differentiation of differentiated cells into pluripotent stem cells may further include dedifferentiation inducers.
  • dedifferentiation inducer refers to a substance that induces finally differentiated cells to be differentiated into induced pluripotent stem cells having a new type of differentiation potential.
  • the reverse differentiation inducer may be included without limitation so long as it is a substance that induces reverse differentiation of differentiated cells, and may be selected according to the type of cells to be differentiated.
  • any one or more proteins selected from the group consisting of Oct4, Sox2, KlF4, c-Myc, Nanog and Lin-28 or any one or more nucleic acid molecules encoding these proteins as inducer It may further include, more preferably may comprise Oct4 protein or nucleic acid molecules encoding these proteins, may comprise Oct4, Sox2 and KlF4 protein or nucleic acid molecules encoding these proteins.
  • composition of the present invention is preferably in the form of a culture medium. Therefore, the composition of the present invention may further include a substance generally included in the cell culture medium, so long as the differentiated cells do not interfere with the reverse differentiation into pluripotent stem cells.
  • the reverse differentiation of 32 new trans-3-indoleacic acid-based composites comprising the novel compounds RSC-133 or ID-558, which were effective in inducing the differentiation of mouse skin fibroblasts
  • RSC-133 or ID-558 novel compounds
  • c-Myc the existing dedifferentiation factor
  • RSC-133 the new small molecule compound RSC-133.
  • c-Myc is a cancer-causing gene. It has been known that re-expression of c-Myc virus gene is involved in cancer-causing in differentiation stem cell lines formed after induction of differentiation. Therefore, research on the induction of dedifferentiation except c-Myc is receiving attention.
  • RSC-133 alone in the present invention does not show a replacement effect, but when added with sodium butylate (NaB) can be substituted for c-Myc factor, it was confirmed that the efficiency of reverse differentiation induction compared to the control (Fig. 5) .
  • NaB sodium butylate
  • novel low molecular weight compound RSC-133 has been identified as an effective factor for effectively enhancing the differentiation efficiency of mouse and human cells.
  • the retrodifferentiation efficiency with each concentration showed positive reaction in Alkaline phosphatase (AP) staining, which is a hESC-specific factor, and was calculated by measuring the number of colonies with hESC-like morphology.
  • Experimental results RSC-133 was able to increase the reverse differentiation efficiency depending on the concentration up to 10 ⁇ M (Fig. 8). It was confirmed that the reverse differentiation efficiency was not further increased in parallel with the condition of increasing the RSC-133 addition concentration to 20 ⁇ M (FIG. 8). In addition, it was verified that the treatment of RSC-133 to human skin fibroblasts up to 50 ⁇ M did not induce cytotoxicity (FIG. 9).
  • RSC-133 was equally treated for 5 days: 1 (5 days after virus infection, FIG. 10; condition 4), 2 (up to -10 days after 5 days of virus infection, FIG. 10; condition 7), 3 (virus infection 10 days after -15 days, FIG. 10; condition 8), 4 steps (up to -20 days after 15 days of virus infection, FIG. 10; condition 9), the first 5 days immediately after the first stage virus infection
  • FIG. 10 it was confirmed that the most effective enhancement of reverse differentiation efficiency (FIG. 10).
  • RSC-133 was applied in the same manner for 10 days: 1 (10 days after virus infection, FIG. 10; condition 3), 2 (up to -15 days after 5 days of virus infection, FIG.
  • step 3 virus infection 10 days after -20 days, when divided into 10, condition 10
  • human embryonic stem cells are transferred to a new culture dish after 5 days in culture (differentiated cell culture medium) for 10 days in the first half from immediately after the first stage virus infection
  • FIG. 10; condition 3 it was confirmed that the most effective enhancement of reverse differentiation efficiency (FIG. 10).
  • RSC-133 was treated in the same 15 days divided into 1 (15 days after virus infection, Figure 10; condition 2), 2 steps (up to -20 days after 5 days of virus infection, Figure 10; condition 5) It was confirmed that the reverse differentiation efficiency was similarly enhanced in both conditions (FIG. 10).
  • the present invention it was confirmed by measuring the total number of cells by the time of the cell number of the new compound RSC-133 has the effect of promoting the growth and proliferation of cells in the process of reverse differentiation induction culture (Fig. 11 ). Compared to the control group that did not transduce OSKM, the increase in cell number was significantly slowed under the conditions in which OSKM was transduced. When the new compound RSC-133 was treated under the same conditions, the slowing of cell growth was relatively improved. (FIG. 12). In addition, cell proliferation mutations during reverse differentiation-induced cultures were confirmed by BrdU assay, and similarly to the above results, the treatment of novel compound RSC-133 significantly improved the cell growth time-dependently. 13-15.
  • the expression pattern of hESC-specific factors according to time zones to confirm whether the novel compound RSC-133 can promote kinetics in the reverse differentiation-induced culture process to shorten the time required for inducing differentiation. was verified.
  • the expression of hESC-specific factors (Nanog, Tra1-81, Oct4, Rex1) was not treated in the control group when induced differentiation under the condition of treatment with the novel compound RSC-133.
  • the new compound RSC-133 promotes reverse differentiation-induced kinetics to effectively shorten the time required for induction of reverse differentiation. It was confirmed that it can be made.
  • the novel compound RSC-133 plays an important role in inducing aging in order to confirm whether the sensitized state induced by OSKM transduction, which is known as an obstacle in the induction of reverse differentiation, can be improved.
  • Expression variation of the known signaling factors p53, p21, p16 (Fig. 16) and SA- ⁇ -Gal assay (Fig. 17) were measured. As shown in FIG. 16, it was confirmed that p53, p21, and p16, which are aging factors, were effectively inhibited in the culture conditions in which the novel compound RSC-133 was treated, and when SAC-133 was treated as shown in FIG. It was confirmed that - ⁇ -Gal positive cells are significantly reduced. As a result, it was confirmed that the inhibition of aging factor by RSC-133 contributes to improving the condition for inducing differentiation.
  • H3K9 an epigenetic activation state associated with a pluripotent state of stem cells
  • RSC-133 an epigenetic activation state associated with a pluripotent state of stem cells
  • FIG. 18 the immunostaining Western blot method confirmed that H3K9 acetylation was enhanced in the culture conditions treated with the new compound RSC-133, indicating that RSC-133 induces epigenetic activation in the process of inducing differentiation. Confirmed.
  • the enzyme activity measurement and Western blot method showed that the above-described H3K9 acetylation enhancement is related to HDAC (in particular, HDAC1) inhibition (FIG.
  • pluripotent stem cells prepared under the conditions treated with the novel compound RSC-133 maintain hESC-like morphology during continuous culture and express hESC-specific factors at levels similar to hESC.
  • hESC-specific promoters Oct4, Nanog
  • OSKM transgenes
  • the present invention provides a method for treating a cell comprising: differentiated cells; The reverse differentiation promoting composition; And reverse differentiation inducer, wherein the differentiated cells provide an in vitro cell culture that is differentiated into pluripotent stem cells.
  • the compound of Formula 1 includes all cell cultures in vitro obtained by treating the differentiated cells comprising the compound of Formula 1 with the composition for promoting reverse differentiation and the reverse differentiation inducer.
  • the compound of Formula 1 may be 3- [3- (1H-indol-3-yl) -acrylamido] -benzamide (RSC-133), or a pharmaceutically acceptable salt thereof.
  • Differentiated cells and pluripotent stem cells of the present invention are as described above.
  • the reverse differentiation may be characterized in that the function of HDAC1 is inhibited and H3K9ace level is increased as compared to the control which is not treated with the composition.
  • the present invention provides a method for producing a cell comprising: (a) delivering a retrodifferentiation inducer to differentiated cells; And (b) culturing the differentiated cells in a medium containing the composition for promoting reverse differentiation, thereby providing a method for producing dedifferentiated pluripotent stem cells from differentiated cells.
  • the method for delivering the reverse differentiation inducer of step (a) to the differentiated cells may be any method that provides nucleic acid molecules or proteins to cells commonly used in the art, but is preferably a reverse differentiation inducer. Is injected into a culture of differentiated cells, a method of injecting a reverse differentiation inducer directly into a differentiated cell or differentiated into a virus obtained from a packaging cell transfected with a viral vector into which a gene of a reverse differentiation inducer is inserted. The method can be used to infect cells.
  • the method of directly injecting the dedifferentiation inducer into the differentiated cells may be used by selecting any method known in the art, but is not limited thereto, and may include, but is not limited to, microinjection, electroporation, and particles. It may be appropriately selected and applied from a method using a particle bombardment, a direct muscle injection method, an insulator and a transposon.
  • the reverse differentiation inducer of the present invention is as described above.
  • the packaging cells may be used by selecting a variety of cells known in the art according to the viral vector used, but is not limited thereto, preferably GP2-293 packaging cells can be used.
  • the viral vectors may be retroviruses, for example, human immunodeficiency virus (HIV), Murine leukemia virus (MLV), Avian sarcoma / leukosis (ASLV), Spleen necrosis virus (SNV), and Rous sarcoma virus (RSV).
  • retroviruses for example, human immunodeficiency virus (HIV), Murine leukemia virus (MLV), Avian sarcoma / leukosis (ASLV), Spleen necrosis virus (SNV), and Rous sarcoma virus (RSV).
  • MMTV mouse mammary tumor virus
  • the present invention is not limited thereto, and preferably, a retroviral vector may be used, and more preferably, a retroviral vector pMXs
  • Steps (a) and (b) may be performed simultaneously, sequentially or in reverse order.
  • the method may further comprise the step of separating embryonic stem cell-like colonies from the culture obtained from step (b).
  • the present invention provides a composition for maintaining and culturing undifferentiated state of pluripotent stem cells comprising a compound of formula (1), or a pharmaceutically acceptable salt thereof.
  • the present invention may include a function of maintaining pluripotent stem cells in an undifferentiated state by using a composition comprising a compound of Formula 1, or a pharmaceutically acceptable salt thereof.
  • H9 human embryonic stem cells which are representative human pluripotent stem cells, are cultured using unconditioned medium (UM), which is a culture condition that is easy to induce differentiation, and treatment of a novel compound RSC-133.
  • UM unconditioned medium
  • RSC-133 a culture condition that is easy to induce differentiation
  • FIG. 29 it was examined whether the induction of differentiation was suppressed and the undifferentiated state could be maintained. As shown in FIG. 29, it was confirmed that differentiation induction was suppressed in the culture conditions treated with the new compound RSC-133, and the undifferentiated state was improved to the level cultured in a conditioned medium (CM).
  • CM conditioned medium
  • the expression of hESC-specific factor is maintained at the level cultured in the CM (FIG.
  • RSC-133 has been shown to be effective in improving and enhancing the maintenance of undifferentiated state of human pluripotent stem cells.
  • the compound of Formula 1 or a pharmaceutically acceptable salt thereof may be included in an amount sufficient to maintain pluripotent stem cells in an undifferentiated state.
  • the medium composition preferably contains RSC-133 at a concentration of greater than 0.01 to less than 50 ⁇ M, more preferably RSC-133 at a concentration of greater than 0.1 to less than 20 ⁇ M for culturing undifferentiated pluripotent stem cells. do. Most preferably RSC-133 at a concentration of greater than 5 and up to 15 ⁇ M.
  • the medium composition may further include one or more selected from the group consisting of N2 supplement, B27 supplement, bFGF and TGF, wherein the N2 supplement and B27 supplement It may be provided in a ratio of 1: 1, the bFGF may be provided at a concentration of 4-100 ng / ml, and the TGF may be provided at a concentration of 1-10 ng / ml.
  • the medium composition may further include one or more of the known composition of the chemically defined medium, it is possible to improve the composition and efficacy of the chemically defined medium by adding RSC-133.
  • the present invention comprises the steps of obtaining an embryonic stem cell; And it provides a method for establishing an embryonic stem cell line that can be maintained in an undifferentiated state comprising the step of culturing the embryonic stem cells under the culture conditions comprising the medium composition to obtain an embryonic stem cell line.
  • the embryonic stem cells include embryonic stem cells of all derived from humans, monkeys, pigs, horses, cattle, sheep, dogs, cats, mice, rabbits, etc., preferably human embryonic stem cells.
  • the present invention provides a method for culturing pluripotent stem cells while maintaining an undifferentiated state comprising culturing the pluripotent stem cells on the composition of the pluripotent stem cells for maintaining and maintaining the undifferentiated state. do.
  • the method may maintain embryonic stem cells in an undifferentiated state with or without animal serum and feeder cells.
  • the embryonic stem cells include embryonic stem cells of all derived from humans, monkeys, pigs, horses, cattle, sheep, dogs, cats, mice, rabbits, etc., preferably human embryonic stem cells.
  • the present invention is a pluripotent stem cell; And an in vitro cell culture comprising the media composition such that the pluripotent stem cells remain undifferentiated through a plurality of serial passages.
  • the present invention includes all cell cultures in vitro obtained by treating the pluripotent stem cells with the composition of the pluripotent stem cells for maintenance and culture of undifferentiated state comprising RSC-133. This includes various cells in the culturing process and various proteins, enzymes and transcripts obtained in the process of culturing them, and even a culture solution containing the same.
  • Pluripotent stem cells of the present invention are as described above.
  • the efficiency of reverse differentiation can be enhanced as well as the induction of reverse differentiation. Can significantly reduce the time it takes. In particular, it was confirmed that it is possible to replace c-Myc, a factor for inducing differentiation and a risk factor for cancer, and confirmed that the efficiency of induction of differentiation can be effectively enhanced even under normal oxygen culture conditions and low oxygen culture conditions.
  • RSC-133 has the effect of inhibiting the aging induction during the induction of reverse differentiation and slowing down the cell proliferation, and improved the induction of reverse differentiation culture by inducing epigenetic activation.
  • the present invention contributes to optimizing the manufacturing process of induced pluripotent stem cells from a small amount of patient-specific somatic cells obtained from various sources, thereby drastically improving and commercializing the development of clinically applicable personalized stem cell therapeutics and drug development. It will contribute to speeding up the time.
  • the novel low molecular weight compound RSC-133 can be an effective culture medium composition for maintaining the undifferentiated state of human embryonic stem cells, which are representative pluripotent stem cells.
  • the media composition to which RSC-133 is added can effectively induce undifferentiated proliferation of human embryonic stem cells and is expected to be useful for developing a large culture system of embryonic stem cells.
  • Figure 1 shows the process of discovering the reverse differentiation regulator of mouse cells using the analog library screening of a novel synthetic trans-3-indoleacrylic acid-based composite.
  • Mouse embryonic fibroblasts (OG2-MEF: hemizygous for the Oct4-GFP transgene) were transfected with Oct4, Sox2, Klf4, and c-Myc antidifferentiation factor viruses to identify low molecular weight compounds that promote the production of stem cells. Switched After 5 days, the cells were divided into gelatin-coated plates and cultured with mouse embryonic stem cell culture medium containing the respective low molecular weight compounds until colonies having a shape similar to that of mouse stem cells were formed.
  • OGFP hemizygous for the Oct4-GFP transgene
  • A is a diagram showing an experimental process of inducing differentiation in mouse embryonic fibroblasts. Oct4 (O), Sox2 (S), Klf4 (K), and cMyc (M).
  • Figure 2a is a comparative analysis of the effect of improving the reverse differentiation efficiency by the novel low molecular weight compound 133.
  • DNA methyltransferase inhibitors (5-Azacytidine; AZA), G9a histone methyltransferase inhibitors (BIX-01294), histone deacetylase inhibitors (Valproic acid; VPA), and new low molecular weight compounds reported to promote stem cell production
  • the reverse differentiation enhancing effect of 133 was compared by measuring the number of colonies expressing endogenous Oct4 GFP fluorescence.
  • Figure 2b is a comparative analysis of the effect of increasing the reverse differentiation efficiency by the novel low molecular weight compound 133.
  • AZA 0.5 ⁇ M
  • VPA 1 mM
  • TSA (20 nM)
  • SB431542 10 ⁇ M
  • RSC 133 10 ⁇ M
  • Values on the graph represent mean values.
  • FIG. 3 shows the results of discovering the retrodifferentiation regulator of human skin fibroblasts (hFF) using analog library screening of a trans-3-indoleacrylic acid-based compound, a novel compound.
  • Figure 4 shows that the new low molecular weight compound 133 in human skin fibroblasts shows the effect of improving the reverse differentiation efficiency in the normal condition (21% O 2 ) as well as the hypoxic condition (5% O 2 ) compared to the control.
  • Previous reports show that dedifferentiation efficiency increases under low oxygen conditions.
  • 133 may add synergistic effects to the dedifferentiation process promoted by these hypoxic conditions.
  • A is a graph measuring AP activity.
  • B is a reverse differentiated stem cell colony formed when 133 was added under hypoxic conditions.
  • FIG. 5 shows the results of investigating the replacement effect on the existing retrodifferentiation factor (c-Myc) upon induction of retrodifferentiation of dedifferentiated stem cells from human dermal fibroblasts by the addition of new low molecular weight compound 133.
  • RSC-133 alone did not show a replacement effect, but when added with sodium butylate (NaB), the c-Myc factor was substituted to enhance the induction of reverse differentiation compared to the control group.
  • NaB sodium butylate
  • the number of AP-positive colonies was measured and the graph shows the efficiency of inducing differentiation. Values on the graph represent mean values.
  • the panel above shows a schematic of the experimental process.
  • the left panel is a schematic of the experimental process.
  • FIG. 13 illustrates the results of RSC-133 increasing the proliferating cell population during dedifferentiation.
  • FIG. 14 shows the results of RSC-133 increasing proliferating cell population in human skin fibroblasts infected with OSKM virus.
  • FIG. 18 is a diagram illustrating the effect of RSC-133 on histone acetylation (H3K9ace) during reverse differentiation.
  • the right panel shows the measurement of H3K9ace level by western blot. H3 protein was identified as an internal control.
  • RSC-133 can inhibit histone deacetylase (HDAC) during the reverse differentiation of human dermal fibroblasts.
  • HDAC histone deacetylase
  • the left panel shows the results of measuring total HDAC enzyme activity during reverse differentiation with or without RSC-133.
  • the graph 20 shows whether RSC-133 affects the activity of DNA Methyl Transferase 1 (DNMT1) during the reverse differentiation of human dermal fibroblasts.
  • the graph shows the activity of DNMT1 measured after incubation for 10 days with or without RSC-133 in human skin fibroblasts into which OSKM was introduced. When not treated, the activity of DNMT1 was compared at 100%.
  • DNMT1 DNA Methyl Transferase 1
  • FIG. 21 shows changes in the amount of HDAC family proteins during the reverse differentiation of human dermal fibroblasts with or without RSC-133.
  • the panel above shows a schematic of the experimental process.
  • the lower panel shows the results of Western blot analysis of HDAC family protein changes.
  • GAPDH protein was identified as an internal control.
  • Figure 22 is a diagram analyzing the human embryonic stem cell marker expression characteristics of dedifferentiated stem cell line (RSC133-iPS) derived from human skin fibroblasts by RSC-133 addition by immunostaining method.
  • RSC133-iPS dedifferentiated stem cell line
  • FIG. 23 shows the results of RT-PCR analysis of stem cell marker genes and dedifferentiation factor expression of dedifferentiated stem cell lines (RSC133-iPS) derived from human dermal fibroblasts by RSC-133 addition.
  • Semi-quantitative RT-PCR was performed using transplanted gene-specific PCR primers capable of determining the relative expression between Total, Endo and Retrovirus Expression (Trans) genes.
  • FIG. 24 Oct4 and Nanog transcription factor promoter methylation in dedifferentiated stem cell lines (RSC133-iPS), H9 human embryonic stem cells (hES) and human skin somatic cells (hFF) induced from human skin fibroblasts by RSC-133 addition.
  • RSC133-iPS dedifferentiated stem cell lines
  • hES H9 human embryonic stem cells
  • hFF human skin somatic cells
  • Figure 25 shows the results of analysis of the gene insertion in the genome of the dedifferentiated stem cell line (RSC133-iPS) derived from human skin fibroblasts by RSC-133 addition.
  • RSC133-iPS dedifferentiated stem cell line
  • Fig. 26 shows the results of dedifferentiated stem cell line (RSC133-iPS) induced from human dermal fibroblasts by RSC-133 addition to preserve normal karyotype (46, XY).
  • RSC133-iPS dedifferentiated stem cell line
  • FIG. 27 is an immunocytochemical photograph showing that the germ cell differentiation capacity is preserved through the formation of an embryoid body of dedifferentiated stem cell line (RSC133-iPS) derived from human skin fibroblasts by RSC-133 addition.
  • FIG. 28 is a photograph showing teratoma formation for demonstrating in vivo differentiation ability of dedifferentiated stem cell line (RSC133-iPS) induced from human skin fibroblasts by RSC-133 addition.
  • RSC133-iPS dedifferentiated stem cell line
  • Figure 30 shows the analysis of immunohistochemistry for expression of undifferentiated markers (Oct4 and Tra1-81) of H9 human embryonic stem cells by RSC-133 addition.
  • H9 human embryonic stem cells were cultured in UM and RSC-133 or VPA was added.
  • CM was observed as a positive control.
  • FIG. 31 shows Western blots of changes in the amount of undifferentiated markers (Oct4) or H3K9ace protein of H9 human embryonic stem cells with or without RSC-133 treatment.
  • FIG. Human skin fibroblasts (hFF) were identified as negative controls.
  • H3 and GAPDH proteins were identified as internal controls.
  • the process for preparing the amide 2c-e of this reaction is as follows. 4-benzyloxy-3-nitrobenzoic acid 1-3, 500 mg, 1.0 equiv was suspended in acetonitrile and Et 3 N (4.0 equiv), and thus 50% PPAA (1.2 equiv). ) was added, stirred at room temperature for 30 minutes, and the appropriate amine was added. The reaction solution was stirred overnight and then evaporated to dryness. The results were purified via column chromatography to give compound 2c-e.
  • the process for preparing the compounds 3a to 3e by reducing the compounds 2a to 2e is as follows. Compounds 2a to 2e were dissolved in anhydrous MeOH, and then 5% palladium carbon was added under argon conditions. The reaction solution was stirred overnight under hydrogen conditions, filtered through a pad of celite, and concentrated without further purification to obtain a crude product.
  • the process for preparing the amides 5a and 5b of the present reaction is as follows. Suspend 3-nitrobenzoic acid (400 mg, 1.0 equiv) in acetonitrile and Et 3 N (4.0 equiv), add 50% PPAA (1.2 equiv), stir for 30 minutes at room temperature, and Amine was added. The reaction solution is stirred overnight and then evaporated to dryness. The results were purified via column chromatography to give compound 5a-b.
  • methyl 3-aminobenzoate (6a) and 3-aminobenzamide (6b) are commercially available products.
  • the process of preparing 6c or 6d by reducing compound 5a or 5b is as follows. Nitrogen substituted compounds 5a or 5b were dissolved in anhydrous MeOH, and then 5% palladium carbon was added under argon conditions. The reaction solution was stirred overnight under hydrogen conditions, filtered through a pad of celite, and concentrated without further purification to obtain a crude product.
  • the prepared compound 3a to compound 3e or compound 6a to compound 6d may be trans-3-Indole acrylic acid (7a) or 3- (1H-indol-3-yl) -propionic acid (3- ( 1H-Indole-3-yl) -propionic acid, 7b) was prepared to prepare compounds 8a to 8j, compound 9, and compounds 10a to 10d of the above scheme. Specific manufacturing method will be described in detail below.
  • RSC-133 (3- [3- (1H-indol-3-yl) -acrylamido] -benzamide, 8b) in the low molecular weight compound was synthesized as follows.
  • trans-3-indoleacrylic acid (7a) and 3-amino-benzamide (6b) are dissolved in DMF, and then, in the solution, amarbenzotriazol-1-yl-N-oxy-tris (pyrrolidino)- Phosphonium hexafluorophosphate (PyBOP, Benzotriazol-1-yl-N-oxy-tris (pyrrolidino) -phosphonium hexafluorophosphate) and N, N-diaisopropylethylamine (DIPEA, N, N-diisopropylethylamine) I had the condition.
  • the reaction solution was stirred at room temperature overnight to react.
  • RSC-133 (3- [3- (1H-indol-3-yl) -acrylamido] -benzamide) synthesized by the present example has a structure of Formula 2 below.
  • ID-52 (3- (3-1H-indol-3-yl-acryloylamino) -benzoic acid methyl ester, 8a) in the low molecular weight compound was trans-3-indoleacrylic acid (7a, 150 mg, 0.8 mmol) And 3-amino-benzoic acid methyl ester (6a, 218 mg, 1.44 mmol) in DMF, followed by 1- [3- (dimethylamino) propyl] -3-ethylcarbodiimide hydrochloride (EDC, 1- [3 -(dimethyamino) propyl] -3-ethylcarbodiimide hydrochloride, 230 mg, 1.2 mmol), hydroxy-7-azabenotriazole (HOAT, Hydroxy-7-azabenotriazole, 163 mg, 1.2 mmol), and N, N-dia Sodium propylethylamine (DIPEA, N, N-diisopropy
  • ID-1027 (3- [3- (1H-indol-3-yl) -acrylamido] -N-methylbenzamide, 8c) was trans-3-indoleacrylic acid (7a, 300 mg, 1.6 mmol) and 3-amino-N-methylbenzamide (6c, 240 mg, 1.6 mmol) were dissolved in DMF and then PyBOP (1.7 g, 3.2 mmol), and DIPEA (0.84 mL, 4.8 mmol) were added. The reaction was stirred overnight at room temperature and separated into EA and brine. The organic phase fractions were dried over MgSO 4 and concentrated.
  • ID-1028 (3- [3- (1H-indol-3-yl) -acrylamido] -N, N-dimethylbenzamide, 8d) was used as trans-3-indoleacrylic acid (7a, 300). mg, 1.6 mmol) and 3-amino-N, N-dimethylbenzamide (6d, 262.7 mg, 1.6 mmol) in DMF, followed by PyBOP (1.7 g, 3.2 mmol), and DIPEA (0.84 mL, 4.8 mmol) was added. The reaction was stirred overnight at room temperature and separated into EA and brine. The organic phase fractions were dried over MgSO 4 and concentrated.
  • ID-134 (3- [3-1H-indol-3-yl-propionylamino] benzamide, 8e) in the low molecular weight compound was 3- (1H-indol-3-yl) -propionic acid (7b, 189 mg , 1.0 mmol) and 3-amino-benzamide (6b, 68.1 mg, 0.5 mmol) were dissolved in DMF, and PyBOP and DIPEA were added to the solution to provide binding conditions. The reaction solution was stirred at room temperature overnight to react.
  • the low molecular weight compound ID-514 (isopropyl 3- [3- (1H-indol-3-yl) -acrylamido] -4-hydroxybenzoate, 8f) was trans-3-indoleacrylic acid (7a, 188 mg, 1.01 mmol), and isopropyl 3-amino-4-hydroxybenzoate (3a, 295 mg, 1.51 mmol) in DMF, followed by EDC (290 mg, 1.51 mmol). ) And 1-hydroxybenzotriazole hydrate (1-hydroxybenzotriazole hydrate, HOBt, 204 mg, 1.51 mmol) were added. The reaction was stirred at room temperature overnight to react.
  • the low molecular weight compound ID-1029 (3- [3- (1H-indol-3-yl) -acrylamido] -4-hydroxybenzamide, 8 g) was trans-3-indoleacrylic acid (7a, 300 mg, 1.6 mmol), and 3-amino-4-hydroxybenzamide (3-amino-4-hydroxybenzamide, 3b, 243 mg, 1.6 mmol) in DMF, followed by PyBOP (1.7 g, 3.2 mmol) and DIPEA (0.84 mL, 4.8 mmol) was added. The reaction was stirred at room temperature overnight to react.
  • the low molecular weight compound ID-557 (3- [3- (1H-indol-3-yl) -acrylamido] -4-hydroxy-N-methylbenzamide, 8h) was trans-3-indole dissolved in THF.
  • 3-amino-4-hydroxy-N-methylbenzamide (3c, 106 mg, 0.64 mmol) was added while stirring the mixture at room temperature for 30 minutes. The reaction was stirred overnight.
  • the low molecular weight compound ID-556 (3- [3- (1H-indol-3-yl) -acrylamido] -4-hydroxy-N-isopropylbenzamide, 8i) was dissolved in THF trans-3- To a solution of indole acrylic acid (7a, 100 mg, 0.53 mmol) was added DCC (220 mg, 1.07 mmol), and DIPEA (0.2 mL, 1.07 mmol). 3-amino-4-hydroxy-N-isopropylbenzamide (3d, 124 mg, 0.64 mmol) was added with stirring the mixture at room temperature for 30 minutes. The reaction was stirred overnight.
  • the low molecular weight compound ID-558 (3- [3- (1H-indol-3-yl) -acrylamido] -4-hydroxy-N, N-dimethylbenzamide, 8j) was dissolved in THF trans-3 To the solution of indole acrylic acid (7a, 100 mg, 0.53 mmol) was added DCC (220 mg, 1.07 mmol), and DIPEA (0.2 mL, 1.07 mmol). 3-amino-4-hydroxy-N, N-dimethylbenzamide (3e, 116 mg, 0.64 mmol) was added while stirring the mixture at room temperature for 30 minutes. It was. The reaction was stirred overnight.
  • the low molecular weight compound ID-116 (3- [3- (1H-indol-3-yl) -acrylamido] benzoic acid) is 3- [3- (1H-indol-3-yl) -acrylamido]- Benzoate (8a, 188 mg, 0.59 mmol) was dissolved in THF / H 2 O (1: 1, 10 mL) and LiOH.H 2 O (49.3 mg, 1.17 mmol) was added at room temperature. The reaction solution was stirred at room temperature overnight for reaction, acidified with hydrochloric acid and extracted with ethyl acetate (EA).
  • EA ethyl acetate
  • the low molecular weight compound ID-263 (3- [3- (1H-indol-3-yl) -acrylamido] -N- (furan-2-yl-methyl) benzamide) is 3- (3-1H- Indol-3-yl-acryloylamino) -benzoic acid (9, 500 mg, 1.63 mmol) and furfurylamine (0.23 mL, 2.45 mmol) were dissolved in DMF, thereby DIPEA (0.43 mL, 2.45 mmol) and HATU (O- (7-azabenzotriazol-1-yl) -N, N, N'N'-tetramethyluronium hexafluorophosphate, 931.6 mg, 2.45 mmol) was added, and the reaction solution was stirred at room temperature overnight to react.
  • the low molecular weight compound ID-264 (3- (3-1H-indol-3-yl-acryloylamino) -N- (2-piperidin-1-yl-ethyl) -benzamide) is 3- ( 3-1H-indol-3-yl-acryloylamino) -benzoic acid (9, 150 mg, 0.49 mmol) and 2-piperidin-1-yl-ethylamine (0.10 mL, 0.73 mmol) were dissolved in DMF. Then HATU (277.6 mg, 0.73 mmol) and DIPEA (0.13 mL, 0.73 mmol) were added. The reaction solution was stirred at room temperature overnight to react.
  • the low molecular weight compound ID-265 (3- (3-1H-indol-3-yl-acryloylamino) -N- (3-morpholin-4-yl-propyl) -benzamide) is 3- (3 -1H-indol-3-yl-acryloylamino) -benzoic acid (9, 150 mg, 0.49 mmol) and 3-morpholin-4-yl-propylamine (0.11 mL, 0.73 mmol) were dissolved in DMF, HATU (277.6 mg, 0.73 mmol), and DIPEA (0.13 mL, 0.73 mmol) were added. The reaction solution was stirred at room temperature overnight to react.
  • the low molecular weight compound ID-517 isopropyl 3- [3- (1H-indol-3-yl) acrylamido] benzoate
  • DIPEA 152 mg, 1.18 mmol
  • hESC Human embryonic stem cells
  • hiPSCs retrodifferentiated stem cells
  • DMEM fetal calf serum
  • NEAA non-essential amino acids
  • NEAA non-essential amino acids
  • Invitrogen 1 mM L-glutamine
  • 0.1 mM ⁇ -mer It was generally incubated with hESC culture medium consisting of captoethanol ( ⁇ -mercaptoethanol, Sigma, St.
  • bFGF basic fibroblast growth factor, Invitrogen
  • Cells were passaged every 5-6 days with 1 mg / ml collagenase IV (Invitrogen).
  • Human newborn foreskin fibroblasts hFF, ATCC, catalog number CRL-2097; American Type Culture Collection, Manassas, VA
  • FBS fetal bovine serum, Invitrogen
  • non-essential amino acids 1 mM Incubated in DMEM containing L-glutamine and 0.1 mM ⁇ -mercapto ethanol.
  • PMXs vectors comprising human cDNAs of OCT4 (POU5F1), SOX2, c-MYC (MYC) and KlF4 as disclosed in the paper, Takahashi, K. et al. (Cell 131, 2007, 861-872) from Addgene Purchased.
  • Package cell line GP2-293 cells were CalPhos transfected with retroviral vector DNA and VSV-G envelope vector. Twenty four hours after transfection, the supernatant containing the first virus was recovered and then the medium was exchanged, and after 48 hours the supernatant containing the second virus was recovered.
  • hFFs human skin fibroblasts
  • MEFs mouse embryonic fibroblasts
  • MEF-CM was prepared as ⁇ -irradiated MEF as known (Xu C. Nat Biotechnol 19, 971-974), and MEF-CM added 8 ng / ml bFGF. The medium was changed once every two days. Twenty days after transfection, hESC type colonies were obtained and transferred to a 12-well plate containing MEFs as feeder cells, followed by continuous propagation culture using the hESC culture method of Example 2.
  • OSKM reversedifferentiation virus was generated following the method of Example 3. Gelatin-coated one day prior to transduction of human dermal fibroblasts (hFFs) and mouse embryonic fibroblasts (OG2-MEF: hemizygous for the Oct4-GFP transgene) to screen for low molecular weight compounds that promote reverse differentiation efficiency
  • hFFs human dermal fibroblasts
  • OGF mouse embryonic fibroblasts
  • Six-well plates were inoculated at a concentration of 1 ⁇ 10 5 cells per well and infected with the virus in the presence of polybrene (8 ⁇ g / ml). Five days after transduction, hFFs cells or MEFs cells were harvested by trypsin and 3.5 ⁇ per well in a Matrigel or gelatin coated 12-well plate for experiments in feeder-free conditions.
  • Re-inoculated at a concentration of 10 4 cells Low molecular weight compounds, trans-3-indoleacrylic acid based composites prepared after exchange with MEF-CM or mouse embryonic stem cell cultures with bFGF at a concentration of 10 ng / ml, were added at various concentrations. Cultures containing each low molecular weight compound were exchanged every other day. 15 days after transfection, the number of colonies expressing AP activity or the number of colonies expressing endogenous Oct4 GFP fluorescence was measured to determine reverse differentiation efficiency.
  • ALP staining was performed using a commercially available ALP kit according to the manufacturer's (Sigma) instructions. Images of ALP-positive cells were recorded with the HP Scanjet G4010. In addition, bright field images were obtained by an Olympus microscope (IX51, Olympus, Japan).
  • hEBs human embryos
  • DMEM / containing HEB medium with suspension (10% serum replacement) Incubated in F12). After 5 days of growth in suspension, embryos were transferred to gelatin-coated plates and cultured in hEB medium. Under the above conditions, the cells attached to the bottom of the plate were left to differentiate for an additional 15 days while changing the medium as needed.
  • the DNA modification process using sodium hydrogen sulfite was carried out using a commercialized kit EZ DNA Methylation Kit (Zymo Research).
  • EZ DNA Methylation Kit Zymo Research
  • methylated cytosine does not change, whereas unmethylated cytosine is converted to uracil. do. Therefore, when amplified by PCR using primers specific for cytosine and uracil sequences, methylated DNA and non-methylated DNA can be distinguished.
  • the primers used are shown in Table 1 below.
  • PCR reaction mixture was prepared with bisulfite-treated DNA, dNTP 0.25 mM / l, MgCl2 1.5 mM / l, primer 50 pM, 1 ⁇ PCR buffer, Taq polymerase (Platinum Taq DNA polymerase, Invitrogen, Carlsbad, CA, USA) As 2.5 units, to a final 20 ⁇ l.
  • PCR reaction conditions were performed for 10 minutes at 95 °C, 40 cycles of 95 °C 1 minute, 60 °C 1 minutes, 72 °C 1 minutes, and finally reacted at 72 °C 10 minutes.
  • PCR reaction products were identified on a 1.5% agarose gel and cloned into pCR2.1-TOPO vector (Invitrogen) after gel elution. Methylated and non-methylated sequences were analyzed by sequencing using M13 primer pairs.
  • the indole ring without amino group showed the highest reprogramming efficiency of the indole-acrylic acid analog compounds RSC-133 and ID-558, which are linked to the benzoic acid analogs in a double bond.
  • RSC-133 contains simple benzamide and ID-558 contains 4-hydroxy-N, N-dimethylbenzamide.
  • the novel low molecular weight compound 133 showed an effect of improving the reverse differentiation efficiency in human skin fibroblasts compared to the control under normal conditions (21% O 2 ) as well as low oxygen conditions (5% O 2 ) (FIG. 4).
  • low oxygen conditions 5% O 2
  • the efficiency of retrodifferentiation increases 133 can add synergistic effects to the dedifferentiation process promoted by these low oxygen conditions (5% O 2 ) (FIG. 4A) and intact Differentiated stem cell colonies could be formed (FIG. 4B).
  • c-Myc dedifferentiation factor
  • c-Myc is an oncogene
  • the re-expression of the c-Myc virus gene in the pluripotent stem cell lines formed after induction of pluripotency is known to be involved in the induction of cancer. Therefore, research on the induction of dedifferentiation except c-Myc is receiving attention.
  • RSC-133 alone did not show a replacement effect, but when added with sodium butylate (NaB), the c-Myc factor was substituted to enhance the efficiency of reverse differentiation compared to the control group (FIG. 5).
  • NaB sodium butylate
  • Retrodifferentiation efficiency was determined by calculating the number of colonies representing AP activity.
  • RSC-133 was treated for the same period (5, 10, 15 days)
  • RSC-133 was treated continuously during the whole process of dedifferentiation depending on the treatment time, the effect of enhancing dedifferentiation efficiency was greatest (FIG. 10, condition 1).
  • RSC-133 is involved in the early stage of retrodifferentiation, continuous treatment most enhances the efficiency of retrodifferentiation. Therefore, RSC-133 is not only induced in the process of dedifferentiation but also in maintenance of the resulting retrodifferentiated stem cells. .
  • RSC-133 not only increases the efficiency of dedifferentiation but also can be involved in the process of dedifferentiation and promote kinetics.
  • Example 16 Functional analysis of RSC- 133 involved in histone protein acetylation during reverse differentiation
  • HDAC histone deacetylase
  • TSA histone acetylase
  • SAHA histone deacetylase
  • HDAC1 can occupy Oct4, Sox2, Klf4, and c-Myc gene loci in embryonic stem cells, and has been reported to increase expression of undifferentiated marker genes in HDAC1 deficient embryonic stem cells. Therefore, RSC-133 is thought to accelerate the dedifferentiation process by inhibiting HDAC1 function and increasing H3K9ace level.
  • RSC133 regulates the activity of epigenetic regulators such as DNA methyltransferase (DNMT) and histone deacetylase (HDAC).
  • DNMT DNA methyltransferase
  • HDAC histone deacetylase
  • RSC133-iPS Stem cell characteristics of RSC133-iPS derived from human dermal fibroblast cells by RSC-133 addition were analyzed by ALP staining and immunostaining. Two cell lines (RSC133-iPS1 and RSC133-iPS2) were identified. As a result, RSC133-iPS cell lines were either morphologically or stained with human embryonic stem cell markers (ALP) and immunostained (OCT4, NANOG, SSEA-3, SSEA-4, TRA-1-60, TRA-1-81). Was indistinguishable (FIG. 22). In addition, Oct4, Sox2, cMyc, and Klf4 mRNA expression was confirmed by semi-quantitative RT-PCR.
  • RSC133-iPS cell lines express Oct4, Sox2, cMyc, and Klf4 as human embryonic stem cells at total and endogenous levels. It was confirmed that the silencing of each transgene introduced through the retrovirus was completed sufficiently (FIG. 23).
  • the degree of methylation of the promoter region of the stem cell markers Oct4 and Nanog gene of the RSC133-iPS cell line was confirmed by bisulfite sequencing analysis.
  • RSC133-iPS reverse differentiated cell line showed a demethylated pattern similar to the human embryonic stem cell line (H9), the parental hFFs were still methylated (Fig. 24).
  • RSC133-iPS1 and RSC133-iPS2 The genomic integration of RSC133-iPS1 and RSC133-iPS2 was confirmed. Genome DNA was extracted using a DNeasy kit (Qiagen, Valencia, CA), and each PCR amplification reaction was performed using primers capable of specifically amplifying only 300 ng of genome DNA and a transgene. As a result, it was confirmed that the RSC133-iPS cell line is Oct4, Sox2, cMyc and Klf4 integrated (Fig. 25). At this time, human embryonic stem cell line (H9, hES) and human skin fibroblast cell line (CRL2097, hFF) were used as a control.
  • H9, hES human embryonic stem cell line
  • CTL2097, hFF human skin fibroblast cell line
  • RSC133-iPS cell line Karyotype of RSC133-iPS cell line was confirmed by G-banding assay. Representative images were obtained using ChIPS-Karyo (Chromosome Image Processing System, GenDix) (FIG. 26). As a result, the RSC133-iPS dedifferentiated cell line shows normal karyotype (46, XY).
  • the retrodifferentiated stem cell line (RSC133-iPS) derived from human fibroblast cells by addition to RSC-133 possesses the differentiation potential characteristic of stem cells
  • the embryoid bodies derived from each dedifferentiated stem cell line Differentiation capacity was investigated. After suspension culture, the embryos were re-attached to gelatin-coated plates for 10 days under differentiation conditions, and then expression of marker proteins specifically expressed in trioderm differentiated cells was confirmed by immunochemical staining method.
  • RSC133-iPS retrodifferentiated stem cell lines were subcutaneously injected into the dorsal flasks of immunodeficiency (SCID) mice in order to confirm the in vivo differentiation of human dedifferentiated stem cell lines (RSC133-iPS) by addition to RSC-133. Injection. After about 12 weeks, the teratoma was confirmed, and hematoxylin / eosin staining observed neural rosette (ectoderm), adipocyte (mesoderm), cartilage (mesoderm), and gut-like epithelium (endoderm) in teratoma (FIG. 28). This shows that human dedifferentiated stem cell line (RSC133-iPS) by addition to RSC-133 has the ability to differentiate into in vitro and in vivo into trioderm.
  • H9 human embryonic stem cells are cultured in unconditioned medium (UM), which is the basic medium condition.
  • UM unconditioned medium
  • RSC-133 RSC-133 was added to UM and cultured for 6 days, it was observed that the induced differentiation was suppressed and pluripotency was regained (Fig. 29, upper panel).
  • human embryonic stem cells cultured for 6 days in MEF-conditioned medium (CM), which is effective for maintaining undifferentiated state were used as a positive control, and the efficiency of maintaining undifferentiated state and differentiation inhibited the number of colonies indicating AP activity. It was calculated and shown (Fig. 29 lower panel).
  • CM MEF-conditioned medium

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Developmental Biology & Embryology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Reproductive Health (AREA)
  • Transplantation (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명에 의하면, 인간 분화세포에서 다능성 줄기세포를 제작하기 위한 역분화 유도 배양과정에 신규한 저분자 화합물 RSC-133을 첨가하면, 역분화 유도 효율을 증진시킬 수 있을 뿐만 아니라 역분화 유도에 소요되는 시간을 획기적으로 줄일 수 있다. 특히, 역분화 유도인자이자 암유발 위험인자인 c-Myc을 대체할 수 있는 것으로 확인되었으며, 정상산소 배양 조건 및 저산소 배양조건에서도 역분화 유도 효율을 모두 효과적으로 증진시킬 수 있음을 확인하였다. 또한, RSC-133은 역분화 유도 과정 중에서 발생하는 노화 유도를 억제하고 세포 증식 둔화를 증진시키는 효과를 나타내며, 후성 유전학적 활성화를 유도함으로써 역분화 유도 배양조건을 개선하고 있음을 검증하였다. 본 발명은 다양한 소스에서 확보된 적은 양의 환자-특이적 체세포로부터 유도 만능 줄기세포를 제작과정을 최적화하는데 기여함으로써 임상적용 가능한 개인 맞춤형 줄기세포 세포 치료제 개발 및 신약개발과정을 획기적으로 개선하고, 실용화시기를 앞당기는데 기여할 것이다. 또 다른 양태로써, 본 발명에 의하면, 신규한 저분자 화합물 RSC-133이 대표적인 다능성 줄기세포인 인간 배아줄기세포의 미분화 상태 유지에 효과적인 배양 배지 조성물이 될 수 있음을 확인하였다. RSC-133이 첨가된 배지 조성물은 인간 배아줄기세포의 미분화 증식을 효과적으로 유도할 수 있으며, 배아줄기세포의 대량 배양 시스템을 개발하는데 유용하게 사용될 수 있을 것으로 기대한다.

Description

다능성 줄기세포의 제작, 유지, 증식을 증진하는 신규 저분자 화합물 및 이를 포함하는 조성물과 배양방법
본 발명은 화학식 1의 인돌아크릴산 기반의 신규한 화합물, 이를 포함하는 배지 조성물, 이를 포함하는 역분화 촉진용 조성물, 이를 포함하는 세포 배양물 및 이를 이용하는 역분화된 다능성 줄기세포 제조 방법 및 유지 방법에 관한 것이다.
줄기세포(stem cell)란, 미분화 상태를 유지하면서 자가-증식능이 우수하고 일정한 환경과 조건이 주어질 경우 특정 기능과 형태를 갖도록 조직-특이적으로 분화할 수 있는 세포를 총체적으로 의미한다. 인간 배아줄기세포(human embryonic stem cells)와 인간 유도만능줄기세포(human induced pluripotent stem cells)를 포함하는 인간 다능성 줄기세포(human pluripotent stem cell)는 적당한 체외 배양조건에서 무한 증식(자가재생산능; self-renewal)을 할 수 있고, 개체를 이루고 있는 모든 종류의 세포로 분화할 수 있는 특성(다능성 또는 전분화능 ;pluripotency)으로 인해 개체의 발생, 분화 및 성장을 포함하는 생물학적 기초 지식 이해 측면에서 뿐만 아니라 다양한 질병의 근복적인 치료 방법인 세포 치료제 개발 그리고 신약 개발 분야에 이르기까지 이를 대상으로 한 연구성과의 활용범위가 확대되고 있다. 다양한 영역에서 인간 다능성 줄기세포을 기반으로 실용화 기술을 개발하기위한 노력이 급증하고 있는 가운데, 여전히 인간 다능성 줄기세포 제작 및 증식 배양 과정에서의 효율성, 안전성, 및 경제성 측면에서 해결되어야 할 병목요소들이 존재하고 있는 실정이다. 구체적으로는, 미분화 및 분화상태의 줄기세포를 확보하고 이용하는 과정에서 상시적으로 수요를 감당할 수 있는 안정화된 대량 생산 기술을 개발하는 것이 요구되며, 특히, 세포 치료제 개발을 위해서는 임상적으로 적용 가능한 상태에서 세포를 공급할 수 있도록 성능이 우수하고, 효율성이 뛰어난 배양 기술을 확보하는 것이 필수적이다.
일반적으로 인간 다능성 줄기세포는 마우스 배아 섬유아세포(mouse embryonic fibroblast; MEF) 등과 같은 영양세포(feeder cells)와 공배양 하거나 영양세포를 증식시킨 배양액(conditioned media; CM)에 배양함으로써 미분화 상태를 유지하면서 지속적으로 유지 및 배양할 수 있다. 그러나, 동물 영양세포와의 직접 배양 또는 영양세포 배양액을 사용하는 배양 방법 모두 바이러스와 같은 1종 이상의 감염원이 동물세포로부터 인간 다능성 줄기세포로 전파될 수 있는 위험이 따른다.
이에, 최근에는 동물 영양세포 또는 혈청을 이용하지 않고 저분자 화합물, 펩타이드 등을 활용하여 배양배지 구성물의 성분이 알려진 무혈청배지 (chemically defined medium)를 개발하고, 이를 인간 다능성 줄기세포 제작, 배양에 적용하기 위한 노력이 지속적으로 진행되고 있으며, 이는 줄기세포 시장 성장에 상당히 높은 비중으로 기여하고 있다.
냉동 배아의 내부세포괴 (inner cell mass)로부터 유래한 배아줄기세포는 폐기될 냉동 배아에서 추출하므로 법적인 문제는 없으나, 배아에서 추출하므로 생명 파괴라는 입장에서 윤리적, 종교적 논란의 대상이 되고 있으며, 제한된 배아로부터 유래하므로 각 개체간 면역 적합성 부재로 인하여 세포 치료제로 개발 시 이식 거부반응을 피할 수 없다. 이러한 문제점을 극복하기 위한 대안으로 최근 역분화 인자를 이용하여 성체세포로부터 배아줄기세포와 거의 유사한 다능성 줄기세포의 특성을 가진 유도 만능 줄기세포를 제작하는 방법이 성공(Cell 126, 663-676, 2006; Cell 131, 861-872, 2007; Nature 441, 1061-1067, 2006; Nature 451, 141-146, 2008)함에 따라 다능성 줄기세포를 이용한 줄기세포 실용화 기술 개발에 대한 기대가 높아지고 있는 실정이다. 특히, 유도 만능 줄기세포는 제작과정에 배아가 필요하지 않으며, 환자 자신에게서 추출한 세포를 이용하는 경우 면역거부에 대한 문제가 없어 기술적인 활용가치가 매우 높다. 다만, 현 기술을 실용화 단계까지 진입시키기 위해서는 필수적으로 현 기술이 가지고 있는 문제점 즉, 낮은 역분화 유도 효율을 개선하고 임상적용의 안전성을 확보하기위해 바이러스 사용을 대체할 수 있는 후속기술개발이 중요하다.
이에, 역분화 효율을 증진시키기 위한 방법론으로 세포 외부 환경조절이나 첨가물 특히, 저분자 화합물을 이용한 유도효율 증가에 대한 성공사례들이 보고되고 있다. 또한, 배아줄기세포의 환경과 유사한 저산소 상태에서 역분화 줄기세포의 유도 효율이 효과적으로 증가됨이 보고된바 있으며(Cell Stem Cell, 5: 237-241, 2009), Ding 박사팀(Shi et al., Cell Stem Cell, 2008)은 BIX-01294(G9a histone methyltransferase inhibitor), BayK8644(L-type calcium channel agonist), RG108(DNA methyltransferase inhibitor)등의 저분자 화합물이 Melton 박사팀(Huangfu et al., Nat Biotechnol, 2008)은 VPA(histone deacetylase inhibitor), TSA(histone deacetylase inhibitor), SAHA(histone deacetylase inhibitor)등의 저분자 화합물이 역분화 유도 효율을 증진 시키는데 효과적임을 보고한바 있다. 바이러스 사용을 대체할 할 수 있는 방법론 개발에 있어 1) 다단백질발현단일벡터(single nonviral polycistronic vector)를 이용한 transient 발현 기술(Gonzalez et al, PNAS USA, 2009; Chang et al, Stem cells, 2009), 2) adenoviral 형질도입 기술(Stadtfeld et al, Science 2008), 3) Cre/loxP 재조합 발현제어시스템 개발(Soldner et al, Cell, 2009)을 통해 다단백질발현단일벡터을 이용하여 iPSC를 확립하고, Cre transfection을 통해 역분화카세트 제거하는 기술(kaji et al, Nature, 2009), 4) piggyBac(PB) 전이인자시스템 transposon system 개발(Woltjen et al, Nature, 2009; kaji et al, Nature, 2009), 5) nonintegrating episomal vectors 개발(Yu et al, Science, 2009)등에 대한 연구 결과가 도출되고 있으나, 여전히, 유전자 이상 및 암화 유발 가능성을 완전히 배제하지 못하고 있는 실정이다.
이에, 본 발명자들은 미분화 상태 인간 다능성 줄기세포의 유지, 배양 기술을 개선할 수 있는 저분자 화합물과 체세포로부터 인간 다능성 줄기세포를 제작하는 역분화 기술을 개선할 수 있는 저분자 화합물을 지속적으로 탐색한 결과, 발굴된 신규한 저분자 화합물 RSC-133을 발굴하였고, RSC-133이 포함된 배지 조성물을 이용하는 경우 인간 다능성 줄기세포를 제작하기위한 역분화 유도 효율이 획기적으로 증진되고, 인간 다능성 줄기세포의 미분화 상태 유지 및 증식을 위한 배양 조건이 효과적으로 개선됨을 검증함으로써 본 발명을 완성하였다.
본 발명의 목적은 하기 화학식 1의 신규한 화합물, 또는 이의 약학적으로 허용가능한 염을 제공하는 것이다.
본 발명의 다른 목적은 화학식 1의 신규한 화합물, 또는 이의 약학적으로 허용가능한 염을 포함하는 배지 조성물을 제공하는 것이다.
본 발명의 다른 목적은 화학식 1의 신규한 화합물, 또는 이의 약학적으로 허용가능한 염을 포함하는 분화된 세포에서 다능성 줄기세포로의 역분화 촉진용 조성물을 제공하는 것이다.
본 발명의 다른 목적은 분화된 세포; 상기 역분화 촉진용 조성물; 및 역분화 유도인자를 포함하며, 상기 분화된 세포는 다능성 줄기세포로 역분화되는 시험관 내 세포 배양물을 제공하는 것이다.
본 발명의 다른 목적은 (a) 분화된 세포에 역분화 유도인자를 전달하는 단계; 및 (b) 분화된 세포를 상기 역분화 촉진용 조성물을 함유하는 배지에서 배양하는 단계를 포함하는, 분화된 세포에서 역분화된 다능성 줄기세포를 제조하는 방법을 제공하는 것이다.
본 발명의 다른 목적은 미분화 상태의 다능성 줄기세포의 유지, 증식을 증진 시킬 수 있는 배지 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 미분화 상태로 다능성 줄기세포를 배양하는 방법에 관한 것이다.
본 발명의 다른 목적은 미분화 상태의 다능성 줄기세포의 유지, 증식을 증진 시킬 수 있는 배지 조성물을 제공하는 것이다.
본 발명의 다른 목적은 다능성 줄기세포; 및 상기 다능성 줄기세포가 다수의 연속 계대 배양을 통해서 미분화 상태로 유지되도록 상기 배지 조성물을 포함하는 시험관 내 세포 배양물을 제공하는 것이다.
상기 목적을 달성하기 위한 하나의 양태로서, 본 발명은 하기 화학식 1의 화합물, 또는 이의 약학적으로 허용가능한 염을 제공한다.
화학식 1
Figure PCTKR2012009420-appb-C000001
상기 화학식에, R1은 메톡시기(OCH3), 아미노기(NH2), 메틸아미노기(NHCH3), 디메틸아미노기(N(CH3)2), O-이소프로필기(O-isopropyl), 프로필아미노기(NHCH(CH3)2), 히드록시기(OH), NHCH2-furan, NHCH2CH2-piperidine, 또는 NH(CH2)3-morpholine이고; R2는 히드록시기(OH) 또는 수소(H)이다. 또한, 상기 ---로 표현된 부분은 단일 결합 또는 이중 결합일 수 있다.
구체적인 일례로서, 상기 화학식 1의 R1은 메톡시기(OCH3)이고; R2는 수소이고; --- 부분이 이중 결합일 수 있다.
구체적인 일례로서, 상기 화학식 1의 R1은 아미노기(NH2)이고; R2는 수소이고; --- 부분이 이중 결합일 수 있다.
구체적인 일례로서, 상기 화학식 1의 R1은 메틸아미노기(NHCH3)이고; R2는 수소이고; --- 부분이 이중 결합일 수 있다.
구체적인 일례로서, 상기 화학식 1의 R1은 디메틸아미노기(N(CH3)2)이고; R2는 수소이고; --- 부분이 이중 결합일 수 있다.
구체적인 일례로서, 상기 화학식 1의 R1은 아미노기(NH2)이고; R2는 수소이고; --- 부분이 단일 결합일 수 있다.
구체적인 일례로서, 상기 화학식 1의 R1은 O-이소프로필(O-isopropyl)이고; R2는 히드록시기(OH)이고; --- 부분이 이중 결합일 수 있다.
구체적인 일례로서, 상기 화학식 1의 R1은 아미노기(NH2)이고; R2는 히드록시기(OH)이고; --- 부분이 이중 결합일 수 있다.
구체적인 일례로서, 상기 화학식 1의 R1은 메틸아미노기(NHCH3)이고; R2는 히드록시기(OH)이고; --- 부분이 이중 결합일 수 있다.
구체적인 일례로서, 상기 화학식 1의 R1은 프로필아미노기(NHCH(CH3)2)이고; R2는 히드록시기(OH)이고; --- 부분이 이중 결합일 수 있다.
구체적인 일례로서, 상기 화학식 1의 R1은 디메틸아미노기(NH(CH3)2)이고; R2는 히드록시기(OH)이고; --- 부분이 이중 결합일 수 있다.
구체적인 일례로서, 상기 화학식 1의 R1은 히드록시기(OH)이고; R2는 수소이고; --- 부분이 이중 결합일 수 있다.
구체적인 일례로서, 상기 화학식 1의 R1은 NHCH2-furan이고; R2는 수소이고; --- 부분이 이중 결합일 수 있다.
구체적인 일례로서, 상기 화학식 1의 R1은 NHCH2CH2-piperidine이고; R2는 수소이고; --- 부분이 이중 결합일 수 있다.
구체적인 일례로서, 상기 화학식 1의 R1은 NH(CH2)3-morpholine이고; R2는 수소이고; --- 부분이 이중 결합일 수 있다.
구체적인 일례로서, 상기 화학식 1의 R1은 O-이소프로필(O-isopropyl)이고; R2는 수소이고; --- 부분이 이중 결합일 수 있다.
구체적인 일례로서, 본 발명의 화학식 1의 화합물 중 바람직한 화합물은 하기 1) 내지 15)와 같다.
1) 메틸 3-[3-(1H-인돌-3-일)-아크릴아미도]-벤조에이트(methyl 3-[3-(1H-indol-3-yl)acrylamido]benzoate);
2) 3-[3-(1H-인돌-3-일)-아크릴아미도]-벤즈아마이드 (3-[3-(1H-indol-3-yl)acrylamido]benzamide);
3) 3-[3-(1H-인돌-3-일)-아크릴아미도]-N-메틸벤즈아마이드 (3-[3-(1H-indol-3-yl)acrylamido]-N-methylbenzamide);
4) 3-[3-(1H-인돌-3-일)-아크릴아미도]-N,N-디메틸벤즈아마이드 (3-[3-(1H-indol-3-yl)acrylamido]-N,N-dimethylbenzamide);
5) 3-(3-1H-인돌-3-일-프로피오닐아미노)-벤즈아마이드 (3-(3-1H-Indol-3-yl-propionylamino)-benzamide);
6) 이소프로필 3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시 벤조에이트 (isopropyl 3-[3-(1H-indol-3-yl)acrylamido]-4-hydroxybenzoate);
7) 3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시 벤즈아마이드 (3-[3-(1H-indol-3-yl)acrylamido]-4-hydroxybenzamide);
8) 3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시-N-메틸벤즈아마이드 (3-[3-(1H-indol-3-yl)acrylamido]-4-hydroxy-N-methylbenzamide);
9) 3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시-N-이소프로필벤즈아마이드(3-[3-(1H-indol-3-yl)acrylamido]-4-hydroxy-N-isopropylbenzamide);
10) 3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시-N,N-디메틸벤즈아마이드 (3-[3-(1H-indol-3-yl)acrylamido]-4-hydroxy-N,N-dimethylbenzamide);
11) 3-[3-(1H-인돌-3-일)-아크릴아미도]벤조산 (3-[3-(1H-indol-3-yl)acrylamido]benzoic acid);
12) 3-[3-(1H-인돌-3-일)-아크릴아미도]-N-(푸란-2-일메틸)벤즈아마이드 (3-[3-(1H-indol-3-yl)acrylamido]-N-(furan-2-ylmethyl)benzamide);
13) 3-(3-1H-인돌-3-일-아크릴로일아미노)-N-(2-피페리딘-1-일-에틸)-벤즈아마이드 (3-(3-1H-Indol-3-yl-acryloylamino)-N-(2-piperidin-1-yl-ethyl)-benzamide);
14) 3-(3-1H-인돌-3-일-아크릴로일아미노)-N-(3-모폴린-4-일-프로필)-벤즈아마이드 (3-(3-1H-Indol-3-yl-acryloylamino)-N-(3-morpholin-4-yl-propyl)-benzamide);
15) 이소프로필 3-[3-(1H-인돌-3-일)아크릴아미도]벤조에이트 (isopropyl 3-[3-(1H-indol-3-yl)acrylamido]benzoate).
본 발명의 화학식 1의 화합물은 당해 기술 분야에서 통상적인 방법에 따라 약학적으로 허용가능한 염 및 용매화물로 제조될 수 있다.
염으로는 약학적으로 허용가능한 유리산(free acid)에 의해 형성된 산부가염이 유용하다. 산 부가염은 통상의 방법, 예를 들어 화합물을 과량의 산 수용액에 용해시키고, 이 염을 수혼화성 유기 용매, 예를 들어 메탄올, 에탄올, 아세톤 또는 아세토니트릴을 사용하여 침전시켜서 제조한다. 동 몰량의 화합물 및 물 중의 산 또는 알콜(예, 글리콜 모노메틸에테르)을 가열하고, 이어서 상기 혼합물을 증발시켜 건조시키거나, 또는 석출된 염을 흡인 여과시킬 수 있다.
이때, 유리산으로는 유기산과 무기산을 사용할 수 있으며, 무기산으로는 염산, 인산, 황산, 질산, 주석산 등을 사용할 수 있고 유기산으로는 메탄술폰산, p-톨루엔술폰산, 아세트산, 트리플루오로아세트산, 말레인산(maleic acid), 숙신산, 옥살산, 벤조산, 타르타르산, 푸마르산(fumaric acid), 만데르산, 프로피온산 (propionic acid), 구연산(citric acid), 젖산(lactic acid), 글리콜산(glycollic acid), 글루콘산(gluconic acid), 갈락투론산, 글루탐산, 글루타르산(glutaric acid), 글루쿠론산(glucuronic acid), 아스파르트산, 아스코르브산, 카본산, 바닐릭산, 히드로아이오딕산 등을 사용할 수 있으며, 이들에 제한되지 않는다.
또한, 염기를 사용하여 약학적으로 허용가능한 금속염을 만들 수 있다. 알칼리 금속 또는 알칼리 토금속염은, 예를 들어 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해시키고, 비용해 화합물 염을 여과한 후 여액을 증발, 건조시켜 얻는다. 이때, 금속염으로서는 특히 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하나 이들에 제한되는 것은 아니다. 또한, 이에 대응하는 은염은 알칼리 금속 또는 알칼리 토금속 염을 적당한 은염(예, 질산은)과 반응시켜 얻을 수 있다.
상기 화학식 1의 화합물의 약학적으로 허용 가능한 염은, 달리 지시되지 않는 한, 화학식 1의 화합물에 존재할 수 있는 산성 또는 염기성 기의 염을 포함한다. 예를 들어, 약학적으로 허용 가능한 염으로는 히드록시기의 나트륨, 칼슘 및 칼륨 염 등이 포함될 수 있고, 아미노기의 기타 약학적으로 허용가능한 염으로는 히드로브로마이드, 황산염, 수소 황산염, 인산염, 수소 인산염, 이수소 인산염, 아세테이트, 숙시네이트, 시트레이트, 타르트레이트, 락테이트, 만델레이트, 메탄술포네이트(메실레이트) 및 p-톨루엔술포네이트(토실레이트)염 등이 있으며 당업계에서 알려진 염의 제조방법을 통하여 제조될 수 있다.
바람직하게는, 본 발명의 화합물을 하기 화학식 2의 구조를 가지는 3-[3-(1H-인돌-3-일)-아크릴아미도]-벤즈아마이드일 수 있다.
화학식 2
Figure PCTKR2012009420-appb-C000002
상기 화학식 2는 인돌 유도체로서 3-[3-(1H-인돌-3-일)-아크릴아미도]-벤즈아마이드 (3-(3-1H-Indol-3-yl)-acrylamido)-benzamide)로 명명될 수 있다 (이하, Reprogramming Stimulating Compound-133, RSC-133, ID-133). 트랜스-3-인돌아크릴산 기반 합성물(trans-3-indoleacrylic acid based compounds)에 대한 아날로그 라이브러리 스크리닝 과정에서 발견된 신규한 화합물이다. 생쥐 섬유아 세포를 역분화 하는 과정에서 상기 트랜스-3-인돌아크릴산 기반 합성물 39종을 각각 처리하여 역분화 효율 증진 효과가 우수한 화합물 2종을 선정하였고, 이를 포함한 화학적 구조가 유사한 새로운 트랜스-3-인돌아크릴산 기반 합성물 32종 선정하여 인간 섬유아세포의 역분화 유도 효율 증진 효과를 분석한 결과 효과가 우수한 reprogramming stimulating compound (RSC)-133을 선정하였다.
본 발명의 일 실시예에서는, 상기 RSC-133 화합물을 제조하기 위하여 트랜스-3-인돌아크릴산과 3-아미노-벤즈아마이드2를 DMF에 녹인 후, 해당 용액에 아마벤조트리아졸-1-일-N-옥시-트리스(피롤리디노)-포스포늄 헥사플루오로포스페이트(PyBOP, Benzotriazol-1-yl-N-oxy-tris(pyrrolidino)-phosphonium hexafluorophosphate) 및 N,N-디아이소프로필에틸아민(DIPEA, N,N-diisopropylethylamine)을 첨가하였다. 해당 반응액을 실온에서 하룻밤 교반하여 반응시켰다. 이후, 분리 및 정제 과정을 통해 3-[3-(1H-인돌-3-일)-아크릴아미도]-벤즈아마이드(RSC-133)를 노란 고체 형태로 얻었다 (실시예 1-2).
다른 하나의 양태로서, 본 발명은 화학식 1의 화합물, 또는 이의 약학적으로 허용가능한 염을 포함하는 배지 조성물을 제공한다. 바람직하게는, 상기 화학식 1의 화합물은 3-[3-(1H-인돌-3-일)-아크릴아미도]-벤즈아마이드(RSC-133), 또는 이의 약학적으로 허용가능한 염일 수 있다.
본 발명에서의 용어 "배지(culture media)"는 체외배양 조건에서 세포성장 및 생존을 지지할 수 있게 하는 배양액을 의미하고, 세포의 배양에 적절한 당 분야에서 사용되는 통상의 배지를 모두 포함한다. 따라서, 상기 배지 조성물이란 배지에 세포를 배양하기 위해서나 특수한 목적을 위해 넣어주는 물질을 뜻하는 것으로, 배지에 화학식 1의 화합물, 또는 이의 약학적으로 허용가능한 염을 첨가하여 세포를 배양하는 용도로 사용될 수 있음을 말한다. 상기 배지는 세포의 종류에 따라 배지의 구성과 배양 조건을 선택할 수 있다. 배양에 사용되는 배지는 바람직하게는 세포 배양 최소 배지(cell culture minimum medium; CCMM)로, 일반적으로 탄소원, 질소원 및 미량원소 성분을 포함한다. 이런 세포 배양 최소 배지에는 예들 들어, DMEM(Dulbecco's Modified Eagle's Medium), MEM(Minimal essential Medium), BME(Basal Medium Eagle), RPMI1640, F-10, F-12, α-MEM(α-Minimal essential Medium), GMEM(Glasgow's Minimal essential Medium), Iscove's Modified Dulbecco's Medium 등이 있으나, 반드시 이들로 제한되는 것은 아니다.
다른 하나의 양태로서, 본 발명은 화학식 1의 화합물, 또는 이의 약학적으로 허용가능한 염을 포함하는 분화된 세포에서 다능성 줄기세포로의 역분화 촉진용 조성물을 제공한다. 바람직하게는, 상기 화학식 1의 화합물은 3-[3-(1H-인돌-3-일)-아크릴아미도]-벤즈아마이드(RSC-133), 또는 이의 약학적으로 허용가능한 염일 수 있다.
본 발명에서 용어 "분화"란 세포가 분열하여 증식하며 전체 개체가 성장하는 동안에 세포의 구조나 기능이 특수화되는 현상을 말한다. 즉, 생물의 세포, 조직 등이 각각에게 주어지는 역할을 수행하기 위해 적합한 형태 및 기능으로 변하는 과정을 말한다. 예를 들어, 배아줄기세포와 같은 전능성 줄기세포는 외배엽, 중배엽, 및 내배엽 세포로 변하는 과정도 분화이며, 좁게는 조혈모세포가 적혈구, 백혈구, 혈소판 등으로 변하는 과정도 분화에 해당된다.
본 발명에서 용어 "분화된 세포"란 상기 분화과정이 진행되어 일정 형태 및 기능을 가지게 된 세포를 말한다. 본 발명의 분화된 세포는 특별한 제한은 없으나 바람직하게는 체세포(somatic cell) 또는 전구세포(progenitor cell)이다. 또한, 바람직하게는 인간에게서 유래한 세포이다.
본 발명에서 용어 "체세포"는 생식세포를 제외한 동식물을 구성하는 분화가 완결된 모든 세포를 뜻하며 염색체가 2n을 유지한다는 특성이 있다.
본 발명에서 용어 "전구세포"는 자손에 해당하는 세포가 특정 분화 형질을 발현하는 것으로 밝혀진 경우, 분화 형질을 발현하지 않은 미분화 부모세포를 말한다. 예를 들면, 신경세포(뉴런)에 대해서는 신경아세포(뉴런간세포)가 전구세포에 해당하고, 근관세포에 대해서는 근아세포가 전구세포에 해당한다.
본 발명에서의 용어 "다능성 줄기세포(pluripotent stem cell)"란 개체의 모든 조직의 세포로 분화할 수 있는 다능성(pluripotent)이거나 전능성(totipotent)이 있는 자가재생산능(self-renewal)을 갖는 줄기세포를 말하며, 배아줄기세포와 유도 만능 줄기세포를 포함하나 이것으로 한정되는 것은 아니다. 해당 다능성 줄기세포로는 인간, 원숭이, 돼지, 말, 소, 양, 개, 고양이, 생쥐, 토끼 등의 모든 유래의 다능성 줄기세포를 포함하나, 바람직하게는 인간 유래의 다능성 줄기세포이다.
본 발명에서의 용어 "배아줄기세포"란, 수정란이 모체의 자궁에 착상하기 직전인 포배기 배아에서 내세포괴(inner cell mass)를 추출하여 체외에서 배양한 것으로서, 개체의 모든 조직의 세포로 분화할 수 있는 다능성(多能性, pluripotent)이거나 전능성(全能性, totipotent)이 있는 자가재생산능(self-renewal)을 갖는 세포를 의미하며, 넓은 의미로는 배아줄기세포로부터 유래한 배아체(embryoid bodies)도 포함한다. 본 발명의 배아줄기세포로는 인간, 원숭이, 돼지, 말, 소, 양, 개, 고양이, 생쥐, 토끼 등의 모든 유래의 배아줄기세포를 포함하나, 바람직하게는 인간 유래의 배아줄기세포이다.
본 발명에서의 용어 "유도 만능 줄기세포"란, 분화된 세포들로부터 인위적인 역분화 과정을 통해 다능성 분화능을 가지도록 유도된 세포들을 일컫는 말로서 역분화줄기세포 (iPSC: induced pluripotent stem cells)이라고도 한다. 인위적인 역분화 과정은 레트로바이러스 및 렌티바이러스를 이용한 바이러스-매개 또는 비바이러스성 벡터 이용, 단백질 및 세포 추출물 등을 이용하는 비바이러스-매개 역분화 인자의 도입에 의해 수행되거나, 줄기세포 추출물, 화합물 등에 의한 역분화 과정을 포함한다. 유도 만능 줄기세포는 배아줄기세포와 거의 같은 특성을 가지며, 구체적으로는 비슷한 세포 모양을 보여주며, 유전자, 단백질 발현 패턴이 유사하며, in vitro 및 in vivo에서 전분화능을 가지며, 테라토마 (teratoma)를 형성하고, 생쥐의 배반포 (blastocyst)에 삽입시켰을 때, 키메라 (chimera) 생쥐를 형성하고, 유전자의 생식선 전이 (germline transmission)이 가능하다. 본 발명의 유도 만능 줄기세포로는 인간, 원숭이, 돼지, 말, 소, 양, 개, 고양이, 생쥐, 토끼 등의 모든 유래의 유도 만능 줄기세포를 포함하나, 바람직하게는 인간 유래의 유도 만능 줄기세포이다.
본 발명에서 용어 "역분화(de-differentiation)"는 분화된 세포가 새로운 유형의 분화되는 잠재력을 갖는 상태로 복원될 수 있는 프로세스를 의미한다. 또한,상기 역분화는 본 발명에서 세포 리프로그래밍과 동일한 의미로 사용된다. 이러한 세포의 역분화 기작은 핵 내의 후생유전학(뉴클레오타이드 서열에서의 변화없이 기능에서의 유전적 변화를 일으키는 것과 관련된 DNA 상태)적 마크가 삭제된 후, 상이한 세트의 후생유전학적 마크를 수립하는 것을 의미하는데, 다세포 생물이 분화 및 성장하는 동안, 상이한 세포 및 조직은 상이한 유전자 발현 프로그램을 획득한다.
본 발명에서 용어 "역분화 촉진"이란 역분화가 일어나는 과정에서 역분화의 과정이 빠르게 일어나게 하거나 역분화되는 효율을 증가시키는 것을 말한다. 곧, 역분화의 효율을 속도 및 비율 면에서 증진한다는 의미를 포함한다.
본 발명의 분화된 세포를 다능성을 가지는 줄기세포로의 역분화를 촉진하는 조성물은 세포의 생존 및 기능에 해가 되지 않는 농도의 RSC-133을 포함한다. 바람직하게는 0.01 초과 내지 50 μM 미만의 농도의 RSC-133을 포함하며, 보다 바람직하게는 0.1 초과 내지 20 μM 미만의 농도의 RSC-133을 포함한다. 가장 바람직하게는 8 초과 내지 12 μM 미만의 농도의 RSC-133을 포함한다.
본 발명에서 분화된 세포를 다능성을 가지는 줄기세포로의 역분화를 촉진하는 조성물에는 역분화 유도인자들이 추가로 포함될 수 있다. 본 발명에서 용어 "역분화 유도인자"란 최종적으로 분화된 세포가 새로운 유형의 분화되는 잠재력을 갖는 유도 만능줄기세포로 역분화 되도록 유도하는 물질이다. 상기 역분화 유도인자는 최종적으로 분화된 세포의 역분화를 유도하는 물질이면 제한 없이 포함할 수 있으며, 분화시키려는 세포의 종류에 따라 선택할 수 있다. 이에 제한되지는 않으나, 바람직하게는 역분화 유도인자로서 Oct4, Sox2, KlF4, c-Myc, Nanog 및 Lin-28로 이루어진 군으로부터 선택되는 어느 하나 이상의 단백질 또는 이들 단백질을 코딩하는 어느 하나 이상의 핵산분자를 추가로 포함할 수 있고, 보다 바람직하게는 Oct4 단백질 또는 이들 단백질을 코딩하는 핵산분자를 포함할 수 있으며, Oct4, Sox2 및 KlF4 단백질 또는 이들 단백질을 코딩하는 핵산분자를 포함할 수 있다.
본 발명의 조성물은 바람직하게는 배양 배지 형태이다. 따라서, 본 발명의 조성물에는 분화된 세포가 다능성 줄기세포로 역분화하는데 방해가 되지 않는 한, 일반적으로 세포 배양 배지에 포함되는 물질이 추가로 포함될 수 있다.
본 발명의 일 실시예에서는, 생쥐 피부 섬유아세포에서 상기 트랜스-3-인돌아크릴산 기반 합성물 39종을 대상으로 역분화 유도 증진효과를 분석한 결과 신규한 화합물 RSC-133 또는 ID-558을 첨가한 경우 대조군에 비해 역분화 효율이 효과적으로 증진되는 것을 확인하였다 (도 1). 기 알려진 역분화 촉진 화합물들(Valproic acid, 5-azacytidine, BIX-01294 등)과 효능을 비교 분석하였을 때 신규한 화합물 RSC-133이 가장 효과적으로 역분화 효율을 증진 시킴을 확인하였다 (도 2a 및 도 2b).
본 발명의 일 실시예에서는, 상기 생쥐 피부 섬유아세포의 역분화 유도에서 효과적으로 작용했던 신규한 화합물 RSC-133 또는 ID-558을 포함하는 신규 트랜스-3-인돌아크릴산 기반 합성물 32종을 대상으로 역분화 유도 증진효과를 분석한 결과 인간 피부 섬유아세포에서 신규한 화합물 RSC-133을 첨가한 경우 대조군에 비해 역분화 효율이 효과적으로 증진되는 것을 확인하였다 (도 3).
본 발명의 일 실시예에서는, 정상배양조건(21% O2) 뿐만 아니라 저산소배양조건(5% O2)에서도 신규한 화합물 RSC-133을 첨가한 경우 대조군에 비해 역분화 유도 효율이 증진됨을 확인하였다 (도 4). 정상배양조건(21% O2) 보다 저산소배양조건(5% O2)이 다능성 유지와 역분화 유도에 효과적임이 여러 연구팀에 의해 확인된 바 있으며, RSC-133의 첨가로 다능성 줄기세포의 배양 조건 및 다능성 줄기세포 역분화 조건이 추가적으로 개선될 수 있음을 확인하였다 (도 4).
또한, 본 발명의 일 실시예에서는 신규 저분자 화합물 RSC-133 첨가에 의한 인간 피부 섬유아세포로부터 역분화 줄기세포의 역분화 유도 시에 기존 역분화 인자 (c-Myc)를 대체할 수 있는지 조사하였다. c-Myc은 암유발 유전자로서 역분화 유도 후 형성된 역분화 줄기세포주에서 c-Myc 바이러스 유전자의 재발현은 암 유발에 관여한다고 알려졌다. 그러므로 c-Myc을 제외한 역분화 유도 방법에 대한 연구가 관심을 받고 있다. 본 발명에서 RSC-133 단독으로는 대체 효과를 보이지 않으나 Sodium butylate (NaB)와 함께 첨가시 c-Myc 인자를 대체할 수 있으며, 대조군에 비해 역분화 유도 효율 또한, 증진됨을 확인하였다 (도 5).
결론적으로 신규 저분자 화합물 RSC-133이 마우스 및 인간 세포의 역분화 효율을 효과적으로 증진시키는 인자로 확인되었다.
또한, 본 발명의 일 실시예에서는 역분화 효율 증진에 효과적인 최적의 RSC-133 첨가 농도 범위를 결정하기 위해 서로 다른 농도 조건에서 역분화 유도 효율을 확인한 결과, RSC-133 농도에 의존적으로 역분화 유도 효율이 증진됨을 확인하였다 (도 8). 구체적으로는, 도 8의 상단에 제시된 배양 조건에 따라 인간 피부 섬유아세포에 OSKM 유전자의 바이러스를 감염시킨 후, 도 8의 하기 그래프에서 나타낸 바와 같이 서로 다른 0μM, 0.1μM, 1μM, 5μM, 10μM, 20μM의 농도로 RSC-133을 첨가한 역분화 유도 조건하에서 역분화 유도 효율 변이를 확인하였다. 각 농도에 따른 역분화 효율은 hESC-특이 인자인 Alkaline phosphatase (AP) 염색에서 양성 반응을 나타내며, hESC-like morphology를 가진 콜로니 수를 측정하여 계산하였다. 실험 결과 RSC-133은 10 μM 까지는 농도에 의존적으로 역분화 효율을 증가시킬 수 있었다 (도 8). RSC-133 첨가 농도를 20 μM까지 높이는 조건에서 역분화 효율이 병행하여 추가로 증가되지 않음을 확인하였다 (도 8). 추가적으로, 인간 피부 섬유아세포에 RSC-133을 50 μM까지 처리하였을 때 세포 독성을 유도하지 않음을 검증하였다 (도 9).
또한, 본 발명의 일 실시예에서는 역분화 유도 프로토콜에서 RSC-133을 처리하는 시기 및 기간을 최적화 하기위해 다양한 조건하에서 RSC-133을 첨가한 후 역분화 유도 효율의 변이를 확인하였다 (도 10).
그 결과, RSC-133을 동일하게 5일 동안 1(바이러스 감염 후 5일, 도 10; 조건 4), 2 (바이러스 감염 5일 후 -10일까지, 도 10; 조건 7), 3 (바이러스 감염 10일 후 -15일까지, 도 10; 조건 8), 4단계 (바이러스 감염 15일 후 -20일까지, 도 10; 조건 9)로 나누어 처리한 경우, 1 단계인 바이러스 감염 직 후부터 초기 5일 동안 분화세포 배양배지와 함께 처리한 경우 가장 효과적으로 역분화 효율을 증진시킴을 확인하였다 (도 10). 또한, RSC-133을 동일하게 10일 동안 1(바이러스 감염 후 10일, 도 10; 조건 3), 2 (바이러스 감염 5일 후 -15일까지, 도 10; 조건 6), 3 단계(바이러스 감염 10일 후 -20일까지, 도 10; 조건 10)로 나누어 처리한 경우, 1 단계인 바이러스 감염 직후부터 전반기 10일 동안 (분화세포 배양배지에서 5일 배양 후 새로운 배양 접시에 옮겨 인간배아줄기세포 배양배지에서 추가로 5일 배양, 도 10; 조건 3) 처리한 경우 가장 효과적으로 역분화 효율을 증진시킴을 확인하였다 (도 10). 또한, RSC-133을 동일하게 15일 동안 1(바이러스 감염 후 15일, 도 10; 조건 2), 2 단계(바이러스 감염 5일 후 -20일까지, 도 10; 조건 5)로 나누어 처리한 경우 두 조건 모두에서 역분화 효율이 유사하게 증진됨을 확인하였다 (도 10). 테스트한 모든 조건에서, 역분화 유도 전체 과정 동안 지속적으로 RSC-133을 처리하였을 때 역분화 유도 효율이 가장 높게 증진됨을 확인하였다 (도 10, 조건1). 결론적으로, RSC-133이 역분화 초기 과정에 처리하였을 때 역분화 유도 증진효과가 가장 우수하며, 초기 이후 처리에 있어서도 처리한 시간에 의존적으로 역분화 효율을 획기적으로 증진시킬 수 있음을 검증하였다.
또한, 본 발명의 일 실시예에서는 신규한 화합물 RSC-133이 역분화 유도 배양과정에서 세포의 성장과 증식을 촉진시키는 효과가 있음을 세포수를 시간대별로 총세포수를 측정함으로써 확인하였다 (도 11). OSKM을 transduction하지 않은 대조군에 비해 OSKM을 transduction한 조건하에서 세포수의 증가가 상당히 둔화됨을 확인할 수 있으며, 같은 조건에서 신규한 화합물 RSC-133을 처리한 경우 이러한 세포성장의 둔화가 상대적으로 향상됨을 확인하였다 (도 12). 추가적으로 역분화 유도 배양동안 세포증식 변이를 BrdU 어세이 방법을 통해 확인 한 결과 상기 결과와 유사하게 신규한 화합물 RSC-133을 처리한 경우 세포성장이 처리한 시간에 의존적인 양태로 유의하게 향상됨을 확인하였다(도 13-15).
또한, 본 발명의 일 실시예에서는 신규한 화합물 RSC-133이 역분화 유도 배양과정에서의 kinetics 촉진하여 역분화 유도에 소요되는 기간을 단축시킬 수 있는지 확인하기 위해 시간대별로 hESC-특이 인자의 발현양상을 검증하였다. 도 15와 16에서 보여지는 바와 같이 신규한 화합물 RSC-133이 처리된 조건에서 역분화를 유도한 경우 hESC-특이 인자들(Nanog, Tra1-81, Oct4, Rex1)의 발현이 처리하지 않은 대조군에 비해 조기에 출현함을 면역염색법 (도 15)과 real-time PCR 방법(도 16)을 통해 확인함으로써, 신규한 화합물 RSC-133이 역분화 유도 kinetics 촉진하여 역분화 유도에 소요되는 기간을 효과적으로 단축시킬 수 있음을 확인하였다.
또한, 본 발명의 일 실시예에서는 신규한 화합물 RSC-133이 역분화 유도 과정에서의 장애요소로 알려진 OSKM transduction에 의해 유도되는 노화상태를 개선할 수 있는지 확인하기 위해 노화유도에 중요한 역할을 하는 것으로 알려진 신호전달인자인 p53, p21, p16의 발현 양태 변이(도 16) 및 SA-β-Gal assay(도 17)를 측정하였다. 도 16에서 보인 바와 같이 신규한 화합물 RSC-133이 처리된 배양조건에서 노화 인자인 p53, p21, p16이 효과적으로 억제되고 있음을 확인하였고, 도 17에 보인 바와 같이 RSC-133을 처리했을 경우에 SA-β-Gal 양성 세포가 현저히 줄어드는 것을 확인하였다. 상기 결과로써 RSC-133에 의한 노화인자의 억제가 역분화 유도조건을 개선하는데 기여하고 있음을 확인하였다.
또한, 본 발명의 일 실시예에서는 신규한 화합물 RSC-133이 역분화 유도 과정에 요구되는 후성유전학적 변이와 연관되어 있는지를 조사하기위해 줄기세포의 다능성 상태와 연관된 후성유전학적 활성화 상태인 H3K9 아세틸화 양태를 분석하였다. 도 18에서 보이는 바와 같이 신규한 화합물 RSC-133이 처리된 배양조건에서 H3K9 아세틸화가 증진됨을 면역염색법 웨스턴 블롯 방법을 통해 확인함으로써 RSC-133이 역분화 유도 과정에서 후성유전학적 활성화를 유도하고 있음을 확인하였다. 또한, 상기한 H3K9 아세틸화 증진이 RSC-133에 의해 유도되는 HDAC (특히, HDAC1) 활성억제 (도 19)와 HDAC1 발현 억제 (도 21)에 연관되어 있음을 효소활성 측정과 웨스턴 블롯 방법을 통해 확인하였다. 아울러, DNA 메틸화에 작용하는 DNA methyl transferase 1(DNMT1)의 활성이 RSC-133에 의해 현저히 저해되는 것을 확인하였다(도 20).
또한, 본 발명의 일 실시예에서는 신규한 화합물 RSC-133을 처리한 조건에서 제작된 다능성 줄기세포가 지속적인 배양과정동안 hESC-like morphology를 유지하고, hESC와 유사한 수준으로 hESC-특이 인자를 발현하며 (도 22-23), hESC-특이 프로모터 (Oct4, Nanog) 메틸화 양태를 나타내고(도 24), 역분화 유도에 이용한 4가지 transgene (OSKM) 모두 숙부세포 게놈에 integration 되어 있고 (도 25), 정상핵형을 유지하며(도 26), 생체외 (도 27) 및 생체내 (도 28)에서 삼배엽으로 분화되는 능력을 가지고 있음을 검증하였다.
다른 하나의 양태로서, 본 발명은 분화된 세포; 상기 역분화 촉진용 조성물; 및 역분화 유도인자를 포함하며, 상기 분화된 세포는 다능성 줄기세포로 역분화되는 시험관 내 세포 배양물을 제공한다.
보다 구체적으로, 분화된 세포에 상기 화학식 1의 화합물을 포함하는 상기 역분화 촉진용 조성물과 역분화 유도인자를 처리하여 얻어지는 시험관 내 모든 세포 배양물을 포함한다. 이는 역분화 과정에 있는 각종 세포들과 이를 배양하는 과정에서 얻어지는 각종 단백질 및 효소, 전사체들과 이를 함유하는 배양액까지 포함한다. 바람직하게는, 상기 화학식 1의 화합물은 3-[3-(1H-인돌-3-일)-아크릴아미도]-벤즈아마이드(RSC-133), 또는 이의 약학적으로 허용가능한 염일 수 있다.
본 발명의 분화된 세포 및 다능성 줄기세포는 상기에서 설명한 바와 같다.
상기 역분화는 조성물을 처리하지 않은 대조군에 비하여 HDAC1의 기능이 억제되고 H3K9ace 레벨을 증가되는 특징을 보일 수 있다.
다른 하나의 양태로서, 본 발명은 (a) 분화된 세포에 역분화 유도인자를 전달하는 단계; 및 (b) 분화된 세포를 상기 역분화 촉진용 조성물을 함유하는 배지에서 배양하는 단계를 포함하는, 분화된 세포에서 역분화된 다능성 줄기세포를 제조하는 방법을 제공한다.
상기 (a) 단계의 역분화 유도인자를 분화된 세포에 전달하는 방법은 당업계에서 통상적으로 사용되는 세포에 핵산분자 또는 단백질을 제공하는 방법을 제한 없이 사용할 수 있으나, 바람직하게는 역분화 유도인자를 분화된 세포의 배양액에 투여하는 방법, 역분화 유도인자를 분화된 세포에 직접 주입하는 방법 또는 역분화 유도인자의 유전자를 삽입한 바이러스 벡터로 트랜스펙션시킨 패키징 세포로부터 수득한 바이러스로 분화된 세포를 감염시키는 것인 방법을 사용할 수 있다.
상기 역분화 유도인자를 분화된 세포에 직접 주입하는 방법은 당업계에 공지된 임의의 방법을 선택하여 사용할 수 있으며, 이에 제한되지는 않으나, 미세주입법(microinjection), 전기천공법(electroporation), 입자 분사법(particle bombardment), 직접근육주입법, 인슐레이터(insulator) 및 트랜스포존을 이용한 방법 중에서 적절하게 선택하여 적용할 수 있다.
본 발명의 역분화 유도인자는 상기에서 설명한 바와 같다.
본 발명에 있어서, 상기 패키징 세포는 사용된 바이러스 벡터에 따라 당업계에 공지된 다양한 세포를 선택하여 사용할 수 있으며, 이에 제한되지는 않으나, 바람직하게는 GP2-293 패키징 세포를 사용할 수 있다.
또한, 상기 바이러스 벡터는 레트로바이러스(Retroviruses), 예를 들어 HIV(Human immunodeficiency virus), MLV(Murine leukemia virus), ASLV(Avian sarcoma/leukosis), SNV(Spleen necrosis virus), RSV(Rous sarcoma virus), MMTV(Mouse mammary tumor virus) 등, 렌티바이러스(Lentiviruses), 아데노바이러스(Adenovirus), 아데노-관련 바이러스(Adeno-associated virus), 헤르페스 심플렉스바이러스(Herpes simplex virus) 등에서 유래한 벡터를 포함할 수 있으며, 이에 제한되지는 않으나, 바람직하게는 레트로바이러스 벡터를 사용할 수 있고, 보다 바람직하게는 레트로바이러스 벡터 pMXs를 사용할 수 있다.
상기 (a) 및 (b)의 단계는 동시, 순차적 또는 역순으로 수행될 수 있다. 상기 방법은 단계 (b)로부터 얻어진 배양물로부터 배아줄기세포-유사 콜로니를 분리하는 단계를 추가로 포함할 수 있다.
다른 하나의 양태로서, 본 발명은 화학식 1의 화합물, 또는 이의 약학적으로 허용가능한 염을 포함하는 다능성 줄기세포의 미분화 상태 유지 및 배양용 조성물을 제공한다. 본 발명에서는 화학식 1의 화합물, 또는 이의 약학적으로 허용가능한 염을 포함하는 조성물을 이용하여 다능성 줄기세포를 미분화 상태로 유지시키는 기능을 포함할 수 있다.
본 발명의 일 실시예에서는, 대표적인 인간 다능성 줄기세포인 H9 인간 배아줄기세포를 분화 상태가 유도되기 쉬운 배양조건인 unconditioned medium (UM)을 이용하여 배양하고 신규한 화합물인 RSC-133을 처리하는 경우 분화 유도가 억제되고 미분화 상태를 유지할 수 있는지 조사하였다. 도 29에서 나타난 바와 같이 신규한 화합물인 RSC-133을 처리한 배양조건에서 분화 유도가 억제되고 미분화 상태가 conditioned medium (CM)에서 배양한 수준으로 개선됨을 확인하였다. 또한, RSC-133을 처리한 배양조건에서 hESC-특이 인자의 발현이 CM에서 배양한 수준으로 유지되고(도 30), 특히, 후성유전학적 활성화 상태를 검증할 수 있는 H3K9 아세틸화 상태가 CM에서 배양된 미분화 hESC와 유사한 수준으로 유지되고 있음(도 31)을 검증함으로써 RSC-133이 인간 다능성 줄기세포의 미분화 상태 유지를 개선하고, 증진시키는데 효과적으로 작용함을 확인하였다.
본 발명에 있어서, 상기 화학식 1의 화합물 또는 이의 약학적으로 허용가능한 염은 다능성 줄기세포를 미분화 상태로 유지시키기에 충분한 양으로 포함될 수 있다. 상기 배지 조성물에는 미분화 다능성 줄기세포를 배양하기 위해 바람직하게는 0.01 초과 내지 50 μM 미만의 농도의 RSC-133을 포함하며, 보다 바람직하게는 0.1 초과 내지 20 μM 미만의 농도의 RSC-133을 포함한다. 가장 바람직하게는 5 초과 내지 15 μM 이하 농도의 RSC-133을 포함한다.
또한, 본 발명에 있어서, 상기 배지 조성물에는 N2 보충물, B27 보충물, bFGF 및 TGF 로 이루어진 군에서 선택되는 1종 이상이 추가로 포함될 수 있으며, 이 때, 상기 N2 보충물과 B27 보충물은 1:1의 비율로 제공되고, 상기 bFGF는 4-100 ng/ml의 농도로 제공되고, 상기 TGF 는 1-10ng/ml의 농도로 제공될 수 있다.
또한, 본 발명에 있어서, 상기 배지 조성물에는 기 알려진 chemically defined medium의 조성물의 1종 이상이 추가로 포함될 수 있으며, RSC-133을 첨가함으로써 chemically defined medium의 조성 및 효능을 개선할 수 있다.
또 다른 양태로서, 본 발명은 배아줄기세포를 수득하는 단계; 및 상기 배아줄기세포를 상기 배지 조성물을 포함하는 배양 조건 하에서 배양하여 배아줄기세포주를 수득하는 단계를 포함하는 미분화 상태로 유지될 수 있는 배아줄기세포주의 확립방법을 제공한다.
이때, 상기 배아줄기세포는 인간, 원숭이, 돼지, 말, 소, 양, 개, 고양이, 생쥐, 토끼 등의 모든 유래의 배아줄기세포를 포함하나, 바람직하게는 인간 유래의 배아줄기세포이다.
또 다른 하나의 양태로서, 본 발명은 상기 미분화 상태 유지 및 배양용 다능성 줄기세포의 조성물 상에서 다능성 줄기세포를 배양하는 단계를 포함하는 미분화 상태를 유지하면서 다능성 줄기세포를 배양하는 방법을 제공한다.
이 때, 상기 방법은 동물 혈청 및 영양세포를 이용하거나 또는 이용하지 않는 상태로 배아줄기세포를 미분화 상태로 유지시킬 수 있다.
이때, 상기 배아줄기세포는 인간, 원숭이, 돼지, 말, 소, 양, 개, 고양이, 생쥐, 토끼 등의 모든 유래의 배아줄기세포를 포함하나, 바람직하게는 인간 유래의 배아줄기세포이다.
다른 하나의 양태로서, 본 발명은 다능성 줄기세포; 및 상기 다능성 줄기세포가 다수의 연속 계대 배양을 통해서 미분화 상태로 유지되도록 상기 배지 조성물을 포함하는 시험관 내 세포 배양물을 제공한다.
본 발명은 다능성 줄기세포에 RSC-133을 포함하는 미분화 상태 유지 및 배양용 다능성 줄기세포의 조성물을 처리하여 얻어지는 시험관 내 모든 세포 배양물을 포함한다. 이는 배양 과정에 있는 각종 세포들과 이를 배양하는 과정에서 얻어지는 각종 단백질 및 효소, 전사체들과 이를 함유하는 배양액까지 포함한다.
본 발명의 다능성 줄기세포는 상기에서 설명한 바와 같다.
본 발명에 의하면, 인간 분화세포에서 다능성 줄기세포를 제작하기 위한 역분화 유도 배양과정에 신규한 저분자 화합물 RSC-133을 첨가하면, 역분화 유도 효율을 증진시킬 수 있을 뿐만 아니라 역분화 유도에 소요되는 시간을 획기적으로 줄일 수 있다. 특히, 역분화 유도인자이자 암유발 위험인자인 c-Myc을 대체할 수 있는 것으로 확인되었으며, 정상산소 배양 조건 및 저산소 배양조건에서도 역분화 유도 효율을 모두 효과적으로 증진시킬 수 있음을 확인하였다. 또한, RSC-133은 역분화 유도 과정 중에서 발생하는 노화 유도를 억제하고 세포 증식 둔화를 증진시키는 효과를 나타내며, 후성유전학적 활성화를 유도함으로써 역분화 유도 배양조건을 개선하고 있음을 검증하였다. 본 발명은 다양한 소스에서 확보된 적은 양의 환자-특이적 체세포로부터 유도 만능 줄기세포를 제작과정을 최적화하는데 기여함으로써 임상적용 가능한 개인 맞춤형 줄기세포 세포 치료제 개발 및 신약개발과정을 획기적으로 개선하고, 실용화시기를 앞당기는데 기여할 것이다. 또 다른 양태로써, 본 발명에 의하면, 신규한 저분자 화합물 RSC-133이 대표적인 다능성 줄기세포인 인간 배아줄기세포의 미분화 상태 유지에 효과적인 배양 배지 조성물이 될 수 있음을 확인하였다. RSC-133이 첨가된 배지 조성물은 인간 배아줄기세포의 미분화 증식을 효과적으로 유도할 수 있으며, 배아줄기세포의 대량 배양 시스템을 개발하는데 유용하게 사용될 수 있을 것으로 기대한다.
도 1은 신규 합성물질인 트랜스-3-인돌아크릴산 기반 합성물의 아날로그 라이브러리 스크리닝을 이용한 마우스 세포의 역분화 조절인자 발굴 과정을 보여 준다. 역분화 줄기세포 생성을 촉진하는 저분자성 화합물을 발굴하기 위해 마우스 배아 섬유아세포 (OG2-MEF: hemizygous for the Oct4-GFP transgene)를 Oct4, Sox2, Klf4, 그리고 c-Myc의 역분화 인자 바이러스로 형질전환 시켰다. 5일 후, 젤라틴 코팅 플레이트에 분주하고 각각의 저분자 화합물을 포함한 마우스 배아줄기세포 배양액으로 마우스 줄기세포와 유사한 모양을 가진 콜로니가 형성될 때 까지 배양하였다. 15일 후 endogenous Oct4 GFP 형광이 발현되는 콜로니 수를 측정하여 대조군에 비해 역분화 효율을 증진 시킨 화합물을 발굴하였다. A는 마우스 배아 섬유아세포에서 역분화를 유도하는 실험 과정을 보인 도면이다. Oct4 (O), Sox2 (S), Klf4 (K), 그리고 cMyc (M). B는 스크리닝한 화합물 중 RSC-133과 558에 의해 역분화 유도 효율이 증가된 결과를 보인 그래프이다. 그래프 상의 값은 평균값을 나타낸다. 상기 데이터를 평균 ± SD (n=3)으로 나타내었다.
도 2a는 신규 저분자 화합물인 133에 의한 역분화 효율 증진 효과를 비교 분석한 도면이다. 역분화 줄기세포 생성을 촉진한다고 보고된 저분자성 화합물인 DNA methyltransferase inhibitor (5-Azacytidine; AZA), G9a histone methyltransferase inhibitor (BIX-01294), 그리고 histone deacetylase inhibitor (Valproic acid; VPA)와 신규 저분자성 화합물 133의 역분화 증진 효과를 endogenous Oct4 GFP 형광이 발현되는 콜로니 수 측정을 통해 비교 분석하였다. RSC-133을 첨가했을 경우, 다른 화합물을 처리하거나 혹은 Oct4, Sox2, Klf4, 그리고 c-Myc(OSKM)의 역분화 인자 바이러스를 증가시켰을 때 보다 대조군에 비해 가장 크게 역분화 효율을 촉진시켰다. 그래프 상의 값은 평균값을 나타낸다. 상기 데이터를 평균 ± SD (n=3)으로 나타내었다(**P < 0.05).
도 2b는 신규 저분자 화합물인 133에 의한 역분화 효율 증진 효과를 비교 분석한 도면이다. 인간 피부 섬유아세포 (hFF)에 OSKM 역분화 인자를 삽입하고 역분화를 유도하는 과정에서 AZA(0.5 μM), VPA(1 mM), TSA(20 nM), SB431542(10 μM)와 RSC 133(10 μM)를 처리하여 AP 양성 콜로니의 수를 세어 역분화 효율을 측정하였다. 그래프 상의 값은 평균값을 나타낸다. 상기 데이터를 평균 ± SD (n=3)으로 나타내었다.
도 3은 신규 합성물질인 트랜스-3-인돌아크릴산 기반 합성물의 아날로그 라이브러리 스크리닝을 이용하여 인간 피부 섬유아세포 (hFF)의 역분화 조절인자를 발굴한 결과이다. 역분화 줄기세포 생성을 촉진하는 저분자성 화합물을 발굴하기 위해 인간 피부 섬유아세포를 Oct4, Sox2, Klf4, 그리고 c-Myc의 역분화 인자 바이러스로 형질전환시켰다. 5일 후, 마트리겔 코팅 플레이트에 분주하고 각각의 저분자 화합물을 포함한 MEF-조건 배양액 (MEF-conditioned medium; CM)으로 인간 배아 줄기세포와 유사한 모양을 가진 콜로니가 형성될 때 까지 배양하였다. 15일 후 Alkaline phosphatase (AP) 활성도를 측정하여 대조군에 비해 역분화 효율을 증진 시킨 화합물질을 발굴하였다. RSC-133이 마우스 배아 섬유아세포에서와 유사하게 인간 피부 섬유아세포의 역분화 효율을 증진시켰다. 그래프 상의 값은 평균값을 나타낸다. 상기 데이터를 평균 ± SD (n=3)으로 나타내었다.
도 4는 인간 피부 섬유아세포에서 신규 저분자 화합물 133이 정상조건(21% O2) 뿐만 아니라 저산소조건(5% O2)에서도 대조군에 비해 역분화 효율 증진 효과를 나타내는 결과를 보여준다. 기존 보고에 따르면 저산소조건에서 역분화 효율이 증가한다. 133은 이러한 저산소조건에 의해 촉진된 역분화 과정에 시너지 효과를 더할 수 있다. A는 AP 활성도를 측정한 그래프이다. B는 저산소조건에서 133을 첨가시 형성된 역분화 줄기세포 콜로니 모양이다.
도 5는 신규 저분자 화합물 133 첨가에 의한 인간 피부 섬유아세포로부터 역분화 줄기세포의 역분화 유도 시에 기존 역분화 인자 (c-Myc)에 대한 대체 효과를 조사한 결과이다. RSC-133 단독으로는 대체 효과를 보이지 않으나 Sodium butylate (NaB)와 함께 첨가시 c-Myc 인자를 대체하여 대조군에 비해 역분화 유도 효율을 증진시켰다. AP-양성 콜로니 수를 측정하여 역분화 유도 효율을 그래프로 나타냈다. 그래프 상의 값은 평균값을 나타낸다. 상기 데이터를 평균 ± SD (n=3)으로 나타내었다. 그래프 상의 값은 평균값을 나타낸다.
도 6은 RSC-133의 1H NMR data이다.
도 7은 RSC-133의 순도를 점검한 HPLC data이다.
도 8은 RSC-133이 역분화 유도 배양액에 첨가된 농도에 의존적으로 역분화 효율을 증가시키는 결과이다. 위 패널은 실험 과정을 도식화한 도면이다. 아래 패널은 처리한 RSC-133 농도에 따른 AP-양성 콜로니 수를 측정하여 역분화 유도 효율을 나타낸 그래프이다. 그래프 상의 값은 평균값을 나타낸다. 상기 데이터를 평균 ± SD (n=3)으로 나타내었다 (** P< 0.005, by t-test).
도 9는 RSC-133이 인간 피부 섬유아세포의 세포 독성에 미치는 영향을 조사한 그래프이다. 각각의 RSC-133 농도를 처리하고 72시간이 지난 후 MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, a yellow tetrazole) assays로 세포 독성을 측정하였다. 그래프 상의 값은 평균값을 나타낸다. 상기 데이터를 평균 ± SD (n=3)으로 나타내었다.
도 10은 RSC-133이 관여하는 역분화 과정 및 이를 이용한 효율적 역분화 방법을 조사한 결과이다. 왼쪽 패널은 실험 과정을 도식화한 도면이다. 오른쪽 패널은 RSC-133을 역분화 과정의 서로 다른 기간 동안 첨가한 후 AP 활성도를 나타내는 콜로니 개수를 계산하여 측정한 역분화 효율이다. 그래프 상의 값은 평균값을 나타낸다. 상기 데이터를 평균 ± SD (n=3)으로 나타내었다 (* P< 0.05, ** P< 0.005, by t-test).
도 11은 역분화 과정 동안 RSC-133이 세포 성장에 미치는 영향을 조사한 그래프이다. 실시예는 도 10과 같다. 그래프 상의 값은 평균값을 나타낸다. 상기 데이터를 평균 ± SD (n=3)으로 나타내었다.
도 12는 인간 피부 섬유아세포 혹은 역분화인자 (OSKM) 바이러스를 감염시킨 인간 피부 섬유아세포에서 RSC-133이 세포 성장에 미치는 영향을 조사한 그래프이다. 그래프 상의 값은 평균값을 나타낸다. 상기 데이터를 평균 ± SD (n=3)으로 나타내었다.
도 13은 역분화 과정 동안 RSC-133이 proliferating cell population을 증가시키는 결과를 나타낸 도면이다. Bromodeoxyuridine (BrdU)에 대한 단클론 항체를 이용하여 면역세포화학분석한 후 BrdU 양성 세포 %를 그래프에 도시하였다. 그래프 상의 값은 평균값을 나타낸다. 상기 데이터를 평균 ± SD (n=3)으로 나타내었다 (* P< 0.05, by t-test).
도 14는 역분화인자 (OSKM) 바이러스를 감염시킨 인간 피부 섬유아세포에서 RSC-133이 proliferating cell population을 증가시키는 결과를 나타낸 도면이다. 왼쪽 패널은 BrdU에 대한 단클론 항체를 이용하여 면역세포화학분석한 결과의 대표 사진이며, 오른쪽 패널은 BrdU 양성 세포 %를 측정하여 나타낸 그래프이다. 그래프 상의 값은 평균값을 나타낸다. 상기 데이터를 평균 ± SD (n=3)으로 나타내었다.
도 15는 RSC-133의 처리 유무에 따라 BrdU 및 미분화마커 (Nanog와 Tra1-81)에 대한 단클론 항체를 이용하여 면역세포화학분석한 결과의 대표 사진을 비교 분석한 결과이다. 인간 피부 섬유아세포를 역분화 유도하고 RSC-133을 처리하거나 처리하지 않고 10일 동안 배양한 후, 각각의 세포를 면역세포화학분석하였다. (크기 바=200 μm)
도 16은 RSC-133이 역분화 과정에 미치는 영향을 조사한 결과이다. 역분화 유도 과정 동안 발현되는 mRNA의 상대적인 레벨을 측정한 결과, RSC-133을 처리하여 역분화를 유도한 실험군에서 미분화 마커인 Nanog, Oct4, 그리고 Rex1 발현이 상대적으로 증가되었고, 역분화를 억제하는 기작으로 알려진 p53, p21, 그리고 p16 발현이 상대적으로 억제되었음을 확인하였다.
도 17은 RSC-133이 역분화 과정에서 세포 주기 정지(세포 노화)에 미치는 영향을 조사한 결과이다. 역분화 유도 과정 동안 SA-β-Gal 측정을 통하여 세포 주기 정지의 정도를 측정한 결과, RSC-133을 처리하여 역분화를 유도한 실험군에서 세포 주기 정지가 상대적으로 감소되었음을 확인하였다. 그래프 상의 값은 평균값을 나타낸다. 상기 데이터를 평균 ± SD으로 나타내었다(크기 바=200 μm, **P<0.01).
도 18은 역분화 과정 중에 RSC-133이 히스톤 acetylation (H3K9ace)에 미치는 영향을 조사한 도면이다. 왼쪽 패널은 인간 피부 섬유아세포를 역분화 유도하고 RSC-133을 처리하거나 처리하지 않고 10일 동안 배양한 후, H3K9ace 및 미분화마커 (Nanog)에 대한 단클론 항체를 이용하여 면역세포화학분석한 결과의 대표 사진이다. (크기 바=200 μm) 오른쪽 패널은 western blot으로 H3K9ace 레벨을 측정한 도면이다. H3 단백질은 내부 대조군으로 확인했다.
도 19는 인간 피부 섬유아세포의 역분화 과정 동안 RSC-133이 histone deacetylase (HDAC)을 저해할 수 있는지 확인한 도면이다. 왼쪽 패널은 RSC-133의 처리 유무에 따른 역분화 과정 동안 총 HDAC 효소의 활성도를 측정한 결과이다. 오른쪽 패널은 RSC-133을 처리하거나 처리하지 않고 10일 동안 배양한 후 측정한 HDAC1의 단백질 양을 나타낸다. 그래프 상의 값은 평균값을 나타낸다. 상기 데이터를 평균 ± SD (n=3)으로 나타내었다 (* P< 0.01, ** P< 0.005, by t-test).
도 20은 인간 피부 섬유아세포의 역분화 과정 동안 RSC-133이 DNA Methyl Transferase 1(DNMT1)의 활성에 영향을 미치는지 확인한 도면이다. 그래프는 OSKM을 도입한 인간 피부 섬유아세포에 RSC-133을 처리하거나 처리하지 않고 10일 동안 배양한 후 측정한 DNMT1의 활성을 나타낸다. 처리하지 않았을 때 DNMT1의 활성을 100%로 하여 비교하였다.
도 21은 RSC-133의 처리 유무에 따른 인간 피부 섬유아세포의 역분화 과정 동안 HDAC family 단백질 양의 변화를 나타낸 도면이다. 위 패널은 실험 과정을 도식화한 도면이다. 아래 패널은 HDAC family 단백질 변화량을 western blot으로 확인한 결과이다. GAPDH 단백질은 내부 대조군으로 확인했다.
도 22는 RSC-133 첨가에 의해 인간 피부 섬유아세포로부터 유도된 역분화 줄기세포주(RSC133-iPS)의 인간배아줄기세포 마커 발현 특성을 면역 염색법으로 분석한 도면이다.
도 23은 RSC-133 첨가에 의해 인간 피부 섬유아세포로부터 유도된 역분화 줄기세포주(RSC133-iPS)의 줄기세포 마커 유전자 및 역분화 인자 발현을 RT-PCR 분석한 결과이다. 전부(Total), 내인성(Endo) 및 레트로바이러스 발현(Trans) 유전자간의 상대적 발현을 결정할 수 있는 이식 유전자-특이적 PCR 프라이머를 사용하여 반-정량 RT-PCR을 수행하였다.
도 24는 RSC-133 첨가에 의해 인간 피부 섬유아세포로부터 유도된 역분화 줄기세포주(RSC133-iPS), H9 인간배아줄기세포(hES) 및 인간 피부 체세포(hFF)에서의 Oct4 및 Nanog 전사인자 프로모터 메틸화 패턴을 분석한 결과를 나타낸다. 각 원의 수평열은 하나의 앰플리콘으로부터의 개별적인 서열을 나타낸다. 빈 원 및 검정 원은 각각 디메틸화된 CpG 및 메틸화된 CpG를 나타내며, 메틸화된 CpG의 비율을 %로 나타내었다.
도 25는 RSC-133 첨가에 의해 인간 피부 섬유아세포로부터 유도된 역분화 줄기세포주(RSC133-iPS)의 게놈내 유전자 삽입을 분석한 결과이다.
도 26은 RSC-133 첨가에 의해 인간 피부 섬유아세포로부터 유도된 역분화 줄기세포주(RSC133-iPS)가 정상 핵형 (46, XY)을 보존하고 있음을 나타내는 결과이다.
도 27은 RSC-133 첨가에 의해 인간 피부 섬유아세포로부터 유도된 역분화 줄기세포주(RSC133-iPS)의 배아체 형성을 통하여 삼배엽 분화능을 보존하고 있음을 보인 면역세포화학분석 사진이다. FOXA2 (내배엽), Sox17 (내배엽), α-SMA (α-smooth muscle actin, 중배엽), desmin (중배엽), Tuj1 (외배엽), 및 Nestin (외배엽)의 면역세포화학분석 사진이며, 핵을 DAPI로 염색하였다 (파란색).
도 28은 RSC-133 첨가에 의해 인간 피부 섬유아세포로부터 유도된 역분화 줄기세포주(RSC133-iPS)의 생체내 분화능을 증명하기 위한 테라토마 형성을 나타낸 사진이다.
도 29는 만능성 획득에 관여하는 RSC-133의 기능을 조사한 도면이다. H9 인간 배아줄기세포 (hES)를 unconditioned medium (UM)에서 배양 시 분화가 유도되지만, RSC-133을 UM에 첨가하고 배양할 경우 유도된 분화 정도가 억제되고 만능성이 재획득된 것을 관찰하였다. 만능성 획득 효율은 AP 활성도를 나타내는 콜로니 개수를 계산하여 측정하였다. 그래프 상의 값은 평균값을 나타낸다. 상기 데이터를 평균 ± SD (n=3)으로 나타내었다 (*P< 0.01, ** P< 0.005, by t-test).
도 30은 RSC-133 첨가에 의해 H9 인간 배아줄기세포의 미분화 마커 (Oct4와 Tra1-81) 발현 특성을 면역 염색법으로 분석한 도면이다. H9 인간 배아줄기세포를 UM에서 배양하고, RSC-133 혹은 VPA를 첨가했다. CM은 양성 대조군으로 관찰하였다. 핵은 DAPI로 염색하였다 (파란색). (크기 바=200 μm)
도 31은 RSC-133의 처리 유무에 따른 H9 인간 배아줄기세포의 미분화 마커 (Oct4) 혹은 H3K9ace 단백질 양의 변화를 western blot으로 확인한 도면이다. 인간 피부 섬유아세포 (hFF)는 음성 대조군으로 확인했다. H3 및 GAPDH 단백질은 내부 대조군으로 확인했다.
이하, 하기 실시예를 통하여 본 발명을 더욱 상세하게 설명하기로 한다. 이들 실시예는 단지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다.
실시예 1. 저분자성 화합물군
1-1. 저분자성 화합물 합성 방법
상기 RSC-133 (3-[3-(1H-인돌-3-일)-아크릴아미도]-벤즈아마이드; 3-(3-1H-Indol-3-yl-acryloylamino)-benzamide)을 포함하는 저분자성 화합물은 하기 반응식 1과 같은 방법으로 합성되었다.
[반응식 1]
Figure PCTKR2012009420-appb-I000001
반응물 및 조건: a) 2a는 H2SO4; 2b-e는 i) SOCl2, MeOH; ii) BnBr, K2CO3, DMF; iii) LiOH, THF, H2O; iv) NH4Cl, EDC, HOBt, DIPEA, DMF (2b); NH2CH3, NH2CH(CH3)2, 또는 NH(CH3)2, 50% PPAA, Et3N, acetonitrile (2c-e); b) H2, 5%Pd/C, MeOH; c) 5a-b는 NH2CH3, 또는 NH(CH3)2, 50% PPAA, Et3N, acetonitrile; d) H2, 10% Pd/C, MeOH; e) EDC, HOAt, 또는 HOBt, DIPEA, DMF; PyBOP, DIPEA, DMF; DCC, DIPEA, THF; f) LiOH, THF/H2O; g) 10a-c는 furfuryamine, 2-piperidin-1-yl-ethylamine, 또는 3-morpholin-4-yl-propylamine, HATU, DIPEA, DMF; 10d는 2-bromopropane, ionic liquid, DMF.
본 합성과정에서는 모든 상업적 화합물은 시약 1등급을 사용하였으며, 추가적인 정제없이 사용하였다. 용액은 표준 절차를 통해 건조되었다. 모든 반응들은 불로 건조된 유리장치에서 건조 아르곤 1기압 하에서 이루어졌다. 양자 핵 자기 공명(1H-NMR) 스펙트럼은 Varian (400 MHz 또는 300 MHz) 스펙트로미터에서 측정하였다. 모든 반응의 결과물들은 별도의 명시가 없는 한, 실리카 겔 60 (230-400 mesh Kieselgel 60)을 이용한 플래시 컬럼 크로마토그래피(flash column chromatography)나 글래스백 실리카겔 플레이트(glass-backed silica gel plates, 1 mm thickness)를 이용한 분리용 얇은 막 크로마토그래피(thin layer chromatography)를 통해 정제되었다. 추가로, 0.25 mm 실리카 플레이트(silica plates, E. Merck, silica gel 60 F254)에서의 얇은막 크로마토그래피를 통해 반응을 모니터링했다. 크로마토그램은 요오드 증기에 노출시키고, PMA나 Hanessian 용액에 담근 뒤 자외선 빛을 이용하여 시각화했다.
상기 반응식에서 2a 화합물에 해당하는 이소프로필 4-히드록시-3-니트로벤조에이트(Isopropyl 4-hydroxy-3-nitrobenzoate)는 다음과 같은과정을 통해 제조되었다. 먼저, 2-프로필 알코올(25mL)에 4-히드록시-3-니트로-벤조산(2.0 g, 10.9 mmol)를 녹인 용액에, 황산(H2SO4 98%)을 0 ℃에서 적하첨가한 후, 해당 혼합액을 48 시간동안 아르곤 존재 하에서 환류(reflux)하였다. 반응이 종료된 후, 해당 반응혼합액을 감압환경에서 농축하였다. 결과물들을 실리카겔 컬럼 크로마토그래피(n-Hexane:EtOAc = 5:1)를 통해 정제하여 이소프로필 4-히드록시-3-니트로벤조에이트(2a)를 노란 고체 형태(2.11g)로 얻었다. 해당 화합물은 1H NMR (CDCl3, 300 MHz) δ = 10.87 (s, 1H), 8.79 (d, J = 1.2 Hz, 1H), 8.23 (dd, J = 1.8 Hz, 8.7 Hz, 1H), 7.22 (t, J = 11.7 Hz, 1H), 5.30 (s, 2H), 5.26 (m, 1H), 1.38 (d, J = 6.6 Hz, 6H)의 성격을 가진다.
상기 반응식에서 2b 화합물에 해당하는 4-벤질록시-3-니트로벤즈아마이드(4-Benzyloxy-3-nitrobenzamide)는 다음과 같은 과정을 통해 제조되었다. 먼저, DMF(15mL)에 4-벤질록시-3-니트로벤조산(4-benzyloxy-3-nitrobenzoic acid1-3, 1 g, 3.6 mmol)과 염화암모늄(ammonium chloride, 294 mg, 5.5 mmol)을 녹인 용액에 EDC (842 mg, 4.4 mmol), HOBt (593 mg, 4.4 mmol) 및 DIPEA (1.6 mL, 9.15 mmol)를 첨가하였다 해당 반응액을 실온에서 하룻밤 교반시킨 후, 물로 냉각시켜 EA로 추출한다. 결과물들을 실리카겔 컬럼 크로마토그래피(n-Hexane:EA = 7:3)를 통해 정제하였다(980 mg). 해당 화합물은 1H NMR (CDCl3, 400 MHz) δ = 8.39 (d, J = 2.4 Hz, 1H), 8.08 (dd, J = 2.0 Hz, 8.4 Hz, 1H), 7.32-7.46 (m, 5H), 7.16 (d, J = 8.8 Hz, 1H), 5.30 (s, 2H)의 성격을 가진다.
본 반응의 아미드계 2c-e를 제조하는 과정은 다음과 같다. 4-벤질록시-3-니트로벤조산(4-benzyloxy-3-nitrobenzoic acid 1-3, 500 mg, 1.0 equiv)은 아세토니트릴과 Et3N(4.0 equiv)에 현탁시키고, 이에 50 % PPAA (1.2 equiv)를 첨가하여 실온에서 30분간 교반하고, 적절한 아민을 첨가하였다. 반응액을 하룻밤 교반시킨 후 증발시켜 건조하였다. 결과물들을 컬럼 크로마토그래피를 통해 정제하여 화합물 2c-e를 수득하였다.
1) 4-벤질록시-N-메틸-3-니트로벤즈아마이드(4-Benzyloxy-N-methyl-3-nitrobenzamide, 2c)는 하얀 고체 형태로 수득되며, 1H NMR (CDCl3, 300 MHz) δ = 8.24 (d, J = 2.1 Hz, 1H), 7.99 (dd, J = 2.4 Hz, 9.0 Hz, 1H), 7.34-7.46 (m, 5H), 7.17 (d, J = 8.7 Hz, 1H), 6.14 (br s, 1H), 5.30 (s, 2H), 3.02 (d, J = 5.1 Hz, 3H)의 성격을 가진다.
2) 4-벤질록시-N-이소프로필-3-니트로벤즈아마이드(4-Benzyloxy-N-isopropyl-3-nitrobenzamide, 2d)는 하얀 고체 형태로 수득되며, 1H NMR (CDCl3, 300 MHz) δ = 8.21 (d, J = 2.1 Hz, 1H), 7.99 (dd, J = 2.1 Hz, 8.7 Hz, 1H), 7.32-7.46 (m, 5H), 7.16 (d, J = 8.7 Hz, 1H), 5.89 (d, J = 7.2 Hz, 1H), 5.30 (s, 2H), 4.27 (m, 1H), 1.27 (d, J = 6.6 Hz, 6H)의 성격을 가진다.
3) 4-벤질록시-N,N-디메틸-3-니트로벤즈아마이드(4-Benzyloxy-N,N-dimethyl-3-nitrobenzamide, 2e)는 하얀 고체 형태로 수득되며, 1H NMR (CDCl3, 300 MHz) δ = 7.96 (d, J = 1.5 Hz, 1H), 7.63 (dd, J = 2.1 Hz, 8.7 Hz, 1H), 7.34-7.46 (m, 5H), 7.15 (d, J = 8.7 Hz, 1H), 5.28 (s, 2H), 3.07 (br s, 6H)의 성격을 가진다.
화합물 2a 내지 2e를 환원시켜 화합물 3a 내지 3e를 제조하는 과정은 다음과 같다. 화합물 2a 내지 2e를 무수 MeOH에 용해시킨 후, 아르곤 조건 하에서 5% 탄화 팔라딘(palladium carbon)을 첨가하였다. 반응액을 수소 조건에서 하룻밤 교반시킨 후, 셀라이트 패드를 통해 필터링하고, 추가적인 정제과정 없이 농축하여 조생성물(crude product)를 얻었다.
1) 이소프로필 3-아미노-4-히드록시벤조에이트(Isopropyl 3-amino-4-hydroxybenzoate, 3a)는 화합물 2a로부터 옅은 노란색 고체 형태로 수득되며, 1H NMR (CDCl3, 300 MHz) δ = 7.43 (s, 1H), 7.38 (d, J = 8.7 Hz, 1H), 6.74 (d, J = 8.1 Hz, 1H), 5.19 (m, 1H), 1.33 (d, J = 6.6 Hz, 6H)의 성격을 가진다.
2) 3-아미노-4-히드록시벤즈아마이드(3-Amino-4-hydroxybenzamide, 3b)는 화합물 2b로부터 갈색 반고체 형태로 수득되며, 1H NMR (DMSO-d6, 400 MHz) δ = 7.48 (s, 1H), 7.11 (d, J = 8.7 Hz, 1H), 6.95 (dd, J = 2.0 Hz, 8.4 Hz, 1H), 6.84 (br s, 1H), 6.61 (d, J = 8.4 Hz, 1H)의 성격을 가진다.
3) 3-아미노-4-히드록시-N-메틸벤즈아마이드(3-Amino-4-hydroxy-N-methylbenzamide, 3c)는 화합물 2c로부터 옅은 노란색 고체 형태로 수득되며, 1H NMR (DMSO-d6, 300 MHz) δ = 7.96 (d, J = 4.5 Hz, 1H), 7.10 (d, J = 2.1 Hz, 1H), 6.92 (dd, J = 2.1 Hz, 8.1 Hz, 1H), 6.63 (d, J = 8.1 Hz, 1H), 4.61 (br s, 2H), 2.70 (d, J = 4.5 Hz, 3H)의 성격을 가진다.
4) 3-아미노-4-히드록시-N-이소프로필벤즈아마이드(3-Amino-4-hydroxy-N-isopropylbenzamide, 3d)는 화합물 2d로부터 옅은 노란색 고체 형태로 수득되며, 1H NMR (DMSO-d6, 300 MHz) δ = 7.73 (d, J = 8.1 Hz, 1H), 7.10 (d, J = 1.5 Hz, 1H), 6.94 (dd, J = 2.1 Hz, 8.1 Hz, 1H), 6.62 (d, J = 7.8 Hz, 1H), 4.60 (br s, 2H), 4.03 (m, 1H), 1.11 (d, J = 6.6 Hz, 6H)의 성격을 가진다.
5) 3-아미노-4-히드록시-N,N-디메틸벤즈아마이드(3-Amino-4-hydroxy-N,N-dimethylbenzamide, 3e)는 화합물 2e로부터 옅은 노란색 고체 형태로 수득되며, 1H NMR (DMSO-d6, 300 MHz) δ = 9.36 (b, 1H), 6.65 (d, J = 1.5 Hz, 1H), 6.63 (d, J = 8.4 Hz, 1H), 6.46 (dd, J = 2.1 Hz, 7.8 Hz, 1H), 4.64 (br s, 2H), 2.92 (s, 6H)의 성격을 가진다.
본 반응의 아미드계 5a 및 5b를 제조하는 과정은 다음과 같다. 3-니트로벤조산(3-nitrobenzoic acid, 400 mg, 1.0 equiv)을 아세토니트릴과 Et3N(4.0 equiv)에 현탁시키고, 이에 50 % PPAA (1.2 equiv)를 첨가하여 실온에서 30분간 교반하고, 적절한 아민을 첨가하였다. 반응액을 하룻밤 교반시킨 후 증발시켜 건조한다. 결과물들을 컬럼 크로마토그래피를 통해 정제하여 화합물 5a-b를 수득하였다.
1) N-메틸-3-니트로벤즈아마이드(N-methyl-3-nitrobenzamide, 5a)는 하얀 고체 형태로 수득되며, 1H NMR (CDCl3, 400 MHz) δ = 8.58 (s, 1H), 8.35-8.37 (m, 1H), 8.16 (d, J = 8.0 Hz, 1H), 5.19 (t, J = 7.6 Hz 1H), 6.23 (br s, 1H), 3.07 (d, J = 4.8 Hz)의 성격을 가진다.
2) N,N-디메틸-3-니트로벤즈아마이드(N,N-dimethyl-3-nitrobenzamide, 5b)는 하얀 고체 형태로 수득되며, 1H NMR (CDCl3, 400 MHz) δ = 8.29 (s, 1H), 8.27 (d, J = 2.4 Hz, 1H), 7.77 (d, J = 7.6 Hz, 1H), 7.62 (t, J = 7.6 Hz 1H), 3.15 (s, 3H), 3.01 (s, 3H) 의 성격을 가진다.
한편, 메틸 3-아미노벤조에이트(Methyl 3-Aminobenzoate, 6a) 및 3-아미노벤즈아마이드(3-Aminobenzamide, 6b)는 상업화된 제품이 이용가능하다.
화합물 5a 또는 5b를 환원시켜 6c 또는 6d를 제조하는 과정은 다음과 같다. 질소 치환된 화합물 5a 나 5b를 무수 MeOH에 용해시킨 후, 아르곤 조건 하에서 5% 탄화 팔라딘(palladium carbon)을 첨가하였다. 반응액을 수소 조건에서 하룻밤 교반시킨 후, 셀라이트 패드를 통해 필터링하고, 추가적인 정제과정 없이 농축하여 조생성물(crude product)를 얻었다.
1) 3-아미노-N-메틸벤즈아마이드(3-Amino-N-methylbenzamide, 6c)는 화합물 5a로부터 하얀 고체 형태로 수득되며, 1H NMR (DMSO-d6, 400 MHz) δ = 8.13 (d, J = 4.0 Hz, 1H), 6.99-7.05 (m, 2H), 6.89 (d, J = 7.2 Hz, 1H), 6.62-6.65 (m, 1H), 5.17 (s, 2H), 2.71 (d, J = 4.8 Hz, 3H)의 성격을 가진다.
2) 3-아미노-N,N-디메틸벤즈아마이드(3-Amino-N,N-dimethylbenzamide, 6d)는 화합물 5b로부터 하얀 고체 형태로 수득되며, 1H NMR (DMSO-d6, 400 MHz) δ = 7.02 (t, J = 7.6 Hz, 1H), 6.55-6.58 (m, 1H), 6.51 (s, 1H), 6.43 (d, J = 7.6 Hz, 1H), 5.18 (s, 2H), 2.89 (d, J = 11.6 Hz, 6H)의 성격을 가진다.
상기 제조한 화합물 3a 내지 화합물 3e 또는 화합물 6a 내지 화합물 6d를 트랜스-3-인돌아크릴산(Trans-3-Indole acrylic acid, 7a) 또는 3-(1H-인돌-3-일)-프로피온산(3-(1H-Indole-3-yl)-propionic acid, 7b)와 반응시켜 상기 반응식의 화합물 8a 내지 8j, 화합물 9, 및 화합물 10a 내지 10d를 제조하였다. 구체적인 제조방법은 하기에 자세히 설명하도록 한다.
1-2. 저분자성 화합물 RSC-133(8b) 합성 방법
상기 저분자성 화합물 중 RSC-133(3-[3-(1H-인돌-3-일)-아크릴아미도]-벤즈아마이드, 8b)은 다음과 같은 방법으로 합성되었다.
먼저, 트랜스-3-인돌아크릴산(7a)과 3-아미노-벤즈아마이드(6b)를 DMF에 녹인 후, 해당 용액에 아마벤조트리아졸-1-일-N-옥시-트리스(피롤리디노)-포스포늄 헥사플루오로포스페이트(PyBOP, Benzotriazol-1-yl-N-oxy-tris(pyrrolidino)-phosphonium hexafluorophosphate) 및 N,N-디아이소프로필에틸아민(DIPEA, N,N-diisopropylethylamine)을 첨가하여 결합조건을 갖춰주었다. 해당 반응액을 실온에서 하룻밤 교반하여 반응시켰다. 이후, 분리 및 정제 과정을 통해 3-[3-(1H-인돌-3-일)-아크릴아미도]-벤즈아마이드(RSC-133)는 노란 고체 형태로 수득되었다. RSC-133의 화학적 특성 및 순도는 1H NMR (도 6), HPLC (도 7)을 통해 확인하였다. 1H NMR (CDCl3, 300 MHz)　d = 8.90 (s, 1H), 8.21 (s, 1H), 7.86-8.03 (m, 4H), 7.76 (d, J = 8.1 Hz, 1H), 7.36-7.41 (m, 3H), 7.20 (m, 2H), 6.60 (d, J = 15.3 Hz, 2H), 3.88 (s, 3H)의 성격을 가진다.
본 실시예에 의해 합성된 RSC-133(3-[3-(1H-인돌-3-일)-아크릴아미도]-벤즈아마이드)는 하기 화학식 2의 구조를 지닌다.
[화학식 2]
Figure PCTKR2012009420-appb-I000002
1-3. 저분자성 화합물 ID-52(8a)의 합성 방법
상기 저분자성 화합물 중 ID-52(3-(3-1H-인돌-3-일-아크릴로일아미노)-벤조산 메틸 에스터, 8a)는 트랜스-3-인돌아크릴산(7a, 150 mg, 0.8 mmol)과 3-아미노-벤조산 메틸 에스터(6a, 218 mg, 1.44 mmol)를 DMF에 녹인 후, 1-[3-(디메틸아미노)프로필]-3-에틸카보다이이미드 하이드로클로라이드 (EDC, 1-[3-(dimethyamino)propyl]-3-ethylcarbodiimide hydrochloride, 230 mg, 1.2 mmol), 히드록시-7-아자베노트리아졸(HOAT, Hydroxy-7-azabenotriazole, 163 mg, 1.2 mmol), 및 N,N-디아이소프로필에틸아민(DIPEA, N,N-diisopropylethylamine, 0.21 mL, 1.2 mmol)를 첨가하여 결합반응을 일으켰다. 해당 반응액을 실온에서 하룻밤 교반하여 반응시켰다. 이후, 분리 및 정제 과정을 통해 3-(3-1H-인돌-3-일-아크릴로일아미노)-벤조산 메틸 에스터(ID-52)는 노란 고체 형태로 수득되며, 1H NMR (CDCl3, 300 MHz) d = 8.90 (s, 1H), 8.21 (s, 1H), 7.86-8.03 (m, 4H), 7.76 (d, J = 8.1 Hz, 1H), 7.36-7.41 (m, 3H), 7.20 (m, 2H), 6.60 (d, J = 15.3 Hz, 2H), 3.88 (s, 3H)의 성질을 갖는다.
1-4. 저분자성 화합물 ID-1027(8c)의 합성 방법
상기 저분자성 화합물 중 ID-1027(3-[3-(1H-인돌-3-일)-아크릴아미도]-N-메틸벤즈아마이드, 8c)은 트랜스-3-인돌아크릴산(7a, 300 mg, 1.6 mmol)과 3-아미노-N-메틸벤즈아마이드(6c, 240 mg, 1.6 mmol)를 DMF에 녹인 후, PyBOP(1.7g, 3.2 mmol), 및 DIPEA(0.84 mL,4.8 mmol)를 첨가하였다. 반응물은 실온에서 하룻밤 교반하고, EA와 brine으로 분리하였다. 유상(organic phase) 분획물을 MgSO4로 건조하고 농축하였다. 이후, 정제과정을 통해 3-[3-(1H-인돌-3-일)-아크릴아미도]-N-메틸벤즈아마이드는 노란 고체 형태로 수득되며, 1H NMR (CD3OD, 400 MHz) d = 8.08 (s, 1H), 7.98 (d, J = 15.2 Hz, 1H), 7.91 (d, J = 8.0 Hz, 1H), 7.88 (dd, J = 1.6 Hz, J = 8.4 Hz, 1H), 7.69 (s, 1H), 7.45-7.47 (m, 2H), 7.21-7.27 (m, 2H), 6.78 (d, J = 15.6 Hz, 1H)의 성질을 갖는다.
1-5. 저분자성 화합물 ID-1028(8d)의 합성 방법
상기 저분자성 화합물 중 ID-1028(3-[3-(1H-인돌-3-일)-아크릴아미도]-N,N-디메틸벤즈아마이드, 8d)은 트랜스-3-인돌아크릴산(7a, 300 mg, 1.6 mmol)과 3-아미노-N,N-디메틸벤즈아마이드(6d, 262.7 mg, 1.6 mmol)를 DMF에 녹인 후, PyBOP(1.7g, 3.2 mmol), 및 DIPEA(0.84 mL,4.8 mmol)를 첨가하였다. 반응물은 실온에서 하룻밤 교반하고, EA와 brine으로 분리하였다. 유상(organic phase) 분획물을 MgSO4로 건조하고 농축하였다. 이후, 정제과정을 통해 3-[3-(1H-인돌-3-일)-아크릴아미도]-N,N-디메틸벤즈아마이드는 노란 고체 형태로 수득되며, 1H NMR (CD3OD, 400 MHz) d = 7.96 (d, J = 8.0 Hz, 1H), 7.92 (d, J = 16.0 Hz, 1H), 7.84 (s, 1H), 7.73 (d, J = 7.6 Hz, 1H), 7.64 (s, 1H), 7.40-7.45 (m, 2H), 7.18-7.25 (m, 2H), 7.13 (d, J = 7.6 Hz, 1H), 6.78 (d, J = 15.6 Hz, 1H), 3.11 (s, 3H), 3.04 (s, 3H)의 성질을 갖는다.
1-6. 저분자성 화합물 ID-134(8e) 합성 방법
상기 저분자성 화합물 중 ID-134(3-[3-1H-인돌-3-일-프로피오닐아미노]벤즈아마이드, 8e)는 3-(1H-인돌-3-일)-프로피온산(7b, 189 mg, 1.0 mmol) 과 3-아미노-벤즈아마이드(6b, 68.1 mg, 0.5 mmol)를 DMF에 녹인 후, 해당 용액에 PyBOP 및 DIPEA를 첨가하여 결합조건을 갖춰주었다. 해당 반응액을 실온에서 하룻밤 교반하여 반응시켰다. 이후, 분리 및 정제 과정을 통해 3-[3-1H-인돌-3-일-프로피오닐아미노]벤즈아마이드(ID-134)는 하얀 고체 형태로 수득되며, 1H NMR (DMSO-d6, 300 MHz) d = 8.02 (s, 1H), 7.75 (d, J = 7.8 Hz, 1H), 7.50 (m, 2H), 7.32 (m, 2H), 6.93-7.09 (m, 3H), 3.04 (t, J = 7.8 Hz, 2H), 2.68 (t, J = 7.2 Hz, 2H)의 성질을 갖는다.
1-7. 저분자성 화합물 ID-514(8f) 합성 방법
상기 저분자성 화합물 ID-514(이소프로필 3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시벤조에이트, 8f)는 트랜스-3-인돌아크릴산(7a, 188 mg, 1.01 mmol), 및 이소프로필 3-아미노-4-히드록시벤조에이트(Isopropyl 3-amino-4-hydroxybenzoate, 3a, 295 mg, 1.51 mmol)를 DMF에 녹인 후, EDC (290 mg, 1.51 mmol) 및 1-히드록시벤조트리아졸 하이드레이트(1-hydroxybenzotriazole hydrate, HOBt, 204 mg, 1.51 mmol)을 첨가하였다. 해당 반응을 실온에서 하룻밤 교반하여 반응시켰다. 이후, 분리 및 정제 과정을 통해 이소프로필 3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시벤조에이트(ID-514)는 노란 고체 형태로 수득되며, 1H NMR (DMSO-d6, 300 MHz) d = 11.65 (s, 1H), 11.07 (s, 1H), 9.60 (s, 1H), 8.65 (d, J = 1.5 Hz, 1H), 8.11 (d, J = 6.6 Hz, 1H), 7.83 (d, J = 2.1 Hz, 1H), 7.79 (d, J = 15.3 Hz, 1H), 7.57 (dd, J = 1.5 Hz, 8.1 Hz, 1H), 7.47 (d, J =7.5 Hz, 1H), 7.19-7.25 (m, 2H), 7.12 (d, J = 15.3 Hz, 1H), 6.96 (d, J = 8.1 Hz, 1H), 5.10 (m, 1H), 1.31 (d, J = 6.6 Hz, 6H)의 성질을 갖는다.
1-8. 저분자성 화합물 ID-1029(8g) 합성 방법
상기 저분자성 화합물 ID-1029(3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시벤즈아마이드, 8g)는 트랜스-3-인돌아크릴산(7a, 300 mg, 1.6 mmol), 및 3-아미노-4-히드록시벤즈아마이드(3-amino-4-hydroxybenzamide, 3b, 243 mg, 1.6 mmol) 를 DMF에 녹인 후, PyBOP (1.7 g, 3.2 mmol) 및 DIPEA (0.84 mL, 4.8 mmol)을 첨가하였다. 해당 반응을 실온에서 하룻밤 교반하여 반응시켰다. 이후, 분리 및 정제 과정을 통해 3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시벤즈아마이드(ID-1029)는 노란 고체 형태로 수득되며, 1H NMR (CD3OD, 400 MHz) d = 8.08 (s, 1H), 7.98 (d, J = 15.2 Hz, 1H), 7.91 (d, J = 8.0 Hz, 1H), 7.88 (dd, J = 1.6 Hz, J = 8.4 Hz, 1H), 7.69 (s, 1H), 7.45-7.47 (m, 2H), 7.21-7.27 (m, 2H), 6.78 (d, J = 15.6 Hz, 1H)의 성질을 갖는다.
1-9. 저분자성 화합물 ID-557(8h) 합성 방법
상기 저분자성 화합물 ID-557(3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시-N-메틸벤즈아마이드, 8h)는 THF에 녹인 트랜스-3-인돌아크릴산(7a, 100 mg, 0.53 mmol) 용액에 DCC (220 mg, 1.07 mmol), 및 DIPEA (0.2 mL, 1.07 mmol)를 첨가하였다. 해당 혼합액을 실온에서 30분간 교반하면서 3-아미노-4-히드록시-N-메틸벤즈아마이드(3-amino-4-hydroxy-N-methylbenzamide, 3c, 106 mg, 0.64 mmol)를 첨가하였다. 반응액을 하룻밤동안 교반시켰다. 이후, 분리 및 정제 과정을 통해 3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시-N-메틸벤즈아마이드(ID-557)는 노란 고체 형태로 수득되며, 1H NMR (acetone-d6, 300 MHz) d = 10.88 (b, 1H), 9.61 (b, 1H), 8.03 (d, J = 15.6 Hz, 1H), 8.02 (d, J = 2.4 Hz, 1H), 7.94 (d, J = 2.1 Hz, 2H), 7.87 (d, J = 2.4 Hz, 2H), 7.52-7.59 (m, 3H), 7.20-7.28 (m, 2H), 7.08 (d, J = 15.3 Hz, 1H), 6.93 (d, J = 8.1 Hz, 1H), 3.62 (q, J = 6.6 Hz, 1H), 2.88 (d, J = 4.5 Hz, 3H)의 성질을 갖는다.
1-10. 저분자성 화합물 ID-556(8i) 합성 방법
상기 저분자성 화합물 ID-556(3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시-N-이소프로필벤즈아마이드, 8i)는 THF에 녹인 트랜스-3-인돌아크릴산(7a, 100 mg, 0.53 mmol) 용액에 DCC (220 mg, 1.07 mmol), 및 DIPEA (0.2 mL, 1.07 mmol)를 첨가하였다. 해당 혼합액을 실온에서 30분간 교반하면서 3-아미노-4-히드록시-N-이소프로필벤즈아마이드(3-amino-4-hydroxy-N-isopropylbenzamide, 3d, 124 mg, 0.64 mmol)를 첨가하였다. 반응액을 하룻밤동안 교반시켰다. 이후, 분리 및 정제 과정을 통해 3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시-N-이소프로필벤즈아마이드(ID-556)는 노란 고체 형태로 수득되며, 1H NMR (acetone-d6, 300 MHz) d = 10.95 (b, 1H), 10.89 (b, 1H), 9.61 (b, 1H), 8.02 (d, J = 15.6 Hz, 1H), 8.01 (s, 1H), 7.88 (t, J = 3.0 Hz, 2H), 7.59 (dd, J = 2.1 Hz, 8.7 Hz, 1H), 7.54 (dd, J = 2.1 Hz, 6.6 Hz, 1H), 7.20-7.28 (m, 3H), 7.08 (d, J = 15.3 Hz, 1H), 6.91 (d, J = 8.1 Hz, 1H), 4.21 (m, 1H), 1.22 (d, J = 6.6 Hz, 6H)의 성질을 갖는다.
1-11. 저분자성 화합물 ID-558(8j) 합성 방법
상기 저분자성 화합물 ID-558(3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시-N,N-디메틸벤즈아마이드, 8j)는 THF에 녹인 트랜스-3-인돌아크릴산(7a, 100 mg, 0.53 mmol) 용액에 DCC (220 mg, 1.07 mmol), 및 DIPEA (0.2 mL, 1.07 mmol)를 첨가하였다. 해당 혼합액을 실온에서 30분간 교반하면서 3-아미노-4-히드록시-N,N-디메틸벤즈아마이드(3-amino-4-hydroxy-N,N-dimethylbenzamide, 3e, 116 mg, 0.64 mmol)를 첨가하였다. 반응액을 하룻밤동안 교반시켰다. 이후, 분리 및 정제 과정을 통해 3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시-N,N-디메틸벤즈아마이드(ID-558)는 노란 고체 형태로 수득되며, 1H NMR (acetone-d6, 300 MHz) d = 10.85 (b, 1H), 9.51 (b, 1H), 8.01 (d, J = 15.3 Hz, 1H), 7.99-8.02 (m, 1H), 7.86 (d, J = 2.1 Hz, 1H), 7.58 (d, J = 2.1 Hz, 1H), 7.52-7.55 (m, 1H), 7.21-7.28 (m, 2H), 7.17 (dd, J = 1.8 Hz, 8.1 Hz, 1H), 7.03 (d, J = 15.6 Hz, 1H), 6.93 (d, J = 8.1 Hz, 1H), 3.02 (s, 6H)의 성질을 갖는다.
1-12. 저분자성 화합물 ID-116(9) 합성 방법
상기 저분자성 화합물 ID-116(3-[3-(1H-인돌-3-일)-아크릴아미도]벤조산)은 3-[3-(1H-인돌-3-일)-아크릴아미도]-벤조에이트(8a, 188mg, 0.59 mmol)를 THF /H2O(1:1, 10 mL)에 녹이고 이에 LiOH·H2O(49.3 mg, 1.17 mmol)를 실온에서 첨가하였다. 반응액을 실온에서 하룻밤 교반하여 반응시킨 후, 염산을 통해 산성화하고 에틸 아세테이트(EA)로 추출해내었다. 이후, 분리 및 정제 과정을 통해 3-[3-(1H-인돌-3-일)-아크릴아미도]벤조산은 하얀 고체 형태로 수득되며, 1H NMR (CD3OD, 300 MHz) d = 8.53 (s, 1H), 7.90-7.96 (m, 3H), 7.74 (d, J = 7.8 Hz, 1H), 7.58 (s, 1H), 7.41 (m, 2H), 7.19 (m, 2H), 6.78 (d, J = 15 Hz, 1H)의 성질을 가진다.
1-13. 저분자성 화합물 ID-263(10a) 합성 방법
상기 저분자성 화합물 ID-263(3-[3-(1H-인돌-3-일)-아크릴아미도]-N-(푸란-2-일-메틸)벤즈아마이드)은 3-(3-1H-인돌-3-일-아크릴로일아미노)-벤조산(9, 500 mg, 1.63 mmol)과 푸르푸릴아민(furfurylamine, 0.23 mL, 2.45 mmol)을 DMF에 녹이고, 이에 DIPEA(0.43 mL, 2.45 mmol) 및 HATU(O-(7-azabenzotriazol-1-yl)-N,N,N'N'-tetramethyluronium hexafluorophosphate, 931.6 mg, 2.45 mmol)를 첨가한 후, 해당 반응액을 실온에서 하룻밤 교반하여 반응시켰다. 이후, 분리 및 정제 과정을 통해 3-[3-(1H-인돌-3-일)-아크릴아미도]-N-(푸란-2-일-메틸)벤즈아마이드(ID-263)는 노란 고체 형태로 수득되며, 1H NMR (CD3OD, 300 MHz) d = 8.13 (m, 1H), 7.96 (m, 2H), 7.82 (m, 1H), 7.63 (s, 1H), 7.52 (m, 1H), 7.39-7.45 (m, 3H), 7.20 (m, 2H), 6.78 (d, J = 15.9 Hz, 1H), 6.32 (m, 2H), 4.56 (s, 2H)의 성질을 가진다.
1-14. 저분자성 화합물 ID-264(10b) 합성 방법
상기 저분자성 화합물 ID-264(3-(3-1H-인돌-3-일-아크릴로일아미노)-N-(2-피페리딘-1-일-에틸)-벤즈아마이드)는 3-(3-1H-인돌-3-일-아크릴로일아미노)-벤조산(9, 150 mg, 0.49 mmol)과 2-피페리딘-1-일-에틸아민(0.10 mL, 0.73 mmol)을 DMF에 녹인 후, HATU(277.6 mg, 0.73 mmol) 및 DIPEA(0.13 mL, 0.73 mmol)를 첨가하였다. 해당 반응액을 실온에서 하룻밤 교반하여 반응시켰다. 이후, 분리 및 정제 과정을 통해 3-(3-1H-인돌-3-일-아크릴로일아미노)-N-(2-피페리딘-1-일-에틸)-벤즈아마이드(ID-264)는 노란 고체 형태로 수득되며, 1H NMR (DMSO-d3, 300 MHz) d = 11.67 (b, 1H), 10.16 (s, 1H), 8.41(s, 1H), 8.11 (s, 1H), 7.76-7.98 (m, 4H), 7.38-7.50 (m, 3H), 7.23 (m, 2H), 6.84 (d, J = 15.9 Hz, 1H) 3.33-3.43 (m, 6H), 2.51 (m, 2H), 1.41-1.54 (m, 6H)의 성질을 가진다.
1-15. 저분자성 화합물 ID-265(10c) 합성 방법
상기 저분자성 화합물 ID-265(3-(3-1H-인돌-3-일-아크릴로일아미노)-N-(3-모폴린-4-일-프로필)-벤즈아마이드)는 3-(3-1H-인돌-3-일-아크릴로일아미노)-벤조산(9, 150 mg, 0.49 mmol)과 3-모폴린-4-일-프로필아민(0.11 mL, 0.73 mmol)을 DMF에 녹인 후, HATU (277.6 mg, 0.73 mmol), 및 DIPEA (0.13 mL, 0.73 mmol)를 첨가하였다. 해당 반응액을 실온에서 하룻밤 교반하여 반응시켰다. 이후, 분리 및 정제 과정을 통해 3-(3-1H-인돌-3-일-아크릴로일아미노)-N-(3-모폴린-4-일-프로필)-벤즈아마이드(ID-265)는 노란 고체 형태로 수득되며, 1H NMR (DMSO-d3, 300 MHz) d = 11.66 (b, 1H), 10.14 (s, 1H), 8.46 (ps-t, J = 5.4 Hz, 1H), 8.09 (s, 1H), 7.76-7.98 (m, 4H), 7.37-7.50 (m, 3H), 7.22 (m, 2H), 6.82 (d, J = 15.9 Hz, 1H), 3.55-3.59 (m, 4H), 3.27 (m, 1H), 3.16 (d, J = 15.9 Hz, 1H), 2.31-2.36 (m, 6H) 1.69 (m, 2H)의 성질을 가진다.
1-16. 저분자성 화합물 ID-517(10d) 합성 방법
상기 저분자성 화합물 ID-517(이소프로필 3-[3-(1H-인돌-3-일)아크릴아미도]벤조에이트)는 3-(3-1H-인돌-3-일-아크릴로일아미노)-벤조산(9, 180 mg, 0.59 mmol)와 이온성 액체(ionic liquid, 1.12 g, 1.47 mmol)를 DMF에 녹인 후, 해당 용액에 2-브로모프로판(2-bromopropane, 144 mg, 1.18 mmol), 및 DIPEA(152 mg, 1.18 mmol)을 첨가하였다. 해당 반응액을 60℃에서 2일간 가열 반응시키고 물로 냉각시켰다. 이후, 분리 및 정제 과정을 통해 이소프로필 3-[3-(1H-인돌-3-일)아크릴아미도]벤조에이트(ID-517)는 옅은 노란 고체 형태로 수득되며, 1H NMR (DMSO-d3, 300 MHz) d = 11.68 (b, 1H), 10.22 (s, 1H), 8.27 (s, 1H), 8.03 (d, J = 9.0 Hz, 1H), 7.94-7.98 (m, 1H), 7.85 (s, 1H), 7.80 (d, J = 16.2 Hz, 1H), 7.62 (d, J = 8.1 Hz, 1H), 7.47 (t, J = 7.2 Hz, 2H), 7.19-7.26 (m, 2H), 6.81 (d, J = 15.6 Hz, 1H), 5.16 (m, 1H), 1.34 (d, J = 6.0 Hz, 6H)의 성질을 갖는다.
실시예 2: 인간배아줄기세포 및 역분화줄기세포 배양
인간배아줄기세포(hESC) H9 (NIH Code, WA09; WiCell Research Institute, Madison, WI) 및 역분화 줄기세포(hiPSC)를 γ-선을 조사한 MEF (mouse embryonic fibroblast) 위에서 80% DMEM/F12, 20% 넉아웃 혈청 대체제 (knockout serum replacement; KSR, Invitrogen, Carlsbad, CA), 1% 비필수 아미노산 (non-essential amino acids; NEAA, Invitrogen), 1 mM L-글루타민 (Invitrogen), 0.1 mM β-머캡토 에탄올 (β-mercaptoethanol, Sigma, St. Louis, MO) 및 6 ng/㎖ bFGF (basic fibroblast growth factor, Invitrogen)로 이루어진 hESC 배양 배지로 일반적으로 배양하였다. 세포들을 1 ㎎/㎖ 콜라게네이즈 IV (Invitrogen)로 매 5-6일 마다 계대 배양하였다. 인간 신생 피부 섬유아세포 (Human newborn foreskin fibroblasts; hFF, ATCC, catalog number CRL-2097; American Type Culture Collection, Manassas, VA)를 10% FBS (fetal bovine serum, Invitrogen), 1% 비필수 아미노산, 1 mM L-글루타민 및 0.1 mM β-머캡토 에탄올을 포함하는 DMEM에서 배양하였다.
실시예 3. 레트로바이러스 생산 및 hiPSC의 유도
논문, Takahashi, K. et al.(Cell 131, 2007, 861-872)에 개시된 바와 같은 OCT4(POU5F1), SOX2, c-MYC(MYC) 및 KlF4의 인간 cDNA를 포함하는 pMXs 벡터를 Addgene사로부터 구입하였다. 패키지 세포주 GP2-293 세포를 레트로바이러스 벡터 DNA 및 VSV-G 외피 벡터로 CalPhos 트랜스펙션하였다. 트랜스펙션 후 24 시간째, 첫 번째 바이러스가 포함된 상등액을 회수한 후 배지를 교환하였고, 48시간 후 두 번째 바이러스가 포함된 상등액을 회수하였다.
iPSC의 생성을 위하여 인간 피부 섬유아 세포(hFFs) 및 마우스 배아섬유아세포(MEF) 등을 형질도입하기 하루 전에 젤라틴이 코팅된 6-웰 플레이트에 각 웰당 1 X 105 개 세포 농도로 접종하였고, polybrene(8 ㎍/㎖) 존재 하에 바이러스를 감염시켰다. 형질도입 5일 후, hFFs 세포 또는 MEFs 세포를 트립신으로 처리하여 회수하고, 기저세포가 없는(feeder-free) 조건에서의 실험을 위하여 마트리겔이 코팅된 6-웰 플레이트에 각 웰당 5 내지 6 X 104 개 세포 농도로 재접종하였다. 10 ng/㎖ 농도의 bFGF가 첨가된 MEF-CM 배지로 교환하였다. MEF-CM은 공지된 바에 따라(Xu C. Nat Biotechnol 19, 971-974) γ-방사선 조사된(γ-irradiated) MEF로 준비하였고, MEF-CM은 8 ng/㎖ bFGF을 추가하였다. 배지는 이틀에 한 번씩 교환하였다. 형질 도입 20일 후, hESC 형태의 콜로니를 획득하여 MEF를 영양세포로 하는 12-웰 플레이트에 옮긴 후, 상기 실시예 2의 hESC 배양 방법을 이용하여 지속적으로 증식 배양하였다.
실시예 4. 저분자성 화합물 스크리닝
실시예 3의 방법을 따라 OSKM 역분화인자 바이러스를 생성하였다. 역분화 효율을 촉진하는 저분자성 화합물을 스크리닝하기 위해 인간 피부 섬유아 세포(hFFs) 및 마우스 배아섬유아세포(OG2-MEF: hemizygous for the Oct4-GFP transgene) 등을 형질도입하기 하루 전에 젤라틴이 코팅된 6-웰 플레이트에 각 웰당 1 X 105 개 세포 농도로 접종하였고, polybrene(8 ㎍/㎖) 존재 하에 바이러스를 감염시켰다. 형질도입 5일 후, hFFs 세포 또는 MEFs 세포를 트립신으로 처리하여 회수하고, 기저세포가 없는(feeder-free) 조건에서의 실험을 위하여 마트리겔 또는 젤라틴이 코팅된 12-웰 플레이트에 각 웰당 3.5 X 104 개 세포 농도로 재접종하였다. 10 ng/㎖ 농도의 bFGF가 첨가된 MEF-CM 혹은 마우스 배아줄기세포 배양액으로 교환 후 준비된 트랜스-3-인돌아크릴산 기반 합성물인 저분자성 화합물을 다양한 농도로 첨가하였다. 각각의 저분자성 화합물을 포함한 배양액은 이틀에 한 번씩 교환하였다. 형질 도입 15일 후, AP 활성도를 마타내는 콜로니 혹은 endogenous Oct4 GFP 형광이 발현되는 콜로니 수를 측정하여 역분화 효율을 측정하였다.
실시예 5. RNA 추출, 역전사 및 PCR 분석
RNeasy Mini 키트(Qiagen, Valencia, CA)를 사용하여 생성한 세포로부터 전체 RNA를 분리한 후, SuperScript First-strand 합성 시스템 키트(Invitrogen)를 사용하여 제조사의 지시에 따라 역전사하였다. 이후, 반-정량 RT-PCR은 platinum Tag SuperMix 키트(Invitrogen)를 사용하여 다음과 같은 조건으로 수행하였다. 94℃ 3분 후, 94℃ 30초, 60℃ 30초 및 72℃ 30초의 25 내지 30 사이클 후 신장을 위하여 72℃에서 10분 동안 반응시켰다.
실시예 6. ALP 염색(Alkaline Phosphatase Staining)
ALP 염색은 제조사(Sigma)의 지침에 따라 시판되는 ALP 키트를 사용하여 수행하였다. ALP-양성 세포의 이미지를 HP Scanjet G4010으로 기록하였다. 또한, 올림푸스 현미경(IX51, Olympus, Japan)으로 명시야상(bight field images)을 얻었다.
실시예 7. 배아체 분화(Embryoid body differentiation)
hESC 분화의 잠재성을 측정하기 위하여 인간 배아체(hEBs)를 비-조직 배양 처리 페트리 디쉬(non-tissue culture treated Petri dishes)를 사용하여 부유액이 있는 hEB 배지(10% 혈청 대체제를 포함하는 DMEM/F12)에서 배양하였다. 부유액에서의 성장 5일 후, 배아체를 젤라틴-코팅 플레이트로 옮겨서 hEB 배지에서 배양하였다. 상기와 같은 조건하에서 플레이트의 바닥에 부착된 세포를 필요에 따라 배지를 교환하면서 추가로 15일 동안 분화되도록 방치하였다.
실시예 8. 면역세포화학적 방법(Immunocytochemistry)
면역염색법을 위하여 세포를 마트리겔로 코팅된 4-웰 Lab-Tek 챔버 슬라이드(Nunc, Naperville, IL)에 접종하고, 개시된 조건 하에서 5일 동안 배양하였다. 세포를 실온(RT)에서 15분 동안 4% 파라포름알데하이드에 고정시킨 후 PBS/0.2% BSA를 사용하여 세척하고, 세포를 15분 동안 PBS/0.2% BSA/0.1% 트리톤 X-100에 투과시킨 뒤, 실온에서 1시간 동안 PBS/0.2% BSA에서 4% 정상 당나귀 혈청(normal donkey serum; Molecular Probes, Eugene, OR, USA)으로 반응시켰다. 세포를 PBS/0.2% BSA로 희석시킨 각각의 1차 항체를 사용하여 4℃에서 2시간 동안 반응시켰다. 세척한 후, 세포를 1시간 동안 실온에서 PBS/0.2% BSA에 있는 2차 항체(Invitrogen)가 부착된 FITC 또는 Alexa594를 사용하여 반응시켰다. 세포를 10 ㎍/㎖ DAPI를 사용하여 대비염색시켰다. 챔버 슬라이드는 올림푸스 현미경 또는 Axiovert 200M 현미경(Carl Zeiss, Gottingen, Germany)으로 분석하였다.
실시예 9. 리프로그래밍 전사인자 프로모터 메틸화 분석
인간배아줄기세포와 유전자 이입 레트로바이러스를 이용하여 확립된 유도 만능 줄기세포의 특성을 검증하기 위하여, 인간배아줄기세포 특이 전사인자인 Oct3/4, Nanog 프로모터 메틸화 상태를 분석하였다. 게놈 DNA를 추출하기 위하여 인간배아줄기세포 배지에서 6일간 배양한 인간배아줄기세포와 역분화 줄기세포를 DNA 추출 키트(Qiagen Genomic DNA purification kit)를 이용하여 추출하였다. Bisulfite 시퀀싱을 3단계로 수행하였다. 1 단계는 아황산수소나트륨(sodium bisulfite)을 이용하여 DNA를 변형시키는 과정이고, 2 단계는 분석하고자 하는 유전자 부위(보통 프로모터 부위)를 PCR로 증폭하는 과정이며, 3 단계는 PCR 산물을 시퀀싱하여 DNA 메틸화 정도를 분석하는 과정이다. 아황산수소나트륨을 이용한 DNA 변형 과정은 상품화된 키트 EZ DNA Methylation Kit(Zymo Research)를 이용하였으며, DNA를 bisulfite로 처리를 할 경우 메틸화되어 있는 시토신은 변하지 않는 반면, 비메틸화되어 있는 시토신은 우라실로 전환된다. 따라서, 시토신과 우라실 염기서열에 특이한 프라이머를 이용하여 각각 PCR로 증폭시킬 경우 메틸화된 DNA와 비메틸화된 DNA를 구분할 수 있게 된다. 사용한 프라이머는 하기 표 1에 나타내었다.
표 1
Gene Primer (Forward) Primer (Reverse) Accession No.
For bisulfate sequencing
bi Oct4-1 ATTTGTTTTTTGGGTAGTTAAAGGT(서열번호 1) CCAACTATCTTCATCTTAATAACATCC (서열번호 2) NM_002701
bi Oct4-2 GGATGTTATTAAGATGAAGATAGTTGG(서열번호 3) CCTAAACTCCCCTTCAAAATCTATT (서열번호 4) NM_002701
bi Nanog TGGTTAGGTTGGTTTTAAATTTTTG (서열번호 5) AACCCACCCTTATAAATTCTCAATTA (서열번호 6) NM_024865
PCR 반응 혼합액은 bisulfite로 처리한 DNA 1 ㎍, dNTP 0.25 mM/ℓ, MgCl2 1.5 mM/ℓ, 프라이머 50 pM, 1× PCR 버퍼, Taq 폴리머라제(Platinum Taq DNA polymerase, Invitrogen, Carlsbad, CA, USA) 2.5 유닛으로서, 최종 20 ㎕가 되게 하였다. PCR 반응 조건은 95℃에서 10분 시행 후 95℃ 1분, 60℃ 1분, 72℃ 1분 과정을 40주기 시행하였으며, 마지막으로 72℃에서 10분간 반응시켰다. PCR 반응 생산물을 1.5% 아가로스 젤에서 확인하였으며, 젤 용리 후 pCR2.1-TOPO 벡터(Invitrogen)에 클로닝하였다. 메틸화 및 비-메틸화 염기서열은 M13 프라이머쌍을 사용하여 시퀀싱하여 분석하였다.
실시예 10. 핵형분석(Karyotype Analysis)
배양된 인간 역분화 줄기세포를 G-banding 분석법에 의해 확인하였다. 대표 이미지를 ChIPS-Karyo(Chromosome Image Processing System, GenDix)를 사용하여 얻었다.
실시예 11: 마우스 및 인간 세포의 역분화 효율을 증가시키는 신규 저분자 화합물 Reprogramming Stimulating Compound (RSC) 133의 발굴
11-1. 신규 합성물질인 트랜스-3-인돌아크릴산 기반 합성물의 아날로그 라이브러리 스크리닝을 이용한 마우스 세포 역분화 조절인자 발굴
역분화 과정에 관여하는 저분자 화합물을 발굴하기 위해, 신규 합성물질인 트랜스-3-인돌아크릴산 기반 합성물의 아날로그 라이브러리 스크리닝을 마우스 세포에서 수행하였다. 마우스 배아 섬유아세포 (OG2-MEF: hemizygous for the Oct4-GFP transgene)를 Oct4, Sox2, Klf4, 그리고 c-Myc (OSKM)의 역분화 인자 바이러스로 형질전환시키고 5일 후, 젤라틴 코팅 12-웰 플레이트에 분주하고 각각의 저분자 화합물을 포함한 마우스 배아줄기세포 배양액으로 마우스 줄기세포와 유사한 모양을 가진 콜로니가 형성되어 endogenous Oct4 GFP 형광이 발현될 때까지 배양하였다 (도 1의 A). 15일 후 endogenous Oct4 GFP 형광이 발현되는 콜로니 수를 측정하여 대조군에 비해 역분화 효율을 증진 시킨 화합물을 조사한 결과, 스크리닝한 화합물 중 RSC-133과 558이 역분화 유도 효율을 증진시키는 효과를 나타냄을 확인하였다 (도 1의 B). 일차적인 스크리닝 결과에 기반하여, 새로운 인돌-아크릴산/인돌-프로피온산 유도체들(반응식 1)을 제조하였고, 생성된 화합물의 리프로그래밍 효율에 대한 구조-활성 관계(structure-activity relationship, SAR)를 평가하였다. 실험한 후보 물질들 중에서, 아미노기없는 인돌 ring이 벤조산 유사체들과 이중 결합으로 연결된 인돌-아크릴산 유사체 화합물 RSC-133 및 ID-558가 가장 높은 리프로그래밍 효율을 보임을 확인하였다. 두 화합물의 벤조산 유사체 부분에 RSC-133은 단순한 벤즈아마이드를 포함하고 있으며, ID-558은 4-히드록시-N,N-디메틸벤즈아마이드를 포함하고 있다.
기존 보고에 따르면 저분자성 화합물인 DNA methyltransferase inhibitor (5-Azacytidine), G9a histone methyltransferase inhibitor (BIX-01294), 그리고 histone deacetylase inhibitor (Valproic acid; VPA) 등이 역분화 줄기세포 생성을 촉진한다고 알려졌다. 흥미롭게도 신규 저분자 화합물인 RSC-133은 보고된 화합물을 처리하거나 혹은 OSKM 역분화 인자 바이러스의 MOI값을 증가시켰을 때보다 대조군에 비해 가장 크게 역분화 효율을 촉진시켰다 (도 2a). RSC-133는 iPSC 생성을 촉진하는 것으로 알려진 화합물들인 AZA, VPA, TSA 및 SB431542보다 1.5배에서 3.3배 월등한 인간 세포 리프로그래밍 촉진 효과를 가진다(도 2b).
11-2. 신규 합성물질인 트랜스-3-인돌아크릴산 기반 합성물의 아날로그 라이브러리 스크리닝을 이용한 인간 세포 역분화 조절인자 발굴
인간 체세포의 역분화 과정에 관여하는 저분자 화합물을 발굴하기 위해, 30개의 선택된 신규 합성물질인 트랜스-3-인돌아크릴산 기반 합성물의 아날로그 라이브러리 스크리닝을 이용하여 인간 피부 섬유아세포의 역분화 조절인자를 조사하였다. 인간 피부 섬유아세포를 OSKM 역분화 인자 바이러스로 형질전환시키고 5일 후, 마트리겔 코팅 12-웰 플레이트에 분주하고 각각의 저분자 화합물을 포함한 MEF-조건 배양액 (MEF-conditioned medium; CM)으로 인간 배아 줄기세포와 유사한 모양을 가진 콜로니가 형성될 때까지 배양하였다. 15일 후 Alkaline phosphatase (AP) 활성도를 측정하여 대조군에 비해 역분화 효율을 증진 시킨 화합물질을 조사한 결과, RSC-133이 마우스 배아 섬유아세포에서와 유사하게 인간 피부 섬유아세포의 역분화 효율을 증진시켰다 (도 3).
11-3. 신규 저분자 화합물 133에 의한 인간 피부 섬유아세포의 역분화 효율 증진 효과 확인
신규 저분자 화합물 133은 인간 피부 섬유아세포에서 정상조건(21% O2) 뿐만 아니라 저산소조건(5% O2)에서도 대조군에 비해 역분화 효율 증진 효과를 나타내었다 (도 4). 저산소조건(5% O2)에서 역분화 효율이 증가하는데, 133은 이러한 저산소조건(5% O2)에 의해 촉진된 역분화 과정에 시너지 효과를 더할 수 있고 (도 4의 A), 온전한 역분화 줄기세포 콜로니 형성시킬 수 있었다 (도 4의 B).
다음으로 신규 저분자 화합물 133 첨가에 의한 인간 피부 섬유아세포로부터 역분화 줄기세포의 역분화 유도 시에 기존 역분화 인자 (c-Myc)를 대체할 수 있는지 조사하였다. c-Myc은 oncogene으로서 역분화 유도 후 형성된 역분화 줄기세포주에서 c-Myc 바이러스 유전자의 재발현은 암 유발에 관여한다고 알려졌다. 그러므로 c-Myc을 제외한 역분화 유도 방법에 대한 연구가 관심을 받고 있다. 흥미롭게도 RSC-133 단독으로는 대체 효과를 보이지 않으나 소듐 부티레이트(Sodium butylate, NaB)와 함께 첨가시 c-Myc 인자를 대체하여 대조군에 비해 역분화 유도 효율을 증진시켰다 (도 5). 결론적으로 신규 저분자 화합물 RSC-133은 마우스 및 인간 세포의 역분화 효율을 증진시키는 인자로 확인되었다.
실시예 12. 역분화 인자 RSC-133의 농도-의존적 역분화 유도 효과 확인
RSC-133에 의한 역분화 효율 증진 효과가 RSC-133의 첨가된 양에 따라 증가되는지 조사하였다. 이를 위해 인간 피부 섬유아세포에 OSKM 유전자의 바이러스를 감염시킨 후 도 8에서 나타낸 바와 같은 실험 방법으로 RSC-133이 역분화 유도 배양액에 첨가된 농도에 의존적으로 역분화 효율을 증가시키는지 확인하였다. 역분화 효율은 AP 활성도를 나타내는 콜로니 수를 측정하여 계산하였다. 실험 결과 RSC-133은 10 μM 까지 처리한 농도에 의존적으로 역분화 효율을 증가시킬 수 있었다 (도 8). 20 μM에서 역분화 효율이 증가하지 않은 것은 고농도에서 RSC-133이 인간 피부 섬유아세포의 세포 독성을 유도하기 때문에 얻어진 결과가 아니다 (도 9). 이상으로 10 μM의 RSC-133이 인간 피부 섬유아세포의 역분화 효율을 가장 촉진시킬 수 있음을 밝혔다.
실시예 13. RSC-133이 관여하는 역분화 과정 규명 및 이를 이용한 효율적 역 분화 방법 확립
인간 피부 섬유아세포의 역분화 유도 과정에 관여하는 RSC-133의 역할을 규명하기 위해, 도 10의 왼쪽 패널에서 나타낸 바와 같이 RSC-133을 역분화 과정의 서로 다른 기간 동안 첨가하였다. 역분화 효율은 AP 활성도를 나타내는 콜로니 개수를 계산하여 측정하였다. 실험 결과, RSC-133을 동일한 기간 (5, 10, 15일) 동안 처리하였을때, 바이러스 감염 후 5일을 포함하는 역분화 유도 과정 초기에 처리하였을 때 다른 시간대에 비해 우수하게 역분화 효율을 증진시킬 수 있었다. 그러나, 처리 시간에 의존적으로 역분화 전체 과정 동안 지속적으로 RSC-133을 처리하였을 때 가장 역분화 효율 증진 효과가 크게 나타났다 (도 10, 조건1). 그러므로 RSC-133이 역분화 초기 과정에 관여하지만, 지속적인 처리가 가장 역분화 효율을 증진시키므로, RSC-133은 역분화 과정의 유도뿐만 아니라 생성된 역분화 줄기세포의 유지에도 관여하는 것을 알 수 있다.
실시예 14. RSC-133에 의한 세포 성장 촉진 효과
최근 보도에 따르면 세포 성장을 촉진시키면 역분화 효율이 증가한다. 또한 세포 성장률은 배아줄기세포의 자가재생산 능력과 연관되어있다. 그러므로 신규 합성물질인 RSC-133이 역분화 과정 동안 세포 성장을 촉진 시킬 수 있는지 조사하였다. 실험 결과, RSC-133을 처리하면서 역분화를 유도했을 때 대조군에 비해 세포 성장률이 약 1.7배 이상 증가하였다 (도 11). 또한 역분화 유도를 시키지 않아도 RSC-133은 인간 피부 섬유아세포 본연의 성장률을 증가시키는 기능을 나타냈다 (도 12). 즉 인간 피부 섬유아세포 혹은 역분화인자 (OSKM) 바이러스를 감염시켰지만 역분화 유도를 시키지 않은 인간 피부 섬유아세포에서 모두 RSC-133 처리에 따라 세포 성장이 증가했다 (도 12). 다음으로 RSC-133이 proliferating cell population을 증가시킬 수 있는지 Bromodeoxyuridine (BrdU)에 대한 단클론 항체를 이용하여 면역세포화학분석을 수행하여 분석하였다. 실험 결과 역분화 과정 동안 (도 13과 16) 그리고 역분화인자 (OSKM) 바이러스를 감염시켰지만 역분화 유도를 시키지 않은 인간 피부 섬유아세포 (도 14)에서 모두 RSC-133 처리에 따라 BrdU 양성 세포군이 증가하였다. 이를 통해 RSC-133이 세포 성장을 촉진시켜 역분화 효율을 증진시켰을 것으로 추측할 수 있다.
실시예 15: RSC-133에 의해 촉진된 역분화 과정 확인
RSC-133이 역분화 과정의 속도를 촉진시킬 수 있는지 알아보기 위해, 역분화 유도 과정 동안 발현되는 mRNA의 상대적인 레벨을 측정하였다. 이를 위해 도 10에서 나타낸 바와 같은 실험 방법으로 인간 피부 섬유아세포에 OSKM 유전자의 바이러스를 감염시킨 후 5일 간격으로 세포를 harvest하여 RSC-133 처리 유무에 따라 변화되는 유전자 발현양을 Real-time RT-PCR 방법으로 확인하였다. 그 결과, RSC-133을 처리하여 역분화를 유도한 실험군에서 미분화 마커인 Nanog, Oct4, 그리고 Rex1 발현이 상대적으로 증가되었고 (도 15 및 도 16 위패널), 역분화를 억제하는 기작에 관여한다고 알려진 p53, p21, 그리고 p16 발현이 상대적으로 억제되었음을 확인하였다 (도 16 아래패널). 아울러, 역분화를 유도하고 10일째에는 세포노화연관-β-갈라토시다제(SA-β-gal) 양성 세포의 비율이 아무것도 처리하지 않은 대조군(OSKM alone)에 비해 37.23% 감소하였다(도 17). 그러므로 RSC-133은 역분화 효율을 증가시킬 뿐만 아니라 역분화 과정에 관여하여 kinetics를 촉진시킬 수 있다는 것을 알 수 있다.
실시예 16: 역분화 과정 동안 히스톤 단백질 아세틸레이션에 관여하는 RSC- 133의 기능 분석
기존에 보고된 역분화 과정에 관여하는 다양한 저분자성 화합물들 중 대부분은 지놈 메틸레이션 패턴, 히스톤 아세틸레이션 패턴, 혹은 주요 신호전달 기작에 관여한다. 이 중에서 히스톤 아세틸레이션 패턴 조정에 관여하는 histone deacetylase (HDAC) 저해제 (VPA, TSA, 그리고 SAHA 등)는 역분화 과정에 중요한 역할을 한다고 알려져 있다. 특히 H3K9 아세틸레이션 (H3K9ace) 레벨의 증가는 만능성와 역분화능과 연관되어 있다. 도 18에서 나타낸 바와 같이 인간 피부 섬유아세포를 역분화 유도하고 RSC-133을 처리하거나 처리하지 않고 10일 동안 배양한 후, H3K9ace 및 미분화마커 (Nanog)에 대한 단클론 항체를 이용하여 면역세포화학분석한 결과, RSC-133을 처리한 실험군에서 H3K9ace 레벨이 높은 미분화 세포의 비율이 대조군에 비해 증가하였다 (도 18 왼쪽패널). Western blot으로 H3K9ace 레벨을 측정하여 단백질 양을 정량화 했을 때도 마찬가지 결과를 얻었다 (도 18, 오른쪽패널).
다음으로 상기 결과가 인간 피부 섬유아세포의 역분화 과정 동안 RSC-133이 HDAC 효소를 저해해서 얻어진 결과인지 확인해 보았다. 실험 결과 역분화 과정 동안 RSC-133의 처리에 따라 총 HDAC 효소의 활성도가 약간 억제된 것을 관찰할 수 있었다 (도 19 왼쪽패널). 도 21에서 도식화한 실험 방법에 따라 역분화 과정 동안 HDAC family의 단백질 발현양을 측정한 결과, RSC-133을 처리한 실험군에서 HDAC1의 단백질 발현양이 RSC-133 처리 후 10일째에 대조군에 비해 억제된 것을 확인할 수 있었다 (도 19 오른쪽패널 및 도 21). HDAC1은 배아줄기세포에서 Oct4, Sox2, Klf4, 그리고 c-Myc gene loci에 occupy할 할 수 있고, HDAC1 결손 배아줄기세포에서 미분화 마커 유전자의 발현이 증가된다고 보고되었다. 그러므로 RSC-133은 HDAC1의 기능을 억제하고 H3K9ace 레벨을 증가시킴으로써 역분화 과정을 촉진시킬 것으로 추정된다.
실시예 17: 역분화 과정 동안 DNA 메틸화에 관여하는 RSC-133의 기능 분석
RSC133는 DNA 메틸전이효소(DNA methyltransferase, DNMT)와 히스톤 탈아세틸화효소(histone deacetylase, HDAC)등과 같은 후생유전적 조절자들의 활성을 조절한다. RSC133로 역분화를 유도하고 10일째에 DNMT1의 활성이 아무것도 처리하지 않은 대조군(OSKM alone)에 비해 38%로 현저히 감소하였다(도 20). DNA 메틸화 및/또는 히스톤 변이 등에 의한 후생유전적 크로마틴 리모델링은 역분화과정에서 광대한 범위의 전사조절에 중요한 역할을 한다. DNA 메틸화 저해제인 AZA를 처리하거나 DNMT1을 결실시킴으로써 DNA 메틸화를 저해할 경우 온전한 iPSC 상태로 빠르게 전환이 유도된다. H3K9 히스톤 아세틸화(ace)의 증가된 수준은 특히, 다능성과 리프로그래밍 능력을 회복하는 것과 관련되어 있다. 또한, 기존에 DNMT1에 의한 DNA 메틸화가 HDAC 활성을 통한 크로마틴 상태변화와 밀접한 관계가 있음이 알려져 있다. 이러한 결과들을 종합하여 볼 때, RSC-133을 통한 DNMT1의 저해와 HDAC1의 활성 저해는 DNA 메틸화와 크로마틴 상태를 변화시키고 상기 4가지 정의된 역분화 효소들의 유전자 위치에 접근성을 높이는 것을 통해 유전자 전사 조절에 간접적으로 영향을 미쳐 리프로그래밍 과정을 촉진하는 것을 시사한다.
실시예 18: RSC-133에 의한 인간 역분화 줄기세포의 특성 분석
18-1. 인간배아줄기세포 마커 발현 확인
RSC-133 첨가에 의해 인간 피부 섬유아체세포로부터 유도된 역분화줄기세포주(RSC133-iPS)의 줄기세포 특성을 ALP 염색 및 면역염색으로 분석하였다. 2개의 세포주 (RSC133-iPS1 및 RSC133-iPS2)를 확인하였다. 그 결과, RSC133-iPS 세포주는 형태적으로나 인간배아줄기세포 마커의 염색(ALP) 및 면역염색(OCT4, NANOG, SSEA-3, SSEA-4, TRA-1-60, TRA-1-81)으로는 구별이 되지 않을 만큼 흡사하였다 (도 22). 또한, semi-quantitative RT-PCR을 수행함으로써 Oct4, Sox2, cMyc, 및 Klf4 mRNA 발현을 확인한 결과, RSC133-iPS 세포주는 Oct4, Sox2, cMyc, 및 Klf4 를 total 및 endogenous level에서 인간배아줄기세포만큼 발현하고 있었으며, 레트로바이러스를 통해 도입된 각 전이유전자의 silencing이 충분이 완료되었음을 확인하였다 (도 23).
18-2. RSC-133에 의한 역분화 줄기세포의 메틸화 분석
상기 실시예 8의 방법에 따라, RSC133-iPS 세포주의 줄기세포 마커 Oct4 및 Nanog 유전자의 프로모터 영역의 메틸화 정도를 bisulfite 시퀀싱 분석을 통하여 확인하였다. 그 결과, 도 21에 나타난 바와 같이, RSC133-iPS 역분화 세포주는 인간배아줄기세포주(H9)와 유사한 탈메틸화된 패턴을 보여주었으나, 모세포인 hFFs는 여전히 메틸화가 유지되고 있었다(도 24).
18-3. RSC-133에 의한 역분화 줄기세포의 genomic integration 확인
RSC133-iPS1 및 RSC133-iPS2의 genomic integration을 확인하였다. 지놈 DNA를 DNeasy 키트(Qiagen, Valencia, CA)를 이용하여 추출하였고, 각 300 ng의 지놈 DNA와 전이유전자만을 특이적으로 증폭할 수 있는 프라이머를 이용하여 각각의 PCR 증폭반응을 수행하였다. 그 결과, RSC133-iPS 세포주는 각각 Oct4, Sox2, cMyc 및 Klf4가 integration 되어 있음을 확인하였다 (도 25). 이때, 인간배아줄기세포주(H9, hES)와 인간 피부 섬유아세포주(CRL2097, hFF)를 대조군으로 사용하였다.
18-4. RSC-133에 의한 역분화 줄기세포의 핵형분석(Karyotype Analysis)
RSC133-iPS 세포주의 핵형을 G-banding 분석법에 의해 확인하였다. 대표 이미지(Representative images)를 ChIPS-Karyo (Chromosome Image Processing System, GenDix)를 사용하여 얻었다 (도 26). 그 결과, RSC133-iPS 역분화 세포주는 정상핵형 (46, XY)을 나타내고 있다.
18-5. RSC-133에 의한 역분화 줄기세포의 전분화능 확인
RSC-133에 첨가에 의해 인간 섬유아체세포로부터 유도된 역분화줄기세포주(RSC133-iPS)가 줄기세포의 특성인 분화 잠재력을 보유하고 있는지 확인하기 위하여, 각 역분화 줄기세포주로부터 유래된 배아체의 분화능력을 조사하였다. 부유배양한 후, 분화 조건하에서 10일간 젤라틴-코팅된 플레이트에 배아체를 재-부착시킨 후, 삼배엽 분화된 세포에서 특이적으로 발현되는 마커 단백질의 발현을 면역화학염색 방법으로 확인하였다. 그 결과 Tuj1(외배엽), Nestin(외배엽), desmin(중배엽), α-SMA(α-smooth muscle actin, 중배엽), Sox17(내배엽) 및 FoxA2(내배엽)에 양성인 세포를 검출하였다 (도 27). 이러한 결과는 RSC-133에 첨가에 의해 유도된 역분화줄기세포주(RSC133-iPS)가 삼배엽으로 분화할 수 있는 잠재력을 보유하고 있으며, 전분화능이 보존되고 있음을 나타낸다.
또한, RSC-133에 첨가에 의한 인간 역분화 줄기세포주(RSC133-iPS)의 인 비보에서의 전분화능을 확인하기 위하여, RSC133-iPS 역분화 줄기세포주를 면역결핍 (SCID) 생쥐의 dorsal flask에 피하주사하였다. 약 12주 후에 테라토마를 확인할 수 있었으며, Hematoxylin/eosin 염색을 통해 테라토마 내의 neural rosette(외배엽), adipocyte(중배엽), cartilage(중배엽), 및 gut-like epithelium(내배엽)을 관찰하였다 (도 28). 이는 RSC-133에 첨가에 의한 인간 역분화 줄기세포주(RSC133-iPS)가 인 비트로 및 인 비보에서 삼배엽으로 분화할 수 있는 능력을 가짐을 보여준다.
실시예 19. 미분화 (만능성) 유지, 증진에 관여하는 RSC-133의 효과
H9 인간 배아줄기세포를 기본배지 조건인 unconditioned medium (UM)에서 배양 시 분화가 유도된다. 그러나 이때 RSC-133을 UM에 첨가하고 6일 동안 배양할 경우 유도된 분화 정도가 억제되고 만능성이 재획득된 것을 관찰할 수 있었다 (도 29 위패널). 이때 양성 대조군으로 미분화 상태 유지에 효과적인 MEF-조건 배양액 (MEF-conditioned medium; CM)에서 6일 동안 배양한 인간 배아줄기세포를 사용하였으며, 미분화 상태 유지 및 분화 억제 효율은 AP 활성도를 나타내는 콜로니 개수를 계산하여 측정하여 나타내었다 (도 29 아래패널). 또한, 도 30에서 보여준 바와 같이, 인간 배아줄기세포를 UM에서 배양시 RSC-133 첨가에 의해 인간 배아줄기세포의 미분화 마커 (Oct4와 Tra1-81)가 CM에서 배양한 인간 배아줄기세포와 유사한 수준으로 발현하고 있음을 면역염색법을 통해 단백질 수준에서 확인하였다. RSC-133에 의한 분화 억제 및 미분화 상태 유지는 미분화 마커인 Oct4와 H3K9ace 단백질 발현 검증을 통해 추가로 확인되었으며, RSC-133을 포함한 UM에서 배양한 인간 배아줄기세포가 CM에서 배양한 인간 배아줄기세포와 유사한 수준으로 Oct4와 H3K9ace 단백질을 발현하고 있음을 관찰하였다 (도 31). 이를 통해 RSC-133은 특이적으로 인간 체세포의 역분화 과정뿐만 아니라 인간 다능성 줄기세포의 만능성 유지에도 효과적으로 작용함을 검증하였다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있음을 이해할 수 있다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 제한적인 것이 아닌 것으로 이해하여야 한다. 본 발명의 범위는 전술한 상세한 설명보다는 후술되는 특허 청구범위의 의미 및 범위, 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (35)

  1. 하기 화학식 1의 화합물, 또는 이의 약학적으로 허용가능한 염:
    [화학식 1]
    상기 화학식에서,
    R1은 아미노기(NH2), 메틸아미노기(NHCH3), 디메틸아미노기(N(CH3)2), O-이소프로필기(O-isopropyl), 또는 프로필아미노기(NHCH(CH3)2)이고;
    R2는 히드록시기(OH) 또는 수소(H)이며;
    ---로 표현된 부분은 단일 결합 또는 이중 결합이다.
  2. 제1항에 있어서,
    R1은 아미노기(NH2)이고;
    R2는 수소이며;
    --- 부분이 이중 결합인 화합물, 또는 이의 약학적으로 허용가능한 염.
  3. 제1항에 있어서,
    R1은 O-이소프로필기(O-isopropyl)이고;
    R2는 히드록시기(OH)이며;
    --- 부분은 이중 결합인 화합물, 또는 이의 약학적으로 허용가능한 염.
  4. 제1항에 있어서,
    R1은 아미노기(NH2)이고;
    R2는 히드록시기(OH)이며;
    --- 부분은 이중 결합인 화합물, 또는 이의 약학적으로 허용가능한 염.
  5. 제1항에 있어서,
    R1은 메틸아미노기(NHCH3)이고;
    R2는 히드록시기(OH)이며;
    --- 부분은 이중 결합인 화합물, 또는 이의 약학적으로 허용가능한 염.
  6. 제1항에 있어서,
    R1은 프로필아미노기(NHCH(CH3)2)이고;
    R2는 히드록시기(OH)이며;
    --- 부분은 이중 결합인 화합물, 또는 이의 약학적으로 허용가능한 염.
  7. 제1항에 있어서,
    R1은 디메틸아미노기(NH(CH3)2)이고;
    R2는 히드록시기(OH)이며;
    --- 부분은 이중 결합인 화합물, 또는 이의 약학적으로 허용가능한 염.
  8. 화학식 1의 화합물은
    1) 3-[3-(1H-인돌-3-일)-아크릴아미도]-벤즈아마이드;
    2) 이소프로필 3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시 벤조에이트;
    3) 3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시 벤즈아마이드;
    4) 3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시-N-메틸벤즈아마이드;
    5) 3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시-N-이소프로필벤즈아마이드; 및
    6) 3-[3-(1H-인돌-3-일)-아크릴아미도]-4-히드록시-N,N- 디메틸벤즈아마이드로 구성되는 군에서 선택되는 것을 특징으로 하는 화합물, 또는 이의 약학적으로 허용가능한 염.
  9. 화학식 1의 화합물, 또는 이의 약학적으로 허용가능한 염을 포함하는 배지 조성물.
  10. 화학식 1의 화합물, 또는 이의 약학적으로 허용가능한 염을 포함하는 분화된 세포에서 다능성 줄기세포로의 역분화 촉진용 조성물.
  11. 제10항에 있어서, 상기 분화된 세포는 체세포 또는 전구세포인 조성물.
  12. 제10항에 있어서, 상기 다능성 줄기세포는 유도 만능 줄기세포 또는 배아줄기세포인 조성물.
  13. 제12항에 있어서, 상기 다능성 줄기세포는 인간 유래인 것인 조성물.
  14. 제10항에 있어서, 상기 화학식 1의 화합물, 또는 이의 약학적으로 허용가능한 염의 농도는 0.01 초과 내지 20μM 미만인 조성물.
  15. 제10항에 있어서, 상기 조성물은 역분화 유도인자를 추가로 포함하는 것인 조성물.
  16. 제15항에 있어서, 상기 역분화 유도인자는 Oct4, Sox2, KlF4, c-Myc, Nanog 및 Lin-28로 이루어진 군으로부터 선택되는 하나 이상의 단백질 또는 이들 단백질을 코딩하는 하나 이상의 핵산분자인 것인 조성물.
  17. 분화된 세포; 제10항 내지 제16항 중 어느 한 항에 따른 조성물; 및 역분화 유도인자를 포함하며, 상기 분화된 세포는 다능성 줄기세포로 역분화되는 시험관 내 세포 배양물.
  18. 제17항에 있어서, 상기 분화된 세포는 체세포 또는 전구세포인 것을 특징으로 하는 세포 배양물.
  19. 제17항에 있어서, 상기 분화된 세포는 인간 유래인 것을 특징으로 하는 세포 배양물.
  20. 제17항에 있어서, 상기 역분화는 제10항 내지 제16항 중 어느 한 항에 따른 조성물을 처리하지 않은 대조군에 비하여 p53, p21, 또는 p16 레벨이 억제되는 것인 세포 배양물.
  21. 제17항에 있어서, 상기 분화된 세포에서 다능성 줄기세포로의 역분화는 제10항 내지 제16항 중 어느 한 항에 따른 조성물을 처리하지 않은 대조군에 비하여 HDAC1의 기능이 억제되고 H3K9ace 레벨이 증가되는 것인 세포 배양물.
  22. (a) 분화된 세포에 역분화 유도인자를 전달하는 단계; 및
    (b) 분화된 세포를 제10항에 따른 조성물을 함유하는 배지에서 배양하는 단계를 포함하는, 분화된 세포에서 역분화된 다능성 줄기세포를 제조하는 방법.
  23. 제22항에 있어서,
    단계 (b)로부터 얻어진 배양물로부터 배아줄기세포-유사 콜로니(embryonic stem cell-like colonies)를 분리하는 단계를 추가로 포함하는 방법.
  24. 제22항에 있어서, 상기 역분화 유도인자는 Oct4, Sox2, KlF4, c-Myc, Nanog 및 Lin-28로 이루어진 군으로부터 선택되는 어느 하나 이상의 단백질 또는 이들 단백질을 코딩하는 어느 하나 이상의 핵산분자인 방법.
  25. 제22항에 있어서, 상기 (a) 단계와 (b) 단계는 동시, 순차적 또는 역순으로 수행되는 것인 방법.
  26. 화학식 1의 화합물, 또는 이의 약학적으로 허용가능한 염을 포함하는 미분화 상태의 다능성 줄기세포 유지 및 배양용 배지 조성물.
  27. 제26항에 있어서, 상기 다능성 줄기세포는 배아줄기세포 또는 유도 만능 줄기세포인 것을 특징으로 하는 배지 조성물.
  28. 제26항에 있어서, 상기 다능성 줄기세포는 인간 유래인 것을 특징으로 하는 배지 조성물.
  29. 제26항에 있어서, 상기 화학식 1의 화합물, 또는 이의 약학적으로 허용가능한 염의 농도는 0.01 초과 내지 20 μM 이하인 것을 특징으로 하는 배지 조성물.
  30. 제26항 내지 제29항 중 어느 한 항에 따른 배지 조성물 상에서 다능성 줄기세포를 배양하는 단계를 포함하는 미분화 상태로 다능성 줄기세포를 배양하는 방법.
  31. 제30항에 있어서, 상기 다능성 줄기세포는 배아줄기세포 또는 유도만능줄기세포인 것을 특징으로 하는 방법.
  32. 제30항에 있어서, 상기 다능성 줄기세포는 인간 유래인 것을 특징으로 하는 방법.
  33. 다능성 줄기세포; 및 상기 다능성 줄기세포가 다수의 연속 계대 배양을 통해서 미분화 상태로 유지되도록 제26항 내지 제29항 중 어느 한 항에 따른 배지 조성물을 포함하는 시험관 내 세포 배양물.
  34. 제33항에 있어서, 상기 다능성 줄기세포는 배아줄기세포 또는 유도 만능 줄기세포인 것을 특징으로 하는 시험관 내 세포 배양물.
  35. 제33항에 있어서, 상기 다능성 줄기세포는 인간 유래인 것을 특징으로 하는 시험관 내 세포 배양물.
PCT/KR2012/009420 2012-05-29 2012-11-08 다능성 줄기세포의 제작, 유지, 증식을 증진하는 신규 저분자 화합물 및 이를 포함하는 조성물과 배양방법 WO2013180350A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP12877706.7A EP2774918B1 (en) 2012-05-29 2012-11-08 Novel low-molecular weight compound for promoting pluripotent stem cell generation, maintenance, and proliferation, and composition and culturing method containing same
US14/358,672 US9587225B2 (en) 2012-05-29 2012-11-08 Low-molecular-compound for improving production, maintenance and proliferation of pluripotent stem cells, composition comprising the same, and culture method
US15/411,642 US10301598B2 (en) 2012-05-29 2017-01-20 Low-molecular-compound for improving production, maintenance and proliferation of pluripotent stem cells, composition comprising the same, and culture method

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2012-0056881 2012-05-29
KR20120056881 2012-05-29
KR10-2012-0057803 2012-05-30
KR20120057803 2012-05-30

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/358,672 A-371-Of-International US9587225B2 (en) 2012-05-29 2012-11-08 Low-molecular-compound for improving production, maintenance and proliferation of pluripotent stem cells, composition comprising the same, and culture method
US15/411,642 Division US10301598B2 (en) 2012-05-29 2017-01-20 Low-molecular-compound for improving production, maintenance and proliferation of pluripotent stem cells, composition comprising the same, and culture method

Publications (1)

Publication Number Publication Date
WO2013180350A1 true WO2013180350A1 (ko) 2013-12-05

Family

ID=49673515

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2012/009420 WO2013180350A1 (ko) 2012-05-29 2012-11-08 다능성 줄기세포의 제작, 유지, 증식을 증진하는 신규 저분자 화합물 및 이를 포함하는 조성물과 배양방법

Country Status (4)

Country Link
US (2) US9587225B2 (ko)
EP (1) EP2774918B1 (ko)
KR (1) KR101586037B1 (ko)
WO (1) WO2013180350A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9587225B2 (en) 2012-05-29 2017-03-07 Korea Research Institute Of Bioscience And Biotechnology Low-molecular-compound for improving production, maintenance and proliferation of pluripotent stem cells, composition comprising the same, and culture method

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101647030B1 (ko) 2014-11-20 2016-08-09 한국생명공학연구원 미토푸신 억제제를 포함하는, 세포 리프로그래밍 촉진용 조성물 및 이의 용도
EP4361131A1 (en) * 2021-06-21 2024-05-01 Iregene Therapeutics Ltd Oct4 high-selectivity activator
CN117487659B (zh) * 2023-11-10 2024-07-12 世联生物工程无锡有限公司 一种蜗牛干细胞培养环境调控系统

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100842351B1 (ko) * 2007-01-04 2008-06-30 한국생명공학연구원 인돌 유도체를 유효성분으로 함유하는 암 예방 및 치료용약학적 조성물

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2517731A1 (en) * 2011-04-07 2012-10-31 Ludwig-Maximilians-Universität München Method of activating a target gene in a cell
EP2774918B1 (en) 2012-05-29 2017-03-22 Korea Research Institute of Bioscience and Biotechnology Novel low-molecular weight compound for promoting pluripotent stem cell generation, maintenance, and proliferation, and composition and culturing method containing same

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100842351B1 (ko) * 2007-01-04 2008-06-30 한국생명공학연구원 인돌 유도체를 유효성분으로 함유하는 암 예방 및 치료용약학적 조성물

Non-Patent Citations (18)

* Cited by examiner, † Cited by third party
Title
CELL STEM CELL, vol. 5, 2009, pages 237 - 241
CELL, vol. 126, 2006, pages 663 - 676
CELL, vol. 131, 2007, pages 861 - 872
CHANG ET AL., STEM CELLS, 2009
GONZALEZ ET AL., PNAS USA, 2009
HUANGFU ET AL., NAT BIOTECHNOL, 2008
HUANGFU, DANWEI ET AL.: "Induction of pluripotent stem cells by defined factors is greatly improved by small-molecule compounds", NATURE BIO-TECHNOLOGY, vol. 26, 2008, pages 795 - 797, XP002502536 *
KAJI ET AL., NATURE, 2009
NATURE, vol. 441, 2006, pages 1061 - 1067
NATURE, vol. 451, 2008, pages 141 - 146
SHI ET AL., CELL STEM CELL, 2008
SHI, TAN ET AL.: "Induction of Pluripotent Stem Cells from Mouse Embryonic Fibroblasts by Oct4 and Klf4 with Small-Molecule Compounds", CELL STEM CELL, vol. 3, no. 5, 2008, pages 568 - 574, XP007913847 *
SOLDNER ET AL., CELL, 2009
STADTFELD ET AL., SCIENCE, 2008
TAKAHASHI, K. ET AL., CELL, vol. 131, 2007, pages 861 - 872
WOLTJEN ET AL., NATURE, 2009
XU C., NAT BIOTECHNOL, vol. 19, pages 971 - 974
YU ET AL., SCIENCE, 2009

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9587225B2 (en) 2012-05-29 2017-03-07 Korea Research Institute Of Bioscience And Biotechnology Low-molecular-compound for improving production, maintenance and proliferation of pluripotent stem cells, composition comprising the same, and culture method
US10301598B2 (en) 2012-05-29 2019-05-28 Korea Research Institute Of Bioscience And Biotechnology Low-molecular-compound for improving production, maintenance and proliferation of pluripotent stem cells, composition comprising the same, and culture method

Also Published As

Publication number Publication date
EP2774918B1 (en) 2017-03-22
US20170159023A1 (en) 2017-06-08
KR101586037B1 (ko) 2016-01-19
KR20130133638A (ko) 2013-12-09
US20150159142A1 (en) 2015-06-11
EP2774918A4 (en) 2015-07-01
US9587225B2 (en) 2017-03-07
US10301598B2 (en) 2019-05-28
EP2774918A1 (en) 2014-09-10

Similar Documents

Publication Publication Date Title
WO2010147395A2 (en) Medium composition comprising neuropeptide y for the generation, maintenance, prologned undifferentiated growth of pluripotent stem cells and method of culturing pluripotent stem cell using the same
WO2013180395A1 (ko) 다능성 줄기세포의 제작, 유지, 증식을 증진하는 대사산물 및 이를 포함하는 조성물과 배양방법
WO2013180350A1 (ko) 다능성 줄기세포의 제작, 유지, 증식을 증진하는 신규 저분자 화합물 및 이를 포함하는 조성물과 배양방법
WO2018190656A1 (ko) In vitro에서 성숙된 인간 장관 오가노이드의 제조 방법 및 이의 용도
WO2011043592A2 (en) Compositions for inducing differentiation into retinal cells from retinal progenitor cells or inducing proliferation of retinal cells comprising wnt signaling pathway activators
WO2014163425A1 (ko) Hmga2를 이용하여 비신경 세포로부터 리프로그래밍된 유도 신경줄기세포를 제조하는 방법
WO2011043591A2 (en) Method for differentiation into retinal cells from stem cells
WO2018135902A1 (ko) 줄기 세포로부터 분화 유도된 연골세포의 제조방법
WO2016032263A1 (en) Method for differentiation into retinal ganglion cells from stem cells
WO2017179767A1 (ko) 지방줄기세포에서 신경줄기세포, 신경세포 및 가바성 신경세포로의 분화 유도 방법, 및 인간 골수 유래 중간엽 줄기세포로부터 성장인자를 다량 분비하는 인간 줄기세포의 분화 유도 방법
WO2021118318A2 (ko) 신규한 인돌 유도체 및 이의 용도
WO2017155166A1 (ko) 물리적 자극에 의한 환경유입을 이용한 세포 리프로그래밍 방법
WO2016140492A1 (ko) 신규 dna-rna 하이브리드 정사면체 구조물 또는 rna 정사면체 구조물
WO2011159137A2 (ko) 신규한 티오우레아 또는 우레아 유도체, 이의 제조방법 및 이를 유효성분으로 함유하는 ａｉｄｓ 예방 또는 치료용 약학 조성물
WO2021045374A1 (ko) 증식 가능한 간 오가노이드 분화용 배지 조성물 및 이를 이용한 간 오가노이드의 제조방법
WO2018135907A1 (ko) 슈반 세포 전구체 및 이로부터 분화된 슈반 세포의 제조 방법
WO2022025559A1 (ko) 줄기세포 유래 엑소좀을 포함하는 조성물 및 이의 제조방법
WO2019132547A1 (ko) Chi3l1 억제제를 유효성분으로 하는 암의 폐 전이 예방 또는 치료용 약학 조성물
WO2013137567A1 (ko) Ｓｅｌｅｎｉｕｍ을 이용한 인간 만능줄기세포의 혈액전구세포, 혈관전구세포, 내피세포 및 평활근세포로의 분화방법
WO2021054806A1 (ko) 직접 리프로그래밍을 통한 유도 도파민성 신경세포 전구체의 제조방법
WO2016080608A1 (en) Compositions comprising a mitofusin inhibitor for promoting cell reprogramming and a use thereof
WO2012148140A2 (ko) 혈관 신생 억제 및 항산화 효과를 가지는 이미다졸계 알칼로이드 유도체 및 이의 제조방법
WO2022005023A1 (ko) 중뇌 오가노이드, 이의 고속 및 대량 제조 방법, 이를 이용한 신경독성물질 스크리닝 방법 및 도파민성 신경세포 관련 질환 치료제 스크리닝 방법
WO2016089178A1 (ko) 에너지를 이용한 다능성 세포 유도 장치 및 방법
WO2022181880A1 (ko) 인간 전분화능 줄기세포 유래 약물 대사능이 증진된 간 오가노이드의 제조 방법 및 상기 방법으로 제조된 간 오가노이드

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12877706

Country of ref document: EP

Kind code of ref document: A1

REEP Request for entry into the european phase

Ref document number: 2012877706

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2012877706

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 14358672

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE